WorldWideScience

Sample records for gene conversion events

  1. Frequent gene conversion events between the X and Y homologous chromosomal regions in primates

    Directory of Open Access Journals (Sweden)

    Hirai Hirohisa

    2010-07-01

    Full Text Available Abstract Background Mammalian sex-chromosomes originated from a pair of autosomes. A step-wise cessation of recombination is necessary for the proper maintenance of sex-determination and, consequently, generates a four strata structure on the X chromosome. Each stratum shows a specific per-site nucleotide sequence difference (p-distance between the X and Y chromosomes, depending on the time of recombination arrest. Stratum 4 covers the distal half of the human X chromosome short arm and the p-distance of the stratum is ~10%, on average. However, a 100-kb region, which includes KALX and VCX, in the middle of stratum 4 shows a significantly lower p-distance (1-5%, suggesting frequent sequence exchanges or gene conversions between the X and Y chromosomes in humans. To examine the evolutionary mechanism for this low p-distance region, sequences of a corresponding region including KALX/Y from seven species of non-human primates were analyzed. Results Phylogenetic analysis of this low p-distance region in humans and non-human primate species revealed that gene conversion like events have taken place at least ten times after the divergence of New World monkeys and Catarrhini (i.e., Old World monkeys and hominoids. A KALY-converted KALX allele in white-handed gibbons also suggests a possible recent gene conversion between the X and Y chromosomes. In these primate sequences, the proximal boundary of this low p-distance region is located in a LINE element shared between the X and Y chromosomes, suggesting the involvement of this element in frequent gene conversions. Together with a palindrome on the Y chromosome, a segmental palindrome structure on the X chromosome at the distal boundary near VCX, in humans and chimpanzees, may mediate frequent sequence exchanges between X and Y chromosomes. Conclusion Gene conversion events between the X and Y homologous regions have been suggested, mainly in humans. Here, we found frequent gene conversions in the

  2. Mammalian BEX, WEX and GASP genes: Coding and non-coding chimaerism sustained by gene conversion events

    Directory of Open Access Journals (Sweden)

    Ponting Chris P

    2005-10-01

    Full Text Available Abstract Background The identification of sequence innovations in the genomes of mammals facilitates understanding of human gene function, as well as sheds light on the molecular mechanisms which underlie these changes. Although gene duplication plays a major role in genome evolution, studies regarding concerted evolution events among gene family members have been limited in scope and restricted to protein-coding regions, where high sequence similarity is easily detectable. Results We describe a mammalian-specific expansion of more than 20 rapidly-evolving genes on human chromosome Xq22.1. Many of these are highly divergent in their protein-coding regions yet contain a conserved sequence motif in their 5' UTRs which appears to have been maintained by multiple events of concerted evolution. These events have led to the generation of chimaeric genes, each with a 5' UTR and a protein-coding region that possess independent evolutionary histories. We suggest that concerted evolution has occurred via gene conversion independently in different mammalian lineages, and these events have resulted in elevated G+C levels in the encompassing genomic regions. These concerted evolution events occurred within and between genes from three separate protein families ('brain-expressed X-linked' [BEX], WWbp5-like X-linked [WEX] and G-protein-coupled receptor-associated sorting protein [GASP], which often are expressed in mammalian brains and associated with receptor mediated signalling and apoptosis. Conclusion Despite high protein-coding divergence among mammalian-specific genes, we identified a DNA motif common to these genes' 5' UTR exons. The motif has undergone concerted evolution events independently of its neighbouring protein-coding regions, leading to formation of evolutionary chimaeric genes. These findings have implications for the identification of non protein-coding regulatory elements and their lineage-specific evolution in mammals.

  3. Gene conversion-like events in the diversification of human rearranged IGHV3-23*01 gene sequences

    Directory of Open Access Journals (Sweden)

    Bhargavi eDuvvuri

    2012-06-01

    Full Text Available Gene conversion (GCV as a mechanism of immunoglobulin diversification is well established in a few species. However, definitive evidence of GCV-like events in human immunoglobulin genes is scarce. GCV is mediated by activation-induced cytidine deaminase (AID. The lack of evidence of GCV in human rearranged immunoglobulin gene sequences is puzzling given the presence of highly similar germline donors and all the enzymatic machinery required for GCV. In this study, we undertook a computational analysis of rearranged IGHV3-23*01 gene sequences from common variable immunodeficiency (CVID patients and healthy individuals to survey ‘GCV-like’ activities. Our search identified strong evidence of GCV-like patterns. Germline VH sequences were identified as potential donors for clustered mutations in rearranged IGHV3-23*01 gene sequences. We identified minimum and maximum sequence identities between donor and recipient sequences that can serve as targets for GCV and our findings are consistent with those reported in literature. We observed that GCV-like tracts are flanked by activation-induced cytidine deaminase (AID hotspot motifs. Structural modeling of IGHV3-23*01 gene sequence revealed that hypermutable bases flanking GCV-like tracts, are in the single stranded DNA (ssDNA of stable stem-loop structures (SLSs. SsDNA is inherently fragile and also an optimal target for AID. We speculate that GCV could have been initiated by the targeting of hypermutable bases in ssDNA state in stable SLSs, plausibly by AID. We have observed that the frequency of GCV-like events is significantly higher in rearranged IGHV323-*01 sequences from healthy individuals compared to that of CVID patients. GCV, unlike SHM, can result in multiple base substitutions that can alter many amino acids. The extensive changes in antibody affinity by GCV-like events, as identified in this study would be instrumental in protecting humans against pathogens that diversify their genome by

  4. Closely linked H2B genes in the marine copepod, Tigriopus californicus indicate a recent gene duplication or gene conversion event.

    Science.gov (United States)

    Brown, D; Cook, A; Wagner, M; Wells, D

    1992-01-01

    Two nonallelic histone gene clusters were characterized in the marine copepod, Tigriopus californicus. The DNA sequence of one of the clusters reveals six genes in the contiguous arrangement of H2B, H1, H3, H4, H2B and H2A. The order of genes within the second cluster is H3, H4, H2B and H2A. There is no evidence for the presence of an H1 gene in this cluster. Comparison of the three copepod H2B genes reveals a high degree of similarity between the 5' upstream regions and between the amino terminal halves of the two H2B genes found within the same cluster. From these data we infer that gene duplication and/or gene conversion events occurred within this cluster in the recent past.

  5. Gene conversion-like events cause steroid 21-hydroxylase deficiency in congenital adrenal hyperplasia

    Energy Technology Data Exchange (ETDEWEB)

    Harada, F.; Kimura, A.; Iwanaga, T.; Shimozawa, K.; Yata, J.; Sasazuki,T.

    1987-11-01

    Genomic DNAs from twelve Japanese patients with steroid 21-hydroxylase deficiency were analyzed by Southern blot hybridization. A 3.7-kilobase (kb) Taq I and a 1.7-kb Pvu II restriction endonuclease fragment that correspond to a 21-OHase B gene were absent from the DNA of two unrelated patients with the salt-wasting form of the disease. However, a 10.5-kb Bgl II fragment corresponding to the region encompassing the 21-OHase B gene was still present in these two patients. The genes encoding 21-OHase were cloned from one of these two patients, who was homozygous by descent for HLA-A26;B39;C4A3;C4B1;DR4. Restriction endonuclease mapping as well as partial nucleotide sequencing analysis revealed that the 21-OHase B gene of the patient has been converted to the pseudogene, 21-OHase A, as far as the critical 0.5-kb sequence was concerned. Thus, the defect was due to both chromosomes each carrying two copies of 21-OHase A pseudogene and lacking functional 21-OHase B gene.

  6. Mechanisms of Ectopic Gene Conversion

    Directory of Open Access Journals (Sweden)

    P.J. Hastings

    2010-11-01

    Full Text Available Gene conversion (conversion, the unidirectional transfer of DNA sequence information, occurs as a byproduct of recombinational repair of broken or damaged DNA molecules. Whereas excision repair processes replace damaged DNA by copying the complementary sequence from the undamaged strand of duplex DNA, recombinational mechanisms copy similar sequence, usually in another molecule, to replace the damaged sequence. In mitotic cells the other molecule is usually a sister chromatid, and the repair does not lead to genetic change. Less often a homologous chromosome or homologous sequence in an ectopic position is used. Conversion results from repair in two ways. First, if there was a double-strand gap at the site of a break, homologous sequence will be used as the template for synthesis to fill the gap, thus transferring sequence information in both strands. Second, recombinational repair uses complementary base pairing, and the heteroduplex molecule so formed is a source of conversion, both as heteroduplex and when donor (undamaged template information is retained after correction of mismatched bases in heteroduplex. There are mechanisms that favour the use of sister molecules that must fail before ectopic homology can be used. Meiotic recombination events lead to the formation of crossovers required in meiosis for orderly segregation of pairs of homologous chromosomes. These events result from recombinational repair of programmed double-strand breaks, but in contrast with mitotic recombination, meiotic recombinational events occur predominantly between homologous chromosomes, so that transfer of sequence differences by conversion is very frequent. Transient recombination events that do not form crossovers form both between homologous chromosomes and between regions of ectopic homology, and leave their mark in the occurrence of frequent non-crossover conversion, including ectopic conversion.

  7. Special Issue: Gene Conversion in Duplicated Genes

    Directory of Open Access Journals (Sweden)

    Hideki Innan

    2011-06-01

    Full Text Available Gene conversion is an outcome of recombination, causing non-reciprocal transfer of a DNA fragment. Several decades later than the discovery of crossing over, gene conversion was first recognized in fungi when non-Mendelian allelic distortion was observed. Gene conversion occurs when a double-strand break is repaired by using homologous sequences in the genome. In meiosis, there is a strong preference to use the orthologous region (allelic gene conversion, which causes non-Mendelian allelic distortion, but paralogous or duplicated regions can also be used for the repair (inter-locus gene conversion, also referred to as non-allelic and ectopic gene conversion. The focus of this special issue is the latter, interlocus gene conversion; the rate is lower than allelic gene conversion but it has more impact on phenotype because more drastic changes in DNA sequence are involved.

  8. Analysis of crossover breakpoints yields new insights into the nature of the gene conversion events associated with large NF1 deletions mediated by nonallelic homologous recombination.

    Science.gov (United States)

    Bengesser, Kathrin; Vogt, Julia; Mussotter, Tanja; Mautner, Victor-Felix; Messiaen, Ludwine; Cooper, David N; Kehrer-Sawatzki, Hildegard

    2014-02-01

    Large NF1 deletions are mediated by nonallelic homologous recombination (NAHR). An in-depth analysis of gene conversion operating in the breakpoint-flanking regions of large NF1 deletions was performed to investigate whether the rate of discontinuous gene conversion during NAHR with crossover is increased, as has been previously noted in NAHR-mediated rearrangements. All 20 germline type-1 NF1 deletions analyzed were mediated by NAHR associated with continuous gene conversion within the breakpoint-flanking regions. Continuous gene conversion was also observed in 31/32 type-2 NF1 deletions investigated. In contrast to the meiotic type-1 NF1 deletions, type-2 NF1 deletions are predominantly of post-zygotic origin. Our findings therefore imply that the mitotic as well as the meiotic NAHR intermediates of large NF1 deletions are processed by long-patch mismatch repair (MMR), thereby ensuring gene conversion tract continuity instead of the discontinuous gene conversion that is characteristic of short-patch repair. However, the single type-2 NF1 deletion not exhibiting continuous gene conversion was processed without MMR, yielding two different deletion-bearing chromosomes, which were distinguishable in terms of their breakpoint positions. Our findings indicate that MMR failure during NAHR, followed by post-meiotic/mitotic segregation, has the potential to give rise to somatic mosaicism in human genomic rearrangements by generating breakpoint heterogeneity.

  9. Life events and escape in conversion disorder.

    Science.gov (United States)

    Nicholson, T R; Aybek, S; Craig, T; Harris, T; Wojcik, W; David, A S; Kanaan, R A

    2016-09-01

    Psychological models of conversion disorder (CD) traditionally assume that psychosocial stressors are identifiable around symptom onset. In the face of limited supportive evidence such models are being challenged. Forty-three motor CD patients, 28 depression patients and 28 healthy controls were assessed using the Life Events and Difficulties Schedule in the year before symptom onset. A novel 'escape' rating for events was developed to test the Freudian theory that physical symptoms of CD could provide escape from stressors, a form of 'secondary gain'. CD patients had significantly more severe life events and 'escape' events than controls. In the month before symptom onset at least one severe event was identified in 56% of CD patients - significantly more than 21% of depression patients [odds ratio (OR) 4.63, 95% confidence interval (CI) 1.56-13.70] and healthy controls (OR 5.81, 95% CI 1.86-18.2). In the same time period 53% of CD patients had at least one 'high escape' event - again significantly higher than 14% in depression patients (OR 6.90, 95% CI 2.05-23.6) and 0% in healthy controls. Previous sexual abuse was more commonly reported in CD than controls, and in one third of female patients was contextually relevant to life events at symptom onset. The majority (88%) of life events of potential aetiological relevance were not identified by routine clinical assessments. Nine per cent of CD patients had no identifiable severe life events. Evidence was found supporting the psychological model of CD, the Freudian notion of escape and the potential aetiological relevance of childhood traumas in some patients. Uncovering stressors of potential aetiological relevance requires thorough psychosocial evaluation.

  10. Gene conversion in human rearranged immunoglobulin genes.

    Science.gov (United States)

    Darlow, John M; Stott, David I

    2006-07-01

    Over the past 20 years, many DNA sequences have been published suggesting that all or part of the V(H) segment of a rearranged immunoglobulin gene may be replaced in vivo. Two different mechanisms appear to be operating. One of these is very similar to primary V(D)J recombination, involving the RAG proteins acting upon recombination signal sequences, and this has recently been proven to occur. Other sequences, many of which show partial V(H) replacements with no addition of untemplated nucleotides at the V(H)-V(H) joint, have been proposed to occur by an unusual RAG-mediated recombination with the formation of hybrid (coding-to-signal) joints. These appear to occur in cells already undergoing somatic hypermutation in which, some authors are convinced, RAG genes are silenced. We recently proposed that the latter type of V(H) replacement might occur by homologous recombination initiated by the activity of AID (activation-induced cytidine deaminase), which is essential for somatic hypermutation and gene conversion. The latter has been observed in other species, but not in human Ig genes, so far. In this paper, we present a new analysis of sequences published as examples of the second type of rearrangement. This not only shows that AID recognition motifs occur in recombination regions but also that some sequences show replacement of central sections by a sequence from another gene, similar to gene conversion in the immunoglobulin genes of other species. These observations support the proposal that this type of rearrangement is likely to be AID-mediated rather than RAG-mediated and is consistent with gene conversion.

  11. Chromatin structure regulates gene conversion.

    Directory of Open Access Journals (Sweden)

    W Jason Cummings

    2007-10-01

    Full Text Available Homology-directed repair is a powerful mechanism for maintaining and altering genomic structure. We asked how chromatin structure contributes to the use of homologous sequences as donors for repair using the chicken B cell line DT40 as a model. In DT40, immunoglobulin genes undergo regulated sequence diversification by gene conversion templated by pseudogene donors. We found that the immunoglobulin Vlambda pseudogene array is characterized by histone modifications associated with active chromatin. We directly demonstrated the importance of chromatin structure for gene conversion, using a regulatable experimental system in which the heterochromatin protein HP1 (Drosophila melanogaster Su[var]205, expressed as a fusion to Escherichia coli lactose repressor, is tethered to polymerized lactose operators integrated within the pseudo-Vlambda donor array. Tethered HP1 diminished histone acetylation within the pseudo-Vlambda array, and altered the outcome of Vlambda diversification, so that nontemplated mutations rather than templated mutations predominated. Thus, chromatin structure regulates homology-directed repair. These results suggest that histone modifications may contribute to maintaining genomic stability by preventing recombination between repetitive sequences.

  12. Gene conversion in the rice genome

    DEFF Research Database (Denmark)

    Xu, Shuqing; Clark, Terry; Zheng, Hongkun;

    2008-01-01

    BACKGROUND: Gene conversion causes a non-reciprocal transfer of genetic information between similar sequences. Gene conversion can both homogenize genes and recruit point mutations thereby shaping the evolution of multigene families. In the rice genome, the large number of duplicated genes...... is not tightly linked to natural selection in the rice genome. To assess the contribution of segmental duplication on gene conversion statistics, we determined locations of conversion partners with respect to inter-chromosomal segment duplication. The number of conversions associated with segmentation is less...

  13. Disruptive Event Biosphere Doser Conversion Factor Analysis

    Energy Technology Data Exchange (ETDEWEB)

    M. Wasiolek

    2000-12-28

    The purpose of this report was to document the process leading to, and the results of, development of radionuclide-, exposure scenario-, and ash thickness-specific Biosphere Dose Conversion Factors (BDCFs) for the postulated postclosure extrusive igneous event (volcanic eruption) at Yucca Mountain. BDCF calculations were done for seventeen radionuclides. The selection of radionuclides included those that may be significant dose contributors during the compliance period of up to 10,000 years, as well as radionuclides of importance for up to 1 million years postclosure. The approach documented in this report takes into account human exposure during three different phases at the time of, and after, volcanic eruption. Calculations of disruptive event BDCFs used the GENII-S computer code in a series of probabilistic realizations to propagate the uncertainties of input parameters into the output. The pathway analysis included consideration of different exposure pathway's contribution to the BDCFs. BDCFs for volcanic eruption, when combined with the concentration of radioactivity deposited by eruption on the soil surface, allow calculation of potential radiation doses to the receptor of interest. Calculation of radioactivity deposition is outside the scope of this report and so is the transport of contaminated ash from the volcano to the location of the receptor. The integration of the biosphere modeling results (BDCFs) with the outcomes of the other component models is accomplished in the Total System Performance Assessment (TSPA), in which doses are calculated to the receptor of interest from radionuclides postulated to be released to the environment from the potential repository at Yucca Mountain.

  14. Disruptive Event Biosphere Dose Conversion Factor Analysis

    Energy Technology Data Exchange (ETDEWEB)

    M. Wasiolek

    2004-09-08

    This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the total system performance assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the volcanic ash exposure scenario, and the development of dose factors for calculating inhalation dose during volcanic eruption. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the Biosphere Model Report in Figure 1-1, contain detailed descriptions of the model input parameters, their development and the relationship between the parameters and specific features, events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the volcanic ash exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and from the five analyses that develop parameter values for the biosphere model (BSC 2004 [DIRS 169671]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; and BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis''. The objective of this

  15. Polarized gene conversion at the bz locus of maize.

    Science.gov (United States)

    Dooner, Hugo K; He, Limei

    2014-09-23

    Nucleotide diversity is greater in maize than in most organisms studied to date, so allelic pairs in a hybrid tend to be highly polymorphic. Most recombination events between such pairs of maize polymorphic alleles are crossovers. However, intragenic recombination events not associated with flanking marker exchange, corresponding to noncrossover gene conversions, predominate between alleles derived from the same progenitor. In these dimorphic heterozygotes, the two alleles differ only at the two mutant sites between which recombination is being measured. To investigate whether gene conversion at the bz locus is polarized, two large diallel crossing matrices involving mutant sites spread across the bz gene were performed and more than 2,500 intragenic recombinants were scored. In both diallels, around 90% of recombinants could be accounted for by gene conversion. Furthermore, conversion exhibited a striking polarity, with sites located within 150 bp of the start and stop codons converting more frequently than sites located in the middle of the gene. The implications of these findings are discussed with reference to recent data from genome-wide studies in other plants.

  16. Self-Exciting Point Process Modeling of Conversation Event Sequences

    Science.gov (United States)

    Masuda, Naoki; Takaguchi, Taro; Sato, Nobuo; Yano, Kazuo

    Self-exciting processes of Hawkes type have been used to model various phenomena including earthquakes, neural activities, and views of online videos. Studies of temporal networks have revealed that sequences of social interevent times for individuals are highly bursty. We examine some basic properties of event sequences generated by the Hawkes self-exciting process to show that it generates bursty interevent times for a wide parameter range. Then, we fit the model to the data of conversation sequences recorded in company offices in Japan. In this way, we can estimate relative magnitudes of the self excitement, its temporal decay, and the base event rate independent of the self excitation. These variables highly depend on individuals. We also point out that the Hawkes model has an important limitation that the correlation in the interevent times and the burstiness cannot be independently modulated.

  17. Self-exciting point process modeling of conversation event sequences

    CERN Document Server

    Masuda, Naoki; Sato, Nobuo; Yano, Kazuo

    2012-01-01

    Self-exciting processes of Hawkes type have been used to model various phenomena including earthquakes, neural activities, and views of online videos. Studies of temporal networks have revealed that sequences of social interevent intervals for individuals are highly bursty. We examine some basic properties of event sequences generated by the Hawkes self-exciting process to show that it generates bursty interevent intervals for a wide parameter range. Then, we fit the model to the data of conversation sequences recorded in company offices in Japan. In this way, we can estimate relative magnitudes of the self excitement, its temporal decay, and the base event rate independent of the self excitation. These variables highly depend on individuals. We also point out that the Hawkes model has an important limitation that the correlation in the interevent intervals and the burstiness cannot be independently modulated.

  18. Deep genome-wide measurement of meiotic gene conversion using tetrad analysis in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Yujin Sun

    Full Text Available Gene conversion, the non-reciprocal exchange of genetic information, is one of the potential products of meiotic recombination. It can shape genome structure by acting on repetitive DNA elements, influence allele frequencies at the population level, and is known to be implicated in human disease. But gene conversion is hard to detect directly except in organisms, like fungi, that group their gametes following meiosis. We have developed a novel visual assay that enables us to detect gene conversion events directly in the gametes of the flowering plant Arabidopsis thaliana. Using this assay we measured gene conversion events across the genome of more than one million meioses and determined that the genome-wide average frequency is 3.5×10(-4 conversions per locus per meiosis. We also detected significant locus-to-locus variation in conversion frequency but no intra-locus variation. Significantly, we found one locus on the short arm of chromosome 4 that experienced 3-fold to 6-fold more gene conversions than the other loci tested. Finally, we demonstrated that we could modulate conversion frequency by varying experimental conditions.

  19. Conversion of homothallic yeast to heterothallism trough HO gene disruption

    CSIR Research Space (South Africa)

    Van Zyl, WH

    1993-04-01

    Full Text Available A simple method was developed for the conversion of homothallic Saccharomyces cerevisiae yeaststrains to heterothallism through HO gene disruption. An integrative ho:: neo disrupted allele was constructed by cloning a dominant selectable marker...

  20. Identifying concerted evolution and gene conversion in mammalian gene pairs lasting over 100 million years

    Directory of Open Access Journals (Sweden)

    Scherer Stephen W

    2009-07-01

    Full Text Available Abstract Background Concerted evolution occurs in multigene families and is characterized by stretches of homogeneity and higher sequence similarity between paralogues than between orthologues. Here we identify human gene pairs that have undergone concerted evolution, caused by ongoing gene conversion, since at least the human-mouse divergence. Our strategy involved the identification of duplicated genes with greater similarity within a species than between species. These genes were required to be present in multiple mammalian genomes, suggesting duplication early in mammalian divergence. To eliminate genes that have been conserved due to strong purifying selection, our analysis also required at least one intron to have retained high sequence similarity between paralogues. Results We identified three human gene pairs undergoing concerted evolution (BMP8A/B, DDX19A/B, and TUBG1/2. Phylogenetic investigations reveal that in each case the duplication appears to have occurred prior to eutherian mammalian radiation, with exactly two paralogues present in all examined species. This indicates that all three gene duplication events were established over 100 million years ago. Conclusion The extended duration of concerted evolution in multiple distant lineages suggests that there has been prolonged homogenization of specific segments within these gene pairs. Although we speculate that selection for homogenization could have been utilized in order to maintain crucial homo- or hetero- binding domains, it remains unclear why gene conversion has persisted for such extended periods of time. Through these analyses, our results demonstrate additional examples of a process that plays a definite, although unspecified, role in molecular evolution.

  1. Ectopic Gene Conversions in the Genome of Ten Hemiascomycete Yeast Species

    Directory of Open Access Journals (Sweden)

    Robert T. Morris

    2011-01-01

    Full Text Available We characterized ectopic gene conversions in the genome of ten hemiascomycete yeast species. Of the ten species, three diverged prior to the whole genome duplication (WGD event present in the yeast lineage and seven diverged after it. We analyzed gene conversions from three separate datasets: paralogs from the three pre-WGD species, paralogs from the seven post-WGD species, and common ohnologs from the seven post-WGD species. Gene conversions have similar lengths and frequency and occur between sequences having similar degrees of divergence, in paralogs from pre- and post-WGD species. However, the sequences of ohnologs are both more divergent and less frequently converted than those of paralogs. This likely reflects the fact that ohnologs are more often found on different chromosomes and are evolving under stronger selective pressures than paralogs. Our results also show that ectopic gene conversions tend to occur more frequently between closely linked genes. They also suggest that the mechanisms responsible for the loss of introns in S. cerevisiae are probably also involved in the gene 3'-end gene conversion bias observed between the paralogs of this species.

  2. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Directory of Open Access Journals (Sweden)

    Hao Weilong

    2010-12-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native

  3. Gene conversion homogenizes the CMT1A paralogous repeats

    Directory of Open Access Journals (Sweden)

    Hurles Matthew E

    2001-12-01

    Full Text Available Abstract Background Non-allelic homologous recombination between paralogous repeats is increasingly being recognized as a major mechanism causing both pathogenic microdeletions and duplications, and structural polymorphism in the human genome. It has recently been shown empirically that gene conversion can homogenize such repeats, resulting in longer stretches of absolute identity that may increase the rate of non-allelic homologous recombination. Results Here, a statistical test to detect gene conversion between pairs of non-coding sequences is presented. It is shown that the 24 kb Charcot-Marie-Tooth type 1A paralogous repeats (CMT1A-REPs exhibit the imprint of gene conversion processes whilst control orthologous sequences do not. In addition, Monte Carlo simulations of the evolutionary divergence of the CMT1A-REPs, incorporating two alternative models for gene conversion, generate repeats that are statistically indistinguishable from the observed repeats. Bounds are placed on the rate of these conversion processes, with central values of 1.3 × 10-4 and 5.1 × 10-5 per generation for the alternative models. Conclusions This evidence presented here suggests that gene conversion may have played an important role in the evolution of the CMT1A-REP paralogous repeats. The rates of these processes are such that it is probable that homogenized CMT1A-REPs are polymorphic within modern populations. Gene conversion processes are similarly likely to play an important role in the evolution of other segmental duplications and may influence the rate of non-allelic homologous recombination between them.

  4. Gene conversion homogenizes the CMT1A paralogous repeats.

    Science.gov (United States)

    Hurles, M E

    2001-01-01

    Non-allelic homologous recombination between paralogous repeats is increasingly being recognized as a major mechanism causing both pathogenic microdeletions and duplications, and structural polymorphism in the human genome. It has recently been shown empirically that gene conversion can homogenize such repeats, resulting in longer stretches of absolute identity that may increase the rate of non-allelic homologous recombination. Here, a statistical test to detect gene conversion between pairs of non-coding sequences is presented. It is shown that the 24 kb Charcot-Marie-Tooth type 1A paralogous repeats (CMT1A-REPs) exhibit the imprint of gene conversion processes whilst control orthologous sequences do not. In addition, Monte Carlo simulations of the evolutionary divergence of the CMT1A-REPs, incorporating two alternative models for gene conversion, generate repeats that are statistically indistinguishable from the observed repeats. Bounds are placed on the rate of these conversion processes, with central values of 1.3 x 10(-4) and 5.1 x 10(-5) per generation for the alternative models. This evidence presented here suggests that gene conversion may have played an important role in the evolution of the CMT1A-REP paralogous repeats. The rates of these processes are such that it is probable that homogenized CMT1A-REPs are polymorphic within modern populations. Gene conversion processes are similarly likely to play an important role in the evolution of other segmental duplications and may influence the rate of non-allelic homologous recombination between them.

  5. Detecting rare gene transfer events in bacterial populations

    Directory of Open Access Journals (Sweden)

    Kaare Magne Nielsen

    2014-01-01

    Full Text Available Horizontal gene transfer (HGT enables bacteria to access, share, and recombine genetic variation, resulting in genetic diversity that cannot be obtained through mutational processes alone. In most cases, the observation of evolutionary successful HGT events relies on the outcome of initially rare events that lead to novel functions in the new host, and that exhibit a positive effect on host fitness. Conversely, the large majority of HGT events occurring in bacterial populations will go undetected due to lack of replication success of transformants. Moreover, other HGT events that would be highly beneficial to new hosts can fail to ensue due to lack of physical proximity to the donor organism, lack of a suitable gene transfer mechanism, genetic compatibility, and stochasticity in tempo-spatial occurrence. Experimental attempts to detect HGT events in bacterial populations have typically focused on the transformed cells or their immediate offspring. However, rare HGT events occurring in large and structured populations are unlikely to reach relative population sizes that will allow their immediate identification; the exception being the unusually strong positive selection conferred by antibiotics. Most HGT events are not expected to alter the likelihood of host survival to such an extreme extent, and will confer only minor changes in host fitness. Due to the large population sizes of bacteria and the time scales involved, the process and outcome of HGT are often not amenable to experimental investigation. Population genetic modeling of the growth dynamics of bacteria with differing HGT rates and resulting fitness changes is therefore necessary to guide sampling design and predict realistic time frames for detection of HGT, as it occurs in laboratory or natural settings. Here we review the key population genetic parameters, consider their complexity and highlight knowledge gaps for further research.

  6. Sister chromatid gene conversion is a prominent double-strand break repair pathway in mammalian cells

    OpenAIRE

    Johnson, Roger D.; Jasin, Maria

    2000-01-01

    In mammalian cells, repair of DNA double-strand breaks (DSBs) occurs by both homologous and non-homologous mechanisms. By definition, homologous recombination requires a template with sufficient sequence identity to the damaged molecule in order to direct repair. We now show that the sister chromatid acts as a repair template in a substantial proportion of DSB repair events. The outcome of sister chromatid repair is primarily gene conversion unassociated with reciprocal exchange. This contras...

  7. Recombination dynamics of a human Y-chromosomal palindrome: rapid GC-biased gene conversion, multi-kilobase conversion tracts, and rare inversions.

    Directory of Open Access Journals (Sweden)

    Pille Hallast

    Full Text Available The male-specific region of the human Y chromosome (MSY includes eight large inverted repeats (palindromes in which arm-to-arm similarity exceeds 99.9%, due to gene conversion activity. Here, we studied one of these palindromes, P6, in order to illuminate the dynamics of the gene conversion process. We genotyped ten paralogous sequence variants (PSVs within the arms of P6 in 378 Y chromosomes whose evolutionary relationships within the SNP-defined Y phylogeny are known. This allowed the identification of 146 historical gene conversion events involving individual PSVs, occurring at a rate of 2.9-8.4×10(-4 events per generation. A consideration of the nature of nucleotide change and the ancestral state of each PSV showed that the conversion process was significantly biased towards the fixation of G or C nucleotides (GC-biased, and also towards the ancestral state. Determination of haplotypes by long-PCR allowed likely co-conversion of PSVs to be identified, and suggested that conversion tract lengths are large, with a mean of 2068 bp, and a maximum in excess of 9 kb. Despite the frequent formation of recombination intermediates implied by the rapid observed gene conversion activity, resolution via crossover is rare: only three inversions within P6 were detected in the sample. An analysis of chimpanzee and gorilla P6 orthologs showed that the ancestral state bias has existed in all three species, and comparison of human and chimpanzee sequences with the gorilla outgroup confirmed that GC bias of the conversion process has apparently been active in both the human and chimpanzee lineages.

  8. Children with autism spectrum disorder: teaching conversation involving feelings about events.

    Science.gov (United States)

    Conallen, K; Reed, P

    2017-03-01

    Two procedures were developed to teach individuals with Autism Spectrum Disorders labels (tacts) for various private events (emotions): Study 1 attempted to distinguish them from pure tacts and mands (requests); and Study 2 attempted to train initiating a conversation with grammatically correct subject-verb-comment construction. A multiple treatment reversal design was used in both studies, followed by a probe to see if the tacts were used across novel settings. The children were prompted to initiate a series of language exchanges, which resulted in an increased ability to participate in conversations about private events. Together, the results of both studies suggest that, by providing an effective and reinforcing means of teaching both the function and the form of these tacts, conversations can be successfully initiated by children with ASD. © 2016 MENCAP and International Association of the Scientific Study of Intellectual and Developmental Disabilities and John Wiley & Sons Ltd.

  9. Simulating the physiology of athletes during endurance sports events: Modelling human energy conversion and metabolism

    NARCIS (Netherlands)

    Beek, J.H.G.M. van; Supandi, F.; Gavai, A.K.; Graaf, A.A. de; Binsl, T.W.; Hettling, H.

    2011-01-01

    The human physiological system is stressed to its limits during endurance sports competition events.We describe a whole body computational model for energy conversion during bicycle racing. About 23 per cent of the metabolic energy is used for muscle work, the rest is converted to heat. We

  10. Simulating the physiology of athletes during endurance sports events: Modelling human energy conversion and metabolism

    NARCIS (Netherlands)

    Beek, J.H.G.M. van; Supandi, F.; Gavai, A.K.; Graaf, A.A. de; Binsl, T.W.; Hettling, H.

    2011-01-01

    The human physiological system is stressed to its limits during endurance sports competition events.We describe a whole body computational model for energy conversion during bicycle racing. About 23 per cent of the metabolic energy is used for muscle work, the rest is converted to heat. We calculate

  11. Evidence for gene conversion among immunoglobulin heavy chain variable region genes.

    Science.gov (United States)

    Clarke, S H; Rudikoff, S

    1984-03-01

    We have previously reported that the VH region amino acid sequence of a phosphocholine (PC)-binding hybridoma antibody of CBA/J origin, HP101 6G6 (6G6), differs extensively from the VH regions of other PC-binding antibodies. The sequence of 6G6 VH appears to be derived from a gene homologous to the BALB/c V11 gene, a member of the PC VH (T15 VH) gene family not normally used to encode PC-binding antibodies. The 6G6 VH sequence differs from the translated sequence of V11 by six amino acids, four of which occur at the same position in other members of this gene family. This coincidence led to the proposal that the 6G6 VH gene was derived by gene conversion involving three genes of the PC VH gene family. We report here the nucleic acid sequence of the rearranged VH gene of hybridoma 6G6. This sequence supports our previous suggestion of gene conversion by confirming those differences, relative to the BALB/c V11 gene sequence, that are encoded by other members of this gene family, and extends this correlation to include three silent base pair substitutions as well. In addition, 5' noncoding region sequence and Southern blot analysis using probes derived from the coding and 5' noncoding regions confirm that the 6G6 VH gene is likely to be derived from the V11 homologue in CBA/J mice, and suggest that all three genes believed to be involved in the generation of the 6G6 VH gene are present in the CBA/J genome, a prerequisite for their involvement in gene conversion.

  12. Gene conversion between red and defective green opsin gene in blue cone monochromacy

    Energy Technology Data Exchange (ETDEWEB)

    Reyniers, E.; Van Thienen, M.N.; De Boulle, K.; Willems, P.J. [Univ. of Antwerp (Belgium)] [and others

    1995-09-20

    Blue cone monochromacy is an X-linked condition in which the function of both the red pigment gene (RCP) and the green pigment gene (GCP) is impaired. Blue cone monochromacy can be due to a red/green gene array rearrangement existing of a single red/green hybrid gene and an inactivating C203R point mutation in both RCP and GCP. The flanking sequences of the C230R mutation in exon 4 of RCP were characteristic for GCP, indicating that this mutation was transferred from GCP into RCP by gene conversion. 23 refs., 3 figs., 1 tab.

  13. The surprising negative correlation of gene length and optimal codon use--disentangling translational selection from GC-biased gene conversion in yeast.

    Science.gov (United States)

    Stoletzki, Nina

    2011-04-11

    Surprisingly, in several multi-cellular eukaryotes optimal codon use correlates negatively with gene length. This contrasts with the expectation under selection for translational accuracy. While suggested explanations focus on variation in strength and efficiency of translational selection, it has rarely been noticed that the negative correlation is reported only in organisms whose optimal codons are biased towards codons that end with G or C (-GC). This raises the question whether forces that affect base composition--such as GC-biased gene conversion--contribute to the negative correlation between optimal codon use and gene length. Yeast is a good organism to study this as equal numbers of optimal codons end in -GC and -AT and one may hence compare frequencies of optimal GC- with optimal AT-ending codons to disentangle the forces. Results of this study demonstrate in yeast frequencies of GC-ending (optimal AND non-optimal) codons decrease with gene length and increase with recombination. A decrease of GC-ending codons along genes contributes to the negative correlation with gene length. Correlations with recombination and gene expression differentiate between GC-ending and optimal codons, and also substitution patterns support effects of GC-biased gene conversion. While the general effect of GC-biased gene conversion is well known, the negative correlation of optimal codon use with gene length has not been considered in this context before. Initiation of gene conversion events in promoter regions and the presence of a gene conversion gradient most likely explain the observed decrease of GC-ending codons with gene length and gene position.

  14. Gene genealogies indicates abundant gene conversions and independent evolutionary histories of the mating-type chromosomes in the evolutionary history of Neurospora tetrasperma

    Directory of Open Access Journals (Sweden)

    Whittle Carrie A

    2010-07-01

    Full Text Available Abstract Background The self-fertile filamentous ascomycete Neurospora tetrasperma contains a large (~7 Mbp and young (mat chromosomes. The objective of the present study is to reveal the evolutionary history, including key genomic events, associated with the various regions of the mat chromosomes among ten strains representing all the nine known species (lineages contained within the N. tetrasperma species complex. Results Comparative analysis of sequence divergence among alleles of 24 mat-linked genes (mat A and mat a indicates that a large region of suppressed recombination exists within the mat chromosome for each of nine lineages of N. tetrasperma sensu latu. The recombinationally suppressed region varies in size and gene composition among lineages, and is flanked on both ends by normally recombining regions. Genealogical analyses among lineages reveals that eight gene conversion events have occurred between homologous mat A and mat a-linked alleles of genes located within the region of restricted recombination during the evolutionary history of N. tetrasperma. Conclusions We conclude that the region of suppressed recombination in the mat chromosomes has likely been subjected to independent contraction and/or expansion during the evolutionary history of the N. tetrasperma species complex. Furthermore, we infer that gene conversion events are likely a common phenomenon within this recombinationally suppressed genomic region. We argue that gene conversions might provide an efficient mechanism of adaptive editing of functional genes, including the removal of deleterious mutations, within the young recombinationally suppressed region of the mat chromosomes.

  15. Gene conversion limits divergence of mammalian TLR1 and TLR6

    Directory of Open Access Journals (Sweden)

    Dunoyer-Geindre Sylvie

    2007-08-01

    Full Text Available Abstract Background Toll-like receptors (TLR recognize pathogen-associated molecular patterns and are important mediators of the innate immune system. TLR1 and TLR6 are paralogs and located in tandem on the same chromosome in mammals. They form heterodimers with TLR2 and bind lipopeptide components of gram-positive and gram-negative bacterial cell walls. To identify conserved stretches in TLR1 and TLR6, that may be important for their function, we compared their protein sequences in nine mammalian species(Homo sapiens, Pan troglodytes, Macaca mulatta, Mus musculus, Rattus norvegicus; Erinaceus europaeus, Bos Taurus, Sus scrofa and Canis familiaris. Results The N-terminal sequences of the orthologous proteins showed greater similarity than corresponding paralog sequences. However, we identified a region of 300 amino acids towards the C-terminus of TLR1 and TLR6, where paralogs had a greater degree of sequence identity than orthologs. Preservation of DNA sequence identity of paralogs in this region was observed in all nine mammalian species investigated, and is due to independent gene conversion events. The regions having undergone gene conversion in each species are almost identical and encode the leucine-rich repeat motifs 16 to 19, the C-terminal cap motif, the transmembrane domain and most of the intracellular Toll/interleukin-1 receptor (TIR domain. Conclusion Our results show that, for a specific conserved region, divergence of TLR1 and TLR6 is limited by gene conversion, most likely because of the need for co-evolution with multiple intracellular and extracellular binding partners. Thus, gene conversion provides a mechanism for limiting the divergence of functional regions of protein paralogs, while allowing other domains to evolve diversified functions.

  16. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  17. Microhomology-mediated deletion and gene conversion in African trypanosomes.

    Science.gov (United States)

    Glover, Lucy; Jun, Junho; Horn, David

    2011-03-01

    Antigenic variation in African trypanosomes is induced by DNA double-strand breaks (DSBs). In these protozoan parasites, DSB repair (DSBR) is dominated by homologous recombination (HR) and microhomology-mediated end joining (MMEJ), while non-homologous end joining (NHEJ) has not been reported. To facilitate the analysis of chromosomal end-joining, we established a system whereby inter-allelic repair by HR is lethal due to loss of an essential gene. Analysis of intrachromosomal end joining in individual DSBR survivors exclusively revealed MMEJ-based deletions but no NHEJ. A survey of microhomologies typically revealed sequences of between 5 and 20 bp in length with several mismatches tolerated in longer stretches. Mean deletions were of 54 bp on the side closest to the break and 284 bp in total. Break proximity, microhomology length and GC-content all favored repair and the pattern of MMEJ described above was similar at several different loci across the genome. We also identified interchromosomal gene conversion involving HR and MMEJ at different ends of a duplicated sequence. While MMEJ-based deletions were RAD51-independent, one-sided MMEJ was RAD51 dependent. Thus, we describe the features of MMEJ in Trypanosoma brucei, which is analogous to micro single-strand annealing; and RAD51 dependent, one-sided MMEJ. We discuss the contribution of MMEJ pathways to genome evolution, subtelomere recombination and antigenic variation.

  18. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett

    2011-02-01

    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  19. Distinct modulation of event-related potentials during motor preparation in patients with motor conversion disorder.

    Directory of Open Access Journals (Sweden)

    Rebekah L Blakemore

    Full Text Available OBJECTIVE: Conversion paresis patients and healthy people feigning weakness both exhibit weak voluntary movement without detectable neuropathology. Uniquely, conversion patients lack a sense of conscious awareness of the origin of their impairment. We investigated whether conversion paresis patients show distinct electroencephalographic (EEG markers associated with their unconscious movement deficits. METHODS: Six unilateral upper limb conversion paresis patients, 12 feigning participants asked to mimic weakness and 12 control participants performed a precued reaction time task, requiring movements of either hand, depending on precue information. Performance measures (force, reaction and movement time, and event-related EEG potentials (ERP were compared, between groups and across hands or hemisphere, using linear mixed models. RESULTS: Feigners generated the same inter-hand difference in reaction and movement time as expressed by patients, even though no specific targets were set nor feedback given on these measures. We found novel ERP signatures specific to patients. When the symptomatic hand was precued, the P3 ERP component accompanying the precue was dramatically larger in patients than in feigning participants. Additionally, in patients the earlier N1 ERP component was diminished when the precue signalled either the symptomatic or asymptomatic hand. CONCLUSIONS: These results are consistent with previous suggestions that lack of awareness of the origin of their symptoms in conversion disorder patients may result from suppression of brain activity normally related to self-agency. In patients the diminished N1 to all precues is consistent with a generalised reduction in cognitive processing of movement-related precues. The P3 enhancement in patients is unlikely to simply reflect changes required for generation of impaired movements, because it was not seen in feigners showing the same behavioural deficits. Rather, this P3 enhancement in

  20. TMEM231 Gene Conversion Associated with Joubert and Meckel-Gruber Syndromes in the Same Family.

    Science.gov (United States)

    Maglic, Dino; Stephen, Joshi; Malicdan, May Christine V; Guo, Jennifer; Fischer, Roxanne; Konzman, Daniel; Mullikin, James C; Gahl, William A; Vilboux, Thierry; Gunay-Aygun, Meral

    2016-11-01

    Joubert and Meckel-Gruber syndromes (JS and MGS) are ciliopathies with overlapping features. JS patients manifest the "molar tooth sign" on brain imaging and variable eye, kidney, and liver disease. MGS presents with polycystic kidneys, occipital encephalocele, and polydactyly; it is typically perinatally fatal. Both syndromes are genetically heterogeneous; some genes cause either syndrome. Here, we report two brothers married to unrelated women. The first brother had three daughters with JS and a son with polycystic kidneys who died at birth. The second brother's wife had a fetal demise due to MGS. Whole exome sequencing identified TMEM231 NM_001077416.2: c.784G>A; p.(Asp262Asn) in all children and the wife of the first brother; the second brother's wife had a c.406T>G;p.(Trp136Gly) change. In-depth analysis uncovered a rare gene conversion event in TMEM231, leading to loss of exon 4, in all the affected children of first brother. We believe that the combination of this gene conversion with different missense mutations led to a spectrum of phenotypes that span JS and MGS. © 2016 WILEY PERIODICALS, INC.

  1. Gene conversions in the growth hormone gene family of primates: stronger homogenizing effects in the Hominidae lineage.

    Science.gov (United States)

    Petronella, Nicholas; Drouin, Guy

    2011-09-01

    In humans, the growth hormone/chorionic somatomammotropin gene family is composed of five highly similar genes. We characterized the gene conversions that occurred between the growth hormone genes of 11 primate species. We detected 48 conversions using GENECONV and others were only detected using phylogenetic analyses. Gene conversions were detected in all species analyzed, their average size (±standard deviation) is 197.8±230.4 nucleotides, the size of the conversions is correlated with sequence similarity and converted regions are significantly more GC-rich than non-converted regions. Gene conversions have a stronger homogenizing effect in Hominidae genes than in other primate species. They are also less frequent in conserved gene regions and towards functionally important genes. This suggests that the high degree of sequence similarity observed between the growth hormone genes of primate species is a consequence of frequent gene conversions in gene regions which are under little selective constraints. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Simulating the physiology of athletes during endurance sports events: modelling human energy conversion and metabolism.

    Science.gov (United States)

    van Beek, Johannes H G M; Supandi, Farahaniza; Gavai, Anand K; de Graaf, Albert A; Binsl, Thomas W; Hettling, Hannes

    2011-11-13

    The human physiological system is stressed to its limits during endurance sports competition events. We describe a whole body computational model for energy conversion during bicycle racing. About 23 per cent of the metabolic energy is used for muscle work, the rest is converted to heat. We calculated heat transfer by conduction and blood flow inside the body, and heat transfer from the skin by radiation, convection and sweat evaporation, resulting in temperature changes in 25 body compartments. We simulated a mountain time trial to Alpe d'Huez during the Tour de France. To approach the time realized by Lance Armstrong in 2004, very high oxygen uptake must be sustained by the simulated cyclist. Temperature was predicted to reach 39°C in the brain, and 39.7°C in leg muscle. In addition to the macroscopic simulation, we analysed the buffering of bursts of high adenosine triphosphate hydrolysis by creatine kinase during cyclical muscle activity at the biochemical pathway level. To investigate the low oxygen to carbohydrate ratio for the brain, which takes up lactate during exercise, we calculated the flux distribution in cerebral energy metabolism. Computational modelling of the human body, describing heat exchange and energy metabolism, makes simulation of endurance sports events feasible.

  3. How did you feel when "The Crocodile Hunter" died? Voicing and silencing in conversation influences memory for an autobiographical event.

    Science.gov (United States)

    Harris, Celia B; Barnier, Amanda J; Sutton, John; Keil, Paul G

    2010-02-01

    Conversations about the past can involve voicing and silencing; processes of validation and invalidation that shape recall. In this experiment we examined the products and processes of remembering a significant autobiographical event in conversation with others. Following the death of Australian celebrity Steve Irwin, in an adapted version of the collaborative recall paradigm, 69 participants described and rated their memories for hearing of his death. Participants then completed a free recall phase where they either discussed the event in groups of three or wrote about the event on their own. Finally, participants completed the original questionnaire again, both 1 week and 1 month after the free recall phase. Discussion influenced later memories for hearing of Irwin's death, particularly memories for emotion and shock. Qualitative analysis of the free recall phase suggested that during conversation a shared understanding of the event developed, but that emotional reactions to the event were silenced in ways that minimised the event's impact. These findings are discussed in terms of the processes and consequences of sharing public and personal memories in conversation.

  4. Evidence of gene conversion in genes encoding the Gal/GalNac lectin complex of Entamoeba.

    Directory of Open Access Journals (Sweden)

    Gareth D Weedall

    2011-06-01

    Full Text Available The human gut parasite Entamoeba histolytica, uses a lectin complex on its cell surface to bind to mucin and to ligands on the intestinal epithelia. Binding to mucin is necessary for colonisation and binding to intestinal epithelia for invasion, therefore blocking this binding may protect against amoebiasis. Acquired protective immunity raised against the lectin complex should create a selection pressure to change the amino acid sequence of lectin genes in order to avoid future detection. We present evidence that gene conversion has occurred in lineages leading to E. histolytica strain HM1:IMSS and E. dispar strain SAW760. This evolutionary mechanism generates diversity and could contribute to immune evasion by the parasites.

  5. Evidence of gene conversion in genes encoding the Gal/GalNac lectin complex of Entamoeba.

    Directory of Open Access Journals (Sweden)

    Gareth D Weedall

    2011-06-01

    Full Text Available The human gut parasite Entamoeba histolytica, uses a lectin complex on its cell surface to bind to mucin and to ligands on the intestinal epithelia. Binding to mucin is necessary for colonisation and binding to intestinal epithelia for invasion, therefore blocking this binding may protect against amoebiasis. Acquired protective immunity raised against the lectin complex should create a selection pressure to change the amino acid sequence of lectin genes in order to avoid future detection. We present evidence that gene conversion has occurred in lineages leading to E. histolytica strain HM1:IMSS and E. dispar strain SAW760. This evolutionary mechanism generates diversity and could contribute to immune evasion by the parasites.

  6. Origin of the plant Tm-1-like gene via two independent horizontal transfer events and one gene fusion event.

    Science.gov (United States)

    Yang, Zefeng; Liu, Li; Fang, Huimin; Li, Pengcheng; Xu, Shuhui; Cao, Wei; Xu, Chenwu; Huang, Jinling; Zhou, Yong

    2016-01-01

    The Tomato mosaic virus (ToMV) resistance gene Tm-1 encodes a direct inhibitor of ToMV RNA replication to protect tomato from infection. The plant Tm-1-like (Tm-1L) protein is predicted to contain an uncharacterized N-terminal UPF0261 domain and a C-terminal TIM-barrel signal transduction (TBST) domain. Homologous searches revealed that proteins containing both of these two domains are mainly present in charophyte green algae and land plants but absent from glaucophytes, red algae and chlorophyte green algae. Although Tm-1 homologs are widely present in bacteria, archaea and fungi, UPF0261- and TBST-domain-containing proteins are generally encoded by different genes in these linages. A co-evolution analysis also suggested a putative interaction between UPF0261- and TBST-domain-containing proteins. Phylogenetic analyses based on homologs of these two domains revealed that plants have acquired UPF0261- and TBST-domain-encoding genes through two independent horizontal gene transfer (HGT) events before the origin of land plants from charophytes. Subsequently, gene fusion occurred between these two horizontally acquired genes and resulted in the origin of the Tm-1L gene in streptophytes. Our results demonstrate a novel evolutionary mechanism through which the recipient organism may acquire genes with functional interaction through two different HGT events and further fuse them into one functional gene.

  7. Population-specific differences in gene conversion patterns between human SUZ12 and SUZ12P are indicative of the dynamic nature of interparalog gene conversion.

    Science.gov (United States)

    Mussotter, Tanja; Bengesser, Kathrin; Högel, Josef; Cooper, David N; Kehrer-Sawatzki, Hildegard

    2014-04-01

    Nonallelic homologous gene conversion (NAHGC) resulting from interparalog recombination without crossover represents an important influence on the evolution of duplicated sequences in the human genome. In 17q11.2, different paralogous sequences mediate large NF1 deletions by nonallelic homologous recombination with crossover (NAHR). Among these paralogs are SUZ12 and its pseudogene SUZ12P which harbour the breakpoints of type-2 (1.2-Mb) NF1 deletions. Such deletions are caused predominantly by mitotic NAHR since somatic mosaicism with normal cells is evident in most patients. Investigating whether SUZ12 and SUZ12P have also been involved in NAHGC, we observed gene conversion tracts between these paralogs in both Africans (AFR) and Europeans (EUR). Since germline type-2 NF1 deletions resulting from meiotic NAHR are very rare, the vast majority of the gene conversion tracts in SUZ12 and SUZ12P are likely to have resulted from mitotic recombination during premeiotic cell divisions of germ cells. A higher number of gene conversion tracts were noted within SUZ12 and SUZ12P in AFR as compared to EUR. Further, the distinctive signature of NAHGC (a high number of SNPs per paralog and a high number of shared SNPs between paralogs), a characteristic of many actively recombining paralogs, was observed in both SUZ12 and SUZ12P but only in AFR and not in EUR. A novel polymorphic 2.3-kb deletion in SUZ12P was identified which exhibited a high allele frequency in EUR. We postulate that this interparalog structural difference, together with low allelic recombination rates, could have caused a reduction in NAHGC between SUZ12 and SUZ12P during human evolution.

  8. Combined effects of thrombosis pathway gene variants predict cardiovascular events.

    Directory of Open Access Journals (Sweden)

    Kirsi Auro

    2007-07-01

    Full Text Available The genetic background of complex diseases is proposed to consist of several low-penetrance risk loci. Addressing this complexity likely requires both large sample size and simultaneous analysis of different predisposing variants. We investigated the role of four thrombosis genes: coagulation factor V (F5, intercellular adhesion molecule 1 (ICAM1, protein C (PROC, and thrombomodulin (THBD in cardiovascular diseases. Single allelic gene variants and their pair-wise combinations were analyzed in two independently sampled population cohorts from Finland. From among 14,140 FINRISK participants (FINRISK-92, n = 5,999 and FINRISK-97, n = 8,141, we selected for genotyping a sample of 2,222, including 528 incident cardiovascular disease (CVD cases and random subcohorts totaling 786. To cover all known common haplotypes (>10%, 54 single nucleotide polymorphisms (SNPs were genotyped. Classification-tree analysis identified 11 SNPs that were further analyzed in Cox's proportional hazard model as single variants and pair-wise combinations. Multiple testing was controlled by use of two independent cohorts and with false-discovery rate. Several CVD risk variants were identified: In women, the combination of F5 rs7542281 x THBD rs1042580, together with three single F5 SNPs, was associated with CVD events. Among men, PROC rs1041296, when combined with either ICAM1 rs5030341 or F5 rs2269648, was associated with total mortality. As a single variant, PROC rs1401296, together with the F5 Leiden mutation, was associated with ischemic stroke events. Our strategy to combine the classification-tree analysis with more traditional genetic models was successful in identifying SNPs-acting either in combination or as single variants--predisposing to CVD, and produced consistent results in two independent cohorts. These results suggest that variants in these four thrombosis genes contribute to arterial cardiovascular events at population level.

  9. Experience of Events of Truth in Hermeneutic Conversation With Text: Ethics and Ontology.

    Science.gov (United States)

    Foss, Berit; Nåden, Dagfinn; Eriksson, Katie

    2016-10-01

    The purpose of this article is to explore what the experience of events of truth can entail in hermeneutic dialogue with text as well as the significance this can have for hermeneutic methodology in caring science. Experience of events of truth is discussed based on Hans-Georg Gadamer's ontological perspective and on Emmanuel Levinas's ethical perspective. A veritable experience of an event of truth is a testimony to the responsibility we take for the Other and to our humanity. Experience of events of truth requires that there is a connection of esteem between ethics and ontology in the reader's understanding of what Hans-Georg Gadamer calls the subject matter (Sache). The experience of events of truth has methodological significance for caring science in that it can contribute to the disclosure of ontological evidence and inform caregiving and caring science. © The Author(s) 2016.

  10. Evolutionary Stasis in Cycad Plastomes and the First Case of Plastome GC-Biased Gene Conversion.

    Science.gov (United States)

    Wu, Chung-Shien; Chaw, Shu-Miaw

    2015-06-27

    In angiosperms, gene conversion has been known to reduce the mutational load of plastid genomes (the plastomes). Particularly, more frequent gene conversions in inverted repeat (IR) than in single copy (SC) regions result in contrasting substitution rates between these two regions. However, little has been known about the effect of gene conversion in the evolution of gymnosperm plastomes. Cycads (Cycadophyta) are the second largest gymnosperm group. Evolutionary study of their plastomes is limited to the basal cycad genus, Cycas. In this study, we addressed three questions. 1) Do the plastomes of other cycad genera evolve slowly as previously observed in the plastome of Cycas taitungensis? 2) Do substitution rates differ between their SC and IR regions? And 3) Does gene conversion occur in the cycad plastomes? If yes, is it AT-biased or GC-biased? Plastomes of eight species from other eight genera of cycads were sequenced. These plastomes are highly conserved in genome organization. Excluding ginkgo, cycad plastomes have significantly lower synonymous and nonsynonymous substitution rates than other gymnosperms, reflecting their evolutionary stasis in nucleotide mutations. In the IRs of cycad plastomes, the reduced substitution rates and GC-biased mutations are associated with a GC-biased gene conversion (gBGC) mechanism. Further investigations suggest that in cycads, gBGC is able to rectify plastome-wide mutations. Therefore, this study is the first to uncover the plastomic gBGC in seed plants. We also propose a gBGC model to interpret the dissimilar evolutionary patterns as well as the compositionally biased mutations in the SC and IR regions of cycad plastomes.

  11. γ-ray telescopes using conversions to e+e- pairs: event generators, angular resolution and polarimetry

    Science.gov (United States)

    Gros, P.; Bernard, D.

    2017-02-01

    We benchmark various available event generators in Geant4 and EGS5 in the light of ongoing projects for high angular-resolution pair-conversion telescopes at low energy. We compare the distributions of key kinematic variables extracted from the geometry of the three final state particles. We validate and use as reference an exact generator using the full 5D differential cross-section of the conversion process. We focus in particular on the effect of the unmeasured recoiling nucleus on the angular resolution. We show that for high resolution trackers, the choice of the generator affects the estimated resolution of the telescope. We also show that the current available generator are unable to describe accurately a linearly polarised photon source.

  12. DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.

    Directory of Open Access Journals (Sweden)

    Adam J L Cook

    2007-04-01

    Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.

  13. Long- and short-patch gene conversions in Streptococcus pneumoniae transformation.

    Science.gov (United States)

    Sicard, M; Lefèvre, J C; Mostachfi, P; Gasc, A M; Méjean, V; Claverys, J P

    1985-01-01

    In pneumococcal transformation some point mutations are integrated by an excision-repair pathway which switches the heteroduplex DNA into homoduplex. This transfer of information is a gene conversion. We have reviewed some of the properties of this system especially those relating to heteroduplex specificity and given evidence that this extends over several kilobases of DNA. We then describe a new process of conversion in pneumococcal transformation which occurs over a very short distance (5 to 27 base-pairs) and is triggered by a single site mutation resulting from the transversion 5'-ATTCAT...to 5'...ATTAAT... Only one of the two heteroduplexes 5'...A...3'/3'...G...5', is converted.

  14. A heuristic Bayesian method for segmenting DNA sequence alignments and detecting evidence for recombination and gene conversion.

    Science.gov (United States)

    Kedzierska, Anna; Husmeier, Dirk

    2006-01-01

    We propose a heuristic approach to the detection of evidence for recombination and gene conversion in multiple DNA sequence alignments. The proposed method consists of two stages. In the first stage, a sliding window is moved along the DNA sequence alignment, and phylogenetic trees are sampled from the conditional posterior distribution with MCMC. To reduce the noise intrinsic to inference from the limited amount of data available in the typically short sliding window, a clustering algorithm based on the Robinson-Foulds distance is applied to the trees thus sampled, and the posterior distribution over tree clusters is obtained for each window position. While changes in this posterior distribution are indicative of recombination or gene conversion events, it is difficult to decide when such a change is statistically significant. This problem is addressed in the second stage of the proposed algorithm, where the distributions obtained in the first stage are post-processed with a Bayesian hidden Markov model (HMM). The emission states of the HMM are associated with posterior distributions over phylogenetic tree topology clusters. The hidden states of the HMM indicate putative recombinant segments. Inference is done in a Bayesian sense, sampling parameters from the posterior distribution with MCMC. Of particular interest is the determination of the number of hidden states as an indication of the number of putative recombinant regions. To this end, we apply reversible jump MCMC, and sample the number of hidden states from the respective posterior distribution.

  15. Caffeine inhibits gene conversion by displacing Rad51 from ssDNA

    Science.gov (United States)

    Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.

    2015-01-01

    Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181

  16. Gene conversion occurs within the mating-type locus of Cryptococcus neoformans during sexual reproduction.

    Directory of Open Access Journals (Sweden)

    Sheng Sun

    2012-07-01

    Full Text Available Meiotic recombination of sex chromosomes is thought to be repressed in organisms with heterogametic sex determination (e.g. mammalian X/Y chromosomes, due to extensive divergence and chromosomal rearrangements between the two chromosomes. However, proper segregation of sex chromosomes during meiosis requires crossing-over occurring within the pseudoautosomal regions (PAR. Recent studies reveal that recombination, in the form of gene conversion, is widely distributed within and may have played important roles in the evolution of some chromosomal regions within which recombination was thought to be repressed, such as the centromere cores of maize. Cryptococcus neoformans, a major human pathogenic fungus, has an unusually large mating-type locus (MAT, >100 kb, and the MAT alleles from the two opposite mating-types show extensive nucleotide sequence divergence and chromosomal rearrangements, mirroring characteristics of sex chromosomes. Meiotic recombination was assumed to be repressed within the C. neoformans MAT locus. A previous study identified recombination hot spots flanking the C. neoformans MAT, and these hot spots are associated with high GC content. Here, we investigated a GC-rich intergenic region located within the MAT locus of C. neoformans to establish if this region also exhibits unique recombination behavior during meiosis. Population genetics analysis of natural C. neoformans isolates revealed signals of homogenization spanning this GC-rich intergenic region within different C. neoformans lineages, consistent with a model in which gene conversion of this region during meiosis prevents it from diversifying within each lineage. By analyzing meiotic progeny from laboratory crosses, we found that meiotic recombination (gene conversion occurs around the GC-rich intergenic region at a frequency equal to or greater than the meiotic recombination frequency observed in other genomic regions. We discuss the implications of these findings with

  17. Interlocus gene conversion explains at least 2.7% of single nucleotide variants in human segmental duplications.

    Science.gov (United States)

    Dumont, Beth L

    2015-06-16

    Interlocus gene conversion (IGC) is a recombination-based mechanism that results in the unidirectional transfer of short stretches of sequence between paralogous loci. Although IGC is a well-established mechanism of human disease, the extent to which this mutagenic process has shaped overall patterns of segregating variation in multi-copy regions of the human genome remains unknown. One expected manifestation of IGC in population genomic data is the presence of one-to-one paralogous SNPs that segregate identical alleles. Here, I use SNP genotype calls from the low-coverage phase 3 release of the 1000 Genomes Project to identify 15,790 parallel, shared SNPs in duplicated regions of the human genome. My approach for identifying these sites accounts for the potential redundancy of short read mapping in multi-copy genomic regions, thereby effectively eliminating false positive SNP calls arising from paralogous sequence variation. I demonstrate that independent mutation events to identical nucleotides at paralogous sites are not a significant source of shared polymorphisms in the human genome, consistent with the interpretation that these sites are the outcome of historical IGC events. These putative signals of IGC are enriched in genomic contexts previously associated with non-allelic homologous recombination, including clear signals in gene families that form tandem intra-chromosomal clusters. Taken together, my analyses implicate IGC, not point mutation, as the mechanism generating at least 2.7% of single nucleotide variants in duplicated regions of the human genome.

  18. Leveraging Distant Relatedness to Quantify Human Mutation and Gene-Conversion Rates.

    Science.gov (United States)

    Palamara, Pier Francesco; Francioli, Laurent C; Wilton, Peter R; Genovese, Giulio; Gusev, Alexander; Finucane, Hilary K; Sankararaman, Sriram; Sunyaev, Shamil R; de Bakker, Paul I W; Wakeley, John; Pe'er, Itsik; Price, Alkes L

    2015-12-01

    The rate at which human genomes mutate is a central biological parameter that has many implications for our ability to understand demographic and evolutionary phenomena. We present a method for inferring mutation and gene-conversion rates by using the number of sequence differences observed in identical-by-descent (IBD) segments together with a reconstructed model of recent population-size history. This approach is robust to, and can quantify, the presence of substantial genotyping error, as validated in coalescent simulations. We applied the method to 498 trio-phased sequenced Dutch individuals and inferred a point mutation rate of 1.66 × 10(-8) per base per generation and a rate of 1.26 × 10(-9) for conversion as 5.99 × 10(-6). We found that recombination does not have observable mutagenic effects after gene conversion is accounted for and that local gene-conversion rates reflect recombination rates. We detected a strong enrichment of recent deleterious variation among mismatching variants found within IBD regions and observed summary statistics of local sharing of IBD segments to closely match previously proposed metrics of background selection; however, we found no significant effects of selection on our mutation-rate estimates. We detected no evidence of strong variation of mutation rates in a number of genomic annotations obtained from several recent studies. Our analysis suggests that a mutation-rate estimate higher than that reported by recent pedigree-based studies should be adopted in the context of DNA-based demographic reconstruction.

