International Nuclear Information System (INIS)
Moreno, Damaris; Fuentes, Jorge L.; Prieto Miranda, Enrique F.; Sanchez Lamar, Angel; Baluja, Ligia
2004-01-01
Radiosensitivity and kinetics of induction of gene conversion and reversion events in Saccharomyces cerevisiae strain D7 to gamma radiation at dose ranges from 100 to 800 Gy and 50 to 300 Gy respectively were studied. A source of 60Co PX- -30 at a dose rate of 49,43 GY/min was utilized. The cell survival curve showed DL50 of 150 Gy. Cell death kinetics was linear and adjusted over 98 %. The induction of gene conversion events was significant in relation to control from 50 Gy on. However, gene reversion was significant only at 200 Gy. Generally speaking, gene conversion event frequencies were higher than those of reversion, which indicates that gamma radiation preferably induces recombinogenic events. Both the conversion and reversion events showed exponential dependence on gamma radiation dose. The relative benefits of this test for mutagenesis and anti-mutagenesis studies were debated in this paper
Frequent gene conversion events between the X and Y homologous chromosomal regions in primates
Directory of Open Access Journals (Sweden)
Hirai Hirohisa
2010-07-01
Full Text Available Abstract Background Mammalian sex-chromosomes originated from a pair of autosomes. A step-wise cessation of recombination is necessary for the proper maintenance of sex-determination and, consequently, generates a four strata structure on the X chromosome. Each stratum shows a specific per-site nucleotide sequence difference (p-distance between the X and Y chromosomes, depending on the time of recombination arrest. Stratum 4 covers the distal half of the human X chromosome short arm and the p-distance of the stratum is ~10%, on average. However, a 100-kb region, which includes KALX and VCX, in the middle of stratum 4 shows a significantly lower p-distance (1-5%, suggesting frequent sequence exchanges or gene conversions between the X and Y chromosomes in humans. To examine the evolutionary mechanism for this low p-distance region, sequences of a corresponding region including KALX/Y from seven species of non-human primates were analyzed. Results Phylogenetic analysis of this low p-distance region in humans and non-human primate species revealed that gene conversion like events have taken place at least ten times after the divergence of New World monkeys and Catarrhini (i.e., Old World monkeys and hominoids. A KALY-converted KALX allele in white-handed gibbons also suggests a possible recent gene conversion between the X and Y chromosomes. In these primate sequences, the proximal boundary of this low p-distance region is located in a LINE element shared between the X and Y chromosomes, suggesting the involvement of this element in frequent gene conversions. Together with a palindrome on the Y chromosome, a segmental palindrome structure on the X chromosome at the distal boundary near VCX, in humans and chimpanzees, may mediate frequent sequence exchanges between X and Y chromosomes. Conclusion Gene conversion events between the X and Y homologous regions have been suggested, mainly in humans. Here, we found frequent gene conversions in the
Gene conversion in the rice genome
DEFF Research Database (Denmark)
Xu, Shuqing; Clark, Terry; Zheng, Hongkun
2008-01-01
-chromosomal conversions distributed between chromosome 1 and 5, 2 and 6, and 3 and 5 are more frequent than genome average (Z-test, P ... is not tightly linked to natural selection in the rice genome. To assess the contribution of segmental duplication on gene conversion statistics, we determined locations of conversion partners with respect to inter-chromosomal segment duplication. The number of conversions associated with segmentation is less...... involved in conversion events. CONCLUSION: The evolution of gene families in the rice genome may have been accelerated by conversion with pseudogenes. Our analysis suggests a possible role for gene conversion in the evolution of pathogen-response genes....
Sexy gene conversions: locating gene conversions on the X-chromosome.
Lawson, Mark J; Zhang, Liqing
2009-08-01
Gene conversion can have a profound impact on both the short- and long-term evolution of genes and genomes. Here, we examined the gene families that are located on the X-chromosomes of human (Homo sapiens), chimpanzee (Pan troglodytes), mouse (Mus musculus) and rat (Rattus norvegicus) for evidence of gene conversion. We identified seven gene families (WD repeat protein family, Ferritin Heavy Chain family, RAS-related Protein RAB-40 family, Diphosphoinositol polyphosphate phosphohydrolase family, Transcription Elongation Factor A family, LDOC1-related family, Zinc Finger Protein ZIC, and GLI family) that show evidence of gene conversion. Through phylogenetic analyses and synteny evidence, we show that gene conversion has played an important role in the evolution of these gene families and that gene conversion has occurred independently in both primates and rodents. Comparing the results with those of two gene conversion prediction programs (GENECONV and Partimatrix), we found that both GENECONV and Partimatrix have very high false negative rates (i.e. failed to predict gene conversions), which leads to many undetected gene conversions. The combination of phylogenetic analyses with physical synteny evidence exhibits high resolution in the detection of gene conversions.
Mechanisms of Ectopic Gene Conversion
Directory of Open Access Journals (Sweden)
P.J. Hastings
2010-11-01
Full Text Available Gene conversion (conversion, the unidirectional transfer of DNA sequence information, occurs as a byproduct of recombinational repair of broken or damaged DNA molecules. Whereas excision repair processes replace damaged DNA by copying the complementary sequence from the undamaged strand of duplex DNA, recombinational mechanisms copy similar sequence, usually in another molecule, to replace the damaged sequence. In mitotic cells the other molecule is usually a sister chromatid, and the repair does not lead to genetic change. Less often a homologous chromosome or homologous sequence in an ectopic position is used. Conversion results from repair in two ways. First, if there was a double-strand gap at the site of a break, homologous sequence will be used as the template for synthesis to fill the gap, thus transferring sequence information in both strands. Second, recombinational repair uses complementary base pairing, and the heteroduplex molecule so formed is a source of conversion, both as heteroduplex and when donor (undamaged template information is retained after correction of mismatched bases in heteroduplex. There are mechanisms that favour the use of sister molecules that must fail before ectopic homology can be used. Meiotic recombination events lead to the formation of crossovers required in meiosis for orderly segregation of pairs of homologous chromosomes. These events result from recombinational repair of programmed double-strand breaks, but in contrast with mitotic recombination, meiotic recombinational events occur predominantly between homologous chromosomes, so that transfer of sequence differences by conversion is very frequent. Transient recombination events that do not form crossovers form both between homologous chromosomes and between regions of ectopic homology, and leave their mark in the occurrence of frequent non-crossover conversion, including ectopic conversion.
Differentially expressed genes in iron-induced prion protein conversion
International Nuclear Information System (INIS)
Kim, Minsun; Kim, Eun-hee; Choi, Bo-Ran; Woo, Hee-Jong
2016-01-01
The conversion of the cellular prion protein (PrP C ) to the protease-resistant isoform is the key event in chronic neurodegenerative diseases, including transmissible spongiform encephalopathies (TSEs). Increased iron in prion-related disease has been observed due to the prion protein-ferritin complex. Additionally, the accumulation and conversion of recombinant PrP (rPrP) is specifically derived from Fe(III) but not Fe(II). Fe(III)-mediated PK-resistant PrP (PrP res ) conversion occurs within a complex cellular environment rather than via direct contact between rPrP and Fe(III). In this study, differentially expressed genes correlated with prion degeneration by Fe(III) were identified using Affymetrix microarrays. Following Fe(III) treatment, 97 genes were differentially expressed, including 85 upregulated genes and 12 downregulated genes (≥1.5-fold change in expression). However, Fe(II) treatment produced moderate alterations in gene expression without inducing dramatic alterations in gene expression profiles. Moreover, functional grouping of identified genes indicated that the differentially regulated genes were highly associated with cell growth, cell maintenance, and intra- and extracellular transport. These findings showed that Fe(III) may influence the expression of genes involved in PrP folding by redox mechanisms. The identification of genes with altered expression patterns in neural cells may provide insights into PrP conversion mechanisms during the development and progression of prion-related diseases. - Highlights: • Differential genes correlated with prion degeneration by Fe(III) were identified. • Genes were identified in cell proliferation and intra- and extracellular transport. • In PrP degeneration, redox related genes were suggested. • Cbr2, Rsad2, Slc40a1, Amph and Mvd were expressed significantly.
Directory of Open Access Journals (Sweden)
Whittle Carrie A
2010-07-01
Full Text Available Abstract Background The self-fertile filamentous ascomycete Neurospora tetrasperma contains a large (~7 Mbp and young (mat chromosomes. The objective of the present study is to reveal the evolutionary history, including key genomic events, associated with the various regions of the mat chromosomes among ten strains representing all the nine known species (lineages contained within the N. tetrasperma species complex. Results Comparative analysis of sequence divergence among alleles of 24 mat-linked genes (mat A and mat a indicates that a large region of suppressed recombination exists within the mat chromosome for each of nine lineages of N. tetrasperma sensu latu. The recombinationally suppressed region varies in size and gene composition among lineages, and is flanked on both ends by normally recombining regions. Genealogical analyses among lineages reveals that eight gene conversion events have occurred between homologous mat A and mat a-linked alleles of genes located within the region of restricted recombination during the evolutionary history of N. tetrasperma. Conclusions We conclude that the region of suppressed recombination in the mat chromosomes has likely been subjected to independent contraction and/or expansion during the evolutionary history of the N. tetrasperma species complex. Furthermore, we infer that gene conversion events are likely a common phenomenon within this recombinationally suppressed genomic region. We argue that gene conversions might provide an efficient mechanism of adaptive editing of functional genes, including the removal of deleterious mutations, within the young recombinationally suppressed region of the mat chromosomes.
DEFF Research Database (Denmark)
Gonzalez-Izarzugaza, Jose Maria; Skov, Laurits; Maretty, Lasse
2017-01-01
with the chimpanzee Y chromosome. We analyzed 2.7 Mb of large inverted repeats (palindromes) for variation patterns among the two palindrome arms and identified 603 mutation and 416 gene conversions events. We find clear evidence for GC-biased gene conversion in the palindromes (and a balancing AT mutation bias...
Kitani, Y
1978-07-01
From the analysis of large samples of gene conversion asci in the g locus of Sordaria fimicola, it was found that neither the conversion event itself nor conversion-associated recombination of flanking markers cause either chiasma or chromatid interference with crossing over in a neighboring interval. The presence of more than one kind of crossover event, one causing interference the other not, is considered. The existence of two kinds of gene loci, one of single-cistron composition and the other of multiple-cistron composition, is discussed in relation to reciprocal recombination within a locus.
Rane, Hallie S; Smith, Jessica M; Bergthorsson, Ulfar; Katju, Vaishali
2010-07-01
Gene conversion, a form of concerted evolution, bears enormous potential to shape the trajectory of sequence and functional divergence of gene paralogs subsequent to duplication events. fog-2, a sex-determination gene unique to Caenorhabditis elegans and implicated in the origin of hermaphroditism in this species, resulted from the duplication of ftr-1, an upstream gene of unknown function. Synonymous sequence divergence in regions of fog-2 and ftr-1 (excluding recent gene conversion tracts) suggests that the duplication occurred 46 million generations ago. Gene conversion between fog-2 and ftr-1 was previously discovered in experimental fog-2 knockout lines of C. elegans, whereby hermaphroditism was restored in mutant obligately outcrossing male-female populations. We analyzed DNA-sequence variation in fog-2 and ftr-1 within 40 isolates of C. elegans from diverse geographic locations in order to evaluate the contribution of gene conversion to genetic variation in the two gene paralogs. The analysis shows that gene conversion contributes significantly to DNA-sequence diversity in fog-2 and ftr-1 (22% and 34%, respectively) and may have the potential to alter sexual phenotypes in natural populations. A radical amino acid change in a conserved region of the F-box domain of fog-2 was found in natural isolates of C. elegans with significantly lower fecundity. We hypothesize that the lowered fecundity is due to reduced masculinization and less sperm production and that amino acid replacement substitutions and gene conversion in fog-2 may contribute significantly to variation in the degree of inbreeding and outcrossing in natural populations.
A strong deletion bias in nonallelic gene conversion.
Directory of Open Access Journals (Sweden)
Raquel Assis
Full Text Available Gene conversion is the unidirectional transfer of genetic information between orthologous (allelic or paralogous (nonallelic genomic segments. Though a number of studies have examined nucleotide replacements, little is known about length difference mutations produced by gene conversion. Here, we investigate insertions and deletions produced by nonallelic gene conversion in 338 Drosophila and 10,149 primate paralogs. Using a direct phylogenetic approach, we identify 179 insertions and 614 deletions in Drosophila paralogs, and 132 insertions and 455 deletions in primate paralogs. Thus, nonallelic gene conversion is strongly deletion-biased in both lineages, with almost 3.5 times as many conversion-induced deletions as insertions. In primates, the deletion bias is considerably stronger for long indels and, in both lineages, the per-site rate of gene conversion is orders of magnitudes higher than that of ordinary mutation. Due to this high rate, deletion-biased nonallelic gene conversion plays a key role in genome size evolution, leading to the cooperative shrinkage and eventual disappearance of selectively neutral paralogs.
Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution
Energy Technology Data Exchange (ETDEWEB)
Kass, D.H. [Louisiana State Univ. Medical Center, New Orleans, LA (United States). Dept. of Biochemistry and Molecular Biology; Batzer, M.A. [Lawrence Livermore National Lab., CA (United States); Deininger, P.L. [Louisiana State Univ. Medical Center, New Orleans, LA (United States). Dept. of Biochemistry and Molecular Biology]|[Alton Ochsner Medical Foundation, New Orleans, LA (United States). Lab. of Molecular Genetics
1995-01-01
The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome. However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.
Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization
Directory of Open Access Journals (Sweden)
Xi-Yin Wang
2011-01-01
Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.