  19. An event-driven approach for studying gene block evolution in bacteria.

    Science.gov (United States)

    Ream, David C; Bankapur, Asma R; Friedberg, Iddo

    2015-07-01

    Gene blocks are genes co-located on the chromosome. In many cases, gene blocks are conserved between bacterial species, sometimes as operons, when genes are co-transcribed. The conservation is rarely absolute: gene loss, gain, duplication, block splitting and block fusion are frequently observed. An open question in bacterial molecular evolution is that of the formation and breakup of gene blocks, for which several models have been proposed. These models, however, are not generally applicable to all types of gene blocks, and consequently cannot be used to broadly compare and study gene block evolution. To address this problem, we introduce an event-based method for tracking gene block evolution in bacteria. We show here that the evolution of gene blocks in proteobacteria can be described by a small set of events. Those include the insertion of genes into, or the splitting of genes out of a gene block, gene loss, and gene duplication. We show how the event-based method of gene block evolution allows us to determine the evolutionary rateand may be used to trace the ancestral states of their formation. We conclude that the event-based method can be used to help us understand the formation of these important bacterial genomic structures. The software is available under GPLv3 license on http://github.com/reamdc1/gene_block_evolution.git. Supplementary online material: http://iddo-friedberg.net/operon-evolution © The Author 2015. Published by Oxford University Press.

  20. Phylogenetic analyses of cyanobacterial genomes: Quantification of horizontal gene transfer events

    OpenAIRE

    Zhaxybayeva, Olga; Gogarten, J. Peter; Charlebois, Robert L.; Doolittle, W Ford; Papke, R Thane

    2006-01-01

    Using 1128 protein-coding gene families from 11 completely sequenced cyanobacterial genomes, we attempt to quantify horizontal gene transfer events within cyanobacteria, as well as between cyanobacteria and other phyla. A novel method of detecting and enumerating potential horizontal gene transfer events within a group of organisms based on analyses of “embedded quartets” allows us to identify phylogenetic signal consistent with a plurality of gene families, as well as to delineate cases of c...

  1. Suppression of Tla1 gene expression for improved solar conversion efficiency and photosynthetic productivity in plants and algae

    Science.gov (United States)

    Melis, Anastasios; Mitra, Mautusi

    2010-06-29

    The invention provides method and compositions to minimize the chlorophyll antenna size of photosynthesis by decreasing TLA1 gene expression, thereby improving solar conversion efficiencies and photosynthetic productivity in plants, e.g., green microalgae, under bright sunlight conditions.

  2. Complex signatures of locus-specific selective pressures and gene conversion on Human Growth Hormone/Chorionic Somatomammotropin genes.

    Science.gov (United States)

    Sedman, Laura; Padhukasahasram, Badri; Kelgo, Piret; Laan, Maris

    2008-10-01

    Reduced birth weight and slow neonatal growth are risks correlated with the development of common diseases in adulthood. The Human Growth Hormone/Chorionic Somatomammotropin (hGH/CSH) gene cluster (48 kb) at 17q22-24, consisting of one pituitary-expressed postnatal (GH1) and four placental genes (GH2, CSH1, CSH2, and CSHL1) may contribute to common variation in intrauterine and infant growth, and also to the regulation of feto-maternal and adult glucose metabolism. In contrast to GH1, there are limited genetic data on the hGH/CSH genes expressed in utero. We report the first survey of sequence variation encompassing all five hGH/CSH genes. Resequencing identified 113 SNPs/indels (ss86217675-ss86217787 in dbSNP) including 66 novel variants, and revealed remarkable differences in diversity patterns among the homologous duplicated genes as well as between the study populations of European (Estonians), Asian (Han Chinese), and African (Mandenkalu) ancestries. A dominant feature of the hGH/CSH region is hyperactive gene conversion, with the rate exceeding tens to hundreds of times the rate of reciprocal crossing-over and resulting in near absence of linkage disequilibrium. The initiation of gene conversion seems to be uniformly distributed because the data do not predict any recombination hotspots. Signatures of different selective constraints acting on each gene indicate functional specification of the hGH/CSH genes. Most strikingly, the GH2 coding for placental growth hormone shows strong intercontinental diversification (F(ST)=0.41-0.91; p<10(-6)) indicative of balancing selection, whereas the flanking CSH1 exhibits low population differentiation (F(ST)=0.03-0.09), low diversity (non-Africans, pi=8-9 x 10(-5); Africans, pi=8.2 x 10(-4)), and one dominant haplotype worldwide, consistent with purifying selection. The results imply that the success of an association study targeted to duplicated genes may be enhanced by prior resequencing of the study population in order

  3. Contrasting evolutionary histories of MHC class I and class II loci in grouse—Effects of selection and gene conversion

    Science.gov (United States)

    Minias, Piotr; Bateson, Zachary W; Whittingham, Linda A; Johnson, Jeff A.; Oyler-McCance, Sara J.; Dunn, Peter O

    2016-01-01

    Genes of the major histocompatibility complex (MHC) encode receptor molecules that are responsible for recognition of intracellular and extracellular pathogens (class I and class II genes, respectively) in vertebrates. Given the different roles of class I and II MHC genes, one might expect the strength of selection to differ between these two classes. Different selective pressures may also promote different rates of gene conversion at each class. Despite these predictions, surprisingly few studies have looked at differences between class I and II genes in terms of both selection and gene conversion. Here, we investigated the molecular evolution of MHC class I and II genes in five closely related species of prairie grouse (Centrocercus and Tympanuchus) that possess one class I and two class II loci. We found striking differences in the strength of balancing selection acting on MHC class I versus class II genes. More than half of the putative antigen-binding sites (ABS) of class II were under positive or episodic diversifying selection, compared with only 10% at class I. We also found that gene conversion had a stronger role in shaping the evolution of MHC class II than class I. Overall, the combination of strong positive (balancing) selection and frequent gene conversion has maintained higher diversity of MHC class II than class I in prairie grouse. This is one of the first studies clearly demonstrating that macroevolutionary mechanisms can act differently on genes involved in the immune response against intracellular and extracellular pathogens.

  4. Bcl6 Is Required for Somatic Hypermutation and Gene Conversion in Chicken DT40 Cells.

    Directory of Open Access Journals (Sweden)

    Alan M Williams

    Full Text Available The activation induced cytosine deaminase (AID mediates diversification of B cell immunoglobulin genes by the three distinct yet related processes of somatic hypermutation (SHM, class switch recombination (CSR, and gene conversion (GCV. SHM occurs in germinal center B cells, and the transcription factor Bcl6 is a key regulator of the germinal center B cell gene expression program, including expression of AID. To test the hypothesis that Bcl6 function is important for the process of SHM, we compared WT chicken DT40 B cells, which constitutively perform SHM/GCV, to their Bcl6-deficient counterparts. We found that Bcl6-deficient DT40 cells were unable to perform SHM and GCV despite enforced high level expression of AID and substantial levels of AID in the nucleus of the cells. To gain mechanistic insight into the GCV/SHM dependency on Bcl6, transcriptional features of a highly expressed SHM target gene were analyzed in Bcl6-sufficient and -deficient DT40 cells. No defect was observed in the accumulation of single stranded DNA in the target gene as a result of Bcl6 deficiency. In contrast, association of Spt5, an RNA polymerase II (Pol II and AID binding factor, was strongly reduced at the target gene body relative to the transcription start site in Bcl6-deficient cells as compared to WT cells. However, partial reconstitution of Bcl6 function substantially reconstituted Spt5 association with the target gene body but did not restore detectable SHM. Our observations suggest that in the absence of Bcl6, Spt5 fails to associate efficiently with Pol II at SHM targets, perhaps precluding robust AID action on the SHM target DNA. Our data also suggest, however, that Spt5 binding is not sufficient for SHM of a target gene even in DT40 cells with strong expression of AID.

  5. Bcl6 Is Required for Somatic Hypermutation and Gene Conversion in Chicken DT40 Cells

    Science.gov (United States)

    Williams, Alan M.; Maman, Yaakov; Alinikula, Jukka; Schatz, David G.

    2016-01-01

    The activation induced cytosine deaminase (AID) mediates diversification of B cell immunoglobulin genes by the three distinct yet related processes of somatic hypermutation (SHM), class switch recombination (CSR), and gene conversion (GCV). SHM occurs in germinal center B cells, and the transcription factor Bcl6 is a key regulator of the germinal center B cell gene expression program, including expression of AID. To test the hypothesis that Bcl6 function is important for the process of SHM, we compared WT chicken DT40 B cells, which constitutively perform SHM/GCV, to their Bcl6-deficient counterparts. We found that Bcl6-deficient DT40 cells were unable to perform SHM and GCV despite enforced high level expression of AID and substantial levels of AID in the nucleus of the cells. To gain mechanistic insight into the GCV/SHM dependency on Bcl6, transcriptional features of a highly expressed SHM target gene were analyzed in Bcl6-sufficient and -deficient DT40 cells. No defect was observed in the accumulation of single stranded DNA in the target gene as a result of Bcl6 deficiency. In contrast, association of Spt5, an RNA polymerase II (Pol II) and AID binding factor, was strongly reduced at the target gene body relative to the transcription start site in Bcl6-deficient cells as compared to WT cells. However, partial reconstitution of Bcl6 function substantially reconstituted Spt5 association with the target gene body but did not restore detectable SHM. Our observations suggest that in the absence of Bcl6, Spt5 fails to associate efficiently with Pol II at SHM targets, perhaps precluding robust AID action on the SHM target DNA. Our data also suggest, however, that Spt5 binding is not sufficient for SHM of a target gene even in DT40 cells with strong expression of AID. PMID:26900682

  6. Reporter system for the detection of in vivo gene conversion: changing colors from blue to green using GFP variants.

    Science.gov (United States)

    Sommer, Jeffrey R; Alderson, Jon; Laible, Goetz; Petters, Robert M

    2006-06-01

    We have devised a system for the study of in vivo gene correction based on the detection of color variants of the green fluorescent protein (GFP) from the jellyfish Aequorea victoria. The intensity and spectra of the fluorescence emitted by the blue (BFP) and red-shifted (EGFP) variants of GFP differ from each other. We modified one nucleotide from an EGFP expression vector that we predicted would yield a blue variant (TAC-CAC, Tyr(66)-His(66)). Cells that were either transiently or stably transfected with the reporter system were used to test the functionality and feasibility of the detection of in vivo gene correction. A thio-protected single-stranded oligonucleotide designed to convert the genotype of the blue variant to that of the EGFP variant by the correction of a single base pair was delivered to the reporter cells using a variety of methodologies and strategies.Conversion events were easily observed using fluorescent microscopy because of the enhanced emission intensity and different spectra of the EGFP variant.

  7. Sgs1 regulates gene conversion tract lengths and crossovers independently of its helicase activity.

    Science.gov (United States)

    Lo, Yi-Chen; Paffett, Kimberly S; Amit, Or; Clikeman, Jennifer A; Sterk, Rosa; Brenneman, Mark A; Nickoloff, Jac A

    2006-06-01

    RecQ helicases maintain genome stability and suppress tumors in higher eukaryotes through roles in replication and DNA repair. The yeast RecQ homolog Sgs1 interacts with Top3 topoisomerase and Rmi1. In vitro, Sgs1 binds to and branch migrates Holliday junctions (HJs) and the human RecQ homolog BLM, with Top3alpha, resolves synthetic double HJs in a noncrossover sense. Sgs1 suppresses crossovers during the homologous recombination (HR) repair of DNA double-strand breaks (DSBs). Crossovers are associated with long gene conversion tracts, suggesting a model in which Sgs1 helicase catalyzes reverse branch migration and convergence of double HJs for noncrossover resolution by Top3. Consistent with this model, we show that allelic crossovers and gene conversion tract lengths are increased in sgs1Delta. However, crossover and tract length suppression was independent of Sgs1 helicase activity, which argues against helicase-dependent HJ convergence. HJs may converge passively by a "random walk," and Sgs1 may play a structural role in stimulating Top3-dependent resolution. In addition to the new helicase-independent functions for Sgs1 in crossover and tract length control, we define three new helicase-dependent functions, including the suppression of chromosome loss, chromosome missegregation, and synthetic lethality in srs2Delta. We propose that Sgs1 has helicase-dependent functions in replication and helicase-independent functions in DSB repair by HR.

  8. Early events in the evolution of spider silk genes.

    Directory of Open Access Journals (Sweden)

    James Starrett

    Full Text Available Silk spinning is essential to spider ecology and has had a key role in the expansive diversification of spiders. Silk is composed primarily of proteins called spidroins, which are encoded by a multi-gene family. Spidroins have been studied extensively in the derived clade, Orbiculariae (orb-weavers, from the suborder Araneomorphae ('true spiders'. Orbicularians produce a suite of different silks, and underlying this repertoire is a history of duplication and spidroin gene divergence. A second class of silk proteins, Egg Case Proteins (ECPs, is known only from the orbicularian species, Lactrodectus hesperus (Western black widow. In L. hesperus, ECPs bond with tubuliform spidroins to form egg case silk fibers. Because most of the phylogenetic diversity of spiders has not been sampled for their silk genes, there is limited understanding of spidroin gene family history and the prevalence of ECPs. Silk genes have not been reported from the suborder Mesothelae (segmented spiders, which diverged from all other spiders >380 million years ago, and sampling from Mygalomorphae (tarantulas, trapdoor spiders and basal araneomorph lineages is sparse. In comparison to orbicularians, mesotheles and mygalomorphs have a simpler silk biology and thus are hypothesized to have less diversity of silk genes. Here, we present cDNAs synthesized from the silk glands of six mygalomorph species, a mesothele, and a non-orbicularian araneomorph, and uncover a surprisingly rich silk gene diversity. In particular, we find ECP homologs in the mesothele, suggesting that ECPs were present in the common ancestor of extant spiders, and originally were not specialized to complex with tubuliform spidroins. Furthermore, gene-tree/species-tree reconciliation analysis reveals that numerous spidroin gene duplications occurred after the split between Mesothelae and Opisthothelae (Mygalomorphae plus Araneomorphae. We use the spidroin gene tree to reconstruct the evolution of amino acid

  9. Early events in the evolution of spider silk genes.

    Science.gov (United States)

    Starrett, James; Garb, Jessica E; Kuelbs, Amanda; Azubuike, Ugochi O; Hayashi, Cheryl Y

    2012-01-01

    Silk spinning is essential to spider ecology and has had a key role in the expansive diversification of spiders. Silk is composed primarily of proteins called spidroins, which are encoded by a multi-gene family. Spidroins have been studied extensively in the derived clade, Orbiculariae (orb-weavers), from the suborder Araneomorphae ('true spiders'). Orbicularians produce a suite of different silks, and underlying this repertoire is a history of duplication and spidroin gene divergence. A second class of silk proteins, Egg Case Proteins (ECPs), is known only from the orbicularian species, Lactrodectus hesperus (Western black widow). In L. hesperus, ECPs bond with tubuliform spidroins to form egg case silk fibers. Because most of the phylogenetic diversity of spiders has not been sampled for their silk genes, there is limited understanding of spidroin gene family history and the prevalence of ECPs. Silk genes have not been reported from the suborder Mesothelae (segmented spiders), which diverged from all other spiders >380 million years ago, and sampling from Mygalomorphae (tarantulas, trapdoor spiders) and basal araneomorph lineages is sparse. In comparison to orbicularians, mesotheles and mygalomorphs have a simpler silk biology and thus are hypothesized to have less diversity of silk genes. Here, we present cDNAs synthesized from the silk glands of six mygalomorph species, a mesothele, and a non-orbicularian araneomorph, and uncover a surprisingly rich silk gene diversity. In particular, we find ECP homologs in the mesothele, suggesting that ECPs were present in the common ancestor of extant spiders, and originally were not specialized to complex with tubuliform spidroins. Furthermore, gene-tree/species-tree reconciliation analysis reveals that numerous spidroin gene duplications occurred after the split between Mesothelae and Opisthothelae (Mygalomorphae plus Araneomorphae). We use the spidroin gene tree to reconstruct the evolution of amino acid compositions of

  10. Association between genes, stressful childhood events and processing bias in depression vulnerable individuals

    NARCIS (Netherlands)

    Vrijsen, J.N.; Oostrom, I.I.H. van; Arias-Vasquez, A.; Franke, B.; Becker, E.S.; Speckens, A.E.M.

    2014-01-01

    The brain-derived neurotrophic factor (BDNF) and catechol-O-methyltransferase (COMT) genes are relevant candidates for depression. Variation in these genes is associated with stress sensitivity and depressotypic cognitive biases. The interaction between genes and stressful events is considered as an

  11. Association between genes, stressful childhood events and processing bias in depression vulnerable individuals

    NARCIS (Netherlands)

    Vrijsen, J.N.; Oostrom, I.I.H. van; Arias-Vasquez, A.; Franke, B.; Becker, E.S.; Speckens, A.E.M.

    2014-01-01

    The brain-derived neurotrophic factor (BDNF) and catechol-O-methyltransferase (COMT) genes are relevant candidates for depression. Variation in these genes is associated with stress sensitivity and depressotypic cognitive biases. The interaction between genes and stressful events is considered as an

  12. GC-biased gene conversion impacts ribosomal DNA evolution in vertebrates, angiosperms, and other eukaryotes.

    Science.gov (United States)

    Escobar, Juan S; Glémin, Sylvain; Galtier, Nicolas

    2011-09-01

    Ribosomal DNA (rDNA) is one of the most conserved genes in eukaryotes. The multiples copies of rDNA in the genome evolve in a concerted manner, through unequal crossing over and/or gene conversion, two mechanisms related to homologous recombination. Recombination increases local GC content in several organisms through a process known as GC-biased gene conversion (gBGC). gBGC has been well characterized in mammals, birds, and grasses, but its phylogenetic distribution across the tree of life is poorly understood. Here, we test the hypothesis that recombination affects the evolution of base composition in 18S rDNA and examine the reliability of this thoroughly studied molecule as a marker of gBGC in eukaryotes. Phylogenetic analyses of 18S rDNA in vertebrates and angiosperms reveal significant heterogeneity in the evolution of base composition across both groups. Mammals, birds, and grasses experience increases in the GC content of the 18S rDNA, consistent with previous genome-wide analyses. In addition, we observe increased GC contents in Ostariophysi ray-finned fishes and commelinid monocots (i.e., the clade including grasses), suggesting that the genomes of these two groups have been affected by gBGC. Polymorphism analyses in rDNA confirm that gBGC, not mutation bias, is the most plausible explanation for these patterns. We also find that helix and loop sites of the secondary structure of ribosomal RNA do not evolve at the same pace: loops evolve faster than helices, whereas helices are GC richer than loops. We extend analyses to major lineages of eukaryotes and suggest that gBGC might have also affected base composition in Giardia (Diplomonadina), nudibranch gastropods (Mollusca), and Asterozoa (Echinodermata).

  13. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  14. A Metagenomic Perspective on Changes to Nutrient-cycling Genes Following Forest-to-agriculture Conversion in the Amazon Basin

    Science.gov (United States)

    Meyer, K. M.; Womack, A. M.; Rodrigues, J.; Nüsslein, K.; Bohannan, B. J. M.

    2014-12-01

    Forest-to-agriculture conversion has been shown to alter nutrient cycling and the community composition of soil microorganisms. However, few studies have looked simultaneously at how the abundance, composition, and diversity of microbial genes involved in nutrient cycling change with conversion. We used shotgun metagenomic sequencing to analyze soil from primary rainforest and converted cattle pasture sampled at the Fazenda Nova Vida in Rondônia, Brazil. The diversity, richness, and evenness of nutrient cycling genes were significantly higher in the pasture, and the composition of nutrient cycling communities differed significantly between land use types. These results largely mirror taxonomic shifts following Amazon rainforest conversion, which tends to increase diversity, richness, and evenness of soil microbial communities. The abundance of genes related to N cycling and methane flux differed between land use types. Methanotrophy genes decreased in abundance in the pasture, whereas methanogenesis genes were not significantly different between land use types. These changes could underlie the commonly observed shift from methane sink to source following forest-to-agriculture conversion. Multiple genes in the nitrogen cycle also differed with land use, including genes related to N-fixation and ammonification. Metagenomics provides a unique perspective on the consequences of land use change on microbial community structure and function.

  15. Codelivery of antitumor drug and gene by a pH-sensitive charge-conversion system.

    Science.gov (United States)

    Guan, Xiuwen; Li, Yanhui; Jiao, Zixue; Lin, Lin; Chen, Jie; Guo, Zhaopei; Tian, Huayu; Chen, Xuesi

    2015-02-11

    In the present study, a gene and drug codelivery system was developed by electrostatic binding of polyethylenimine-poly(l-lysine)-poly(l-glutamic acid) (PELG), polyethylenimine (PEI), cis-aconityl-doxorubicin (CAD), and DNA. Zeta potential and drug release analysis confirmed the pH-responsive charge conversion and acid-sensitive drug release functional properties of the PELG/PEI/(DNA+CAD) system. Gel retardation assay and transfection experiment showed the codelivery system had effective DNA binding ability and good transfection efficiency on HepG2 cells. The therapeutic gene p53 was further employed to study its combinational effects with CAD. Cytotoxicity assay showed the half inhibitory concentration (IC50) of the PELG/PEI/(p53+CAD) codelivery system was lower than that of the gene or the drug delivery system. Confocal laser scanning microscopy (CLSM) showed that the drug and gene could be delivered into the cells simultaneously. A significant increase of p53 gene expression was achieved after HepG2 cells treated by PELG/PEI/(p53+CAD) codelivery system. The apoptosis experiment indicated clearly that the codelivery system could lead an effective apoptosis on tumor cells, which was beneficial for the treatment of cancer. The biodistribution and tumor accumulation of the codelivery system was explored via in vivo imaging in subcutaneous xenograft and in situ tumor models. The tumor and some major organs were excised and imaged, and the results showed that the codelivery system can accumulate efficiently in tumor for both tumor models. It can be suggested from the above results that the PELG/PEI/(DNA+CAD) codelivery system will have great potential applications in cancer therapy.

  16. The genomic landscape of meiotic crossovers and gene conversions in Arabidopsis thaliana

    Science.gov (United States)

    Wijnker, Erik; Velikkakam James, Geo; Ding, Jia; Becker, Frank; Klasen, Jonas R; Rawat, Vimal; Rowan, Beth A; de Jong, Daniël F; de Snoo, C Bastiaan; Zapata, Luis; Huettel, Bruno; de Jong, Hans; Ossowski, Stephan; Weigel, Detlef; Koornneef, Maarten; Keurentjes, Joost JB; Schneeberger, Korbinian

    2013-01-01

    Knowledge of the exact distribution of meiotic crossovers (COs) and gene conversions (GCs) is essential for understanding many aspects of population genetics and evolution, from haplotype structure and long-distance genetic linkage to the generation of new allelic variants of genes. To this end, we resequenced the four products of 13 meiotic tetrads along with 10 doubled haploids derived from Arabidopsis thaliana hybrids. GC detection through short reads has previously been confounded by genomic rearrangements. Rigid filtering for misaligned reads allowed GC identification at high accuracy and revealed an ∼80-kb transposition, which undergoes copy-number changes mediated by meiotic recombination. Non-crossover associated GCs were extremely rare most likely due to their short average length of ∼25–50 bp, which is significantly shorter than the length of CO-associated GCs. Overall, recombination preferentially targeted non-methylated nucleosome-free regions at gene promoters, which showed significant enrichment of two sequence motifs. DOI: http://dx.doi.org/10.7554/eLife.01426.001 PMID:24347547

  17. IDconverter and IDClight: Conversion and annotation of gene and protein IDs

    Directory of Open Access Journals (Sweden)

    Díaz-Uriarte Ramón

    2007-01-01

    Full Text Available Abstract Background Researchers involved in the annotation of large numbers of gene, clone or protein identifiers are usually required to perform a one-by-one conversion for each identifier. When the field of research is one such as microarray experiments, this number may be around 30,000. Results To help researchers map accession numbers and identifiers among clones, genes, proteins and chromosomal positions, we have designed and developed IDconverter and IDClight. They are two user-friendly, freely available web server applications that also provide additional functional information by mapping the identifiers on to pathways, Gene Ontology terms, and literature references. Both tools are high-throughput oriented and include identifiers for the most common genomic databases. These tools have been compared to other similar tools, showing that they are among the fastest and the most up-to-date. Conclusion These tools provide a fast and intuitive way of enriching the information coming out of high-throughput experiments like microarrays. They can be valuable both to wet-lab researchers and to bioinformaticians.

  18. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    Science.gov (United States)

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  19. Gene conversion is strongly induced in human cells by double-strand breaks and is modulated by the expression of BCL-XL

    Energy Technology Data Exchange (ETDEWEB)

    Wiese, Claudia; Pierce, Andrew J.; Gauny, Stacey S.; Jasin, Maria; Kronenberg, Amy

    2001-09-25

    Homology-directed repair (HDR) of DNA double-strand breaks (DSBs) is a well-established mechanism that contributes to the maintenance of genomic stability in rodent cells, and it has been assumed that HDR is of similar importance in the repair of DSBs in human cells. However, in addition to promoting genomic stability, some outcomes of homologous recombination can be deleterious, suggesting that factors exist to regulate HDR. We previously demonstrated that overexpression of BCL-2 or BCL-xL enhanced the frequency of x-ray-induced mutations involving the TK1 locus, including loss of heterozygosity (LOH) events presumed to arise by mitotic recombination. The present study was designed to test whether HDR is a prominent DSB repair pathway in human cells, and to directly determine whether ectopic expression of BCL-xL affects HDR. We used the B-lymphoblastoid cell line TK6, which expresses wild-type TP53 and resembles normal lymphocytes in undergoing apoptosis following! genotoxic stress. U sing isogenic derivatives of TK6 cells (TK6-neo, TK6-bcl-xL), we find that a DSB in an integrated HDR reporter stimulates gene conversion 40-50-fold in TK6-neo cells, demonstrating that a DSB can be efficiently repaired by gene conversion in human cells. Significantly, DSB-induced gene conversion events are 3- to 4-fold more frequent in BCL-xL overexpressing cells. The results demonstrate that HDR plays an important role in maintaining genomic integrity in human cells and that ectopic expression of BCL-xL enhances HDR of DSBs. To our knowledge, this is the first study to highlight a function for BCL-xL in modulating DSB repair in human cells.

  20. Gene conversion in the CYP11B2 gene encoding P450c11AS is associated with, but does not cause, the syndrome of corticosterone methyloxidase II deficiency

    Energy Technology Data Exchange (ETDEWEB)

    Fardella, C.E.; Hum, D.W.; Rodriguez, H. [Univ. of California, San Francisco, CA (United States)]|[Univ. of Colorado, Denver, CO (United States)] [and others

    1996-01-01

    Cytochrome P450c11AS (aldosterone synthase) has 11{beta}hydroxylase, 18-hydroxylase, and 18-oxidase activities and is expressed solely in the adrenal zona glomerulosa. Corticosterone methyloxidase II (CMOII) deficiency denotes a rare disorder of adrenal steroidogenesis in which only the 18-oxidase activity of P450c11AS is disrupted, while the 11{beta}-hydroxylase and 18-hydroxylase activities persist. Such patients have elevated serum concentrations of corticosterone and 18-hydroxycorticosterone and very low or unmeasurable concentrations of aldosterone, often resulting in a clinical salt-losing crisis in infancy. We have sought mutations causing CMOII deficiency in outbred populations. In three of four unrelated P450c11AS alleles from two unrelated patients with CMOII deficiency, we found a gene conversion event in which exons 3 and 4 of the CYP11B2 gene encoding P450c11AS were changed to the sequence of the nearby CYP11B1 gene, which encodes the related enzyme P450c11{beta}. This conversion resulted in a mutant P450c11AS protein carrying three changes. We built seven vectors expressing P450c11AS carrying each mutation singly, each of the three possible pairs of mutations, and the triple mutation as found in the proband. The activities in steroidogenic MA-10 and JEG-3 cells were 10- to 20-fold higher. In these systems all of the mutants retained normal 18-oxidase activity, indicating that the detected gene conversion event is associated with but does not cause CMOII deficiency. None of the four CPY11B2 alleles in these two patients bore other identifiable mutations. These patients might have mutations in the promoters or other noncoding regions, or mutations in genes other than CYP11B2 may cause the syndrome of CMOII deficiency. 37 refs., 2 figs., 2 tabs.

  1. OrgConv: detection of gene conversion using consensus sequences and its application in plant mitochondrial and chloroplast homologs

    Directory of Open Access Journals (Sweden)

    Hao Weilong

    2010-03-01

    Full Text Available Abstract Background The ancestry of mitochondria and chloroplasts traces back to separate endosymbioses of once free-living bacteria. The highly reduced genomes of these two organelles therefore contain very distant homologs that only recently have been shown to recombine inside the mitochondrial genome. Detection of gene conversion between mitochondrial and chloroplast homologs was previously impossible due to the lack of suitable computer programs. Recently, I developed a novel method and have, for the first time, discovered recurrent gene conversion between chloroplast mitochondrial genes. The method will further our understanding of plant organellar genome evolution and help identify and remove gene regions with incongruent phylogenetic signals for several genes widely used in plant systematics. Here, I implement such a method that is available in a user friendly web interface. Results OrgConv (Organellar Conversion is a computer package developed for detection of gene conversion between mitochondrial and chloroplast homologous genes. OrgConv is available in two forms; source code can be installed and run on a Linux platform and a web interface is available on multiple operating systems. The input files of the feature program are two multiple sequence alignments from different organellar compartments in FASTA format. The program compares every examined sequence against the consensus sequence of each sequence alignment rather than exhaustively examining every possible combination. Making use of consensus sequences significantly reduces the number of comparisons and therefore reduces overall computational time, which allows for analysis of very large datasets. Most importantly, with the significantly reduced number of comparisons, the statistical power remains high in the face of correction for multiple tests. Conclusions Both the source code and the web interface of OrgConv are available for free from the OrgConv website http

  2. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Identification of Candidate Genes and Biosynthesis Pathways Related to Fertility Conversion by Wheat KTM3315A Transcriptome Profiling

    Directory of Open Access Journals (Sweden)

    Lingli Zhang

    2017-04-01

    Full Text Available The Aegilops kotschyi thermo-sensitive cytoplasmic male sterility (K-TCMS system may facilitate hybrid wheat (Triticum aestivum L. seed multiplication and production. The K-TCMS line is completely male sterile during the normal wheat-growing season, whereas its fertility can be restored in a high-temperature environment. To elucidate the molecular mechanisms responsible for male sterility/fertility conversion and candidate genes involved with pollen development in K-TCMS, we employed RNA-seq to sequence the transcriptomes of anthers from K-TCMS line KTM3315A during development under sterile and fertile conditions. We identified 16840 differentially expressed genes (DEGs in different stages including15157 known genes (15135 nuclear genes and 22 plasmagenes and 1683 novel genes. Bioinformatics analysis identified possible metabolic pathways involved with fertility based on KEGG pathway enrichment of the DEGs expressed in fertile and sterile plants. We found that most of the genes encoding key enzyme in the phenylpropanoid biosynthesis and jasmonate biosynthesis pathways were significant upregulated in uninucleate, binuclate or trinucleate stage, which both interact with MYB transcription factors, and that link between all play essential roles in fertility conversion. The relevant DEGs were verified by quantitative RT-PCR. Thus, we suggested that phenylpropanoid biosynthesis and jasmonate biosynthesis pathways were involved in fertility conversion of K-TCMS wheat. This will provide a new perspective and an effective foundation for the research of molecular mechanisms of fertility conversion of CMS wheat. Fertility conversion mechanism in thermo-sensitive cytoplasmic male sterile/fertile wheat involves the phenylpropanoid biosynthesis pathway, jasmonate biosynthesis pathway, and MYB transcription factors.

  4. Events

    Directory of Open Access Journals (Sweden)

    Igor V. Karyakin

    2016-02-01

    Full Text Available The 9th ARRCN Symposium 2015 was held during 21st–25th October 2015 at the Novotel Hotel, Chumphon, Thailand, one of the most favored travel destinations in Asia. The 10th ARRCN Symposium 2017 will be held during October 2017 in the Davao, Philippines. International Symposium on the Montagu's Harrier (Circus pygargus «The Montagu's Harrier in Europe. Status. Threats. Protection», organized by the environmental organization «Landesbund für Vogelschutz in Bayern e.V.» (LBV was held on November 20-22, 2015 in Germany. The location of this event was the city of Wurzburg in Bavaria.

  5. Biased gene conversion and GC-content evolution in the coding sequences of reptiles and vertebrates.

    Science.gov (United States)

    Figuet, Emeric; Ballenghien, Marion; Romiguier, Jonathan; Galtier, Nicolas

    2014-12-19

    Mammalian and avian genomes are characterized by a substantial spatial heterogeneity of GC-content, which is often interpreted as reflecting the effect of local GC-biased gene conversion (gBGC), a meiotic repair bias that favors G and C over A and T alleles in high-recombining genomic regions. Surprisingly, the first fully sequenced nonavian sauropsid (i.e., reptile), the green anole Anolis carolinensis, revealed a highly homogeneous genomic GC-content landscape, suggesting the possibility that gBGC might not be at work in this lineage. Here, we analyze GC-content evolution at third-codon positions (GC3) in 44 vertebrates species, including eight newly sequenced transcriptomes, with a specific focus on nonavian sauropsids. We report that reptiles, including the green anole, have a genome-wide distribution of GC3 similar to that of mammals and birds, and we infer a strong GC3-heterogeneity to be already present in the tetrapod ancestor. We further show that the dynamic of coding sequence GC-content is largely governed by karyotypic features in vertebrates, notably in the green anole, in agreement with the gBGC hypothesis. The discrepancy between third-codon positions and noncoding DNA regarding GC-content dynamics in the green anole could not be explained by the activity of transposable elements or selection on codon usage. This analysis highlights the unique value of third-codon positions as an insertion/deletion-free marker of nucleotide substitution biases that ultimately affect the evolution of proteins.

  6. Role of Double-Strand Break End-Tethering during Gene Conversion in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Suvi Jain

    2016-04-01

    Full Text Available Correct repair of DNA double-strand breaks (DSBs is critical for maintaining genome stability. Whereas gene conversion (GC-mediated repair is mostly error-free, repair by break-induced replication (BIR is associated with non-reciprocal translocations and loss of heterozygosity. We have previously shown that a Recombination Execution Checkpoint (REC mediates this competition by preventing the BIR pathway from acting on DSBs that can be repaired by GC. Here, we asked if the REC can also determine whether the ends that are engaged in a GC-compatible configuration belong to the same break, since repair involving ends from different breaks will produce potentially deleterious translocations. We report that the kinetics of repair are markedly delayed when the two DSB ends that participate in GC belong to different DSBs (termed Trans compared to the case when both DSB ends come from the same break (Cis. However, repair in Trans still occurs by GC rather than BIR, and the overall efficiency of repair is comparable. Hence, the REC is not sensitive to the "origin" of the DSB ends. When the homologous ends for GC are in Trans, the delay in repair appears to reflect their tethering to sequences on the other side of the DSB that themselves recombine with other genomic locations with which they share sequence homology. These data support previous observations that the two ends of a DSB are usually tethered to each other and that this tethering facilitates both ends encountering the same donor sequence. We also found that the presence of homeologous/repetitive sequences in the vicinity of a DSB can distract the DSB end from finding its bona fide homologous donor, and that inhibition of GC by such homeologous sequences is markedly increased upon deleting Sgs1 but not Msh6.

  7. Role of Double-Strand Break End-Tethering during Gene Conversion in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Suvi Jain

    2016-04-01

    Full Text Available Correct repair of DNA double-strand breaks (DSBs is critical for maintaining genome stability. Whereas gene conversion (GC-mediated repair is mostly error-free, repair by break-induced replication (BIR is associated with non-reciprocal translocations and loss of heterozygosity. We have previously shown that a Recombination Execution Checkpoint (REC mediates this competition by preventing the BIR pathway from acting on DSBs that can be repaired by GC. Here, we asked if the REC can also determine whether the ends that are engaged in a GC-compatible configuration belong to the same break, since repair involving ends from different breaks will produce potentially deleterious translocations. We report that the kinetics of repair are markedly delayed when the two DSB ends that participate in GC belong to different DSBs (termed Trans compared to the case when both DSB ends come from the same break (Cis. However, repair in Trans still occurs by GC rather than BIR, and the overall efficiency of repair is comparable. Hence, the REC is not sensitive to the "origin" of the DSB ends. When the homologous ends for GC are in Trans, the delay in repair appears to reflect their tethering to sequences on the other side of the DSB that themselves recombine with other genomic locations with which they share sequence homology. These data support previous observations that the two ends of a DSB are usually tethered to each other and that this tethering facilitates both ends encountering the same donor sequence. We also found that the presence of homeologous/repetitive sequences in the vicinity of a DSB can distract the DSB end from finding its bona fide homologous donor, and that inhibition of GC by such homeologous sequences is markedly increased upon deleting Sgs1 but not Msh6.

  8. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)

    2015-11-27

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  9. Pinda: a web service for detection and analysis of intraspecies gene duplication events.

    Science.gov (United States)

    Kontopoulos, Dimitrios-Georgios; Glykos, Nicholas M

    2013-09-01

    We present Pinda, a Web service for the detection and analysis of possible duplications of a given protein or DNA sequence within a source species. Pinda fully automates the whole gene duplication detection procedure, from performing the initial similarity searches, to generating the multiple sequence alignments and the corresponding phylogenetic trees, to bootstrapping the trees and producing a Z-score-based list of duplication candidates for the input sequence. Pinda has been cross-validated using an extensive set of known and bibliographically characterized duplication events. The service facilitates the automatic and dependable identification of gene duplication events, using some of the most successful bioinformatics software to perform an extensive analysis protocol. Pinda will prove of use for the analysis of newly discovered genes and proteins, thus also assisting the study of recently sequenced genomes. The service's location is http://orion.mbg.duth.gr/Pinda. The source code is freely available via https://github.com/dgkontopoulos/Pinda/.

  10. Gene polymorphisms in APOE, NOS3, and LIPC genes may be risk factors for cardiac adverse events after primary CABG

    Directory of Open Access Journals (Sweden)

    Nollert Georg

    2009-08-01

    Full Text Available Abstract Introduction Coronary artery disease progression after primary coronary artery bypass grafting may, beside classical atherosclerosis risk factors, be depending on genetic predisposition. Methods We investigated 192 CABG patients (18% female, age: 60.9 ± 7.4 years. Clinically cardiac adverse events were defined as need for reoperation (n = 88; 46%, reintervention (n = 58; 30%, or angina (n = 89; 46%. Mean follow-up time measured 10.1 ± 5.1 years. Gene polymorphisms (ApoE, NOS3, LIPC, CETP, SERPINE-1, Prothrombin were investigated separately and combined (gene risk profile. Results Among classical risk factors, arterial hypertension and hypercholesterinemia significantly influenced CAD progression. Single ApoE, NOS3 and LIPC polymorphisms provided limited information. Patients missing the most common ApoE ε3 allele (5,2%, showed recurrent symptoms (p = 0,077 and had more frequently reintervention (p = 0,001. NOS3 a allele was associated with a significant increase for reintervention (p = 0,041 and recurrent symptoms (p = 0,042. Homozygous LIPC patients had a higher reoperation rate (p = 0.049. A gene risk profile enabled us to discriminate between faster and slower occurrence of cardiac adverse events (p = 0.0012. Conclusion Single APOE, LIPC and NOS3 polymorphisms permitted limited prognosis of cardiac adverse events in patients after CABG. Risk profile, in contrast, allowed for risk stratification.

  11. Association between genes, stressful childhood events and processing bias in depression vulnerable individuals.

    Science.gov (United States)

    Vrijsen, J N; van Oostrom, I; Arias-Vásquez, A; Franke, B; Becker, E S; Speckens, A

    2014-06-01

    The brain-derived neurotrophic factor (BDNF) and catechol-O-methyltransferase (COMT) genes are relevant candidates for depression. Variation in these genes is associated with stress sensitivity and depressotypic cognitive biases. The interaction between genes and stressful events is considered as an important mechanism in the development of depression. This study examined the effects of the BDNF and COMT genes on biased processing and the interaction with childhood stress in vulnerable individuals. A total of 198 remitted depressed individuals performed an n-back task with emotional facial stimuli (happy and sad). Childhood events were measured with a questionnaire. Genotype by childhood events interactions were analyzed for happy and sad expressions for BDNF (Val66Met; rs6265) and COMT (Val158Met; rs4680), individually and combined. BDNF and COMT both interacted significantly (P = 0.006 and P = 0.014, respectively) with childhood trauma on reaction time for happy faces. For both genes, Met-carriers with childhood trauma showed less positive bias for happy faces than those without childhood trauma. Val-carriers did not show a differential bias. Individuals with childhood trauma and 3 or 4 risk alleles (BDNF and COMT combined) showed less positive bias than those without childhood trauma (P = 0.011). The BDNF × COMT × childhood trauma interaction yielded a P = 0.055, but had limited power. A potential weakness is the measurement method of the childhood events, as negative bias might have affected participants' recall. Our findings endorse the association of BDNF and COMT with stress and depression and provide a possible intermediate, i.e. biased processing of positive information. Tailoring treatment to specific risk profiles based on genetic susceptibility and childhood stress could be promising. © 2014 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  12. Recognition events in AM symbiosis: analysis of fungal gene expression at the early appressorium stage.

    Science.gov (United States)

    Breuninger, Magadalene; Requena, Natalia

    2004-08-01

    Arbuscular mycorrhizal symbiosis is induced upon a series of recognition events involving the reorganization of both plant and fungal cellular programs culminating in the formation of appressoria on the epidermal root cells. In this work we monitored for the first time the genetic changes occurring in the fungal partner during early appressorium development. We established an in vitro system of Glomus mosseae and Petroselinum crispum for studying appressorium formation and found that after 120 h first appressoria developed in the root epidermis. We have constructed a fungal subtractive suppressive library enriched in genes up-regulated at this stage. Our aim was to identify early signaling events during plant recognition leading to appressoria formation. The library contains 375 clones with an average size of 500 bp. From these, 200 clones were sequenced and most of them represent gene fragments with no known homologues (63%) and therefore putative new genes specific to the mycorrhiza symbiosis. Reverse-Northern blot and RT-PCR analyses confirmed that ca. 30% of the genes present in the library were up-regulated upon plant induction after 120 h. Among the genes with homologues in other organisms we found several genes common to other plant-microbe interactions including some genes related to Ca2+-dependent signaling. The up-regulation of these genes opens the possibility that Ca2+ plays a role in the early stages of mycorrhiza formation as it has been found in other plant-microbe interactions such as the Rhizobium symbiosis or the Magnaporthe grisea/rice pathogenic interaction.

  13. Making memories of stressful events: a journey along epigenetic, gene transcription and signaling pathways

    Directory of Open Access Journals (Sweden)

    Johannes M.H.M. eReul

    2014-01-01

    Full Text Available Strong psychologically stressful events are known to have a long-lasting impact on behavior. The consolidation of such, largely adaptive, behavioral responses to stressful events involves changes in gene expression in limbic brain regions such as the hippocampus and amygdala. The underlying molecular mechanisms however were until recently unresolved. More than a decade ago we started to investigate the role of these hormones in signaling and epigenetic mechanisms participating in the effects of stress on gene transcription in hippocampal neurons. We discovered a novel, rapid non-genomic mechanism in which glucocorticoids via glucocorticoid receptors (GRs facilitate signaling of the ERK MAPK signaling pathway to the downstream nuclear kinases MSK1 and Elk-1 in dentate gyrus (DG granule neurons. Activation of this signaling pathway results in serine10 (S10 phosphorylation and lysine14 (K14 acetylation at histone H3 (H3S10p-K14ac, leading to the induction of the immediate early genes c-Fos and Egr-1. In addition, we found a role of the DNA methylation status of gene promoters. A series of studies showed that these molecular mechanisms play a critical role in the long-lasting consolidation of behavioral responses in the forced swim test and Morris water maze. Furthermore, an important role of GABA was found in controlling the epigenetic and gene transcriptional responses to psychological stress. Thus, psychologically stressful events evoke a long-term impact on behavior through changes in hippocampal function brought about by distinct glutamatergic and glucocorticoid-driven changes in epigenetic regulation of gene transcription which are modulated by (local GABAergic interneurons and limbic afferent inputs. These epigenetic processes may play an important role in the etiology of stress-related mental disorders such as major depressive and anxiety disorders like PTSD.

  14. Low-temperature affected LC-PUFA conversion and associated gene transcript level in Nannochloropsis oculata CS-179

    Science.gov (United States)

    Ma, Xiaolei; Zhang, Lin; Zhu, Baohua; Pan, Kehou; Li, Si; Yang, Guanpin

    2011-09-01

    Nannochloropsis oculata CS-179, a marine eukaryotic unicellular microalga, is rich in long-chain polyunsaturated fatty acids (LC-PUFAs). Culture temperature affected cell growth and the composition of LC-PUFAs. At an initial cell density of 1.5 × 106 cell mL-1, the highest growth was observed at 25°C and the cell density reached 3 × 107 cell mL-1 at the beginning of logarithmic phase. The content of LC-PUFAs varied with culture temperature. The highest content of LC-PUFAs (43.96%) and EPA (36.6%) was gained at 20°C. Real-time PCR showed that the abundance of Δ6-desaturase gene transcripts was significantly different among 5 culture temperatures and the highest transcript level (15°C) of Nanoc-D6D took off at cycle 21.45. The gene transcript of C20-elongase gene was higher at lower temperatures (10, 15, and 20°C), and the highest transcript level (20°C) of Nanoc-E took off at cycle 21.18. The highest conversion rate (39.3%) of Δ6-desaturase was also gained at 20°C. But the conversion rate of Nanoc-E was not detected. The higher content of LC-PUFAs was a result of higher gene transcript level and higher enzyme activity. Compared with C20-elongase gene, Δ6-desaturase gene transcript and enzyme activity varied significantly with temperature. It will be useful to study the mechanism of how the content of LC-PUFAs is affected by temperature.

  15. Evolutionarily diverged regulation of X-chromosomal genes as a primal event in mouse reproductive isolation.

    Science.gov (United States)

    Oka, Ayako; Takada, Toyoyuki; Fujisawa, Hironori; Shiroishi, Toshihiko

    2014-04-01

    Improper gene regulation is implicated in reproductive isolation, but its genetic and molecular bases are unknown. We previously reported that a mouse inter-subspecific X chromosome substitution strain shows reproductive isolation characterized by male-specific sterility due to disruption of meiotic entry in spermatogenesis. Here, we conducted comprehensive transcriptional profiling of the testicular cells of this strain by microarray. The results clearly revealed gross misregulation of gene expression in the substituted donor X chromosome. Such misregulation occurred prior to detectable spermatogenetic impairment, suggesting that it is a primal event in reproductive isolation. The misregulation of X-linked genes showed asymmetry; more genes were disproportionally downregulated rather than upregulated. Furthermore, this misregulation subsequently resulted in perturbation of global transcriptional regulation of autosomal genes, probably by cascading deleterious effects. Remarkably, this transcriptional misregulation was substantially restored by introduction of chromosome 1 from the same donor strain as the X chromosome. This finding implies that one of regulatory genes acting in trans for X-linked target genes is located on chromosome 1. This study collectively suggests that regulatory incompatibility is a major cause of reproductive isolation in the X chromosome substitution strain.

  16. Transcription of a donor enhances its use during double-strand break-induced gene conversion in human cells.

    Science.gov (United States)

    Schildkraut, Ezra; Miller, Cheryl A; Nickoloff, Jac A

    2006-04-01

    Homologous recombination (HR) mediates accurate repair of double-strand breaks (DSBs) but carries the risk of large-scale genetic change, including loss of heterozygosity, deletions, inversions, and translocations. Nearly one-third of the human genome consists of repetitive sequences, and DSB repair by HR often requires choices among several homologous repair templates, including homologous chromosomes, sister chromatids, and linked or unlinked repeats. Donor preference during DSB-induced gene conversion was analyzed by using several HR substrates with three copies of neo targeted to a human chromosome. Repair of I-SceI nuclease-induced DSBs in one neo (the recipient) required a choice between two donor neo genes. When both donors were downstream, there was no significant bias for proximal or distal donors. When donors flanked the recipient, we observed a marked (85%) preference for the downstream donor. Reversing the HR substrate in the chromosome eliminated this preference, indicating that donor choice is influenced by factors extrinsic to the HR substrate. Prior indirect evidence suggested that transcription might increase donor use. We tested this question directly and found that increased transcription of a donor enhances its use during gene conversion. A preference for transcribed donors would minimize the use of nontranscribed (i.e., pseudogene) templates during repair and thus help maintain genome stability.

  17. Evidence for somatic gene conversion and deletion in bipolar disorder, Crohn's disease, coronary artery disease, hypertension, rheumatoid arthritis, type-1 diabetes, and type-2 diabetes.

    Science.gov (United States)

    Ross, Kenneth Andrew

    2011-02-03

    During gene conversion, genetic information is transferred unidirectionally between highly homologous but non-allelic regions of DNA. While germ-line gene conversion has been implicated in the pathogenesis of some diseases, somatic gene conversion has remained technically difficult to investigate on a large scale. A novel analysis technique is proposed for detecting the signature of somatic gene conversion from SNP microarray data. The Wellcome Trust Case Control Consortium has gathered SNP microarray data for two control populations and cohorts for bipolar disorder (BD), cardiovascular disease (CAD), Crohn's disease (CD), hypertension (HT), rheumatoid arthritis (RA), type-1 diabetes (T1D) and type-2 diabetes (T2D). Using the new analysis technique, the seven disease cohorts are analyzed to identify cohort-specific SNPs at which conversion is predicted. The quality of the predictions is assessed by identifying known disease associations for genes in the homologous duplicons, and comparing the frequency of such associations with background rates. Of 28 disease/locus pairs meeting stringent conditions, 22 show various degrees of disease association, compared with only 8 of 70 in a mock study designed to measure the background association rate (P conversion could be a significant causative factor in each of the seven diseases. The specific genes provide potential insights about disease mechanisms, and are strong candidates for further study.

  18. Genetic Polymorphisms of Mc4R and IGF2 Gene Association with Feed Conversion Efficiency Traits in Beef Cattle

    Directory of Open Access Journals (Sweden)

    Xin-hua Du§, Cui Chen§, Zheng-rong Yuan, Li-min Zhang, Xiao-jie Chen, Yan-hui Wang, Xue Gao, Lu-pei Zhang, Hui-jiang Gao, Jun-ya Li and Shang-zhong Xu*

    2013-11-01

    Full Text Available Melanocortin-4 receptor (MC4R gene is part of the central melanocortin pathway located in the hypothalamus, an area of the brain in which appetite is regulated. Insulin-like growth factor 2 (IGF2 gene plays a role in muscle growth, myoblast proliferation and differentiation. Thus, they are candidate genes for feed conversion efficiency (FCE. The study was to investigate the effects of variants in cattle MC4R and IGF2 gene on FCE traits including residual feed intake (RFI, feed conversion ratio (FCR and average daily gain (ADG. We screened single nucleotide polymorphisms (SNPs of the two genes in 118 Simmental bulls by DNA-pool sequencing and genotyped by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS analysis. C1069G locus of MC4R and four SNPs (C2209T, G18587C, A22950T and G26920T of IGF2 were identified in the population. The χ2 test showed that only MC4R-C1069G, IGF2-C2209T and IGF2-G18587C loci fitted with Hardy-Weinberg equilibrium (P>0.05. General linear model (GLM was used to analyze differences between genotypes. The results showed that only IGF2-G18587C locus has a significant effect on ADG (P0.05. CC and GG genotypes were the dominant genotypes; individual with CC or GG genotype had a larger ADG than GC (P<0.05.

  19. A new computational method for the detection of horizontal gene transfer events.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

  20. Role of Ectopic Gene Conversion in the Evolution of a Candida krusei Pleiotropic Drug Resistance Transporter Family

    Science.gov (United States)

    Lamping, Erwin; Zhu, Jing-yi; Niimi, Masakazu; Cannon, Richard David

    2017-01-01

    Gene duplications enable the evolution of novel gene function, but strong positive selection is required to preserve advantageous mutations in a population. This is because frequent ectopic gene conversions (EGCs) between highly similar, tandem-duplicated, sequences, can rapidly remove fate-determining mutations by replacing them with the neighboring parent gene sequences. Unfortunately, the high sequence similarities between tandem-duplicated genes severely hamper empirical studies of this important evolutionary process, because deciphering their correct sequences is challenging. In this study, we employed the eukaryotic model organism Saccharomyces cerevisiae to clone and functionally characterize all 30 alleles of an important pair of tandem-duplicated multidrug efflux pump genes, ABC1 and ABC11, from seven strains of the diploid pathogenic yeast Candida krusei. Discovery and functional characterization of their closest ancestor, C. krusei ABC12, helped elucidate the evolutionary history of the entire gene family. Our data support the proposal that the pleiotropic drug resistance (PDR) transporters Abc1p and Abc11p have evolved by concerted evolution for ∼134 MY. While >90% of their sequences remained identical, very strong purifying selection protected six short DNA patches encoding just 18 core amino acid (aa) differences in particular trans membrane span (TMS) regions causing two distinct efflux pump functions. A proline-kink change at the bottom of Abc11p TMS3 was possibly fate determining. Our data also enabled the first empirical estimates for key parameters of eukaryotic gene evolution, they provided rare examples of intron loss, and PDR transporter phylogeny confirmed that C. krusei belongs to a novel, yet unnamed, third major Saccharomycotina lineage. PMID:28159755

  1. The Wnt-target gene Dlk-1 is regulated by the Prmt5-associated factor Copr5 during adipogenic conversion

    Directory of Open Access Journals (Sweden)

    Conception Paul

    2015-02-01

    Full Text Available Protein arginine methyl transferase 5 (Prmt5 regulates various differentiation processes, including adipogenesis. Here, we investigated adipogenic conversion in cells and mice in which Copr5, a Prmt5- and histone-binding protein, was genetically invalidated. Compared to control littermates, the retroperitoneal white adipose tissue (WAT of Copr5 KO mice was slightly but significantly reduced between 8 and 16 week/old and contained fewer and larger adipocytes. Moreover, the adipogenic conversion of Copr5 KO embryoid bodies (EB and of primary embryo fibroblasts (Mefs was markedly delayed. Differential transcriptomic analysis identified Copr5 as a negative regulator of the Dlk-1 gene, a Wnt target gene involved in the control of adipocyte progenitors cell fate. Dlk-1 expression was upregulated in Copr5 KO Mefs and the Vascular Stromal Fraction (VSF of Copr5 KO WAT. Chromatin immunoprecipitation (ChIP show that the ablation of Copr5 has impaired both the recruitment of Prmt5 and β-catenin at the Dlk-1 promoter. Overall, our data suggest that Copr5 is involved in the transcriptional control exerted by the Wnt pathway on early steps of adipogenesis.

  2. Coalescent Times and Patterns of Genetic Diversity in Species with Facultative Sex: Effects of Gene Conversion, Population Structure, and Heterogeneity.

    Science.gov (United States)

    Hartfield, Matthew; Wright, Stephen I; Agrawal, Aneil F

    2016-01-01

    Many diploid organisms undergo facultative sexual reproduction. However, little is currently known concerning the distribution of neutral genetic variation among facultative sexual organisms except in very simple cases. Understanding this distribution is important when making inferences about rates of sexual reproduction, effective population size, and demographic history. Here we extend coalescent theory in diploids with facultative sex to consider gene conversion, selfing, population subdivision, and temporal and spatial heterogeneity in rates of sex. In addition to analytical results for two-sample coalescent times, we outline a coalescent algorithm that accommodates the complexities arising from partial sex; this algorithm can be used to generate multisample coalescent distributions. A key result is that when sex is rare, gene conversion becomes a significant force in reducing diversity within individuals. This can reduce genomic signatures of infrequent sex (i.e., elevated within-individual allelic sequence divergence) or entirely reverse the predicted patterns. These models offer improved methods for assessing null patterns of molecular variation in facultative sexual organisms.

  3. Homology Requirements and Competition between Gene Conversion and Break-Induced Replication during Double-Strand Break Repair.

    Science.gov (United States)

    Mehta, Anuja; Beach, Annette; Haber, James E

    2017-02-02

    Saccharomyces cerevisiae mating-type switching is initiated by a double-strand break (DSB) at MATa, leaving one cut end perfectly homologous to the HMLα donor, while the second end must be processed to remove a non-homologous tail before completing repair by gene conversion (GC). When homology at the matched end is ≤150 bp, efficient repair depends on the recombination enhancer, which tethers HMLα near the DSB. Thus, homology shorter than an apparent minimum efficient processing segment can be rescued by tethering the donor near the break. When homology at the second end is ≤150 bp, second-end capture becomes inefficient and repair shifts from GC to break-induced replication (BIR). But when pol32 or pif1 mutants block BIR, GC increases 3-fold, indicating that the steps blocked by these mutations are reversible. With short second-end homology, absence of the RecQ helicase Sgs1 promotes gene conversion, whereas deletion of the FANCM-related Mph1 helicase promotes BIR. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Epigenetic genes and emotional reactivity to daily life events: a multi-step gene-environment interaction study.

    Directory of Open Access Journals (Sweden)

    Ehsan Pishva

    Full Text Available Recent human and animal studies suggest that epigenetic mechanisms mediate the impact of environment on development of mental disorders. Therefore, we hypothesized that polymorphisms in epigenetic-regulatory genes impact stress-induced emotional changes. A multi-step, multi-sample gene-environment interaction analysis was conducted to test whether 31 single nucleotide polymorphisms (SNPs in epigenetic-regulatory genes, i.e. three DNA methyltransferase genes DNMT1, DNMT3A, DNMT3B, and methylenetetrahydrofolate reductase (MTHFR, moderate emotional responses to stressful and pleasant stimuli in daily life as measured by Experience Sampling Methodology (ESM. In the first step, main and interactive effects were tested in a sample of 112 healthy individuals. Significant associations in this discovery sample were then investigated in a population-based sample of 434 individuals for replication. SNPs showing significant effects in both the discovery and replication samples were subsequently tested in three other samples of: (i 85 unaffected siblings of patients with psychosis, (ii 110 patients with psychotic disorders, and iii 126 patients with a history of major depressive disorder. Multilevel linear regression analyses showed no significant association between SNPs and negative affect or positive affect. No SNPs moderated the effect of pleasant stimuli on positive affect. Three SNPs of DNMT3A (rs11683424, rs1465764, rs1465825 and 1 SNP of MTHFR (rs1801131 moderated the effect of stressful events on negative affect. Only rs11683424 of DNMT3A showed consistent directions of effect in the majority of the 5 samples. These data provide the first evidence that emotional responses to daily life stressors may be moderated by genetic variation in the genes involved in the epigenetic machinery.

  5. Horizontal gene transfer events reshape the global landscape of arm race between viruses and homo sapiens.

    Science.gov (United States)

    Chen, Dong-Sheng; Wu, Yi-Quan; Zhang, Wei; Jiang, San-Jie; Chen, Shan-Ze

    2016-06-07

    Horizontal gene transfer (HGT) drives the evolution of recipient organism particularly if it provides a novel function which enhances the fitness or its adaption to the environment. Virus-host co-evolution is attractive for studying co-evolutionary processes, since viruses strictly replicate inside of the host cells and thus their evolution is inexorably tangled with host biology. HGT, as a mechanism of co-evolution between human and viruses, has been widely documented, however, the roles HGT play during the interaction between human and viruses are still in their infancy. In this study, we performed a comprehensive analysis on the genes horizontally transferred between viruses and their corresponding human hosts. Our study suggests that the HGT genes in human are predominantly enriched in immune related GO terms while viral HGT genes are tend to be encoded by viruses which promote the invasion of immune system of hosts. Based on our results, it gives us a hint about the evolution trajectory of HGT events. Overall, our study suggests that the HGT between human and viruses are highly relevant to immune interaction and probably reshaped the arm race between hosts and viruses.

  6. DNA bar coding and pyrosequencing to analyze adverse events in therapeutic gene transfer.

    Science.gov (United States)

    Wang, Gary P; Garrigue, Alexandrine; Ciuffi, Angela; Ronen, Keshet; Leipzig, Jeremy; Berry, Charles; Lagresle-Peyrou, Chantal; Benjelloun, Fatine; Hacein-Bey-Abina, Salima; Fischer, Alain; Cavazzana-Calvo, Marina; Bushman, Frederic D

    2008-05-01

    Gene transfer has been used to correct inherited immunodeficiencies, but in several patients integration of therapeutic retroviral vectors activated proto-oncogenes and caused leukemia. Here, we describe improved methods for characterizing integration site populations from gene transfer studies using DNA bar coding and pyrosequencing. We characterized 160,232 integration site sequences in 28 tissue samples from eight mice, where Rag1 or Artemis deficiencies were corrected by introducing the missing gene with gamma-retroviral or lentiviral vectors. The integration sites were characterized for their genomic distributions, including proximity to proto-oncogenes. Several mice harbored abnormal lymphoproliferations following therapy--in these cases, comparison of the location and frequency of isolation of integration sites across multiple tissues helped clarify the contribution of specific proviruses to the adverse events. We also took advantage of the large number of pyrosequencing reads to show that recovery of integration sites can be highly biased by the use of restriction enzyme cleavage of genomic DNA, which is a limitation in all widely used methods, but describe improved approaches that take advantage of the power of pyrosequencing to overcome this problem. The methods described here should allow integration site populations from human gene therapy to be deeply characterized with spatial and temporal resolution.

  7. Adverse events in families with hypertrophic or dilated cardiomyopathy and mutations in the MYBPC3 gene

    Directory of Open Access Journals (Sweden)

    Lehrke Stephanie

    2008-10-01

    Full Text Available Abstract Background Mutations in MYBPC3 encoding myosin binding protein C belong to the most frequent causes of hypertrophic cardiomyopathy (HCM and may also lead to dilated cardiomyopathy (DCM. MYBPC3 mutations initially were considered to cause a benign form of HCM. The aim of this study was to examine the clinical outcome of patients and their relatives with 18 different MYBPC3 mutations. Methods 87 patients with HCM and 71 patients with DCM were screened for MYBPC3 mutations by denaturing gradient gel electrophoresis and sequencing. Close relatives of mutation carriers were genotyped for the respective mutation. Relatives with mutation were then evaluated by echocardiography and magnetic resonance imaging. A detailed family history regarding adverse clinical events was recorded. Results In 16 HCM (18.4% and two DCM (2.8% index patients a mutation was detected. Seven mutations were novel. Mutation carriers exhibited no additional mutations in genes MYH7, TNNT2, TNNI3, ACTC and TPM1. Including relatives of twelve families, a total number of 42 mutation carriers was identified of which eleven (26.2% had at least one adverse event. Considering the twelve families and six single patients with mutations, 45 individuals with cardiomyopathy and nine with borderline phenotype were identified. Among the 45 patients, 23 (51.1% suffered from an adverse event. In eleven patients of seven families an unexplained sudden death was reported at the age between 13 and 67 years. Stroke or a transient ischemic attack occurred in six patients of five families. At least one adverse event occurred in eleven of twelve families. Conclusion MYBPC3 mutations can be associated with cardiac events such as progressive heart failure, stroke and sudden death even at younger age. Therefore, patients with MYBPC3 mutations require thorough clinical risk assessment.

  8. Increased conversion of phosphatidylinositol to phosphatidylinositol phosphate in Dictyostelium cells expressing a mutated ras gene

    NARCIS (Netherlands)

    Kaay, Jeroen van der; Draijer, Richard; Haastert, Peter J.M. van

    1990-01-01

    Dictyostelium discoideum cells that overexpress a ras gene with a Gly12 → Thr12 mutation (Dd-ras-Thr12) have an altered phenotype. These cells were labeled with [3H]inositol and the incorporation of radioactivity into inositol 1,4,5-trisphosphate [Ins(1,4,5)P3] was analyzed and found to be higher th

  9. Correlation of a set of gene variants, life events and personality features on adult ADHD severity.

    Science.gov (United States)

    Müller, Daniel J; Chiesa, Alberto; Mandelli, Laura; De Luca, Vincenzo; De Ronchi, Diana; Jain, Umesh; Serretti, Alessandro; Kennedy, James L

    2010-07-01

    Increasing evidence suggests that symptoms of attention deficit hyperactivity disorder (ADHD) could persist into adult life in a substantial proportion of cases. The aim of the present study was to investigate the impact of (1) adverse events, (2) personality traits and (3) genetic variants chosen on the basis of previous findings and (4) their possible interactions on adult ADHD severity. One hundred and ten individuals diagnosed with adult ADHD were evaluated for occurrence of adverse events in childhood and adulthood, and personality traits by the Temperament and Character Inventory (TCI). Common polymorphisms within a set of nine important candidate genes (SLC6A3, DBH, DRD4, DRD5, HTR2A, CHRNA7, BDNF, PRKG1 and TAAR9) were genotyped for each subject. Life events, personality traits and genetic variations were analyzed in relationship to severity of current symptoms, according to the Brown Attention Deficit Disorder Scale (BADDS). Genetic variations were not significantly associated with severity of ADHD symptoms. Life stressors displayed only a minor effect as compared to personality traits. Indeed, symptoms' severity was significantly correlated with the temperamental trait of Harm avoidance and the character trait of Self directedness. The results of the present work are in line with previous evidence of a significant correlation between some personality traits and adult ADHD. However, several limitations such as the small sample size and the exclusion of patients with other severe comorbid psychiatric disorders could have influenced the significance of present findings.

  10. Identifying early events of gene expression in breast cancer with systems biology phylogenetics.

    Science.gov (United States)

    Abu-Asab, M S; Abu-Asab, N; Loffredo, C A; Clarke, R; Amri, H

    2013-01-01

    Advanced omics technologies such as deep sequencing and spectral karyotyping are revealing more of cancer heterogeneity at the genetic, genomic, gene expression, epigenetic, proteomic, and metabolomic levels. With this increasing body of emerging data, the task of data analysis becomes critical for mining and modeling to better understand the relevant underlying biological processes. However, the multiple levels of heterogeneity evident within and among populations, healthy and diseased, complicate the mining and interpretation of biological data, especially when dealing with hundreds to tens of thousands of variables. Heterogeneity occurs in many diseases, such as cancers, autism, macular degeneration, and others. In cancer, heterogeneity has hampered the search for validated biomarkers for early detection, and it has complicated the task of finding clonal (driver) and nonclonal (nonexpanded or passenger) aberrations. We show that subtyping of cancer (classification of specimens) should be an a priori step to the identification of early events of cancers. Studying early events in oncogenesis can be done on histologically normal tissues from diseased individuals (HNTDI), since they most likely have been exposed to the same mutagenic insults that caused the cancer in their neighboring tissues. Polarity assessment of HNTDI data variables by using healthy specimens as outgroup(s), followed by the application of parsimony phylogenetic analysis, produces a hierarchical classification of specimens that reveals the early events of the disease ontogeny within its subtypes as shared derived changes (abnormal changes) or synapomorphies in phylogenetic terminology. Copyright © 2013 S. Karger AG, Basel.

  11. Conversion of the pathogenic fungus Colletotrichum magna to a nonpathogenic, endophytic mutualist by gene disruption

    Science.gov (United States)

    Redman, R.S.; Ranson, J.C.; Rodriguez, R.J.

    1999-01-01

    Hygromycin-resistant transformants of the cucurbit pathogen Colletotrichum magna (teleomorph: Glomerella magna) were generated by restriction enzyme-mediated integration (REMI) transformation. A rapid pathogenicity assay involving watermelon (Citrullus lanatus) seedlings was developed and 14,400 REMI transformants were screened and assessed for their ability to cause disease, colonize plant tissues, and confer disease resistance against wild-type C. magna. A total of 176 nonpathogenic REMI mutants capable of colonizing cucurbit plants were isolated and assigned to three groups based on their ability to confer disease resistance: phenotype A, 80 to 100% disease protection; phenotype B, 10 to 65% disease protection; and phenotype C, 0 to 4% disease protection. Molecular and genetic analyses of one REMI mutant (R1) indicated that the nonpathogenic phenotype A resulted from a single-site integration. R1 showed a 1:1 segregation of hygromycin resistance and nonpathogenicity and all hygromycin-resistant progeny were nonpathogenic. The integrated vector and 5.5 kb of flanking fungal genomic DNA were isolated from R1 and designated pGMR1. To verify that pGMR1 contained pathogenicity gene sequences, a wild-type isolate of C. magna was transformed with pGMR1 to induce gene disruptions by homologous integration. Approximately 47% of the pGMR1 transformants expressed phenotype A, indicating homologous integration and gene disruption.

  12. Extending the evaluation of Genia Event task toward knowledge base construction and comparison to Gene Regulation Ontology task.

    Science.gov (United States)

    Kim, Jin-Dong; Kim, Jung-Jae; Han, Xu; Rebholz-Schuhmann, Dietrich

    2015-01-01

    The third edition of the BioNLP Shared Task was held with the grand theme "knowledge base construction (KB)". The Genia Event (GE) task was re-designed and implemented in light of this theme. For its final report, the participating systems were evaluated from a perspective of annotation. To further explore the grand theme, we extended the evaluation from a perspective of KB construction. Also, the Gene Regulation Ontology (GRO) task was newly introduced in the third edition. The final evaluation of the participating systems resulted in relatively low performance. The reason was attributed to the large size and complex semantic representation of the ontology. To investigate potential benefits of resource exchange between the presumably similar tasks, we measured the overlap between the datasets of the two tasks, and tested whether the dataset for one task can be used to enhance performance on the other. We report an extended evaluation on all the participating systems in the GE task, incoporating a KB perspective. For the evaluation, the final submission of each participant was converted to RDF statements, and evaluated using 8 queries that were formulated in SPARQL. The results suggest that the evaluation may be concluded differently between the two different perspectives, annotation vs. KB. We also provide a comparison of the GE and GRO tasks by converting their datasets into each other's format. More than 90% of the GE data could be converted into the GRO task format, while only half of the GRO data could be mapped to the GE task format. The imbalance in conversion indicates that the GRO is a comprehensive extension of the GE task ontology. We further used the converted GRO data as additional training data for the GE task, which helped improve GE task participant system performance. However, the converted GE data did not help GRO task participants, due to overfitting and the ontology gap.

  13. Fibrinogen gene haplotypes in relation to risk of coronary events and coronary and extracoronary atherosclerosis: the Rotterdam Study.

    Science.gov (United States)

    Kardys, Isabella; Uitterlinden, André G; Hofman, Albert; Witteman, Jacqueline C M; de Maat, Moniek P M

    2007-02-01

    Fibrin network structure has been correlated with coronary disease. Fibrinogen gamma and alpha (FGG and FGA) gene haplotypes (chromosome 4q28) may be associated with fibrin network structure, and thereby with rigidity of the fibrin clot and sensitivity of the fibrin clot to the fibrinolytic system. Through these mechanisms they may influence risk of cardiovascular disease. We set out to investigate the relation between combined fibrinogen FGG and FGA gene haplotypes, representing the common variation of the fibrinogen FGG and FGA genes, coronary events and measures of coronary and extracoronary atherosclerosis. The study was embedded in the Rotterdam Study, a prospective population-based study among men and women aged >or=55 years. Common haplotypes were studied using seven tagging SNPs across a 30-kb region with the FGG and FGA genes. Incident coronary events were registered, and carotid intima-media thickness, carotid plaques, ankle-arm index, aortic calcification and coronary calcification were assessed. Seven haplotypes with frequencies >1% covered 97.5% of the genetic variation. In 5,667 participants without history of coronary heart disease (CHD), 733 CHD cases occurred during a median follow-up time of 11.9 years. Fibrinogen gene haplotypes were not associated with coronary events. Fibrinogen gene haplotypes did not show a consistent association with measures of coronary and extracoronary atherosclerosis. In conclusion, fibrinogen FGG and FGA gene haplotypes are not associated with coronary events, coronary atherosclerosis or extracoronary atherosclerosis. Confirmation of these findings by future population-based studies is warranted.

  14. Complete resequencing of 40 genomes reveals domestication events and genes in silkworm (Bombyx)

    DEFF Research Database (Denmark)

    Xia, Qingyou; Guo, Yiran; Zhang, Ze;

    2009-01-01

    A single-base pair resolution silkworm genetic variation map was constructed from 40 domesticated and wild silkworms, each sequenced to approximately threefold coverage, representing 99.88% of the genome. We identified ~16 million single-nucleotide polymorphisms, many indels, and structural...... variations. We find that the domesticated silkworms are clearly genetically differentiated from the wild ones, but they have maintained large levels of genetic variability, suggesting a short domestication event involving a large number of individuals. We also identified signals of selection at 354 candidate...... genes that may have been important during domestication, some of which have enriched expression in the silk gland, midgut, and testis. These data add to our understanding of the domestication processes and may have applications in devising pest control strategies and advancing the use of silkworms...

  15. Plant gene expression in the age of systems biology: integrating transcriptional and post-transcriptional events.

    Science.gov (United States)

    Belostotsky, Dmitry A; Rose, Alan B

    2005-07-01

    The extensive mechanistic and regulatory interconnections between the various events of mRNA biogenesis are now recognized as a fundamental principle of eukaryotic gene expression, yet the specific details of the coupling between the various steps of mRNA biogenesis do differ, and sometimes dramatically, between the different kingdoms. In this review, we emphasize examples where plants must differ in this respect from other eukaryotes, and highlight a recurring trend of recruiting the conserved, versatile functional modules, which have evolved to support the general mRNA biogenesis reactions, for plant-specific functions. We also argue that elucidating the inner workings of the plant 'mRNA factory' is essential for accomplishing the ambitious goal of building the 'virtual plant'.

  16. Prevention of adverse events of interferon γ gene therapy by gene delivery of interferon γ-heparin-binding domain fusion protein in mice

    Directory of Open Access Journals (Sweden)

    Mitsuru Ando

    2014-01-01

    Full Text Available Sustained gene delivery of interferon (IFN γ can be an effective treatment, but our previous study showed high levels of IFNγ-induced adverse events, including the loss of body weight. These unwanted events could be reduced by target-specific delivery of IFNγ after in vivo gene transfer. To achieve this, we selected the heparin-binding domain (HBD of extracellular superoxide dismutase as a molecule to anchor IFNγ to the cell surface. We designed three IFNγ derivatives, IFNγ-HBD1, IFNγ-HBD2, and IFNγ-HBD3, each of which had 1, 2, or 3 HBDs, respectively. Each plasmid-encoding fusion proteins was delivered to the liver, a model target in this study, by hydrodynamic tail vein injection. The serum concentration of IFNγ-HBD2 and IFNγ-HBD3 after gene delivery was lower than that of IFNγ or IFNγ-HBD1. Gene delivery of IFNγ-HBD2, but not of IFNγ-HBD3, effectively increased the mRNA expression of IFNγ-inducible genes in the liver, suggesting liver-specific distribution of IFNγ-HBD2. Gene delivery of IFNγ-HBD2-suppressed tumor growth in the liver as efficiently as that of IFNγ with much less symptoms of adverse effects. These results indicate that the adverse events of IFNγ gene transfer can be prevented by gene delivery of IFNγ-HBD2, a fusion protein with high cell surface affinity.

  17. Aspirin exposure reveals novel genes associated with platelet function and cardiovascular events.

    Science.gov (United States)

    Voora, Deepak; Cyr, Derek; Lucas, Joseph; Chi, Jen-Tsan; Dungan, Jennifer; McCaffrey, Timothy A; Katz, Richard; Newby, L Kristin; Kraus, William E; Becker, Richard C; Ortel, Thomas L; Ginsburg, Geoffrey S

    2013-10-01

    The aim of this study was to develop ribonucleic acid (RNA) profiles that could serve as novel biomarkers for the response to aspirin. Aspirin reduces death and myocardial infarction (MI), suggesting that aspirin interacts with biological pathways that may underlie these events. Aspirin was administered, followed by whole-blood RNA microarray profiling, in a discovery cohort of healthy volunteers (HV1) (n = 50) and 2 validation cohorts of healthy volunteers (HV2) (n = 53) and outpatient cardiology patients (OPC) (n = 25). Platelet function was assessed using the platelet function score (PFS) in HV1 and HV2 and the VerifyNow Aspirin Test (Accumetrics, Inc., San Diego, California) in OPC. Bayesian sparse factor analysis identified sets of coexpressed transcripts, which were examined for associations with PFS in HV1 and validated in HV2 and OPC. Proteomic analysis confirmed the association of validated transcripts in platelet proteins. Validated gene sets were tested for association with death or MI in 2 patient cohorts (n = 587 total) from RNA samples collected at cardiac catheterization. A set of 60 coexpressed genes named the "aspirin response signature" (ARS) was associated with PFS in HV1 (r = -0.31, p = 0.03), HV2 (r = -0.34, Bonferroni p = 0.03), and OPC (p = 0.046). Corresponding proteins for the 17 ARS genes were identified in the platelet proteome, of which 6 were associated with PFS. The ARS was associated with death or MI in both patient cohorts (odds ratio: 1.2 [p = 0.01]; hazard ratio: 1.5 [p = 0.001]), independent of cardiovascular risk factors. Compared with traditional risk factors, reclassification (net reclassification index = 31% to 37%, p ≤ 0.0002) was improved by including the ARS or 1 of its genes, ITGA2B. RNA profiles of platelet-specific genes are novel biomarkers for identifying patients who do not respond adequately to aspirin and who are at risk for death or MI. Copyright © 2013 American College of Cardiology Foundation. Published by

  18. Reconciling gene and genome duplication events: using multiple nuclear gene families to infer the phylogeny of the aquatic plant family Pontederiaceae.

    Science.gov (United States)

    Ness, Rob W; Graham, Sean W; Barrett, Spencer C H

    2011-11-01

    Most plant phylogenetic inference has used DNA sequence data from the plastid genome. This genome represents a single genealogical sample with no recombination among genes, potentially limiting the resolution of evolutionary relationships in some contexts. In contrast, nuclear DNA is inherently more difficult to employ for phylogeny reconstruction because major mutational events in the genome, including polyploidization, gene duplication, and gene extinction can result in homologous gene copies that are difficult to identify as orthologs or paralogs. Gene tree parsimony (GTP) can be used to infer the rooted species tree by fitting gene genealogies to species trees while simultaneously minimizing the estimated number of duplications needed to reconcile conflicts among them. Here, we use GTP for five nuclear gene families and a previously published plastid data set to reconstruct the phylogenetic backbone of the aquatic plant family Pontederiaceae. Plastid-based phylogenetic studies strongly supported extensive paraphyly of Eichhornia (one of the four major genera) but also depicted considerable ambiguity concerning the true root placement for the family. Our results indicate that species trees inferred from the nuclear genes (alone and in combination with the plastid data) are highly congruent with gene trees inferred from plastid data alone. Consideration of optimal and suboptimal gene tree reconciliations place the root of the family at (or near) a branch leading to the rare and locally restricted E. meyeri. We also explore methods to incorporate uncertainty in individual gene trees during reconciliation by considering their individual bootstrap profiles and relate inferred excesses of gene duplication events on individual branches to whole-genome duplication events inferred for the same branches. Our study improves understanding of the phylogenetic history of Pontederiaceae and also demonstrates the utility of GTP for phylogenetic analysis.

  19. Genesis of the vertebrate FoxP subfamily member genes occurred during two ancestral whole genome duplication events.

    Science.gov (United States)

    Song, Xiaowei; Tang, Yezhong; Wang, Yajun

    2016-08-22

    The vertebrate FoxP subfamily genes play important roles in the construction of essential functional modules involved in physiological and developmental processes. To explore the adaptive evolution of functional modules associated with the FoxP subfamily member genes, it is necessary to study the gene duplication process. We detected four member genes of the FoxP subfamily in sea lampreys (a representative species of jawless vertebrates) through genome screenings and phylogenetic analyses. Reliable paralogons (i.e. paralogous chromosome segments) have rarely been detected in scaffolds of FoxP subfamily member genes in sea lampreys due to the considerable existence of HTH_Tnp_Tc3_2 transposases. However, these transposases did not alter gene numbers of the FoxP subfamily in sea lampreys. The coincidence between the "1-4" gene duplication pattern of FoxP subfamily genes from invertebrates to vertebrates and two rounds of ancestral whole genome duplication (1R- and 2R-WGD) events reveal that the FoxP subfamily of vertebrates was quadruplicated in the 1R- and 2R-WGD events. Furthermore, we deduced that a synchronous gene duplication process occurred for the FoxP subfamily and for three linked gene families/subfamilies (i.e. MIT family, mGluR group III and PLXNA subfamily) in the 1R- and 2R-WGD events using phylogenetic analyses and mirror-dendrogram methods (i.e. algorithms to test protein-protein interactions). Specifically, the ancestor of FoxP1 and FoxP3 and the ancestor of FoxP2 and FoxP4 were generated in 1R-WGD event. In the subsequent 2R-WGD event, these two ancestral genes were changed into FoxP1, FoxP2, FoxP3 and FoxP4. The elucidation of these gene duplication processes shed light on the phylogenetic relationships between functional modules of the FoxP subfamily member genes.

  20. Predictability of conversation partners

    CERN Document Server

    Takaguchi, Taro; Sato, Nobuo; Yano, Kazuo; Masuda, Naoki

    2011-01-01

    Recent developments in sensing technologies have enabled us to examine the nature of human social behavior in greater detail. By applying an information theoretic method to the spatiotemporal data of cell-phone locations, Song et al. (2010) found that human mobility patterns are remarkably predictable. Inspired by their work, we address a similar predictability question in a different kind of human social activity: conversation events. The predictability in the sequence of one's conversation partners is defined as the degree to which one's next conversation partner can be predicted given the current partner. We quantify this predictability by using the mutual information. We examine the predictability of conversation events for each individual using the longitudinal data of face-to-face interactions collected from two company offices in Japan. Each subject wears a name tag equipped with an infrared sensor node, and conversation events are marked when signals are exchanged between close sensor nodes. We find t...

  1. Gene array analysis of neural crest cells identifies transcription factors necessary for direct conversion of embryonic fibroblasts into neural crest cells

    Directory of Open Access Journals (Sweden)

    Tsutomu Motohashi

    2016-03-01

    Full Text Available Neural crest cells (NC cells are multipotent cells that emerge from the edge of the neural folds and migrate throughout the developing embryo. Although the gene regulatory network for generation of NC cells has been elucidated in detail, it has not been revealed which of the factors in the network are pivotal to directing NC identity. In this study we analyzed the gene expression profile of a pure NC subpopulation isolated from Sox10-IRES-Venus mice and investigated whether these genes played a key role in the direct conversion of Sox10-IRES-Venus mouse embryonic fibroblasts (MEFs into NC cells. The comparative molecular profiles of NC cells and neural tube cells in 9.5-day embryos revealed genes including transcription factors selectively expressed in developing trunk NC cells. Among 25 NC cell-specific transcription factor genes tested, SOX10 and SOX9 were capable of converting MEFs into SOX10-positive (SOX10+ cells. The SOX10+ cells were then shown to differentiate into neurons, glial cells, smooth muscle cells, adipocytes and osteoblasts. These SOX10+ cells also showed limited self-renewal ability, suggesting that SOX10 and SOX9 directly converted MEFs into NC cells. Conversely, the remaining transcription factors, including well-known NC cell specifiers, were unable to convert MEFs into SOX10+ NC cells. These results suggest that SOX10 and SOX9 are the key factors necessary for the direct conversion of MEFs into NC cells.

  2. Two genes, rif15 and rif16, of the rifamycin biosynthetic gene cluster in Amycolatopsis mediterranei likely encode a transketolase and a P450 monooxygenase,respectively, both essential for the conversion of rifamycin SV into B

    Institute of Scientific and Technical Information of China (English)

    Hua Yuan; Wei Zhao; Yi Zhong; Jin Wang; Zhongiun Qin; Xiaoming Ding; Guo-Ping Zhao

    2011-01-01

    Amycolatopsis mediterranei produces an important antibiotic rifamycin,the biosynthesis of which involves many unusual modifications.Previous work suggested a putative P450 enzyme encoded by rif16 within the rifamycin biosynthetic gene cluster (rif) was required for the conversion of the intermediate rifamycin SV into the end product rifamycin B.In this study,we genetically proved that a putative transketolase encoded by rif15 is another essential enzyme for this conversion.Expression of merely rif15 and rif16 in a rif cluster null mutant ofA.mediterranei U32 was able to convert rifamycin SV into B.However,this Rifl5- and Rifl6-mediated conversion was only detected in intact cells of A.meidterranei,but not in Streptomyce coelicolor or Mycobacterium smegmatis,suggesting that yet-characterized gene(s) in A.mediterranei other than those encoded by the rif cluster should be involved in this process.

  3. DNA methyl transferase (DNMT gene polymorphisms could be a primary event in epigenetic susceptibility to schizophrenia.

    Directory of Open Access Journals (Sweden)

    Koramannil Radha Saradalekshmi

    Full Text Available DNA methylation has been implicated in the etiopathology of various complex disorders. DNA methyltransferases are involved in maintaining and establishing new methylation patterns. The aim of the present study was to investigate the inherent genetic variations within DNA methyltransferase genes in predisposing to susceptibility to schizophrenia. We screened for polymorphisms in DNA methyltransferases, DNMT1, DNMT3A, DNMT3B and DNMT3L in 330 schizophrenia patients and 302 healthy controls for association with Schizophrenia in south Indian population. These polymorphisms were also tested for subgroup analysis with patient's gender, age of onset and family history. DNMT1 rs2114724 (genotype P = .004, allele P = 0.022 and rs2228611 (genotype P = 0.004, allele P = 0.022 were found to be significantly associated at genotypic and allelic level with Schizophrenia in South Indian population. DNMT3B rs2424932 genotype (P = 0.023 and allele (P = 0.0063 increased the risk of developing schizophrenia in males but not in females. DNMT3B rs1569686 (genotype P = 0.027, allele P = 0.033 was found to be associated with early onset of schizophrenia and also with family history and early onset (genotype P = 0.009. DNMT3L rs2070565 (genotype P = 0.007, allele P = 0.0026 confers an increased risk of developing schizophrenia at an early age in individuals with family history. In-silico prediction indicated functional relevance of these SNPs in regulating the gene. These observations might be crucial in addressing and understanding the genetic control of methylation level differences from ethnic viewpoint. Functional significance of genotype variations within the DNMTs indeed suggest that the genetic nature of methyltransferases should be considered while addressing epigenetic events mediated by methylation in Schizophrenia.

  4. Opossum carboxylesterases: sequences, phylogeny and evidence for CES gene duplication events predating the marsupial-eutherian common ancestor

    Directory of Open Access Journals (Sweden)

    Chan Jeannie

    2008-02-01

    Full Text Available Abstract Background Carboxylesterases (CES perform diverse metabolic roles in mammalian organisms in the detoxification of a broad range of drugs and xenobiotics and may also serve in specific roles in lipid, cholesterol, pheromone and lung surfactant metabolism. Five CES families have been reported in mammals with human CES1 and CES2 the most extensively studied. Here we describe the genetics, expression and phylogeny of CES isozymes in the opossum and report on the sequences and locations of CES1, CES2 and CES6 'like' genes within two gene clusters on chromosome one. We also discuss the likely sequence of gene duplication events generating multiple CES genes during vertebrate evolution. Results We report a cDNA sequence for an opossum CES and present evidence for CES1 and CES2 like genes expressed in opossum liver and intestine and for distinct gene locations of five opossum CES genes,CES1, CES2.1, CES2.2, CES2.3 and CES6, on chromosome 1. Phylogenetic and sequence alignment studies compared the predicted amino acid sequences for opossum CES with those for human, mouse, chicken, frog, salmon and Drosophila CES gene products. Phylogenetic analyses produced congruent phylogenetic trees depicting a rapid early diversification into at least five distinct CES gene family clusters: CES2, CES1, CES7, CES3, and CES6. Molecular divergence estimates based on a Bayesian relaxed clock approach revealed an origin for the five mammalian CES gene families between 328–378 MYA. Conclusion The deduced amino acid sequence for an opossum cDNA was consistent with its identity as a mammalian CES2 gene product (designated CES2.1. Distinct gene locations for opossum CES1 (1: 446,222,550–446,274,850, three CES2 genes (1: 677,773,395–677,927,030 and a CES6 gene (1: 677,585,520–677,730,419 were observed on chromosome 1. Opossum CES1 and multiple CES2 genes were expressed in liver and intestine. Amino acid sequences for opossum CES1 and three CES2 gene products

  5. Low ABCB1 gene expression is an early event in colorectal carcinogenesis.

    Directory of Open Access Journals (Sweden)

    Vibeke Andersen

    Full Text Available The ABCB1/MDR1 gene product ABCB1/P-glycoprotein is implicated in the development of colorectal cancer (CRC. NFKB1 encodes transcription factors regulating expression of a number of genes including ABCB1. We have previously found association between the ABCB1 C-rs3789243-T polymorphism and CRC risk and interactions between the ABCB1 C-rs3789243-T and C3435T polymorphisms and meat intake in relation to CRC risk (Andersen, BMC Cancer, 2009, 9, 407. ABCB1 and NFKB1 mRNA levels were assessed in intestinal tissue from 122 CRC cases, 101 adenoma cases (12 with severe dysplasia, 89 with mild-moderate dysplasia and from 18 healthy individuals, together with gene polymorphisms in ABCB1 and NFKB1. ABCB1 mRNA levels were highest in the healthy individuals and significantly lower in mild/moderate and severe dysplasia tissue (P<0.05 for both, morphologically normal tissues close to the tumour (P<0.05, morphologically normal tissue at a distance from the tumour (P<0.05 and CRC tissue (P<0.001. Furthermore, ABCB1 mRNA levels were lower in adenomas and carcinomas compared to morphologically normal tissue from the same individuals (P<0.01. The ABCB1 C-rs3789243-T and NFKB1 -94ins/del homozygous variant genotypes were associated with low ABCB1 mRNA levels in morphologically normal sigmoid tissue from adenoma cases (P<0.05 for both. NFKB1 mRNA levels were lower in both tumour and normal tissue from cancer patients (P<0.001 as compared to healthy individuals but we were unable to show association between NFKB1 -94ins/del genotype and NFKB1 mRNA levels. This study suggests that low ABCB1 mRNA levels are an early event in CRC development and that the two polymorphisms affect ABCB1 mRNA levels whereas low NFKB1 mRNA levels occur later in carcinogenesis. Low ABCB1 protein levels may promote colorectal carcinogenesis through increasing intracellular exposure to carcinogenic ABCB1 substrates.

  6. Insights into the coupling of duplication events and macroevolution from an age profile of animal transmembrane gene families.

    Directory of Open Access Journals (Sweden)

    Guohui Ding

    2006-08-01

    Full Text Available The evolution of new gene families subsequent to gene duplication may be coupled to the fluctuation of population and environment variables. Based upon that, we presented a systematic analysis of the animal transmembrane gene duplication events on a macroevolutionary scale by integrating the palaeontology repository. The age of duplication events was calculated by maximum likelihood method, and the age distribution was estimated by density histogram and normal kernel density estimation. We showed that the density of the duplicates displays a positive correlation with the estimates of maximum number of cell types of common ancestors, and the oxidation events played a key role in the major transitions of this density trace. Next, we focused on the Phanerozoic phase, during which more macroevolution data are available. The pulse mass extinction timepoints coincide with the local peaks of the age distribution, suggesting that the transmembrane gene duplicates fixed frequently when the environment changed dramatically. Moreover, a 61-million-year cycle is the most possible cycle in this phase by spectral analysis, which is consistent with the cycles recently detected in biodiversity. Our data thus elucidate a strong coupling of duplication events and macroevolution; furthermore, our method also provides a new way to address these questions.

  7. Recombination Rate Variation Modulates Gene Sequence Evolution Mainly via GC-Biased Gene Conversion, Not Hill-Robertson Interference, in an Avian System.

    Science.gov (United States)

    Bolívar, Paulina; Mugal, Carina F; Nater, Alexander; Ellegren, Hans

    2016-01-01

    The ratio of nonsynonymous to synonymous substitution rates (ω) is often used to measure the strength of natural selection. However, ω may be influenced by linkage among different targets of selection, that is, Hill-Robertson interference (HRI), which reduces the efficacy of selection. Recombination modulates the extent of HRI but may also affect ω by means of GC-biased gene conversion (gBGC), a process leading to a preferential fixation of G:C ("strong," S) over A:T ("weak," W) alleles. As HRI and gBGC can have opposing effects on ω, it is essential to understand their relative impact to make proper inferences of ω. We used a model that separately estimated S-to-S, S-to-W, W-to-S, and W-to-W substitution rates in 8,423 avian genes in the Ficedula flycatcher lineage. We found that the W-to-S substitution rate was positively, and the S-to-W rate negatively, correlated with recombination rate, in accordance with gBGC but not predicted by HRI. The W-to-S rate further showed the strongest impact on both dN and dS. However, since the effects were stronger at 4-fold than at 0-fold degenerated sites, likely because the GC content of these sites is farther away from its equilibrium, ω slightly decreases with increasing recombination rate, which could falsely be interpreted as a consequence of HRI. We corroborated this hypothesis analytically and demonstrate that under particular conditions, ω can decrease with increasing recombination rate. Analyses of the site-frequency spectrum showed that W-to-S mutations were skewed toward high, and S-to-W mutations toward low, frequencies, consistent with a prevalent gBGC-driven fixation bias.

  8. A model-based analysis of GC-biased gene conversion in the human and chimpanzee genomes.

    Directory of Open Access Journals (Sweden)

    John A Capra

    Full Text Available GC-biased gene conversion (gBGC is a recombination-associated process that favors the fixation of G/C alleles over A/T alleles. In mammals, gBGC is hypothesized to contribute to variation in GC content, rapidly evolving sequences, and the fixation of deleterious mutations, but its prevalence and general functional consequences remain poorly understood. gBGC is difficult to incorporate into models of molecular evolution and so far has primarily been studied using summary statistics from genomic comparisons. Here, we introduce a new probabilistic model that captures the joint effects of natural selection and gBGC on nucleotide substitution patterns, while allowing for correlations along the genome in these effects. We implemented our model in a computer program, called phastBias, that can accurately detect gBGC tracts about 1 kilobase or longer in simulated sequence alignments. When applied to real primate genome sequences, phastBias predicts gBGC tracts that cover roughly 0.3% of the human and chimpanzee genomes and account for 1.2% of human-chimpanzee nucleotide differences. These tracts fall in clusters, particularly in subtelomeric regions; they are enriched for recombination hotspots and fast-evolving sequences; and they display an ongoing fixation preference for G and C alleles. They are also significantly enriched for disease-associated polymorphisms, suggesting that they contribute to the fixation of deleterious alleles. The gBGC tracts provide a unique window into historical recombination processes along the human and chimpanzee lineages. They supply additional evidence of long-term conservation of megabase-scale recombination rates accompanied by rapid turnover of hotspots. Together, these findings shed new light on the evolutionary, functional, and disease implications of gBGC. The phastBias program and our predicted tracts are freely available.

  9. New CYP2A6 gene deletion and conversion variants in a population of Black African descent.

    Science.gov (United States)

    Mwenifumbo, Jill C; Zhou, Qian; Benowitz, Neal L; Sellers, Edward M; Tyndale, Rachel F

    2010-02-01

    Cytochrome P450 2A6 (CYP2A6) is a human enzyme best known for metabolizing nicotine and nitrosamine precarcinogens. Our aim was to discover and characterize new CYP2A6 alleles in a population of Black African descent. We used cloning, sequencing and genotyping of genomic DNA to discover new variants, and in vivo nicotine pharmacokinetic phenotyping to characterize the functional effect of the new alleles. Four new CYP2A6 alleles, CYP2A6*4G, *4H, *1B4 and *1L, were discovered and characterized in a population of Black African descent. The two new deletion alleles, CYP2A6*4G and *4H, are distinguished by different crossover junctions at 7.9 and 7.8 kb downstream of the CYP2A6 +1ATG start site, respectively; their combined allele frequency is 1.6%. The new gene conversion alleles, CYP2A6*1B4 and CYP2A6*1L, contain 27 and 10 bp of CYP2A7 sequence in the CYP2A6 3 -flanking region, respectively; their combined allele frequency is 7.3%. CYP2A6*4 appears to associate with lower CYP2A6 activity in vivo, while CYP2A6*1L does not; however, CYP2A6*1L confounds genotyping assays that use the 2A6R3 and 2A6R4 primers. As new variants are discovered, the relationships between CYP2A6 genotype, nicotine metabolism, smoking behaviors and tobacco-related cancer risk will be further clarified.

  10. Conversion to Sirolimus Ameliorates Cyclosporine-Induced Nephropathy in the Rat: Focus on Serum, Urine, Gene, and Protein Renal Expression Biomarkers

    Directory of Open Access Journals (Sweden)

    José Sereno

    2014-01-01

    Full Text Available Protocols of conversion from cyclosporin A (CsA to sirolimus (SRL have been widely used in immunotherapy after transplantation to prevent CsA-induced nephropathy, but the molecular mechanisms underlying these protocols remain nuclear. This study aimed to identify the molecular pathways and putative biomarkers of CsA-to-SRL conversion in a rat model. Four animal groups (n=6 were tested during 9 weeks: control, CsA, SRL, and conversion (CsA for 3 weeks followed by SRL for 6 weeks. Classical and emergent serum, urinary, and kidney tissue (gene and protein expression markers were assessed. Renal lesions were analyzed in hematoxylin and eosin, periodic acid-Schiff, and Masson’s trichrome stains. SRL-treated rats presented proteinuria and NGAL (serum and urinary as the best markers of renal impairment. Short CsA treatment presented slight or even absent kidney lesions and TGF-β, NF-κβ, mTOR, PCNA, TP53, KIM-1, and CTGF as relevant gene and protein changes. Prolonged CsA exposure aggravated renal damage, without clear changes on the traditional markers, but with changes in serums TGF-β and IL-7, TBARs clearance, and kidney TGF-β and mTOR. Conversion to SRL prevented CsA-induced renal damage evolution (absent/mild grade lesions, while NGAL (serum versus urine seems to be a feasible biomarker of CsA replacement to SRL.

  11. Conversion to Sirolimus Ameliorates Cyclosporine-Induced Nephropathy in the Rat: Focus on Serum, Urine, Gene, and Protein Renal Expression Biomarkers

    Science.gov (United States)

    Sereno, José; Nunes, Sara; Rodrigues-Santos, Paulo; Rocha-Pereira, Petronila; Fernandes, João; Teixeira, Frederico; Reis, Flávio

    2014-01-01

    Protocols of conversion from cyclosporin A (CsA) to sirolimus (SRL) have been widely used in immunotherapy after transplantation to prevent CsA-induced nephropathy, but the molecular mechanisms underlying these protocols remain nuclear. This study aimed to identify the molecular pathways and putative biomarkers of CsA-to-SRL conversion in a rat model. Four animal groups (n = 6) were tested during 9 weeks: control, CsA, SRL, and conversion (CsA for 3 weeks followed by SRL for 6 weeks). Classical and emergent serum, urinary, and kidney tissue (gene and protein expression) markers were assessed. Renal lesions were analyzed in hematoxylin and eosin, periodic acid-Schiff, and Masson's trichrome stains. SRL-treated rats presented proteinuria and NGAL (serum and urinary) as the best markers of renal impairment. Short CsA treatment presented slight or even absent kidney lesions and TGF-β, NF-κ β, mTOR, PCNA, TP53, KIM-1, and CTGF as relevant gene and protein changes. Prolonged CsA exposure aggravated renal damage, without clear changes on the traditional markers, but with changes in serums TGF-β and IL-7, TBARs clearance, and kidney TGF-β and mTOR. Conversion to SRL prevented CsA-induced renal damage evolution (absent/mild grade lesions), while NGAL (serum versus urine) seems to be a feasible biomarker of CsA replacement to SRL. PMID:24971338

  12. Genome analysis and gene nblA identification of Microcystis aeruginosa myovirus (MaMV-DC) reveal the evidence for horizontal gene transfer events between cyanomyovirus and host.

    Science.gov (United States)

    Ou, Tong; Gao, Xiao-Chan; Li, San-Hua; Zhang, Qi-Ya

    2015-12-01

    The genome sequence, genetic characterization and nblA gene function of Microcystis aeruginosa myovirus isolated from Lake Dianchi in China (MaMV-DC) have been analysed. The genome DNA is 169 223 bp long, with 170 predicted protein-coding genes (001L–170L) and a tRNA gene. About one-sixth of these genes have homologues in the host cyanobacteria M. aeruginosa. The genome carries a gene homologous to host nblA, which encodes a protein involved in the degradation of cyanobacterial phycobilisome. Its expression during MaMV-DC infection was confirmed by reverse transcriptase PCR and Western blot detection and abundant expression was companied by the significant decline of phycocyanin content and massive release of progeny MaMV-DC. In addition, expressing MaMV-DC nblA reduced the phycocyanin peak and the phycocyanin to chlorophyll ratio in model cyanobacteria. These results confirm that horizontal gene transfer events have occurred between cyanobacterial host and cyanomyovirus and suggest that MaMV-DC carrying host-derived genes (such as 005L, that codes for NblA) is responsible for more efficient expression of cyanophage genes and release of progeny cyanophage. This study provides novel insight into the horizontal gene transfer in cyanophage and the interactions between cyanophage and their host.

  13. A Conversation Well Worth Remembering

    Science.gov (United States)

    Woolven-Allen, John

    2009-01-01

    To mark the 200th anniversary of Charles Darwin's birth, a special event was held at Oxford, which included a "Conversation" between Professor Richard Dawkins and Bishop Richard Harries. Here we present a personal reminiscence of the event.

  14. A Conversation Well Worth Remembering

    Science.gov (United States)

    Woolven-Allen, John

    2009-01-01

    To mark the 200th anniversary of Charles Darwin's birth, a special event was held at Oxford, which included a "Conversation" between Professor Richard Dawkins and Bishop Richard Harries. Here we present a personal reminiscence of the event.

  15. Epigenetic Genes and Emotional Reactivity to Daily Life Events : A Multi-Step Gene-Environment Interaction Study

    NARCIS (Netherlands)

    Pishva, Ehsan; Drukker, Marjan; Viechtbauer, Wolfgang; Decoster, Jeroen; Collip, Dina; van Winkel, Ruud; Wichers, Marieke; Jacobs, Nele; Thiery, Evert; Derom, Catherine; Geschwind, Nicole; van den Hove, Daniel; Lataster, Tineke; Myin-Germeys, Inez; van Os, Jim; Rutten, Bart P. F.; Kenis, Gunter

    2014-01-01

    Recent human and animal studies suggest that epigenetic mechanisms mediate the impact of environment on development of mental disorders. Therefore, we hypothesized that polymorphisms in epigenetic-regulatory genes impact stress-induced emotional changes. A multi-step, multi-sample gene-environment i

  16. Conversational Dominance.

    Science.gov (United States)

    Esau, Helmut; Poth, Annette

    Details of conversational behavior can often not be interpreted until the social interaction, including the rights and obligations of the participants, their intent, the topic, etc., has been defined. This paper presents a model of conversation in which the conversational image a person presents in a given conversational situation is a function of…

  17. Cheetahs have 4 serum amyloid a genes evolved through repeated duplication events.

    Science.gov (United States)

    Chen, Lei; Une, Yumi; Higuchi, Keiichi; Mori, Masayuki

    2012-01-01

    Amyloid A (AA) amyloidosis is a leading cause of mortality in captive cheetahs (Acinonyx jubatus). We performed genome walking and PCR cloning and revealed that cheetahs have 4 SAA genes (provisionally named SAA1A, SAA1B, SAA3A, and SAA3B). In addition, we identified multiple nucleotide polymorphisms in the 4 SAA genes by screening 51 cheetahs. The polymorphisms defined 4, 7, 6, and 4 alleles for SAA1A, SAA3A, SAA1B, and SAA3B, respectively. Pedigree analysis of the inheritance of genotypes for the SAA genes revealed that specific combinations of alleles for the 4 SAA genes cosegregated as a unit (haplotype) in pedigrees, indicating that the 4 genes were linked on the same chromosome. Notably, cheetah SAA1A and SAA1B were highly homologous in their nucleotide sequences. Likewise, SAA3A and SAA3B genes were homologous. These observations suggested a model for the evolution of the 4 SAA genes in cheetahs in which duplication of an ancestral SAA gene first gave rise to SAA1 and SAA3. Subsequently, each gene duplicated one more time, uniquely making 4 genes in the cheetah genome. The monomorphism of the cheetah SAA1A protein might be one of the factors responsible for the high incidence of AA amyloidosis in this species.

  18. Tandem Duplication Events in the Expansion of the Small Heat Shock Protein Gene Family in Solanum lycopersicum (cv. Heinz 1706)

    Science.gov (United States)

    Krsticevic, Flavia J.; Arce, Débora P.; Ezpeleta, Joaquín; Tapia, Elizabeth

    2016-01-01

    In plants, fruit maturation and oxidative stress can induce small heat shock protein (sHSP) synthesis to maintain cellular homeostasis. Although the tomato reference genome was published in 2012, the actual number and functionality of sHSP genes remain unknown. Using a transcriptomic (RNA-seq) and evolutionary genomic approach, putative sHSP genes in the Solanum lycopersicum (cv. Heinz 1706) genome were investigated. A sHSP gene family of 33 members was established. Remarkably, roughly half of the members of this family can be explained by nine independent tandem duplication events that determined, evolutionarily, their functional fates. Within a mitochondrial class subfamily, only one duplicated member, Solyc08g078700, retained its ancestral chaperone function, while the others, Solyc08g078710 and Solyc08g078720, likely degenerated under neutrality and lack ancestral chaperone function. Functional conservation occurred within a cytosolic class I subfamily, whose four members, Solyc06g076570, Solyc06g076560, Solyc06g076540, and Solyc06g076520, support ∼57% of the total sHSP RNAm in the red ripe fruit. Subfunctionalization occurred within a new subfamily, whose two members, Solyc04g082720 and Solyc04g082740, show heterogeneous differential expression profiles during fruit ripening. These findings, involving the birth/death of some genes or the preferential/plastic expression of some others during fruit ripening, highlight the importance of tandem duplication events in the expansion of the sHSP gene family in the tomato genome. Despite its evolutionary diversity, the sHSP gene family in the tomato genome seems to be endowed with a core set of four homeostasis genes: Solyc05g014280, Solyc03g082420, Solyc11g020330, and Solyc06g076560, which appear to provide a baseline protection during both fruit ripening and heat shock stress in different tomato tissues. PMID:27565886

  19. Tandem Duplication Events in the Expansion of the Small Heat Shock Protein Gene Family in Solanum lycopersicum (cv. Heinz 1706

    Directory of Open Access Journals (Sweden)

    Flavia J. Krsticevic

    2016-10-01

    Full Text Available In plants, fruit maturation and oxidative stress can induce small heat shock protein (sHSP synthesis to maintain cellular homeostasis. Although the tomato reference genome was published in 2012, the actual number and functionality of sHSP genes remain unknown. Using a transcriptomic (RNA-seq and evolutionary genomic approach, putative sHSP genes in the Solanum lycopersicum (cv. Heinz 1706 genome were investigated. A sHSP gene family of 33 members was established. Remarkably, roughly half of the members of this family can be explained by nine independent tandem duplication events that determined, evolutionarily, their functional fates. Within a mitochondrial class subfamily, only one duplicated member, Solyc08g078700, retained its ancestral chaperone function, while the others, Solyc08g078710 and Solyc08g078720, likely degenerated under neutrality and lack ancestral chaperone function. Functional conservation occurred within a cytosolic class I subfamily, whose four members, Solyc06g076570, Solyc06g076560, Solyc06g076540, and Solyc06g076520, support ∼57% of the total sHSP RNAm in the red ripe fruit. Subfunctionalization occurred within a new subfamily, whose two members, Solyc04g082720 and Solyc04g082740, show heterogeneous differential expression profiles during fruit ripening. These findings, involving the birth/death of some genes or the preferential/plastic expression of some others during fruit ripening, highlight the importance of tandem duplication events in the expansion of the sHSP gene family in the tomato genome. Despite its evolutionary diversity, the sHSP gene family in the tomato genome seems to be endowed with a core set of four homeostasis genes: Solyc05g014280, Solyc03g082420, Solyc11g020330, and Solyc06g076560, which appear to provide a baseline protection during both fruit ripening and heat shock stress in different tomato tissues.

  20. A genome landscape of SRSF3-regulated splicing events and gene expression in human osteosarcoma U2OS cells.

    Science.gov (United States)

    Ajiro, Masahiko; Jia, Rong; Yang, Yanqin; Zhu, Jun; Zheng, Zhi-Ming

    2016-02-29

    Alternative RNA splicing is an essential process to yield proteomic diversity in eukaryotic cells, and aberrant splicing is often associated with numerous human diseases and cancers. We recently described serine/arginine-rich splicing factor 3 (SRSF3 or SRp20) being a proto-oncogene. However, the SRSF3-regulated splicing events responsible for its oncogenic activities remain largely unknown. By global profiling of the SRSF3-regulated splicing events in human osteosarcoma U2OS cells, we found that SRSF3 regulates the expression of 60 genes including ERRFI1, ANXA1 and TGFB2, and 182 splicing events in 164 genes, including EP300, PUS3, CLINT1, PKP4, KIF23, CHK1, SMC2, CKLF, MAP4, MBNL1, MELK, DDX5, PABPC1, MAP4K4, Sp1 and SRSF1, which are primarily associated with cell proliferation or cell cycle. Two SRSF3-binding motifs, CCAGC(G)C and A(G)CAGCA, are enriched to the alternative exons. An SRSF3-binding site in the EP300 exon 14 is essential for exon 14 inclusion. We found that the expression of SRSF1 and SRSF3 are mutually dependent and coexpressed in normal and tumor tissues/cells. SRSF3 also significantly regulates the expression of at least 20 miRNAs, including a subset of oncogenic or tumor suppressive miRNAs. These data indicate that SRSF3 affects a global change of gene expression to maintain cell homeostasis.

  1. Conversion disorder

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000954.htm Conversion disorder To use the sharing features on this page, please enable JavaScript. Conversion disorder is a mental condition in which a person ...

  2. Evolution of GHF5 endoglucanase gene structure in plant-parasitic nematodes: no evidence for an early domain shuffling event

    Directory of Open Access Journals (Sweden)

    Gheysen Godelieve

    2008-11-01

    PPN GHF5 endoglucanase gene most probably consisted of the whole gene cassette, i.e. the GHF5 catalytic domain and the CBM2, rather than that it evolved by domain shuffling. Our evolutionary model for the gene structure in PPN GHF5 endoglucanases implies the occurrence of an early duplication event, and more recent gene duplications at genus or species level.

  3. The Influence of Major Life Events on Economic Attitudes in a World of Gene-Environment Interplay

    Science.gov (United States)

    Hatemi, Peter K.

    2014-01-01

    The role of “genes” on political attitudes has gained attention across disciplines. However, person-specific experiences have yet to be incorporated into models that consider genetic influences. Relying on a gene-environment interplay approach, this study explicates how life-events, such as losing one’s job or suffering a financial loss, influence economic policy attitudes. The results indicate genetic and environmental variance on support for unions, immigration, capitalism, socialism and property tax is moderated by financial risks. Changes in the magnitude of genetic influences, however, are temporary. After two years, the phenotypic effects of the life events remain on most attitudes, but changes in the sources of individual differences do not. Univariate twin models that estimate the independent contributions of genes and environment on the variation of attitudes appear to provide robust baseline indicators of sources of individual differences. These estimates, however, are not event or day specific. In this way, genetic influences add stability, while environment cues change, and this process is continually updated. PMID:24860199

  4. Homologous and homeologous intermolecular gene conversion are not differentially affected by mutations in the DNA damage or the mismatch repair genes RAD1, RAD50, RAD51, RAD52, RAD54, PMS1 and MSH2

    Energy Technology Data Exchange (ETDEWEB)

    Porter, G.; Westmoreland, J.; Priebe, S. [National Institute of Environmental Health Sciences, Research Triangle Park, NC (United States)] [and others

    1996-06-01

    Mismatch repair (MMR) genes or genes involved in both DNA damage repair and homologous recombination might affect homeologous vs. homologous recombination differentially. Spontaneous mitotic gene conversion between a chromosome and a homologous or homeologous donor sequence (14% diverged) on a single copy plasmid was examined in wild-type Saccharomyces cerevisiae strains and in MMR or DNA damage repair mutants. Homologous recombination in rad51, rad52 and rad54 mutants was considerably reduced, while there was little effect of rad1, rad50, pms1 and msh2 null mutations. DNA divergence resulted in no differential effect on recombination rates in the wild type or the mutants; there was only a five- to 10-fold reduction in homeologous relative to homologous recombination regardless of background. Since DNA divergence is known to affect recombination in some systems, we propose that differences in the role of MMR depends on the mode of recombination and/or the level of divergence. Based on analysis of the recombination breakpoints, there is a minimum of three homologous bases required at a recombination junction. A comparison of Rad{sup +} vs. rad52 strains revealed that while all conversion tracts are continuous, elimination of RAD52 leads to the appearance of a novel class of very short conversion tracts. 67 refs., 5 figs., 4 tabs.

  5. Experimental evidence validating the computational inference of functional associations from gene fusion events: a critical survey.

    Science.gov (United States)

    Promponas, Vasilis J; Ouzounis, Christos A; Iliopoulos, Ioannis

    2014-05-01

    More than a decade ago, a number of methods were proposed for the inference of protein interactions, using whole-genome information from gene clusters, gene fusions and phylogenetic profiles. This structural and evolutionary view of entire genomes has provided a valuable approach for the functional characterization of proteins, especially those without sequence similarity to proteins of known function. Furthermore, this view has raised the real possibility to detect functional associations of genes and their corresponding proteins for any entire genome sequence. Yet, despite these exciting developments, there have been relatively few cases of real use of these methods outside the computational biology field, as reflected from citation analysis. These methods have the potential to be used in high-throughput experimental settings in functional genomics and proteomics to validate results with very high accuracy and good coverage. In this critical survey, we provide a comprehensive overview of 30 most prominent examples of single pairwise protein interaction cases in small-scale studies, where protein interactions have either been detected by gene fusion or yielded additional, corroborating evidence from biochemical observations. Our conclusion is that with the derivation of a validated gold-standard corpus and better data integration with big experiments, gene fusion detection can truly become a valuable tool for large-scale experimental biology.

  6. Robert M. Gagne and M. David Merrill: In Conversation. No. 5: A Comparison of Robert M. Gagne's Events of Instruction and M. David Merrill's Component Display Theory.

    Science.gov (United States)

    Twitchell, David, Ed.

    1990-01-01

    This fifth in a series of edited transcripts based on a conference at Utah State University compares elements in Gagne's Events of Instruction with Merrill's Component Display Theory (CDT). Topics discussed include presenting objectives to the student; prior learning; stimulus and guidance; and presentation forms. (six references) (LRW)

  7. Low ABCB1 gene expression is an early event in colorectal carcinogenesis

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Vogel, Ulla Birgitte; Godiksen, Sine

    2013-01-01

    The ABCB1/MDR1 gene product ABCB1/P-glycoprotein is implicated in the development of colorectal cancer (CRC). NFKB1 encodes transcription factors regulating expression of a number of genes including ABCB1. We have previously found association between the ABCB1 C-rs3789243-T polymorphism and CRC...... risk and interactions between the ABCB1 C-rs3789243-T and C3435T polymorphisms and meat intake in relation to CRC risk (Andersen, BMC Cancer, 2009, 9, 407). ABCB1 and NFKB1 mRNA levels were assessed in intestinal tissue from 122 CRC cases, 101 adenoma cases (12 with severe dysplasia, 89 with mild......-moderate dysplasia) and from 18 healthy individuals, together with gene polymorphisms in ABCB1 and NFKB1. ABCB1 mRNA levels were highest in the healthy individuals and significantly lower in mild/moderate and severe dysplasia tissue (P...

  8. Comparative genomics study of polyhydroxyalkanoates (PHA and ectoine relevant genes from Halomonas sp. TD01 revealed extensive horizontal gene transfer events and co-evolutionary relationships

    Directory of Open Access Journals (Sweden)

    Cai Lei

    2011-11-01

    Full Text Available Abstract Background Halophilic bacteria have shown their significance in industrial production of polyhydroxyalkanoates (PHA and are gaining more attention for genetic engineering modification. Yet, little information on the genomics and PHA related genes from halophilic bacteria have been disclosed so far. Results The draft genome of moderately halophilic bacterium, Halomonas sp. TD01, a strain of great potential for industrial production of short-chain-length polyhydroxyalkanoates (PHA, was analyzed through computational methods to reveal the osmoregulation mechanism and the evolutionary relationship of the enzymes relevant to PHA and ectoine syntheses. Genes involved in the metabolism of PHA and osmolytes were annotated and studied in silico. Although PHA synthase, depolymerase, regulator/repressor and phasin were all involved in PHA metabolic pathways, they demonstrated different horizontal gene transfer (HGT events between the genomes of different strains. In contrast, co-occurrence of ectoine genes in the same genome was more frequently observed, and ectoine genes were more likely under coincidental horizontal gene transfer than PHA related genes. In addition, the adjacent organization of the homologues of PHA synthase phaC1 and PHA granule binding protein phaP was conserved in the strain TD01, which was also observed in some halophiles and non-halophiles exclusively from γ-proteobacteria. In contrast to haloarchaea, the proteome of Halomonas sp. TD01 did not show obvious inclination towards acidity relative to non-halophilic Escherichia coli MG1655, which signified that Halomonas sp. TD01 preferred the accumulation of organic osmolytes to ions in order to balance the intracellular osmotic pressure with the environment. Conclusions The accessibility of genome information would facilitate research on the genetic engineering of halophilic bacteria including Halomonas sp. TD01.

  9. Analysis of the relationship between longitudinal gene expressions and ordered categorical event data

    OpenAIRE

    Rajicic, Natasa; Finkelstein, Dianne M; Schoenfeld, David A.

    2009-01-01

    The NIH project ”Inflammatory and Host Response to Injury” (Glue) is being conducted to study the changes in the body over time in response to trauma and burn. Patients are monitored for changes in their clinical status, such as the onset of and recovery from organ failure. Blood samples are drawn over the first days and weeks after the injury to obtain gene expression levels over time. Our goal was to develop a method of selecting genes that differentially expressed in pati...

  10. Independent stratum formation on the avian sex chromosomes reveals inter-chromosomal gene conversion and predominance of purifying selection on the W chromosome.

    Science.gov (United States)

    Wright, Alison E; Harrison, Peter W; Montgomery, Stephen H; Pointer, Marie A; Mank, Judith E

    2014-11-01

    We used a comparative approach spanning three species and 90 million years to study the evolutionary history of the avian sex chromosomes. Using whole transcriptomes, we assembled the largest cross-species dataset of W-linked coding content to date. Our results show that recombination suppression in large portions of the avian sex chromosomes has evolved independently, and that long-term sex chromosome divergence is consistent with repeated and independent inversions spreading progressively to restrict recombination. In contrast, over short-term periods we observe heterogeneous and locus-specific divergence. We also uncover four instances of gene conversion between both highly diverged and recently evolved gametologs, suggesting a complex mosaic of recombination suppression across the sex chromosomes. Lastly, evidence from 16 gametologs reveal that the W chromosome is evolving with a significant contribution of purifying selection, consistent with previous findings that W-linked genes play an important role in encoding sex-specific fitness.

  11. Genome-wide study of gene variants associated with differential cardiovascular event reduction by pravastatin therapy.

    Directory of Open Access Journals (Sweden)

    Dov Shiffman

    Full Text Available Statin therapy reduces the risk of coronary heart disease (CHD, however, the person-to-person variability in response to statin therapy is not well understood. We have investigated the effect of genetic variation on the reduction of CHD events by pravastatin. First, we conducted a genome-wide association study of 682 CHD cases from the Cholesterol and Recurrent Events (CARE trial and 383 CHD cases from the West of Scotland Coronary Prevention Study (WOSCOPS, two randomized, placebo-controlled studies of pravastatin. In a combined case-only analysis, 79 single nucleotide polymorphisms (SNPs were associated with differential CHD event reduction by pravastatin according to genotype (P<0.0001, and these SNPs were analyzed in a second stage that included cases as well as non-cases from CARE and WOSCOPS and patients from the PROspective Study of Pravastatin in the Elderly at Risk/PHArmacogenomic study of Statins in the Elderly at risk for cardiovascular disease (PROSPER/PHASE, a randomized placebo controlled study of pravastatin in the elderly. We found that one of these SNPs (rs13279522 was associated with differential CHD event reduction by pravastatin therapy in all 3 studies: P = 0.002 in CARE, P = 0.01 in WOSCOPS, P = 0.002 in PROSPER/PHASE. In a combined analysis of CARE, WOSCOPS, and PROSPER/PHASE, the hazard ratio for CHD when comparing pravastatin with placebo decreased by a factor of 0.63 (95% CI: 0.52 to 0.75 for each extra copy of the minor allele (P = 4.8 × 10(-7. This SNP is located in DnaJ homolog subfamily C member 5B (DNAJC5B and merits investigation in additional randomized studies of pravastatin and other statins.

  12. Postnatal events in intestinal gene expression and splenic cell composition is altered in NOD mice

    DEFF Research Database (Denmark)

    Damlund, Dina Silke Malling; Metzdorff, Stine Broeng; Kristensen, Matilde Bylov

    2013-01-01

    , cellular composition in spleen and liver. At PND1 and 2, the number of Ly-6G and CD11b positive cells in NOD mice was significantly (p=0.05) higher as compared to C57/bl6. Furthermore, gene expression analyses of liver, spleen and intestine showed differences between the two mouse strains in the early...

  13. Gene cloning of an efficiency oleate hydratase from Stenotrophomonas nitritireducens for polyunsaturated fatty acids and its application in the conversion of plant oils to 10-hydroxy fatty acids.

    Science.gov (United States)

    Kang, Woo-Ri; Seo, Min-Ju; Shin, Kyung-Chul; Park, Jin-Byung; Oh, Deok-Kun

    2017-01-01

    Hydroxy fatty acids are used as precursors of lactones and dicarboxylic acids, as starting materials of polymers, and as additives in coatings and paintings. Stenotrophomonas nitritireducens efficiently converts cis-9 polyunsaturated fatty acids (PUFAs) to 10-hydroxy fatty acids. However, gene encoding enzyme involved in this conversion has not been identified to date. We purified a putative fatty acid double-bond hydratase from S. nitritireducens by ultrafiltration and HiPrep DEAE FF and Resource Q ion exchange chromatographies. Peptide sequences of the purified enzyme were obtained by liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) analysis. Sequence of the partial gene encoding this putative fatty acid double-bond hydratase was determined by degenerate polymerase chain reaction (PCR) based on the peptide sequences. The remaining gene sequence was identified by rapid amplification of cDNA ends using cDNA of S. nitritireducens as a template, and the full-length gene was cloned subsequently. The expressed enzyme was identified as an oleate hydratase by determining its kinetic parameters toward unsaturated fatty acids. S. nitritireducens oleate hydratase showed higher activity toward PUFAs compared with other available oleate hydratases. This suggested that the enzyme could be used effectively to convert plant oils to 10-hydroxy fatty acids because these oils contained unsaturated fatty acids such as oleic acid (OA) and linoleic acid (LA) and PUFAs such as α-linolenic acid and/or γ-linolenic acid. The enzyme converted soybean oil and perilla seed oil hydrolyzates containing 10 mM total unsaturated fatty acids, including OA, LA, and ALA, to 8.87 and 8.70 mM total 10-hydroxy fatty acids, respectively, in 240 min. To our knowledge, this is the first study on the biotechnological conversion of PUFA-containing oils to hydroxy fatty acids. Biotechnol. Bioeng. 2017;114: 74-82. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. Allelic loss of the ING gene family loci is a frequent event in ameloblastoma.

    Science.gov (United States)

    Borkosky, Silvia S; Gunduz, Mehmet; Beder, Levent; Tsujigiwa, Hidetsugu; Tamamura, Ryo; Gunduz, Esra; Katase, Naoki; Rodriguez, Andrea P; Sasaki, Akira; Nagai, Noriyuki; Nagatsuka, Hitoshi

    2010-01-01

    Ameloblastoma is the most frequently encountered odontogenic tumor, characterized by a locally invasive behavior, frequent recurrences, and, although rare, metastatic capacity. Loss or inactivation of tumor suppressor genes (TSGs) allows cells to acquire neoplastic growth. The ING family proteins are tumor suppressors that physically and functionally interact with p53 to perform important roles in apoptosis, DNA repair, cell cycle regulation, and senescence. TP53 genetic alterations were reported to infrequently occur in ameloblastoma. Considering that other TSGs related to TP53 could be altered in this tumor, we focused our study on the ING family genes. We analyzed the loss of heterozygosity (LOH) status of the ING family (ING1-ING5) chromosomal loci in a group of ameloblastomas by microsatellite analysis, and correlated the ING LOH status with clinicopathological characteristics. By using specific microsatellite markers, high frequency of LOH was found at the loci of each ING gene family member (33.3-72.2%). A significant relationship was shown between LOH of D2S 140 (ING5 locus) and solid tumor type (p = 0.02). LOH of ING3MS (ING3 locus) was also high in solid type tumors, showing a near significant association. In addition, a notable tendency toward higher LOH for half of the markers was observed in recurrent cases. LOH of ING family genes appears as a common genetic alteration in solid ameloblastoma. The current study provides interesting novel information regarding the potential prognostic significance of the allelic loss of the ING gene family loci in ameloblastoma tumorigenesis.

  15. Prevalence of enterococcus species and their virulence genes in fresh water prior to and after storm events.

    Science.gov (United States)

    Sidhu, J P S; Skelly, E; Hodgers, L; Ahmed, W; Li, Y; Toze, S

    2014-01-01

    Enterococcus spp. isolates (n = 286) collected from six surface water bodies in subtropical Brisbane, Australia, prior to and after storm events, were identified to species level and tested for the presence of seven clinically important virulence genes (VGs). Enterococcus faecalis (48%), Enterococcus faecium (14%), Enterococcus mundtii (13%), and Enterococcus casseliflavus (13%) were frequently detected at all sites. The frequency of E. faecium occurrence increased from 6% in the dry period to 18% after the wet period. The endocarditis antigen (efaA), gelatinase (gelE), collagen-binding protein (ace), and aggregation substance (asa1) were detected in 61%, 43%, 43%, and 23% of Enterococcus isolates, respectively. The chances of occurrence of ace, gelE, efaA, and asa1 genes in E. faecalis were found to be much higher compared to the other Enterococcus spp. The observed odds ratio of occurrence of ace and gelE genes in E. faecalis was much higher at 7.96 and 6.40 times, respectively. The hyl gene was 3.84 times more likely to be detected in E. casseliflavus. The presence of multiple VGs in most of the E. faecalis isolates underscores the importance of E. faecalis as a reservoir of VGs in the fresh water aquatic environment. Consequently, if contaminated surface water is to be used for production of potable and nonpotable water some degree of treatment depending upon intended use such as detention in basins prior to use or chlorination is required.

  16. Drug-resistant gene based genotyping for Acinetobacter baumannii in tracing epidemiological events and for clinical treatment within nosocomial settings

    Institute of Scientific and Technical Information of China (English)

    JIN Hui; XU Xiao-min; MI Zu-huang; MOU Yi; LIU Pei

    2009-01-01

    Background Acinetobacter baumannfi has emerged as an important pathogen related to serious infections and nosocomial outbreaks around the world. However, of the frequently used methods, pulsed-field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) in Acinetobacter baumannii genotyping lack the direct molecular proof of drug resistance. This study was conducted to establish a typing method based on drug resistant gene identification in contrast to traditional PFGE and AFLP in the period of nosocomial epidemic or outbreak.Methods From January 2005 to October 2005, twenty-seven strains of Acinetobacter species from Intensive Care Units, the Second Affiliated Hospital in Ningbo were isolated, including both epidemic and sporadic events. Susceptibility test, PFGE, AFLP and drug resistance gene typing (DRGT) were carded out to confirm the drug resistance and analyze the genotyping, respectively. PFGE was used as a reference to evaluate the typeability of DRGT and AFLP.Results Twenty-seven strains of Acinetobacter displayed multiple antibiotic resistance and drug resistant genes, and β-lactamase genes were detected in 85.2% strains. The result of DRGT was comparable to PFGE in Acinetobacter strains with different drug resistance though a little difference existed, and even suggested a molecular evolution course of different drug-resistant strains. AFLP showed great polymorphism between strains and had weak ability in distinguishing the drug resistance.Conclusion Compared to AFLP and PFGE, DRGT is useful to analyze localized molecular epidemiology of nosocomial infections and outbreaks, which would benefit clinical diagnosis and therapy.

  17. [Mutations of APOC3 gene, metabolism of triglycerides and reduction of ischemic cardiovascular events].