2010-01-01
Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests
Directory of Open Access Journals (Sweden)
Hao Weilong
2010-12-01
Full Text Available Abstract Background Horizontal gene transfer (HGT is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
Directory of Open Access Journals (Sweden)
Matthew A Carrigan
Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates
Gene conversion limits divergence of mammalian TLR1 and TLR6
Directory of Open Access Journals (Sweden)
Dunoyer-Geindre Sylvie
2007-08-01
Full Text Available Abstract Background Toll-like receptors (TLR recognize pathogen-associated molecular patterns and are important mediators of the innate immune system. TLR1 and TLR6 are paralogs and located in tandem on the same chromosome in mammals. They form heterodimers with TLR2 and bind lipopeptide components of gram-positive and gram-negative bacterial cell walls. To identify conserved stretches in TLR1 and TLR6, that may be important for their function, we compared their protein sequences in nine mammalian species(Homo sapiens, Pan troglodytes, Macaca mulatta, Mus musculus, Rattus norvegicus; Erinaceus europaeus, Bos Taurus, Sus scrofa and Canis familiaris. Results The N-terminal sequences of the orthologous proteins showed greater similarity than corresponding paralog sequences. However, we identified a region of 300 amino acids towards the C-terminus of TLR1 and TLR6, where paralogs had a greater degree of sequence identity than orthologs. Preservation of DNA sequence identity of paralogs in this region was observed in all nine mammalian species investigated, and is due to independent gene conversion events. The regions having undergone gene conversion in each species are almost identical and encode the leucine-rich repeat motifs 16 to 19, the C-terminal cap motif, the transmembrane domain and most of the intracellular Toll/interleukin-1 receptor (TIR domain. Conclusion Our results show that, for a specific conserved region, divergence of TLR1 and TLR6 is limited by gene conversion, most likely because of the need for co-evolution with multiple intracellular and extracellular binding partners. Thus, gene conversion provides a mechanism for limiting the divergence of functional regions of protein paralogs, while allowing other domains to evolve diversified functions.
Gene conversion homogenizes the CMT1A paralogous repeats
Directory of Open Access Journals (Sweden)
Hurles Matthew E
2001-12-01
Full Text Available Abstract Background Non-allelic homologous recombination between paralogous repeats is increasingly being recognized as a major mechanism causing both pathogenic microdeletions and duplications, and structural polymorphism in the human genome. It has recently been shown empirically that gene conversion can homogenize such repeats, resulting in longer stretches of absolute identity that may increase the rate of non-allelic homologous recombination. Results Here, a statistical test to detect gene conversion between pairs of non-coding sequences is presented. It is shown that the 24 kb Charcot-Marie-Tooth type 1A paralogous repeats (CMT1A-REPs exhibit the imprint of gene conversion processes whilst control orthologous sequences do not. In addition, Monte Carlo simulations of the evolutionary divergence of the CMT1A-REPs, incorporating two alternative models for gene conversion, generate repeats that are statistically indistinguishable from the observed repeats. Bounds are placed on the rate of these conversion processes, with central values of 1.3 × 10-4 and 5.1 × 10-5 per generation for the alternative models. Conclusions This evidence presented here suggests that gene conversion may have played an important role in the evolution of the CMT1A-REP paralogous repeats. The rates of these processes are such that it is probable that homogenized CMT1A-REPs are polymorphic within modern populations. Gene conversion processes are similarly likely to play an important role in the evolution of other segmental duplications and may influence the rate of non-allelic homologous recombination between them.
Diversification of the Primary Antibody Repertoire by AID-Mediated Gene Conversion.
Lanning, Dennis K; Knight, Katherine L
2015-01-01
Gene conversion, mediated by activation-induced cytidine deaminase (AID), has been found to contribute to generation of the primary antibody repertoire in several vertebrate species. Generation of the primary antibody repertoire by gene conversion of immunoglobulin (Ig) genes occurs primarily in gut-associated lymphoid tissues (GALT) and is best described in chicken and rabbit. Here, we discuss current knowledge of the mechanism of gene conversion as well as the contribution of the microbiota in promoting gene conversion of Ig genes. Finally, we propose that the antibody diversification strategy used in GALT species, such as chicken and rabbit, is conserved in a subset of human and mouse B cells.
Directory of Open Access Journals (Sweden)
Laurits Skov
2017-08-01
Full Text Available The human Y-chromosome does not recombine across its male-specific part and is therefore an excellent marker of human migrations. It also plays an important role in male fertility. However, its evolution is difficult to fully understand because of repetitive sequences, inverted repeats and the potentially large role of gene conversion. Here we perform an evolutionary analysis of 62 Y-chromosomes of Danish descent sequenced using a wide range of library insert sizes and high coverage, thus allowing large regions of these chromosomes to be well assembled. These include 17 father-son pairs, which we use to validate variation calling. Using a recent method that can integrate variants based on both mapping and de novo assembly, we genotype 10898 SNVs and 2903 indels (max length of 27241 bp in our sample and show by father-son concordance and experimental validation that the non-recurrent SNP and indel variation on the Y chromosome tree is called very accurately. This includes variation called in a 0.9 Mb centromeric heterochromatic region, which is by far the most variable in the Y chromosome. Among the variation is also longer sequence-stretches not present in the reference genome but shared with the chimpanzee Y chromosome. We analyzed 2.7 Mb of large inverted repeats (palindromes for variation patterns among the two palindrome arms and identified 603 mutation and 416 gene conversions events. We find clear evidence for GC-biased gene conversion in the palindromes (and a balancing AT mutation bias, but irrespective of this, also a strong bias towards gene conversion towards the ancestral state, suggesting that palindromic gene conversion may alleviate Muller's ratchet. Finally, we also find a large number of large-scale gene duplications and deletions in the palindromic regions (at least 24 and find that such events can consist of complex combinations of simultaneous insertions and deletions of long stretches of the Y chromosome.
Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion
Directory of Open Access Journals (Sweden)
Jeffrey A. Fawcett
2011-02-01
Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.
Meiotic gene-conversion rate and tract length variation in the human genome.
Padhukasahasram, Badri; Rannala, Bruce
2013-02-27
Meiotic recombination occurs in the form of two different mechanisms called crossing-over and gene-conversion and both processes have an important role in shaping genetic variation in populations. Although variation in crossing-over rates has been studied extensively using sperm-typing experiments, pedigree studies and population genetic approaches, our knowledge of variation in gene-conversion parameters (ie, rates and mean tract lengths) remains far from complete. To explore variability in population gene-conversion rates and its relationship to crossing-over rate variation patterns, we have developed and validated using coalescent simulations a comprehensive Bayesian full-likelihood method that can jointly infer crossing-over and gene-conversion rates as well as tract lengths from population genomic data under general variable rate models with recombination hotspots. Here, we apply this new method to SNP data from multiple human populations and attempt to characterize for the first time the fine-scale variation in gene-conversion parameters along the human genome. We find that the estimated ratio of gene-conversion to crossing-over rates varies considerably across genomic regions as well as between populations. However, there is a great degree of uncertainty associated with such estimates. We also find substantial evidence for variation in the mean conversion tract length. The estimated tract lengths did not show any negative relationship with the local heterozygosity levels in our analysis.European Journal of Human Genetics advance online publication, 27 February 2013; doi:10.1038/ejhg.2013.30.
Life events and escape in conversion disorder.
Nicholson, T R; Aybek, S; Craig, T; Harris, T; Wojcik, W; David, A S; Kanaan, R A
2016-09-01
Psychological models of conversion disorder (CD) traditionally assume that psychosocial stressors are identifiable around symptom onset. In the face of limited supportive evidence such models are being challenged. Forty-three motor CD patients, 28 depression patients and 28 healthy controls were assessed using the Life Events and Difficulties Schedule in the year before symptom onset. A novel 'escape' rating for events was developed to test the Freudian theory that physical symptoms of CD could provide escape from stressors, a form of 'secondary gain'. CD patients had significantly more severe life events and 'escape' events than controls. In the month before symptom onset at least one severe event was identified in 56% of CD patients - significantly more than 21% of depression patients [odds ratio (OR) 4.63, 95% confidence interval (CI) 1.56-13.70] and healthy controls (OR 5.81, 95% CI 1.86-18.2). In the same time period 53% of CD patients had at least one 'high escape' event - again significantly higher than 14% in depression patients (OR 6.90, 95% CI 2.05-23.6) and 0% in healthy controls. Previous sexual abuse was more commonly reported in CD than controls, and in one third of female patients was contextually relevant to life events at symptom onset. The majority (88%) of life events of potential aetiological relevance were not identified by routine clinical assessments. Nine per cent of CD patients had no identifiable severe life events. Evidence was found supporting the psychological model of CD, the Freudian notion of escape and the potential aetiological relevance of childhood traumas in some patients. Uncovering stressors of potential aetiological relevance requires thorough psychosocial evaluation.
DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.
Directory of Open Access Journals (Sweden)
Adam J L Cook
2007-04-01
Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.
Coevolution of Siglec-11 and Siglec-16 via gene conversion in primates.
Hayakawa, Toshiyuki; Khedri, Zahra; Schwarz, Flavio; Landig, Corinna; Liang, Suh-Yuen; Yu, Hai; Chen, Xi; Fujito, Naoko T; Satta, Yoko; Varki, Ajit; Angata, Takashi
2017-11-23
Siglecs-11 and -16 are members of the sialic acid recognizing Ig-like lectin family, and expressed in same cells. Siglec-11 functions as an inhibitory receptor, whereas Siglec-16 exhibits activating properties. In humans, SIGLEC11 and SIGLEC16 gene sequences are extremely similar in the region encoding the extracellular domain due to gene conversions. Human SIGLEC11 was converted by the nonfunctional SIGLEC16P allele, and the converted SIGLEC11 allele became fixed in humans, possibly because it provides novel neuroprotective functions in brain microglia. However, the detailed evolutionary history of SIGLEC11 and SIGLEC16 in other primates remains unclear. We analyzed SIGLEC11 and SIGLEC16 gene sequences of multiple primate species, and examined glycan binding profiles of these Siglecs. The phylogenetic tree demonstrated that gene conversions between SIGLEC11 and SIGLEC16 occurred in the region including the exon encoding the sialic acid binding domain in every primate examined. Functional assays showed that glycan binding preference is similar between Siglec-11 and Siglec-16 in all analyzed hominid species. Taken together with the fact that Siglec-11 and Siglec-16 are expressed in the same cells, Siglec-11 and Siglec-16 are regarded as paired receptors that have maintained similar ligand binding preferences via gene conversions. Relaxed functional constraints were detected on the SIGLEC11 and SIGLEC16 exons that underwent gene conversions, possibly contributing to the evolutionary acceptance of repeated gene conversions. The frequency of nonfunctional SIGLEC16P alleles is much higher than that of SIGLEC16 alleles in every human population. Our findings indicate that Siglec-11 and Siglec-16 have been maintained as paired receptors by repeated gene conversions under relaxed functional constraints in the primate lineage. The high prevalence of the nonfunctional SIGLEC16P allele and the fixation of the converted SIGLEC11 imply that the loss of Siglec-16 and the gain of
Translational errors as an early event in prion conversion.
Hatin, I; Bidou, L; Cullin, C; Rousset, J P
2001-01-01
A prion is an infectious, altered form of a cellular protein which can self-propagate and affect normal phenotype. Prion conversion has been observed for mammalian and yeast proteins but molecular mechanisms that trigger this process remain unclear. Up to now, only post-translational models have been explored. In this work, we tested the hypothesis that co-translational events may be implicated in the conformation changes of the Ure2p protein of Saccharomyces cerevisiae. This protein can adopt a prion conformation leading to an [URE3] phenotype which can be easily assessed and quantified. We analyzed the effect of two antibiotics, known to affect translation, on [URE3] conversion frequency. For cells treated with G418 we observed a parallel increase of translational errors rate and frequency of [URE3] conversion. By contrast, cycloheximide which was not found to affect translational fidelity, has no influence on the induction of [URE3] phenotype. These results raise the possibility that the mechanism of prion conversion might not only involve alternative structures of strictly identical molecules but also aberrant proteins resulting from translational errors.
Revertant mosaicism in epidermolysis bullosa caused by mitotic gene conversion
Jonkman, MF; Scheffer, H; Stulp, R; Pas, HH; Nijenhuis, Albertine; Heeres, K; Owaribe, K; Pulkkinen, L; Uitto, J
1997-01-01
Mitotic gene conversion acting as reverse mutation has not been previously demonstrated in human. We report here that the revertant mosaicism of a compound heterozygous proband with an autosomal recessive genodermatosis, generalized atrophic benign epidermolysis bullosa, is caused by mitotic gene
Directory of Open Access Journals (Sweden)
Ross Kenneth
2011-02-01
Full Text Available Abstract Background During gene conversion, genetic information is transferred unidirectionally between highly homologous but non-allelic regions of DNA. While germ-line gene conversion has been implicated in the pathogenesis of some diseases, somatic gene conversion has remained technically difficult to investigate on a large scale. Methods A novel analysis technique is proposed for detecting the signature of somatic gene conversion from SNP microarray data. The Wellcome Trust Case Control Consortium has gathered SNP microarray data for two control populations and cohorts for bipolar disorder (BD, cardiovascular disease (CAD, Crohn's disease (CD, hypertension (HT, rheumatoid arthritis (RA, type-1 diabetes (T1D and type-2 diabetes (T2D. Using the new analysis technique, the seven disease cohorts are analyzed to identify cohort-specific SNPs at which conversion is predicted. The quality of the predictions is assessed by identifying known disease associations for genes in the homologous duplicons, and comparing the frequency of such associations with background rates. Results Of 28 disease/locus pairs meeting stringent conditions, 22 show various degrees of disease association, compared with only 8 of 70 in a mock study designed to measure the background association rate (P -9. Additional candidate genes are identified using less stringent filtering conditions. In some cases, somatic deletions appear likely. RA has a distinctive pattern of events relative to other diseases. Similarities in patterns are apparent between BD and HT. Conclusions The associations derived represent the first evidence that somatic gene conversion could be a significant causative factor in each of the seven diseases. The specific genes provide potential insights about disease mechanisms, and are strong candidates for further study. Please see Commentary: http://www.biomedcentral.com/1741-7015/9/13/abstract.
Zhang, J R; Norris, S J
1998-08-01
The Lyme disease spirochete Borrelia burgdorferi possesses 15 silent vls cassettes and a vls expression site (vlsE) encoding a surface-exposed lipoprotein. Segments of the silent vls cassettes have been shown to recombine with the vlsE cassette region in the mammalian host, resulting in combinatorial antigenic variation. Despite promiscuous recombination within the vlsE cassette region, the 5' and 3' coding sequences of vlsE that flank the cassette region are not subject to sequence variation during these recombination events. The segments of the silent vls cassettes recombine in the vlsE cassette region through a unidirectional process such that the sequence and organization of the silent vls loci are not affected. As a result of recombination, the previously expressed segments are replaced by incoming segments and apparently degraded. These results provide evidence for a gene conversion mechanism in VlsE antigenic variation.