    Science.gov (United States)

    Pirillo, Angela; Catapano, Alberico Luigi

    2015-05-01

    A direct relationship between high plasma triglyceride (TG) levels and increased risk of cardiovascular disease has been shown in several studies. TG are present in the blood associated with different lipoprotein classes, including hepatically-derived very low density lipoproteins (VLDL) and intestinally-derived chylomicrons. Lipoprotein lipase (LPL) is a key enzyme that hydrolyzes TG, releasing free fatty acids that accumulate in peripheral tissues and remnant lipoproteins, that are then cleared by the liver. LPL activity is finely modulated by several cofactors, including apolipoprotein C-III (apoC-III) which acts as a LPL inhibitor. The key role of apoCIII has been established in several studies: animal models lacking APOC3 gene exhibit reduced plasma TG levels, whereas the overexpression of APOC3 gene led to increased TG levels. In humans, several mutations in APOC3 gene have been identified, leading to lower apoC-III levels and associated with reduced plasma TG levels. Recently, these mutations were found to be associated with a reduced risk for cardiovascular ischemia and coronary heart disease, thus confirming the negative role of apoC-III in TG metabolism and suggesting apoC-III as possible therapeutic target for the management of hypertriglyceridemia.

  18. Perinucleolar relocalization and nucleolin as crucial events in the transcriptional activation of key genes in mantle cell lymphoma.

    Science.gov (United States)

    Allinne, Jeanne; Pichugin, Andrei; Iarovaia, Olga; Klibi, Manel; Barat, Ana; Zlotek-Zlotkiewicz, Ewa; Markozashvili, Diana; Petrova, Natalia; Camara-Clayette, Valérie; Ioudinkova, Elena; Wiels, Joëlle; Razin, Sergey V; Ribrag, Vincent; Lipinski, Marc; Vassetzky, Yegor S

    2014-03-27

    In mantle cell lymphoma (MCL), one allele of the cyclin D1 (Ccnd1) gene is translocated from its normal localization on chromosome 11 to chromosome 14. This is considered as the crucial event in the transformation process of a normal naive B-cell; however, the actual molecular mechanism leading to Ccnd1 activation remains to be deciphered. Using a combination of three-dimensional and immuno-fluorescence in situ hybridization experiments, the radial position of the 2 Ccnd1 alleles was investigated in MCL-derived cell lines and malignant cells from affected patients. The translocated Ccnd1 allele was observed significantly more distant from the nuclear membrane than its nontranslocated counterpart, with a very high proportion of IgH-Ccnd1 chromosomal segments localized next to a nucleolus. These perinucleolar areas were found to contain active RNA polymerase II (PolII) clusters. Nucleoli are rich in nucleolin, a potent transcription factor that we found to bind sites within the Ccnd1 gene specifically in MCL cells and to activate Ccnd1 transcription. We propose that the Ccnd1 transcriptional activation in MCL cells relates to the repositioning of the rearranged IgH-Ccnd1-carrying chromosomal segment in a nuclear territory with abundant nucleolin and active PolII molecules. Similar transforming events could occur in Burkitt and other B-cell lymphomas.

  19. Paralogous gene conversion, allelic divergence of attacin genes and its expression profile in response to BmNPV infection in silkworm Bombyx mori

    Directory of Open Access Journals (Sweden)

    G Lekha

    2015-08-01

    Full Text Available The genomic organization, structure and polymorphism of attacin gene within the mulberry silkworm Bombyx mori strains have been analyzed. Genomic contig (AADK01007556 of B. mori attacin gene contains locus with two transcribed basic attacin genes, which were designated as attacin I and attacin II. Survey of the naturally occurring genetic variation in different strains of silkworm B. mori at the promoter and coding regions of two attacin genes revealed high levels of silent nucleotide variations (1- 4 % per nucleotide heterozygosity without polymorphism at the amino acid level (nonSynonymous substitution. We also investigated variations in gene expression of attacin I and attacin II in silkworm B. mori infected with nucleopolyhedrovirus (BmNPV. Two B. mori strains, Sarupat, CSR-2 which were resistant and susceptible to BmNPV infection respectively were used in this study. Expression profiles of B. mori genes were analyzed using microarray technique and results revealed that the immune response genes including attacin were selectively up regulated in virus invaded midguts of both races. Microarray data and real-time qPCR results revealed that attacin I gene was significantly up-regulated in the midgut of Sarupat following BmNPV infection, indicating its specific role in the anti-viral response. Our results imply that these up-regulated attacin genes were not only involved in anti-bacterial mechanism, but are also involved in B. mori immune response against BmNPV infection.

  20. Catechol-o-methyltransferase gene polymorphism modifies the effect of coffee intake on incidence of acute coronary events.

    Directory of Open Access Journals (Sweden)

    Pertti Happonen

    Full Text Available BACKGROUND: The role of coffee intake as a risk factor for coronary heart disease (CHD has been debated for decades. We examined whether the relationship between coffee intake and incidence of CHD events is dependent on the metabolism of circulating catecholamines, as determined by functional polymorphism of the catechol-O-methyltransferase (COMT gene. METHODOLOGY/PRINCIPAL FINDINGS: In a cohort of 773 men who were 42 to 60 years old and free of symptomatic CHD at baseline in 1984-89, 78 participants experienced an acute coronary event during an average follow-up of 13 years. In logistic regression adjusting for age, smoking, family history of CHD, vitamin C deficiency, blood pressure, plasma cholesterol concentration, and diabetes, the odds ratio (90% confidence interval comparing heavy coffee drinkers with the low activity COMT genotype with those with the high activity or heterozygotic genotypes was 3.2 (1.2-8.4. Urinary adrenaline excretion increased with increasing coffee intake, being over two-fold in heavy drinkers compared with nondrinkers (p = 0.008 for trend. CONCLUSIONS/SIGNIFICANCE: Heavy coffee consumption increases the incidence of acute coronary events in men with low but not high COMT activity. Further studies are required to determine to which extent circulating catecholamines mediate the relationship between coffee intake and CHD.

  1. Targeted delivery of Bcl-2 conversion gene by MPEG-PCL-PEI-FA cationic copolymer to combat therapeutic resistant cancer.

    Science.gov (United States)

    Li, Zibiao; Liu, Xuan; Chen, Xiaohong; Chua, Ming Xuan; Wu, Yun-Long

    2017-07-01

    Deregulation of anti-apoptosis Bcl-2 protein expression was a key feature in human cancers with therapeutic resistance. Nuclear receptor Nur77 could induce the conformation change of Bcl-2 protein and converted it into an apoptosis inducer by "enemy to friend" strategy. However, the safe and effective delivery of this gene to combat therapeutic resistant cancer remained largely unexplored. In this report, we designed an amphiphilic cationic MPEG-PCL-PEI-FA copolymer, comprising biocompatible and hydrophilic methoxy-poly(ethylene glycol) (MPEG), biodegradable and hydrophobic poly(ε-caprolactone) (PCL), cationic poly(ethylene imine) (PEI) segments, and folic acid (FA) as targeting group, as a high efficient Nur77 gene carrier to folate receptor (FR) highly expressed and therapeutic resistant HeLa/Bcl-2 cancer cells. Interestingly, due to the incorporation of PCL and PEG segments, this MPEG-PCL-PEI-FA copolymer showed less toxicity but better gene transfection efficiency than non-viral gene carrier gold standard PEI (25kDa). This might be due to the formation of micelles to stabilize polyplex for enhanced gene transfection ability. More importantly, MPEG-PCL-PEI-FA copolymer exhibited excellent growth inhibition ability on therapeutic resistant HeLa/Bcl-2 cancer cells, which was FR overexpressed HeLa cervical cancer cells with high expression of Bcl-2 protein, thanks to its FA induced targeting ability, high gene transfection efficiency, and low cytotoxicity. This work signifies the first time that cationic amphiphilic MPEG-PCL-PEI-FA copolymers could be utilized for the gene delivery to therapeutic resistant cancer cells with high expression of anti-apoptosis Bcl-2 protein and the positive results are encouraging for the further design of polymeric platforms for combating drug resistant tumors. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. The genes coding for the conversion of carbazole to catechol are flanked by IS6100 elements in Sphingomonas sp. strain XLDN2-5.

    Directory of Open Access Journals (Sweden)

    Zhonghui Gai

    Full Text Available BACKGROUND: Carbazole is a recalcitrant compound with a dioxin-like structure and possesses mutagenic and toxic activities. Bacteria respond to a xenobiotic by recruiting exogenous genes to establish a pathway to degrade the xenobiotic, which is necessary for their adaptation and survival. Usually, this process is mediated by mobile genetic elements such as plasmids, transposons, and insertion sequences. FINDINGS: The genes encoding the enzymes responsible for the degradation of carbazole to catechol via anthranilate were cloned, sequenced, and characterized from a carbazole-degrading Sphingomonas sp. strain XLDN2-5. The car gene cluster (carRAaBaBbCAc and fdr gene were accompanied on both sides by two copies of IS6100 elements, and organized as IS6100::ISSsp1-ORF1-carRAaBaBbCAc-ORF8-IS6100-fdr-IS6100. Carbazole was converted by carbazole 1,9a-dioxygenase (CARDO, CarAaAcFdr, meta-cleavage enzyme (CarBaBb, and hydrolase (CarC to anthranilate and 2-hydroxypenta-2,4-dienoate. The fdr gene encoded a novel ferredoxin reductase whose absence resulted in lower transformation activity of carbazole by CarAa and CarAc. The ant gene cluster (antRAcAdAbAa which was involved in the conversion of anthranilate to catechol was also sandwiched between two IS6100 elements as IS6100-antRAcAdAbAa-IS6100. Anthranilate 1,2-dioxygenase (ANTDO was composed of a reductase (AntAa, a ferredoxin (AntAb, and a two-subunit terminal oxygenase (AntAcAd. Reverse transcription-PCR results suggested that carAaBaBbCAc gene cluster, fdr, and antRAcAdAbAa gene cluster were induced when strain XLDN2-5 was exposed to carbazole. Expression of both CARDO and ANTDO in Escherichia coli required the presence of the natural reductases for full enzymatic activity. CONCLUSIONS/SIGNIFICANCE: We predict that IS6100 might play an important role in the establishment of carbazole-degrading pathway, which endows the host to adapt to novel compounds in the environment. The organization of the car

  3. Characterizing proteases in an Antarctic Janthinobacterium sp. isolate:Evidence of a protease horizontal gene transfer event

    Institute of Scientific and Technical Information of China (English)

    Cecilia Martinez-Rosales; Juan Jos Marizcurrena; Andrs Iriarte; Natalia Fullana; Hctor Musto; Susana Castro-Sowinski

    2015-01-01

    We report the isolation of a cold-adapted bacterium belonging to the genus Janthinobacterium (named AU11), from a water sample collected in Lake Uruguay (King George Island, South Shetlands). AU11 (growth between 4°C and 30°C) produces a single cold-active extracellular protease (ExPAU11), differentially expressed at low temperature. ExPAU11 was identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-ToF MS) as an alkaline metallo-protease (70% coverage with an extracellular protease of Janthinobacterium sp. PI12), and by protease-inhibitor screening identified as a serine-protease. To the best of our knowledge this is the first experimental evidence of a cold-active extracellular protease produced by Janthinobacterium. Furthermore, we identified a serine-protease gene (named JSP8A) showing 60% identity (98%query coverage) to subtilisin peptidases belonging to the S8 family (S8A subfamily) of many cyanobacteria. A phylogenetic analysis of the JSP8A protease, along with related bacterial protein sequences, confirms that JSP8A clusters with S8A subtilisin sequences from different cyanobacteria, and is clearly separated from S8A bacterial sequences of other phyla (including its own). An analysis of the genomic organization around JSP8A suggests that this protease gene was acquired in an event that duplicated a racemase gene involved in transforming L- to D-amino acids. Our results suggest that AU11 probably acquired this subtilisin-like protease gene by horizontal gene transfer (HGT) from a cyanobacterium. We discuss the relevance of a bacterial protease-HGT in the Antarctic environment in light of this hypothesis.

  4. Specific Genes Associated with Adverse Events of Methylphenidate Use in the Pediatric Population

    DEFF Research Database (Denmark)

    Joensen, Beinta; Meyer, Morten; Aagaard, Lise

    2017-01-01

    were significantly associated with the following genes: appetite reduction (CES1*G); buccal-lingual movements (T1065G); diastolic blood pressure (ADRA2A Mspl C/C-GC); emotionality (DAT1*9/9); irritability (SNAP25 T1065G); picking (DRD4*7/DRD4*4); social withdrawal (DRD4*7/DRD4*4); somatic complaints....... They included small patient samples, poorly standardized treatment regimens, and limited outcome assessments. In the future, more pharmacogenomic studies in ADHD are needed, preferably using randomized, controlled study designs and of longer duration (more than 6 months)....

  5. Predictability of Conversation Partners

    Science.gov (United States)

    Takaguchi, Taro; Nakamura, Mitsuhiro; Sato, Nobuo; Yano, Kazuo; Masuda, Naoki

    2011-08-01

    Recent developments in sensing technologies have enabled us to examine the nature of human social behavior in greater detail. By applying an information-theoretic method to the spatiotemporal data of cell-phone locations, [C. Song , ScienceSCIEAS0036-8075 327, 1018 (2010)] found that human mobility patterns are remarkably predictable. Inspired by their work, we address a similar predictability question in a different kind of human social activity: conversation events. The predictability in the sequence of one’s conversation partners is defined as the degree to which one’s next conversation partner can be predicted given the current partner. We quantify this predictability by using the mutual information. We examine the predictability of conversation events for each individual using the longitudinal data of face-to-face interactions collected from two company offices in Japan. Each subject wears a name tag equipped with an infrared sensor node, and conversation events are marked when signals are exchanged between sensor nodes in close proximity. We find that the conversation events are predictable to a certain extent; knowing the current partner decreases the uncertainty about the next partner by 28.4% on average. Much of the predictability is explained by long-tailed distributions of interevent intervals. However, a predictability also exists in the data, apart from the contribution of their long-tailed nature. In addition, an individual’s predictability is correlated with the position of the individual in the static social network derived from the data. Individuals confined in a community—in the sense of an abundance of surrounding triangles—tend to have low predictability, and those bridging different communities tend to have high predictability.

  6. Discrete gene replication events drive coupling between the cell cycle and circadian clocks.

    Science.gov (United States)

    Paijmans, Joris; Bosman, Mark; Ten Wolde, Pieter Rein; Lubensky, David K

    2016-04-12

    Many organisms possess both a cell cycle to control DNA replication and a circadian clock to anticipate changes between day and night. In some cases, these two rhythmic systems are known to be coupled by specific, cross-regulatory interactions. Here, we use mathematical modeling to show that, additionally, the cell cycle generically influences circadian clocks in a nonspecific fashion: The regular, discrete jumps in gene-copy number arising from DNA replication during the cell cycle cause a periodic driving of the circadian clock, which can dramatically alter its behavior and impair its function. A clock built on negative transcriptional feedback either phase-locks to the cell cycle, so that the clock period tracks the cell division time, or exhibits erratic behavior. We argue that the cyanobacterium Synechococcus elongatus has evolved two features that protect its clock from such disturbances, both of which are needed to fully insulate it from the cell cycle and give it its observed robustness: a phosphorylation-based protein modification oscillator, together with its accompanying push-pull read-out circuit that responds primarily to the ratios of different phosphoform concentrations, makes the clock less susceptible to perturbations in protein synthesis; the presence of multiple, asynchronously replicating copies of the same chromosome diminishes the effect of replicating any single copy of a gene.

  7. Conversational Narcissism.

    Science.gov (United States)

    Vangelisti, Anita L.; And Others

    1990-01-01

    Examines narcissistic communication and the ways it is exhibited in everyday conversation. Identifies the following behavioral referents: boasting, refocusing the topic of conversation on the self, exaggerating hand and body movements, using a loud tone of voice, and "glazing over" when others speak. Suggests that conversational…

  8. Contentious Conversations

    Science.gov (United States)

    Zuidema, Leah A.

    2011-01-01

    The idea of joining a conversation through reading and writing is not new; in his 1941 book "The Philosophy of Literary Form: Studies in Symbolic Action," Kenneth Burke suggests that the acts of reading and writing are like entering a parlor where others are already conversing. The author explores the place of professional debate within NCTE and…

  9. Direct conversion of mouse embryonic fibroblasts into functional keratinocytes through transient expression of pluripotency-related genes.

    Science.gov (United States)

    Iacovides, Demetris; Rizki, Gizem; Lapathitis, Georgios; Strati, Katerina

    2016-07-29

    The insufficient ability of specialized cells such as neurons, cardiac myocytes, and epidermal cells to regenerate after tissue damage poses a great challenge to treat devastating injuries and ailments. Recent studies demonstrated that a diverse array of cell types can be directly derived from embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), or somatic cells by combinations of specific factors. The use of iPSCs and direct somatic cell fate conversion, or transdifferentiation, holds great promise for regenerative medicine as these techniques may circumvent obstacles related to immunological rejection and ethical considerations. However, producing iPSC-derived keratinocytes requires a lengthy two-step process of initially generating iPSCs and subsequently differentiating into skin cells, thereby elevating the risk of cellular damage accumulation and tumor formation. In this study, we describe the reprogramming of mouse embryonic fibroblasts into functional keratinocytes via the transient expression of pluripotency factors coupled with directed differentiation. The isolation of an iPSC intermediate is dispensable when using this method. Cells derived with this approach, termed induced keratinocytes (iKCs), morphologically resemble primary keratinocytes. Furthermore they express keratinocyte-specific markers, downregulate mesenchymal markers as well as the pluripotency factors Oct4, Sox2, and Klf4, and they show important functional characteristics of primary keratinocytes. iKCs can be further differentiated by high calcium administration in vitro and are capable of regenerating a fully stratified epidermis in vivo. Efficient conversion of somatic cells into keratinocytes could have important implications for studying genetic skin diseases and designing regenerative therapies to ameliorate devastating skin conditions.

  10. A cholinergic receptor gene (CHRM2) affects event-related oscillations.

    Science.gov (United States)

    Jones, Kevin A; Porjesz, Bernice; Almasy, Laura; Bierut, Laura; Dick, Danielle; Goate, Alison; Hinrichs, Anthony; Rice, John P; Wang, Jen C; Bauer, Lance O; Crowe, Raymond; Foroud, Tatiana; Hesselbrock, Victor; Kuperman, Samuel; Nurnberger, John; O'Connor, Sean J; Rohrbaugh, John; Schuckit, Marc A; Tischfield, Jay; Edenberg, Howard J; Begleiter, Henri

    2006-09-01

    We report genetic linkage and association findings which implicate the gene encoding the muscarinic acetylcholine receptor M2 (CHRM2) in the modulation of a scalp-recorded electrophysiological phenotype. The P3 (P300) response was evoked using a three-stimulus visual oddball paradigm and a phenotype that relates to the energy in the theta band (4-5 Hz) was analyzed. Studies have shown that similar electrophysiological measures represent cognitive correlates of attention, working memory, and response selection; a role has been suggested for the ascending cholinergic pathway in the same functions. The results of our genetic association tests, combined with knowledge regarding the presence of presynaptic cholinergic M2 autoreceptors in the basal forebrain, indicate that the cognitive processes required by the experiment may in part be mediated by inhibitory neural networks. These findings underscore the utility of electrophysiology and neurogenetics in the understanding of cognitive function and the study of brain-related disorders.

  11. Development and Event-specific Detection of Transgenic Glyphosate-resistant Rice Expressing the G2-EPSPS Gene.

    Science.gov (United States)

    Dong, Yufeng; Jin, Xi; Tang, Qiaoling; Zhang, Xin; Yang, Jiangtao; Liu, Xiaojing; Cai, Junfeng; Zhang, Xiaobing; Wang, Xujing; Wang, Zhixing

    2017-01-01

    Glyphosate is a widely used herbicide, due to its broad spectrum, low cost, low toxicity, high efficiency, and non-selective characteristics. Rice farmers rarely use glyphosate as a herbicide, because the crop is sensitive to this chemical. The development of transgenic glyphosate-tolerant rice could greatly improve the economics of rice production. Here, we transformed the Pseudomonas fluorescens G2 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS) gene G2-EPSPS, which conferred tolerance to glyphosate herbicide into a widely used japonica rice cultivar, Zhonghua 11 (ZH11), to develop two highly glyphosate-tolerant transgenic rice lines, G2-6 and G2-7, with one exogenous gene integration. Seed germination tests and glyphosate-tolerance assays of plants grown in a greenhouse showed that the two transgenic lines could greatly improve glyphosate-tolerance compared with the wild-type; The glyphosate-tolerance field test indicated that both transgenic lines could grow at concentrations of 20,000 ppm glyphosate, which is more than 20-times the recommended concentration in the field. Isolation of the flanking sequence of transgenic rice G2-6 indicated that the 5'-terminal of T-DNA was inserted into chromosome 8 of the rice genome. An event-specific PCR test system was established and the limit of detection of the primers reached five copies. Overall, the G2-EPSPS gene significantly improved glyphosate-tolerance in transgenic rice; furthermore, it is a useful candidate gene for the future development of commercial transgenic rice.

  12. COOH-terminal deletion of HBx gene is a frequent event in HBV-associated hepatocellular carcinoma

    Institute of Scientific and Technical Information of China (English)

    Xiao-Hong Liu; Jing Lin; Shu-Hui Zhang; Shun-Min Zhang; Mark A Feitelson; Heng-Jun Gao; Ming-Hua Zhu

    2008-01-01

    AIM:To investigate the hepatitis B virus (HBV) x gene (HBx) state in the tissues of HBV-related hepatocellular carcinoma (HCC) in Chinese patients and whether there were particular HBx mutations.METHODS:HBx gene was amplified and direct sequencing was used in genomic DNA samples from 20HCC and corresponding non-cancerous liver tissues from HBsAg-positive patients.HBV DNA integration and HBx deleted mutation were validated in 45 HCC patients at different stages by Southern blot analysis and polymerase chain reaction methods.RESULTS:The frequencies of HBx point mutations were significantly lower in HCC than their corresponding non-cancerous liver tissues (11/19 vs 18/19,P = 0.019).In contrast,deletions in HBx gene were significantly higher in HCC than their non-cancerous liver tissues (16/19 vs 4/19,P<0.001).The deletion of HBx COOH-terminal was detected in 14 HCC tissues.A specific integration of HBx at 17p13 locus was also found in 8 of 16 HCC,and all of them also exhibited full-length HBx deletions.Integrated or integrated coexistence with replicated pattern was obtained in 45.5% (20145)-56.8% (25145)tumors and 40.9% (18/45)-52.3% (23/45) non-tumor tissues.CONCLUSION:HBx deletion,especially the COOH-terminal deletion of HBx is a frequent event in HBV-associated HCC tissues in China.HBV integration had also taken place in partial HCC tissues.This supporting the hypothesis that deletion and probably integrated forms of the HBx gene may be implicated in liver carcinogenesis.

  13. Depletion of Key Meiotic Genes and Transcriptome-Wide Abiotic Stress Reprogramming Mark Early Preparatory Events Ahead of Apomeiotic Transition

    Science.gov (United States)

    Shah, Jubin N.; Kirioukhova, Olga; Pawar, Pallavi; Tayyab, Muhammad; Mateo, Juan L.; Johnston, Amal J.

    2016-01-01

    Molecular dissection of apomixis – an asexual reproductive mode – is anticipated to solve the enigma of loss of meiotic sex, and to help fixing elite agronomic traits. The Brassicaceae genus Boechera comprises of both sexual and apomictic species, permitting comparative analyses of meiotic circumvention (apomeiosis) and parthenogenesis. Whereas previous studies reported local transcriptome changes during these events, it remained unclear whether global changes associated with hybridization, polyploidy and environmental adaptation that arose during evolution of Boechera might serve as (epi)genetic regulators of early development prior apomictic initiation. To identify these signatures during vegetative stages, we compared seedling RNA-seq transcriptomes of an obligate triploid apomict and a diploid sexual, both isolated from a drought-prone habitat. Uncovered were several genes differentially expressed between sexual and apomictic seedlings, including homologs of meiotic genes ASYNAPTIC 1 (ASY1) and MULTIPOLAR SPINDLE 1 (MPS1) that were down-regulated in apomicts. An intriguing class of apomict-specific deregulated genes included several NAC transcription factors, homologs of which are known to be transcriptionally reprogrammed during abiotic stress in other plants. Deregulation of both meiotic and stress-response genes during seedling stages might possibly be important in preparation for meiotic circumvention, as similar transcriptional alteration was discernible in apomeiotic floral buds too. Furthermore, we noted that the apomict showed better tolerance to osmotic stress in vitro than the sexual, in conjunction with significant upregulation of a subset of NAC genes. In support of the current model that DNA methylation epigenetically regulates stress, ploidy, hybridization and apomixis, we noted that ASY1, MPS1 and NAC019 homologs were deregulated in Boechera seedlings upon DNA demethylation, and ASY1 in particular seems to be repressed by global DNA

  14. High Throughput Sequencing of Entamoeba 27nt Small RNA Population Reveals Role in Permanent Gene Silencing But No Effect on Regulating Gene Expression Changes during Stage Conversion, Oxidative, or Heat Shock Stress

    Science.gov (United States)

    Manna, Dipak; Hall, Neil; Singh, Upinder

    2015-01-01

    The human parasite Entamoeba histolytica has an active RNA interference (RNAi) pathway with an extensive repertoire of 27nt small RNAs that silence genes. However the role of this pathway in regulating amebic biology remains unknown. In this study, we address whether silencing via 27nt small RNAs may be a mechanism for controlling gene expression changes during conversion between the trophozoite and cyst stages of the parasite. We sequenced small RNA libraries generated from trophozoites, early cysts, mature cysts, and excysting cells and mapped them to the E. invadens genome. Our results show that, as in E. histolytica, small RNAs in E. invadens are largely ~27nt in length, have an unusual 5'-polyphosphate structure and mediate gene silencing. However, when comparing the libraries from each developmental time-point we found few changes in the composition of the small RNA populations. Furthermore, genes targeted by small RNAs were permanently silenced with no changes in transcript abundance during development. Thus, the E. invadens 27nt small RNA population does not mediate gene expression changes during development. In order to assess the generalizability of our observations, we examined whether small RNAs may be regulating gene expression changes during stress response in E. histolytica. Comparison of the 27nt small RNA populations from E. histolytica trophozoites from basal conditions, or after heat shock or exposure to oxidative stress showed few differences. Similar to data in E. invadens development, genes targeted by small RNAs were consistently silenced and did not change expression under tested stress conditions. Thus, the biological roles of the 27nt small RNA population in Entamoeba remain elusive. However, as the first characterization of the RNAi pathway in E. invadens these data serve as a useful resource for the study of Entamoeba development and open the door to the development of RNAi-based gene silencing tools in E. invadens. PMID:26248204

  15. High Throughput Sequencing of Entamoeba 27nt Small RNA Population Reveals Role in Permanent Gene Silencing But No Effect on Regulating Gene Expression Changes during Stage Conversion, Oxidative, or Heat Shock Stress.

    Science.gov (United States)

    Zhang, Hanbang; Ehrenkaufer, Gretchen M; Manna, Dipak; Hall, Neil; Singh, Upinder

    2015-01-01

    The human parasite Entamoeba histolytica has an active RNA interference (RNAi) pathway with an extensive repertoire of 27nt small RNAs that silence genes. However the role of this pathway in regulating amebic biology remains unknown. In this study, we address whether silencing via 27nt small RNAs may be a mechanism for controlling gene expression changes during conversion between the trophozoite and cyst stages of the parasite. We sequenced small RNA libraries generated from trophozoites, early cysts, mature cysts, and excysting cells and mapped them to the E. invadens genome. Our results show that, as in E. histolytica, small RNAs in E. invadens are largely ~27nt in length, have an unusual 5'-polyphosphate structure and mediate gene silencing. However, when comparing the libraries from each developmental time-point we found few changes in the composition of the small RNA populations. Furthermore, genes targeted by small RNAs were permanently silenced with no changes in transcript abundance during development. Thus, the E. invadens 27nt small RNA population does not mediate gene expression changes during development. In order to assess the generalizability of our observations, we examined whether small RNAs may be regulating gene expression changes during stress response in E. histolytica. Comparison of the 27nt small RNA populations from E. histolytica trophozoites from basal conditions, or after heat shock or exposure to oxidative stress showed few differences. Similar to data in E. invadens development, genes targeted by small RNAs were consistently silenced and did not change expression under tested stress conditions. Thus, the biological roles of the 27nt small RNA population in Entamoeba remain elusive. However, as the first characterization of the RNAi pathway in E. invadens these data serve as a useful resource for the study of Entamoeba development and open the door to the development of RNAi-based gene silencing tools in E. invadens.

  16. Application of gene expression programming and neural networks to predict adverse events of radical hysterectomy in cervical cancer patients.

    Science.gov (United States)

    Kusy, Maciej; Obrzut, Bogdan; Kluska, Jacek

    2013-12-01

    The aim of this article was to compare gene expression programming (GEP) method with three types of neural networks in the prediction of adverse events of radical hysterectomy in cervical cancer patients. One-hundred and seven patients treated by radical hysterectomy were analyzed. Each record representing a single patient consisted of 10 parameters. The occurrence and lack of perioperative complications imposed a two-class classification problem. In the simulations, GEP algorithm was compared to a multilayer perceptron (MLP), a radial basis function network neural, and a probabilistic neural network. The generalization ability of the models was assessed on the basis of their accuracy, the sensitivity, the specificity, and the area under the receiver operating characteristic curve (AUROC). The GEP classifier provided best results in the prediction of the adverse events with the accuracy of 71.96 %. Comparable but slightly worse outcomes were obtained using MLP, i.e., 71.87 %. For each of measured indices: accuracy, sensitivity, specificity, and the AUROC, the standard deviation was the smallest for the models generated by GEP classifier.

  17. Conversion Disorder

    Science.gov (United States)

    ... Recent significant stress or emotional trauma Being female — women are much more likely to develop conversion disorder Having a mental health condition, such as mood or anxiety disorders, dissociative disorder or certain personality disorders Having ...

  18. Conversation Analysis.

    Science.gov (United States)

    Schiffrin, Deborah

    1990-01-01

    Summarizes the current state of research in conversation analysis, referring primarily to six different perspectives that have developed from the philosophy, sociology, anthropology, and linguistics disciplines. These include pragmatics; speech act theory; interactional sociolinguistics; ethnomethodology; ethnography of communication; and…

  19. Conversation Analysis.

    Science.gov (United States)

    Schiffrin, Deborah

    1990-01-01

    Summarizes the current state of research in conversation analysis, referring primarily to six different perspectives that have developed from the philosophy, sociology, anthropology, and linguistics disciplines. These include pragmatics; speech act theory; interactional sociolinguistics; ethnomethodology; ethnography of communication; and…

  20. The B cell transcription program mediates hypomethylation and overexpression of key genes in Epstein-Barr virus-associated proliferative conversion.

    Science.gov (United States)

    Hernando, Henar; Shannon-Lowe, Claire; Islam, Abul B; Al-Shahrour, Fatima; Rodríguez-Ubreva, Javier; Rodríguez-Cortez, Virginia C; Javierre, Biola M; Mangas, Cristina; Fernández, Agustín F; Parra, Maribel; Delecluse, Henri-Jacques; Esteller, Manel; López-Granados, Eduardo; Fraga, Mario F; López-Bigas, Nuria; Ballestar, Esteban

    2013-01-15

    Epstein-Barr virus (EBV) infection is a well characterized etiopathogenic factor for a variety of immune-related conditions, including lymphomas, lymphoproliferative disorders and autoimmune diseases. EBV-mediated transformation of resting B cells to proliferating lymphoblastoid cells occurs in early stages of infection and is an excellent model for investigating the mechanisms associated with acquisition of unlimited growth. We investigated the effects of experimental EBV infection of B cells on DNA methylation profiles by using high-throughput analysis. Remarkably, we observed hypomethylation of around 250 genes, but no hypermethylation. Hypomethylation did not occur at repetitive sequences, consistent with the absence of genomic instability in lymphoproliferative cells. Changes in methylation only occurred after cell divisions started, without the participation of the active demethylation machinery, and were concomitant with acquisition by B cells of the ability to proliferate. Gene Ontology analysis, expression profiling, and high-throughput analysis of the presence of transcription factor binding motifs and occupancy revealed that most genes undergoing hypomethylation are active and display the presence of NF-κB p65 and other B cell-specific transcription factors. Promoter hypomethylation was associated with upregulation of genes relevant for the phenotype of proliferating lymphoblasts. Interestingly, pharmacologically induced demethylation increased the efficiency of transformation of resting B cells to lymphoblastoid cells, consistent with productive cooperation between hypomethylation and lymphocyte proliferation. Our data provide novel clues on the role of the B cell transcription program leading to DNA methylation changes, which we find to be key to the EBV-associated conversion of resting B cells to proliferating lymphoblasts.

  1. Strategic conversation

    Directory of Open Access Journals (Sweden)

    Nicholas Asher

    2013-08-01

    Full Text Available Models of conversation that rely on a strong notion of cooperation don’t apply to strategic conversation — that is, to conversation where the agents’ motives don’t align, such as courtroom cross examination and political debate. We provide a game-theoretic framework that provides an analysis of both cooperative and strategic conversation. Our analysis features a new notion of safety that applies to implicatures: an implicature is safe when it can be reliably treated as a matter of public record. We explore the safety of implicatures within cooperative and non cooperative settings. We then provide a symbolic model enabling us (i to prove a correspondence result between a characterisation of conversation in terms of an alignment of players’ preferences and one where Gricean principles of cooperative conversation like Sincerity hold, and (ii to show when an implicature is safe and when it is not. http://dx.doi.org/10.3765/sp.6.2 BibTeX info

  2. Mosaicism for FMR1 gene full mutation and intermediate allele in a female foetus: a postzygotic retraction event.

    Science.gov (United States)

    Ferreira, Susana Isabel; Pires, Luís Miguel; Ferrão, José; Sá, Joaquim; Serra, Armando; Carreira, Isabel Marques

    2013-09-15

    Fragile X syndrome is caused by the expansion of an unstable CGG repeat in the 5'UTR of FMR1 gene. The occurrence of mosaicism is not uncommon, especially in male patients, whereas in females it is not so often reported. Here we report a female foetus that was subject to prenatal diagnosis, because of her mother being a premutation carrier. The foetus was identified as being a mosaic for an intermediate allele and a full mutation of FMR1 gene, in the presence of a normal allele. The mosaic status was confirmed in three different tissues of the foetus--amniotic fluid, skin biopsy and blood--the last two obtained after pregnancy termination. Karyotype analysis and X-chromosome STR markers analysis do not support the mosaicism as inheritance of both maternal alleles. Oligonucleotide array-CGH excluded an imbalance that could contain the primer binding site with a different repeat size. The obtained results give compelling evidence for a postzygotic expansion mechanism where the foetus mosaic pattern originated from expansion of the mother's premutation into a full mutation and consequent regression to an intermediate allele in a proportion of cells. These events occurred in early embryogenesis before the commitment of cells into the different tissues, as the three tested tissues of the foetus have the same mosaic pattern. The couple has a son with Fragile X mental retardation syndrome and choose to terminate this pregnancy after genetic counselling.

  3. Low-dose gamma-rays and simulated solar particle event protons modify splenocyte gene and cytokine expression patterns.

    Science.gov (United States)

    Rizvi, Asma; Pecaut, Michael J; Gridley, Daila S

    2011-01-01

    The goal was to investigate the T helper (Th) response in splenocytes of mice exposed to low-dose/low-dose-rate (LDR) γ-rays, simulated solar particle event protons (sSPE), or combination of both. C57BL/6 mice were exposed to LDR γ-radiation ((57)Co) to a total dose of 0.05 Gray (Gy) at 0.024 cGy/h, either with or without subsequent exposure to 2 Gy sSPE protons. Expression of genes related to Th cells was evaluated immediately after exposure (day 0). On day 21, intra- and extracellular cytokine production was assessed after activation with anti-CD3 monoclonal antibodies (mAb) or phorbol 12-myristate 13-acetate/ionophore (PMA/I). Five genes were significantly modulated on day 0 in one or more of the irradiated groups compared to controls (p rays (p rays can in some cases modulate the response to sSPE.

  4. Direct Conversion of Energy

    Energy Technology Data Exchange (ETDEWEB)

    Corliss, William R

    1964-01-01

    Topics include: direct versus dynamic energy conversion; laws governing energy conversion; thermoelectricity; thermionic conversion; magnetohydrodynamic conversion; chemical batteries; the fuel cell; solar cells; nuclear batteries; and advanced concepts including ferroelectric conversion and thermomagnetic conversion.

  5. Mouse Mammary Tumor Virus Promoter-Containing Retroviral Promoter Conversion Vectors for Gene-Directed Enzyme Prodrug Therapy are Functional in Vitro and in Vivo

    Directory of Open Access Journals (Sweden)

    Reinhard Klein

    2008-01-01

    Full Text Available Gene directed-enzyme prodrug therapy (GDEPT is an approach for sensitization of tumor cells to an enzymatically activated, otherwise nontoxic, prodrug. Cytochrome P450 2B1 (CYP2B1 metabolizes the prodrugs cyclophosphamide (CPA and ifosfamide (IFA to produce the cytotoxic substances phosphoramide mustard and isophosphoramide mustard as well as the byproduct acrolein. We have constructed a retroviral promoter conversion (ProCon vector for breast cancer GDEPT. The vector allows expression of CYP2B1 from the mouse mammary tumor virus (MMTV promoter known to be active in the mammary glands of transgenic animals. It is anticipated to be used for the generation of encapsulated viral vector producing cells which, when placed inside or close to a tumor, will act as suppliers of the therapeutic CYP2B1 protein as well as of the therapeutic vector itself. The generated vector was effectively packaged by virus producing cells and allowed the production of high levels of enzymatically active CYP2B1 in infected cells which sensitized them to killing upon treatment with both IFA and CPA. Determination of the respective IC50 values demonstrated that the effective IFA dose was reduced by sixteen folds. Infection efficiencies in vivo were determined using a reporter gene-bearing vector in a mammary cancer cell-derived xenograft tumor mouse model.

  6. Two Lycopene β-Cyclases Genes from Sweet Orange (Citrus sinensis L. Osbeck) Encode Enzymes With Different Functional Efifciency During the Conversion of Lycopene-to-Provitamin A

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jian-cheng; ZHOU Wen-jing; XU Qiang; TAO Neng-guo; YE Jun-li; GUO Fei; XU Juan; DENG Xiu-xin

    2013-01-01

    Citrus fruits are rich in carotenoids. In the carotenoid biosynthetic pathway, lycopene β-cyclase (LCYb, EC:1.14.-.-) is a key regulatory enzyme in the catalysis of lycopene to β-carotene, an important dietary precursor of vitamin A for human nutrition. Two closely related lycopeneβ-cyclase cDNAs, designated CsLCYb1 and CsLCYb2, were isolated from the pulp of orange fruits (Citrus sinensis). The expression level of CsLCYb genes is lower in the lfavedo and juice sacs of a lycopene-accumulating genotype Cara Cara than that in common genotype Washington, and this might be correlated with lycopene accumulation in Cara Cara fruit. The CsLCYb1 efifciently converted lycopene into the bicyclicβ-carotene in an Escherichia coli expression system, but the CsLCYb2 exhibited a lower enzyme activity and converted lycopene into theβ-carotene and the monocyclic γ-carotene. In tomato transformation studies, expression of CsLCYb1 under the control of the caulilfower mosaic virus (CaMV) 35S constitutive promoter resulted in a virtually complete conversion of lycopene intoβ-carotene, and the ripe fruits displayed a bright orange colour. However, the CsLCYb2 transgenic tomato plants did not show an altered fruit colour during development and maturation. In fruits of the CsLCYb1 transgenic plants, most of the lycopene was converted intoβ-carotene with provitamin A levels reaching about 700 µg g-1 DW. Unexpectedly, most transgenic tomatoes showed a reduction in total carotenoid accumulation, and this is consistent with the decrease in expression of endogenous carotenogenic genes in transgenic fruits. Collectively, these results suggested that the cloned CsLCYb1 and CsLCYb2 genes encoded two functional lycopene β-cyclases with different catalytic efifciency, and they may have potential for metabolite engineering toward altering pigmentation and enhancing nutritional value of food crops.

  7. Nuclear localisation sequence templated nonviral gene delivery vectors: investigation of intracellular trafficking events of LMD and LD vector systems.

    Science.gov (United States)

    Keller, Michael; Harbottle, Richard P; Perouzel, Eric; Colin, Morvane; Shah, Imran; Rahim, Ahad; Vaysse, Laurence; Bergau, Anna; Moritz, Sylviane; Brahimi-Horn, Christiane; Coutelle, Charles; Miller, Andrew D

    2003-04-04

    The impact of a peptide that contains a nuclear localisation sequence (NLS) on intracellular DNA trafficking was studied. We used the adenoviral core peptide mu and an SV40 NLS peptide to condense plasmid DNA (pDNA) prior to formulation with 3beta-[N-(N', N'-dimethylaminoethane)carbamoyl]cholesterol/dioleoyl-L-alpha-phosphatidyl ethanolamine (DC-Chol/DOPE) liposomes to give LMD and LND vectors, respectively. Fluorescent-labelled lipid and peptides plus dye-labelled pDNA components were used to investigate gene delivery in dividing and S-phase growth-arrested cells. Confocal microscopic analyses reveal little difference in intracellular trafficking events. Strikingly, mu peptide associates with nuclei and nucleoli of cells within less than 15 mins incubation of LMD with cells, which suggests that mu peptide has an NLS function. These NLS properties were confirmed by cloning of a mu-beta-galactosidase fusion protein that localises in the nuclei of cells after cytosolic translation. In dividing cells both LMD and LND deliver pDNA(Cy3) to nuclei within 30-45 min incubation with cells. By contrast, pDNA is detected only in the cytoplasm in growth-arrested cells over the period of time investigated, and not in the nuclei. LD systems prepared from DC-Chol/DOPE cationic liposomes and pDNA(Cy3) behave similarly to LMD systems, which suggests that mu peptide is unable to influence trafficking events in this current LMD formulation, in spite of its strong NLS capacity. We further describe the effect of polyethyleneglycol (PEG) on cellular uptake. "Stealth" systems obtained by post-coating LMD particles with fluorescent-labelled PEG molecules (0.5, 5 and 10 mol % fluorescein-PEG(5000)-N-hydroxysuccinimide) were prepared and shown to be internalised rapidly (mins) by cells, without detectable transgene expression. This result indicates that PEG blocks intracellular trafficking of pDNA.

  8. CNR1 gene is associated with high neuroticism and low agreeableness and interacts with recent negative life events to predict current depressive symptoms.

    Science.gov (United States)

    Juhasz, Gabriella; Chase, Diana; Pegg, Emma; Downey, Darragh; Toth, Zoltan G; Stones, Kathryn; Platt, Hazel; Mekli, Krisztina; Payton, Antony; Elliott, Rebecca; Anderson, Ian M; Deakin, J F William

    2009-07-01

    Cannabinoid receptor 1 (CB1) gene (CNR1) knockout mice are prone to develop anhedonic and helpless behavior after chronic mild stress. In humans, the CB1 antagonist rimonabant increases the risk of depressed mood disorders and anxiety. These studies suggest the hypothesis that genetic variation in CB1 receptor function influences the risk of depression in humans in response to stressful life events. In a population sample (n=1269), we obtained questionnaire measures of personality (Big Five Inventory), depression and anxiety (Brief Symptom Inventory), and life events. The CNR1 gene was covered by 10 SNPs located throughout the gene to determine haplotypic association. Variations in the CNR1 gene were significantly associated with a high neuroticism and low agreeableness phenotype (explained variance 1.5 and 2.5%, respectively). Epistasis analysis of the SNPs showed that the previously reported functional 5' end of the CNR1 gene significantly interacts with the 3' end in these phenotypes. Furthermore, current depression scores significantly associated with CNR1 haplotypes but this effect diminished after covariation for recent life events, suggesting a gene x environment interaction. Indeed, rs7766029 showed highly significant interaction between recent negative life events and depression scores. The results represent the first evidence in humans that the CNR1 gene is a risk factor for depression--and probably also for co-morbid psychiatric conditions such as substance use disorders--through a high neuroticism and low agreeableness phenotype. This study also suggests that the CNR1 gene influences vulnerability to recent psychosocial adversity to produce current symptoms of depression.

  9. Functional gene polymorphisms in the serotonin system and traumatic life events modulate the neural basis of fear acquisition and extinction.

    Directory of Open Access Journals (Sweden)

    Andrea Hermann

    Full Text Available Fear acquisition and extinction are crucial mechanisms in the etiology and maintenance of anxiety disorders. Moreover, they might play a pivotal role in conveying the influence of genetic and environmental factors on the development of a (more or less stronger proneness for, or resilience against psychopathology. There are only few insights in the neurobiology of genetically and environmentally based individual differences in fear learning and extinction. In this functional magnetic resonance imaging study, 74 healthy subjects were investigated. These were invited according to 5-HTTLPR/rs25531 (S+ vs. L(AL(A; triallelic classification and TPH2 (G(-703T (T+ vs. T- genotype. The aim was to investigate the influence of genetic factors and traumatic life events on skin conductance responses (SCRs and neural responses (amygdala, insula, dorsal anterior cingulate cortex (dACC and ventromedial prefrontal cortex (vmPFC during acquisition and extinction learning in a differential fear conditioning paradigm. Fear acquisition was characterized by stronger late conditioned and unconditioned responses in the right insula in 5-HTTLPR S-allele carriers. During extinction traumatic life events were associated with reduced amygdala activation in S-allele carriers vs. non-carriers. Beyond that, T-allele carriers of the TPH2 (G(-703T polymorphism with a higher number of traumatic life events showed enhanced responsiveness in the amygdala during acquisition and in the vmPFC during extinction learning compared with non-carriers. Finally, a combined effect of the two polymorphisms with higher responses in S- and T-allele carriers was found in the dACC during extinction. The results indicate an increased expression of conditioned, but also unconditioned fear responses in the insula in 5-HTTLPR S-allele carriers. A combined effect of the two polymorphisms on dACC activation during extinction might be associated with prolonged fear expression. Gene

  10. Conversational Telugu.

    Science.gov (United States)

    Beinstein, Judith; And Others

    The purpose of this text is to develop elementary conversational skills in Telugu. The language materials consist of four types of language learning activities. The first, and most predominant, is the unit microwave cycle. These cycles divide the learning process into two basic phases, the first of which involves mimicry, memorization, and…

  11. Conversion Disorder

    National Research Council Canada - National Science Library

    Fisher, Robert S; Stonnington, Cynthia M; Barry, John J

    2006-01-01

    ... to proceed after establishing a diagnosis of conversion disorder. Case Presentation "Ms. A," a 53-year-old left-handed woman, was admitted to our epilepsy monitoring unit for evaluation of a 4-month history of tremors, head bobbing, and episodic loss of awareness. The onset of these symptoms was 1 week after she had visited an emergency department...

  12. Altered gene expression in T-cell receptor signalling in peripheral blood leucocytes in acute coronary syndrome predicts secondary coronary events

    Science.gov (United States)

    Takashima, Shin-ichiro; Usui, Soichiro; Kurokawa, Keisuke; Kitano, Teppei; Kato, Takeshi; Murai, Hisayoshi; Furusho, Hiroshi; Oda, Hiroyuki; Maruyama, Michiro; Nagata, Yoshiki; Usuda, Kazuo; Kubota, Koji; Takeshita, Yumie; Sakai, Yoshio; Honda, Masao; Kaneko, Shuichi; Takamura, Masayuki

    2016-01-01

    Objective Comprehensive profiling of gene expression in peripheral blood leucocytes (PBLs) in patients with acute coronary syndrome (ACS) as a prognosticator is needed. We explored the specific profile of gene expression in PBLs in ACS for long-term risk stratification. Methods 30 patients with ACS who underwent primary percutaneous coronary intervention (PCI) and 15 age-matched adults who participated in medical check-ups were enrolled from three centres. Peripheral blood samples were collected to extract RNA for microarray analyses. Results During the 5-year follow-up, 36% of this cohort developed the expected non-fatal coronary events (NFEs) of target lesion revascularisation (TLR) and PCI for a de novo lesion. Class comparison analysis (p<0.005) demonstrated that 83 genes among 7785 prefiltered genes (41 upregulated vs 42 downregulated genes) were extracted to classify the patients according to the occurrence of NFE. Pathway analysis based on gene ontology revealed that the NFEs were associated with altered gene expression regarding the T-cell receptor signalling pathway in ACS. Univariate t test showed that the expression level of death-associated protein kinase1 (DAPK1), known to regulate inflammation, was the most significantly negatively regulated gene in the event group (0.61-fold, p<0.0005). Kaplan-Meier curve analysis and multivariate analysis adjusted for baseline characteristics or clinical biomarkers demonstrated that lower DAPK1 expression in PBL emerged as an independent risk factor for the NFEs (HR: 8.73; CI 1.05 to 72.8, p=0.045). Conclusions Altered gene expression in T-cell receptor signalling in PBL in ACS could be a prognosticator for secondary coronary events. Trial registration number UMIN000001932; Results. PMID:27403330

  13. Gene targeting with retroviral vectors

    Energy Technology Data Exchange (ETDEWEB)

    Ellis, J.; Bernstein, A. (Toronto Univ., ON (Canada))

    1989-04-01

    The authors have designed and constructed integration-defective retroviral vectors to explore their potential for gene targeting in mammalian cells. Two nonoverlapping deletion mutants of the bacterial neomycin resistance (neo) gene were used to detect homologous recombination events between viral and chromosomal sequences. Stable neo gene correction events were selected at a frequency of approximately 1 G418/sup r/ cell per 3 x 10/sup 6/ infected cells. Analysis of the functional neo gene in independent targeted cell clones indicated that unintegrated retroviral linear DNA recombined with the target by gene conversion for variable distances into regions of nonhomology. In addition, transient neo gene correction events which were associated with the complete loss of the chromosomal target sequences were observed. These results demonstrated that retroviral vectors can recombine with homologous chromosomal sequences in rodent and human cells.

  14. Conversion Disorder

    Directory of Open Access Journals (Sweden)

    Yacov Rofé

    2013-11-01

    Full Text Available Conversion disorder remains a mystery that has only become more complicated with the decline of the scientific status of psychoanalysis (e.g., Piper, Lillevik, & Kritzer, 2008; Rofé, 2008 and recent neurological findings suggest that this behavior is controlled by biological mechanisms (van Beilen, Vogt, & Leenders, 2010. Moreover, existing theories have difficulty explaining the efficacy of various interventions, such as psychoanalysis, behavior therapy, drug therapy and religious therapy. This article reviews research and clinical evidence pertaining to both the development and treatment of conversion disorder and shows that this seemingly incompatible evidence can be integrated within a new theory, the Rational-Choice Theory of Neurosis (RCTN; Rofé, 2010. Despite the striking differences, RCTN continues Freud's framework of thinking as it employs a new concept of repression and replaces the unconscious with self-deception. Moreover, it incorporates Freud's idea, implicitly expressed in his theory, that neurotic disorders are, in fact, rational behaviors.

  15. Conversational sensing

    Science.gov (United States)

    Preece, Alun; Gwilliams, Chris; Parizas, Christos; Pizzocaro, Diego; Bakdash, Jonathan Z.; Braines, Dave

    2014-05-01

    Recent developments in sensing technologies, mobile devices and context-aware user interfaces have made it pos- sible to represent information fusion and situational awareness for Intelligence, Surveillance and Reconnaissance (ISR) activities as a conversational process among actors at or near the tactical edges of a network. Motivated by use cases in the domain of Company Intelligence Support Team (CoIST) tasks, this paper presents an approach to information collection, fusion and sense-making based on the use of natural language (NL) and controlled nat- ural language (CNL) to support richer forms of human-machine interaction. The approach uses a conversational protocol to facilitate a ow of collaborative messages from NL to CNL and back again in support of interactions such as: turning eyewitness reports from human observers into actionable information (from both soldier and civilian sources); fusing information from humans and physical sensors (with associated quality metadata); and assisting human analysts to make the best use of available sensing assets in an area of interest (governed by man- agement and security policies). CNL is used as a common formal knowledge representation for both machine and human agents to support reasoning, semantic information fusion and generation of rationale for inferences, in ways that remain transparent to human users. Examples are provided of various alternative styles for user feedback, including NL, CNL and graphical feedback. A pilot experiment with human subjects shows that a prototype conversational agent is able to gather usable CNL information from untrained human subjects.

  16. Transcriptomic events involved in melon mature-fruit abscission comprise the sequential induction of cell-wall degrading genes coupled to a stimulation of endo and exocytosis.

    Directory of Open Access Journals (Sweden)

    Jorge Corbacho

    Full Text Available BACKGROUND: Mature-fruit abscission (MFA in fleshy-fruit is a genetically controlled process with mechanisms that, contrary to immature-fruit abscission, has not been fully characterized. Here, we use pyrosequencing to characterize the transcriptomes of melon abscission zone (AZ at three stages during AZ-cell separation in order to understand MFA control at an early stage of AZ-activation. PRINCIPAL FINDINGS: The results show that by early induction of MFA, the melon AZ exhibits major gene induction, while by late induction of MFA, melon AZ shows major gene repression. Although some genes displayed similar regulation in both early and late induction of abscission, such as EXT1-EXT4, EGase1, IAA2, ERF1, AP2D15, FLC, MADS2, ERAF17, SAP5 and SCL13 genes, the majority had different expression patterns. This implies that time-specific events occur during MFA, and emphasizes the value of characterizing multiple time-specific abscission transcriptomes. Analysis of gene-expression from these AZs reveal that a sequential induction of cell-wall-degrading genes is associated with the upregulation of genes involved in endo and exocytosis, and a shift in plant-hormone metabolism and signaling genes during MFA. This is accompanied by transcriptional activity of small-GTPases and synthaxins together with tubulins, dynamins, V-type ATPases and kinesin-like proteins potentially involved in MFA signaling. Early events are potentially controlled by down-regulation of MADS-box, AP2/ERF and Aux/IAA transcription-factors, and up-regulation of homeobox, zinc finger, bZIP, and WRKY transcription-factors, while late events may be controlled by up-regulation of MYB transcription-factors. SIGNIFICANCE: Overall, the data provide a comprehensive view on MFA in fleshy-fruit, identifying candidate genes and pathways associated with early induction of MFA. Our comprehensive gene-expression profile will be very useful for elucidating gene regulatory networks of the MFA in

  17. Diversification of genes encoding granule-bound starch synthase in monocots and dicots is marked by multiple genome-wide duplication events.

    Directory of Open Access Journals (Sweden)

    Jun Cheng

    Full Text Available Starch is one of the major components of cereals, tubers, and fruits. Genes encoding granule-bound starch synthase (GBSS, which is responsible for amylose synthesis, have been extensively studied in cereals but little is known about them in fruits. Due to their low copy gene number, GBSS genes have been used to study plant phylogenetic and evolutionary relationships. In this study, GBSS genes have been isolated and characterized in three fruit trees, including apple, peach, and orange. Moreover, a comprehensive evolutionary study of GBSS genes has also been conducted between both monocots and eudicots. Results have revealed that genomic structures of GBSS genes in plants are conserved, suggesting they all have evolved from a common ancestor. In addition, the GBSS gene in an ancestral angiosperm must have undergone genome duplication ∼251 million years ago (MYA to generate two families, GBSSI and GBSSII. Both GBSSI and GBSSII are found in monocots; however, GBSSI is absent in eudicots. The ancestral GBSSII must have undergone further divergence when monocots and eudicots split ∼165 MYA. This is consistent with expression profiles of GBSS genes, wherein these profiles are more similar to those of GBSSII in eudicots than to those of GBSSI genes in monocots. In dicots, GBSSII must have undergone further divergence when rosids and asterids split from each other ∼126 MYA. Taken together, these findings suggest that it is GBSSII rather than GBSSI of monocots that have orthologous relationships with GBSS genes of eudicots. Moreover, diversification of GBSS genes is mainly associated with genome-wide duplication events throughout the evolutionary course of history of monocots and eudicots.

  18. Identification of HLA-G*01:17, a new allele possibly generated by an interloci gene conversion event involving exon 3 of HLA-B.

    Science.gov (United States)

    Czarnecki, Chris; Van Domselaar, Gary; Embreé, Joanne; Brunham, Robert; Plummer, Francis A; Luo, Ma

    2011-03-01

    HLA-G*01:17 was discovered in a woman of Kenyan descent who was enrolled in a mother-to-child HIV-1 transmission cohort. The new allele was identical to HLA-G*01:06 at exons 2, 3, and 4 with the exception of a base pair substitution at codon 169 (CAC → CGC) resulting in a coding change from histidine to arginine and codon 171 (TAC → CAC), resulting in turn in a coding change from tyrosine to histidine. The World Health Organization (WHO) Nomenclature Committee has named this allele HLA-G*01:17.

  19. Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

    Science.gov (United States)

    Boulila, Moncef

    2010-06-01

    To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

  20. Inter-MAR association contributes to transcriptionally active looping events in human beta-globin gene cluster.

    Science.gov (United States)

    Wang, Li; Di, Li-Jun; Lv, Xiang; Zheng, Wei; Xue, Zheng; Guo, Zhi-Chen; Liu, De-Pei; Liang, Chi-Chuan

    2009-01-01

    Matrix attachment regions (MARs) are important in chromatin organization and gene regulation. Although it is known that there are a number of MAR elements in the beta-globin gene cluster, it is unclear that how these MAR elements are involved in regulating beta-globin genes expression. Here, we report the identification of a new MAR element at the LCR (locus control region) of human beta-globin gene cluster and the detection of the inter-MAR association within the beta-globin gene cluster. Also, we demonstrate that SATB1, a protein factor that has been implicated in the formation of network like higher order chromatin structures at some gene loci, takes part in beta-globin specific inter-MAR association through binding the specific MARs. Knocking down of SATB1 obviously reduces the binding of SATB1 to the MARs and diminishes the frequency of the inter-MAR association. As a result, the ACH establishment and the alpha-like globin genes and beta-like globin genes expressions are affected either. In summary, our results suggest that SATB1 is a regulatory factor of hemoglobin genes, especially the early differentiation genes at least through affecting the higher order chromatin structure.

  1. Cryptic splicing events in the iron transporter ABCB7 and other key target genes in SF3B1-mutant myelodysplastic syndromes.

    Science.gov (United States)

    Dolatshad, H; Pellagatti, A; Liberante, F G; Llorian, M; Repapi, E; Steeples, V; Roy, S; Scifo, L; Armstrong, R N; Shaw, J; Yip, B H; Killick, S; Kušec, R; Taylor, S; Mills, K I; Savage, K I; Smith, C W J; Boultwood, J

    2016-12-01

    The splicing factor SF3B1 is the most frequently mutated gene in myelodysplastic syndromes (MDS), and is strongly associated with the presence of ring sideroblasts (RS). We have performed a systematic analysis of cryptic splicing abnormalities from RNA sequencing data on hematopoietic stem cells (HSCs) of SF3B1-mutant MDS cases with RS. Aberrant splicing events in many downstream target genes were identified and cryptic 3' splice site usage was a frequent event in SF3B1-mutant MDS. The iron transporter ABCB7 is a well-recognized candidate gene showing marked downregulation in MDS with RS. Our analysis unveiled aberrant ABCB7 splicing, due to usage of an alternative 3' splice site in MDS patient samples, giving rise to a premature termination codon in the ABCB7 mRNA. Treatment of cultured SF3B1-mutant MDS erythroblasts and a CRISPR/Cas9-generated SF3B1-mutant cell line with the nonsense-mediated decay (NMD) inhibitor cycloheximide showed that the aberrantly spliced ABCB7 transcript is targeted by NMD. We describe cryptic splicing events in the HSCs of SF3B1-mutant MDS, and our data support a model in which NMD-induced downregulation of the iron exporter ABCB7 mRNA transcript resulting from aberrant splicing caused by mutant SF3B1 underlies the increased mitochondrial iron accumulation found in MDS patients with RS.

  2. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  3. Interaction of FKBP5 Gene Variants and Adverse Life Events in Predicting Depression Onset: Results From a 10-Year Prospective Community Study

    Science.gov (United States)

    Zimmermann, Petra; Brückl, Tanja; Nocon, Agnes; Pfister, Hildegard; Binder, Elisabeth B.; Uhr, Manfred; Lieb, Roselind; Moffitt, Terrie E.; Caspi, Avshalom; Holsboer, Florian; Ising, Marcus

    2013-01-01

    Objective The binding protein FKBP5 is an important modulator of the function of the glucocorticoid receptor, the main receptor of the stress horm one system. This turns the FKBP5 gene into a key candidate for gene-environment interactions, which are considered critical for pathogenesis of stress-related disorders. The authors explored gene-environment interactions between FKBP5 gene variants and adverse life events in predicting the first occurrence of a major depressive episode. Method The analyses were based on 884 Caucasians in a 10-year prospective community study. At baseline, they were 14–24 years old and did not fulfill criteria for a major depressive episode. The DSM-IV-based Munich Composite International Diagnostic Interview was used to assess adverse life events preceding baseline and major depressive episodes during follow-up. On the basis of previous findings, five single-nucleotide polymorphisms (SNPs) within the FKBP5 gene were selected for genotyping. Results While the authors did not observe genetic main effects, they found interactions between the five SNPs and traumatic (but not separation) events, with the strongest effect for severe trauma. The effect of trauma on incident major depressive episodes was evident among subjects homozygous for the minor alleles but not subjects with other genotypes. The findings were replicated in the U.K. Environmental Risk Longitudinal Twin Study. Conclusions These hypothesis-driven results suggest that an interaction between FKBP5 genotype and trauma is involved in the onset of depression. Subjects homozygous for the minor alleles of the investigated FKBP5 SNPs seem to be particularly sensitive to effects of trauma exposure in terms of triggering depression onset. PMID:21865530

  4. Recombination events near the immunoglobulin Cmu gene join variable and constant region genes, switch heavy-chain expression, or inactivate the locus.

    Science.gov (United States)

    Cory, S; Webb, E; Gough, J; Adams, J M

    1981-04-28

    Immunoglobulin heavy-chain expression is initiated by recombination between a variable region (VH) gene and one of several joining region (JH) genes located near the mu constant region (Cmu) gene, and the active VH gene can subsequently switch to another CH gene. That the general mechanism for CH switching involves recombination between sites within the JH-Cmu intervening sequence and the 5' flanking region of another CH gene is supported here by Southern blot hybridization analysis of eight IgG- and IgA-secreting plasmacytomas. An alternative model requiring successive VH linkage to similar JH clusters near each CH gene is shown to be very unlikely since the mouse genome appears to contain only one complement of the JH locus and no JH gene was detectable within large cloned sequences flanking germline C gamma 3 and C gamma 1 genes. Thus, VH-JH joining and CH switching are mediated by separate regions of "the joining-switch" or J-S element. In each plasmacytoma examined, the J-S element had undergone recombination within both the JH locus and the switch region and was shown to be linked to the functional CH gene in an IgG3, and IgG1, and three IgA secretors. Both JH joining and CH switching occurred by deletion of DNA. Switch recombination occurred at more than one site within the J-S element in different lines, even for recombination with the same CH gene. Significantly, although heavy-chain expression is restricted to one allele ("allelic exclusion"), all rearranged in each plasmacytoma. Some rearrangements were aberrant, involving, for example, deletion of all JH genes from the allele. Hence, an error-prone recombination machinery may account for allelic exclusion in many plasmacytomas.

  5. A Novel NADPH-Dependent Aldehyde Reductase Gene from Saccharomyces cerevisiae NRRL Y-12632 Involved in the Detoxification of Aldehyde Inhibitors Derived from Lignocellulosic Biomass Conversion

    Science.gov (United States)

    Aldehyde inhibitors such as furfural, 5-hydroxymethylfurfural (HMF), anisaldehyde, benzaldehyde, cinnamaldehyde, and phenylaldehyde are commonly generated during lignocellulosic biomass conversion process for low-cost cellulosic ethanol production that interferes with subsequent microbial growth and...

  6. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    Science.gov (United States)

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  7. Localized conversion in Streptococcus pneumoniae recombination: heteroduplex preference.

    Science.gov (United States)

    Sicard, M; Lefevre, J C; Mostachfi, P; Gasc, A M; Sarda, C

    1985-08-01

    In pneumococcal transformation the frequency of recombinants between point mutations is generally proportional to distance. We have recently described an aberrant marker in the amiA locus that appeared to enhance recombination frequency when crossed with any other allele of this gene. The hyperrecombination that we have observed in two-point crosses could be explained by two hypotheses: the aberrant marker induces frequent crossovers in its vicinity or the mutant is converted to wild type. In this report we present evidence showing that, in suitable three-point crosses, this hyperrecombination does not modify the recombination frequency between outside markers, suggesting that a conversion occurs at the site of this mutation. To estimate the length over which this event occurs, we isolated very closely linked markers and used them in two-point crosses. It appears that the conversion system removes only a few base pairs (from three to 27) around the aberrant marker. This conversion process is quite different from the mismatch-repair system controlled by hex genes in pneumococcus, which involves several thousand base pairs. Moreover, we have constructed artificial heteroduplexes using separated DNA strands. It appears that only one of the two heteroduplexes is specifically converted. The conversion system acts upon 5'..ATTAAT..3'/3'.. TAAGTA..5'. A possible role of the palindrome resulting from the mutation is discussed.

  8. Capturing the biological impact of CDKN2A and MC1R genes as an early predisposing event in melanoma and non melanoma skin cancer

    Science.gov (United States)

    Puig-Butille, Joan Anton; Escámez, María José; Garcia-Garcia, Francisco; Tell-Marti, Gemma; Fabra, Àngels; Martínez-Santamaría, Lucía; Badenas, Celia; Aguilera, Paula; Pevida, Marta; Dopazo, Joaquín; del Río, Marcela; Puig, Susana

    2014-01-01

    Germline mutations in CDKN2A and/or red hair color variants in MC1R genes are associated with an increased susceptibility to develop cutaneous melanoma or non melanoma skin cancer. We studied the impact of the CDKN2A germinal mutation p.G101W and MC1R variants on gene expression and transcription profiles associated with skin cancer. To this end we set-up primary skin cell co-cultures from siblings of melanoma prone-families that were later analyzed using the expression array approach. As a result, we found that 1535 transcripts were deregulated in CDKN2A mutated cells, with over-expression of immunity-related genes (HLA-DPB1, CLEC2B, IFI44, IFI44L, IFI27, IFIT1, IFIT2, SP110 and IFNK) and down-regulation of genes playing a role in the Notch signaling pathway. 3570 transcripts were deregulated in MC1R variant carriers. In particular, genes related to oxidative stress and DNA damage pathways were up-regulated as well as genes associated with neurodegenerative diseases such as Parkinson’s, Alzheimer and Huntington. Finally, we observed that the expression signatures indentified in phenotypically normal cells carrying CDKN2A mutations or MC1R variants are maintained in skin cancer tumors (melanoma and squamous cell carcinoma). These results indicate that transcriptome deregulation represents an early event critical for skin cancer development. PMID:24742402

  9. Evolution of DNA Double-Strand Break Repair by Gene Conversion: Coevolution Between a Phage and a Restriction-Modification System

    Science.gov (United States)

    Yahara, Koji; Horie, Ryota; Kobayashi, Ichizo; Sasaki, Akira

    2007-01-01

    The necessity to repair genome damage has been considered to be an immediate factor responsible for the origin of sex. Indeed, attack by a cellular restriction enzyme of invading DNA from several bacteriophages initiates recombinational repair by gene conversion if there is homologous DNA. In this work, we modeled the interaction between a bacteriophage and a bacterium carrying a restriction enzyme as antagonistic coevolution. We assume a locus on the bacteriophage genome has either a restriction-sensitive or a restriction-resistant allele, and another locus determines whether it is recombination/repair proficient or defective. A restriction break can be repaired by a co-infecting phage genome if one of them is recombination/repair proficient. We define the fitness of phage (resistant/sensitive and repair-positive/-negative) genotypes and bacterial (restriction-positive/-negative) genotypes by assuming random encounter of the genotypes, with given probabilities of single and double infections, and the costs of resistance, repair, and restriction. Our results show the evolution of the repair allele depends on \\documentclass[10pt]{article} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{mathrsfs} \\usepackage{pmc} \\pagestyle{empty} \\oddsidemargin -1.0in \\begin{document} \\begin{equation*}b_{1}/b_{0},\\end{equation*}\\end{document} the ratio of the burst size \\documentclass[10pt]{article} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{mathrsfs} \\usepackage{pmc} \\pagestyle{empty} \\oddsidemargin -1.0in \\begin{document} \\begin{equation*}b_{1}\\end{equation*}\\end{document} under damage to host cell physiology induced by an unrepaired double-strand break to the default burst size \\documentclass[10pt]{article} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage

  10. Temporal Dissection of Rate Limiting Transcriptional Events Using Pol II ChIP and RNA Analysis of Adrenergic Stress Gene Activation.

    Directory of Open Access Journals (Sweden)

    Daniel P Morris

    Full Text Available In mammals, increasing evidence supports mechanisms of co-transcriptional gene regulation and the generality of genetic control subsequent to RNA polymerase II (Pol II recruitment. In this report, we use Pol II Chromatin Immunoprecipitation to investigate relationships between the mechanistic events controlling immediate early gene (IEG activation following stimulation of the α1a-Adrenergic Receptor expressed in rat-1 fibroblasts. We validate our Pol II ChIP assay by comparison to major transcriptional events assessable by microarray and PCR analysis of precursor and mature mRNA. Temporal analysis of Pol II density suggests that reduced proximal pausing often enhances gene expression and was essential for Nr4a3 expression. Nevertheless, for Nr4a3 and several other genes, proximal pausing delayed the time required for initiation of productive elongation, consistent with a role in ensuring transcriptional fidelity. Arrival of Pol II at the 3' cleavage site usually correlated with increased polyadenylated mRNA; however, for Nfil3 and probably Gprc5a expression was delayed and accompanied by apparent pre-mRNA degradation. Intragenic pausing not associated with polyadenylation was also found to regulate and delay Gprc5a expression. Temporal analysis of Nr4a3, Dusp5 and Nfil3 shows that transcription of native IEG genes can proceed at velocities of 3.5 to 4 kilobases/min immediately after activation. Of note, all of the genes studied here also used increased Pol II recruitment as an important regulator of expression. Nevertheless, the generality of co-transcriptional regulation during IEG activation suggests temporal and integrated analysis will often be necessary to distinguish causative from potential rate limiting mechanisms.

  11. Analysis of the interferon gamma (rs2430561, +874T/A functional gene variant in relation to the presence of cardiovascular events in rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Mercedes García-Bermúdez

    Full Text Available OBJECTIVE: Rheumatoid arthritis (RA is a chronic inflammatory disease associated with increased cardiovascular (CV morbidity and mortality. Since interferon-gamma (IFN-γ has a direct effect on inflammation, in this study we assessed the potential association of the IFNG functional gene variant rs2430561 with CV disease in patients with RA. METHODS: One thousand six hundred and thirty-five patients fulfilling the 1987 American College of Rheumatology classification criteria for RA were genotyped for the IFNG (rs2430561, +874T/A gene polymorphism using TaqMan genotyping assay. Patients were stratified according to the presence of CV events or not. Logistic regression models to explain the presence of CV disease according to the IFNG rs2430561 allele distribution were performed. The potential influence of this variant in the development of subclinical atherosclerosis was also analyzed in a subgroup of patients with no history of CV events to determine carotid artery intima-media thickness (IMT (n = 286 and presence of carotid plaques. Levels of the cytokine were determined in a subgroup of patients by ELISA. RESULTS: Adjusted logistic regression model disclosed that presence of the minor allele A was not associated with increased risk of suffering CV events in RA patients. Besides, differences did not achieve statistical significance regarding carotid IMT and presence of carotid plaques in RA patients carrying IFNG rs2430561 variant allele. Levels of IFN-γ were higher in patients who had suffered CV events compared to patients who did not. CONCLUSION: Our results do not support a role of IFNG rs2430561 (+874T/A functional gene variant in the development of CV disease in RA patients.

  12. Conversations with Miss Jane

    Directory of Open Access Journals (Sweden)

    Geneviève Fabre

    2006-05-01

    Full Text Available Considering the wide range of conversations in the autobiography, this essay will attempt to appraise the importance of these verbal exchanges in relation to the overall narrative structure of the book and to the prevalent oral tradition in Louisiana culture, as both an individual and communal expression. The variety of circumstances, the setting and staging, the interlocutors , and the complex intersection of time and place, of stories and History, will be examined; in these conversations with Miss Jane many actors participate, from  the interviewer-narrator, to most characters; even the reader becomes involved.Speaking, hearing, listening, keeping silent is an elaborate ritual that performs many functions; besides conveying news or rumors, it imparts information on the times and on the life of a “representative” woman whose existence - spanning a whole century- is both singular and emblematic. Most importantly this essay will analyse the resonance of an eventful and often dramatic era on her sensibility and conversely show how her evolving sensibility informs that history and draws attention to aspects that might have passed unnoticed or be forever silenced. Jane’s desire for liberty and justice is often challenged as she faces the possibilities of life or death.Conversations build up a complex, often contradictory, but compelling portrait: torn between silence and vehemence, between memories and the urge to meet the future, Jane summons body and mind to find her way through the maze of a fast changing world; self-willed and obstinate she claims her right to speak, to express with wit and wisdom her firm belief in the word, in the ability to express deep seated convictions and faith and a whole array of feelings and emotions.

  13. Gene Expression Patterns Define Key Transcriptional Events InCell-Cycle Regulation By cAMP And Protein Kinase A

    Energy Technology Data Exchange (ETDEWEB)

    Zambon, Alexander C.; Zhang, Lingzhi; Minovitsky, Simon; Kanter, Joan R.; Prabhakar, Shyam; Salomonis, Nathan; Vranizan, Karen; Dubchak Inna,; Conklin, Bruce R.; Insel, Paul A.

    2005-06-01

    Although a substantial number of hormones and drugs increase cellular cAMP levels, the global impact of cAMP and its major effector mechanism, protein kinase A (PKA), on gene expression is not known. Here we show that treatment of murine wild-type S49 lymphoma cells for 24 h with 8-(4-chlorophenylthio)-cAMP (8-CPTcAMP), a PKA-selective cAMP analog, alters the expression of approx equal to 4,500 of approx. equal to 13,600 unique genes. By contrast, gene expression was unaltered in Kin- S49 cells (that lack PKA) incubated with 8-CPTcAMP. Changes in mRNA and protein expression of several cell cycle regulators accompanied cAMP-induced G1-phase cell-cycle arrest of wild-type S49 cells. Within 2h, 8-CPT-cAMP altered expression of 152 genes that contain evolutionarily conserved cAMP-response elements within 5 kb of transcriptional start sites, including the circadian clock gene Per1. Thus, cAMP through its activation of PKA produces extensive transcriptional regulation in eukaryotic cells. These transcriptional networks include a primary group of cAMP-response element-containing genes and secondary networks that include the circadian clock.

  14. Systematic analysis of human kinase genes: a large number of genes and alternative splicing events result in functional and structural diversity

    Science.gov (United States)

    Milanesi, Luciano; Petrillo, Mauro; Sepe, Leandra; Boccia, Angelo; D'Agostino, Nunzio; Passamano, Myriam; Di Nardo, Salvatore; Tasco, Gianluca; Casadio, Rita; Paolella, Giovanni

    2005-01-01

    Background Protein kinases are a well defined family of proteins, characterized by the presence of a common kinase catalytic domain and playing a significant role in many important cellular processes, such as proliferation, maintenance of cell shape, apoptosys. In many members of the family, additional non-kinase domains contribute further specialization, resulting in subcellular localization, protein binding and regulation of activity, among others. About 500 genes encode members of the kinase family in the human genome, and although many of them represent well known genes, a larger number of genes code for proteins of more recent identification, or for unknown proteins identified as kinase only after computational studies. Results A systematic in silico study performed on the human genome, led to the identification of 5 genes, on chromosome 1, 11, 13, 15 and 16 respectively, and 1 pseudogene on chromosome X; some of these genes are reported as kinases from NCBI but are absent in other databases, such as KinBase. Comparative analysis of 483 gene regions and subsequent computational analysis, aimed at identifying unannotated exons, indicates that a large number of kinase may code for alternately spliced forms or be incorrectly annotated. An InterProScan automated analysis was perfomed to study domain distribution and combination in the various families. At the same time, other structural features were also added to the annotation process, including the putative presence of transmembrane alpha helices, and the cystein propensity to participate into a disulfide bridge. Conclusion The predicted human kinome was extended by identifiying both additional genes and potential splice variants, resulting in a varied panorama where functionality may be searched at the gene and protein level. Structural analysis of kinase proteins domains as defined in multiple sources together with transmembrane alpha helices and signal peptide prediction provides hints to function assignment

  15. Association of β-adrenergic receptor genes polymorphisms with incidence of subsequent cardiovascular events in Han Chinese patients with coronary artery disease

    Institute of Scientific and Technical Information of China (English)

    LI Zhi-gen; WU Hong; ZHOU Ying-ling; CHEN Zhu-jun; MENG Jin-xiu; YANG Jun-qing; CHEN Ji-yan

    2013-01-01

    Background Sequence variants in the β-adrenergic receptor (ADRB) genes have a close relationship with the development of coronary artery disease (CAD) and the patient's prognosis.However,there is a lack of data on the role of the variants in ADRBs genes in Han Chinese patients with CAD.We aimed to investigate the association of genetic variants in the ADRB1 and ADRB2 genes with the incidence of major adverse cardiac event (MACE) in Han Chinese patients with CAD.Methods A total of 545 Han Chinese patients with CAD undergoing percutaneous coronary intervention (PCI) were recruited to the study and followed for one year.Three variant sites in ADRB1 (rs1801253) and ADRB2 (rs1042713 and rs1042714) were genotyped.The effect of the ADRB1 and ADRB2 genotypes on MACE within one year was assessed.Results There were 47 cases of MACE during follow-up.There was no significant difference in the incidence of MACE among patients carrying different genotypes of the three variants in ADRB1 and ADRB2 (Log-rank,all P >0.05).Cox regression analysis showed no association between three variants in ADRB1 and ADRB2 genes and the incidence of MACE during one-year follow-up,the adjusted hazard ratios (95% confidence interval) for rs1801253,rs1042713 and rs1042714 were 1.05 (0.54-2.02),1.24 (0.58-2.64) and 1.66 (0.81-3.42),respectively.Conclusion Our data did not support a relationship between the three polymorphisms of ADRB1 (rs1801253) and ADRB2 (rs1042713 and rs1042714) genes and risk of subsequent cardiovascular events after PCI in Han Chinese patients with CAD.

  16. Gene expression profiling of preovulatory follicle in the buffalo cow: effects of increased IGF-I concentration on periovulatory events.

    Directory of Open Access Journals (Sweden)

    Jyotsna U Rao

    Full Text Available The preovulatory follicle in response to gonadotropin surge undergoes dramatic biochemical, and morphological changes orchestrated by expression changes in hundreds of genes. Employing well characterized bovine preovulatory follicle model, granulosa cells (GCs and follicle wall were collected from the preovulatory follicle before, 1, 10 and 22 h post peak LH surge. Microarray analysis performed on GCs revealed that 450 and 111 genes were differentially expressed at 1 and 22 h post peak LH surge, respectively. For validation, qPCR and immunocytochemistry analyses were carried out for some of the differentially expressed genes. Expression analysis of many of these genes showed distinct expression patterns in GCs and the follicle wall. To study molecular functions and genetic networks, microarray data was analyzed using Ingenuity Pathway Analysis which revealed majority of the differentially expressed genes to cluster within processes like steroidogenesis, cell survival and cell differentiation. In the ovarian follicle, IGF-I is established to be an important regulator of the above mentioned molecular functions. Thus, further experiments were conducted to verify the effects of increased intrafollicular IGF-I levels on the expression of genes associated with the above mentioned processes. For this purpose, buffalo cows were administered with exogenous bGH to transiently increase circulating and intrafollicular concentrations of IGF-I. The results indicated that increased intrafollicular concentrations of IGF-I caused changes in expression of genes associated with steroidogenesis (StAR, SRF and apoptosis (BCL-2, FKHR, PAWR. These results taken together suggest that onset of gonadotropin surge triggers activation of various biological pathways and that the effects of growth factors and peptides on gonadotropin actions could be examined during preovulatory follicle development.

  17. Temporal variations in the gene expression levels of cyanobacterial anti-oxidant enzymes through geological history: implications for biological evolution during the Great Oxidation Event

    Science.gov (United States)

    Harada, M.; Furukawa, R.; Yokobori, S. I.; Tajika, E.; Yamagishi, A.

    2016-12-01

    A significant rise in atmospheric O2 levels during the GOE (Great Oxidation Event), ca. 2.45-2.0 Ga, must have caused a great stress to biosphere, enforcing life to adapt to oxic conditions. Cyanobacteria, oxygenic photosynthetic bacteria that had been responsible for the GOE, are at the same time one of the organisms that would have been greatly affected by the rise of O2 level in the surface environments. Knowledge on the evolution of cyanobacteria is not only important to elucidate the cause of the GOE, but also helps us to better understand the adaptive evolution of life in response to the GOE. Here we performed phylogenetic analysis of an anti-oxidant enzyme Fe-SOD (iron superoxide dismutase) of cyanobacteria, to assess the adaptive evolution of life under the GOE. The rise of O2 level must have increased the level of toxic reactive oxygen species in cyanobacterial cells, thus forced them to change activities or the gene expression levels of Fe-SOD. In the present study, we focus on the change in the gene expression levels of the enzyme, which can be estimated from the promoter sequences of the gene. Promoters are DNA sequences found upstream of protein encoding regions, where RNA polymerase binds and initiates transcription. "Strong" promoters that efficiently interact with RNA polymerase induce high rates of transcription, leading to high levels of gene expression. Thus, from the temporal changes in the promoter sequences, we can estimate the variations in the gene expression levels during the geological time. Promoter sequences of Fe-SOD at each ancestral node of cyanobacteria were predicted from phylogenetic analysis, and the ancestral promoter sequences were compared to the promoters of known highly expressed genes. The similarity was low at the time of the emergence of cyanobacteria; however, increased at the branching nodes diverged 2.4 billon years ago. This roughly coincided with the onset of the GOE, implying that the transition from low to high gene

  18. Low TLR7 gene expression in atherosclerotic plaques is associated with major adverse cardio- and cerebrovascular events

    DEFF Research Database (Denmark)

    Karadimou, Glykeria; Folkersen, Lasse; Berg, Martin;

    2016-01-01

    Aims: Processes in the development of atherosclerotic lesions can lead to plaque rupture or erosion, which can in turn elicit myocardial infarction or ischaemic stroke. The aims of this study were to determine whether Toll-like receptor 7 (TLR7) gene expression levels influence patient outcome an...

  19. Transcription and double-strand breaks induce similar mitotic recombination events in Saccharomyces cerevisiae.

    Science.gov (United States)

    González-Barrera, Sergio; García-Rubio, María; Aguilera, Andrés

    2002-10-01

    We have made a comparative analysis of double-strand-break (DSB)-induced recombination and spontaneous recombination under low- and high-transcription conditions in yeast. We constructed two different recombination substrates, one for the analysis of intermolecular gene conversions and the other for intramolecular gene conversions and inversions. Such substrates were based on the same leu2-HOr allele fused to the tet promoter and containing a 21-bp HO site. Gene conversions and inversions were differently affected by rad1, rad51, rad52, and rad59 single and double mutations, consistent with the actual view that such events occur by different recombination mechanisms. However, the effect of each mutation on each type of recombination event was the same, whether associated with transcription or induced by the HO-mediated DSB. Both the highly transcribed DNA and the HO-cut sequence acted as recipients of the gene conversion events. These results are consistent with the hypothesis that transcription promotes initiation of recombination along the DNA sequence being transcribed. The similarity between transcription-associated and DSB-induced recombination suggests that transcription promotes DNA breaks.

  20. Major mutation events in structural genes of peste des petits ruminants virus through serial passages in vitro.

    Science.gov (United States)

    Wu, Xiaodong; Liu, Fuxiao; Li, Lin; Zou, Yanli; Liu, Shan; Wang, Zhiliang

    2016-06-01

    Peste des petits ruminants (PPR) is an highly contagious disease of small ruminants, and caused by peste des petits ruminants virus (PPRV), a member of the genus Morbillivirus in the family Paramyxoviridae. The first outbreak of PPR in China was officially reported in July 2007, when a PPRV strain was successfully isolated from a sick goat in Tibet, followed by sequencing at a full-genome level (China/Tibet/Geg/07-30, GenBank: FJ905304.1). To date, this isolate has been virulently attenuated by more than 90 serial passages in Vero-Dog-SLAM cells at our laboratory. In this study, a total of nine strains by serial passages (namely the 10th, 20th, 30th, 40th, 50th, 60th, 70th, 80th, and 90th passages) were chosen for sequencing of six structural genes in PPRV. The sequence analysis showed that mutation rates in all viral genes were relatively low, and only a few identical mutations within certain genes were stably maintained after an earlier passage, perhaps indicating a predominance of mutants after such a passage.

  1. Horizontal gene transfer and functional diversification of plant cell wall degrading polygalacturonases: Key events in the evolution of herbivory in beetles.

    Science.gov (United States)

    Kirsch, Roy; Gramzow, Lydia; Theißen, Günter; Siegfried, Blair D; Ffrench-Constant, Richard H; Heckel, David G; Pauchet, Yannick

    2014-09-01

    Plant cell walls are the largest reservoir of organic carbon on earth. To breach and utilize this carbohydrate-rich protective barrier, microbes secrete plant cell wall degrading enzymes (PCWDEs) targeting pectin, cellulose and hemicelluloses. There is a growing body of evidence that genomes of some herbivorous insects also encode PCWDEs, raising questions about their evolutionary origins and functions. Among herbivorous beetles, pectin-degrading polygalacturonases (PGs) are found in the diverse superfamilies Chrysomeloidea (leaf beetles, long-horn beetles) and Curculionoidea (weevils). Here our aim was to test whether these arose from a common ancestor of beetles or via horizontal gene transfer (HGT), and whether PGs kept their ancestral function in degrading pectin or evolved novel functions. Transcriptome data derived from 10 beetle species were screened for PG-encoding sequences and used for phylogenetic comparisons with their bacterial, fungal and plant counterparts. These analyses revealed a large family of PG-encoding genes of Chrysomeloidea and Curculionoidea sharing a common ancestor, most similar to PG genes of ascomycete fungi. In addition, 50 PGs from beetle digestive systems were heterologously expressed and functionally characterized, showing a set of lineage-specific consecutively pectin-degrading enzymes, as well as conserved but enzymatically inactive PG proteins. The evidence indicates that a PG gene was horizontally transferred ∼200 million years ago from an ascomycete fungus to a common ancestor of Chrysomeloidea and Curculionoidea. This has been followed by independent duplications in these two lineages, as well as independent replacement in two sublineages of Chrysomeloidea by two other subsequent HGTs. This origin, leading to subsequent functional diversification of the PG gene family within its new hosts, was a key event promoting the evolution of herbivory in these beetles. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. In situ detection of the hypermethylation-induced inactivation of the p16 gene as an early event in oncogenesis

    OpenAIRE

    Nuovo,Gerard J; Plaia, Todd W.; Steven A Belinsky; Baylin, Stephen B.; Herman, James G.

    1999-01-01

    We have developed a technique, methylation-specific PCR in situ hybridization (MSP-ISH), which allows for the methylation status of specific DNA sequences to be visualized in individual cells. We use MSP-ISH to monitor the timing and consequences of aberrant hypermethylation of the p16 tumor suppresser gene during the progression of cancers of the lung and cervix. Hypermethylation of p16 was localized only to the neoplastic cells in both in situ lesions and invasive cancers, and was associate...

  3. Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution

    Directory of Open Access Journals (Sweden)

    Tartar Aurélien

    2010-06-01

    Full Text Available Abstract Background Glutamine synthetase (GS is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae, and additional green algal (Chlorophyceae and Prasinophytae and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB and eukaryotic (GSIIE GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT. Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida. However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting

  4. High ABCC2 and Low ABCG2 Gene Expression Are Early Events in the Colorectal Adenoma-Carcinoma Sequence

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Vogel, Lotte K.; Kopp, Tine Iskov

    2015-01-01

    Development of colorectal cancer (CRC) may result from a dysfunctional interplay between diet, gut microbes and the immune system. The ABC transport proteins ABCB1 (P-glycoprotein, Multidrug resistance protein 1, MDR1), ABCC2 (MRP2) and ABCG2 (BCRP) are involved in transport of various compounds...... across the epithelial barrier. Low mRNA level of ABCB1 has previously been identified as an early event in colorectal carcinogenesis (Andersen et al., PLoS One. 2013 Aug 19; 8(8): e72119). ABCC2 and ABCG2 mRNA levels were assessed in intestinal tissue from 122 CRC cases, 106 adenoma cases (12 with severe...... in carcinogenesis suggesting that these ABC transporters are involved in the early steps of carcinogenesis as previously reported for ABCB1. These results suggest that dysfunctional transport across the epithelial barrier may contribute to colorectal carcinogenesis....

  5. The Interacting Effect of the BDNF Val66Met Polymorphism and Stressful Life Events on Adolescent Depression Is Not an Artifact of Gene-Environment Correlation: Evidence from a Longitudinal Twin Study

    Science.gov (United States)

    Chen, Jie; Li, Xinying; McGue, Matt

    2013-01-01

    Background: Confounding introduced by gene-environment correlation (rGE) may prevent one from observing a true gene-environment interaction (G × E) effect on psychopathology. The present study investigated the interacting effect of the BDNF Val66Met polymorphism and stressful life events (SLEs) on adolescent depression while controlling for the…

  6. Inhibition of PID1/NYGGF4/PCLI1 gene expression highlights its role in the early events of the cell cycle in NIH3T3 fibroblasts.

    Science.gov (United States)

    Monteleone, Francesca; Vitale, Monica; Caratù, Ginevra; D'Ambrosio, Chiara; Di Giovanni, Stefano; Gorrese, Marisa; Napolitano, Francesco; Romano, Maria Fiammetta; Del Vecchio, Luigi; Succoio, Mariangela; Scaloni, Andrea; Zambrano, Nicola

    2016-01-01

    The PID1/NYGGF4/PCLI1 gene encodes for a protein with a phosphotyrosine-binding domain, which interacts with the lipoprotein receptor-related protein 1. Previous work by us and others suggested a function of the gene in cell proliferation of NIH3T3 fibroblasts and 3T3-L1 pre-adipocytes. The molecular characterization of PCLI1 protein, ectopically expressed in NIH3T3 fibroblasts, revealed two phosphorylation sites at Ser154 and Ser165. In order to clarify the functions of this gene, we analyzed the effects of its downregulation on cellular proliferation and cell cycle progression in NIH3T3 cell cultures. Downregulation of PID1/NYGGF4/PCLI1 mRNA levels by short hairpin RNAs (shRNAs) elicited decreased proliferation rate in mammalian cell lines; cell cycle analysis of serum-starved, synchronized NIH3T3 fibroblasts showed an increased accumulation of shRNA-interfered cells in the G1 phase. Decreased levels of FOS and MYC mRNAs were accordingly associated with these events. The molecular scenario emerging from our data suggests that PID1/NYGGF4/PCLI1 controls cellular proliferation and cell cycle progression in NIH3T3 cells.

  7. Influence of Serotonin Transporter Gene Polymorphisms and Adverse Life Events on Depressive Symptoms in the Elderly: A Population-Based Study

    Science.gov (United States)

    Davin, Annalisa; Monti, Maria Cristina; Polito, Letizia; Vaccaro, Roberta; Abbondanza, Simona; Gnesi, Marco; Villani, Simona; Guaita, Antonio

    2015-01-01

    Background Depression is common in the elderly. The role of genetic and environmental factors in modulating depressive symptoms is not clear. Methods We evaluated the influence of serotonin transporter gene polymorphisms and recent adverse life events on depressive symptoms in an elderly Italian population. We used data from “InveCe.Ab”, a population-based study of 1321 subjects aged 70–74 years. We used the 15-item Geriatric Depression Scale (GDS) to assess depressive symptoms–a GDS score ≥5 points (GDS≥5) indicated the presence of clinically relevant symptoms–and performed 5-HTTLPR and rs25531 genotyping to obtain the triallelic polymorphism of the serotonin transporter. We used the Geriatric Adverse Life Events Scale to measure adverse life events, and logistic regression models to evaluate the role of genotype and recent adverse life events in depressive symptoms, controlling for potential confounders and independent predictors. Results Two hundred subjects (15.76%) had a GDS≥5. The 5-HTTLPR triallelic polymorphism was significantly associated with GDS≥5. Only S′S′ carriers showed an increased risk of depressive symptoms (ORadj = 1.81, p = .022); one extra adverse life event increased this risk by 14% (p = .061) independently of genotype. Other factors significantly related to GDS≥5 were: female gender (ORadj = 2.49, p depression (ORadj = 4.73, p depressive symptoms by 57% (p = .005) only in the L′L′ carriers, while antidepressant intake was directly related to GDS≥5 in the L′S′ carriers (ORadj = 2.46, p = .036) and borderline significant in the S′S′ carriers (ORadj = 2.41, p = .081). Discussion The S′S′ genotype and recent exposure to adverse life events were independently associated with depressive symptoms. The S′S′ genotype, compared with the environment, exerted a predominant effect on depressive symptoms, suggesting that it reduces the efficacy of antidepressant therapy. We conclude that genetics may be an

  8. In situ detection of the hypermethylation-induced inactivation of the p16 gene as an early event in oncogenesis.

    Science.gov (United States)

    Nuovo, G J; Plaia, T W; Belinsky, S A; Baylin, S B; Herman, J G

    1999-10-26

    We have developed a technique, methylation-specific PCR in situ hybridization (MSP-ISH), which allows for the methylation status of specific DNA sequences to be visualized in individual cells. We use MSP-ISH to monitor the timing and consequences of aberrant hypermethylation of the p16 tumor suppresser gene during the progression of cancers of the lung and cervix. Hypermethylation of p16 was localized only to the neoplastic cells in both in situ lesions and invasive cancers, and was associated with loss of p16 protein expression. MSP-ISH allowed us to dissect the surprising finding that p16 hypermethylation occurs in cervical carcinoma. This tumor is associated with infection of the oncogenic human papillomavirus, which expresses a protein, E7, that inactivates the retinoblastoma (Rb) protein. Thus, simultaneous Rb and p16 inactivation would not be needed to abrogate the critical cyclin D-Rb pathway. MSP-ISH reveals that p16 hypermethylation occurs heterogeneously within early cervical tumor cell populations that are separate from those expressing viral E7 transcripts. In advanced cervical cancers, the majority of cells have a hypermethylated p16, lack p16 protein, but no longer express E7. These data suggest that p16 inactivation is selected as the most effective mechanism of blocking the cyclin D-Rb pathway during the evolution of an invasive cancer from precursor lesions. These studies demonstrate that MSP-ISH is a powerful approach for studying the dynamics of aberrant methylation of critical tumor suppressor genes during tumor evolution.

  9. Resistance to dual-gene Bt maize in Spodoptera frugiperda: selection, inheritance, and cross-resistance to other transgenic events

    Science.gov (United States)

    Santos-Amaya, Oscar F.; Rodrigues, João V. C.; Souza, Thadeu C.; Tavares, Clébson S.; Campos, Silverio O.; Guedes, Raul N.C.; Pereira, Eliseu J.G.

    2015-01-01

    Transgenic crop “pyramids” producing two or more Bacillus thuringiensis (Bt) toxins active against the same pest are used to delay evolution of resistance in insect pest populations. Laboratory and greenhouse experiments were performed with fall armyworm, Spodoptera frugiperda, to characterize resistance to Bt maize producing Cry1A.105 and Cry2Ab and test some assumptions of the “pyramid” resistance management strategy. Selection of a field-derived strain of S. frugiperda already resistant to Cry1F maize with Cry1A.105 + Cry2Ab maize for ten generations produced resistance that allowed the larvae to colonize and complete the life cycle on these Bt maize plants. Greenhouse experiments revealed that the resistance was completely recessive (Dx = 0), incomplete, autosomal, and without maternal effects or cross-resistance to the Vip3Aa20 toxin produced in other Bt maize events. This profile of resistance supports some of the assumptions of the pyramid strategy for resistance management. However, laboratory experiments with purified Bt toxin and plant leaf tissue showed that resistance to Cry1A.105 + Cry2Ab2 maize further increased resistance to Cry1Fa, which indicates that populations of fall armyworm have high potential for developing resistance to some currently available pyramided maize used against this pest, especially where resistance to Cry1Fa was reported in the field. PMID:26675246

  10. Resistance to dual-gene Bt maize in Spodoptera frugiperda: selection, inheritance, and cross-resistance to other transgenic events.

    Science.gov (United States)

    Santos-Amaya, Oscar F; Rodrigues, João V C; Souza, Thadeu C; Tavares, Clébson S; Campos, Silverio O; Guedes, Raul N C; Pereira, Eliseu J G

    2015-12-17

    Transgenic crop "pyramids" producing two or more Bacillus thuringiensis (Bt) toxins active against the same pest are used to delay evolution of resistance in insect pest populations. Laboratory and greenhouse experiments were performed with fall armyworm, Spodoptera frugiperda, to characterize resistance to Bt maize producing Cry1A.105 and Cry2Ab and test some assumptions of the "pyramid" resistance management strategy. Selection of a field-derived strain of S. frugiperda already resistant to Cry1F maize with Cry1A.105 + Cry2Ab maize for ten generations produced resistance that allowed the larvae to colonize and complete the life cycle on these Bt maize plants. Greenhouse experiments revealed that the resistance was completely recessive (Dx = 0), incomplete, autosomal, and without maternal effects or cross-resistance to the Vip3Aa20 toxin produced in other Bt maize events. This profile of resistance supports some of the assumptions of the pyramid strategy for resistance management. However, laboratory experiments with purified Bt toxin and plant leaf tissue showed that resistance to Cry1A.105 + Cry2Ab2 maize further increased resistance to Cry1Fa, which indicates that populations of fall armyworm have high potential for developing resistance to some currently available pyramided maize used against this pest, especially where resistance to Cry1Fa was reported in the field.

  11. The crtS gene of Xanthophyllomyces dendrorhous encodes a novel cytochrome-P450 hydroxylase involved in the conversion of beta-carotene into astaxanthin and other xanthophylls.

    Science.gov (United States)

    Alvarez, Vanessa; Rodríguez-Sáiz, Marta; de la Fuente, Juan Luis; Gudiña, Eduardo J; Godio, Ramiro P; Martín, Juan F; Barredo, José Luis

    2006-04-01

    The conversion of beta-carotene into xanthophylls is a subject of great scientific and industrial interest. We cloned the crtS gene involved in astaxanthin biosynthesis from two astaxanthin producing strains of Xanthophyllomyces dendrorhous: VKPM Y2410, an astaxanthin overproducing strain, and the wild type ATCC 24203. In both cases, the ORF has a length of 3166 bp, including 17 introns, and codes for a protein of 62.6 kDa with similarity to cytochrome-P450 hydroxylases. crtS gene sequences from strains VKPM Y2410, ATCC 24203, ATCC 96594, and ATCC 96815 show several nucleotide changes, but none of them causes any amino acid substitution, except a G2268 insertion in the 13th exon of ATCC 96815 which causes a change in the reading frame. A G1470 --> A change in the 5' splicing region of intron 8 was also found in ATCC 96815. Both point mutations explain astaxanthin idiotrophy and beta-carotene accumulation in ATCC 96815. Mutants accumulating precursors of the astaxanthin biosynthetic pathway were selected from the parental strain VKPM Y2410 (red) showing different colors depending on the compound accumulated. Two of them were blocked in the biosynthesis of astaxanthin, M6 (orange; 1% astaxanthin, 71 times more beta-carotene) and M7 (orange; 1% astaxanthin, 58 times more beta-carotene, 135% canthaxanthin), whereas the rest produced lower levels of astaxanthin (5-66%) than the parental strain. When the crtS gene was expressed in M7, canthaxanthin accumulation disappeared and astaxanthin production was partially restored. Moreover, astaxanthin biosynthesis was restored when X. dendrorhous ATCC 96815 was transformed with the crtS gene. The crtS gene was heterologously expressed in Mucor circinelloides conferring to this fungus an improved capacity to synthesize beta-cryptoxanthin and zeaxanthin, two hydroxylated compounds from beta-carotene. These results show that the crtS gene is involved in the conversion of beta-carotene into xanthophylls, being potentially useful to

  12. Phylogenetic analysis of eukaryotic NEET proteins uncovers a link between a key gene duplication event and the evolution of vertebrates

    Science.gov (United States)

    Inupakutika, Madhuri A.; Sengupta, Soham; Nechushtai, Rachel; Jennings, Patricia A.; Onuchic, Jose’ N.; Azad, Rajeev K.; Padilla, Pamela; Mittler, Ron

    2017-02-01

    NEET proteins belong to a unique family of iron-sulfur proteins in which the 2Fe-2S cluster is coordinated by a CDGSH domain that is followed by the “NEET” motif. They are involved in the regulation of iron and reactive oxygen metabolism, and have been associated with the progression of diabetes, cancer, aging and neurodegenerative diseases. Despite their important biological functions, the evolution and diversification of eukaryotic NEET proteins are largely unknown. Here we used the three members of the human NEET protein family (CISD1, mitoNEET; CISD2, NAF-1 or Miner 1; and CISD3, Miner2) as our guides to conduct a phylogenetic analysis of eukaryotic NEET proteins and their evolution. Our findings identified the slime mold Dictyostelium discoideum’s CISD proteins as the closest to the ancient archetype of eukaryotic NEET proteins. We further identified CISD3 homologs in fungi that were previously reported not to contain any NEET proteins, and revealed that plants lack homolog(s) of CISD3. Furthermore, our study suggests that the mammalian NEET proteins, mitoNEET (CISD1) and NAF-1 (CISD2), emerged via gene duplication around the origin of vertebrates. Our findings provide new insights into the classification and expansion of the NEET protein family, as well as offer clues to the diverged functions of the human mitoNEET and NAF-1 proteins.

  13. Effect of variable number of tandem repeats polymorphism in the human dopamine transporter gene on conflict information processing according to event-related potential

    Institute of Scientific and Technical Information of China (English)

    Chunyu Han; Yuping Wang; Xin Wang; Ying Liu

    2010-01-01

    The dopamine transporter(DAT)is responsible for dopamine reuptake from the synaptic cleft.A variable number of tandem repeats polymorphism in the DAT gene is related to DAT availability and has been associated with cognition.With the advantage of high-time resolution,event-related potential is an important method to study the time course of human information processing.Previous results have suggested that dopamine exhibits a close relationship with conflicting information processing.Therefore,the present study assumed that conflicting information processing could be influenced by DAT variable number of tandem repeats polymorphism.To confirm this,the present study analyzed the influence of DAT genotypes on N270,which is presumed to reflect neural activity of conflict information processing in young healthy adults.A S1-S2 matching task was performed in healthy adults with 10/10 genotype(n = 14)and 10/9genotypes(n = 14),respectively,when event-related potentials were recorded.Results demonstrated that subjects with the 10/10 genotype exhibited shorter N270 latency and quicker reaction times compared with subjects with the 10/9 genotype.There were no differences in N270amplitude between the two genotypes.These results suggested that 10/10 genotype subjects more efficiently processed conflict information.

  14. Event Management

    OpenAIRE

    Havlenová, Tereza

    2016-01-01

    Event is an experience that is perceived by all the senses. Event management is a process involving the various activities that are assigned to staffers. Organizing special events became an individual field. If the manager understand the events as a communication platform gets into the hands of a modern, multifunctional and very impressive tool. The procedure to implement a successful event in a particular area is part of this work. The first part explains the issues of event management on th...

  15. Diversity of cystathionine ß-synthase haplotypes bearing the most common homocystinuria mutation c.833T>C: a possible role for gene conversion

    DEFF Research Database (Denmark)

    Vyletal, P; Sokolová, J; Cooper, DN;

    2007-01-01

    Homozygosity or compound heterozygosity for the c.833T>C transition (p.I278 T) in the cystathionine beta-synthase (CBS) gene represents the most common cause of pyridoxine-responsive homocystinuria in Western Eurasians. However, the frequency of the pathogenic c.833C allele, as observed in healthy...

  16. De novo intrachromosomal gene conversion from OPN1MW to OPN1LW in the male germline results in Blue Cone Monochromacy

    NARCIS (Netherlands)

    Buena-Atienza, Elena; Ruether, Klaus; Baumann, Britta; Bergholz, Richard; Birch, David; De Baere, Elfride; Dollfus, Helene; Greally, Marie T.; Gustavsson, Peter; Hamel, Christian P.; Heckenlively, John R.; Leroy, Bart P.; Plomp, Astrid S.; Pott, Jan Willem R.; Rose, Katherine; Rosenberg, Thomas; Stark, Zornitza; Verheij, Joke B. G. M.; Weleber, Richard; Zobor, Ditta; Weisschuh, Nicole; Kohl, Susanne; Wissinger, Bernd

    2016-01-01

    X-linked cone dysfunction disorders such as Blue Cone Monochromacy and X-linked Cone Dystrophy are characterized by complete loss (of) or reduced L-and M-cone function due to defects in the OPN1LW/OPN1MW gene cluster. Here we investigated 24 affected males from 16 families with either a structurally

  17. Amplification of the Insulin-Like Growth Factor 1 Receptor Gene Is a Rare Event in Adrenocortical Adenocarcinomas: Searching for Potential Mechanisms of Overexpression

    Directory of Open Access Journals (Sweden)

    Tamaya Castro Ribeiro

    2014-01-01

    Full Text Available Context. IGF1R overexpression appears to be a prognostic biomarker of metastatic pediatric adrenocortical tumors. However, the molecular mechanisms that are implicated in its upregulation remain unknown. Aim. To investigate the potential mechanisms involved in IGF1R overexpression. Patients and Methods. We studied 64 adrenocortical tumors. IGF1R copy number variation was determined in all patients using MLPA and confirmed using real time PCR. In a subgroup of 32 patients, automatic sequencing was used to identify IGF1R allelic variants and the expression of microRNAs involved in IGF1R regulation by real time PCR. Results. IGF1R amplification was detected in an adrenocortical carcinoma that was diagnosed in a 46-year-old woman with Cushing’s syndrome and virilization. IGF1R overexpression was demonstrated in this case. In addition, gene amplification of other loci was identified in this adrenocortical malignant tumor, but no IGF1R copy number variation was evidenced in the remaining cases. Automatic sequencing revealed three known polymorphisms but they did not correlate with its expression. Expression of miR-100, miR-145, miR-375, and miR-126 did not correlate with IGF1R expression. Conclusion. We demonstrated amplification and overexpression of IGF1R gene in only one adrenocortical carcinoma, suggesting that these combined events are uncommon. In addition, IGF1R polymorphisms and abnormal microRNA expression did not correlate with IGF1R upregulation in adrenocortical tumors.

  18. LimTox: a web tool for applied text mining of adverse event and toxicity associations of compounds, drugs and genes.

    Science.gov (United States)

    Cañada, Andres; Capella-Gutierrez, Salvador; Rabal, Obdulia; Oyarzabal, Julen; Valencia, Alfonso; Krallinger, Martin

    2017-05-22

    A considerable effort has been devoted to retrieve systematically information for genes and proteins as well as relationships between them. Despite the importance of chemical compounds and drugs as a central bio-entity in pharmacological and biological research, only a limited number of freely available chemical text-mining/search engine technologies are currently accessible. Here we present LimTox (Literature Mining for Toxicology), a web-based online biomedical search tool with special focus on adverse hepatobiliary reactions. It integrates a range of text mining, named entity recognition and information extraction components. LimTox relies on machine-learning, rule-based, pattern-based and term lookup strategies. This system processes scientific abstracts, a set of full text articles and medical agency assessment reports. Although the main focus of LimTox is on adverse liver events, it enables also basic searches for other organ level toxicity associations (nephrotoxicity, cardiotoxicity, thyrotoxicity and phospholipidosis). This tool supports specialized search queries for: chemical compounds/drugs, genes (with additional emphasis on key enzymes in drug metabolism, namely P450 cytochromes-CYPs) and biochemical liver markers. The LimTox website is free and open to all users and there is no login requirement. LimTox can be accessed at: http://limtox.bioinfo.cnio.es. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Influence of nitrous oxide anesthesia, B-vitamins, and MTHFR gene polymorphisms on perioperative cardiac events: the vitamins in nitrous oxide (VINO) randomized trial.

    Science.gov (United States)

    Nagele, Peter; Brown, Frank; Francis, Amber; Scott, Mitchell G; Gage, Brian F; Miller, J Philip

    2013-07-01

    Nitrous oxide causes an acute increase in plasma homocysteine that is more pronounced in patients with the methylenetetrahydrofolate reductase (MTHFR) C677T or A1298C gene variant. In this randomized controlled trial, the authors sought to determine whether patients carrying the MTHFR C677T or A1298C variant had a higher risk for perioperative cardiac events after nitrous oxide anesthesia and whether this risk could be mitigated by B-vitamins. The authors randomized adult patients with cardiac risk factors undergoing noncardiac surgery, to receive nitrous oxide plus intravenous B-vitamins before and after surgery, or to nitrous oxide and placebo. Serial cardiac biomarkers and 12-lead electrocardiograms were obtained. The primary study endpoint was the incidence of myocardial injury, as defined by cardiac troponin I increase within the first 72 h after surgery. A total of 500 patients completed the trial. Patients who were homozygous for either MTHFR C677T, or A1298C gene variant (n=98; 19.6%) had no increased rate of postoperative cardiac troponin I increase compared with wild-type and heterozygous patients (11.2 vs. 14.0%; relative risk 0.96; 95% CI, 0.85-1.07; P=0.48). B-vitamins blunted the rise in homocysteine, but had no effect on cardiac troponin I increase compared with patients receiving placebo (13.2 vs. 13.6%; relative risk 1.02; 95% CI 0.78 to 1.32; P=0.91). Neither MTHFR C677T and A1298C gene variant, nor acute homocysteine increase are associated with perioperative cardiac troponin increase after nitrous oxide anesthesia. B-vitamins blunt nitrous oxide-induced homocysteine increase but have no effect on cardiac troponin I increase.

  20. [Chronic conversion somatic disorder: a case report].

    Science.gov (United States)

    Macrì, Francesco; Minichino, Amedeo; Campi, Sandra; Marino, Marzia; Pannese, Rossella; De Michele, Francesco; Capra, Enrico; Trabucchi, Guido; Bersani, Francesco Saverio

    2013-02-01

    Conversion disorder is characterized by several neurological and internistical symptoms that cannot be explained by an organic cause, exacerbating after stress events. The course of this disorder is typically short: it usually lasts about two weeks, and only 20-25% of patients relapse in the following year. This paper aims to show the clinical history of a patient complaining conversion symptoms from 7 consecutive years.

  1. Special issue: Plasma Conversion

    NARCIS (Netherlands)

    Nozaki, T.; Bogaerts, A.; Tu, X.; van de Sanden, M. C. M.

    2017-01-01

    With growing concern of energy and environmental issues, the combination of plasma and heterogeneous catalysts receives special attention in greenhouse gas conversion, nitrogen fixation and hydrocarbon chemistry. Plasma gas conversion driven by renewable electricity is particularly important for the

  2. Does pedagogical documentation support maternal reminiscing conversations?

    Directory of Open Access Journals (Sweden)

    Bethany Fleck

    2015-12-01

    Full Text Available When parents talk with their children about lessons learned in school, they are participating in reminiscing of an unshared event. This study sought to understand if pedagogical documentation, from the Reggio Approach to early childhood education, would support and enhance the conversation. Mother–child dyads reminisced two separate times about preschool lessons, one time with documentation available to them and one time without. Transcripts were coded extracting variables indicative of high and low maternal reminiscing styles. Results indicate that mother and child conversation characteristics were more highly elaborative when documentation was present than when it was not. In addition, children added more information to the conversation supporting the notion that such conversations enhanced memory for lessons. Documentation could be used as a support tool for conversations and children’s memory about lessons learned in school.

  3. Chinese Conversation Structure

    Institute of Scientific and Technical Information of China (English)

    LIU Yan

    2016-01-01

    This paper aims to describe the features of Chinese conversation structure. Specifically speaking, the structure will be analyzed from the following four aspects:openings and pre-sequence, adjacency pairs, pre-closing and closing. Generally speak-ing, Chinese conversation structure is similar to English conversation structure. But still a lot of differences are found due to cul-tural factors.

  4. Event marketing

    OpenAIRE

    Novotná, Michaela

    2008-01-01

    This study aims to analyze event-marketing activities of the small firm and propose new events. At first the theoretical part describes marketing and communication mix and then especially planning and development of event marketing campaign. Research data were collected by the method of survey to propose the new events. Randomly selected customers were asked to fill the questionnaire. Its results were integrated into the proposal of the new events. The interview was realized with the owner of...

  5. Elements of energy conversion

    CERN Document Server

    Russell, Charles R

    2013-01-01

    Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll

  6. NGL data conversion system

    Science.gov (United States)

    Shoji, Masahiro; Horiuchi, Nobuyasu

    2005-06-01

    We are developing a NGL data conversion system for EPL, for LEEPL, and for EBDW, which is based on our established photomask data conversion system, PATACON PC-cluster. For EPL data conversion, it has SF division, Complementary division, Stitching, Proximity effect correction, Alignment mark insertion, EB stepper control data creation, and Mask inspection data creation. For LEEPL data conversion, it has Pattern checking, Complementary division, Stitching, Stress distortion correction, Alignment mark insertion, and Mask inspection data creation. For EB direct-writing data conversion, it has Proximity effect correction and Extraction of aperture pattern for cell projection exposure.

  7. 酿酒酵母减数分裂的事件和特异性基因%Meiosis Events and Specific Genes Involved in Saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    李丽

    2006-01-01

    Meiosis is the most important reproduce and favoured by organisms. The key events of meiosis identified are pairing, synapsis, genetic recombination, segregation. In this article, the specific genes of meiosis and pathways are described in these events in Saccharomyces cerevisiae. Two pathways have been identified in homolog pairing and Dmc1,Hop2, Rad51 and Mnd1 have function in pairing. In synapsis Red1, Hop1 and Zip1 are the components of synaptonemal complex. Hop2 is required for synapsis. Genetic recombination is the most important event of meiosis and provides genetic diversity for organisms to adapt the environment change. The meiosis specific genes involved in gene recombination are Spo11, Rad52 epistasis group, Dmc1, Mnd1, Msh4, Msh5, Mek1, Red1, and Hop1. Rec8,Spo13 and Sgo1 are involved in segregation.%减数分裂是生物体重要的有性生殖方式,它提供来自母本和父本的基因信息,产生具有生物多样性的子代,使其能够适应环境的变化而不断进化.本文简述了现已阐明的酿酒酵母减数分裂的重要事件如同源染色体配对、联会、基因重组、染色体分裂和特异性基因.在同源染色体配对的过程中现已发现了2条途径,一条由Rad51独立完成,另一条有Dmc1、Hop2、Rad51和Mnd1参与,同时Rad51也可能参与.Red1、Hop1和Zip1是联会复合体的组成成分,而联会也要求其他减数分裂的特异性基因如Hop2的参与.基因重组是减数分裂中最重要的事件,它为子代提供了新的遗传信息,是生物多样性的基础之一.Spo11、Rad52组、Dmc1、Mnd1、Msh4、Msh5、Mek1、Red1和Hop1参与了基因重组.Spo11是发现和研究得最早的启动基因重组的基因之一;Rec8、Spo13和Sgo1参与了染色体分裂的过程.

  8. Genome-wide association study of theta band event-related oscillations identifies serotonin receptor gene HTR7 influencing risk of alcohol dependence.

    Science.gov (United States)

    Zlojutro, Mark; Manz, Niklas; Rangaswamy, Madhavi; Xuei, Xiaoling; Flury-Wetherill, Leah; Koller, Daniel; Bierut, Laura J; Goate, Alison; Hesselbrock, Victor; Kuperman, Samuel; Nurnberger, John; Rice, John P; Schuckit, Marc A; Foroud, Tatiana; Edenberg, Howard J; Porjesz, Bernice; Almasy, Laura

    2011-01-01

    Event-related brain oscillations (EROs) represent highly heritable neuroelectrical correlates of human perception and cognitive performance that exhibit marked deficits in patients with various psychiatric disorders. We report the results of the first genome-wide association study (GWAS) of an ERO endophenotype-frontal theta ERO evoked by visual oddball targets during P300 response in 1,064 unrelated individuals drawn from a study of alcohol dependence. Forty-two SNPs of the Illumina HumanHap 1 M microarray were selected from the theta ERO GWAS for replication in family-based samples (N = 1,095), with four markers revealing nominally significant association. The most significant marker from the two-stage study is rs4907240 located within ARID protein 5A gene (ARID5A) on chromosome 2q11 (unadjusted, Fisher's combined P = 3.68 × 10⁻⁶). However, the most intriguing association to emerge is with rs7916403 in serotonin receptor gene HTR7 on chromosome 10q23 (combined P = 1.53 × 10⁻⁴), implicating the serotonergic system in the neurophysiological underpinnings of theta EROs. Moreover, promising SNPs were tested for association with diagnoses of alcohol dependence (DSM-IV), revealing a significant relationship with the HTR7 polymorphism among GWAS case-controls (P = 0.008). Significant recessive genetic effects were also detected for alcohol dependence in both case-control and family-based samples (P = 0.031 and 0.042, respectively), with the HTR7 risk allele corresponding to theta ERO reductions among homozygotes. These results suggest a role of the serotonergic system in the biological basis of alcohol dependence and underscore the utility of analyzing brain oscillations as a powerful approach to understanding complex genetic psychiatric disorders.

  9. Evolution of human alpha 1-acid glycoprotein genes and surrounding Alu repeats.

    Science.gov (United States)

    Merritt, C M; Easteal, S; Board, P G

    1990-04-01

    There is a mosaic pattern of variation between the two tandemly arranged human alpha 1-acid glycoprotein genes. Both the synonymous and the nonsynonymous sites of exons 3 and 4 are more divergent than the rest of the gene, suggesting that they have had a different evolutionary history. Comparisons of the two gene sequences with rat AGP indicate that exons 3 and 4 of AGP2 have been evolving without functional constraint since their divergence from AGP1. It is proposed that the conserved region of the gene has been homogenized recently by gene conversion with the homologous regions of AGP1. The Alu sequences surrounding the genes appear to have been involved in both the gene duplication and the gene conversion events.

  10. Uranium conversion; Conversion de l`uranium

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-05-01

    This booklet is a presentation of the activities of the Comurhex company, created in 1971 and which became a 100% Cogema`s daughter company in 1992. The Comurhex company is in charge of the conversion of natural uranium into gaseous uranium hexafluoride (UF{sub 6}). The two steps of the conversion operation are performed in the Malvesi and Pierrelatte (France) industrial sites and represent 31% (14000 t/year) of the uranium conversion capacity of western countries. The refining and UF{sub 4} production (Malvesi) and the UF{sub 6} fabrication (Pierrelatte) processes are described. Comurhex is also one of the few companies in the world which produces UF{sub 6} from the uranium of spent fuels. (J.S.)

  11. Computers and conversation

    CERN Document Server

    Luff, Paul; Gilbert, Nigel G

    1986-01-01

    In the past few years a branch of sociology, conversation analysis, has begun to have a significant impact on the design of human*b1computer interaction (HCI). The investigation of human*b1human dialogue has emerged as a fruitful foundation for interactive system design.****This book includes eleven original chapters by leading researchers who are applying conversation analysis to HCI. The fundamentals of conversation analysis are outlined, a number of systems are described, and a critical view of their value for HCI is offered.****Computers and Conversation will be of interest to all concerne

  12. Does Pedagogical Documentation Support Maternal Reminiscing Conversations?

    Science.gov (United States)

    Fleck, Bethany; Richmond, Aaron S.; Sanderson, Jordace; Yacovetta, Sara

    2015-01-01

    When parents talk with their children about lessons learned in school, they are participating in reminiscing of an unshared event. This study sought to understand if pedagogical documentation, from the Reggio Approach to early childhood education, would support and enhance the conversation. Mother-child dyads reminisced two separate times about…

  13. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  14. SENTINEL EVENTS

    Directory of Open Access Journals (Sweden)

    Andrej Robida

    2004-09-01

    Full Text Available Background. The Objective of the article is a two year statistics on sentinel events in hospitals. Results of a survey on sentinel events and the attitude of hospital leaders and staff are also included. Some recommendations regarding patient safety and the handling of sentinel events are given.Methods. In March 2002 the Ministry of Health introduce a voluntary reporting system on sentinel events in Slovenian hospitals. Sentinel events were analyzed according to the place the event, its content, and root causes. To show results of the first year, a conference for hospital directors and medical directors was organized. A survey was conducted among the participants with the purpose of gathering information about their view on sentinel events. One hundred questionnaires were distributed.Results. Sentinel events. There were 14 reports of sentinel events in the first year and 7 in the second. In 4 cases reports were received only after written reminders were sent to the responsible persons, in one case no reports were obtained. There were 14 deaths, 5 of these were in-hospital suicides, 6 were due to an adverse event, 3 were unexplained. Events not leading to death were a suicide attempt, a wrong side surgery, a paraplegia after spinal anaesthesia, a fall with a femoral neck fracture, a damage of the spleen in the event of pleural space drainage, inadvertent embolization with absolute alcohol into a femoral artery and a physical attack on a physician by a patient. Analysis of root causes of sentinel events showed that in most cases processes were inadequate.Survey. One quarter of those surveyed did not know about the sentinel events reporting system. 16% were having actual problems when reporting events and 47% beleived that there was an attempt to blame individuals. Obstacles in reporting events openly were fear of consequences, moral shame, fear of public disclosure of names of participants in the event and exposure in mass media. The majority of

  15. The Conversation Class

    Science.gov (United States)

    Jackson, Acy L.

    2012-01-01

    The conversation class occupies a unique place in the process of learning English as a second or foreign language. From the author's own experience in conducting special conversation classes with Persian-speaking adults, he has drawn up a number of simple but important guidelines, some of which he hopes may provide helpful suggestions for the…

  16. Content for Conversation Partners.

    Science.gov (United States)

    Olson, Kathleen

    2002-01-01

    Suggests that a good strategy for helping English language learners to develop communicative competence in English is by pairing them with native English speakers. In such conversation programs, conversation partners should be provided with topics and activities that incorporate the goals, interests, and experiences of the learners. Recommends…

  17. Canning Canned Conversations.

    Science.gov (United States)

    Gilmore, Michael P.; Daigaku, Sanyo

    Ways to improve the role-playing conversations found in most second language textbooks are outlined. It is argued that the conversations are often restrictive, dull, and repetitive, and students respond to them in kind. The teacher can make the target language used more interesting by creating new characters, situations, settings, or objectives.…

  18. Hydrothermal conversion of biomass

    NARCIS (Netherlands)

    Knezevic, Dragan

    2009-01-01

    This thesis presents research of hydrothermal conversion of biomass (HTC). In this process, hot compressed water (subcritical water) is used as the reaction medium. Therefore this technique is suitable for conversion of wet biomass/ waste streams. By working at high pressures, the evaporation of wat

  19. Political conversations on Facebook

    DEFF Research Database (Denmark)

    Sørensen, Mads P.

    2016-01-01

    Political conversations are according to theories on deliberative democracy essential to well-functioning democracies. Traditionally these conversations have taken place in face-to-face settings, in e.g. party meetings and town meetings. However, social media such as Facebook and Twitter offers new...... possibilities for online political conversations between citizens and politicians. This paper examines the presence on Facebook and Twitter of Members of the Danish national Parliament, the Folketing, and focusses on a quantitative mapping of the political conversation activities taking place in the threads...... following Facebook posts from Danish Members of Parliament (MPs). The paper shows that, in comparison with previous findings from other countries, Danish MPs have a relatively high degree of engagement in political conversations with citizens on Facebook – and that a large number of citizens follow MPs...

  20. Event Modeling

    DEFF Research Database (Denmark)

    Bækgaard, Lars

    2001-01-01

    The purpose of this chapter is to discuss conceptual event modeling within a context of information modeling. Traditionally, information modeling has been concerned with the modeling of a universe of discourse in terms of information structures. However, most interesting universes of discourse...... are dynamic and we present a modeling approach that can be used to model such dynamics. We characterize events as both information objects and change agents (Bækgaard 1997). When viewed as information objects events are phenomena that can be observed and described. For example, borrow events in a library can...

  1. Event Modeling

    DEFF Research Database (Denmark)

    Bækgaard, Lars

    2001-01-01

    The purpose of this chapter is to discuss conceptual event modeling within a context of information modeling. Traditionally, information modeling has been concerned with the modeling of a universe of discourse in terms of information structures. However, most interesting universes of discourse...... are dynamic and we present a modeling approach that can be used to model such dynamics.We characterize events as both information objects and change agents (Bækgaard 1997). When viewed as information objects events are phenomena that can be observed and described. For example, borrow events in a library can...

  2. Translation of Motions Events:Retention and Conversion of Semantic Features%运动事件的翻译:语义特征的保留与转换研究--以《红楼梦》诗词英译为例

    Institute of Scientific and Technical Information of China (English)

    董银燕

    2016-01-01

    基于Talmy 的运动事件框架和词汇化模式研究,以杨宪益、戴乃迭和霍克斯的《红楼梦》诗词的译文为例,以方式、结果、路径和物像等特征为着眼点,探讨运动事件翻译过程中的语义特征保留与转换。研究发现,译者采用了不同的原文解析方式,以动词为中心重组译文,突显不同的语义特征,从而使译文的运动事件特征呈现不同的保留度与转换度。%Based on the motion event framework and lexicalization patterns research proposed by Talmy and focused on features like pattern,result, path and image, taking the translation versions of“A Dream of Red Mansion” by Xianyi Yang & Naidie Dai and Hawks as an example, the paper tries to explore the retention and conversion of semantic features in the translation of motion events. It is found that translators adopt different analytic methods of the original texts and choose different verbs to profile semantic features, leading to the reconstruction of the original texts in English.

  3. Genome-wide high-resolution mapping of UV-induced mitotic recombination events in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Yi Yin

    2013-10-01

    Full Text Available In the yeast Saccharomyces cerevisiae and most other eukaryotes, mitotic recombination is important for the repair of double-stranded DNA breaks (DSBs. Mitotic recombination between homologous chromosomes can result in loss of heterozygosity (LOH. In this study, LOH events induced by ultraviolet (UV light are mapped throughout the genome to a resolution of about 1 kb using single-nucleotide polymorphism (SNP microarrays. UV doses that have little effect on the viability of diploid cells stimulate crossovers more than 1000-fold in wild-type cells. In addition, UV stimulates recombination in G1-synchronized cells about 10-fold more efficiently than in G2-synchronized cells. Importantly, at high doses of UV, most conversion events reflect the repair of two sister chromatids that are broken at approximately the same position whereas at low doses, most conversion events reflect the repair of a single broken chromatid. Genome-wide mapping of about 380 unselected crossovers, break-induced replication (BIR events, and gene conversions shows that UV-induced recombination events occur throughout the genome without pronounced hotspots, although the ribosomal RNA gene cluster has a significantly lower frequency of crossovers.

  4. Increased Sensitivity to Possible Muonium to Antimuonium Conversion

    CERN Document Server

    Meyer, V; Jungmann, Klaus; Merkel, J; zu Putlitz, Gisbert; Reinhard, I; Träger, K; Schmidt, P V; Willmann, L; Engfer, R; Wirtz, H P; Abela, R; Bertl, W; Renker, D; Walter, H K; Karpukhin, V V; Kisel, I V; Korenchenko, A S; Korenchenko, S M; Kravchuk, N; Kuchinskii, N A; Moiseenko, A; Bagaturia, Yu S; Mzhavia, D A; Sakhelashvili, T M; Hughes, V W

    1998-01-01

    A new experimental search for muonium-antimuonium conversion was conducted at the Paul Scherrer Institute, Villigen, Switzerland. The preliminary analysis yielded one event fulfilling all required criteria at an expected background of 1.7(2) events due to accidental coincidences. An upper limit for the conversion probability in 0.1 T magnetic field is extracted as $8 \\cdot 10^{-11}$ (90% CL).

  5. Uranium conversion; Urankonvertering

    Energy Technology Data Exchange (ETDEWEB)

    Oliver, Lena; Peterson, Jenny; Wilhelmsen, Katarina [Swedish Defence Research Agency (FOI), Stockholm (Sweden)

    2006-03-15

    FOI, has performed a study on uranium conversion processes that are of importance in the production of different uranium compounds in the nuclear industry. The same conversion processes are of interest both when production of nuclear fuel and production of fissile material for nuclear weapons are considered. Countries that have nuclear weapons ambitions, with the intention to produce highly enriched uranium for weapons purposes, need some degree of uranium conversion capability depending on the uranium feed material available. This report describes the processes that are needed from uranium mining and milling to the different conversion processes for converting uranium ore concentrate to uranium hexafluoride. Uranium hexafluoride is the uranium compound used in most enrichment facilities. The processes needed to produce uranium dioxide for use in nuclear fuel and the processes needed to convert different uranium compounds to uranium metal - the form of uranium that is used in a nuclear weapon - are also presented. The production of uranium ore concentrate from uranium ore is included since uranium ore concentrate is the feed material required for a uranium conversion facility. Both the chemistry and principles or the different uranium conversion processes and the equipment needed in the processes are described. Since most of the equipment that is used in a uranium conversion facility is similar to that used in conventional chemical industry, it is difficult to determine if certain equipment is considered for uranium conversion or not. However, the chemical conversion processes where UF{sub 6} and UF{sub 4} are present require equipment that is made of corrosion resistant material.

  6. Uranium Conversion & Enrichment

    Energy Technology Data Exchange (ETDEWEB)

    Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-02-06

    The isotopes of uranium that are found in nature, and hence in ‘fresh’ Yellowcake’, are not in relative proportions that are suitable for power or weapons applications. The goal of conversion then is to transform the U3O8 yellowcake into UF6. Conversion and enrichment of uranium is usually required to obtain material with enough 235U to be usable as fuel in a reactor or weapon. The cost, size, and complexity of practical conversion and enrichment facilities aid in nonproliferation by design.