Chen, H T; Alexander, C B; Mage, R G
1995-06-15
Normal rabbits preferentially rearrange the 3'-most VH gene, VH1, to encode Igs with VHa allotypes, which constitute the majority of rabbit serum Igs. A gene conversion-like mechanism is employed to diversify the primary Ab repertoire. In mutant Alicia rabbits that derived from a rabbit with VHa2 allotype, the VH1 gene was deleted. Our previous studies showed that the first functional gene (VH4) or VH4-like genes were rearranged in 2- to 8-wk-old homozygous Alicia. The VH1a2-like sequences that were found in splenic mRNA from 6-wk and older Alicia rabbits still had some residues that were typical of VH4. The appearances of sequences resembling that of VH1a2 may have been caused by gene conversions that altered the sequences of the rearranged VH or there may have been rearrangement of upstream VH1a2-like genes later in development. To investigate this further, we constructed a cosmid library and isolated a VH1a2-like gene, VH12-1-6, with a sequence almost identical to VH1a2. This gene had a deleted base in the heptamer of its recombination signal sequence. However, even if this defect diminished or eliminated its ability to rearrange, the a2-like gene could have acted as a donor for gene-conversion-like alteration of rearranged VH genes. Sequence comparisons suggested that this gene or a gene like it could have acted as a donor for gene conversion in mutant Alicia and in normal rabbits.
International Nuclear Information System (INIS)
Williamson, M.S.; Game, J.C.; Fogel, S.
1985-01-01
The PMS1 mutants, isolated on the basis of sharply elevated meiotic prototroph frequencies for two closely linked HIS4 alleles, display pleiotropic phenotypes in meiotic and mitotic cells. Two isolates carrying recessive mutations in PMS1 were characterized. They identify a function required to maintain low postmeiotic segregation (PMS) frequencies at many heterozygous sites. In addition, they are mitotic mutators. In mutant diploids, spore viability is reduced, and among survivors, gene conversion and postmeiotic segregation frequencies are increased, but reciprocal exchange frequencies are not affected. The conversion event pattern is also dramatically changed in multiply marked regions in PMS1 homozygotes. The PMS1 locus maps near MET4 on chromosome XIV. The PMS1 gene may identify an excision-resynthesis long patch mismatch correction function or a function that facilitates correction tract elongation. The PMS1 gene product may also play an important role in spontaneous mitotic mutation avoidance and correction of mismatches in heteroduplex DNA formed during spontaneous and UV-induced mitotic recombination. Based on meiotic recombination models emphasizing mismatch correction in heteroduplex DNA intermediates, this interpretation is favored, but alternative interpretations involving longer recombination intermediates in the mutants are also considered
Caffeine inhibits gene conversion by displacing Rad51 from ssDNA
Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.
2015-01-01
Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181
Spontaneous and radiation induced gene conversion in Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Rao, B.S.; Murthy, M.S.S.
1977-01-01
Spontaneous and radiation induced gene conversion to arginine independence was studied in a heteroallelic diploid strain of yeast Saccharomyces cerevisiae BZ 34. When stationary phase cells were incubated in phosphate buffer (pH 7 ) at 30 0 C under aerated condition for 48 hours, the conversion frequency increased by a factor of about 1000 times the background. This was found to be so even when the cells were incubated in saline (0.85%) or distilled water. Various conditions influencing this enhancement have been investigated. Conversion frequency enhancement was not significant under anoxic conditions and was absent at low temperatures and in log phase cells. Caffeine could inhibit this enhancement when present in the suspension medium. These results can be explained on the basis of the induction of meiosis in cells held in buffer. Microscopic examination confirmed this view. Under conditions not favourable for the onset of meiosis there is no significant enhancement in conversion frequency. In stationary phase cells exposed to series of gamma doses, the conversion frequency increases with dose. Post irradiation incubation in buffer further increases the conversion frequency. However, the increase expressed as the ratio of the conversion frequency on buffer holding to that on immediate plating decreased with increasing dose. This decrease in enhancement with increasing dose may be due to the dose dependent inhibition of meiosis. (author)
1000 human genomes carry widespread signatures of GC biased gene conversion.
Dutta, Rajib; Saha-Mandal, Arnab; Cheng, Xi; Qiu, Shuhao; Serpen, Jasmine; Fedorova, Larisa; Fedorov, Alexei
2018-04-16
GC-Biased Gene Conversion (gBGC) is one of the important theories put forward to explain profound long-range non-randomness in nucleotide compositions along mammalian chromosomes. Nucleotide changes due to gBGC are hard to distinguish from regular mutations. Here, we present an algorithm for analysis of millions of known SNPs that detects a subset of so-called "SNP flip-over" events representing recent gBGC nucleotide changes, which occurred in previous generations via non-crossover meiotic recombination. This algorithm has been applied in a large-scale analysis of 1092 sequenced human genomes. Altogether, 56,328 regions on all autosomes have been examined, which revealed 223,955 putative gBGC cases leading to SNP flip-overs. We detected a strong bias (11.7% ± 0.2% excess) in AT- > GC over GC- > AT base pair changes within the entire set of putative gBGC cases. On average, a human gamete acquires 7 SNP flip-over events, in which one allele is replaced by its complementary allele during the process of meiotic non-crossover recombination. In each meiosis event, on average, gBGC results in replacement of 7 AT base pairs by GC base pairs, while only 6 GC pairs are replaced by AT pairs. Therefore, every human gamete is enriched by one GC pair. Happening over millions of years of evolution, this bias may be a noticeable force in changing the nucleotide composition landscape along chromosomes.
Conversion of homothallic yeast to heterothallism trough HO gene disruption
CSIR Research Space (South Africa)
Van Zyl, WH
1993-04-01
Full Text Available A simple method was developed for the conversion of homothallic Saccharomyces cerevisiae yeaststrains to heterothallism through HO gene disruption. An integrative ho:: neo disrupted allele was constructed by cloning a dominant selectable marker...
International Nuclear Information System (INIS)
Wiese, Claudia; Pierce, Andrew J.; Gauny, Stacey S.; Jasin, Maria; Kronenberg, Amy
2001-01-01
Homology-directed repair (HDR) of DNA double-strand breaks (DSBs) is a well-established mechanism that contributes to the maintenance of genomic stability in rodent cells, and it has been assumed that HDR is of similar importance in the repair of DSBs in human cells. However, in addition to promoting genomic stability, some outcomes of homologous recombination can be deleterious, suggesting that factors exist to regulate HDR. We previously demonstrated that overexpression of BCL-2 or BCL-xL enhanced the frequency of x-ray-induced mutations involving the TK1 locus, including loss of heterozygosity (LOH) events presumed to arise by mitotic recombination. The present study was designed to test whether HDR is a prominent DSB repair pathway in human cells, and to directly determine whether ectopic expression of BCL-xL affects HDR. We used the B-lymphoblastoid cell line TK6, which expresses wild-type TP53 and resembles normal lymphocytes in undergoing apoptosis following genotoxic stress. U sing isogenic derivatives of TK6 cells (TK6-neo, TK6-bcl-xL), we find that a DSB in an integrated HDR reporter stimulates gene conversion 40-50-fold in TK6-neo cells, demonstrating that a DSB can be efficiently repaired by gene conversion in human cells. Significantly, DSB-induced gene conversion events are 3- to 4-fold more frequent in BCL-xL overexpressing cells. The results demonstrate that HDR plays an important role in maintaining genomic integrity in human cells and that ectopic expression of BCL-xL enhances HDR of DSBs. To our knowledge, this is the first study to highlight a function for BCL-xL in modulating DSB repair in human cells
Self-Exciting Point Process Modeling of Conversation Event Sequences
Masuda, Naoki; Takaguchi, Taro; Sato, Nobuo; Yano, Kazuo
Self-exciting processes of Hawkes type have been used to model various phenomena including earthquakes, neural activities, and views of online videos. Studies of temporal networks have revealed that sequences of social interevent times for individuals are highly bursty. We examine some basic properties of event sequences generated by the Hawkes self-exciting process to show that it generates bursty interevent times for a wide parameter range. Then, we fit the model to the data of conversation sequences recorded in company offices in Japan. In this way, we can estimate relative magnitudes of the self excitement, its temporal decay, and the base event rate independent of the self excitation. These variables highly depend on individuals. We also point out that the Hawkes model has an important limitation that the correlation in the interevent times and the burstiness cannot be independently modulated.
Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing
2007-11-01
Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.
Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R
2000-06-01
We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N
International Nuclear Information System (INIS)
Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.
2015-01-01
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Energy Technology Data Exchange (ETDEWEB)
Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)
2015-11-27
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Disruptive Event Biosphere Doser Conversion Factor Analysis
Energy Technology Data Exchange (ETDEWEB)
M. Wasiolek
2000-12-28
The purpose of this report was to document the process leading to, and the results of, development of radionuclide-, exposure scenario-, and ash thickness-specific Biosphere Dose Conversion Factors (BDCFs) for the postulated postclosure extrusive igneous event (volcanic eruption) at Yucca Mountain. BDCF calculations were done for seventeen radionuclides. The selection of radionuclides included those that may be significant dose contributors during the compliance period of up to 10,000 years, as well as radionuclides of importance for up to 1 million years postclosure. The approach documented in this report takes into account human exposure during three different phases at the time of, and after, volcanic eruption. Calculations of disruptive event BDCFs used the GENII-S computer code in a series of probabilistic realizations to propagate the uncertainties of input parameters into the output. The pathway analysis included consideration of different exposure pathway's contribution to the BDCFs. BDCFs for volcanic eruption, when combined with the concentration of radioactivity deposited by eruption on the soil surface, allow calculation of potential radiation doses to the receptor of interest. Calculation of radioactivity deposition is outside the scope of this report and so is the transport of contaminated ash from the volcano to the location of the receptor. The integration of the biosphere modeling results (BDCFs) with the outcomes of the other component models is accomplished in the Total System Performance Assessment (TSPA), in which doses are calculated to the receptor of interest from radionuclides postulated to be released to the environment from the potential repository at Yucca Mountain.
Directory of Open Access Journals (Sweden)
Lingli Zhang
2017-04-01
Full Text Available The Aegilops kotschyi thermo-sensitive cytoplasmic male sterility (K-TCMS system may facilitate hybrid wheat (Triticum aestivum L. seed multiplication and production. The K-TCMS line is completely male sterile during the normal wheat-growing season, whereas its fertility can be restored in a high-temperature environment. To elucidate the molecular mechanisms responsible for male sterility/fertility conversion and candidate genes involved with pollen development in K-TCMS, we employed RNA-seq to sequence the transcriptomes of anthers from K-TCMS line KTM3315A during development under sterile and fertile conditions. We identified 16840 differentially expressed genes (DEGs in different stages including15157 known genes (15135 nuclear genes and 22 plasmagenes and 1683 novel genes. Bioinformatics analysis identified possible metabolic pathways involved with fertility based on KEGG pathway enrichment of the DEGs expressed in fertile and sterile plants. We found that most of the genes encoding key enzyme in the phenylpropanoid biosynthesis and jasmonate biosynthesis pathways were significant upregulated in uninucleate, binuclate or trinucleate stage, which both interact with MYB transcription factors, and that link between all play essential roles in fertility conversion. The relevant DEGs were verified by quantitative RT-PCR. Thus, we suggested that phenylpropanoid biosynthesis and jasmonate biosynthesis pathways were involved in fertility conversion of K-TCMS wheat. This will provide a new perspective and an effective foundation for the research of molecular mechanisms of fertility conversion of CMS wheat. Fertility conversion mechanism in thermo-sensitive cytoplasmic male sterile/fertile wheat involves the phenylpropanoid biosynthesis pathway, jasmonate biosynthesis pathway, and MYB transcription factors.
Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T
2015-11-27
Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.
Karn, Robert C; Laukaitis, Christina M
2012-01-01
Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.
Directory of Open Access Journals (Sweden)
Yi Yin
2013-10-01
Full Text Available In the yeast Saccharomyces cerevisiae and most other eukaryotes, mitotic recombination is important for the repair of double-stranded DNA breaks (DSBs. Mitotic recombination between homologous chromosomes can result in loss of heterozygosity (LOH. In this study, LOH events induced by ultraviolet (UV light are mapped throughout the genome to a resolution of about 1 kb using single-nucleotide polymorphism (SNP microarrays. UV doses that have little effect on the viability of diploid cells stimulate crossovers more than 1000-fold in wild-type cells. In addition, UV stimulates recombination in G1-synchronized cells about 10-fold more efficiently than in G2-synchronized cells. Importantly, at high doses of UV, most conversion events reflect the repair of two sister chromatids that are broken at approximately the same position whereas at low doses, most conversion events reflect the repair of a single broken chromatid. Genome-wide mapping of about 380 unselected crossovers, break-induced replication (BIR events, and gene conversions shows that UV-induced recombination events occur throughout the genome without pronounced hotspots, although the ribosomal RNA gene cluster has a significantly lower frequency of crossovers.
van Beek, J.H.G.M.; Supandi, F.B.; Gavai, Anand; de Graaf, A.A.; Binsl, T.W.; Hettling, H.
2011-01-01
The human physiological system is stressed to its limits during endurance sports competition events.We describe a whole body computational model for energy conversion during bicycle racing. About 23 per cent of the metabolic energy is used for muscle work, the rest is converted to heat. We
Beek, J.H.G.M. van; Supandi, F.; Gavai, A.K.; Graaf, A.A. de; Binsl, T.W.; Hettling, H.
2011-01-01
The human physiological system is stressed to its limits during endurance sports competition events.We describe a whole body computational model for energy conversion during bicycle racing. About 23 per cent of the metabolic energy is used for muscle work, the rest is converted to heat. We
Alteration of gene conversion patterns in Sordaria fimicola by supplementation with DNA bases.
Kitani, Y; Olive, L S
1970-08-01
Supplementation with DNA bases in crosses of Sordaria fimicola heterozygous for spore color markers (g(1), h(2)) within the gray-spore (g) locus has been found to cause significant alterations in patterns of gene conversion at the two mutant sites. Each base had its own characteristic effect in altering the conversion pattern, and responses of the two mutant sites to the four bases were different in several ways. Also, the responses of the two involved chromatids of the meiotic bivalent were different.
Disruptive Event Biosphere Dose Conversion Factor Analysis
Energy Technology Data Exchange (ETDEWEB)
M. A. Wasiolek
2003-07-21
This analysis report, ''Disruptive Event Biosphere Dose Conversion Factor Analysis'', is one of the technical reports containing documentation of the ERMYN (Environmental Radiation Model for Yucca Mountain Nevada) biosphere model for the geologic repository at Yucca Mountain, its input parameters, and the application of the model to perform the dose assessment for the repository. The biosphere model is one of a series of process models supporting the Total System Performance Assessment (TSPA) for the Yucca Mountain repository. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of the two reports that develop biosphere dose conversion factors (BDCFs), which are input parameters for the TSPA model. The ''Biosphere Model Report'' (BSC 2003 [DIRS 164186]) describes in detail the conceptual model as well as the mathematical model and lists its input parameters. Model input parameters are developed and described in detail in five analysis report (BSC 2003 [DIRS 160964], BSC 2003 [DIRS 160965], BSC 2003 [DIRS 160976], BSC 2003 [DIRS 161239], and BSC 2003 [DIRS 161241]). The objective of this analysis was to develop the BDCFs for the volcanic ash exposure scenario and the dose factors (DFs) for calculating inhalation doses during volcanic eruption (eruption phase of the volcanic event). The volcanic ash exposure scenario is hereafter referred to as the volcanic ash scenario. For the volcanic ash scenario, the mode of radionuclide release into the biosphere is a volcanic eruption through the repository with the resulting entrainment of contaminated waste in the tephra and the subsequent atmospheric transport and dispersion of contaminated material in
Disruptive Event Biosphere Dose Conversion Factor Analysis
International Nuclear Information System (INIS)
M. A. Wasiolek
2003-01-01
This analysis report, ''Disruptive Event Biosphere Dose Conversion Factor Analysis'', is one of the technical reports containing documentation of the ERMYN (Environmental Radiation Model for Yucca Mountain Nevada) biosphere model for the geologic repository at Yucca Mountain, its input parameters, and the application of the model to perform the dose assessment for the repository. The biosphere model is one of a series of process models supporting the Total System Performance Assessment (TSPA) for the Yucca Mountain repository. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of the two reports that develop biosphere dose conversion factors (BDCFs), which are input parameters for the TSPA model. The ''Biosphere Model Report'' (BSC 2003 [DIRS 164186]) describes in detail the conceptual model as well as the mathematical model and lists its input parameters. Model input parameters are developed and described in detail in five analysis report (BSC 2003 [DIRS 160964], BSC 2003 [DIRS 160965], BSC 2003 [DIRS 160976], BSC 2003 [DIRS 161239], and BSC 2003 [DIRS 161241]). The objective of this analysis was to develop the BDCFs for the volcanic ash exposure scenario and the dose factors (DFs) for calculating inhalation doses during volcanic eruption (eruption phase of the volcanic event). The volcanic ash exposure scenario is hereafter referred to as the volcanic ash scenario. For the volcanic ash scenario, the mode of radionuclide release into the biosphere is a volcanic eruption through the repository with the resulting entrainment of contaminated waste in the tephra and the subsequent atmospheric transport and dispersion of contaminated material in the biosphere. The biosphere process
Disruptive Event Biosphere Dose Conversion Factor Analysis
Energy Technology Data Exchange (ETDEWEB)
M. Wasiolek
2004-09-08
This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the total system performance assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the volcanic ash exposure scenario, and the development of dose factors for calculating inhalation dose during volcanic eruption. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the Biosphere Model Report in Figure 1-1, contain detailed descriptions of the model input parameters, their development and the relationship between the parameters and specific features, events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the volcanic ash exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and from the five analyses that develop parameter values for the biosphere model (BSC 2004 [DIRS 169671]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; and BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis''. The objective of this
Disruptive Event Biosphere Dose Conversion Factor Analysis
International Nuclear Information System (INIS)
M. Wasiolek
2004-01-01
This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the total system performance assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the volcanic ash exposure scenario, and the development of dose factors for calculating inhalation dose during volcanic eruption. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the Biosphere Model Report in Figure 1-1, contain detailed descriptions of the model input parameters, their development and the relationship between the parameters and specific features, events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the volcanic ash exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and from the five analyses that develop parameter values for the biosphere model (BSC 2004 [DIRS 169671]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; and BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis''. The objective of this analysis was to develop the BDCFs for the volcanic ash
DISRUPTIVE EVENT BIOSPHERE DOSE CONVERSION FACTOR ANALYSIS
International Nuclear Information System (INIS)
M.A. Wasiolek
2005-01-01
This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the total system performance assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the volcanic ash exposure scenario, and the development of dose factors for calculating inhalation dose during volcanic eruption. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA model. The Biosphere Model Report (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the Biosphere Model Report in Figure 1-1, contain detailed descriptions of the model input parameters, their development and the relationship between the parameters and specific features, events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the volcanic ash exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and from the five analyses that develop parameter values for the biosphere model (BSC 2005 [DIRS 172827]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; and BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis'' (Figure 1-1). The objective of this analysis was to develop the BDCFs for the volcanic
STRIDE: Species Tree Root Inference from Gene Duplication Events.
Emms, David M; Kelly, Steven
2017-12-01
The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Tigst Demeke
2018-05-01
Full Text Available Droplet digital PCR (ddPCR has been used for absolute quantification of genetically engineered (GE events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences (HMG-I/Y, FatA(A, CruA and Ccf for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A, reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes. Keywords: Canola, Digital PCR, DNA extraction, GMO, Reference genes
Signals of historical interlocus gene conversion in human segmental duplications.
Directory of Open Access Journals (Sweden)
Beth L Dumont
Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.
Demeke, Tigst; Eng, Monika
2018-05-01
Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.
Computational challenges in modeling gene regulatory events.
Pataskar, Abhijeet; Tiwari, Vijay K
2016-10-19
Cellular transcriptional programs driven by genetic and epigenetic mechanisms could be better understood by integrating "omics" data and subsequently modeling the gene-regulatory events. Toward this end, computational biology should keep pace with evolving experimental procedures and data availability. This article gives an exemplified account of the current computational challenges in molecular biology.
Effect of methyl-β-cyclodextrin on gene expression in microbial conversion of phytosterol.
Shtratnikova, Victoria Y; Schelkunov, Mikhail I; Dovbnya, Dmitry V; Bragin, Eugeny Y; Donova, Marina V
2017-06-01
Modified β-cyclodextrins are widely used for the enhancement of microbial conversions of lipophilic compounds such as steroids. Multiple mechanisms of cyclodextrin-mediated enhancement of phytosterol bioconversion by mycobacteria had previously been shown to include steroid solubilization, alterations in the cell wall permeability for both steroids and nutrients, facilitation of protein leaking, and activity suppression of some steroid-transforming enzymes.In this work, we studied whether cyclodextrins might affect expression of the genes involved in the steroid catabolic pathway. Phytosterol bioconversion with 9α-hydroxy-androst-4-ene-3,17-dione accumulation by Mycobacterium sp. VKM Ac-1817D in the presence of methylated β-cyclodextrin (MCD) was investigated. RNA sequencing of the whole transcriptomes in different combinations of phytosterol and MCD showed a similar expression level of the steroid catabolism genes related to the KstR-regulon and was responsible for side chain and initial steps of steroid core oxidation; whereas, induction levels of the genes related to the KstR2-regulon were attenuated in the presence of MCD in this strain. The data were attenuated with quantitative real-time PCR.The results contribute to the understanding of cyclodextrin effects on microbial steroid conversion and provide a basis for the use of cyclodextrins as expression enhancers for studies of sterol catabolism in actinobacteria.
Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K
2017-04-01
There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.
Gros, P.; Bernard, D.
2017-02-01
We benchmark various available event generators in Geant4 and EGS5 in the light of ongoing projects for high angular-resolution pair-conversion telescopes at low energy. We compare the distributions of key kinematic variables extracted from the geometry of the three final state particles. We validate and use as reference an exact generator using the full 5D differential cross-section of the conversion process. We focus in particular on the effect of the unmeasured recoiling nucleus on the angular resolution. We show that for high resolution trackers, the choice of the generator affects the estimated resolution of the telescope. We also show that the current available generator are unable to describe accurately a linearly polarised photon source.
Ross, Kenneth Andrew
2011-02-03
During gene conversion, genetic information is transferred unidirectionally between highly homologous but non-allelic regions of DNA. While germ-line gene conversion has been implicated in the pathogenesis of some diseases, somatic gene conversion has remained technically difficult to investigate on a large scale. A novel analysis technique is proposed for detecting the signature of somatic gene conversion from SNP microarray data. The Wellcome Trust Case Control Consortium has gathered SNP microarray data for two control populations and cohorts for bipolar disorder (BD), cardiovascular disease (CAD), Crohn's disease (CD), hypertension (HT), rheumatoid arthritis (RA), type-1 diabetes (T1D) and type-2 diabetes (T2D). Using the new analysis technique, the seven disease cohorts are analyzed to identify cohort-specific SNPs at which conversion is predicted. The quality of the predictions is assessed by identifying known disease associations for genes in the homologous duplicons, and comparing the frequency of such associations with background rates. Of 28 disease/locus pairs meeting stringent conditions, 22 show various degrees of disease association, compared with only 8 of 70 in a mock study designed to measure the background association rate (P conversion could be a significant causative factor in each of the seven diseases. The specific genes provide potential insights about disease mechanisms, and are strong candidates for further study.
Conservation of transcription factor binding events predicts gene expression across species
Hemberg, Martin; Kreiman, Gabriel
2011-01-01
Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to function, defined as expression of the target genes. We show that (i) there is a significantly higher degree of conservation of TFBEs when the target gene is expressed in both species; (ii) there is increased conservation of binding events for groups of TFs compared to individual TFs; and (iii) conserved TFBEs have a greater impact on the expression of their target genes than non-conserved ones. These results link conservation of structural elements (TFBEs) to conservation of function (gene expression) and suggest a higher degree of functional conservation than implied by previous studies. PMID:21622661
Saleem, M; Lamb, B C; Nevo, E
2001-12-01
Recombination generates new combinations of existing genetic variation and therefore may be important in adaptation and evolution. We investigated whether there was natural genetic variation for recombination frequencies and whether any such variation was environment related and possibly adaptive. Crossing over and gene conversion frequencies often differed significantly in a consistent direction between wild strains of the fungus Sordaria fimicola isolated from a harsher or a milder microscale environment in "Evolution Canyon," Israel. First- and second-generation descendants from selfing the original strains from the harsher, more variable, south-facing slope had higher frequencies of crossing over in locus-centromere intervals and of gene conversion than those from the lusher north-facing slopes. There were some significant differences between strains within slopes, but these were less marked than between slopes. Such inherited variation could provide a basis for natural selection for optimum recombination frequencies in each environment. There were no significant differences in meiotic hybrid DNA correction frequencies between strains from the different slopes. The conversion analysis was made using only conversions to wild type, because estimations of conversion to mutant were affected by a high frequency of spontaneous mutation. There was no polarized segregation of chromosomes at meiosis I or of chromatids at meiosis II.
Predictability of Conversation Partners
Takaguchi, Taro; Nakamura, Mitsuhiro; Sato, Nobuo; Yano, Kazuo; Masuda, Naoki
2011-08-01
Recent developments in sensing technologies have enabled us to examine the nature of human social behavior in greater detail. By applying an information-theoretic method to the spatiotemporal data of cell-phone locations, [C. Song , ScienceSCIEAS0036-8075 327, 1018 (2010)] found that human mobility patterns are remarkably predictable. Inspired by their work, we address a similar predictability question in a different kind of human social activity: conversation events. The predictability in the sequence of one’s conversation partners is defined as the degree to which one’s next conversation partner can be predicted given the current partner. We quantify this predictability by using the mutual information. We examine the predictability of conversation events for each individual using the longitudinal data of face-to-face interactions collected from two company offices in Japan. Each subject wears a name tag equipped with an infrared sensor node, and conversation events are marked when signals are exchanged between sensor nodes in close proximity. We find that the conversation events are predictable to a certain extent; knowing the current partner decreases the uncertainty about the next partner by 28.4% on average. Much of the predictability is explained by long-tailed distributions of interevent intervals. However, a predictability also exists in the data, apart from the contribution of their long-tailed nature. In addition, an individual’s predictability is correlated with the position of the individual in the static social network derived from the data. Individuals confined in a community—in the sense of an abundance of surrounding triangles—tend to have low predictability, and those bridging different communities tend to have high predictability.
Predictability of Conversation Partners
Directory of Open Access Journals (Sweden)
Taro Takaguchi
2011-09-01
Full Text Available Recent developments in sensing technologies have enabled us to examine the nature of human social behavior in greater detail. By applying an information-theoretic method to the spatiotemporal data of cell-phone locations, [C. Song et al., Science 327, 1018 (2010SCIEAS0036-8075] found that human mobility patterns are remarkably predictable. Inspired by their work, we address a similar predictability question in a different kind of human social activity: conversation events. The predictability in the sequence of one’s conversation partners is defined as the degree to which one’s next conversation partner can be predicted given the current partner. We quantify this predictability by using the mutual information. We examine the predictability of conversation events for each individual using the longitudinal data of face-to-face interactions collected from two company offices in Japan. Each subject wears a name tag equipped with an infrared sensor node, and conversation events are marked when signals are exchanged between sensor nodes in close proximity. We find that the conversation events are predictable to a certain extent; knowing the current partner decreases the uncertainty about the next partner by 28.4% on average. Much of the predictability is explained by long-tailed distributions of interevent intervals. However, a predictability also exists in the data, apart from the contribution of their long-tailed nature. In addition, an individual’s predictability is correlated with the position of the individual in the static social network derived from the data. Individuals confined in a community—in the sense of an abundance of surrounding triangles—tend to have low predictability, and those bridging different communities tend to have high predictability.