  7. Solar energy conversion systems

    CERN Document Server

    Brownson, Jeffrey R S

    2013-01-01

    Solar energy conversion requires a different mind-set from traditional energy engineering in order to assess distribution, scales of use, systems design, predictive economic models for fluctuating solar resources, and planning to address transient cycles and social adoption. Solar Energy Conversion Systems examines solar energy conversion as an integrative design process, applying systems thinking methods to a solid knowledge base for creators of solar energy systems. This approach permits different levels of access for the emerging broad audience of scientists, engineers, architects, planners

  8. A Model for Conversation

    DEFF Research Database (Denmark)

    Ayres, Phil

    2012-01-01

    This essay discusses models. It examines what models are, the roles models perform and suggests various intentions that underlie their construction and use. It discusses how models act as a conversational partner, and how they support various forms of conversation within the conversational activity...... of design. Three distinctions are drawn through which to develop this discussion of models in an architectural context. An examination of these distinctions serves to nuance particular characteristics and roles of models, the modelling activity itself and those engaged in it....

  9. Energy conversion statics

    CERN Document Server

    Messerle, H K; Declaris, Nicholas

    2013-01-01

    Energy Conversion Statics deals with equilibrium situations and processes linking equilibrium states. A development of the basic theory of energy conversion statics and its applications is presented. In the applications the emphasis is on processes involving electrical energy. The text commences by introducing the general concept of energy with a survey of primary and secondary energy forms, their availability, and use. The second chapter presents the basic laws of energy conversion. Four postulates defining the overall range of applicability of the general theory are set out, demonstrating th

  10. Postoperative conversion disorder.

    Science.gov (United States)

    Afolabi, Kola; Ali, Sameer; Gahtan, Vivian; Gorji, Reza; Li, Fenghua; Nussmeier, Nancy A

    2016-05-01

    Conversion disorder is a psychiatric disorder in which psychological stress causes neurologic deficits. A 28-year-old female surgical patient had uneventful general anesthesia and emergence but developed conversion disorder 1 hour postoperatively. She reported difficulty speaking, right-hand numbness and weakness, and right-leg paralysis. Neurologic examination and imaging revealed no neuronal damage, herniation, hemorrhage, or stroke. The patient mentioned failing examinations the day before surgery and discontinuing her prescribed antidepressant medication, leading us to diagnose conversion disorder, with eventual confirmation by neuroimaging and follow-up examinations. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Structured luminescence conversion layer

    Science.gov (United States)

    Berben, Dirk; Antoniadis, Homer; Jermann, Frank; Krummacher, Benjamin Claus; Von Malm, Norwin; Zachau, Martin

    2012-12-11

    An apparatus device such as a light source is disclosed which has an OLED device and a structured luminescence conversion layer deposited on the substrate or transparent electrode of said OLED device and on the exterior of said OLED device. The structured luminescence conversion layer contains regions such as color-changing and non-color-changing regions with particular shapes arranged in a particular pattern.

  12. Managing social media conversations

    OpenAIRE

    2015-01-01

    The purpose of this thesis was to explore how companies can manage (monitor and control) social media conversations. Regardless of the companies’ presence in social media networks, they or their industry are constantly being discussed in social media. Therefore organisations should be present in social media, monitor and participate in conversations, in order to turn them into their benefit. There are software and services available to help in monitoring. Variety of tools and statistic de...

  13. Conversational flow promotes solidarity.

    Science.gov (United States)

    Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H

    2013-01-01

    Social interaction is fundamental to the development of various aspects of "we-ness". Previous research has focused on the role the content of interaction plays in establishing feelings of unity, belongingness and shared reality (a cluster of variables referred to as solidarity here). The present paper is less concerned with content, but focuses on the form of social interaction. We propose that the degree to which conversations flow smoothly or not is, of itself, a cue to solidarity. We test this hypothesis in samples of unacquainted and acquainted dyads who communicate via headsets. Conversational flow is disrupted by introducing a delay in the auditory feedback (vs. no delay). Results of three studies show that smoothly coordinated conversations (compared with disrupted conversations and a control condition) increase feelings of belonging and perceptions of group entitativity, independently of conversation content. These effects are driven by the subjective experience of conversational flow. Our data suggest that this process occurs largely beyond individuals' control. We conclude that the form of social interaction is a powerful cue for inferring group solidarity. Implications for the impact of modern communication technology on developing a shared social identity are discussed.

  14. Conversational flow promotes solidarity.

    Directory of Open Access Journals (Sweden)

    Namkje Koudenburg

    Full Text Available Social interaction is fundamental to the development of various aspects of "we-ness". Previous research has focused on the role the content of interaction plays in establishing feelings of unity, belongingness and shared reality (a cluster of variables referred to as solidarity here. The present paper is less concerned with content, but focuses on the form of social interaction. We propose that the degree to which conversations flow smoothly or not is, of itself, a cue to solidarity. We test this hypothesis in samples of unacquainted and acquainted dyads who communicate via headsets. Conversational flow is disrupted by introducing a delay in the auditory feedback (vs. no delay. Results of three studies show that smoothly coordinated conversations (compared with disrupted conversations and a control condition increase feelings of belonging and perceptions of group entitativity, independently of conversation content. These effects are driven by the subjective experience of conversational flow. Our data suggest that this process occurs largely beyond individuals' control. We conclude that the form of social interaction is a powerful cue for inferring group solidarity. Implications for the impact of modern communication technology on developing a shared social identity are discussed.

  15. Conversion disorder: a problematic diagnosis.

    Science.gov (United States)

    Nicholson, Timothy R J; Stone, Jon; Kanaan, Richard A A

    2011-11-01

    The diagnosis of conversion disorder is problematic. Since doctors have conceptually and practically differentiated the symptoms from neurological ('organic') disease it has been presumed to be a psychological disorder, but the psychological mechanism, and how this differs from feigning (conscious simulation), has remained elusive. Although misdiagnosis of neurological disease as conversion disorder is uncommon, it remains a concern for clinicians, particularly for psychiatrists who may be unaware of the positive ways in which neurologists can exclude organic disease. The diagnosis is anomalous in psychiatry in that current diagnostic systems require that feigning is excluded and that the symptoms can be explained psychologically. In practice, feigning is very difficult to either disprove or prove, and a psychological explanation cannot always be found. Studies of childhood and adult psychological precipitants have tended to support the relevance of stressful life events prior to symptom onset at the group level but they are not found in a substantial proportion of cases. These problems highlight serious theoretical and practical issues not just for the current diagnostic systems but for the concept of the disorder itself. Psychology, physiology and functional imaging techniques have been used in attempts to elucidate the neurobiology of conversion disorder and to differentiate it from feigning, but while intriguing results are emerging they can only be considered preliminary. Such work looks to a future that could refine our understanding of the disorder. However, until that time, the formal diagnostic requirement for associated psychological stressors and the exclusion of feigning are of limited clinical value. Simplified criteria are suggested which will also encourage cooperation between neurology and psychiatry in the management of these patients.

  16. Comparative genomic analysis of Vibrio parahaemolyticus: serotype conversion and virulence

    Directory of Open Access Journals (Sweden)

    Gil Ana I

    2011-06-01

    functional categories. Conclusions Our data support the idea that the pandemic strains are closely related and that recent South American outbreaks of foodborne disease caused by V. parahaemolyticus are closely linked to outbreaks in India. Serotype conversion from O3:K6 to O4:K68 was likely due to a recombination event involving a region much larger than the O-antigen- and K-antigen-encoding gene clusters. Major differences between pathogenicity islands and mobile elements are also likely driving the evolution of V. parahaemolyticus. In addition, our analyses categorized genes that may be useful in differentiating pathogenic Vibrios at the species level.

  17. Boiler conversions for biomass

    Energy Technology Data Exchange (ETDEWEB)

    Kinni, J. [Tampella Power Inc., Tampere (Finland)

    1996-12-31

    Boiler conversions from grate- and oil-fired boilers to bubbling fluidized bed combustion have been most common in pulp and paper industry. Water treatment sludge combustion, need for additional capacity and tightened emission limits have been the driving forces for the conversion. To accomplish a boiler conversion for biofuel, the lower part of the boiler is replaced with a fluidized bed bottom and new fuel, ash and air systems are added. The Imatran Voima Rauhalahti pulverized-peat-fired boiler was converted to bubbling fluidized bed firing in 1993. In the conversion the boiler capacity was increased by 10 % to 295 MWth and NO{sub x} emissions dropped. In the Kymmene Kuusankoski boiler, the reason for conversion was the combustion of high chlorine content biosludge. The emissions have been under general European limits. During the next years, the emission limits will tighten and the boilers will be designed for most complete combustion and compounds, which can be removed from flue gases, will be taken care of after the boiler. (orig.) 3 refs.

  18. The mitochondrial genome of the stingless bee Melipona bicolor (Hymenoptera, Apidae, Meliponini: sequence, gene organization and a unique tRNA translocation event conserved across the tribe Meliponini

    Directory of Open Access Journals (Sweden)

    Daniela Silvestre

    2008-01-01

    Full Text Available At present a complete mtDNA sequence has been reported for only two hymenopterans, the Old World honey bee, Apis mellifera and the sawfly Perga condei. Among the bee group, the tribe Meliponini (stingless bees has some distinction due to its Pantropical distribution, great number of species and large importance as main pollinators in several ecosystems, including the Brazilian rain forest. However few molecular studies have been conducted on this group of bees and few sequence data from mitochondrial genomes have been described. In this project, we PCR amplified and sequenced 78% of the mitochondrial genome of the stingless bee Melipona bicolor (Apidae, Meliponini. The sequenced region contains all of the 13 mitochondrial protein-coding genes, 18 of 22 tRNA genes, and both rRNA genes (one of them was partially sequenced. We also report the genome organization (gene content and order, gene translation, genetic code, and other molecular features, such as base frequencies, codon usage, gene initiation and termination. We compare these characteristics of M. bicolor to those of the mitochondrial genome of A. mellifera and other insects. A highly biased A+T content is a typical characteristic of the A. mellifera mitochondrial genome and it was even more extreme in that of M. bicolor. Length and compositional differences between M. bicolor and A. mellifera genes were detected and the gene order was compared. Eleven tRNA gene translocations were observed between these two species. This latter finding was surprising, considering the taxonomic proximity of these two bee tribes. The tRNA Lys gene translocation was investigated within Meliponini and showed high conservation across the Pantropical range of the tribe.

  19. Photovoltaic solar energy conversion

    CERN Document Server

    Bauer, Gottfried H

    2015-01-01

    This concise primer on photovoltaic solar energy conversion invites readers to reflect on the conversion of solar light into energy at the most fundamental level and encourages newcomers to the field to help find meaningful answers on how photovoltaic solar energy conversion can work (better), eventually contributing to its ongoing advancement. The book is based on lectures given to graduate students in the Physics Department at the University of Oldenburg over the last two decades, yet also provides an easy-to-follow introduction for doctoral and postdoctoral students from related disciplines such as the materials sciences and electrical engineering. Inspired by classic textbooks in the field, it reflects the author’s own ideas on how to understand, visualize and eventually teach the microscopic physical mechanisms and effects, while keeping the text as concise as possible so as to introduce interested readers to the field and balancing essential knowledge with open questions.

  20. Direct conversion technology

    Energy Technology Data Exchange (ETDEWEB)

    Massier, P.F.; Back, L.H.; Ryan, M.A.; Fabris, G.

    1992-01-07

    The overall objective of the Direct Conversion Technology task is to develop an experimentally verified technology base for promising direct conversion systems that have potential application for energy conservation in the end-use sectors. This report contains progress of research on the Alkali Metal Thermal-to-Electric Converter (AMTEC) and on the Two-Phase Liquid-Metal MHD Electrical Generator (LMMHD) for the period January 1, 1991 through December 31, 1991. Research on AMTEC and on LMMHD was initiated during October 1987. Reports prepared on previous occasions (Refs. 1--5) contain descriptive and performance discussions of the following direct conversion concepts: thermoelectric, pyroelectric, thermionic, thermophotovoltaic, thermoacoustic, thermomagnetic, thermoelastic (Nitionol heat engine); and also, more complete descriptive discussions of AMTEC and LMMHD systems.

  1. Freely flowing conversations

    DEFF Research Database (Denmark)

    Aakjær, Marie Kirstejn; Andrade, David; Dexters, Peter

    2012-01-01

    on - and support “positive deviants” (Pascal, Sternin and Sternin) – courageous individuals and groups (inmates as well as staff) who transform conversations into new actions and behavioral traits that become beckons of an improved future. In the following we explore concrete examples of efforts at improving......Some would say this article is an impossibility - the authors being a project manager from the Department of Prisons an (ex) inmate and a Designer doing an industrial PhD in the prisons. We hope that others may see this article as an embodiment of how taking part in new conversations...... and in regards to rehabilitation efforts. In the context of prisons UDI is inspired by the complexity approach (Stacey 2005). We seek to facilitate freely flowing conversations between inmates, staff and managers – pushing the boundaries of existing norms, roles and beliefs. In the end however we rely...

  2. Converse Barrier Certificate Theorem

    DEFF Research Database (Denmark)

    Wisniewski, Rafael; Sloth, Christoffer

    2013-01-01

    This paper presents a converse barrier certificate theorem for a generic dynamical system.We show that a barrier certificate exists for any safe dynamical system defined on a compact manifold. Other authors have developed a related result, by assuming that the dynamical system has no singular...... points in the considered subset of the state space. In this paper, we redefine the standard notion of safety to comply with generic dynamical systems with multiple singularities. Afterwards, we prove the converse barrier certificate theorem and illustrate the differences between ours and previous work...

  3. Ocean wave energy conversion

    CERN Document Server

    McCormick, Michael E

    2007-01-01

    This volume will prove of vital interest to those studying the use of renewable resources. Scientists, engineers, and inventors will find it a valuable review of ocean wave mechanics as well as an introduction to wave energy conversion. It presents physical and mathematical descriptions of the nine generic wave energy conversion techniques, along with their uses and performance characteristics.Author Michael E. McCormick is the Corbin A. McNeill Professor of Naval Engineering at the U.S. Naval Academy. In addition to his timely and significant coverage of possible environmental effects associa

  4. Identification of fibroblast growth factor-8b target genes associated with early and late cell cycle events in breast cancer cells.

    Science.gov (United States)

    Nilsson, E M; Brokken, L J S; Narvi, E; Kallio, M J; Härkönen, P L

    2012-07-01

    Fibroblast growth factor-8 (FGF-8) is implicated in the development and progression of breast cancer and its levels are frequently elevated in breast tumors. The mechanisms driving FGF-8-mediated tumorigenesis are not well understood. Herein we aimed to identify target genes associated with FGF-8b-mediated breast cancer cell proliferation by carrying out a cDNA microarray analysis of genes expressed in estrogen receptor negative S115 breast cancer cells treated with FGF-8b for various time periods in comparison with those expressed in non-treated cells. Gene and protein expression was validated for selected genes by qPCR and western blotting respectively. Furthermore, using TRANSBIG data, the expression of human orthologs of FGF-8-regulated genes was correlated to the Nottingham prognostic index and estrogen receptor status. The analysis revealed a number of significantly up- and down-regulated genes in response to FGF-8b at all treatment times. The most differentially expressed genes were genes related to cell cycle regulation, mitosis, cancer, and cell death. Several key regulators of early cell cycle progression such as Btg2 and cyclin D1, as well as regulators of mitosis, including cyclin B, Plk1, survivin, and aurora kinase A, were identified as novel targets for FGF-8b, some of which were additionally shown to correlate with prognosis and ER status in human breast cancer. The results suggest that in stimulation of proliferation FGF-8b not only promotes cell cycle progression through the G1 restriction point but also regulates key proteins involved in chromosomal segregation during mitosis and cytokinesis of breast cancer cells.

  5. Gender Differences in Conversation

    Institute of Scientific and Technical Information of China (English)

    陈媛媛

    2014-01-01

    Men and women applied language distinct from each other in many ways. The thesis gives an illustration of gender dif-ferences in conversation and different interpretive frames within which the discourse between men and women take place. More profoundly, it tries to explain them from perspective of socialization.

  6. Predicting AD conversion

    DEFF Research Database (Denmark)

    Liu, Yawu; Mattila, Jussi; Ruiz, Miguel �ngel Mu�oz

    2013-01-01

    To compare the accuracies of predicting AD conversion by using a decision support system (PredictAD tool) and current research criteria of prodromal AD as identified by combinations of episodic memory impairment of hippocampal type and visual assessment of medial temporal lobe atrophy (MTA) on MRI...

  7. Clinical Linguistics: Conversational Reflections

    Science.gov (United States)

    Crystal, David

    2013-01-01

    This is a report of the main points I made in an informal "conversation" with Paul Fletcher and the audience at the 14th ICPLA conference in Cork. The observations arose randomly, as part of an unstructured 1-h Q&A, so they do not provide a systematic account of the subject, but simply reflect the issues which were raised by the conference…

  8. Solar energy conversion

    OpenAIRE

    Crabtree, George W.; Lewis, Nathan S.

    2007-01-01

    If solar energy is to become a practical alternative to fossil fuels, we must have efficient ways to convert photons into electricity, fuel, and heat. The need for better conversion technologies is a driving force behind many recent developments in biology, materials, and especially nanoscience.

  9. Wavelength conversion technology

    DEFF Research Database (Denmark)

    Stubkjær, Kristian

    1998-01-01

    Optical wavelength conversion is currently attracting much interest. This is because it enables full flexibility and eases management of WDM fibre networks. The tutorial will review existing and potential application areas. Examples of node architectures and network demonstrators that use wavelen...

  10. Wavelength conversion devices

    DEFF Research Database (Denmark)

    Mikkelsen, Benny; Durhuus, Terji; Jørgensen, Carsten

    1996-01-01

    system requirements. The ideal wavelength converter should be transparent to the bit rate and signal format and provide an unchirped output signal with both a high extinction ratio and a large signal-to-noise ratio. It should allow conversion to both shorter and longer wavelengths with equal performance...

  11. Dissenting in Reflective Conversations

    DEFF Research Database (Denmark)

    Bjørn, Pernille; Boulus, Nina

    2011-01-01

    a methodological reflective approach that provides space for taking seriously uncertainties experienced in the field as these can be a catalyst for learning and sharpening our theoretical and empirical skills as action researchers. Through first-person inquiry, we investigate how our reflective conversations...

  12. Paralympics and conversion disorder

    National Research Council Canada - National Science Library

    David, Anthony S

    ...' for whose disorders are the most stigmatised. Psychiatry has a strong claim on this with mental illness generally regarded as among the most feared and least understood. 1 And within psychiatry there is a similar hierarchy such that patients with 'hysteria' or conversion disorder (CD) are those found to be least satisfying to treat and are least like...

  13. Leadership is a conversation.

    Science.gov (United States)

    Groysberg, Boris; Slind, Michael

    2012-06-01

    Globalization and new technologies have sharply reduced the efficacy of command-and-control management and its accompanying forms of corporate communication. In the course of a recent research project, the authors concluded that by talking with employees, rather than simply issuing orders, leaders can promote operational flexibility, employee engagement, and tight strategic alignment. Groysberg and Slind have identified four elements of organizational conversation that reflect the essential attributes of interpersonal conversation: intimacy, interactivity, inclusion, and intentionality. Intimacy shifts the focus from a top-down distribution of information to a bottom-up exchange of ideas. Organizational conversation is less corporate in tone and more casual. And it's less about issuing and taking orders than about asking and answering questions. Interactivity entails shunning the simplicity of monologue and embracing the unpredictable vitality of dialogue. Traditional one-way media-print and broadcast, in particular-give way to social media buttressed by social thinking. Inclusion turns employees into full-fledged conversation partners, entitling them to provide their own ideas, often on company channels. They can create content and act as brand ambassadors, thought leaders, and storytellers. Intentionality enables leaders and employees to derive strategically relevant action from the push and pull of discussion and debate.

  14. Converse Barrier Certificate Theorems

    DEFF Research Database (Denmark)

    Wisniewski, Rafael; Sloth, Christoffer

    2016-01-01

    This paper shows that a barrier certificate exists for any safe dynamical system. Specifically, we prove converse barrier certificate theorems for a class of structurally stable dynamical systems. Other authors have developed a related result by assuming that the dynamical system has neither sing...

  15. Conversational English Program, 1.

    Science.gov (United States)

    Instituto de Idiomas Yazigi, Sao Paulo (Brazil). Centro de Linguistica Aplicada.

    This first book of a conversational English program for adults contains an introductory section in Portuguese and exercises in English. The text centers around an English-speaking family from the United States that goes to live in Brazil. It contains color photographs with captions followed by exercises. The exercises are in English and involve…

  16. Conversational English Program, 2.

    Science.gov (United States)

    Instituto de Idiomas Yazigi, Sao Paulo (Brazil). Centro de Linguistica Aplicada.

    This second book of a conversational English program for adults contains an introductory section in Portuguese and exercises in English. The text centers around an English-speaking family from the United States that goes to live in Brazil. It contains color photographs with captions followed by exercises. The exercises are in English and involve…

  17. Conversion of large heterologies in Streptococcus pneumoniae.

    Science.gov (United States)

    Pasta, F; Lefèvre, J C; Guillot, E; Sicard, A M

    1991-04-01

    In genetic transformation, long deletions dramatically increase the frequency of wild-type recombinants in 2-point crosses. In 3-point crosses in which the deletion was localized between 2 point mutations we demonstrated that this hyper-recombination was the result of genetic conversion extending over several scores of bases outside the deletion. As this conversion did not require an active DNA polymerase A gene, it was proposed that the mechanism of conversion involves breakage and ligation between DNA molecules. A similar hyper-recombination was observed when donor DNA carried an insertion. These results suggest that long heterologies participated in recombination so that surrounding homologous regions are almost completely paired and that these long heterologies are converted. It appears that it is a process that evolved to correct errors of replication which lead to long deletions and which are not eliminated by other systems.

  18. Interspecies recombination between the penA genes of Neisseria meningitidis and commensal Neisseria species during the emergence of penicillin resistance in N. meningitidis: natural events and laboratory simulation.

    Science.gov (United States)

    Bowler, L D; Zhang, Q Y; Riou, J Y; Spratt, B G

    1994-01-01

    The penicillin-binding protein 2 genes (penA) of penicillin-resistant Neisseria meningitidis have a mosaic structure that has arisen by the introduction of regions from the penA genes of Neisseria flavescens or Neisseria cinerea. Chromosomal DNA from both N. cinerea and N. flavescens could transform a penicillin-susceptible isolate of N. meningitidis to increased resistance to penicillin. With N. flavescens DNA, transformation to resistance was accompanied by the introduction of the N. flavescens penA gene, providing a laboratory demonstration of the interspecies recombinational events that we believe underlie the development of penicillin resistance in many meningococci in nature. Surprisingly, with N. cinerea DNA, the penicillin-resistant transformants did not obtain the N. cinerea penA gene. However, the region of the penA gene derived from N. cinerea in N. meningitidis K196 contained an extra codon (Asp-345A) which was not found in any of the four N. cinerea isolates that we examined and which is known to result in a decrease in the affinity of PBP 2 in gonococci.

  19. Freely flowing conversations

    DEFF Research Database (Denmark)

    Aakjær, Marie Kirstejn; Andrade, David; Dexters, Peter

    2012-01-01

    and relationships may allow us to transcend the barriers of our formal positions. To us it is a testimony of the struggles and the good times we have shared while attempting to improve life in prisons. Also, this is an occasion for reflection on what we have learned from the process. The User Driven Innovation (in...... for guards. It has turned the focus of the organization towards the importance of relationship-building. In 2011 the Director General and the Prison Governors stated that building positive relations is the most important future task for Danish prisons both in regards to improving prison environments...... relations by changing conversations. Through the theoretical framework of the complexity approach, we discuss how this may lead to organizational change. Finally we suggest that inviting inmates to take part in conversations about core organizational development may be a fundamental strategy in trying...

  20. Conversion electron surface imaging

    CERN Document Server

    Irwin, G M; Wehner, A

    1999-01-01

    A method of imaging the Moessbauer absorption over the surface of a sample based on counting conversion electrons emitted from the surface following resonant absorption of gamma radiation is described. This Conversion Electron Surface Imaging (CESI) method is somewhat analogous to Magnetic Resonance Imaging (MRI), particularly chemical shift imaging, and similar tomographic reconstruction techniques are involved in extracting the image. The theory behind the technique and a prototype device is described, as well as the results of proof-of-principle experiments which demonstrate the function of the device. Eventually this same prototype device will be part of a system to determine the spatial variation of the Moessbauer spectrum over the surface of a sample. Applications include imaging of variations of surface properties of steels and other iron containing alloys, as well as other surfaces over which sup 5 sup 7 Fe has been deposited.

  1. Les conversions de cens

    Directory of Open Access Journals (Sweden)

    Laurent Feller

    2006-09-01

    Full Text Available Dans le cadre d’une recherche entamée sur la circulation des richesses au Moyen Âge, la réflexion s’est dirigée vers la question de la conversion, c’est-à-dire du passage d’une forme à une autre dans la mesure des valeurs (argent contre nature, objets dont l’usage se transforme en s’échangeant, conversions monétaires. Un cycle de trois rencontres est prévu afin de débrouiller une question complexe qui devrait permettre au groupe d’éclairer la question de la valeur des choses au Moyen Âge. La...

  2. Clinical linguistics: conversational reflections.

    Science.gov (United States)

    Crystal, David

    2013-04-01

    This is a report of the main points I made in an informal "conversation" with Paul Fletcher and the audience at the 14th ICPLA conference in Cork. The observations arose randomly, as part of an unstructured 1-h Q&A, so they do not provide a systematic account of the subject, but simply reflect the issues which were raised by the conference participants during that time.

  3. Specific PCR detection of Fusarium oxysporum f. sp. vasinfectum California Race 4 based on a unique Tfo1 insertion event in the PHO gene

    Science.gov (United States)

    A highly virulent race 4 (Cal race 4) of Fusarium oxysporum f. sp. vasinfectum (Fov) was identified in California cotton fields in 2001, and has since been found in increasing numbers of fields. Cal race 4 isolates contain a unique Tfo1 transposon insertion in the PHO gene that was not found in othe...

  4. Molecular evolution of the keratin associated protein gene family in mammals, role in the evolution of mammalian hair

    Directory of Open Access Journals (Sweden)

    Irwin David M

    2008-08-01

    Full Text Available Abstract Background Hair is unique to mammals. Keratin associated proteins (KRTAPs, which contain two major groups: high/ultrahigh cysteine and high glycine-tyrosine, are one of the major components of hair and play essential roles in the formation of rigid and resistant hair shafts. Results The KRTAP family was identified as being unique to mammals, and near-complete KRTAP gene repertoires for eight mammalian genomes were characterized in this study. An expanded KRTAP gene repertoire was found in rodents. Surprisingly, humans have a similar number of genes as other primates despite the relative hairlessness of humans. We identified several new subfamilies not previously reported in the high/ultrahigh cysteine KRTAP genes. Genes in many subfamilies of the high/ultrahigh cysteine KRTAP genes have evolved by concerted evolution with frequent gene conversion events, yielding a higher GC base content for these gene sequences. In contrast, the high glycine-tyrosine KRTAP genes have evolved more dynamically, with fewer gene conversion events and thus have a lower GC base content, possibly due to positive selection. Conclusion Most of the subfamilies emerged early in the evolution of mammals, thus we propose that the mammalian ancestor should have a diverse KRTAP gene repertoire. We propose that hair content characteristics have evolved and diverged rapidly among mammals because of rapid divergent evolution of KRTAPs between species. In contrast, subfamilies of KRTAP genes have been homogenized within each species due to concerted evolution.

  5. Natural gas conversion process

    Energy Technology Data Exchange (ETDEWEB)

    1992-01-01

    The experimental apparatus was dismantled and transferred to a laboratory space provided by Lawrence Berkeley Laboratory (LBL) which is already equipped with a high-ventilation fume hood. This will enable us to make tests at higher gas flow rates in a safe environment. Three papers presented at the ACS meeting in San Francisco (Symposium on Natural Gas Upgrading II) April 5--10, 1992 show that the goal of direct catalytic conversion of Methane into heavier Hydrocarbons in a reducing atmosphere is actively pursued in three other different laboratories. There are similarities in their general concept with our own approach, but the temperature range of the experiments reported in these recent papers is much lower and this leads to uneconomic conversion rates. This illustrates the advantages of Methane activation by a Hydrogen plasma to reach commercial conversion rates. A preliminary process flow diagram was established for the Integrated Process, which was outlined in the previous Quarterly Report. The flow diagram also includes all the required auxiliary facilities for product separation and recycle of the unconverted feed as well as for the preparation and compression of the Syngas by-product.

  6. Organization of immunoglobulin genes.

    Science.gov (United States)

    Tonegawa, S; Brack, C; Hozumi, N; Pirrotta, V

    1978-01-01

    The nucleotide-sequence determination of a cloned, embryonic Vlambda gene directly demonstrated that V genes are separate from a corresponding C gene in embryonic cells. Analysis by restriction enzymes of total cellular DNA from various sources strongly suggested that the two separate immunoglobulin genes become continuous during differentiation of B lymphocytes. There seems to be a strict correlation between the joining event and activation of the joined genes. Cloning of more immunoglobulin genes from embryo and plasma cells will not only provide direct demonstration of such a gene-joining event but also help in the elucidation of a possible relationship of the event to gene activation mechanisms.

  7. Ocean energy conversion - A reality

    Digital Repository Service at National Institute of Oceanography (India)

    Sarkar, A.

    This chapter presents an overview of ocean energy conversion in respect of its significance as the renewable energy resources. It deals with the thermodynamic principles relating to ocean thermal energy conversion (OTEC). Besides, it provides an in...

  8. Event extraction for DNA methylation

    Directory of Open Access Journals (Sweden)

    Ohta Tomoko

    2011-10-01

    Full Text Available Abstract Background We consider the task of automatically extracting DNA methylation events from the biomedical domain literature. DNA methylation is a key mechanism of epigenetic control of gene expression and implicated in many cancers, but there has been little study of automatic information extraction for DNA methylation. Results We present an annotation scheme for DNA methylation following the representation of the BioNLP shared task on event extraction, select a set of 200 abstracts including a representative sample of all PubMed citations relevant to DNA methylation, and introduce manual annotation for this corpus marking nearly 3000 gene/protein mentions and 1500 DNA methylation and demethylation events. We retrain a state-of-the-art event extraction system on the corpus and find that automatic extraction of DNA methylation events, the methylated genes, and their methylation sites can be performed at 78% precision and 76% recall. Conclusions Our results demonstrate that reliable extraction methods for DNA methylation events can be created through corpus annotation and straightforward retraining of a general event extraction system. The introduced resources are freely available for use in research from the GENIA project homepage http://www-tsujii.is.s.u-tokyo.ac.jp/GENIA.

  9. Microbial Energy Conversion

    Energy Technology Data Exchange (ETDEWEB)

    Buckley, Merry [American Society for Microbiology (ASM), Washington, DC (United States); Wall, Judy D. [Univ. of Missouri, Columbia, MO (United States)

    2006-10-01

    The American Academy of Microbiology convened a colloquium March 10-12, 2006, in San Francisco, California, to discuss the production of energy fuels by microbial conversions. The status of research into various microbial energy technologies, the advantages and disadvantages of each of these approaches, research needs in the field, and education and training issues were examined, with the goal of identifying routes for producing biofuels that would both decrease the need for fossil fuels and reduce greenhouse gas emissions. Currently, the choices for providing energy are limited. Policy makers and the research community must begin to pursue a broader array of potential energy technologies. A diverse energy portfolio that includes an assortment of microbial energy choices will allow communities and consumers to select the best energy solution for their own particular needs. Funding agencies and governments alike need to prepare for future energy needs by investing both in the microbial energy technologies that work today and in the untested technologies that will serve the world’s needs tomorrow. More mature bioprocesses, such as ethanol production from starchy materials and methane from waste digestors, will find applications in the short term. However, innovative techniques for liquid fuel or biohydrogen production are among the longer term possibilities that should also be vigorously explored, starting now. Microorganisms can help meet human energy needs in any of a number of ways. In their most obvious role in energy conversion, microorganisms can generate fuels, including ethanol, hydrogen, methane, lipids, and butanol, which can be burned to produce energy. Alternatively, bacteria can be put to use in microbial fuel cells, where they carry out the direct conversion of biomass into electricity. Microorganisms may also be used some day to make oil and natural gas technologies more efficient by sequestering carbon or by assisting in the recovery of oil and

  10. Witnessing stressful events induces glutamatergic synapse pathway alterations and gene set enrichment of positive EPSP regulation within the VTA of adult mice: An ontology based approach

    Science.gov (United States)

    Brewer, Jacob S.

    It is well known that exposure to severe stress increases the risk for developing mood disorders. Currently, the neurobiological and genetic mechanisms underlying the functional effects of psychological stress are poorly understood. Presenting a major obstacle to the study of psychological stress is the inability of current animal models of stress to distinguish between physical and psychological stressors. A novel paradigm recently developed by Warren et al., is able to tease apart the effects of physical and psychological stress in adult mice by allowing these mice to "witness," the social defeat of another mouse thus removing confounding variables associated with physical stressors. Using this 'witness' model of stress and RNA-Seq technology, the current study aims to study the genetic effects of psychological stress. After, witnessing the social defeat of another mouse, VTA tissue was extracted, sequenced, and analyzed for differential expression. Since genes often work together in complex networks, a pathway and gene ontology (GO) analysis was performed using data from the differential expression analysis. The pathway and GO analyzes revealed a perturbation of the glutamatergic synapse pathway and an enrichment of positive excitatory post-synaptic potential regulation. This is consistent with the excitatory synapse theory of depression. Together these findings demonstrate a dysregulation of the mesolimbic reward pathway at the gene level as a result of psychological stress potentially contributing to depressive like behaviors.

  11. Infrared up-conversion microscope

    DEFF Research Database (Denmark)

    2014-01-01

    There is presented an up-conversion infrared microscope (110) arranged for imaging an associated object (130), wherein the up-conversion infrared microscope (110) comprises a non-linear crystal (120) arranged for up-conversion of infrared electromagnetic radiation, and wherein an objective optical...

  12. Infrared up-conversion telescope

    DEFF Research Database (Denmark)

    2014-01-01

    There is presented to an up-conversion infrared telescope (110) arranged for imaging an associated scene (130), wherein the up-conversion infrared telescope (110) comprises a non-linear crystal (120) arranged for up-conversion of infrared electromagnetic radiation, and wherein a first optical...

  13. Special Features in Children's Conversations.

    Science.gov (United States)

    Karjalainen, Merja

    In a study of features that seem to be typical of children's conversations, 10 Finnish preschool children's conversations were videotaped and audiotaped over a period of 10 hours. The children were taped in conversation, play, fairy tale, and eating situations. Among the findings are that all children enjoy playing with language, but some initiate…

  14. The Application of Conversational Implicature in Doctor-Patient Conversation

    Institute of Scientific and Technical Information of China (English)

    GAO Chong

    2014-01-01

    The doctor-patient conversation is the major way of communication between doctors and patients. A good conversa-tion helps to construct a harmonious doctor-patient relationship. This paper attempts to analyze the doctor-patient conversation by applying the Theory of Conversational Implicature. The theory is accepted as the cooperative principle consisting of four max-ims:quantity, quality, relation, manner. This paper will analyse how the four maxims work and the violating of the maxims in the doctor-patient conversation. Through linguistic study of the conversation, we try to find out the problems in the doctor-patient conversation and to provide some directive linguistic suggestions to doctors and patients.

  15. Revisiting the diffusion approximation to estimate evolutionary rates of gene family diversification.

    Science.gov (United States)

    Gjini, Erida; Haydon, Daniel T; David Barry, J; Cobbold, Christina A

    2014-01-21

    Genetic diversity in multigene families is shaped by multiple processes, including gene conversion and point mutation. Because multi-gene families are involved in crucial traits of organisms, quantifying the rates of their genetic diversification is important. With increasing availability of genomic data, there is a growing need for quantitative approaches that integrate the molecular evolution of gene families with their higher-scale function. In this study, we integrate a stochastic simulation framework with population genetics theory, namely the diffusion approximation, to investigate the dynamics of genetic diversification in a gene family. Duplicated genes can diverge and encode new functions as a result of point mutation, and become more similar through gene conversion. To model the evolution of pairwise identity in a multigene family, we first consider all conversion and mutation events in a discrete manner, keeping track of their details and times of occurrence; second we consider only the infinitesimal effect of these processes on pairwise identity accounting for random sampling of genes and positions. The purely stochastic approach is closer to biological reality and is based on many explicit parameters, such as conversion tract length and family size, but is more challenging analytically. The population genetics approach is an approximation accounting implicitly for point mutation and gene conversion, only in terms of per-site average probabilities. Comparison of these two approaches across a range of parameter combinations reveals that they are not entirely equivalent, but that for certain relevant regimes they do match. As an application of this modelling framework, we consider the distribution of nucleotide identity among VSG genes of African trypanosomes, representing the most prominent example of a multi-gene family mediating parasite antigenic variation and within-host immune evasion. © 2013 Published by Elsevier Ltd. All rights reserved.

  16. Solar energy conversion

    CERN Document Server

    Likhtenshtein, Gertz I

    2012-01-01

    Finally filling a gap in the literature for a text that also adopts the chemist?s view of this hot topic, Prof Likhtenshtein, an experienced author and internationally renowned scientist, considers different physical and engineering aspects in solar energy conversion. From theory to real-life systems, he shows exactly which chemical reactions take place when converting light energy, providing an overview of the chemical perspective from fundamentals to molecular harvesting systems and solar cells. This essential guide will thus help researchers in academia and industry better understa

  17. Moodle 20 Course Conversion

    CERN Document Server

    Wild, Ian

    2011-01-01

    With clear instructions and plenty of screenshots, this book provides all the support and guidance you will need as you begin to convert your teaching to Moodle. Step-by-step tutorials use real-world examples to show you how to convert to Moodle in the most efficient and effective ways possible. Moodle Course Conversion carefully illustrates how Moodle can be used to teach content and ideas and clearly demonstrates the advantages of doing so. This book is for teachers, tutors, and lecturers who already have a large body of teaching material and want to use Moodle to enhance their course, rathe

  18. Cooperative internal conversion process

    CERN Document Server

    Kálmán, Péter

    2015-01-01

    A new phenomenon, called cooperative internal conversion process, in which the coupling of bound-free electron and neutron transitions due to the dipole term of their Coulomb interaction permits cooperation of two nuclei leading to neutron exchange if it is allowed by energy conservation, is discussed theoretically. General expression of the cross section of the process is reported in one particle nuclear and spherical shell models as well in the case of free atoms (e.g. noble gases). A half-life characteristic of the process is also determined. The case of $Ne$ is investigated numerically. The process may have significance in fields of nuclear waste disposal and nuclear energy production.

  19. Broadband frequency conversion

    DEFF Research Database (Denmark)

    Sanders, Nicolai Højer; Jensen, Ole Bjarlin; Dam, Jeppe Seidelin;

    that ensures phase matching over a broad spectral range in the BBO crystal. Since the tuning mechanism relies on all-passive components with extremely short response times the proposed method is well suited for short pulse, broad bandwidth laser sources like mode-locked lasers or super-continuum sources......We demonstrate a method for frequency conversion of broadly tunable or broad bandwidth light in a static, passive setup. Using simple optical components like lenses, mirrors and gratings and a BiBO crystal as the nonlinear material, we are able to frequency double a single-frequency, tunable...

  20. Catalytic Conversion of Carbohydrates

    DEFF Research Database (Denmark)

    Osmundsen, Christian Mårup

    . The synthesis of these by the cycloaddition of ethylene to furanic compounds, followed by dehydrative aromatization, was demonstrated in good yields, using a strong Brønsted acidic catalyst, WOx/ZrO2. As both ethylene and furanics can be derived from carbohydrates by known processes, this constitutes...... to be an efficient initial conversion step in the utilization of biomass for chemicals production. The shift from an oil based chemical industry to one based on renewable resources is bound to happen sooner or later, however the environmental problems associated with the burning of fossil resources means...

  1. Keep Meaning in Conversational Coordination

    Directory of Open Access Journals (Sweden)

    Elena Clare Cuffari

    2014-12-01

    Full Text Available Coordination is a widely employed term across recent quantitative and qualitative approaches to intersubjectivity, particularly approaches that give embodiment and enaction central explanatory roles. With a focus on linguistic and bodily coordination in conversational contexts, I review the operational meaning of coordination in recent empirical research and related theorizing of embodied intersubjectivity. This discussion articulates what must be involved in treating linguistic meaning as dynamic processes of coordination. The coordination approach presents languaging as a set of dynamic self-organizing processes and actions on multiple timescales and across multiple modalities that come about and work in certain domains (those jointly constructed in social, interactive, high-order sense-making. These processes go beyond meaning at the level that is available to first-person experience. I take one crucial consequence of this to be the ubiquitously moral nature of languaging with others. Languaging coordinates experience, among other levels of behavior and event. Ethical effort is called for by the automatic autonomy-influencing forces of languaging as coordination.

  2. Event-related potentials (ERP) and SGIP1 gene polymorphisms in alcoholics: relation to family history of alcoholism and drug usage.

    Science.gov (United States)

    Chwedorowicz, Roman; Raszewski, Grzegorz; Kapka-Skrzypczak, Lucyna; Sawicki, Krzysztof; Studziński, Tadeusz

    2016-12-23

    The electrophysiological characteristics may serve as valuable biomarkers for the genetic vulnerability underlying alcoholism. The purpose of this study was to evaluate the potential associations between single nucleotide polymorphisms (SNPs) located in the SGIP1 gene and the theta ERP quantitative traits. The theta band (4-7 Hz) visual ERP occurring in the P300 response in the resting EEG were examined to explore the electrophysiological effects of alcohol on the brain in five regions: frontal, central, parietal, temporal and occipital in patients with alcohol addiction. In addition, we tested the potential associations between single nucleotide polymorphisms (SNPs) located in the SGIP1 gene and ERP quantitative traits. We found that the amplitude of the auditory P300 response differed considerably among groups of alcoholics in the frontal, central and temporal areas of the brain and it was lower in the studied brain regions in alcoholics in comparison to non-alcoholics. However, among subjects in the young adult group (GR-1) there was no statistical difference in amplitude of P300 response with control subjects in all studied brain regions in comparison with non-alcoholics. Moreover, we revealed that SNP rs10889635 had a significant effect on P300 amplitude in the central and temporal regions. The reduced P300 amplitude was in AA carriers in comparison to both carriers of GG and GA alleles. The present study demonstrated a possible association of target P300 evoked theta and of alcohol dependence with SNPs from the gene SGIP1 in the region of rs10889635, but further studies are required.

  3. Events diary

    Science.gov (United States)

    2000-01-01

    as Imperial College, the Royal Albert Hall, the Royal College of Art, the Natural History and Science Museums and the Royal Geographical Society. Under the heading `Shaping the future together' BA2000 will explore science, engineering and technology in their wider cultural context. Further information about this event on 6 - 12 September may be obtained from Sandra Koura, BA2000 Festival Manager, British Association for the Advancement of Science, 23 Savile Row, London W1X 2NB (tel: 0171 973 3075, e-mail: sandra.koura@britassoc.org.uk ). Details of the creating SPARKS events may be obtained from creating.sparks@britassoc.org.uk or from the website www.britassoc.org.uk . Other events 3 - 7 July, Porto Alegre, Brazil VII Interamerican conference on physics education: The preparation of physicists and physics teachers in contemporary society. Info: IACPE7@if.ufrgs.br or cabbat1.cnea.gov.ar/iacpe/iacpei.htm 27 August - 1 September, Barcelona, Spain GIREP conference: Physics teacher education beyond 2000. Info: www.blues.uab.es/phyteb/index.html

  4. Conversion program in Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Jonsson, E.B. [Studsvik Nuclear AB, Nykoeping (Sweden)

    1997-08-01

    The conversion of the Swedish 50 MW R2 reactor from HEU to LEU fuel has been successfully accomplished over a 16 cycles long process. The conversion started in January 1991 with the introduction of 6 LEU assemblies in the 8*8 core. The first all LEU core was loaded in March 1993 and physics measurements were performed for the final licensing reports. A total of 142 LEU fuel assemblies have been irradiated up until September 1994 without any fuel incident. The operating licence for the R2 reactor was renewed in mid 1994 taking into account new fuel type. The Swedish Nuclear Inspectorate (SKI) pointed out one crucial problem with the LEU operation, that the back end of the LEU fuel cycle has not yet been solved. For the HEU fuel Sweden had the reprocessing alternative. The country is now relying heavily on the success of the USDOEs Off Site Fuels Policy to take back the spent fuel from the research reactors. They have in the meantime increased their intermediate storage facilities. There is, however, a limit both in time and space for storage of MTR-type of assemblies in water. The penalty of the lower thermal neutron flux in LEU cores has been reduced by improvements of the new irradiation rigs and by fine tuning the core calculations. The Studsvik code package, CASMO-SIMULATE, widely used for ICFM in LWRs has been modified to suit the compact MTR type of core.

  5. Equipment for gas conversion

    Energy Technology Data Exchange (ETDEWEB)

    Tabata, K.; Matsumoto, I.

    1983-01-28

    Equipment is proposed for vapor conversion of hydrocarbons (Uv), possibly in a mixture with air, in order to produce an inorganic gas, which chiefly consists of H2 and COx. It consists of a reaction pipe made of an inorganic refractory ceramic and equipped along the wall circumference with heaters. The reaction pipe is filled with a combined, multilayer catalyst (Kt) carrier, made of gamma-A1203 which in the transverse cross section has a multipore reticular or fibrous structure. Replacement of the traditional steel (St) materials for the walls of the reaction pipe with ceramic materials reduces the output of the hydrocarbon which contaminates the surface (Pv) of the catalyst; the use of a multilayer carrier for the catalyst made of gamma-A1203 with a porous reticular or fibrous structure reduces the pressure losses in the reactor and facilitates the replacement of the spent catalyst. The equipment is designed for vapor conversion of natural gas, C3H8, and vapors of kerosene, naphtha and so on.

  6. Viral driven epigenetic events alter the expression of cancer-related genes in Epstein-Barr-virus naturally infected Burkitt lymphoma cell lines.

    Science.gov (United States)

    Hernandez-Vargas, Hector; Gruffat, Henri; Cros, Marie Pierre; Diederichs, Audrey; Sirand, Cécilia; Vargas-Ayala, Romina C; Jay, Antonin; Durand, Geoffroy; Le Calvez-Kelm, Florence; Herceg, Zdenko; Manet, Evelyne; Wild, Christopher P; Tommasino, Massimo; Accardi, Rosita

    2017-07-19

    Epstein-Barr virus (EBV) was identified as the first human virus to be associated with a human malignancy, Burkitt's lymphoma (BL), a pediatric cancer endemic in sub-Saharan Africa. The exact mechanism of how EBV contributes to the process of lymphomagenesis is not fully understood. Recent studies have highlighted a genetic difference between endemic (EBV+) and sporadic (EBV-) BL, with the endemic variant showing a lower somatic mutation load, which suggests the involvement of an alternative virally-driven process of transformation in the pathogenesis of endemic BL. We tested the hypothesis that a global change in DNA methylation may be induced by infection with EBV, possibly thereby accounting for the lower mutation load observed in endemic BL. Our comparative analysis of the methylation profiles of a panel of BL derived cell lines, naturally infected or not with EBV, revealed that the presence of the virus is associated with a specific pattern of DNA methylation resulting in altered expression of cellular genes with a known or potential role in lymphomagenesis. These included ID3, a gene often found to be mutated in sporadic BL. In summary this study provides evidence that EBV may contribute to the pathogenesis of BL through an epigenetic mechanism.

  7. Event Display for the Visualization of CMS Events

    Science.gov (United States)

    Bauerdick, L. A. T.; Eulisse, G.; Jones, C. D.; Kovalskyi, D.; McCauley, T.; Mrak Tadel, A.; Muelmenstaedt, J.; Osborne, I.; Tadel, M.; Tu, Y.; Yagil, A.

    2011-12-01

    During the last year the CMS experiment engaged in consolidation of its existing event display programs. The core of the new system is based on the Fireworks event display program which was by-design directly integrated with the CMS Event Data Model (EDM) and the light version of the software framework (FWLite). The Event Visualization Environment (EVE) of the ROOT framework is used to manage a consistent set of 3D and 2D views, selection, user-feedback and user-interaction with the graphics windows; several EVE components were developed by CMS in collaboration with the ROOT project. In event display operation simple plugins are registered into the system to perform conversion from EDM collections into their visual representations which are then managed by the application. Full event navigation and filtering as well as collection-level filtering is supported. The same data-extraction principle can also be applied when Fireworks will eventually operate as a service within the full software framework.

  8. Event Displays for the Visualization of CMS Events

    CERN Document Server

    Jones, Christopher Duncan

    2010-01-01

    During the last year the CMS experiment engaged in consolidation of its existing event display programs. The core of the new system is based on the Fireworks event display program which was by-design directly integrated with the CMS Event Data Model (EDM) and the light version of the software framework (FWLite). The Event Visualization Environment (EVE) of the ROOT framework is used to manage a consistent set of 3D and 2D views, selection, user-feedback and user-interaction with the graphics windows; several EVE components were developed by CMS in collaboration with the ROOT project. In event display operation simple plugins are registered into the system to perform conversion from EDM collections into their visual representations which are then managed by the application. Full event navigation and filtering as well as collection-level filtering is supported. The same data-extraction principle can also be applied when Fireworks will eventually operate as a service within the full software framework.

  9. Thermal blurring of event-by-event fluctuations generated by rapidity conversion

    Science.gov (United States)

    Ohnishi, Yutaro; Kitazawa, Masakiyo; Asakawa, Masayuki

    2016-10-01

    We study the effect of thermal blurring caused by the use of (momentum-space) rapidity as a proxy of coordinate-space rapidity in experimental measurements of conserved-charge fluctuations in relativistic heavy-ion collisions. In theoretical studies assuming statistical mechanics, calculated fluctuations are those in a spatial volume. Experiments, on the other hand, can measure fluctuations only in a momentum space in the final state. In a standard argument to compare experimental results for a momentum space with theoretical studies for a coordinate space, rapidities of particles are implicitly regarded as equivalent to their coordinate-space rapidity. We show that the relation of two fluctuations is significantly altered by the existence of the thermal motion, i.e., thermal blurring. We discuss that the thermal blurring can be regarded as a part of the diffusion process, and the effect can be understood by studying the rapidity window dependences of fluctuations. Centrality dependence of the thermal blurring effect is also discussed.

  10. Thermal blurring of event-by-event fluctuations provoked by rapidity conversion

    CERN Document Server

    Ohnishi, Yutaro; Asakawa, Masayuki

    2016-01-01

    We study the effect of thermal blurring caused by the use of (momentum-space) rapidity as a proxy of coordinate-space rapidity in experimental measurements of conserved charge fluctuations in relativistic heavy ion collisions. In theoretical studies assuming statistical mechanics, calculated fluctuations are those in a spatial volume. Experiments, on the other hand, can measure fluctuations only in a momentum-space in the final state. In a standard argument to compare experimental results for a momentum space with theoretical studies for a coordinate space, rapidities of particles are implicitly regarded as equivalent to their coordinate-space rapidity. We show that the relation of two fluctuations is significantly altered by the existence of the thermal motion, i.e. thermal blurring. We discuss that the thermal blurring can be regarded as a part of the diffusion process, and the effect can be understood by studying the rapidity window dependences of fluctuations. Centrality dependence of the thermal blurring...

  11. MINING NUCLEAR TRANSIENT DATA THROUGH SYMBOLIC CONVERSION

    Energy Technology Data Exchange (ETDEWEB)

    Diego MAndelli; Tunc Aldemir; Alper Yilmaz; Curtis Smith

    2013-09-01

    Dynamic Probabilistic Risk Assessment (DPRA) methodologies generate enormous amounts of data for a very large number of simulations. The data contain temporal information of both the state variables of the simulator and the temporal status of specific systems/components. In order to measure system performances, limitations and resilience, such data need to be carefully analyzed with the objective of discovering the correlations between sequence/timing of events and system dynamics. A first approach toward discovering these correlations from data generated by DPRA methodologies has been performed by organizing scenarios into groups using classification or clustering based algorithms. The identification of the correlations between system dynamics and timing/sequencing of events is performed by observing the temporal distribution of these events in each group of scenarios. Instead of performing “a posteriori” analysis of these correlations, this paper shows how it is possible to identify the correlations implicitly by performing a symbolic conversion of both continuous (temporal profiles of simulator state variables) and discrete (status of systems and components) data. Symbolic conversion is performed for each simulation by properly quantizing both continuous and discrete data and then converting them as a series of symbols. After merging both series together, a temporal phrase is obtained. This phrase preserves duration, coincidence and sequence of both continuous and discrete data in a uniform and consistent manner. In this paper it is also shown that by using specific distance measures, it is still possible to post-process such symbolic data using clustering and classification techniques but in considerably less time since the memory needed to store the data is greatly reduced by the symbolic conversion.

  12. Association between a cannabinoid receptor gene (CNR1) polymorphism and cannabinoid-induced alterations of the auditory event-related P300 potential.

    Science.gov (United States)

    Stadelmann, Andreas M; Juckel, Georg; Arning, Larissa; Gallinat, Jürgen; Epplen, Jörg T; Roser, Patrik

    2011-05-27

    Numerous studies demonstrated a close relationship between cannabis abuse and schizophrenia with similar impairments in cognitive processing, particularly in P300 generation. Recently, an (AAT)n triplet repeat polymorphism within the cannabinoid receptor gene CNR1 has been found to be associated with both schizophrenia and substance dependence, and to modulate the P300 potential. As previously reported, both acute oral Δ(9)-tetrahydrocannabinol (Δ(9)-THC), the main psychoactive constituent of cannabis, and standardized cannabis extract containing Δ(9)-THC and cannabidiol (CBD) revealed a significant reduction of P300 amplitudes in healthy subjects but did not show any differences among each other. The aim of this study was to investigate whether the (AAT)n polymorphism differentially modulates the effects of Δ(9)-THC and cannabis extract on P300 generation in 20 healthy volunteers during an auditory choice reaction task. For the >10/>10 genotype, there was a significant decrease of P300 amplitude as well as a significant prolongation of P300 latency under pure Δ(9)-THC but not under cannabis extract. Moreover, we found a significant correlation between the number of AAT repeats and P300 variables for the Δ(9)-THC condition. Our data thus indicate that the CNR1 gene seems to be involved in the regulation of the P300 wave as a marker of selective attention and working memory. Moreover, it appears that variations within CNR1 may differentially alter the sensitivity to the acute effects of cannabinoids on P300 generation in healthy subjects.

  13. Phylogenetic analyses of influenza A (H1N1)pdm09 hemagglutinin gene during and after the pandemic event in Brazil.

    Science.gov (United States)

    Resende, Paola Cristina; Motta, Fernando Couto; Born, Priscila Silva; Machado, Daniela; Caetano, Braulia Costa; Brown, David; Siqueira, Marilda Mendonça

    2015-12-01

    Pandemic influenza A H1N1 [A(H1N1)pdm09] was first detected in Brazil in May 2009, and spread extensively throughout the country causing a peak of infection during June to August 2009. Since then, it has continued to circulate with a seasonal pattern, causing high rates of morbidity and mortality. Over this period, the virus has continually evolved with the accumulation of new mutations. In this study we analyze the phylogenetic relationship in a collection of 220 A(H1N1)pdm09 hemagglutinin (HA) gene sequences collected during and after the pandemic period (2009 to 2014) in Brazil. In addition, we have looked for evidence of viral polymorphisms associated with severe disease and compared the range of viral variants with the vaccine strain (A/California/7/2009) used throughout this period. The phylogenetic analyses in this study revealed the circulation of at least eight genetic groups in Brazil. Two (G6-pdm and G7-pdm) co-circulated during the pandemic period, showing an early pattern of viral diversification with a low genetic distance from vaccine strain. Other phylogenetic groups, G5, G6 (including 6B, 6C and 6D subgroups), and G7 were found in the subsequent epidemic seasons from 2011 to 2014. These viruses exhibited more amino acid differences from the vaccine strain with several substitutions at the antigenic sites. This is associated with a theoretical decrease in the vaccine efficacy. Furthermore, we observed that the presence of any polymorphism at residue 222 of the HA gene was significantly associated with severe/fatal cases, reinforcing previous reports that described this residue as a potential virulence marker. This study provides new information about the circulation of some viral variants in Brazil, follows up potential genetic markers associated with virulence and allows infer if the efficacy of the current vaccine against more recent A(H1N1)pdm09 strains may be reduced.

  14. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  15. Power conversion technologies

    Energy Technology Data Exchange (ETDEWEB)

    Newton, M. A.

    1997-02-01

    The Power Conversion Technologies thrust area identifies and sponsors development activities that enhance the capabilities of engineering at Lawrence Livermore National Laboratory (LLNL) in the area of solid- state power electronics. Our primary objective is to be a resource to existing and emerging LLNL programs that require advanced solid-state power electronic technologies.. Our focus is on developing and integrating technologies that will significantly impact the capability, size, cost, and reliability of future power electronic systems. During FY-96, we concentrated our research efforts on the areas of (1) Micropower Impulse Radar (MIR); (2) novel solid-state opening switches; (3) advanced modulator technology for accelerators; (4) compact accelerators; and (5) compact pulse generators.

  16. Quantum optical waveform conversion

    CERN Document Server

    Kielpinski, D; Wiseman, HM

    2010-01-01

    Currently proposed architectures for long-distance quantum communication rely on networks of quantum processors connected by optical communications channels [1,2]. The key resource for such networks is the entanglement of matter-based quantum systems with quantum optical fields for information transmission. The optical interaction bandwidth of these material systems is a tiny fraction of that available for optical communication, and the temporal shape of the quantum optical output pulse is often poorly suited for long-distance transmission. Here we demonstrate that nonlinear mixing of a quantum light pulse with a spectrally tailored classical field can compress the quantum pulse by more than a factor of 100 and flexibly reshape its temporal waveform, while preserving all quantum properties, including entanglement. Waveform conversion can be used with heralded arrays of quantum light emitters to enable quantum communication at the full data rate of optical telecommunications.

  17. Conversations About Responsible Nanoresearch.

    Science.gov (United States)

    Kjølberg, Kamilla Lein; Strand, Roger

    2011-04-01

    There is currently a strong focus on responsible research in relation to the development of nanoscience and nanotechnology. This study presents a series of conversations with nanoresearchers, with the 'European Commission recommendation on a code of conduct for responsible nanosciences and nanotechnologies research' (EC-CoC) as its point of departure. Six types of reactions to the document are developed, illustrating the diversity existing within the scientific community in responses towards this kind of new approaches to governance. Three broad notions of responsible nanoresearch are presented. The article concludes by arguing that while the suggestion put forward in the EC-CoC brings the concept of responsible nanoresearch a long way, one crucial element is to be wanted, namely responsible nanoresearch as increased awareness of moral choices.

  18. Conversation with Meir Sternberg

    Directory of Open Access Journals (Sweden)

    Federico Pianzola

    2011-07-01

    Full Text Available Below are the videos of the interview recorded the 21st May 2011 in Fribourg (CH, in occasion of the first RRN conference.Conversation with Meir Sternberg.Part 1 of 8 - Narratology: classical and postclassical studies. Part 2 of 8 - The development of an original theoretical framework. Part 3 of 8 - Sternberg and Genette: different ways for the same problems. Part 4 of 8 - «There are no forms except in terms of functions». Part 5 of 8 - A life writing articles: so many papers and just four books. Part 6 of 8 - Two arguments against mimetical approaches to narrative. Part 7 of 8 - «Narrative is not given, it is a construct». Part 8 of 8 - The proteus principle. the many-to-many correspondence between forms and functions.

  19. Thermodynamics and energy conversion

    CERN Document Server

    Struchtrup, Henning

    2014-01-01

    This textbook gives a thorough treatment of engineering thermodynamics with applications to classical and modern energy conversion devices.   Some emphasis lies on the description of irreversible processes, such as friction, heat transfer and mixing, and the evaluation of the related work losses. Better use of resources requires high efficiencies, therefore the reduction of irreversible losses should be seen as one of the main goals of a thermal engineer. This book provides the necessary tools.   Topics include: car and aircraft engines,  including Otto, Diesel and Atkinson cycles, by-pass turbofan engines, ramjet and scramjet;  steam and gas power plants, including advanced regenerative systems, solar tower, and compressed air energy storage; mixing and separation, including reverse osmosis, osmotic powerplants, and carbon sequestration; phase equilibrium and chemical equilibrium, distillation, chemical reactors, combustion processes, and fuel cells; the microscopic definition of entropy.    The book i...

  20. A single crossing-over event in voltage-sensitive Na+ channel genes may cause critical failure of dengue mosquito control by insecticides.

    Directory of Open Access Journals (Sweden)

    Koichi Hirata

    2014-08-01

    Full Text Available The voltage-sensitive sodium (Na+ channel (Vssc is the target site of pyrethroid insecticides. Pest insects develop resistance to this class of insecticide by acquisition of one or multiple amino acid substitution(s in this channel. In Southeast Asia, two major Vssc types confer pyrethroid resistance in the dengue mosquito vector Aedes aegypti, namely, S989P+V1016G and F1534C. We expressed several types of Vssc in Xenopus oocytes and examined the effect of amino acid substitutions in Vssc on pyrethroid susceptibilities. S989P+V1016G and F1534C haplotypes reduced the channel sensitivity to permethrin by 100- and 25-fold, respectively, while S989P+V1016G+F1534C triple mutations reduced the channel sensitivity to permethrin by 1100-fold. S989P+V1016G and F1534C haplotypes reduced the channel sensitivity to deltamethrin by 10- and 1-fold (no reduction, respectively, but S989P+V1016G+F1534C triple mutations reduced the channel sensitivity to deltamethrin by 90-fold. These results imply that pyrethroid insecticides are highly likely to lose their effectiveness against A. aegypti if such a Vssc haplotype emerges as the result of a single crossing-over event; thus, this may cause failure to control this key mosquito vector. Here, we strongly emphasize the importance of monitoring the occurrence of triple mutations in Vssc in the field population of A. aegypti.

  1. The Role of Conversation Policy in Carrying Out Agent Conversations

    Energy Technology Data Exchange (ETDEWEB)

    Link, Hamilton E.; Phillips, Laurence R.

    1999-05-20

    Structured conversation diagrams, or conversation specifications, allow agents to have predictable interactions and achieve predefined information-based goals, but they lack the flexibility needed to function robustly in an unpredictable environment. We propose a mechanism that combines a typical conversation structure with a separately established policy to generate an actual conversation. The word "policy" connotes a high-level direction external to a specific planned interaction with the environment. Policies, which describe acceptable procedures and influence decisions, can be applied to broad sets of activity. Based on their observation of issues related to a policy, agents may dynamically adjust their communication patterns. The policy object describes limitations, constraints, and requirements that may affect the conversation in certain circumstances. Using this new mechanism of interaction simplifies the description of individual conversations and allows domain-specific issues to be brought to bear more easily during agent communication. By following the behavior of the conversation specification when possible and deferring to the policy to derive behavior in exceptional circumstances, an agent is able to function predictably under normal situations and still act rationally in abnormal situations. Different conversation policies applied to a given conversation specification can change the nature of the interaction without changing the specification.

  2. Single-Step qPCR and dPCR Detection of Diverse CRISPR-Cas9 Gene Editing Events In Vivo

    Directory of Open Access Journals (Sweden)

    Micol Falabella

    2017-10-01

    Full Text Available Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR-CRISPR-associated protein 9 (Cas9-based technology is currently the most flexible means to create targeted mutations by recombination or indel mutations by nonhomologous end joining. During mouse transgenesis, recombinant and indel alleles are often pursued simultaneously. Multiple alleles can be formed in each animal to create significant genetic complexity that complicates the CRISPR-Cas9 approach and analysis. Currently, there are no rapid methods to measure the extent of on-site editing with broad mutation sensitivity. In this study, we demonstrate the allelic diversity arising from targeted CRISPR editing in founder mice. Using this DNA sample collection, we validated specific quantitative and digital PCR methods (qPCR and dPCR, respectively for measuring the frequency of on-target editing in founder mice. We found that locked nucleic acid (LNA probes combined with an internal reference probe (Drop-Off Assay provide accurate measurements of editing rates. The Drop-Off LNA Assay also detected on-target CRISPR-Cas9 gene editing in blastocysts with a sensitivity comparable to PCR-clone sequencing. Lastly, we demonstrate that the allele-specific LNA probes used in qPCR competitor assays can accurately detect recombinant mutations in founder mice. In summary, we show that LNA-based qPCR and dPCR assays provide a rapid method for quantifying the extent of on-target genome editing in vivo, testing RNA guides, and detecting recombinant mutations.