International Nuclear Information System (INIS)
De Bertoldi, M.; Griselli, M.; Consiglio Nazionale delle Ricerche, Pisa; Barale, R.
1980-01-01
The wide variety of the genetic alterations produced by environmental mutagens has increased the necessity of using experimental microorganisms to reveal the induction of such genetic events with short-term tests. Aspergillus nidulans, because of its well-developed genetic system and the availability of morphological markers seay to score, can be profitably used in mutagen testing. The constitution of particular diploid strains of A. nidulans able to detect the induction of mitotic gene conversion, mitotic crossing-over and mitotic non-disjunction with selective procedures are described and validated with standard mutagens: methyl methanesulphonate and UV radiation (lacking a specific genetic activity), benomyl and p-fluorophenylalanine (with a specific genetic activity). The possibility of using mammalian metabolic activation of promutagens in A. nidulans in vitro was tested with cyclophosphamide, with positive results in all the tested genetic systems. A method that increases the sensitivity of conidia to mutagenic treatments is described; its application appeared to be particularly useful in experiments on crossing-over and non-disjunction. (orig.)
Studies on the induction of mitotic gene conversion by ultraviolet irradiation
International Nuclear Information System (INIS)
Ito, T.; Kobayashi, K.
1975-01-01
Action spectra for the induction of intragenic mitotic recombination (gene conversion) at the trp 5 locus by UV are presented for three cell stages (T 0 , T 9 and T 16 ) taken from synchronously growing cultures of Saccharomyces cerevisiae. The spectra over the range from 230 to 300 nm were taken mostly in 5-nm steps. The peak in the action spectra was significantly shifted, regardless of the stage, towards the longer wavelengths as compared with that of the absorption spectrum of DNA (258nm) or even that of thymine (265nm). In one extreme case ( 16 ), the peak was shifted 17nm from the absorption peak of DNA. Further, the spectrum changed its shape as the cell stage advanced from the non-dividing (unbudded) (T 0 ) to a dividing phase (T 16 ). Furthermore, the induction cross section decreased by a large factor (about 40), regardless of the wavelength, in going from the non-dividing to a dividing phase. From observations of the high photoreversibility of induced conversions, the major primary damage was thought to be pyrimidine dimers in the DNA
Directory of Open Access Journals (Sweden)
Mitsuru Ando
2014-01-01
Full Text Available Sustained gene delivery of interferon (IFN γ can be an effective treatment, but our previous study showed high levels of IFNγ-induced adverse events, including the loss of body weight. These unwanted events could be reduced by target-specific delivery of IFNγ after in vivo gene transfer. To achieve this, we selected the heparin-binding domain (HBD of extracellular superoxide dismutase as a molecule to anchor IFNγ to the cell surface. We designed three IFNγ derivatives, IFNγ-HBD1, IFNγ-HBD2, and IFNγ-HBD3, each of which had 1, 2, or 3 HBDs, respectively. Each plasmid-encoding fusion proteins was delivered to the liver, a model target in this study, by hydrodynamic tail vein injection. The serum concentration of IFNγ-HBD2 and IFNγ-HBD3 after gene delivery was lower than that of IFNγ or IFNγ-HBD1. Gene delivery of IFNγ-HBD2, but not of IFNγ-HBD3, effectively increased the mRNA expression of IFNγ-inducible genes in the liver, suggesting liver-specific distribution of IFNγ-HBD2. Gene delivery of IFNγ-HBD2-suppressed tumor growth in the liver as efficiently as that of IFNγ with much less symptoms of adverse effects. These results indicate that the adverse events of IFNγ gene transfer can be prevented by gene delivery of IFNγ-HBD2, a fusion protein with high cell surface affinity.
Gene-Tree Reconciliation with MUL-Trees to Resolve Polyploidy Events.
Gregg, W C Thomas; Ather, S Hussain; Hahn, Matthew W
2017-11-01
Polyploidy can have a huge impact on the evolution of species, and it is a common occurrence, especially in plants. The two types of polyploids-autopolyploids and allopolyploids-differ in the level of divergence between the genes that are brought together in the new polyploid lineage. Because allopolyploids are formed via hybridization, the homoeologous copies of genes within them are at least as divergent as orthologs in the parental species that came together to form them. This means that common methods for estimating the parental lineages of allopolyploidy events are not accurate, and can lead to incorrect inferences about the number of gene duplications and losses. Here, we have adapted an algorithm for topology-based gene-tree reconciliation to work with multi-labeled trees (MUL-trees). By definition, MUL-trees have some tips with identical labels, which makes them a natural representation of the genomes of polyploids. Using this new reconciliation algorithm we can: accurately place allopolyploidy events on a phylogeny, identify the parental lineages that hybridized to form allopolyploids, distinguish between allo-, auto-, and (in most cases) no polyploidy, and correctly count the number of duplications and losses in a set of gene trees. We validate our method using gene trees simulated with and without polyploidy, and revisit the history of polyploidy in data from the clades including both baker's yeast and bread wheat. Our re-analysis of the yeast data confirms the allopolyploid origin and parental lineages previously identified for this group. The method presented here should find wide use in the growing number of genomes from species with a history of polyploidy. [Polyploidy; reconciliation; whole-genome duplication.]. © The Author(s) 2017. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A
2015-06-08
The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Escape Excel: A tool for preventing gene symbol and accession conversion errors.
Welsh, Eric A; Stewart, Paul A; Kuenzi, Brent M; Eschrich, James A
2017-01-01
Microsoft Excel automatically converts certain gene symbols, database accessions, and other alphanumeric text into dates, scientific notation, and other numerical representations. These conversions lead to subsequent, irreversible, corruption of the imported text. A recent survey of popular genomic literature estimates that one-fifth of all papers with supplementary gene lists suffer from this issue. Here, we present an open-source tool, Escape Excel, which prevents these erroneous conversions by generating an escaped text file that can be safely imported into Excel. Escape Excel is implemented in a variety of formats (http://www.github.com/pstew/escape_excel), including a command line based Perl script, a Windows-only Excel Add-In, an OS X drag-and-drop application, a simple web-server, and as a Galaxy web environment interface. Test server implementations are accessible as a Galaxy interface (http://apostl.moffitt.org) and simple non-Galaxy web server (http://apostl.moffitt.org:8000/). Escape Excel detects and escapes a wide variety of problematic text strings so that they are not erroneously converted into other representations upon importation into Excel. Examples of problematic strings include date-like strings, time-like strings, leading zeroes in front of numbers, and long numeric and alphanumeric identifiers that should not be automatically converted into scientific notation. It is hoped that greater awareness of these potential data corruption issues, together with diligent escaping of text files prior to importation into Excel, will help to reduce the amount of Excel-corrupted data in scientific analyses and publications.
Directory of Open Access Journals (Sweden)
Tsutomu Motohashi
2016-03-01
Full Text Available Neural crest cells (NC cells are multipotent cells that emerge from the edge of the neural folds and migrate throughout the developing embryo. Although the gene regulatory network for generation of NC cells has been elucidated in detail, it has not been revealed which of the factors in the network are pivotal to directing NC identity. In this study we analyzed the gene expression profile of a pure NC subpopulation isolated from Sox10-IRES-Venus mice and investigated whether these genes played a key role in the direct conversion of Sox10-IRES-Venus mouse embryonic fibroblasts (MEFs into NC cells. The comparative molecular profiles of NC cells and neural tube cells in 9.5-day embryos revealed genes including transcription factors selectively expressed in developing trunk NC cells. Among 25 NC cell-specific transcription factor genes tested, SOX10 and SOX9 were capable of converting MEFs into SOX10-positive (SOX10+ cells. The SOX10+ cells were then shown to differentiate into neurons, glial cells, smooth muscle cells, adipocytes and osteoblasts. These SOX10+ cells also showed limited self-renewal ability, suggesting that SOX10 and SOX9 directly converted MEFs into NC cells. Conversely, the remaining transcription factors, including well-known NC cell specifiers, were unable to convert MEFs into SOX10+ NC cells. These results suggest that SOX10 and SOX9 are the key factors necessary for the direct conversion of MEFs into NC cells.
Melis, Anastasios; Mitra, Mautusi
2010-06-29
The invention provides method and compositions to minimize the chlorophyll antenna size of photosynthesis by decreasing TLA1 gene expression, thereby improving solar conversion efficiencies and photosynthetic productivity in plants, e.g., green microalgae, under bright sunlight conditions.
Directory of Open Access Journals (Sweden)
Rebekah L Blakemore
Full Text Available OBJECTIVE: Conversion paresis patients and healthy people feigning weakness both exhibit weak voluntary movement without detectable neuropathology. Uniquely, conversion patients lack a sense of conscious awareness of the origin of their impairment. We investigated whether conversion paresis patients show distinct electroencephalographic (EEG markers associated with their unconscious movement deficits. METHODS: Six unilateral upper limb conversion paresis patients, 12 feigning participants asked to mimic weakness and 12 control participants performed a precued reaction time task, requiring movements of either hand, depending on precue information. Performance measures (force, reaction and movement time, and event-related EEG potentials (ERP were compared, between groups and across hands or hemisphere, using linear mixed models. RESULTS: Feigners generated the same inter-hand difference in reaction and movement time as expressed by patients, even though no specific targets were set nor feedback given on these measures. We found novel ERP signatures specific to patients. When the symptomatic hand was precued, the P3 ERP component accompanying the precue was dramatically larger in patients than in feigning participants. Additionally, in patients the earlier N1 ERP component was diminished when the precue signalled either the symptomatic or asymptomatic hand. CONCLUSIONS: These results are consistent with previous suggestions that lack of awareness of the origin of their symptoms in conversion disorder patients may result from suppression of brain activity normally related to self-agency. In patients the diminished N1 to all precues is consistent with a generalised reduction in cognitive processing of movement-related precues. The P3 enhancement in patients is unlikely to simply reflect changes required for generation of impaired movements, because it was not seen in feigners showing the same behavioural deficits. Rather, this P3 enhancement in
Yasukochi, Yoshiki; Satta, Yoko
2015-01-01
The human cytochrome P450 (CYP) 2D6 gene is a member of the CYP2D gene subfamily, along with the CYP2D7P and CYP2D8P pseudogenes. Although the CYP2D6 enzyme has been studied extensively because of its clinical importance, the evolution of the CYP2D subfamily has not yet been fully understood. Therefore, the goal of this study was to reveal the evolutionary process of the human drug metabolic system. Here, we investigate molecular evolution of the CYP2D subfamily in primates by comparing 14 CYP2D sequences from humans to New World monkey genomes. Window analysis and statistical tests revealed that entire genomic sequences of paralogous genes were extensively homogenized by gene conversion during molecular evolution of CYP2D genes in primates. A neighbor-joining tree based on genomic sequences at the nonsubstrate recognition sites showed that CYP2D6 and CYP2D8 genes were clustered together due to gene conversion. In contrast, a phylogenetic tree using amino acid sequences at substrate recognition sites did not cluster the CYP2D6 and CYP2D8 genes, suggesting that the functional constraint on substrate specificity is one of the causes for purifying selection at the substrate recognition sites. Our results suggest that the CYP2D gene subfamily in primates has evolved to maintain the regioselectivity for a substrate hydroxylation activity between individual enzymes, even though extensive gene conversion has occurred across CYP2D coding sequences. PMID:25808902
Rueckauer, Bodo; Lungu, Iulia-Alexandra; Hu, Yuhuang; Pfeiffer, Michael; Liu, Shih-Chii
2017-01-01
Spiking neural networks (SNNs) can potentially offer an efficient way of doing inference because the neurons in the networks are sparsely activated and computations are event-driven. Previous work showed that simple continuous-valued deep Convolutional Neural Networks (CNNs) can be converted into accurate spiking equivalents. These networks did not include certain common operations such as max-pooling, softmax, batch-normalization and Inception-modules. This paper presents spiking equivalents of these operations therefore allowing conversion of nearly arbitrary CNN architectures. We show conversion of popular CNN architectures, including VGG-16 and Inception-v3, into SNNs that produce the best results reported to date on MNIST, CIFAR-10 and the challenging ImageNet dataset. SNNs can trade off classification error rate against the number of available operations whereas deep continuous-valued neural networks require a fixed number of operations to achieve their classification error rate. From the examples of LeNet for MNIST and BinaryNet for CIFAR-10, we show that with an increase in error rate of a few percentage points, the SNNs can achieve more than 2x reductions in operations compared to the original CNNs. This highlights the potential of SNNs in particular when deployed on power-efficient neuromorphic spiking neuron chips, for use in embedded applications.
Directory of Open Access Journals (Sweden)
Bodo Rueckauer
2017-12-01
Full Text Available Spiking neural networks (SNNs can potentially offer an efficient way of doing inference because the neurons in the networks are sparsely activated and computations are event-driven. Previous work showed that simple continuous-valued deep Convolutional Neural Networks (CNNs can be converted into accurate spiking equivalents. These networks did not include certain common operations such as max-pooling, softmax, batch-normalization and Inception-modules. This paper presents spiking equivalents of these operations therefore allowing conversion of nearly arbitrary CNN architectures. We show conversion of popular CNN architectures, including VGG-16 and Inception-v3, into SNNs that produce the best results reported to date on MNIST, CIFAR-10 and the challenging ImageNet dataset. SNNs can trade off classification error rate against the number of available operations whereas deep continuous-valued neural networks require a fixed number of operations to achieve their classification error rate. From the examples of LeNet for MNIST and BinaryNet for CIFAR-10, we show that with an increase in error rate of a few percentage points, the SNNs can achieve more than 2x reductions in operations compared to the original CNNs. This highlights the potential of SNNs in particular when deployed on power-efficient neuromorphic spiking neuron chips, for use in embedded applications.