  3. Review on Telephone Conversations Analysis

    Institute of Scientific and Technical Information of China (English)

    张咏梅

    2014-01-01

    Telephone conversation, one of the most common uses of human communication, has been a hot topic in linguistic field in modern times. This essay aims at reviewing the main theories and findings in telephone conversation analysis and provid-ing some insights of this aspect which can often be overlooked in our daily life. It is also hoped that this essay can help to pave a foundation for further in-depth study in telephone conversations.

  4. Paradoxical therapy in conversion disorder

    OpenAIRE

    ATAOĞLU, Ahmet

    2014-01-01

    Paradoxical therapy consists of suggesting that the patient intentionally engages in the unwanted behaviour, such as performing complusive ritual or bringing on a conversion attack. In this study paradoxical intention (PI) was used with to half of the patients with conversion disorders, while the other half were treated with diazepam in order to examine the efficiency of the PI versus diazepam in conversion disorder. Patients treated with PI appeared to have a greater improvement r...

  5. Optimized breeding strategies for multiple trait integration: II. Process efficiency in event pyramiding and trait fixation.

    Science.gov (United States)

    Peng, Ting; Sun, Xiaochun; Mumm, Rita H

    2014-01-01

    Multiple trait integration (MTI) is a multi-step process of converting an elite variety/hybrid for value-added traits (e.g. transgenic events) through backcross breeding. From a breeding standpoint, MTI involves four steps: single event introgression, event pyramiding, trait fixation, and version testing. This study explores the feasibility of marker-aided backcross conversion of a target maize hybrid for 15 transgenic events in the light of the overall goal of MTI of recovering equivalent performance in the finished hybrid conversion along with reliable expression of the value-added traits. Using the results to optimize single event introgression (Peng et al. Optimized breeding strategies for multiple trait integration: I. Minimizing linkage drag in single event introgression. Mol Breed, 2013) which produced single event conversions of recurrent parents (RPs) with ≤8 cM of residual non-recurrent parent (NRP) germplasm with ~1 cM of NRP germplasm in the 20 cM regions flanking the event, this study focused on optimizing process efficiency in the second and third steps in MTI: event pyramiding and trait fixation. Using computer simulation and probability theory, we aimed to (1) fit an optimal breeding strategy for pyramiding of eight events into the female RP and seven in the male RP, and (2) identify optimal breeding strategies for trait fixation to create a 'finished' conversion of each RP homozygous for all events. In addition, next-generation seed needs were taken into account for a practical approach to process efficiency. Building on work by Ishii and Yonezawa (Optimization of the marker-based procedures for pyramiding genes from multiple donor lines: I. Schedule of crossing between the donor lines. Crop Sci 47:537-546, 2007a), a symmetric crossing schedule for event pyramiding was devised for stacking eight (seven) events in a given RP. Options for trait fixation breeding strategies considered selfing and doubled haploid approaches to achieve homozygosity

  6. Lambda-lifting and CPS conversion in an imperative language

    CERN Document Server

    Kerneis, Gabriel

    2012-01-01

    This paper is a companion technical report to the article "Continuation-Passing C: from threads to events through continuations". It contains the complete version of the proofs of correctness of lambda-lifting and CPS-conversion presented in the article.

  7. Geothermal energy conversion facility

    Energy Technology Data Exchange (ETDEWEB)

    Kutscher, C.F.

    1997-12-31

    With the termination of favorable electricity generation pricing policies, the geothermal industry is exploring ways to improve the efficiency of existing plants and make them more cost-competitive with natural gas. The Geothermal Energy Conversion Facility (GECF) at NREL will allow researchers to study various means for increasing the thermodynamic efficiency of binary cycle geothermal plants. This work has received considerable support from the US geothermal industry and will be done in collaboration with industry members and utilities. The GECF is being constructed on NREL property at the top of South Table Mountain in Golden, Colorado. As shown in Figure 1, it consists of an electrically heated hot water loop that provides heating to a heater/vaporizer in which the working fluid vaporizes at supercritical or subcritical pressures as high as 700 psia. Both an air-cooled and water-cooled condenser will be available for condensing the working fluid. In order to minimize construction costs, available equipment from the similar INEL Heat Cycle Research Facility is being utilized.

  8. Event Index - an LHCb Event Search System

    CERN Document Server

    Ustyuzhanin, Andrey

    2015-01-01

    During LHC Run 1, the LHCb experiment recorded around 1011 collision events. This paper describes Event Index | an event search system. Its primary function is to quickly select subsets of events from a combination of conditions, such as the estimated decay channel or number of hits in a subdetector. Event Index is essentially Apache Lucene [1] optimized for read-only indexes distributed over independent shards on independent nodes.

  9. Gastrointestinal events with clopidogrel

    DEFF Research Database (Denmark)

    Grove, Erik Lerkevang; Würtz, Morten; Schwarz, Peter

    2013-01-01

    Clopidogrel prevents cardiovascular events, but has been linked with adverse gastrointestinal (GI) complications, particularly bleeding events.......Clopidogrel prevents cardiovascular events, but has been linked with adverse gastrointestinal (GI) complications, particularly bleeding events....

  10. Wavelength conversion techniques and devices

    DEFF Research Database (Denmark)

    Danielsen, Søren Lykke; Mikkelsen, Benny; Hansen, Peter Bukhave

    1997-01-01

    interesting for use in WDM optical fibre networks. However, the perfect converter has probably not yet been fabricated and new techniques such as conversion relying on cross-absorption modulation in electro-absorption modulators might also be considered in pursue of effective conversion devices...

  11. Conversational Competence in Academic Settings

    Science.gov (United States)

    Bowman, Richard F.

    2014-01-01

    Conversational competence is a process, not a state. Ithaca does not exist, only the voyage to Ithaca. Vibrant campuses are a series of productive conversations. At its core, communicative competence in academic settings mirrors a collective search for meaning regarding the purpose and direction of a campus community. Communicative competence…

  12. Conversational Competence in Academic Settings

    Science.gov (United States)

    Bowman, Richard F.

    2014-01-01

    Conversational competence is a process, not a state. Ithaca does not exist, only the voyage to Ithaca. Vibrant campuses are a series of productive conversations. At its core, communicative competence in academic settings mirrors a collective search for meaning regarding the purpose and direction of a campus community. Communicative competence…

  13. Civil Conversations Using Primary Documents

    Science.gov (United States)

    Singleton, Laurel; Pereira, Carolyn

    2005-01-01

    Primary source documents can be a key element in conversation and deliberation. They lend authenticity to student consideration of issues facing people's democracy and stimulate student interest. In addition, conversation about a primary document leads to a much deeper understanding of that document and can raise authentic questions for further…

  14. Faculty Meetings: Hidden Conversational Dynamics

    Science.gov (United States)

    Bowman, Richard F.

    2015-01-01

    In the everydayness of faculty meetings, collegial conversations mirror distinctive dynamics and practices, which either enhance or undercut organizational effectiveness. A cluster of conversational practices affect how colleagues connect, engage, interact, and influence others during faculty meetings in diverse educational settings. The…

  15. Conversing Life: An Autoethnographic Construction

    Science.gov (United States)

    Hoelson, Christopher N.; Burton, Rod

    2012-01-01

    This autoethnography is a constructed account of a co-exploration into the nature and effects of a longitudinal dyadic conversation process from a relational constructionist perspective. The conversations, between me as participant autoethnographer and a co-participant, aimed at maximising personal learning for both. Through co-created contexts of…

  16. Cosmopolitanism - Conversation with Stuart Hall

    OpenAIRE

    Hall, Stuart

    2006-01-01

    Forty minute conversation between Stuart Hall and Pnina Werbner, filmed and edited by Haim Bresheeth. Synopsis by Sarah Harrison. Conversation between Stuart Hall and Pnina Werbner on the theme of Cosmopolitanism (to be shown at the Association of Social Anthropologists Silver Jubilee conference in 2006), in March 2006

  17. [Neuropsychological assessment in conversion disorder].

    Science.gov (United States)

    Demır, Süleyman; Çelıkel, Feryal Çam; Taycan, Serap Erdoğan; Etıkan, İlker

    2013-01-01

    Conversion disorder is characterized by functional impairment in motor, sensory, or neurovegetative systems that cannot be explained by a general medical condition. Diagnostic systems emphasize the absence of an organic basis for the dysfunction observed in conversion disorder. Nevertheless, there is a growing body of data on the specific functional brain correlates of conversion symptoms, particularly those obtained via neuroimaging and neurophysiological assessment. The present study aimed to determine if there are differences in measures of cognitive functioning between patients with conversion disorder and healthy controls. The hypothesis of the study was that the patients with conversion disorder would have poorer neurocognitive performance than the controls. The patient group included 43 patients diagnosed as conversion disorder and other psychiatric comorbidities according to DSM-IV-TR. Control group 1 included 44 patients diagnosed with similar psychiatric comorbidities, but not conversion diosorder, and control group 2 included 43 healthy individuals. All participants completed a sociodemographic questionnaire and were administered the SCID-I and a neuropsychological test battery of 6 tests, including the Serial Digit Learning Test (SDLT), Auditory Verbal Learning Test (AVLT), Wechsler Memory Scale, Stroop Color Word Interference Test, Benton Judgment of Line Orientation Test (BJLOT), and Cancellation Test. The patient group had significantly poorer performance on the SDLT, AVLT, Stroop Color Word Interference Test, and BJLOT than both control groups. The present findings highlight the differences between the groups in learning and memory, executive and visuospatial functions, and attention, which seemed to be specific to conversion disorder.

  18. The Practicalities of Document Conversion.

    Science.gov (United States)

    Galbraith, Ian

    1993-01-01

    Describes steps involved in the conversion of source documents to scanned digital image format. Topics addressed include document preparation, including photographs and oversized material; indexing procedures, including automatic indexing possibilities; scanning documents, including resolution and throughput; quality control; backfile conversion;…

  19. Optimization theory for ballistic conversion

    NARCIS (Netherlands)

    Xie, Yanbo; Versluis, Andreas Michel; van den Berg, Albert; Eijkel, Jan C.T.

    2016-01-01

    The growing demand of renewable energy stimulates the exploration of new materials and methods for clean energy. We recently demonstrated a high efficiency and power density energy conversion mechanism by using jetted charged microdroplets, termed as ballistic energy conversion. Hereby, we model and

  20. Coelacanth genome sequence reveals the evolutionary history of vertebrate genes.

    Science.gov (United States)

    Noonan, James P; Grimwood, Jane; Danke, Joshua; Schmutz, Jeremy; Dickson, Mark; Amemiya, Chris T; Myers, Richard M

    2004-12-01

    The coelacanth is one of the nearest living relatives of tetrapods. However, a teleost species such as zebrafish or Fugu is typically used as the outgroup in current tetrapod comparative sequence analyses. Such studies are complicated by the fact that teleost genomes have undergone a whole-genome duplication event, as well as individual gene-duplication events. Here, we demonstrate the value of coelacanth genome sequence by complete sequencing and analysis of the protocadherin gene cluster of the Indonesian coelacanth, Latimeria menadoensis. We found that coelacanth has 49 protocadherin cluster genes organized in the same three ordered subclusters, alpha, beta, and gamma, as the 54 protocadherin cluster genes in human. In contrast, whole-genome and tandem duplications have generated two zebrafish protocadherin clusters comprised of at least 97 genes. Additionally, zebrafish protocadherins are far more prone to homogenizing gene conversion events than coelacanth protocadherins, suggesting that recombination- and duplication-driven plasticity may be a feature of teleost genomes. Our results indicate that coelacanth provides the ideal outgroup sequence against which tetrapod genomes can be measured. We therefore present L. menadoensis as a candidate for whole-genome sequencing.

  1. Improvement of skeleton conversion in ICRP reference phantom conversion project

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhao Jun; Yeom, Yeon Soo; Thang, Nguyen Tat; Kim, Han Sung; Han, Min Cheol; Kim, Chan Hyeong [Dept. of Nuclear Engineering, Hanyang University, Seoul (Korea, Republic of); Kim, Seong Hoon [Dept. of Radiation Oncology, College of Medicine, Hanyang University, Seoul (Korea, Republic of)

    2014-11-15

    In the previous skeleton conversion, most bones were directly converted from the ICRP voxel phantoms by using the 3D rendering method whereas several complex-shape bones (cranium, ribs, spines, feet, and hands) were not able to be directly converted. We alternatively employed the corresponding well-defined polygonal models and attempted to adjust them to match the voxel models. However, this approach was unsatisfactory. The shapes of the alternative models were significantly different from those of the voxel models, making it virtually impossible to exactly match the voxel models as shown in Fig. 3 (left). In order to overcome the difficulty in the complex bone conversion, the present study developed a new conversion method and converted these complex bones voxel models of the ICRP male phantom to polygonal models. The present study developed the new conversion method and successfully improved polygonal models for cranium, ribs, and spines for the ICRP male phantom. The new conversion method will be also applied to the complex bone conversion for the ICRP female phantom as well as other complex organ conversion in the future.

  2. Creating Special Events

    Science.gov (United States)

    deLisle, Lee

    2009-01-01

    "Creating Special Events" is organized as a systematic approach to festivals and events for students who seek a career in event management. This book looks at the evolution and history of festivals and events and proceeds to the nuts and bolts of event management. The book presents event management as the means of planning, organizing, directing,…

  3. Conversion of deletions during recombination in pneumococcal transformation.

    Science.gov (United States)

    Lefèvre, J C; Mostachfi, P; Gasc, A M; Guillot, E; Pasta, F; Sicard, M

    1989-11-01

    Genetic analysis of 16 deletions obtained in the amiA locus of pneumococcus is described. When present on donor DNA, all deletions increased drastically the frequency of wild-type recombinants in two-point crosses. This effect was maximal for deletions longer than 200 bases. It was reduced for heterologies shorter than 76 bases and did not exist for very short deletions. In three-point crosses in which the deletion was localized between two point mutations, we demonstrated that this excess of wild-type recombinants was the result of a genetic conversion. This conversion extended over several scores of bases outside the deletion. Conversion takes place during the heteroduplex stage of recombination. Therefore, in pneumococcal transformation, long heterologies participated in this heteroduplex configuration. As this conversion did not require an active DNA polymerase A gene it is proposed that the mechanism of conversion is not a DNA repair synthesis but involves breakage and ligation between DNA molecules. Conversion of deletions did not require the Hex system of correction of mismatched bases. It differs also from localized conversion. It appears that it is a process that evolved to correct errors of replication which lead to long heterologies and which are not eliminated by other systems.

  4. Petite fabrique de conversation francaise (Little Factory of French Conversation).

    Science.gov (United States)

    Dubroca, Danielle

    1987-01-01

    A technique using dialogues and realistic prose passages from the works of Georges Simenon and Simone de Beauvoir to teach French conversational skills at the college level is explained and illustrated. (MSE)

  5. Petite fabrique de conversation francaise (Little Factory of French Conversation).

    Science.gov (United States)

    Dubroca, Danielle

    1987-01-01

    A technique using dialogues and realistic prose passages from the works of Georges Simenon and Simone de Beauvoir to teach French conversational skills at the college level is explained and illustrated. (MSE)

  6. Roadmap on optical energy conversion

    Science.gov (United States)

    Boriskina, Svetlana V.; Green, Martin A.; Catchpole, Kylie; Yablonovitch, Eli; Beard, Matthew C.; Okada, Yoshitaka; Lany, Stephan; Gershon, Talia; Zakutayev, Andriy; Tahersima, Mohammad H.; Sorger, Volker J.; Naughton, Michael J.; Kempa, Krzysztof; Dagenais, Mario; Yao, Yuan; Xu, Lu; Sheng, Xing; Bronstein, Noah D.; Rogers, John A.; Alivisatos, A. Paul; Nuzzo, Ralph G.; Gordon, Jeffrey M.; Wu, Di M.; Wisser, Michael D.; Salleo, Alberto; Dionne, Jennifer; Bermel, Peter; Greffet, Jean-Jacques; Celanovic, Ivan; Soljacic, Marin; Manor, Assaf; Rotschild, Carmel; Raman, Aaswath; Zhu, Linxiao; Fan, Shanhui; Chen, Gang

    2016-07-01

    For decades, progress in the field of optical (including solar) energy conversion was dominated by advances in the conventional concentrating optics and materials design. In recent years, however, conceptual and technological breakthroughs in the fields of nanophotonics and plasmonics combined with a better understanding of the thermodynamics of the photon energy-conversion processes reshaped the landscape of energy-conversion schemes and devices. Nanostructured devices and materials that make use of size quantization effects to manipulate photon density of states offer a way to overcome the conventional light absorption limits. Novel optical spectrum splitting and photon-recycling schemes reduce the entropy production in the optical energy-conversion platforms and boost their efficiencies. Optical design concepts are rapidly expanding into the infrared energy band, offering new approaches to harvest waste heat, to reduce the thermal emission losses, and to achieve noncontact radiative cooling of solar cells as well as of optical and electronic circuitries. Light-matter interaction enabled by nanophotonics and plasmonics underlie the performance of the third- and fourth-generation energy-conversion devices, including up- and down-conversion of photon energy, near-field radiative energy transfer, and hot electron generation and harvesting. Finally, the increased market penetration of alternative solar energy-conversion technologies amplifies the role of cost-driven and environmental considerations. This roadmap on optical energy conversion provides a snapshot of the state of the art in optical energy conversion, remaining challenges, and most promising approaches to address these challenges. Leading experts authored 19 focused short sections of the roadmap where they share their vision on a specific aspect of this burgeoning research field. The roadmap opens up with a tutorial section, which introduces major concepts and terminology. It is our hope that the roadmap

  7. Roadmap on optical energy conversion

    Energy Technology Data Exchange (ETDEWEB)

    Boriskina, Svetlana V.; Green, Martin A.; Catchpole, Kylie; Yablonovitch, Eli; Beard, Matthew C.; Okada, Yoshitaka; Lany, Stephan; Gershon, Talia; Zakutayev, Andriy; Tahersima, Mohammad H.; Sorger, Volker J.; Naughton, Michael J.; Kempa, Krzysztof; Dagenais, Mario; Yao, Yuan; Xu, Lu; Sheng, Xing; Bronstein, Noah D.; Rogers, John A.; Alivisatos, A. Paul; Nuzzo, Ralph G.; Gordon, Jeffrey M.; Wu, Di M.; Wisser, Michael D.; Salleo, Alberto; Dionne, Jennifer; Bermel, Peter; Greffet, Jean-Jacques; Celanovic, Ivan; Soljacic, Marin; Manor, Assaf; Rotschild, Carmel; Raman, Aaswath; Zhu, Linxiao; Fan, Shanhui; Chen, Gang

    2016-06-24

    For decades, progress in the field of optical (including solar) energy conversion was dominated by advances in the conventional concentrating optics and materials design. In recent years, however, conceptual and technological breakthroughs in the fields of nanophotonics and plasmonics combined with a better understanding of the thermodynamics of the photon energy-conversion processes reshaped the landscape of energy-conversion schemes and devices. Nanostructured devices and materials that make use of size quantization effects to manipulate photon density of states offer a way to overcome the conventional light absorption limits. Novel optical spectrum splitting and photon-recycling schemes reduce the entropy production in the optical energy-conversion platforms and boost their efficiencies. Optical design concepts are rapidly expanding into the infrared energy band, offering new approaches to harvest waste heat, to reduce the thermal emission losses, and to achieve noncontact radiative cooling of solar cells as well as of optical and electronic circuitries. Light-matter interaction enabled by nanophotonics and plasmonics underlie the performance of the third- and fourth-generation energy-conversion devices, including up- and down-conversion of photon energy, near-field radiative energy transfer, and hot electron generation and harvesting. Finally, the increased market penetration of alternative solar energy-conversion technologies amplifies the role of cost-driven and environmental considerations. This roadmap on optical energy conversion provides a snapshot of the state of the art in optical energy conversion, remaining challenges, and most promising approaches to address these challenges. Leading experts authored 19 focused short sections of the roadmap where they share their vision on a specific aspect of this burgeoning research field. The roadmap opens up with a tutorial section, which introduces major concepts and terminology. It is our hope that the roadmap

  8. A note on conversational interruptions A note on conversational interruptions

    OpenAIRE

    Anthony F. Deyes

    2008-01-01

    In their seminal article, Sacks, Schegloff and Jefferson (1974) examine procedures for turn-taking in conversation. Sometimes, they note, a s peaker will select who has the next turn, but more frequently a "self-select" system operates, whereby the participants in a conversation themselves determine when they wish to speak. But how, ask Sacks, Schegloff and Jefferson, do the interlocutors secure a turn in the ongoing flow of another speaker's utterance? To answer this question the author...

  9. Internal conversion in highly-stripped {sup 83}Kr ions

    Energy Technology Data Exchange (ETDEWEB)

    Rehm, K.E.; Ahmad, I.; Gehring, J. [and others

    1995-08-01

    The transition probability per unit time for the decay of a nuclear level via internal conversion (IC), {lambda}IC, depends on the electron environment of the nucleus. For example, inner-shell conversion in highly-charged ions can change appreciably as electrons are successively removed from the ion. Magnetic dipole (Ml) transitions are especially sensitive to this effect since the internal conversion depends strongly on the electron density at the nucleus. Hence, measurements of {lambda}IC,q, the internal conversion rate in an ion with charge state q, can provide good tests of theoretical electron wave functions if the electron configuration in the ions is known. In a previous experiment, a new method which identifies charge-changing events during passage of ion beams through a magnetic spectrometer was used to determine {lambda}IC,q for the 14.4-keV isomer in {sup 57}Fe. This contribution reports measurements made using the same technique for the 9.4-keV isomer in {sup 83}Kr. A beam of {sup 83}Kr with energy 650 MeV bombarded a Au target with a thickness 300 {mu}g cm{sup -2}. Secondary scattered beams were accepted and analyzed by an Enge magnetic spectrometer. The numbers of excited nuclei decaying during passage through the spectrometer and their internal conversion rates were deduced from the pattern of events measured in the spectrometer focal plane.

  10. Direct conversion of fusion energy

    Energy Technology Data Exchange (ETDEWEB)

    Johansson, Markus

    2003-03-01

    Deuterium and tritium are expected to be used as fuel in the first fusion reactors. Energy is released as kinetic energy of ions and neutrons, when deuterium reacts with tritium. One way to convert the kinetic energy to electrical energy, is to let the ions and neutrons hit the reactor wall and convert the heat that is caused by the particle bombardment to electrical energy with ordinary thermal conversion. If the kinetic energy of the ions instead is converted directly to electrical energy, a higher efficiency of the energy conversion is possible. The majority of the fusion energy is released as kinetic energy of neutrons, when deuterium reacts with tritium. Fusion reactions such as the D-D reactions, the D-{sup 3}He reaction and the p-{sup 11}B reaction, where a larger part of the fusion energy becomes kinetic energy of charged particles, appears therefore more suitable for direct conversion. Since they have lower reactivity than the D-T reaction, they need a larger {beta}B{sup 2}{sub 0} to give sufficiently high fusion power density. Because of this, the fusion configurations spherical torus (ST) and field-reversed configuration (FRC), where high {beta} values are possible, appear interesting. Rosenbluth and Hinton come to the conclusion that efficient direct conversion isn't possible in closed field line systems and that open geometries, which facilitate direct conversion, provide inadequate confinement for D-{sup 3}He. It is confirmed in this study that it doesn't seem possible to achieve as high direct conversion efficiency in closed systems as in open systems. ST and FRC fusion power plants that utilize direct conversion seem however interesting. Calculations with the help of Maple indicate that the reactor parameters needed for a D-D ST and a D{sub 3} He ST hopefully are possible to achieve. The best energy conversion option for a D-D or D{sub 3} He ST appears to be direct electrodynamic conversion (DEC) together with ordinary thermal conversion

  11. Conversion of Abbandoned Military Areas

    Directory of Open Access Journals (Sweden)

    Daiva Marcinkevičiūtė

    2011-03-01

    Full Text Available The article analyses the situation of abandoned military sites, their value and significance of their conservation. It also reviews their impact on their environment and their potential in tourism, environmental, economic and social spheres. Further the positive experiences in military sites' conversion are studied. The importance of society's involvement in the conversions is discussed. The situation of XIX-XX age's military object's, the significance of their conservation and their potential in tourism market is separately analysed. The results of two researches are introduced, one of which inquires about the Lithuanian military objects' potential in tourism sphere, another one explores the possibilities of conversion. Article in Lithuanian

  12. Correlation between the Polymorphism of PepT1 Gene and Feed Conversion Rate in Chongren Spotty Chicken%崇仁麻鸡PepT1基因多态性与饲料转化率的关联分析

    Institute of Scientific and Technical Information of China (English)

    肖金华; 何余湧; 侯冠彧; 谢金防; 武艳平; 陆伟; 刘林秀; 霍俊宏; 季华员; 康昭风; 谢明贵; 唐维国

    2013-01-01

    In this study 60-120 d Chongren spotty chickens were used as the test material and primers were designed according to the sequence of PepT1 gene. Then the single nucleotide polymorphisms of PepT1 gene were detected by PCR direct sequencing and its genotype was analyzed by read-through of DNA sequence along with the identification of its peak chart, which aimed to explore the relationship between PepT1 gene polymorphism and feed conversion rate in Chongren spotty chickens. Three SNP loci were found and they were completely silent mutations. A single base was transformed( G→A) on the 95st spot of exon 4 in PepT1, leading to three genotypes: AA, AB and BB. And another two mutations, which were proved identical, were detected on the 64st spot and the 70st spot of exon 6 of PepT1 gene ( C→G and A→G, respectively) , leading to two genotypes; AA and AB. By analyzing PepT1 gene polymorphism with POPGENE 32 software, PV1 ' s polymorphic locus was moderate and that of PV2 was low, although they were in Hardy - Weinberg equilibrium. Correlation analysis between SNPs genotype of PepT1 gene and feed conversion rate was carried out through SPSS 17.0 and showed that three genotypes in PV1 and two genotypes in PV2 of PepTl. gene were not significantly correlated with feed conversion rate (P>0.05).%试验以60 ~120日龄崇仁麻鸡为试验材料,根据鸡PepT1基因序列设计引物,采用PCR产物直接测序方法检测PepT1基因单核苷酸多态性,并通过对序列碱基的通读以及峰图的鉴定进行基因型分析,探讨PepT1基因多态性与崇仁麻鸡饲料转化率之间的关系.结果共检测到3个SNP位点,且均为沉默突变.其中在PepT1基因外显子4第95处发生了单碱基的改变(G→A),这个突变产生3种基因型(AA,AB和BB),在PepT1基因外显子6第64处和第70处上发现两处突变(分别是由C→G和A→G),且这两处突变具有同一性,这两个突变产生2种基因型(AA,AB).用POPGENE 32软件分析PepT1

  13. Enzymes for improved biomass conversion

    Science.gov (United States)

    Brunecky, Roman; Himmel, Michael E.

    2016-02-02

    Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.

  14. Effective communication during difficult conversations.

    Science.gov (United States)

    Polito, Jacquelyn M

    2013-06-01

    A strong interest and need exist in the workplace today to master the skills of conducting difficult conversations. Theories and strategies abound, yet none seem to have found the magic formula with universal appeal and success. If it is such an uncomfortable skill to master is it better to avoid or initiate such conversations with employees? Best practices and evidence-based management guide us to the decision that quality improvement dictates effective communication, even when difficult. This brief paper will offer some suggestions for strategies to manage difficult conversations with employees. Mastering the skills of conducting difficult conversations is clearly important to keeping lines of communication open and productive. Successful communication skills may actually help to avert confrontation through employee engagement, commitment and appropriate corresponding behavior

  15. Feature conversion for concurrent engineering

    NARCIS (Netherlands)

    De Kraker, J.K.

    1998-01-01

    Feature conversion for concurrent engineering integrates two modern product development paradigms. Concurrent engineering is a product development paradigm in which multiple engineering disciplines participate. It optimizes a product with respect to available resources and product quality, for which

  16. Enzymes for improved biomass conversion

    Energy Technology Data Exchange (ETDEWEB)

    Brunecky, Roman; Himmel, Michael E.

    2016-02-02

    Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.

  17. Compact energy conversion module Project

    Data.gov (United States)

    National Aeronautics and Space Administration — This STTR project delivers a compact vibration-based Energy Conversion Module (ECM) that powers sensors for purposes like structural health monitoring (SHM). NASA...

  18. Improved upper limit on Muonium to Antimuonium Conversion

    CERN Document Server

    Abela, R; Bertl, W; Engfer, R; Von Weikersthal, B F; Grossmann, A; Hughes, V W; Jungmann, Klaus; Kampmann, D; Karpukhin, V V; Kisel, I V; Klaas, A; Korenchenko, S M; Kuchinskii, N A; Leuschner, A; Matthias, B E; Menz, R; Meyer, V; Mzhavia, D A; Otter, Gerd; Prokscha, T; Pruys, H S; zu Putlitz, Gisbert; Reichart, W; Reinhard, I; Renker, D; Sakhelashvili, T M; Schmidt, P V; Seeliger, R; Walter, H K; Willmann, L; Zhang, L

    1998-01-01

    A new experiment has been set up at the Paul Scherrer Institut to search for muonium to antimuonium conversion. No event was found to fulfil the requested signature which consists of the coincident detection of both constituents of the antiatom in its decay. Assuming an effective (V-A)$\\times$(V-A) type interaction an improved upper limit is established for the conversion probability of ${\\rm P_{M\\bar{M}}} \\leq 8 \\cdot 10^{-9}$ (90%C.L.), which is almost two orders of magnitude lower compared to previous results and provides a sensitive test for theoretical extensions of the standard model.

  19. Nominal Performance Biosphere Dose Conversion Factor Analysis

    Energy Technology Data Exchange (ETDEWEB)

    M.A. Wasiolek

    2005-04-28

    This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the Total System Performance Assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the groundwater exposure scenario, and the development of conversion factors for assessing compliance with the groundwater protection standards. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop BDCFs, which are input parameters for the TSPA-LA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the ''Biosphere Model Report'' in Figure 1-1, contain detailed description of the model input parameters, their development, and the relationship between the parameters and specific features events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the groundwater exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and the five analyses that develop parameter values for the biosphere model (BSC 2005 [DIRS 172827]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis

  20. Humor and embodied conversational agents

    OpenAIRE

    Nijholt, A.

    2003-01-01

    This report surveys the role of humor in human-to-human interaction and the possible role of humor in human-computer interaction. The aim is to see whether it is useful for embodied conversational agents to integrate humor capabilities in their internal model of intelligence, emotions and interaction (verbal and nonverbal) capabilities. A current state of the art of research in embodied conversational agents, affective computing and verbal and nonverbal interaction is presented. The report ad...

  1. Conversational implicature in business negotiation

    Institute of Scientific and Technical Information of China (English)

    刘秀云

    2008-01-01

    Conversational implicature is a feature of language in use. This paper is trying to explore the conversational implicature phenomenonin business negotiation. From pragmatics view, it analyses the potential meaning of break off the Negotiation and carry on the negotiation in business negotiation. Through carefully selected examples, it manages to show how to behave politely in business negotiation. It's hoped that this paper can help those who are in such field to achieve successful negotiation.

  2. Bilingualism Accentuates Children's Conversational Understanding

    OpenAIRE

    Michael Siegal; Luca Surian; Ayumi Matsuo; Alessandra Geraci; Laura Iozzi; Yuko Okumura; Shoji Itakura

    2010-01-01

    BACKGROUND: Although bilingualism is prevalent throughout the world, little is known about the extent to which it influences children's conversational understanding. Our investigation involved children aged 3-6 years exposed to one or more of four major languages: English, German, Italian, and Japanese. In two experiments, we examined the children's ability to identify responses to questions as violations of conversational maxims (to be informative and avoid redundancy, to speak the truth, be...

  3. Event Segmentation Ability Uniquely Predicts Event Memory

    Science.gov (United States)

    Sargent, Jesse Q.; Zacks, Jeffrey M.; Hambrick, David Z.; Zacks, Rose T.; Kurby, Christopher A.; Bailey, Heather R.; Eisenberg, Michelle L.; Beck, Taylor M.

    2013-01-01

    Memory for everyday events plays a central role in tasks of daily living, autobiographical memory, and planning. Event memory depends in part on segmenting ongoing activity into meaningful units. This study examined the relationship between event segmentation and memory in a lifespan sample to answer the following question: Is the ability to segment activity into meaningful events a unique predictor of subsequent memory, or is the relationship between event perception and memory accounted for by general cognitive abilities? Two hundred and eight adults ranging from 20 to 79 years old segmented movies of everyday events and attempted to remember the events afterwards. They also completed psychometric ability tests and tests measuring script knowledge for everyday events. Event segmentation and script knowledge both explained unique variance in event memory above and beyond the psychometric measures, and did so as strongly in older as in younger adults. These results suggest that event segmentation is a basic cognitive mechanism, important for memory across the lifespan. PMID:23942350

  4. Frequency conversion of structured light.

    Science.gov (United States)

    Steinlechner, Fabian; Hermosa, Nathaniel; Pruneri, Valerio; Torres, Juan P

    2016-02-15

    Coherent frequency conversion of structured light, i.e. the ability to manipulate the carrier frequency of a wave front without distorting its spatial phase and intensity profile, provides the opportunity for numerous novel applications in photonic technology and fundamental science. In particular, frequency conversion of spatial modes carrying orbital angular momentum can be exploited in sub-wavelength resolution nano-optics and coherent imaging at a wavelength different from that used to illuminate an object. Moreover, coherent frequency conversion will be crucial for interfacing information stored in the high-dimensional spatial structure of single and entangled photons with various constituents of quantum networks. In this work, we demonstrate frequency conversion of structured light from the near infrared (803 nm) to the visible (527 nm). The conversion scheme is based on sum-frequency generation in a periodically poled lithium niobate crystal pumped with a 1540-nm Gaussian beam. We observe frequency-converted fields that exhibit a high degree of similarity with the input field and verify the coherence of the frequency-conversion process via mode projection measurements with a phase mask and a single-mode fiber. Our results demonstrate the suitability of exploiting the technique for applications in quantum information processing and coherent imaging.

  5. Translation of Conversational Implicature and the Strategies

    Institute of Scientific and Technical Information of China (English)

    TIAN Yuan

    2015-01-01

    Grice introduced the theory of conversational implicature which is essential in translation, especially in conversation translation of fictions. Four most commonly-seen and effective strategies of translating the conversational implicature are going to discussed.

  6. Holter and Event Monitors

    Science.gov (United States)

    ... Share this page from the NHLBI on Twitter. Holter and Event Monitors Also known as ambulatory EKG; continuous EKG; EKG event monitors. Holter and event monitors are small, portable electrocardiogram devices ...

  7. Keterlibatan Event Stakeholders pada Keberhasilan Event PR

    Directory of Open Access Journals (Sweden)

    Lidya Wati Evelina

    2013-03-01

    Full Text Available The objective of this article is to determine how event organizers collaborate with stakeholders including the media, particular community, sponsors, participants, venue providers, accommodation providers, carteres, legal and finance personnel, production, local trade, transportation providers, government and associations for implementation Public Relations event. This paper discusses about the things that must be done for the cooperation and the benefits of cooperation undertaken. The method used in this paper is qualitative research method based on observations, literature and case studies. The results of this research note that the event organizers or companies can together with the stakeholders (the other party make an event as mutually beneficial Public Relations. This means that all parties can achieve through the event. At the conclusion of an event Public Relations, all stakeholders involved for their own purposes. Event organizer must ensure that all stakeholders work together effectively in accordance with the agreed schedule and budget. One important feature of the agreement is to maintain a good flow of communication according to the needs of its stakeholders. All information is documented to avoid misunderstandings. Collaboration between stakeholders continuously until the event is completed. Discussion of issues that arise during the event takes place between the committee with various stakeholders is an important thing for the evaluation and response to the events that occurred.

  8. Cardiac event monitors

    Science.gov (United States)

    ... ECG) - ambulatory; Continuous electrocardiograms (EKGs); Holter monitors; Transtelephonic event monitors ... attached. You can carry or wear a cardiac event monitor up to 30 days. You carry the ...

  9. The opsin repertoire of Jenynsia onca: a new perspective on gene duplication and divergence in livebearers

    Directory of Open Access Journals (Sweden)

    Owens Gregory L

    2009-08-01

    Full Text Available Abstract Background Jenynsia onca, commonly known as the one sided livebearer, is a member of the family Anablepidae. The opsin gene repertoires of J. onca's close relatives, the four-eyed fish (Anableps anableps and the guppy (Poecilia reticulata, have been characterized and each found to include one unique LWS opsin. Currently, the relationship among LWS paralogs and orthologs in these species are unclear, making it difficult to test the hypotheses that link vision to morphology or life history traits. The phylogenetic signal appears to have been disrupted by gene conversion. Here we have sequenced the opsin genes of J. onca in order to resolve these relationships. Findings We identified nine visual opsins; LWS S180r, LWS S180, LWS P180, SWS1, SWS2A, SWS2B, RH1, RH2-1, and RH2-2. Key site analysis revealed only one unique haplotype, RH2-2, although this is unlikely to shift λmax significantly. LWS P180 was found to be a product of a gene conversion event with LWS S180, followed by convergence to a proline residue at the 180 site. Conclusion Jenynsia onca has at least 9 visual opsins: three LWS, one RH1, two RH2, one SWS1 and two SWS2. The presence of LWS P180 moves the location of the LWS P180-S180 tandem duplication event back to the base of the Poeciliidae-Anablepidae clade, expanding the number of species possessing this unusual blue shifted LWS opsin. The presence of the LWS P180 gene also confirms that gene conversion events have homogenized opsin paralogs in fish, just as they have in humans.

  10. Serious Illness Conversations in ESRD.

    Science.gov (United States)

    Mandel, Ernest I; Bernacki, Rachelle E; Block, Susan D

    2017-05-08

    Dialysis-dependent ESRD is a serious illness with high disease burden, morbidity, and mortality. Mortality in the first year on dialysis for individuals over age 75 years old approaches 40%, and even those with better prognoses face multiple hospitalizations and declining functional status. In the last month of life, patients on dialysis over age 65 years old experience higher rates of hospitalization, intensive care unit admission, procedures, and death in hospital than patients with cancer or heart failure, while using hospice services less. This high intensity of care is often inconsistent with the wishes of patients on dialysis but persists due to failure to explore or discuss patient goals, values, and preferences in the context of their serious illness. Fewer than 10% of patients on dialysis report having had a conversation about goals, values, and preferences with their nephrologist, although nearly 90% report wanting this conversation. Many nephrologists shy away from these conversations, because they do not wish to upset their patients, feel that there is too much uncertainty in their ability to predict prognosis, are insecure in their skills at broaching the topic, or have difficulty incorporating the conversations into their clinical workflow. In multiple studies, timely discussions about serious illness care goals, however, have been associated with enhanced goal-consistent care, improved quality of life, and positive family outcomes without an increase in patient distress or anxiety. In this special feature article, we will (1) identify the barriers to serious illness conversations in the dialysis population, (2) review best practices in and specific approaches to conducting serious illness conversations, and (3) offer solutions to overcome barriers as well as practical advice, including specific language and tools, to implement serious illness conversations in the dialysis population. Copyright © 2017 by the American Society of Nephrology.

  11. Chemical Conversion of Human Fibroblasts into Functional Schwann Cells

    Directory of Open Access Journals (Sweden)

    Eva C. Thoma

    2014-10-01

    Full Text Available Direct transdifferentiation of somatic cells is a promising approach to obtain patient-specific cells for numerous applications. However, conversion across germ-layer borders often requires ectopic gene expression with unpredictable side effects. Here, we present a gene-free approach that allows efficient conversion of human fibroblasts via a transient progenitor stage into Schwann cells, the major glial cell type of peripheral nerves. Using a multikinase inhibitor, we transdifferentiated fibroblasts into transient neural precursors that were subsequently further differentiated into Schwann cells. The resulting induced Schwann cells (iSCs expressed numerous Schwann cell-specific proteins and displayed neurosupportive and myelination capacity in vitro. Thus, we established a strategy to obtain mature Schwann cells from human postnatal fibroblasts under chemically defined conditions without the introduction of ectopic genes.

  12. Conversion chimique du gaz naturel Chemical Conversion of Natural Gas

    Directory of Open Access Journals (Sweden)

    Chaumette P.

    2006-11-01

    Full Text Available Dans cet article sont passés en revue les travaux de recherche et développement et les procédés existants dans le domaine de la conversion chimique du gaz naturel. Les deux voies possibles, conversion directe du méthane et conversion indirecte, via le gaz de synthèse, sont présentées. Tant la préparation d'hydrocarbures utilisables comme carburants, que celle des composés de bases pour la pétrochimie ou la chimie sont évoquées. L'accent est mis sur l'étape clé du développement de chaque procédé qui, selon le produit visé, consiste en la mise au point d'un nouveau système catalytique, en un changement de la technologie du réacteur, ou en la mise au point d'une section fractionnement moins complexe. This article reviews the research and development work and the existing processes in the area of chemical conversion of natural gas. The two possible methods, direct conversion of methane and indirect conversion via synthesis gas, are discussed. The preparation of hydrocarbons that can be used as fuels and the production of building blocks for the petrochemical and chemical industries are both dealt with. The accent is placed on the key step in developing each process. Depending on the target product, this key step consists in working out a new catalytic system, changing reactor technology or engineering a less complex fractionation section.

  13. Polarity of localised conversion in Streptococcus pneumoniae transformation.

    Science.gov (United States)

    Mostachfi, P; Sicard, A M

    1987-06-01

    Localised conversion in pneumococcal transformation is a process that spans a few nucleotides when the 5'-ATTAAT/3'-TAAGTA configuration occurs at the pairing step. It was first observed in two-point crosses between an amiA mutation (amiA36) carrying this sequence and other closely linked mutants of the locus. The yield of the amiA resistance allele conversion to wild type is 20%. In order to characterize this process, which differs from long-patch conversion by the length of DNA repair, gene requirements and sequence specificity, we devised experiments to detect the reciprocal conversion, AmiA+ to AmiAr. For this purpose we examined the suppressibility by a pneumococcal informational suppressor of several nonsense mutations at the locus. Amber (UAG) and ochre (UAA) mutations are suppressed whereas UGA is not suppressed. In this genetic background, where amiA36 is partly suppressed, it was possible to select for double mutants in a cross between amiA36 and a closely linked non-suppressible marker. Direct isolation of such double mutants was also performed without any screening in crosses between amiA36 and the same linked marker in cloned DNA. The frequency of double mutants was very low (1/175) suggesting that there is no conversion of wild-type to mutant alleles. Thus conversion is a polarized process changing specifically A to C.

  14. Prion protein and its conformational conversion: a structural perspective.

    Science.gov (United States)

    Surewicz, Witold K; Apostol, Marcin I

    2011-01-01

    The key molecular event in the pathogenesis of prion diseases is the conformational conversion of a cellular prion protein, PrP(C), into a misfolded form, PrP(Sc). In contrast to PrP(C) that is monomeric and α-helical, PrP(Sc) is oligomeric in nature and rich in β-sheet structure. According to the "protein-only" model, PrP(Sc) itself represents the infectious prion agent responsible for transmissibility of prion disorders. While this model is supported by rapidly growing experimental data, detailed mechanistic and structural aspects of prion protein conversion remain enigmatic. In this chapter we describe recent advances in understanding biophysical and biochemical aspects of prion diseases, with a special focus on structural underpinnings of prion protein conversion, the structural basis of prion strains, and generation of prion infectivity in vitro from bacterially-expressed recombinant PrP.

  15. DNA Sequence Evolution and Rare Homoeologous Conversion in Tetraploid Cotton.

    Directory of Open Access Journals (Sweden)

    Justin T Page

    2016-05-01

    Full Text Available Allotetraploid cotton species are a vital source of spinnable fiber for textiles. The polyploid nature of the cotton genome raises many evolutionary questions as to the relationships between duplicated genomes. We describe the evolution of the cotton genome (SNPs and structural variants with the greatly improved resolution of 34 deeply re-sequenced genomes. We also explore the evolution of homoeologous regions in the AT- and DT-genomes and especially the phenomenon of conversion between genomes. We did not find any compelling evidence for homoeologous conversion between genomes. These findings are very different from other recent reports of frequent conversion events between genomes. We also identified several distinct regions of the genome that have been introgressed between G. hirsutum and G. barbadense, which presumably resulted from breeding efforts targeting associated beneficial alleles. Finally, the genotypic data resulting from this study provides access to a wealth of diversity sorely needed in the narrow germplasm of cotton cultivars.

  16. Conformational conversion of prion protein in prion diseases

    Institute of Scientific and Technical Information of China (English)

    Zheng Zhou; Gengfu Xiao

    2013-01-01

    Prion diseases are a group of infectious fatal neurodegenerative diseases.The conformational conversion of a cellular prion protein (PrPC) into an abnormal misfolded isoform (PrPSc) is the key event in prion diseases pathology.Under normal conditions,the high-energy barrier separates PrPC from PrPsc isoform.However,pathogenic mutations,modifications as well as some cofactors,such as glycosaminoglycans,nucleic acids,and lipids,could modulate the conformationai conversion process.Understanding the mechanism of conformational conversion of prion protein is essential for the biomedical research and the treatment of prion diseases.Particularly,the characterization of cofactors interacting with prion protein might provide new diagnostic and therapeutic strategies.

  17. Sequential mutations in the interleukin-3 (IL3)/granulocyte-macrophage colony-stimulating factor/IL5 receptor beta-subunit genes are necessary for the complete conversion to growth autonomy mediated by a truncated beta C subunit.

    Science.gov (United States)

    Hannemann, J; Hara, T; Kawai, M; Miyajima, A; Ostertag, W; Stocking, C

    1995-05-01

    An amino-terminally truncated beta C receptor (beta C-R) subunit of the interleukin-3 (IL3)/granulocyte-macrophage colony-stimulating factor/IL5 receptor complex mediates factor-independent and tumorigenic growth in two spontaneous mutants of a promyelocytic cell line. The constitutive activation of the JAK2 protein kinase in these mutants confirms that signaling occurs through the truncated receptor protein. Noteworthily, in addition to a 10-kb deletion in the beta C-R subunit gene encoding the truncated receptor, several secondary and independent mutations that result in the deletion or functional inactivation of the allelic beta C-R subunit and the closely related beta IL3-R subunit genes were observed in both mutants, suggesting that such mutations are necessary for the full oncogenic penetrance of the truncated beta C-R subunit. Reversion of these mutations by the expression of the wild-type beta C-R in the two mutants resulted in a fivefold decrease in cloning efficiency of the mutants in the absence of IL3, confirming a functional interaction between the wild-type and truncated proteins. Furthermore, expression of the truncated beta C-R subunit in factor-dependent myeloid cells did not immediately render the cells autonomous but increased the spontaneous frequency to factor-independent growth by 4 orders of magnitude. Implications for both leukemogenic progression and receptor-subunit interaction and signaling are discussed.

  18. Concerted evolution of duplicated protein-coding genes in Drosophila.

    Science.gov (United States)

    Hickey, D A; Bally-Cuif, L; Abukashawa, S; Payant, V; Benkel, B F

    1991-03-01

    Very rapid rates of gene conversion were observed between duplicated alpha-amylase-coding sequences in Drosophila melanogaster. This gene conversion process was also seen in the related species Drosophila erecta. Specifically, there is virtual sequence identity between the coding regions of the two genes within each species, while the sequence divergence between species is close to that expected based on their phylogenetic relationship. The flanking, noncoding regions are much more highly diverged and do not appear to be subject to gene conversion. Comparison of amylase sequences between the two species provides a clear demonstration that recurrent gene conversion does indeed lead to the concerted evolution of the gene pair.

  19. Conversational Markers of Constructive Discussions

    CERN Document Server

    Niculae, Vlad

    2016-01-01

    Group discussions are essential for organizing every aspect of modern life, from faculty meetings to senate debates, from grant review panels to papal conclaves. While costly in terms of time and organization effort, group discussions are commonly seen as a way of reaching better decisions compared to solutions that do not require coordination between the individuals (e.g. voting)---through discussion, the sum becomes greater than the parts. However, this assumption is not irrefutable: anecdotal evidence of wasteful discussions abounds, and in our own experiments we find that over 30% of discussions are unproductive. We propose a framework for analyzing conversational dynamics in order to determine whether a given task-oriented discussion is worth having or not. We exploit conversational patterns reflecting the flow of ideas and the balance between the participants, as well as their linguistic choices. We apply this framework to conversations naturally occurring in an online collaborative world exploration ga...

  20. Frequency conversion of structured light

    CERN Document Server

    Steinlechner, Fabian; Pruneri, Valerio; Torres, Juan P

    2015-01-01

    We demonstrate the coherent frequency conversion of structured light, optical beams in which the phase varies in each point of the transverse plane, from the near infrared (803nm) to the visible (527nm). The frequency conversion process makes use of sum-frequency generation in a periodically poled lithium niobate (ppLN) crystal with the help of a 1540-nm Gaussian pump beam. We perform far-field intensity measurements of the frequency-converted field, and verify the sought-after transformation of the characteristic intensity and phase profiles for various input modes. The coherence of the frequency-conversion process is confirmed using a mode-projection technique with a phase mask and a single-mode fiber. The presented results could be of great relevance to novel applications in high-resolution microscopy and quantum information processing.

  1. Blind-date Conversation Joining

    Directory of Open Access Journals (Sweden)

    Luca Cesari

    2013-07-01

    Full Text Available We focus on a form of joining conversations among multiple parties in service-oriented applications where a client may asynchronously join an existing conversation without need to know in advance any information about it. More specifically, we show how the correlation mechanism provided by orchestration languages enables a form of conversation joining that is completely transparent to clients and that we call 'blind-date joining'. We provide an implementation of this strategy by using the standard orchestration language WS-BPEL. We then present its formal semantics by resorting to COWS, a process calculus specifically designed for modelling service-oriented applications. We illustrate our approach by means of a simple, but realistic, case study from the online games domain.

  2. Engineering Escherichia coli for methanol conversion.

    Science.gov (United States)

    Müller, Jonas E N; Meyer, Fabian; Litsanov, Boris; Kiefer, Patrick; Potthoff, Eva; Heux, Stéphanie; Quax, Wim J; Wendisch, Volker F; Brautaset, Trygve; Portais, Jean-Charles; Vorholt, Julia A

    2015-03-01

    Methylotrophic bacteria utilize methanol and other reduced one-carbon compounds as their sole source of carbon and energy. For this purpose, these bacteria evolved a number of specialized enzymes and pathways. Here, we used a synthetic biology approach to select and introduce a set of "methylotrophy genes" into Escherichia coli based on in silico considerations and flux balance analysis to enable methanol dissimilation and assimilation. We determined that the most promising approach allowing the utilization of methanol was the implementation of NAD-dependent methanol dehydrogenase and the establishment of the ribulose monophosphate cycle by expressing the genes for hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexuloisomerase (Phi). To test for the best-performing enzymes in the heterologous host, a number of enzyme candidates from different donor organisms were selected and systematically analyzed for their in vitro and in vivo activities in E. coli. Among these, Mdh2, Hps and Phi originating from Bacillus methanolicus were found to be the most effective. Labeling experiments using (13)C methanol with E. coli producing these enzymes showed up to 40% incorporation of methanol into central metabolites. The presence of the endogenous glutathione-dependent formaldehyde oxidation pathway of E. coli did not adversely affect the methanol conversion rate. Taken together, the results of this study represent a major advancement towards establishing synthetic methylotrophs by gene transfer.

  3. La Conversation par le theatre (Conversation through Theater).

    Science.gov (United States)

    Bayoff, Marie-Jose

    1986-01-01

    A successful advanced college-level French conversation course using French theater as a basis for students to learn oral skills has six phases: an overview of the history of French theater, reading, adaptation of the text, rehearsal-readings, final rehearsals, and performance. (MSE)

  4. Nominal Performance Biosphere Dose Conversion Factor Analysis

    Energy Technology Data Exchange (ETDEWEB)

    M. Wasiolek

    2004-09-08

    This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the Total System Performance Assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the groundwater exposure scenario, and the development of conversion factors for assessing compliance with the groundwater protection standard. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA-LA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the ''Biosphere Model Report'' in Figure 1-1, contain detailed description of the model input parameters, their development, and the relationship between the parameters and specific features events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the groundwater exposure scenario. The objectives of this analysis are to develop BDCFs for the groundwater exposure scenario for the three climate states considered in the TSPA-LA as well as conversion factors for evaluating compliance with the groundwater protection standard. The BDCFs will be used in performance assessment for calculating all-pathway annual doses for a given concentration of radionuclides in groundwater. The conversion factors will be used for calculating gross alpha particle

  5. Wavelength conversion devices and techniques

    DEFF Research Database (Denmark)

    Stubkjær, Kristian; Jørgensen, Carsten; Danielsen, Søren Lykke;

    1996-01-01

    Wavelength division multiplexed (WDM) networks are currently subject to an immense interest because of the extra capacity and flexibility they provide together with the possibilities for graceful system upgrades. For full network flexibility it is very attractive to be able to translate the chann...... wavelengths in an easy way and preferably without opto-electronic conversion. Here, we will first briefly look at advantages of employing optical wavelength converters in WDM networks and next review the optical wavelength conversion devices with emphasis on recent developments....

  6. Hyperthermophilic endoglucanase for in planta lignocellulose conversion

    Directory of Open Access Journals (Sweden)

    Klose Holger

    2012-08-01

    Full Text Available Abstract Background The enzymatic conversion of lignocellulosic plant biomass into fermentable sugars is a crucial step in the sustainable and environmentally friendly production of biofuels. However, a major drawback of enzymes from mesophilic sources is their suboptimal activity under established pretreatment conditions, e.g. high temperatures, extreme pH values and high salt concentrations. Enzymes from extremophiles are better adapted to these conditions and could be produced by heterologous expression in microbes, or even directly in the plant biomass. Results Here we show that a cellulase gene (sso1354 isolated from the hyperthermophilic archaeon Sulfolobus solfataricus can be expressed in plants, and that the recombinant enzyme is biologically active and exhibits the same properties as the wild type form. Since the enzyme is inactive under normal plant growth conditions, this potentially allows its expression in plants without negative effects on growth and development, and subsequent heat-inducible activation. Furthermore we demonstrate that the recombinant enzyme acts in high concentrations of ionic liquids and can therefore degrade α-cellulose or even complex cell wall preparations under those pretreatment conditions. Conclusion The hyperthermophilic endoglucanase SSO1354 with its unique features is an excellent tool for advanced biomass conversion. Here we demonstrate its expression in planta and the possibility for post harvest activation. Moreover the enzyme is suitable for combined pretreatment and hydrolysis applications.

  7. Hyperthermophilic endoglucanase for in planta lignocellulose conversion

    Science.gov (United States)

    2012-01-01

    Background The enzymatic conversion of lignocellulosic plant biomass into fermentable sugars is a crucial step in the sustainable and environmentally friendly production of biofuels. However, a major drawback of enzymes from mesophilic sources is their suboptimal activity under established pretreatment conditions, e.g. high temperatures, extreme pH values and high salt concentrations. Enzymes from extremophiles are better adapted to these conditions and could be produced by heterologous expression in microbes, or even directly in the plant biomass. Results Here we show that a cellulase gene (sso1354) isolated from the hyperthermophilic archaeon Sulfolobus solfataricus can be expressed in plants, and that the recombinant enzyme is biologically active and exhibits the same properties as the wild type form. Since the enzyme is inactive under normal plant growth conditions, this potentially allows its expression in plants without negative effects on growth and development, and subsequent heat-inducible activation. Furthermore we demonstrate that the recombinant enzyme acts in high concentrations of ionic liquids and can therefore degrade α-cellulose or even complex cell wall preparations under those pretreatment conditions. Conclusion The hyperthermophilic endoglucanase SSO1354 with its unique features is an excellent tool for advanced biomass conversion. Here we demonstrate its expression in planta and the possibility for post harvest activation. Moreover the enzyme is suitable for combined pretreatment and hydrolysis applications. PMID:22928996

  8. Conversion disorder: current problems and potential solutions for DSM-5.

    Science.gov (United States)

    Stone, Jon; LaFrance, W Curt; Brown, Richard; Spiegel, David; Levenson, James L; Sharpe, Michael

    2011-12-01

    Conversion disorder in the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV-TR) describes neurological symptoms, including weakness, numbness and events resembling epilepsy or syncope, which can be positively identified as not being due to recognised neurological disease. This review combines perspectives from psychiatry, psychology and neurology to identify and discuss key problems with the current diagnostic DSM-IV criteria for conversion disorder and to make the following proposals for DSM-5: (a) abandoning the label "conversion disorder" and replacing it with an alternative term that is both theoretically neutral and potentially more acceptable to patients and practitioners; (b) relegating the requirements for "association of psychological factors" and the "exclusion of feigning" to the accompanying text; (c) adding a criterion requiring clinical findings of internal inconsistency or incongruity with recognised neurological or medical disease and altering the current 'disease exclusion' criteria to one in which the symptom must not be 'better explained' by a disease if present, (d) adding a 'cognitive symptoms' subtype. We also discuss whether conversion symptoms are better classified with other somatic symptom disorders or with dissociative disorders and how we might address the potential heterogeneity of conversion symptoms in classification. 2011 Elsevier Inc. All rights reserved.

  9. Functional neuroimaging of conversion disorder: the role of ancillary activation.

    Science.gov (United States)

    Burke, Matthew J; Ghaffar, Omar; Staines, W Richard; Downar, Jonathan; Feinstein, Anthony

    2014-01-01

    Previous functional neuroimaging studies investigating the neuroanatomy of conversion disorder have yielded inconsistent results that may be attributed to small sample sizes and disparate methodologies. The objective of this study was to better define the functional neuroanatomical correlates of conversion disorder. Ten subjects meeting clinical criteria for unilateral sensory conversion disorder underwent fMRI during which a vibrotactile stimulus was applied to anesthetic and sensate areas. A block design was used with 4 s of stimulation followed by 26 s of rest, the pattern repeated 10 times. Event-related group averages of the BOLD response were compared between conditions. All subjects were right-handed females, with a mean age of 41. Group analyses revealed 10 areas that had significantly greater activation (p conversion symptoms are associated with a pattern of abnormal cerebral activation comprising neural networks implicated in emotional processing and sensory integration. Further study of the roles and potential interplay of these networks may provide a basis for an underlying psychobiological mechanism of conversion disorder.

  10. Conversation with Marcia Baxter Magolda.

    Science.gov (United States)

    Weinstein, Gideon L.

    1999-01-01

    Presents the reconstruction of conversations and e-mail correspondences with Dr. Marcia Baxter Magolda regarding students'"ways of knowing." Dr. Baxter Magolda reveals various ways in which students beginning college learn, offers examples of effective teaching, and exemplifies principles for promoting learning. (VWC)

  11. Direct Energy Conversion Literature Abstracts

    Science.gov (United States)

    1962-12-01

    here-between in contact with Tecnica Ital.26:65-71, Jan/Feb.1961. said second electrode. (U.S. Patent Off. Off. Gaz. 773:260, Dec.5,1961). In Italian...DETERMINATION OF MOLECULAR WEIGHT. Mikrochim. Acta p.457-466, 3168 S 1951. Huber, H. and Bensimon, J. SUR LA CONVERSION DIRECTE DE CHALEUR EN (In English

  12. Energy Conversion and Storage Program

    Energy Technology Data Exchange (ETDEWEB)

    Cairns, E.J.

    1992-03-01

    The Energy Conversion and Storage Program applies chemistry and materials science principles to solve problems in (1) production of new synthetic fuels, (2) development of high-performance rechargeable batteries and fuel cells, (3) development of advanced thermochemical processes for energy conversion, (4) characterization of complex chemical processes, and (5) application of novel materials for energy conversion and transmission. Projects focus on transport-process principles, chemical kinetics, thermodynamics, separation processes, organic and physical chemistry, novel materials, and advanced methods of analysis. Electrochemistry research aims to develop advanced power systems for electric vehicle and stationary energy storage applications. Topics include identification of new electrochemical couples for advanced rechargeable batteries, improvements in battery and fuel-cell materials, and the establishment of engineering principles applicable to electrochemical energy storage and conversion. Chemical Applications research includes topics such as separations, catalysis, fuels, and chemical analyses. Included in this program area are projects to develop improved, energy-efficient methods for processing waste streams from synfuel plants and coal gasifiers. Other research projects seek to identify and characterize the constituents of liquid fuel-system streams and to devise energy-efficient means for their separation. Materials Applications research includes the evaluation of the properties of advanced materials, as well as the development of novel preparation techniques. For example, the use of advanced techniques, such as sputtering and laser ablation, are being used to produce high-temperature superconducting films.

  13. Humor and embodied conversational agents

    NARCIS (Netherlands)

    Nijholt, A.

    2003-01-01

    This report surveys the role of humor in human-to-human interaction and the possible role of humor in human-computer interaction. The aim is to see whether it is useful for embodied conversational agents to integrate humor capabilities in their internal model of intelligence, emotions and interactio

  14. Turbulence and energy conversion research

    Energy Technology Data Exchange (ETDEWEB)

    Hutchinson, R.A.

    1985-07-01

    This report examines the role of fluid mechanics research (particularly turbulence research) in improving energy conversion systems. In this report two of the listed application areas are selected as examples: fluidization and cavitation. Research needs in general, and research possibilities for ECUT in particular, are examined.

  15. Teachers' Conversation with Partial Autobiographies.

    Science.gov (United States)

    Aoki, Naoko

    2002-01-01

    Reports a teachers' conversation group that was part of a course in a Japanese as a second language teacher education program. Explains the rationale for using this format and quotes part of a story one student wrote and two stories told by other students on a theme in the written story. Relates these two stories to histories of students'…

  16. Photovoltaic conversion of laser energy

    Science.gov (United States)

    Stirn, R. J.

    1976-01-01

    The Schottky barrier photovoltaic converter is suggested as an alternative to the p/n junction photovoltaic devices for the conversion of laser energy to electrical energy. The structure, current, output, and voltage output of the Schottky device are summarized. The more advanced concepts of the multilayer Schottky barrier cell and the AMOS solar cell are briefly considered.

  17. Conversation Analysis and Applied Linguistics.

    Science.gov (United States)

    Schegloff, Emanuel A.; Koshik, Irene; Jacoby, Sally; Olsher, David

    2002-01-01

    Offers biographical guidance on several major areas of conversation-analytic work--turn-taking, repair, and word selection--and indicates past or potential points of contact with applied linguistics. Also discusses areas of applied linguistic work. (Author/VWL)

  18. Coaching Conversations: Enacting Instructional Scaffolding

    Science.gov (United States)

    Gibson, Sharan A.

    2011-01-01

    This study analyzed coaching conversations and interviews of four coach/teacher partnerships for specific ways in which kindergarten and first-grade teachers, and coaches, conceptualized instructional scaffolding for guided reading. Interview transcripts were coded for coaches' and teachers' specific hypotheses/ ideas regarding instructional…

  19. Episodes, events, and models

    Directory of Open Access Journals (Sweden)

    Sangeet eKhemlani

    2015-10-01

    Full Text Available We describe a novel computational theory of how individuals segment perceptual information into representations of events. The theory is inspired by recent findings in the cognitive science and cognitive neuroscience of event segmentation. In line with recent theories, it holds that online event segmentation is automatic, and that event segmentation yields mental simulations of events. But it posits two novel principles as well: first, discrete episodic markers track perceptual and conceptual changes, and can be retrieved to construct event models. Second, the process of retrieving and reconstructing those episodic markers is constrained and prioritized. We describe a computational implementation of the theory, as well as a robotic extension of the theory that demonstrates the processes of online event segmentation and event model construction. The theory is the first unified computational account of event segmentation and temporal inference. We conclude by demonstrating now neuroimaging data can constrain and inspire the construction of process-level theories of human reasoning.