Energy Technology Data Exchange (ETDEWEB)
Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia); Slamka, Tomas; Martinicky, David; Ilencikova, Denisa [National Cancer Institute, Department of Oncologic Genetics, Klenova 1, 833 01 Bratislava (Slovakia); Bartosova, Zdena [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia)
2009-11-20
Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or
Directory of Open Access Journals (Sweden)
Ilencikova Denisa
2009-11-01
Full Text Available Abstract Background Depending on the population studied, large genomic rearrangements (LGRs of the mismatch repair (MMR genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC. It has been reported that loss of heterozygosity (LOH at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. Methods The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. Results We found six rearrangements in the MSH2 gene (five deletions and dup5-6, and one aberration in the MLH1 gene (del5-6. The MSH2 deletions were of three types (del1, del1-3, del1-7. We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. Conclusion LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1
International Nuclear Information System (INIS)
Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova; Slamka, Tomas; Martinicky, David; Ilencikova, Denisa; Bartosova, Zdena
2009-01-01
Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or
A Conversation Well Worth Remembering
Woolven-Allen, John
2009-01-01
To mark the 200th anniversary of Charles Darwin's birth, a special event was held at Oxford, which included a "Conversation" between Professor Richard Dawkins and Bishop Richard Harries. Here we present a personal reminiscence of the event.
Large-scale event extraction from literature with multi-level gene normalization.
Directory of Open Access Journals (Sweden)
Sofie Van Landeghem
Full Text Available Text mining for the life sciences aims to aid database curation, knowledge summarization and information retrieval through the automated processing of biomedical texts. To provide comprehensive coverage and enable full integration with existing biomolecular database records, it is crucial that text mining tools scale up to millions of articles and that their analyses can be unambiguously linked to information recorded in resources such as UniProt, KEGG, BioGRID and NCBI databases. In this study, we investigate how fully automated text mining of complex biomolecular events can be augmented with a normalization strategy that identifies biological concepts in text, mapping them to identifiers at varying levels of granularity, ranging from canonicalized symbols to unique gene and proteins and broad gene families. To this end, we have combined two state-of-the-art text mining components, previously evaluated on two community-wide challenges, and have extended and improved upon these methods by exploiting their complementary nature. Using these systems, we perform normalization and event extraction to create a large-scale resource that is publicly available, unique in semantic scope, and covers all 21.9 million PubMed abstracts and 460 thousand PubMed Central open access full-text articles. This dataset contains 40 million biomolecular events involving 76 million gene/protein mentions, linked to 122 thousand distinct genes from 5032 species across the full taxonomic tree. Detailed evaluations and analyses reveal promising results for application of this data in database and pathway curation efforts. The main software components used in this study are released under an open-source license. Further, the resulting dataset is freely accessible through a novel API, providing programmatic and customized access (http://www.evexdb.org/api/v001/. Finally, to allow for large-scale bioinformatic analyses, the entire resource is available for bulk download from
Directory of Open Access Journals (Sweden)
José Sereno
2014-01-01
Full Text Available Protocols of conversion from cyclosporin A (CsA to sirolimus (SRL have been widely used in immunotherapy after transplantation to prevent CsA-induced nephropathy, but the molecular mechanisms underlying these protocols remain nuclear. This study aimed to identify the molecular pathways and putative biomarkers of CsA-to-SRL conversion in a rat model. Four animal groups (n=6 were tested during 9 weeks: control, CsA, SRL, and conversion (CsA for 3 weeks followed by SRL for 6 weeks. Classical and emergent serum, urinary, and kidney tissue (gene and protein expression markers were assessed. Renal lesions were analyzed in hematoxylin and eosin, periodic acid-Schiff, and Masson’s trichrome stains. SRL-treated rats presented proteinuria and NGAL (serum and urinary as the best markers of renal impairment. Short CsA treatment presented slight or even absent kidney lesions and TGF-β, NF-κβ, mTOR, PCNA, TP53, KIM-1, and CTGF as relevant gene and protein changes. Prolonged CsA exposure aggravated renal damage, without clear changes on the traditional markers, but with changes in serums TGF-β and IL-7, TBARs clearance, and kidney TGF-β and mTOR. Conversion to SRL prevented CsA-induced renal damage evolution (absent/mild grade lesions, while NGAL (serum versus urine seems to be a feasible biomarker of CsA replacement to SRL.
Directory of Open Access Journals (Sweden)
Johannes M.H.M. eReul
2014-01-01
Full Text Available Strong psychologically stressful events are known to have a long-lasting impact on behavior. The consolidation of such, largely adaptive, behavioral responses to stressful events involves changes in gene expression in limbic brain regions such as the hippocampus and amygdala. The underlying molecular mechanisms however were until recently unresolved. More than a decade ago we started to investigate the role of these hormones in signaling and epigenetic mechanisms participating in the effects of stress on gene transcription in hippocampal neurons. We discovered a novel, rapid non-genomic mechanism in which glucocorticoids via glucocorticoid receptors (GRs facilitate signaling of the ERK MAPK signaling pathway to the downstream nuclear kinases MSK1 and Elk-1 in dentate gyrus (DG granule neurons. Activation of this signaling pathway results in serine10 (S10 phosphorylation and lysine14 (K14 acetylation at histone H3 (H3S10p-K14ac, leading to the induction of the immediate early genes c-Fos and Egr-1. In addition, we found a role of the DNA methylation status of gene promoters. A series of studies showed that these molecular mechanisms play a critical role in the long-lasting consolidation of behavioral responses in the forced swim test and Morris water maze. Furthermore, an important role of GABA was found in controlling the epigenetic and gene transcriptional responses to psychological stress. Thus, psychologically stressful events evoke a long-term impact on behavior through changes in hippocampal function brought about by distinct glutamatergic and glucocorticoid-driven changes in epigenetic regulation of gene transcription which are modulated by (local GABAergic interneurons and limbic afferent inputs. These epigenetic processes may play an important role in the etiology of stress-related mental disorders such as major depressive and anxiety disorders like PTSD.
Mei, Yan-Zhen; Wan, Yong-Min; He, Bing-Fang; Ying, Han-Jie; Ouyang, Ping-Kai
2009-12-01
The thermophile Bacillus fordii MH602 was screened for stereospecifically hydrolyzing DL-5-substituted hydantoins to L-alpha-amino acids. Since the reaction at higher temperature, the advantageous for enhancement of substrate solubility and for racemization of DL-5-substituted hydantoins during the conversion were achieved. The hydantoin metabolism gene cluster from thermophile was firstly reported in this paper. The genes involved in hydantoin utilization (hyu) were isolated on an 8.2 kb DNA fragment by Restriction Site-dependent PCR, and six ORFs were identified by DNA sequence analysis. The hyu gene cluster contained four genes with novel cluster organization characteristics: the hydantoinase gene hyuH, putative transport protein hyuP, hyperprotein hyuHP, and L-carbamoylase gene hyuC. The hyuH and hyuC genes were heterogeneously expressed in E. coli. The results indicated that hyuH and hyuC are involved in the conversion of DL-5-substituted hydantoins to an N-carbamyl intermediate that is subsequently converted to L-alpha-amino acids. Hydantoinase and carbamoylase from B. fordii MH602 comparing respectively with reported hydantoinase and carbamoylase showed the highest identities of 71% and 39%. The novel cluster organization characteristics and the difference of the key enzymes between thermopile B. fordii MH602 and other mesophiles were presumed to be related to the evolutionary origins of concerned metabolism.
The Influence of Major Life Events on Economic Attitudes in a World of Gene-Environment Interplay.
Hatemi, Peter K
2013-10-01
The role of "genes" on political attitudes has gained attention across disciplines. However, person-specific experiences have yet to be incorporated into models that consider genetic influences. Relying on a gene-environment interplay approach, this study explicates how life-events, such as losing one's job or suffering a financial loss, influence economic policy attitudes. The results indicate genetic and environmental variance on support for unions, immigration, capitalism, socialism and property tax is moderated by financial risks. Changes in the magnitude of genetic influences, however, are temporary. After two years, the phenotypic effects of the life events remain on most attitudes, but changes in the sources of individual differences do not. Univariate twin models that estimate the independent contributions of genes and environment on the variation of attitudes appear to provide robust baseline indicators of sources of individual differences. These estimates, however, are not event or day specific. In this way, genetic influences add stability, while environment cues change, and this process is continually updated.
Nikolaidis, Nikolas; Nei, Masatoshi
2004-03-01
We have identified the Hsp70 gene superfamily of the nematode Caenorhabditis briggsae and investigated the evolution of these genes in comparison with Hsp70 genes from C. elegans, Drosophila, and yeast. The Hsp70 genes are classified into three monophyletic groups according to their subcellular localization, namely, cytoplasm (CYT), endoplasmic reticulum (ER), and mitochondria (MT). The Hsp110 genes can be classified into the polyphyletic CYT group and the monophyletic ER group. The different Hsp70 and Hsp110 groups appeared to evolve following the model of divergent evolution. This model can also explain the evolution of the ER and MT genes. On the other hand, the CYT genes are divided into heat-inducible and constitutively expressed genes. The constitutively expressed genes have evolved more or less following the birth-and-death process, and the rates of gene birth and gene death are different between the two nematode species. By contrast, some heat-inducible genes show an intraspecies phylogenetic clustering. This suggests that they are subject to sequence homogenization resulting from gene conversion-like events. In addition, the heat-inducible genes show high levels of sequence conservation in both intra-species and inter-species comparisons, and in most cases, amino acid sequence similarity is higher than nucleotide sequence similarity. This indicates that purifying selection also plays an important role in maintaining high sequence similarity among paralogous Hsp70 genes. Therefore, we suggest that the CYT heat-inducible genes have been subjected to a combination of purifying selection, birth-and-death process, and gene conversion-like events.
Post-event processing in social anxiety.
Dannahy, Laura; Stopa, Lusia
2007-06-01
Clark and Wells' [1995. A cognitive model of social phobia. In: R. Heimberg, M. Liebowitz, D.A. Hope, & F.R. Schneier (Eds.) Social phobia: Diagnosis, assessment and treatment (pp. 69-93). New York: Guildford Press.] cognitive model of social phobia proposes that following a social event, individuals with social phobia will engage in post-event processing, during which they conduct a detailed review of the event. This study investigated the relationship between self-appraisals of performance and post-event processing in individuals high and low in social anxiety. Participants appraised their performance immediately after a conversation with an unknown individual and prior to an anticipated second conversation task 1 week later. The frequency and valence of post-event processing during the week following the conversation was also assessed. The study also explored differences in the metacognitive processes of high and low socially anxious participants. The high socially anxious group experienced more anxiety, predicted worse performance, underestimated their actual performance, and engaged in more post-event processing than low socially anxious participants. The degree of negative post-event processing was linked to the extent of social anxiety and negative appraisals of performance, both immediately after the conversation task and 1 week later. Differences were also observed in some metacognitive processes. The results are discussed in relation to current theory and previous research.
Momper, L. M.; Magnabosco, C.; Amend, J.; Osburn, M. R.; Fournier, G. P.
2017-12-01
The marine and terrestrial subsurface biospheres represent quite likely the largest reservoirs for life on Earth, directly impacting surface processes and global cycles throughout Earth's history. In the deep subsurface biosphere (DSB) organic carbon and energy are often extremely scarce. However, archaea and bacteria are able to persist in the DSB to at least 3.5 km below surface [1]. Understanding how they persist, and by what metabolisms they subsist, are key questions in this biosphere. To address these questions we investigated 5 global DSB environments: one legacy mine in South Dakota, USA, 3 mines in South Africa and marine fluids circulating beneath the Juan de Fuca Ridge. Boreholes within these mines provided access to fluids buried beneath the earth's surface and sampled depths down to 3.1 km. Geochemical data were collected concomitantly with DNA for metagenomic sequencing. We examined genomes of the ancient and deeply branching Chloroflexi for metabolic capabilities and interrogated the geochemical drivers behind those metabolisms with in situ thermodynamic modeling of reaction energetics. In total, 23 Chloroflexi genomes were identified and analyzed from the 5 subsurface sites. Genes for nitrate reduction (nar) and sulfite reduction (dsr) were found in many of the South Africa Chloroflexi but were absent from genomes collected in South Dakota. Indeed, nitrate reduction was among the most energetically favorable reactions in South African fluids (10-14 kJ cell-1 sec -1 per mol of reactant) and sulfur reduction with Fe2+ or H2 was also exergonic [2]. Conversely, genes for nitrite and nitrous oxide reduction (nrf, nir and nos) were found in genomes collected in South Dakota and Juan de Fuca, but not South Africa. We examined the origin of genes conferring these metabolisms in the Chloroflexi genomes. We discovered evidence for horizontal gene transfer (HGT) for all of these putative metabolisms. Retention of these genes in Chloroflexi lineages indicates
Wu, Dong-Dong; Irwin, David M; Zhang, Ya-Ping
2008-08-23
Hair is unique to mammals. Keratin associated proteins (KRTAPs), which contain two major groups: high/ultrahigh cysteine and high glycine-tyrosine, are one of the major components of hair and play essential roles in the formation of rigid and resistant hair shafts. The KRTAP family was identified as being unique to mammals, and near-complete KRTAP gene repertoires for eight mammalian genomes were characterized in this study. An expanded KRTAP gene repertoire was found in rodents. Surprisingly, humans have a similar number of genes as other primates despite the relative hairlessness of humans. We identified several new subfamilies not previously reported in the high/ultrahigh cysteine KRTAP genes. Genes in many subfamilies of the high/ultrahigh cysteine KRTAP genes have evolved by concerted evolution with frequent gene conversion events, yielding a higher GC base content for these gene sequences. In contrast, the high glycine-tyrosine KRTAP genes have evolved more dynamically, with fewer gene conversion events and thus have a lower GC base content, possibly due to positive selection. Most of the subfamilies emerged early in the evolution of mammals, thus we propose that the mammalian ancestor should have a diverse KRTAP gene repertoire. We propose that hair content characteristics have evolved and diverged rapidly among mammals because of rapid divergent evolution of KRTAPs between species. In contrast, subfamilies of KRTAP genes have been homogenized within each species due to concerted evolution.
Conversion of Questionnaire Data
International Nuclear Information System (INIS)
Powell, Danny H.; Elwood, Robert H. Jr.
2011-01-01
During the survey, respondents are asked to provide qualitative answers (well, adequate, needs improvement) on how well material control and accountability (MC and A) functions are being performed. These responses can be used to develop failure probabilities for basic events performed during routine operation of the MC and A systems. The failure frequencies for individual events may be used to estimate total system effectiveness using a fault tree in a probabilistic risk analysis (PRA). Numeric risk values are required for the PRA fault tree calculations that are performed to evaluate system effectiveness. So, the performance ratings in the questionnaire must be converted to relative risk values for all of the basic MC and A tasks performed in the facility. If a specific material protection, control, and accountability (MPC and A) task is being performed at the 'perfect' level, the task is considered to have a near zero risk of failure. If the task is performed at a less than perfect level, the deficiency in performance represents some risk of failure for the event. As the degree of deficiency in performance increases, the risk of failure increases. If a task that should be performed is not being performed, that task is in a state of failure. The failure probabilities of all basic events contribute to the total system risk. Conversion of questionnaire MPC and A system performance data to numeric values is a separate function from the process of completing the questionnaire. When specific questions in the questionnaire are answered, the focus is on correctly assessing and reporting, in an adjectival manner, the actual performance of the related MC and A function. Prior to conversion, consideration should not be given to the numeric value that will be assigned during the conversion process. In the conversion process, adjectival responses to questions on system performance are quantified based on a log normal scale typically used in human error analysis (see A
A simple model for the influence of meiotic conversion tracts on GC content.
Directory of Open Access Journals (Sweden)
Marie-Claude Marsolier-Kergoat
Full Text Available A strong correlation between GC content and recombination rate is observed in many eukaryotes, which is thought to be due to conversion events linked to the repair of meiotic double-strand breaks. In several organisms, the length of conversion tracts has been shown to decrease exponentially with increasing distance from the sites of meiotic double-strand breaks. I show here that this behavior leads to a simple analytical model for the evolution and the equilibrium state of the GC content of sequences devoid of meiotic double-strand break sites. In the yeast Saccharomyces cerevisiae, meiotic double-strand breaks are practically excluded from protein-coding sequences. A good fit was observed between the predictions of the model and the variations of the average GC content of the third codon position (GC3 of S. cerevisiae genes. Moreover, recombination parameters that can be extracted by fitting the data to the model coincide with experimentally determined values. These results thus indicate that meiotic recombination plays an important part in determining the fluctuations of GC content in yeast coding sequences. The model also accounted for the different patterns of GC variations observed in the genes of Candida species that exhibit a variety of sexual lifestyles, and hence a wide range of meiotic recombination rates. Finally, the variations of the average GC3 content of human and chicken coding sequences could also be fitted by the model. These results suggest the existence of a widespread pattern of GC variation in eukaryotic genes due to meiotic recombination, which would imply the generality of two features of meiotic recombination: its association with GC-biased gene conversion and the quasi-exclusion of meiotic double-strand breaks from coding sequences. Moreover, the model points out to specific constraints on protein fragments encoded by exon terminal sequences, which are the most affected by the GC bias.
Yang, Chunxia; Sun, Ning; Liu, Zhifen; Li, Xinrong; Xu, Yong; Zhang, Kerang
2016-03-30
Major depressive disorder (MDD) is a mental disorder that results from complex interplay between multiple and partially overlapping sets of susceptibility genes and environmental factors. The brain derived neurotrophic factor (BDNF) and Protein kinase C gamma type (PRKCG) are logical candidate genes in MDD. Among diverse environmental factors, negative life events have been suggested to exert a crucial impact on brain development. In the present study, we hypothesized that interactions between genetic variants in BDNF and PRKCG and negative life events may play an important role in the development of MDD. We recruited a total of 406 patients with MDD and 391 age- and gender-matched control subjects. Gene-environment interactions were analyzed using generalized multifactor dimensionality reduction (GMDR). Under a dominant model, we observed a significant three-way interaction among BDNF rs6265, PRKCG rs3745406, and negative life events. The gene-environment combination of PRKCG rs3745406 C allele, BDNF rs6265 G allele and high level of negative life events (C-G-HN) was significantly associated with MDD (OR, 5.97; 95% CI, 2.71-13.15). To our knowledge, this is the first report of evidence that the BDNF-PRKCG interaction may modify the relationship between negative life events and MDD in the Chinese population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Moran, Yehu; Weinberger, Hagar; Lazarus, Nimrod; Gur, Maya; Kahn, Roy; Gordon, Dalia; Gurevitz, Michael
2009-08-01
Sea anemones are sessile predators that use a variety of toxins to paralyze prey and foe. Among these toxins, Types I, II and III are short peptides that affect voltage-gated sodium channels. Anemonia viridis is the only sea anemone species that produces both Types I and III neurotoxin. Although the two toxin types are unrelated in sequence and three-dimensional structure, cloning and comparative analysis of their loci revealed a highly similar sequence at the 5' region, which encodes a signal peptide. This similarity was likely generated by gene fusion and could be advantageous in transcript stability and intracellular trafficking and secretion. In addition, these analyses identified the processed pseudogenes of the two gene families in the genome of A. viridis, probably resulting from retrotransposition events. As presence of processed pseudogenes in the genome requires transcription in germ-line cells, we analyzed oocyte-rich ovaries and found that indeed they contain Types I and III transcripts. This result raises questions regarding the role of toxin transcripts in these tissues. Overall, the retrotransposition and gene fusion events suggest that the genes of both Types I and III neurotoxins evolved in a similar fashion and share a partial common ancestry.
International Nuclear Information System (INIS)
Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.
1987-01-01
The predominant β-thalassemia in Sardinia is the β 0 type in which no β-globin chains are synthesized in the homozygous state. The authors determined the β-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same β/sup 39(CAG→TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the β-globin gene region
Raynard, Steven J; Baker, Mark D
2004-01-01
In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.
Tyrosine kinase chromosomal translocations mediate distinct and overlapping gene regulation events
International Nuclear Information System (INIS)
Kim, Hani; Gillis, Lisa C; Jarvis, Jordan D; Yang, Stuart; Huang, Kai; Der, Sandy; Barber, Dwayne L
2011-01-01
Leukemia is a heterogeneous disease commonly associated with recurrent chromosomal translocations that involve tyrosine kinases including BCR-ABL, TEL-PDGFRB and TEL-JAK2. Most studies on the activated tyrosine kinases have focused on proximal signaling events, but little is known about gene transcription regulated by these fusions. Oligonucleotide microarray was performed to compare mRNA changes attributable to BCR-ABL, TEL-PDGFRB and TEL-JAK2 after 1 week of activation of each fusion in Ba/F3 cell lines. Imatinib was used to control the activation of BCR-ABL and TEL-PDGFRB, and TEL-JAK2-mediated gene expression was examined 1 week after Ba/F3-TEL-JAK2 cells were switched to factor-independent conditions. Microarray analysis revealed between 800 to 2000 genes induced or suppressed by two-fold or greater by each tyrosine kinase, with a subset of these genes commonly induced or suppressed among the three fusions. Validation by Quantitative PCR confirmed that eight genes (Dok2, Mrvi1, Isg20, Id1, gp49b, Cxcl10, Scinderin, and collagen Vα1(Col5a1)) displayed an overlapping regulation among the three tested fusion proteins. Stat1 and Gbp1 were induced uniquely by TEL-PDGFRB. Our results suggest that BCR-ABL, TEL-PDGFRB and TEL-JAK2 regulate distinct and overlapping gene transcription profiles. Many of the genes identified are known to be involved in processes associated with leukemogenesis, including cell migration, proliferation and differentiation. This study offers the basis for further work that could lead to an understanding of the specificity of diseases caused by these three chromosomal translocations
Directory of Open Access Journals (Sweden)
Conception Paul
2015-02-01
Full Text Available Protein arginine methyl transferase 5 (Prmt5 regulates various differentiation processes, including adipogenesis. Here, we investigated adipogenic conversion in cells and mice in which Copr5, a Prmt5- and histone-binding protein, was genetically invalidated. Compared to control littermates, the retroperitoneal white adipose tissue (WAT of Copr5 KO mice was slightly but significantly reduced between 8 and 16 week/old and contained fewer and larger adipocytes. Moreover, the adipogenic conversion of Copr5 KO embryoid bodies (EB and of primary embryo fibroblasts (Mefs was markedly delayed. Differential transcriptomic analysis identified Copr5 as a negative regulator of the Dlk-1 gene, a Wnt target gene involved in the control of adipocyte progenitors cell fate. Dlk-1 expression was upregulated in Copr5 KO Mefs and the Vascular Stromal Fraction (VSF of Copr5 KO WAT. Chromatin immunoprecipitation (ChIP show that the ablation of Copr5 has impaired both the recruitment of Prmt5 and β-catenin at the Dlk-1 promoter. Overall, our data suggest that Copr5 is involved in the transcriptional control exerted by the Wnt pathway on early steps of adipogenesis.
Czech Academy of Sciences Publication Activity Database
Sochorova, Jana; Coriton, O.; Kuderová, Alena; Lunerová Bedřichová, Jana; Chevre, A.-M.; Kovařík, Aleš
2017-01-01
Roč. 119, č. 1 (2017), s. 13-26 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA13-10057S Institutional support: RVO:68081707 Keywords : ribosomal-rna genes * concerted evolution * intergenic spacer Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 4.041, year: 2016
Recent adaptive events in human brain revealed by meta-analysis of positively selected genes.
Directory of Open Access Journals (Sweden)
Yue Huang
Full Text Available BACKGROUND AND OBJECTIVES: Analysis of positively-selected genes can help us understand how human evolved, especially the evolution of highly developed cognitive functions. However, previous works have reached conflicting conclusions regarding whether human neuronal genes are over-represented among genes under positive selection. METHODS AND RESULTS: We divided positively-selected genes into four groups according to the identification approaches, compiling a comprehensive list from 27 previous studies. We showed that genes that are highly expressed in the central nervous system are enriched in recent positive selection events in human history identified by intra-species genomic scan, especially in brain regions related to cognitive functions. This pattern holds when different datasets, parameters and analysis pipelines were used. Functional category enrichment analysis supported these findings, showing that synapse-related functions are enriched in genes under recent positive selection. In contrast, immune-related functions, for instance, are enriched in genes under ancient positive selection revealed by inter-species coding region comparison. We further demonstrated that most of these patterns still hold even after controlling for genomic characteristics that might bias genome-wide identification of positively-selected genes including gene length, gene density, GC composition, and intensity of negative selection. CONCLUSION: Our rigorous analysis resolved previous conflicting conclusions and revealed recent adaptation of human brain functions.
Resonant spin-flavor conversion of supernova neutrinos: Dependence on electron mole fraction
International Nuclear Information System (INIS)
Yoshida, Takashi; Takamura, Akira; Kimura, Keiichi; Yokomakura, Hidekazu; Kawagoe, Shio; Kajino, Toshitaka
2009-01-01
Detailed dependence of resonant spin-flavor (RSF) conversion of supernova neutrinos on electron mole fraction Y e is investigated. Supernova explosion forms a hot-bubble and neutrino-driven wind region of which electron mole fraction exceeds 0.5 in several seconds after the core collapse. When a higher resonance of the RSF conversion is located in the innermost region, flavor change of the neutrinos strongly depends on the sign of 1-2Y e . At an adiabatic high RSF resonance the flavor conversion of ν e ↔ν μ,τ occurs in Y e e >0.5 and inverted mass hierarchy. In other cases of Y e values and mass hierarchies, the conversion of ν e ↔ν μ,τ occurs. The final ν e spectrum is evaluated in the cases of Y e e >0.5 taking account of the RSF conversion. Based on the obtained result, time variation of the event number ratios of low ν e energy to high ν e energy is discussed. In normal mass hierarchy, an enhancement of the event ratio should be seen in the period when the electron fraction in the innermost region exceeds 0.5. In inverted mass hierarchy, on the other hand, a dip of the event ratio should be observed. Therefore, the time variation of the event number ratio is useful to investigate the effect of the RSF conversion.
Parametric down conversion of X-rays, recent experiments
Adams, B; Novikov, D V; Materlik, G; Mills, D M
2001-01-01
Parametric down conversion of X-ray photons in diamond crystals was detected in six experiments, all using the phase matching scheme first employed in the X-ray regime by Eisenberger and McCall (Eisenberger and McCall, Phys. Rev. Lett. 26 (1971) 684). The conversion events were detected by a combination of time correlation spectroscopy and energy discrimination. The time correlation spectra gave a direct comparison of the conversion rate over the accidental coincidence rate.
Gene conversion in yeast as a function of linear energy transfer (LET) for low-LET radiation
International Nuclear Information System (INIS)
Unrau, P.; Morrison, D.P.; Johnson, J.R.
1992-05-01
The relative biological effectiveness (RBE) for low-LET radiation is known to depend on such factors as LET and dose rate. Microdosimetric calculations indicate that the biological target size could also be an important parameter, and calculations predict that the RBE for effects produced by hits in target sizes below about 100 nm should be unity for all low LET radiation. We have measured that RBE for gene conversion in yeast (a small target) for five different low LET photon sources, and the results were consistent with an RBE of unity, which agrees with microdosimetric predictions. 4 refs
A new computational method for the detection of horizontal gene transfer events.
Tsirigos, Aristotelis; Rigoutsos, Isidore
2005-01-01
In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.
Liu, Mengjin; Siezen, Roland J; Nauta, Arjen
2009-06-01
Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions.
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Event Displays for the Visualization of CMS Events
Jones, Christopher Duncan
2010-01-01
During the last year the CMS experiment engaged in consolidation of its existing event display programs. The core of the new system is based on the Fireworks event display program which was by-design directly integrated with the CMS Event Data Model (EDM) and the light version of the software framework (FWLite). The Event Visualization Environment (EVE) of the ROOT framework is used to manage a consistent set of 3D and 2D views, selection, user-feedback and user-interaction with the graphics windows; several EVE components were developed by CMS in collaboration with the ROOT project. In event display operation simple plugins are registered into the system to perform conversion from EDM collections into their visual representations which are then managed by the application. Full event navigation and filtering as well as collection-level filtering is supported. The same data-extraction principle can also be applied when Fireworks will eventually operate as a service within the full software framework.
Event Display for the Visualization of CMS Events
Bauerdick, L. A. T.; Eulisse, G.; Jones, C. D.; Kovalskyi, D.; McCauley, T.; Mrak Tadel, A.; Muelmenstaedt, J.; Osborne, I.; Tadel, M.; Tu, Y.; Yagil, A.