  20. A note on conversational interruptions A note on conversational interruptions

    Directory of Open Access Journals (Sweden)

    Anthony F. Deyes

    2008-04-01

    Full Text Available In their seminal article, Sacks, Schegloff and Jefferson (1974 examine procedures for turn-taking in conversation. Sometimes, they note, a s peaker will select who has the next turn, but more frequently a "self-select" system operates, whereby the participants in a conversation themselves determine when they wish to speak. But how, ask Sacks, Schegloff and Jefferson, do the interlocutors secure a turn in the ongoing flow of another speaker's utterance? To answer this question the authors introduce the notion of "transition relevance place", that is, a point in the turn-holder's utterance where another speaker is most likely to take up a turn. Clearly the most obvious transition relevance place occurs at the end of an utterance sentence, where a pause may be made. However, clause or thersyntactic boundaries also offer opportunities for other speakers to interrupt. As Sacks et al point out, if conversational participants do not take up a turn at a transition relevance place the turn holder will normally continue. In their seminal article, Sacks, Schegloff and Jefferson (1974 examine procedures for turn-taking in conversation. Sometimes, they note, a s peaker will select who has the next turn, but more frequently a "self-select" system operates, whereby the participants in a conversation themselves determine when they wish to speak. But how, ask Sacks, Schegloff and Jefferson, do the interlocutors secure a turn in the ongoing flow of another speaker's utterance? To answer this question the authors introduce the notion of "transition relevance place", that is, a point in the turn-holder's utterance where another speaker is most likely to take up a turn. Clearly the most obvious transition relevance place occurs at the end of an utterance sentence, where a pause may be made. However, clause or thersyntactic boundaries also offer opportunities for other speakers to interrupt. As Sacks et al point out, if conversational participants do not take up

  1. Development of social perception: a conversation study of 6-, 12- and 36-month-old children.

    Science.gov (United States)

    Bakker, Marta; Kochukhova, Olga; von Hofsten, Claes

    2011-04-01

    A conversation is made up of visual and auditory signals in a complex flow of events. What is the relative importance of these components for young children's ability to maintain attention on a conversation? In the present set of experiments the visual and auditory signals were disentangled in four filmed events. The visual events were either accompanied by the speech sounds of the conversation or by matched motor sounds and the auditory events by either the natural visual turn taking of the conversation or a matched turn taking of toy trucks. A cornea-reflection technique was used to record the gaze-pattern of subjects while they were looking at the films. Three age groups of typically developing children were studied; 6-month-olds, 1-year-olds and 3-year-olds. The results show that the children are more attracted by the social component of the conversation independent of the kind of sound used. Older children find spoken language more interesting than motor sound. Children look longer at the speaking agent when humans maintain the conversation. The study revealed that children are more attracted to the mouth than to the eyes area. The ability to make more predictive gaze shifts develops gradually over age.

  2. The global event system

    Energy Technology Data Exchange (ETDEWEB)

    Winans, J.

    1994-03-02

    The support for the global event system has been designed to allow an application developer to control the APS event generator and receiver boards. This is done by the use of four new record types. These records are customized and are only supported by the device support modules for the APS event generator and receiver boards. The use of the global event system and its associated records should not be confused with the vanilla EPICS events and the associated event records. They are very different.

  3. Alt Event Finder: a tool for extracting alternative splicing events from RNA-seq data

    OpenAIRE

    Zhou Ao; Breese Marcus R; Hao Yangyang; Edenberg Howard J; Li Lang; Skaar Todd C; Liu Yunlong

    2012-01-01

    Abstract Background Alternative splicing increases proteome diversity by expressing multiple gene isoforms that often differ in function. Identifying alternative splicing events from RNA-seq experiments is important for understanding the diversity of transcripts and for investigating the regulation of splicing. Results We developed Alt Event Finder, a tool for identifying novel splicing events by using transcript annotation derived from genome-guided construction tools, such as Cufflinks and ...

  4. Event dependent sampling of recurrent events

    DEFF Research Database (Denmark)

    Kvist, Tine Kajsa; Andersen, Per Kragh; Angst, Jules

    2010-01-01

    The effect of event-dependent sampling of processes consisting of recurrent events is investigated when analyzing whether the risk of recurrence increases with event count. We study the situation where processes are selected for study if an event occurs in a certain selection interval. Motivation...... retrospective and prospective disease course histories are used. We examine two methods to correct for the selection depending on which data are used in the analysis. In the first case, the conditional distribution of the process given the pre-selection history is determined. In the second case, an inverse......-probability-of-selection weighting scheme is suggested. The ability of the methods to correct for the bias due to selection is investigated with simulations. Furthermore, the methods are applied to affective disease data from a register-based study (Kessing et al. Br J Psychiatry 185:372-377, 2004a) and from a long-term clinical...

  5. DNA sequences required to induce localized conversion in Streptococcus pneumoniae transformation.

    Science.gov (United States)

    Garcia, P; Gasc, A M; Kyriakidis, X; Baty, D; Sicard, M

    1988-11-01

    In pneumococcal transformation a particular point mutation belonging to the amiA locus is able markedly to enhance recombination frequency when crossed with any other markers of this gene. This results from a polarized conversion of the mutation towards the wild-type sequence. In this report, by site-directed oligonucleotide mutagenesis, we have generated a series of mutants showing various degrees of conversion. We have found that the substitution 5'-ATTCAT----5'-ATTAAT is a sufficient signal for localized conversion. Changing individual bases within this sequence results in decreased conversion frequencies to levels that depend on the mutation, suggesting that there is a family to related sequences which may act as a substrate for a conversion system. Moreover, the length over which this conversion occurs has been estimated to be 12 base pairs on the average.

  6. Traumatic events and children

    Science.gov (United States)

    ... stabbing of a person Sudden death of a parent or trusted caregiver Hospitalization Examples of traumatic events that your child experiences over and over are: Physical or emotional abuse Sexual abuse Gang violence War Terrorist events

  7. Advertising Effectiveness In Events

    OpenAIRE

    Jain, Sushilkumar

    2012-01-01

    Confronted with decreasing effectiveness of the classic marketing communications, events have become an increasingly popular alternative for marketers. Events constitute one of the most exciting and fastest growing forms of leisure and business. With time, the decreasing effectiveness of classical marketing communications boosted the use of events for marketing and making brand awareness. Event marketing is seen as the unique opportunity to integrate the firm’s communication activities like p...

  8. Extensive microheterogeneity of serine tRNA genes from Drosophila melanogaster.

    Science.gov (United States)

    Cribbs, D L; Leung, J; Newton, C H; Hayashi, S; Miller, R C; Tener, G M

    1987-10-05

    The nucleotide sequences of nine genes corresponding to tRNA(Ser)4 or tRNA(Ser)7 of Drosophila melanogaster were determined. Eight of the genes compose the major tRNA(Ser)4,7 cluster at 12DE on the X chromosome, while the other is from 23E on the left arm of chromosome 2. Among the eight X-linked genes, five different, interrelated, classes of sequence were found. Four of the eight genes correspond to tRNA(Ser)4 and tRNA(Ser)7 (which are 96% homologous), two appear to result from single crossovers between tRNA(Ser)4 and tRNA(Ser)7 genes, one is an apparent double crossover product, and the last differs from a tRNA(Ser)4 gene by a single C to T transition at position 50. The single autosomal gene corresponds to tRNA(Ser)7. Comparison of a pair of genes corresponding to tRNA(Ser)4 from D. melanogaster and Drosophila simulans showed that, while gene flanking sequences may diverge considerably by accumulation of point changes, gene sequences are maintained intact. Our data indicate that recombination occurs between non-allelic tRNA(Ser) genes, and suggest that at least some recombinational events may be intergenic conversions.

  9. Event generators at BESⅢ

    Institute of Scientific and Technical Information of China (English)

    PING Rong-Gang

    2008-01-01

    We present a brief remark and introduction to event generators for tau-charm physics currently used at BESⅢ,including KKMC,BesEvtGen,Bhlumi,Bhwide,Babayaga and inclusive Monte-Carlo event generators.This paper provides basic information on event generators for BESⅢ users.

  10. Conversion Disorder Comorbidity and Childhood Trauma.

    Science.gov (United States)

    Akyüz, Fatma; Gökalp, Peykan G; Erdiman, Sezgin; Oflaz, Serap; Karşidağ, Çağatay

    2017-03-01

    The aim of this study is to examine the socio-demographic and clinical characteristics, the presence of comorbidity, and the link with childhood traumatic experiences in patients with conversion disorder (CD) in a psychiatric outpatient clinic. A total of 60 literate, female patients between 18 and 65 years of age who were referred to the general psychiatry outpatient clinic and who were diagnosed with conversion disorder according to the DSM-IV diagnostic criteria were included in the study. A questionnaire on sociodemographic and clinical characteristics, the Brief Psychiatric Rating Scale (BPRS), the Hamilton Depression Rating Scale (HDRS), the Hamilton Anxiety Rating Scale (HARS), the Childhood Trauma Questionnaire (CTQ), and the Dissociative Events Scale (DES) were used to assess the cases. The mean age of the participants was 36.27±11.18 years. 72% of the patients were married and 63% were primary school graduates. The most common symptoms were asthenia (100%), aphasia (96.7%), and crying-convulsions (93%). The most common co-morbidities were depression (50%) and dissociative disorders (48.3%). Among the patients, 53.3% reported a history of exposure to physical violence and 25% reported a history of sexual assault in childhood. Assessment of the Childhood Traumatic Questionnaire revealed a significant positive relation between emotional, physical, and sexual abuse scores and DES score. CD has not yet been fully analyzed in detail in health institutions; co-existence of another mental disorder and the presence of traumatic experiences in the past further complicate the issue. Consideration of these factors during treatment will have a positive impact on the course and prognosis of the disorder.

  11. Molecular population genetics of the -esterase gene cluster of Drosophila melanogaster

    Indian Academy of Sciences (India)

    Evgeniy S. Balakirev; Francisco J. Ayala

    2003-12-01

    We have investigated nucleotide polymorphism at the -esterase gene cluster including the Est-6 gene and Est-6 putative pseudogene in four samples of Drosophila melanogaster derived from natural populations of southern Africa (Zimbabwe), Europe (Spain), North America (USA: California), and South America (Venezuela). A complex haplo-type structure is revealed in both Est-6 and Est-6. Total nucleotide diversity is twice in Est-6 as in Est-6; diversity is higher in the African sample than in the non-African ones. Strong linkage disequilibrium occurs within the -esterase gene cluster in non-African samples, but not in the African one. Intragenic gene conversion events are detected within Est-6 and, to a much greater extent, within Est-6; intergenic gene conversion events are rare. Tests of neutrality with recombination are significant for the -esterase gene cluster in the non-African samples but not significant in the African one. We suggest that the demographic history (bottleneck and admixture of genetically differentiated populations) is the major factor shaping the pattern of nucleotide polymorphism in the -esterase gene cluster. However there are some ‘footprints’ of directional and balancing selection shaping specific distribution of nucleotide polymorphism within the cluster. Intergenic epistatic selection between Est-6 and Est-6 may play an important role in the evolution of the -esterase gene cluster preserving the putative pseudogene from degenerative destruction and reflecting possible functional interaction between the functional gene and the putative pseudogene. Est-6 and Est-6 may represent an indivisible intergenic complex (‘intergene’) in which each single component (Est-6 or Est-6) cannot separately carry out the full functional role.

  12. Electrocatalysts for carbon dioxide conversion

    Energy Technology Data Exchange (ETDEWEB)

    Masel, Richard I; Salehi-Khojin, Amin

    2015-04-21

    Electrocatalysts for carbon dioxide conversion include at least one catalytically active element with a particle size above 0.6 nm. The electrocatalysts can also include a Helper Catalyst. The catalysts can be used to increase the rate, modify the selectivity or lower the overpotential of electrochemical conversion of CO.sub.2. Chemical processes and devices using the catalysts also include processes to produce CO, HCO.sup.-, H.sub.2CO, (HCO.sub.2).sup.-, H.sub.2CO.sub.2, CH.sub.3OH, CH.sub.4, C.sub.2H.sub.4, CH.sub.3CH.sub.2OH, CH.sub.3COO.sup.-, CH.sub.3COOH, C.sub.2H.sub.6, (COOH).sub.2, or (COO.sup.-).sub.2, and a specific device, namely, a CO.sub.2 sensor.

  13. IMAGE CONVERSION FOR LASER PYROGRAPHY

    Directory of Open Access Journals (Sweden)

    Adrian PETRU

    2015-12-01

    Full Text Available All previous studies of pyrography have been focussed on colour obtained through modifying the work parameters. This paper analyses colour nuances obtained by laser woodworking by measuring colour changes digitally. The investigated parameter is colour reproduction by laser technology, using different image conversion methods (Halftone Round, Jarvis, and so on. The changes of image reproduction are analysed globally and colour by colour. The results show that the colour nuances are represented to a more and less degree, according to the conversion method selected. To evaluate the aesthetic changes, CIEL*a*b* colour measurements were applied. The results show that laser burning on wood surfaces has a great influence on wood colour. These findings will be useful to develop innovative design possibilities for wood surfaces for furniture and other products.

  14. Conversation, speech acts, and memory.

    Science.gov (United States)

    Holtgraves, Thomas

    2008-03-01

    Speakers frequently have specific intentions that they want others to recognize (Grice, 1957). These specific intentions can be viewed as speech acts (Searle, 1969), and I argue that they play a role in long-term memory for conversation utterances. Five experiments were conducted to examine this idea. Participants in all experiments read scenarios ending with either a target utterance that performed a specific speech act (brag, beg, etc.) or a carefully matched control. Participants were more likely to falsely recall and recognize speech act verbs after having read the speech act version than after having read the control version, and the speech act verbs served as better recall cues for the speech act utterances than for the controls. Experiment 5 documented individual differences in the encoding of speech act verbs. The results suggest that people recognize and retain the actions that people perform with their utterances and that this is one of the organizing principles of conversation memory.

  15. Catalytic conversions of methyltetrahydrophthalic anhydride

    Energy Technology Data Exchange (ETDEWEB)

    Lezdin, S.Yu.; Dokuchaeva, T.G.; Sibarov, D.A.; Panfilova, N.N.; Proskuryakov, V.A.

    1987-07-10

    Catalysts with various amounts (from 2.0 to 6.0 mass %) of the active component were tested for estimation of the hydrogenating and dehydrogenating properties of palladium on alumina. Alumina-palladium catalyst with a palladium content of 5.0 mass % has the highest activity and selectivity in synthesis of 4-MPA. The yield of 4-MPA under the optical conditions found is 60-61% on the converted feed, with 100% conversion. Alumina-palladium catalyst with a palladium content of 3.0 mass % has the highest activity and selectivity in synthesis of 4-MHHPA. Under the optimal conditions found the yield of 4-MHHPA is 75-80% on the converted feed, with 100% conversion.

  16. Progress in understanding conversion disorder

    Science.gov (United States)

    Allin, Matthew; Streeruwitz, Anna; Curtis, Vivienne

    2005-01-01

    Conversion disorder has a history that may reach back into antiquity, and it continues to present a clinical challenge to both psychiatrists and neurologists. This article reviews the current state of knowledge surrounding the prevalence, etiology, and neurobiology of conversion disorder. There have been improvements in the accuracy of diagnosis that are possibly related to improved technologies such as neuroimaging. Once the diagnosis is made, it is important to develop a therapeutic alliance between the patient and the medical team, and where comorbid psychiatric diagnoses have been made, these need to be adequately treated. While there have been no formal trials of medication or psychoanalytic treatments in this disorder, case reports suggest that a combination of antidepressants, psychotherapy, and a multidisciplinary approach to rehabilitation may be beneficial. PMID:18568070

  17. Caring, conversing, and realizing values

    DEFF Research Database (Denmark)

    Hodges, Bert; Steffensen, Sune Vork; Martin, James E.

    2012-01-01

    of this issue, though, is the role of conversations in humans caring for each other and the ecosystems of which they are a part. Emergency medical care, parents and children playing, and students learning a second language, are among the contexts of caring considered. Also considered are ways in which symbol......Language serves many functions for humans, but three of the most important are coordination, learning, and friendship. All of those functions were well served by the conversations from which this special issue emerged, a conference, ‘‘Grounding language in perception and (inter) action’’, held...... at Gordon College in June 2009. The conference brought together researchers primarily from three research traditions, dynamical systems theory, distributed language, and ecological psychology, and each of these perspectives is reviewed and illustrated in this special issue. The particular focus...

  18. Analog-to-digital conversion

    CERN Document Server

    Pelgrom, Marcel

    2017-01-01

    This textbook is appropriate for use in graduate-level curricula in analog-to-digital conversion, as well as for practicing engineers in need of a state-of-the-art reference on data converters. It discusses various analog-to-digital conversion principles, including sampling, quantization, reference generation, nyquist architectures and sigma-delta modulation. This book presents an overview of the state of the art in this field and focuses on issues of optimizing accuracy and speed, while reducing the power level. This new, third edition emphasizes novel calibration concepts, the specific requirements of new systems, the consequences of 22-nm technology and the need for a more statistical approach to accuracy. Pedagogical enhancements to this edition include additional, new exercises, solved examples to introduce all key, new concepts and warnings, remarks and hints, from a practitioner’s perspective, wherever appropriate. Considerable background information and practical tips, from designing a PCB, to lay-o...

  19. The effect of familiarity of conversation partners on conversation turns contributed by augmented and typical speakers.

    Science.gov (United States)

    Tsai, Meng-Ju

    2013-08-01

    The purpose of this current research was to determine the effect of familiarity of conversation partners on contributed conversation turns to dyadic conversation between individuals who use AAC and typically speaking conversation partners. Three groups (G1-G3) participated in this study. Each group contained seven participants, including an individual who used a speech-generating device (SGD) and familiar and unfamiliar conversation partners. Each 20-min dyadic conversation was video-recorded for analysis of contributed conversation turns. The findings of the current study showed that the asymmetries of contributed conversation turns exist in both familiar and unfamiliar dyadic conversation between AAC users and typically speaking conversation partners. In addition, the asymmetry in the familiar dyadic conversation did not differ from that in the unfamiliar dyadic conversation.

  20. A Conversation with Adam Heller

    OpenAIRE

    Heller, A.; Cairns, EJ

    2015-01-01

    © 2015 by Annual Reviews. All rights reserved.Adam Heller, Ernest Cockrell Sr. Chair in Engineering Emeritus of the John J. McKetta Department of Chemical Engineering at The University of Texas at Austin, recalls his childhood in the Holocaust and his contributions to science and technology that earned him the US National Medal of Technology and Innovation in a conversation with Elton J. Cairns, Professor of Chemical and Biomolecular Engineering at the University of California, Berkeley. Dr. ...

  1. Explicit Polymorphism and CPS Conversion,

    Science.gov (United States)

    1992-10-01

    programming language design , the concepts of polymorphism [14, 28, 39] and continuation-passing [38, 41, 43] are of particular interest. The use of...Principles of Programming Languages, January 1991. [9] Matthias Felleisen . The Calculi of X.-CS Conversion: A Syntactic Theory of Control and State in...Imperative Higher-Order Programming Languages. PhD thesis, Indiana University, Bloomington, IN, 1987. 18 [10] Matthias Felleisen and Daniel Friedman

  2. Religious Conversion, Models and Paradigms

    OpenAIRE

    Boz, Tuba

    2012-01-01

    This papers examines the experiences of converts to Islam among Australian women in the milieu of polemic views and debates such as ‘Islam versus the west', which is most visible in the image of the ‘eastern' ‘oppressed' Muslim woman. Employing the experiences of Australian Muslim women converts in Melbourne, issues concerning identity politics, and the individuals and social dimensions of conversion are investigated. While there is an array of literature about Muslim women from various disci...

  3. A Map Enters the Conversation

    DEFF Research Database (Denmark)

    Munk, Anders Kristian

    'modes of mattering'. In this paper I explore what difference digital cartography can make to STS practice. I draw on three examples from my own work where digitally mediated maps have entered the conversation and made critical, often surprising, differences to the research process. In my first example...... it was trying to chart. I use these examples to discuss the potential modes of mattering afforded by digital cartography in STS....

  4. The Construction of Moral Agency in Mother-Child Conversations about Helping and Hurting across Childhood and Adolescence

    Science.gov (United States)

    Recchia, Holly E.; Wainryb, Cecilia; Bourne, Stacia; Pasupathi, Monisha

    2014-01-01

    This study examined mother-child conversations about children's and adolescents' past harmful and helpful actions. The sample included 100 mothers and their 7-, 11-, or 16-year-old children; each dyad discussed events when the child (a) helped a friend and (b) hurt a friend. Analyses suggested that conversations about help may serve to…

  5. From Events to Reactions: A Progress Report

    Directory of Open Access Journals (Sweden)

    Tony Garnock-Jones

    2016-06-01

    Full Text Available Syndicate is a new coordinated, concurrent programming language. It occupies a novel point on the spectrum between the shared-everything paradigm of threads and the shared-nothing approach of actors. Syndicate actors exchange messages and share common knowledge via a carefully controlled database that clearly scopes conversations. This approach clearly simplifies coordination of concurrent activities. Experience in programming with Syndicate, however, suggests a need to raise the level of linguistic abstraction. In addition to writing event handlers and managing event subscriptions directly, the language will have to support a reactive style of programming. This paper presents event-oriented Syndicate programming and then describes a preliminary design for augmenting it with new reactive programming constructs.

  6. Event studies in Turkey

    Directory of Open Access Journals (Sweden)

    Ulkem Basdas

    2014-09-01

    Full Text Available The primary goal of this paper is to review the event studies conducted for Turkey to in order to identify the common components in their designs. This paper contributes to the existing literature by reviewing all event studies for Turkey for the first time, but more importantly; this review leads to the upcoming event studies on Turkey by highlighting main components of a proper design. Based on the review of 75 studies, it is observed that event studies generally choose BIST-100 (formerly, ISE-100 market index and market adjusted returns with the parametric tests. In general, the studies prefer to rely on one type of model to calculate abnormal returns without discussing the selection of the underlying model. Especially for the event studies focusing on the impact of political events or macroeconomic announcements in Turkey, there is a risk of clustering due to the application of same event date for all observations.

  7. Targeted gene repair: the ups and downs of a promising gene therapy approach.

    Science.gov (United States)

    de Semir, David; Aran, Josep M

    2006-08-01

    As a novel form of molecular medicine based on direct actions over the genes, targeted gene repair has raised consideration recently above classical gene therapy strategies based on genetic augmentation or complementation. Targeted gene repair relies on the local induction of the cell's endogenous DNA repair mechanisms to attain a therapeutic gene conversion event within the genome of the diseased cell. Successful repair has been achieved both in vitro and in vivo with a variety of corrective molecules ranging from oligonucleotides (chimeraplasts, modified single-stranded oligonucleotides, triplex-forming oligonucleotides), to small DNA fragments (small fragment homologous replacement (SFHR)), and even viral vectors (AAV-based). However, controversy on the consistency and lack of reproducibility of early experiments regarding frequencies and persistence of targeted gene repair, particularly for chimeraplasty, has flecked the field. Nevertheless, several hurdles such as inefficient nuclear uptake of the corrective molecules, and misleading assessment of targeted repair frequencies have been identified and are being addressed. One of the key bottlenecks for exploiting the overall potential of the different targeted gene repair modalities is the lack of a detailed knowledge of their mechanisms of action at the molecular level. Several studies are now focusing on the assessment of the specific repair pathway(s) involved (homologous recombination, mismatch repair, etc.), devising additional strategies to increase their activity (using chemotherapeutic drugs, chimeric nucleases, etc.), and assessing the influence of the cell cycle in the regulation of the repair process. Until therapeutic correction frequencies for single gene disorders are reached both in cellular and animal models, precision and undesired side effects of this promising gene therapy approach will not be thoroughly evaluated.

  8. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by c

  9. Conversion Disorder Presenting As Neuritic Leprosy

    Directory of Open Access Journals (Sweden)

    Sayal SK

    2000-01-01

    Full Text Available Conversion disorder is not normally listed amongst the conditions in differential diagnosis of leprosy neuropathy. A case conversion reaction who was initially diagnosed as neuritic leprosy is reported. Patient responded to narcosuggestion and psychotherapy.

  10. Frequency Conversion Activation on the Mercury Laser

    Energy Technology Data Exchange (ETDEWEB)

    Bayramian, A J; Beach, R J; Bibeau, C; Campbell, R; Ebbers, C A; Freitas, B L; Kent, R; Van Lue, D; Liao, Z; Landron, T; Payne, S A; Schaffers, K I; Sutton, S; Fei, Y; Chai, B

    2004-09-24

    High efficiency frequency conversion while operating at average power is critical for the Mercury laser. We will demonstrate average power frequency conversion of face-cooled DKDP and YCOB crystals using a sapphire heat spreader approach.

  11. 31 CFR 800.205 - Conversion.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Conversion. 800.205 Section 800.205 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF INVESTMENT... FOREIGN PERSONS Definitions § 800.205 Conversion. The term conversion means the exercise of a right...

  12. Alkaline Hydrolysis Conversion of Nitrocellulose Fines

    Science.gov (United States)

    1997-10-01

    The conversion of 1,125,000 pounds of bone-dry nitrocellulose fines into a liquid fertilizer was documented. Alkaline hydrolysis was the conversion... fertilizer . Fertilizer nutrient value was 1.3% nitrogen (N), 8.0% potassium (K2O) and 0.9% phosphorus (P2O5). Conversion met all applicable federal and state safety and environmental regulations.

  13. Trends and Challenges in Catalytic Biomass Conversion

    DEFF Research Database (Denmark)

    Osmundsen, Christian Mårup; Egeblad, Kresten; Taarning, Esben

    2013-01-01

    . The conversion of biomass-derived substrates, such as glycerol, by hydrogenolysis to the important chemicals ethylene glycol and propane diols. Secondly, the conversion of carbohydrates by Lewis acidic zeolites to yield alkyl lactates, and finally the conversion of lignin, an abundant low value source of biomass...

  14. Valproate in Conversion Disorder: A Case Report

    OpenAIRE

    Antonino Messina; Anna Maria Fogliani

    2010-01-01

    Few data are in literature about the pharmacological treatment of conversion disorder and there are not any studies about the use of Valproate extended release (ER) in treating conversion disorder. In this article, we are reporting a case of an Italian woman with a diagnosis of conversion disorder treated effectively and quickly by Valproate ER.

  15. Conversational Knowledge Process for Social Technology

    Science.gov (United States)

    Nishida, Toyoaki

    The conversational knowledge process is a collective activity for knowledge creation, management, and application where conversational communications are used as a primary means of interaction among participating actors. In this article, I survey a suite of communication tools that augment the conversational knowledge process in order to accelerate social problem solving.

  16. Alpine radar conversion for LAWR

    Science.gov (United States)

    Savina, M.; Burlando, P.

    2012-04-01

    The Local Area Weather Radar (LAWR) is a ship-born weather radar system operating in X-band developed by the DHI Group to detect precipitation in urban areas. To date more than thirty units are installed in different settings around the world. A LAWR was also deployed in the Alps, at 3883 m a.s.l. on the Kl. Matterhorn (Valais, Switzerland). This was the highest LAWR of the world and it led to the development of an Alpine LAWR system that, besides featuring important technological improvements needed to withstand the severe Alpine conditions, required the development of a new Alpine Radar COnversion Model (ARCOM), which is the main focus of this contribution. The LAWR system is equipped with the original FURUNO fan-beam slotted antenna and the original logarithmic receiver, which limits the radar observations to the video signal (L) withour providing the reflectivity (Z). The beam is 0.95 deg wide and 20 deg high. It can detect precipitation to a max range of 60 km. In order to account for the limited availability of raw signal and information and the specific mountain set-up, the conversion model had to be developed differently from the state-of-the-art radar conversion technique used for this class of radars. In particular, the ARCOM is based on a model used to simulate a spatial dependent factor, hereafter called ACF, which is in turn function of parameters that take in account climatological conditions, also used in other conversion methods, but additionally accounting for local radar beam features and for orographic forcings such as the effective sampling power (sP), which is modelled by means of antenna pattern, geometric ground clutter and their interaction. The result is a conversion factor formulated to account for a range correction that is based on the increase of the sampling volume, partial beam blocking and local climatological conditions. The importance of the latter in this study is double with respect to the standard conversion technique for this

  17. Algal Energy Conversion and Capture

    Science.gov (United States)

    Hazendonk, P.

    2015-12-01

    We address the potential for energy conversions and capture for: energy generation; reduction in energy use; reduction in greenhouse gas emissions; remediation of water and air pollution; protection and enhancement of soil fertility. These processes have the potential to sequester carbon at scales that may have global impact. Energy conversion and capture strategies evaluate energy use and production from agriculture, urban areas and industries, and apply existing and emerging technologies to reduce and recapture energy embedded in waste products. The basis of biocrude production from Micro-algal feedstocks: 1) The nutrients from the liquid fraction of waste streams are concentrated and fed into photo bioreactors (essentially large vessels in which microalgae are grown) along with CO2 from flue gasses from down stream processes. 2) The algae are processed to remove high value products such as proteins and beta-carotenes. The advantage of algae feedstocks is the high biomass productivity is 30-50 times that of land based crops and the remaining biomass contains minimal components that are difficult to convert to biocrude. 3) The remaining biomass undergoes hydrothermal liquefaction to produces biocrude and biochar. The flue gasses of this process can be used to produce electricity (fuel cell) and subsequently fed back into the photobioreactor. The thermal energy required for this process is small, hence readily obtained from solar-thermal sources, and furthermore no drying or preprocessing is required keeping the energy overhead extremely small. 4) The biocrude can be upgraded and refined as conventional crude oil, creating a range of liquid fuels. In principle this process can be applied on the farm scale to the municipal scale. Overall, our primary food production is too dependent on fossil fuels. Energy conversion and capture can make food production sustainable.

  18. Wavelength conversion based spectral imaging

    DEFF Research Database (Denmark)

    Dam, Jeppe Seidelin

    There has been a strong, application driven development of Si-based cameras and spectrometers for imaging and spectral analysis of light in the visible and near infrared spectral range. This has resulted in very efficient devices, with high quantum efficiency, good signal to noise ratio and high...... resolution for this spectral region. Today, an increasing number of applications exists outside the spectral region covered by Si-based devices, e.g. within cleantech, medical or food imaging. We present a technology based on wavelength conversion which will extend the spectral coverage of state of the art...... visible or near infrared cameras and spectrometers to include other spectral regions of interest....

  19. Soundscapes, events, resistance

    Directory of Open Access Journals (Sweden)

    Andrea Mubi Brighenti

    2008-12-01

    Full Text Available Put it bluntly, a soundscape is the sonic counterpart, or component, of landscape. From such minimal assumption, some interesting consequences follow: just as landscape is far from being a simple stage-set upon which events take place, soundscape, too, is itself evental, i.e., it consists of events. Not only because its nature, far from being acoustics is always ‘psychoacoustics’, as Murray Schafer (1977/1994 first argued. Processes of environmental perception are of course there.

  20. Gastrointestinal symptoms among swimmers following rain events at a beach impacted by urban runoff

    Science.gov (United States)

    Gastrointestinal symptoms among swimmers following rain events at a beach impacted by urban runoff Timothy J. Wade, Reagan R. Converse, Elizabeth A. Sams, Ann H. Williams, Edward Hudgens, Alfred P. Dufour Gastrointestinal symptoms among swimmers have been associated with fecal ...

  1. The Terrorist Event

    OpenAIRE

    Nichols, Bill

    2007-01-01

    In his article "The Terrorist Event," Bill Nichols examines how the US media attempted to make meaning of the events of 9/11. How were news anchors and producers to explain an event that escaped their comprehension? Without context or historical equivalence in the US, news outlets groped for a narrative in which to frame the event even if that meant creating the meaning themselves. In their attempt to create meaning, what sorts of fetishes and fantasies did they draw-on and in turn create? Th...

  2. The PHENIX Event Builder

    Science.gov (United States)

    Winter, David

    2004-10-01

    The PHENIX Event Builder is a critical part of the back-end of the PHENIX DAQ. It is reponsible for assembling event fragments from each subsystem into complete events ready for archiving. It allows subsystems to be read out either in parallel or simultaneously while supporting a high rate of archiving. Additionally, it implements an environment where Level-2 trigger algorithms may be optionally executed, providing the ability to tag and/or filter rare physics events. Up to and including RHIC Run-4, the Event Builder was implemented as a set of three Windows NT/2000 multithreaded executables that run on a farm of over 100 dual-cpu 1U servers connected via a Foundry Layer2/3 Gigabit switch. Under this architecture it has been capable of recording a wide range of event sizes from central Au-Au to p-p interactions, with data archiving rates of over 400 MB/s at 2 KHz event rates. Between Runs 4 and 5, the Event Builder will be ported to Linux. Preliminary work has shown we can expect great improvements in performance when moving to this platform for Run 5. The PHENIX Event Builder design and implementation, as well as performance and plans for future development, will be discussed.

  3. Evolution and expression analysis of the soybean glutamate decarboxylase gene family

    Indian Academy of Sciences (India)

    Tae Kyung Hyun; Seung Hee Eom; Xiao Han; Ju-Sung Kim

    2014-12-01

    Glutamate decarboxylase (GAD) is an enzyme that catalyses the conversion of L-glutamate into -aminobutyric acid (GABA), which is a four-carbon non-protein amino acid present in all organisms. Although plant GAD plays important roles in GABA biosynthesis, our knowledge concerning GAD gene family members and their evolutionary relationship remains limited. Therefore, in this study, we have analysed the evolutionary mechanisms of soybean GAD genes and suggested that these genes expanded in the soybean genome partly due to segmental duplication events. The approximate dates of duplication events were calculated using the synonymous substitution rate, and we suggested that the segmental duplication of GAD genes in soybean originated 9.47 to 11.84 million years ago (Mya). In addition, all segmental duplication pairs (GmGAD1/3 and GmGAD2/4) are subject to purifying selection. Furthermore, GmGAD genes displayed differential expression either in their transcript abundance or in their expression patterns under abiotic stress conditions like salt, drought, and cold. The expression pattern of paralogous pairs suggested that they might have undergone neofunctionalization during the subsequent evolution process. Taken together, our results provide valuable information for the evolution of the GAD gene family and represent the basis for future research on the functional characterization of GAD genes in higher plants.

  4. Frustration and fulfillment of needs in dissociative and conversion disorders.

    Science.gov (United States)

    Ishikura, Reiji; Tashiro, Nobutada

    2002-08-01

    We reviewed all patients with dissociative disorders (nine patients with dissociative amnesia or dissociative fugue) and conversion disorders (10 patients) who were admitted and treated during the past 15 years. Needs frustrated at the appearance of the symptoms and those fulfilled at discharge were studied in both groups using Maslow's hierarchy of needs. The patients of both groups who encountered troubles in their life events were found to have frustrated needs. These symptoms tended to be accompanied more often by frustrations regarding a 'need for love' in the dissociative disorders group and by frustration in the need for 'self-esteem and self-actualization' in the conversion disorders group. In addition, needs of lower orders were already threatened at onset in many patients. The symptoms disappeared in patients in whom the situation completely improved (needs were fulfilled), but the symptoms were alleviated or unchanged in those in whom the problems remained unresolved.

  5. Biomass thermochemical conversion program. 1985 annual report

    Energy Technology Data Exchange (ETDEWEB)

    Schiefelbein, G.F.; Stevens, D.J.; Gerber, M.A.

    1986-01-01

    Wood and crop residues constitute a vast majority of the biomass feedstocks available for conversion, and thermochemical processes are well suited for conversion of these materials. The US Department of Energy (DOE) is sponsoring research on this conversion technology for renewable energy through its Biomass Thermochemical Conversion Program. The Program is part of DOE's Biofuels and Municipal Waste Technology Division, Office of Renewable Technologies. This report briefly describes the Thermochemical Conversion Program structure and summarizes the activities and major accomplishments during fiscal year 1985. 32 figs., 4 tabs.

  6. High resolution A/D conversion based on piecewise conversion at lower resolution

    Science.gov (United States)

    Terwilliger, Steve

    2012-06-05

    Piecewise conversion of an analog input signal is performed utilizing a plurality of relatively lower bit resolution A/D conversions. The results of this piecewise conversion are interpreted to achieve a relatively higher bit resolution A/D conversion without sampling frequency penalty.

  7. Bilingualism accentuates children's conversational understanding.

    Directory of Open Access Journals (Sweden)

    Michael Siegal

    Full Text Available BACKGROUND: Although bilingualism is prevalent throughout the world, little is known about the extent to which it influences children's conversational understanding. Our investigation involved children aged 3-6 years exposed to one or more of four major languages: English, German, Italian, and Japanese. In two experiments, we examined the children's ability to identify responses to questions as violations of conversational maxims (to be informative and avoid redundancy, to speak the truth, be relevant, and be polite. PRINCIPAL FINDINGS: In Experiment 1, with increasing age, children showed greater sensitivity to maxim violations. Children in Italy who were bilingual in German and Italian (with German as the dominant language L1 significantly outperformed Italian monolinguals. In Experiment 2, children in England who were bilingual in English and Japanese (with English as L1 significantly outperformed Japanese monolinguals in Japan with vocabulary age partialled out. CONCLUSIONS: As the monolingual and bilingual groups had a similar family SES background (Experiment 1 and similar family cultural identity (Experiment 2, these results point to a specific role for early bilingualism in accentuating children's developing ability to appreciate effective communicative responses.

  8. Analog-to-digital conversion

    CERN Document Server

    Pelgrom, Marcel J. M

    2013-01-01

    This textbook is appropriate for use in graduate-level curricula in analog to digital conversion, as well as for practicing engineers in need of a state-of-the-art reference on data converters.  It discusses various analog-to-digital conversion principles, including sampling, quantization, reference generation, nyquist architectures and sigma-delta modulation.  This book presents an overview of the state-of-the-art in this field and focuses on issues of optimizing accuracy and speed, while reducing the power level. This new, second edition emphasizes novel calibration concepts, the specific requirements of new systems, the consequences of 45-nm technology and the need for a more statistical approach to accuracy.  Pedagogical enhancements to this edition include more than twice the exercises available in the first edition, solved examples to introduce all key, new concepts and warnings, remarks and hints, from a practitioner’s perspective, wherever appropriate.  Considerable background information and pr...

  9. Electromagnetic wave energy conversion research

    Science.gov (United States)

    Bailey, R. L.; Callahan, P. S.

    1975-01-01

    Known electromagnetic wave absorbing structures found in nature were first studied for clues of how one might later design large area man-made radiant-electric converters. This led to the study of the electro-optics of insect dielectric antennae. Insights were achieved into how these antennae probably operate in the infrared 7-14um range. EWEC theoretical models and relevant cases were concisely formulated and justified for metal and dielectric absorber materials. Finding the electromagnetic field solutions to these models is a problem not yet solved. A rough estimate of losses in metal, solid dielectric, and hollow dielectric waveguides indicates future radiant-electric EWEC research should aim toward dielectric materials for maximum conversion efficiency. It was also found that the absorber bandwidth is a theoretical limitation on radiant-electric conversion efficiency. Ideally, the absorbers' wavelength would be centered on the irradiating spectrum and have the same bandwith as the irradiating wave. The EWEC concept appears to have a valid scientific basis, but considerable more research is needed before it is thoroughly understood, especially for the complex randomly polarized, wide band, phase incoherent spectrum of the sun. Specific recommended research areas are identified.

  10. Photochemical conversion of solar energy.

    Science.gov (United States)

    Balzani, Vincenzo; Credi, Alberto; Venturi, Margherita

    2008-01-01

    Energy is the most important issue of the 21st century. About 85% of our energy comes from fossil fuels, a finite resource unevenly distributed beneath the Earth's surface. Reserves of fossil fuels are progressively decreasing, and their continued use produces harmful effects such as pollution that threatens human health and greenhouse gases associated with global warming. Prompt global action to solve the energy crisis is therefore needed. To pursue such an action, we are urged to save energy and to use energy in more efficient ways, but we are also forced to find alternative energy sources, the most convenient of which is solar energy for several reasons. The sun continuously provides the Earth with a huge amount of energy, fairly distributed all over the world. Its enormous potential as a clean, abundant, and economical energy source, however, cannot be exploited unless it is converted into useful forms of energy. This Review starts with a brief description of the mechanism at the basis of the natural photosynthesis and, then, reports the results obtained so far in the field of photochemical conversion of solar energy. The "grand challenge" for chemists is to find a convenient means for artificial conversion of solar energy into fuels. If chemists succeed to create an artificial photosynthetic process, "... life and civilization will continue as long as the sun shines!", as the Italian scientist Giacomo Ciamician forecast almost one hundred years ago.

  11. Astrophysicists' conversational connections on Twitter.

    Science.gov (United States)

    Holmberg, Kim; Bowman, Timothy D; Haustein, Stefanie; Peters, Isabella

    2014-01-01

    Because Twitter and other social media are increasingly used for analyses based on altmetrics, this research sought to understand what contexts, affordance use, and social activities influence the tweeting behavior of astrophysicists. Thus, the presented study has been guided by three research questions that consider the influence of astrophysicists' activities (i.e., publishing and tweeting frequency) and of their tweet construction and affordance use (i.e. use of hashtags, language, and emotions) on the conversational connections they have on Twitter. We found that astrophysicists communicate with a variety of user types (e.g. colleagues, science communicators, other researchers, and educators) and that in the ego networks of the astrophysicists clear groups consisting of users with different professional roles can be distinguished. Interestingly, the analysis of noun phrases and hashtags showed that when the astrophysicists address the different groups of very different professional composition they use very similar terminology, but that they do not talk to each other (i.e. mentioning other user names in tweets). The results also showed that in those areas of the ego networks that tweeted more the sentiment of the tweets tended to be closer to neutral, connecting frequent tweeting with information sharing activities rather than conversations or expressing opinions.

  12. Astrophysicists' conversational connections on Twitter.

    Directory of Open Access Journals (Sweden)

    Kim Holmberg

    Full Text Available Because Twitter and other social media are increasingly used for analyses based on altmetrics, this research sought to understand what contexts, affordance use, and social activities influence the tweeting behavior of astrophysicists. Thus, the presented study has been guided by three research questions that consider the influence of astrophysicists' activities (i.e., publishing and tweeting frequency and of their tweet construction and affordance use (i.e. use of hashtags, language, and emotions on the conversational connections they have on Twitter. We found that astrophysicists communicate with a variety of user types (e.g. colleagues, science communicators, other researchers, and educators and that in the ego networks of the astrophysicists clear groups consisting of users with different professional roles can be distinguished. Interestingly, the analysis of noun phrases and hashtags showed that when the astrophysicists address the different groups of very different professional composition they use very similar terminology, but that they do not talk to each other (i.e. mentioning other user names in tweets. The results also showed that in those areas of the ego networks that tweeted more the sentiment of the tweets tended to be closer to neutral, connecting frequent tweeting with information sharing activities rather than conversations or expressing opinions.

  13. [Neurology of hysteria (conversion disorder)].

    Science.gov (United States)

    Sonoo, Masahiro

    2014-07-01

    Hysteria has served as an important driving force in the development of both neurology and psychiatry. Jean Martin Charcot's devotion to mesmerism for treating hysterical patients evoked the invention of psychoanalysis by Sigmund Freud. Meanwhile, Joseph Babinski took over the challenge to discriminate between organic and hysterical patients from Charcot and found Babinski's sign, the greatest milestone in modern neurological symptomatology. Nowadays, the usage of the term hysteria is avoided. However, new terms and new classifications are complicated and inconsistent between the two representative taxonomies, the DSM-IV and ICD-10. In the ICD-10, even the alternative term conversion disorder, which was becoming familiar to neurologists, has also disappeared as a group name. The diagnosis of hysteria remains important in clinical neurology. Extensive exclusive diagnoses and over investigation, including various imaging studies, should be avoided because they may prolong the disease course and fix their symptoms. Psychological reasons that seem to explain the conversion are not considered reliable. Positive neurological signs suggesting nonorganic etiologies are the most reliable measures for diagnosing hysteria, as Babinski first argued. Hysterical paresis has several characteristics, such as giving-way weakness or peculiar distributions of weakness. Signs to uncover nonorganic paresis utilizing synergy include Hoover's test and the Sonoo abductor test.

  14. Biological conversion of synthesis gas

    Energy Technology Data Exchange (ETDEWEB)

    Klasson, K.T.; Basu, R.; Johnson, E.R.; Clausen, E.C.; Gaddy, J.L.

    1992-03-01

    Mass transfer and kinetic studies were carried out for the Rhodospirillum rubrum and Chlorobium thiosulfatophilum bacterial systems. R. rubrum is a photosynthetic anaerobic bacterium which catalyzes the biological water gas shift reaction: CO + H[sub 2]0 [yields] CO[sub 2] + H[sub 2]. C. thiosulfatophilum is also a H[sub 2]S and COS to elemental sulfur. The growth of R. rubrum may be satisfactorily carried out at 25[degree] and 30[degree]C, while CO uptake and thus the conversion of CO best occurs at temperatures of either 30[degree], 32[degree] or 34[degree]C. The rate of conversion of COs and H[sub 2]O to CO[sub 2] and H[sub 2]S may be modeled by a first order rate expression. The rate constant at 30[degree]C was found to be 0.243 h[sup [minus]1]. The growth of C. thiosulfatophilum may be modeled in terms of incoming light intensity using a Monod equation: [mu] = [sub 351] + I[sub o]/[sup 0.152]I[sub o]. Comparisons of the growth of R. rubrum and C. thiosulfatophilum shows that the specific growth rate of C. thiosulfatophilum is much higher at a given light intensity.

  15. Bilingualism Accentuates Children's Conversational Understanding

    Science.gov (United States)

    Siegal, Michael; Surian, Luca; Matsuo, Ayumi; Geraci, Alessandra; Iozzi, Laura; Okumura, Yuko; Itakura, Shoji

    2010-01-01

    Background Although bilingualism is prevalent throughout the world, little is known about the extent to which it influences children's conversational understanding. Our investigation involved children aged 3–6 years exposed to one or more of four major languages: English, German, Italian, and Japanese. In two experiments, we examined the children's ability to identify responses to questions as violations of conversational maxims (to be informative and avoid redundancy, to speak the truth, be relevant, and be polite). Principal Findings In Experiment 1, with increasing age, children showed greater sensitivity to maxim violations. Children in Italy who were bilingual in German and Italian (with German as the dominant language L1) significantly outperformed Italian monolinguals. In Experiment 2, children in England who were bilingual in English and Japanese (with English as L1) significantly outperformed Japanese monolinguals in Japan with vocabulary age partialled out. Conclusions As the monolingual and bilingual groups had a similar family SES background (Experiment 1) and similar family cultural identity (Experiment 2), these results point to a specific role for early bilingualism in accentuating children's developing ability to appreciate effective communicative responses. PMID:20140246

  16. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  17. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  18. Supercritical Carbon Dioxide Brayton Cycle Energy Conversion System

    Energy Technology Data Exchange (ETDEWEB)

    Cha, Jae Eun; Kim, S. O.; Seong, S. H.; Eoh, J. H.; Lee, T. H.; Choi, S. K.; Han, J. W.; Bae, S. W

    2007-12-15

    This report contains the description of the S-CO{sub 2} Brayton cycle coupled to KALIMER-600 as an alternative energy conversion system. For system development, a computer code was developed to calculate heat balance of 100% power operation condition. Based on the computer code, the S-CO{sub 2} Brayton cycle energy conversion system was constructed for the KALIMER-600. Using the developed turbomachinery models, the off-design characteristics and the sensitivities of the S-CO{sub 2} turbomachinery were investigated. For the development of PCHE models, a one-dimensional analysis computer code was developed to evaluate the performance of the PCHE. Possible control schemes for power control in the KALIMER-600 S-CO{sub 2} Brayton cycle were investigated by using the MARS code. Simple power reduction and recovery event was selected and analyzed for the transient calculation. For the evaluation of Na/CO{sub 2} boundary failure event, a computer was developed to simulate the complex thermodynamic behaviors coupled with the chemical reaction between liquid sodium and CO{sub 2} gas. The long term behavior of a Na/CO{sub 2} boundary failure event and its consequences which lead to a system pressure transient were evaluated.

  19. The conversational interface talking to smart devices

    CERN Document Server

    McTear, Michael; Griol, David

    2016-01-01

    This book provides a comprehensive introduction to the conversational interface, which is becoming the main mode of interaction with virtual personal assistants, smart devices, various types of wearables, and social robots. The book consists of four parts: Part I presents the background to conversational interfaces, examining past and present work on spoken language interaction with computers; Part II covers the various technologies that are required to build a conversational interface along with practical chapters and exercises using open source tools; Part III looks at interactions with smart devices, wearables, and robots, and then goes on to discusses the role of emotion and personality in the conversational interface; Part IV examines methods for evaluating conversational interfaces and discusses future directions. · Presents a comprehensive overview of the various technologies that underlie conversational user interfaces; · Combines descriptions of conversational user interface technologies with a gui...

  20. Completion of the mitochondrial genome sequence of onion (Allium cepa L.) containing the CMS-S male-sterile cytoplasm and identification of an independent event of the ccmF N gene split.

    Science.gov (United States)

    Kim, Bongju; Kim, Kyunghee; Yang, Tae-Jin; Kim, Sunggil

    2016-11-01

    Cytoplasmic male-sterility (CMS) conferred by the CMS-S cytoplasm has been most commonly used for onion (Allium cepa L.) F1 hybrid seed production. We first report the complete mitochondrial genome sequence containing CMS-S cytoplasm in this study. Initially, seven contigs were de novo assembled from 150-bp paired-end raw reads produced from the total genomic DNA using the Illumina NextSeq500 platform. These contigs were connected into a single circular genome consisting of 316,363 bp (GenBank accession: KU318712) by PCR amplification. Although all 24 core protein-coding genes were present, no ribosomal protein-coding genes, except rps12, were identified in the onion mitochondrial genome. Unusual trans-splicing of the cox2 gene was verified, and the cox1 gene was identified as part of the chimeric orf725 gene, which is a candidate gene responsible for inducing CMS. In addition to orf725, two small chimeric genes were identified, but no transcripts were detected for these two open reading frames. Thirteen chloroplast-derived sequences, with sizes of 126-13,986 bp, were identified in the intergenic regions. Almost 10 % of the onion mitochondrial genome was composed of repeat sequences. The vast majority of repeats were short repeats of Allium species. The complete onion mitochondrial genome sequence reported in this study would be fundamental information for elucidation of onion CMS evolution.

  1. Polyamines and WOX genes in the recalcitrance to plant conversion ...

    African Journals Online (AJOL)

    Raul Valle

    2015-02-18

    Feb 18, 2015 ... apparent that the induction of the embryogenic pathway ... 1.5 atm for 15 min. Once the seeds .... vacuoles, mitochondria and chloroplasts (Slocum, 1991). Borrell et al. ..... Shoot architecture in higher plants is highly dependent.

  2. Gene conversion homogenizes the CMT1A paralogous repeats

    OpenAIRE

    Hurles Matthew E

    2001-01-01

    RIGHTS : This article is licensed under the BioMed Central licence at http://www.biomedcentral.com/about/license which is similar to the 'Creative Commons Attribution Licence'. In brief you may : copy, distribute, and display the work; make derivative works; or make commercial use of the work - under the following conditions: the original author must be given credit; for any reuse or distribution, it must be made clear to others what the license terms of this work are. Abstract Backgrou...

  3. Conversion of homothallic yeast to heterothallism through to gene disruption

    CSIR Research Space (South Africa)

    Van Zyl, WH

    1993-04-01

    Full Text Available ). DNA content. The cellular DNA of stationary-phase cells (5 x 109 cells per sample) was extracted with perchloric acid and the DNA content determined in duplicate according to the diphenylamine method described by Stewart (1975). Herring sperm DNA... few viable spores, it should be possible to enrich for such spores by ether treatment (Rockmill et al. 1991) prior to selection for G418 resis- tance. Acknowledgements. We thank Dr. James R. Broach at Princeton University, Princeton, N. J., USA...

  4. Features, Events, and Processes: Disruptive Events

    Energy Technology Data Exchange (ETDEWEB)

    J. King

    2004-03-31

    The primary purpose of this analysis is to evaluate seismic- and igneous-related features, events, and processes (FEPs). These FEPs represent areas of natural system processes that have the potential to produce disruptive events (DE) that could impact repository performance and are related to the geologic processes of tectonism, structural deformation, seismicity, and igneous activity. Collectively, they are referred to as the DE FEPs. This evaluation determines which of the DE FEPs are excluded from modeling used to support the total system performance assessment for license application (TSPA-LA). The evaluation is based on the data and results presented in supporting analysis reports, model reports, technical information, or corroborative documents that are cited in the individual FEP discussions in Section 6.2 of this analysis report.

  5. Features, Events, and Processes: Disruptive Events

    Energy Technology Data Exchange (ETDEWEB)

    P. Sanchez

    2004-11-08

    The purpose of this analysis report is to evaluate and document the inclusion or exclusion of the disruptive events features, events, and processes (FEPs) with respect to modeling used to support the total system performance assessment for license application (TSPA-LA). A screening decision, either ''Included'' or ''Excluded,'' is given for each FEP, along with the technical basis for screening decisions. This information is required by the U.S. Nuclear Regulatory Commission (NRC) at 10 CFR 63.114 (d), (e), and (f) [DIRS 156605]. The FEPs addressed in this report deal with both seismic and igneous disruptive events, such as fault displacements through the repository and an igneous intrusion into the repository. For included FEPs, this analysis summarizes the implementation of the FEP in TSPA-LA (i.e., how the FEP is included). For excluded FEPs, this analysis provides the technical basis for exclusion from TSPA-LA (i.e., why the FEP is excluded). Previous versions of this report were developed to support the total system performance assessments (TSPA) for various prior repository designs. This revision addresses the repository design for the license application (LA).

  6. Practices Surrounding Event Photos

    NARCIS (Netherlands)

    Vyas, Dhaval; Nijholt, Antinus; van der Veer, Gerrit C.; Kotzé, P.; Marsden, G.; Lindgaard, G.; Wesson, J.; Winckler, M.

    Sharing photos through mobile devices has a great potential for creating shared experiences of social events between co-located as well as remote participants. In order to design novel event sharing tools, we need to develop indepth understanding of current practices surrounding these so called

  7. Committed Sport Event Volunteers

    Science.gov (United States)

    Han, Keunsu; Quarterman, Jerome; Strigas, Ethan; Ha, Jaehyun; Lee, Seungbum

    2013-01-01

    The purpose of this study was to investigate the relationships among selected demographic characteristics (income, education and age), motivation and commitment of volunteers at a sporting event. Three-hundred and five questionnaires were collected from volunteers in a marathon event and analyzed using structural equation modeling (SEM). Based on…

  8. CHED Events: Philadelphia

    Science.gov (United States)

    Wink, Donald J.

    2008-08-01

    These Division of Chemical Education (CHED) Committee meetings and events are planned for the Fall 2008 ACS Meeting in Philadelphia. Most will take place in the Sheraton Philadelphia City Center Hotel, 17th and Race Streets: This includes the Sunday evening Reception and Social Event; there will be no CHED Banquet.

  9. The Agency of Event

    DEFF Research Database (Denmark)

    Nicholas, Paul; Tamke, Martin; Riiber, Jacob

    2014-01-01

    This paper explores the notion of agency within event-based models. We present an event-based modeling approach that links interdependent generative, analytic and decision making sub-models within a system of exchange. Two case study projects demonstrate the underlying modeling concepts...

  10. The Agency of Event

    DEFF Research Database (Denmark)

    Nicholas, Paul; Tamke, Martin; Riiber, Jacob

    2014-01-01

    This paper explores the notion of agency within event-based models. We present an event-based modeling approach that links interdependent generative, analytic and decision making sub-models within a system of exchange. Two case study projects demonstrate the underlying modeling concepts and metho...

  11. Activating Event Knowledge

    Science.gov (United States)

    Hare, Mary; Jones, Michael; Thomson, Caroline; Kelly, Sarah; McRae, Ken

    2009-01-01

    An increasing number of results in sentence and discourse processing demonstrate that comprehension relies on rich pragmatic knowledge about real-world events, and that incoming words incrementally activate such knowledge. If so, then even outside of any larger context, nouns should activate knowledge of the generalized events that they denote or…

  12. The ATLAS Event Builder

    CERN Document Server

    Vandelli, W; Battaglia, A; Beck, H P; Blair, R; Bogaerts, A; Bosman, M; Ciobotaru, M; Cranfield, R; Crone, G; Dawson, J; Dobinson, Robert W; Dobson, M; Dos Anjos, A; Drake, G; Ermoline, Y; Ferrari, R; Ferrer, M L; Francis, D; Gadomski, S; Gameiro, S; Gorini, B; Green, B; Haberichter, W; Haberli, C; Hauser, R; Hinkelbein, C; Hughes-Jones, R; Joos, M; Kieft, G; Klous, S; Korcyl, K; Kordas, K; Kugel, A; Leahu, L; Lehmann, G; Martin, B; Mapelli, L; Meessen, C; Meirosu, C; Misiejuk, A; Mornacchi, G; Müller, M; Nagasaka, Y; Negri, A; Pasqualucci, E; Pauly, T; Petersen, J; Pope, B; Schlereth, J L; Spiwoks, R; Stancu, S; Strong, J; Sushkov, S; Szymocha, T; Tremblet, L; Ünel, G; Vermeulen, J; Werner, P; Wheeler-Ellis, S; Wickens, F; Wiedenmann, W; Yu, M; Yasu, Y; Zhang, J; Zobernig, H; 2007 IEEE Nuclear Science Symposium and Medical Imaging Conference

    2008-01-01

    Event data from proton-proton collisions at the LHC will be selected by the ATLAS experiment in a three-level trigger system, which, at its first two trigger levels (LVL1+LVL2), reduces the initial bunch crossing rate of 40~MHz to $sim$3~kHz. At this rate, the Event Builder collects the data from the readout system PCs (ROSs) and provides fully assembled events to the Event Filter (EF). The EF is the third trigger level and its aim is to achieve a further rate reduction to $sim$200~Hz on the permanent storage. The Event Builder is based on a farm of O(100) PCs, interconnected via a Gigabit Ethernet to O(150) ROSs. These PCs run Linux and multi-threaded software applications implemented in C++. All the ROSs, and substantial fractions of the Event Builder and Event Filter PCs have been installed and commissioned. We report on performance tests on this initial system, which is capable of going beyond the required data rates and bandwidths for Event Building for the ATLAS experiment.

  13. Interview with Jill Freedman: A Conversation about Having Conversations

    Science.gov (United States)

    Schwarzbaum, Sara

    2009-01-01

    Jill Freedman is director of Evanston Family Therapy Center and a faculty member of the Chicago Center for Family Health. She has coauthored (with Gene Combs) more than 25 articles on narrative therapy and three books. The first two books are "Symbol, Story, and Ceremony: Using Metaphor in Individual and Family Therapy and Narrative Therapy:…

  14. Interview with Jill Freedman: A Conversation about Having Conversations

    Science.gov (United States)

    Schwarzbaum, Sara

    2009-01-01

    Jill Freedman is director of Evanston Family Therapy Center and a faculty member of the Chicago Center for Family Health. She has coauthored (with Gene Combs) more than 25 articles on narrative therapy and three books. The first two books are "Symbol, Story, and Ceremony: Using Metaphor in Individual and Family Therapy and Narrative Therapy: The…

  15. Microturbine Power Conversion Technology Review

    Energy Technology Data Exchange (ETDEWEB)

    Staunton, R.H.

    2003-07-21

    In this study, the Oak Ridge National Laboratory (ORNL) is performing a technology review to assess the market for commercially available power electronic converters that can be used to connect microturbines to either the electric grid or local loads. The intent of the review is to facilitate an assessment of the present status of marketed power conversion technology to determine how versatile the designs are for potentially providing different services to the grid based on changes in market direction, new industry standards, and the critical needs of the local service provider. The project includes data gathering efforts and documentation of the state-of-the-art design approaches that are being used by microturbine manufacturers in their power conversion electronics development and refinement. This project task entails a review of power converters used in microturbines sized between 20 kW and 1 MW. The power converters permit microturbine generators, with their non-synchronous, high frequency output, to interface with the grid or local loads. The power converters produce 50- to 60-Hz power that can be used for local loads or, using interface electronics, synchronized for connection to the local feeder and/or microgrid. The power electronics enable operation in a stand-alone mode as a voltage source or in grid-connect mode as a current source. Some microturbines are designed to automatically switch between the two modes. The information obtained in this data gathering effort will provide a basis for determining how close the microturbine industry is to providing services such as voltage regulation, combined control of both voltage and current, fast/seamless mode transfers, enhanced reliability, reduced cost converters, reactive power supply, power quality, and other ancillary services. Some power quality improvements will require the addition of storage devices; therefore, the task should also determine what must be done to enable the power conversion circuits to

  16. Molecular trajectories leading to the alternative fates of duplicate genes.

    Directory of Open Access Journals (Sweden)

    Michael Marotta

    Full Text Available Gene duplication generates extra gene copies in which mutations can accumulate without risking the function of pre-existing genes. Such mutations modify duplicates and contribute to evolutionary novelties. However, the vast majority of duplicates appear to be short-lived and experience duplicate silencing within a few million years. Little is known about the molecular mechanisms leading to these alternative fates. Here we delineate differing molecular trajectories of a relatively recent duplication event between humans and chimpanzees by investigating molecular properties of a single duplicate: DNA sequences, gene expression and promoter activities. The inverted duplication of the Glutathione S-transferase Theta 2 (GSTT2 gene had occurred at least 7 million years ago in the common ancestor of African great apes and is preserved in chimpanzees (Pan troglodytes, whereas a deletion polymorphism is prevalent in humans. The alternative fates are associated with expression divergence between these species, and reduced expression in humans is regulated by silencing mutations that have been propagated between duplicates by gene conversion. In contrast, selective constraint preserved duplicate divergence in chimpanzees. The difference in evolutionary processes left a unique DNA footprint in which dying duplicates are significantly more similar to each other (99.4% than preserved ones. Such molecular trajectories could provide insights for the mechanisms underlying duplicate life and death in extant genomes.

  17. Interspecies recombination between the penA genes of Neisseria meningitidis and commensal Neisseria species during the emergence of penicillin resistance in N. meningitidis: natural events and laboratory simulation.

    OpenAIRE

    Bowler, L. D.; Zhang, Q Y; Riou, J Y; Spratt, B G

    1994-01-01

    The penicillin-binding protein 2 genes (penA) of penicillin-resistant Neisseria meningitidis have a mosaic structure that has arisen by the introduction of regions from the penA genes of Neisseria flavescens or Neisseria cinerea. Chromosomal DNA from both N. cinerea and N. flavescens could transform a penicillin-susceptible isolate of N. meningitidis to increased resistance to penicillin. With N. flavescens DNA, transformation to resistance was accompanied by the introduction of the N. flaves...

  18. Molecular analysis of the structure and expression of the RH locus in individuals with D--, Dc-, and DCw- gene complexes.

    Science.gov (United States)

    Chérif-Zahar, B; Raynal, V; D'Ambrosio, A M; Cartron, J P; Colin, Y

    1994-12-15

    Rh blood group antigens of the D, C/c, and E/e series are carried by at least three red cell membrane polypeptides encoded by two highly related genes, RHD and RHCE. Homozygous individuals carrying the D--, Dc-, and DCw- gene complexes are characterized by a total or partial lack of expression of the RHCE-encoded antigens. Analysis of the molecular genetic basis of these rare conditions indicates that complete or partial expression defect of Cc/Ee antigens result from different alterations at the RH locus, but not from gross deletions. No rearrangement or mutation of the RHCE gene could be detected in donors homozygous for the D-- complex, suggesting that the lack of the Cc and Ee antigens might result from a reduced transcriptional activity of the RHCE gene. The Dc- and DCw- gene complexes, however, exhibited an important rearrangement of the RHCE gene. Instead of the normal RHCE gene, both variants carried a hybrid RHCE-D-CE gene in which exons 4 to 9 (Dc- complex) and 2 (or 3) to 9 (DCw- complex) of the RHCE gene, respectively, have been substituted by the equivalent region of the RHD gene. These gene conversion events provide an explanation for the well-described abnormal antigen profiles associated with the Dc- and DCw- complexes, like the increased expression of RhD, the reduced expression of RhC/c or RhCw, and the absence of RhE/e.

  19. Conversation Analysis in Applied Linguistics

    DEFF Research Database (Denmark)

    Kasper, Gabriele; Wagner, Johannes

    2014-01-01

    with understanding fundamental issues of talk in action and of intersubjectivity in human conduct. The field has expanded its scope from the analysis of talk—often phone calls—towards an integration of language with other semiotic resources for embodied action, including space and objects. Much of this expansion has...... been driven by applied work. After laying out CA's standard practices of data treatment and analysis, this article takes up the role of comparison as a fundamental analytical strategy and reviews recent developments into cross-linguistic and cross-cultural directions. The remaining article focuses......For the last decade, conversation analysis (CA) has increasingly contributed to several established fields in applied linguistics. In this article, we will discuss its methodological contributions. The article distinguishes between basic and applied CA. Basic CA is a sociological endeavor concerned...

  20. Photoelectrochemical based direct conversion systems

    Energy Technology Data Exchange (ETDEWEB)

    Kocha, S.; Arent, D.; Peterson, M. [National Renewable Energy Lab., Golden, CO (United States)] [and others

    1995-09-01

    The goal of this research is to develop a stable, cost effective, photoelectrochemical based system that will split water upon illumination, producing hydrogen and oxygen directly, using sunlight as the only energy input. This type of direct conversion system combines a photovoltaic material and an electrolyzer into a single monolithic device. We report on our studies of two multifunction multiphoton photoelectrochemical devices, one based on the ternary semiconductor gallium indium phosphide, (GaInP{sub 2}), and the other one based on amorphous silicon carbide. We also report on our studies of the solid state surface treatment of GaInP{sub 2} as well as our continuing effort to develop synthetic techniques for the attachment of transition metal complexes to the surface of semiconductor electrodes. All our surface studies are directed at controlling the interface energetics and forming stable catalytic surfaces.