2011-12-01
During the last year the CMS experiment engaged in consolidation of its existing event display programs. The core of the new system is based on the Fireworks event display program which was by-design directly integrated with the CMS Event Data Model (EDM) and the light version of the software framework (FWLite). The Event Visualization Environment (EVE) of the ROOT framework is used to manage a consistent set of 3D and 2D views, selection, user-feedback and user-interaction with the graphics windows; several EVE components were developed by CMS in collaboration with the ROOT project. In event display operation simple plugins are registered into the system to perform conversion from EDM collections into their visual representations which are then managed by the application. Full event navigation and filtering as well as collection-level filtering is supported. The same data-extraction principle can also be applied when Fireworks will eventually operate as a service within the full software framework.
Event Display for the Visualization of CMS Events
International Nuclear Information System (INIS)
Bauerdick, L A T; Eulisse, G; Jones, C D; McCauley, T; Osborne, I; Kovalskyi, D; Tadel, A Mrak; Muelmenstaedt, J; Tadel, M; Tu, Y; Yagil, A
2011-01-01
During the last year the CMS experiment engaged in consolidation of its existing event display programs. The core of the new system is based on the Fireworks event display program which was by-design directly integrated with the CMS Event Data Model (EDM) and the light version of the software framework (FWLite). The Event Visualization Environment (EVE) of the ROOT framework is used to manage a consistent set of 3D and 2D views, selection, user-feedback and user-interaction with the graphics windows; several EVE components were developed by CMS in collaboration with the ROOT project. In event display operation simple plugins are registered into the system to perform conversion from EDM collections into their visual representations which are then managed by the application. Full event navigation and filtering as well as collection-level filtering is supported. The same data-extraction principle can also be applied when Fireworks will eventually operate as a service within the full software framework.
Arenillas, Juan F; Massot, Andreu; Alvarez-Sabín, Jose; Fernandez-Cadenas, Israel; del Rio-Espinola, Albert; Chacon, Pilar; Quintana, Manuel; Molina, Carlos A; Rovira, Alex; Montaner, Joan
2009-01-01
High levels of C-reactive protein (CRP) are associated with an increased risk of further ischemic events in patients with symptomatic intracranial atherosclerotic disease (ICAD). It remains unknown to which extent this increased risk might be genetically predetermined. We aimed to investigate the relationship between a common genetic polymorphism of the CRP gene and the risk of recurrent ischemic events in symptomatic ICAD patients. We studied 75 consecutive patients with a first-ever cerebral ischemic event attributable to symptomatic ICAD. Blood samples were drawn 3 months after the qualifying event. Genomic DNA was isolated and the C1444T single nucleotide polymorphism (SNP) of the CRP gene was determined. The blood concentration of CRP was also measured. Patients underwent long-term clinical follow-up to detect the occurrence of further major ischemic events. During a median follow-up time of 23 months, 18 patients (24%) suffered a major ischemic event (10 ischemic strokes, 3 transient ischemic attacks and 5 myocardial infarctions). Raised CRP levels at baseline (p = 0.02) and the presence of the T allele within the CRP C1444T SNP were associated with a higher risk of recurrent ischemic events (p = 0.02). Kaplan-Meier and multivariable Cox regression analyses adjusted for age, sex, vascular risk factors and CRP level identified that the presence of the T allele in the studied polymorphism predicted the occurrence of further ischemic events (hazard ratio 3.6, 95% confidence interval 1.2-11.1; p = 0.025). The presence of the T allele within the CRP gene C1444T polymorphism may be associated with a higher risk of further ischemic events in symptomatic ICAD patients. (c) 2009 S. Karger AG, Basel.
Liu, Mengjin; Siezen, Roland J.; Nauta, Arjen
2009-01-01
Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions. PMID:19395564
Does pedagogical documentation support maternal reminiscing conversations?
Directory of Open Access Journals (Sweden)
Bethany Fleck
2015-12-01
Full Text Available When parents talk with their children about lessons learned in school, they are participating in reminiscing of an unshared event. This study sought to understand if pedagogical documentation, from the Reggio Approach to early childhood education, would support and enhance the conversation. Mother–child dyads reminisced two separate times about preschool lessons, one time with documentation available to them and one time without. Transcripts were coded extracting variables indicative of high and low maternal reminiscing styles. Results indicate that mother and child conversation characteristics were more highly elaborative when documentation was present than when it was not. In addition, children added more information to the conversation supporting the notion that such conversations enhanced memory for lessons. Documentation could be used as a support tool for conversations and children’s memory about lessons learned in school.
Saccharomyces cerevisiae mutants with enhanced induced mutation and altered mitotic gene conversion.
Ivanov, E L; Kovaltzova, S V; Korolev, V G
1989-08-01
We have developed a method to isolate yeast (Saccharomyces cerevisiae) mutants with enhanced induced mutagenesis based on nitrous acid-induced reversion of the ade2-42 allele. Six mutants have been isolated and designated him (high induced mutagenesis), and 4 of them were studied in more detail. The him mutants displayed enhanced reversion of the ade2-42 allele, either spontaneous or induced by nitrous acid, UV light, and the base analog 6-N-hydroxylaminopurine, but not by gamma-irradiation. It is worth noting that the him mutants turned out not to be sensitive to the lethal effects of the mutagens used. The enhancement in mutation induced by nitrous acid, UV light, and 6-N-hydroxylaminopurine has been confirmed in a forward-mutation assay (induction of mutations in the ADE1, ADE2 genes). The latter agent revealed the most apparent differences between the him mutants and the wild-type strain and was, therefore, chosen for the genetic analysis of mutants, him mutations analyzed behaved as a single Mendelian trait; complementation tests indicated 3 complementation groups (HIM1, HIM2, and HIM3), each containing 1 mutant allele. Uracil-DNA glycosylase activity was determined in crude cell extracts, and no significant differences between the wild-type and him strains were detected. Spontaneous mitotic gene conversion at the ADE2 locus is altered in him1 strains, either increased or decreased, depending on the particular heteroallelic combination. Genetic evidence strongly suggests him mutations to be involved in a process of mismatch correction of molecular heteroduplexes.
Antigenic variation of Anaplasma marginale msp2 occurs by combinatorial gene conversion.
Brayton, Kelly A; Palmer, Guy H; Lundgren, Anna; Yi, Jooyoung; Barbet, Anthony F
2002-03-01
The rickettsial pathogen Anaplasma marginale establishes lifelong persistent infection in the mammalian reservoir host, during which time immune escape variants continually arise in part because of variation in the expressed copy of the immunodominant outer membrane protein MSP2. A key question is how the small 1.2 Mb A. marginale genome generates sufficient variants to allow long-term persistence in an immunocompetent reservoir host. The recombination of whole pseudogenes into the single msp2 expression site has been previously identified as one method of generating variants, but is inadequate to generate the number of variants required for persistent infection. In the present study, we demonstrate that recombination of a whole pseudogene is followed by a second level of variation in which small segments of pseudogenes recombine into the expression site by gene conversion. Evidence for four short sequential changes in the hypervariable region of msp2 coupled with the identification of nine pseudogenes from a single strain of A. marginale provides for a combinatorial number of possible expressed MSP2 variants sufficient for lifelong persistence.
International Nuclear Information System (INIS)
Murthy, M.S.S.; Rao, B.S.; Deorukhakar, V.V.
1976-01-01
The yield of radiation-induced gene conversion to arginine independence in diploid yeast depended on the concentration of the amino acid both in the plating medium and in the intracellular pool. By depletion of the level of arginine in the intracellular pool of amino acid or by provision of arginine at 0.4 mg/l of the plating medium, the yield was varied by a factor as high as 20. This may be important in studies of the genetic mapping of alleles based on the slope of conversion frequency versus dose line
5S rRNA gene arrangements in protists: a case of nonadaptive evolution.
Drouin, Guy; Tsang, Corey
2012-06-01
Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.
Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.
2001-01-01
Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by
Reported Speech in Conversational Storytelling during Nursing Shift Handover Meetings
Bangerter, Adrian; Mayor, Eric; Pekarek Doehler, Simona
2011-01-01
Shift handovers in nursing units involve formal transmission of information and informal conversation about non-routine events. Informal conversation often involves telling stories. Direct reported speech (DRS) was studied in handover storytelling in two nursing care units. The study goal is to contribute to a better understanding of conversation…
Directory of Open Access Journals (Sweden)
Antonella Carsana
2013-01-01
Full Text Available Exertional rhabdomyolysis (ER and stress-induced malignant hyperthermia (MH events are syndromes that primarily afflict military recruits in basic training and athletes. Events similar to those occurring in ER and in stress-induced MH events are triggered after exposure to anesthetic agents in MH-susceptible (MHS patients. MH is an autosomal dominant hypermetabolic condition that occurs in genetically predisposed subjects during general anesthesia, induced by commonly used volatile anesthetics and/or the neuromuscular blocking agent succinylcholine. Triggering agents cause an altered intracellular calcium regulation. Mutations in RYR1 gene have been found in about 70% of MH families. The RYR1 gene encodes the skeletal muscle calcium release channel of the sarcoplasmic reticulum, commonly known as ryanodine receptor type 1 (RYR1. The present work reviews the documented cases of ER or of stress-induced MH events in which RYR1 sequence variations, associated or possibly associated to MHS status, have been identified.
Chemical Conversion of Human Fibroblasts into Functional Schwann Cells
Directory of Open Access Journals (Sweden)
Eva C. Thoma
2014-10-01
Full Text Available Direct transdifferentiation of somatic cells is a promising approach to obtain patient-specific cells for numerous applications. However, conversion across germ-layer borders often requires ectopic gene expression with unpredictable side effects. Here, we present a gene-free approach that allows efficient conversion of human fibroblasts via a transient progenitor stage into Schwann cells, the major glial cell type of peripheral nerves. Using a multikinase inhibitor, we transdifferentiated fibroblasts into transient neural precursors that were subsequently further differentiated into Schwann cells. The resulting induced Schwann cells (iSCs expressed numerous Schwann cell-specific proteins and displayed neurosupportive and myelination capacity in vitro. Thus, we established a strategy to obtain mature Schwann cells from human postnatal fibroblasts under chemically defined conditions without the introduction of ectopic genes.
Peng, Ting; Sun, Xiaochun; Mumm, Rita H
2014-01-01
Multiple trait integration (MTI) is a multi-step process of converting an elite variety/hybrid for value-added traits (e.g. transgenic events) through backcross breeding. From a breeding standpoint, MTI involves four steps: single event introgression, event pyramiding, trait fixation, and version testing. This study explores the feasibility of marker-aided backcross conversion of a target maize hybrid for 15 transgenic events in the light of the overall goal of MTI of recovering equivalent performance in the finished hybrid conversion along with reliable expression of the value-added traits. Using the results to optimize single event introgression (Peng et al. Optimized breeding strategies for multiple trait integration: I. Minimizing linkage drag in single event introgression. Mol Breed, 2013) which produced single event conversions of recurrent parents (RPs) with ≤8 cM of residual non-recurrent parent (NRP) germplasm with ~1 cM of NRP germplasm in the 20 cM regions flanking the event, this study focused on optimizing process efficiency in the second and third steps in MTI: event pyramiding and trait fixation. Using computer simulation and probability theory, we aimed to (1) fit an optimal breeding strategy for pyramiding of eight events into the female RP and seven in the male RP, and (2) identify optimal breeding strategies for trait fixation to create a 'finished' conversion of each RP homozygous for all events. In addition, next-generation seed needs were taken into account for a practical approach to process efficiency. Building on work by Ishii and Yonezawa (Optimization of the marker-based procedures for pyramiding genes from multiple donor lines: I. Schedule of crossing between the donor lines. Crop Sci 47:537-546, 2007a), a symmetric crossing schedule for event pyramiding was devised for stacking eight (seven) events in a given RP. Options for trait fixation breeding strategies considered selfing and doubled haploid approaches to achieve homozygosity
Leist, Thomas P; Comi, Giancarlo; Cree, Bruce A C; Coyle, Patricia K; Freedman, Mark S; Hartung, Hans-Peter; Vermersch, Patrick; Casset-Semanaz, Florence; Scaramozza, Matthew
2014-03-01
Patients who develop relapsing-remitting multiple sclerosis (MS) present with a first clinical demyelinating event. In this double-blind, multicentre, randomised, phase 3 study we investigated the effect of oral cladribine on conversion to clinically definite MS in patients with a first clinical demyelinating event, when given at the same doses shown to be effective in relapsing-remitting MS. Between Oct 21, 2008, and Oct 11, 2010, we recruited patients aged 18-55 years, inclusive, from 160 hospitals, private clinics, or treatment centres in 34 countries. Eligible patients had a first clinical demyelinating event within 75 days before screening, at least two clinically silent lesions of at least 3 mm on a T2-weighted brain MRI scan, and an Expanded Disability Status Scale score of 5.0 or lower. Patients with a first clinical demyelinating event ≤75 days before screening were randomly assigned (1:1:1) to receive cladribine tablets at cumulative doses of 5.25 mg/kg or 3.5 mg/kg or placebo. Randomisation was done with a central web-based randomisation system and was stratified by geographic region. Masking was maintained using a two-physician model. The primary endpoint of this 96-week study was time to conversion to clinically definite MS according to the Poser criteria. This study is registered with ClinicalTrials.gov, number NCT00725985. Of 903 participants assessed for eligibility, 616 patients received cladribine 5.25 mg/kg (n=204), cladribine 3.5 mg/kg (n=206), or placebo (n=206). At trial termination on Oct 25, 2011, cladribine was associated with a risk reduction versus placebo for time to conversion to clinically definite MS (hazard ratio [HR] for 5.25 mg/kg=0.38, 95% CI 0.25-0.58, pMS diagnosis compared with placebo. The safety profile of cladribine was similar to that noted in a trial in patients with relapsing-remitting MS. Further research could clarify the potential effects of oral cladribine treatment in the early stages of MS. Merck Serono SA Geneva
DEFF Research Database (Denmark)
Keers, R.; Uher, R.; Huezo-Diaz, P.
2011-01-01
, and several polymorphisms in the serotonin transporter gene (SLC6A4) have been genotyped including the serotonin transporter-linked polymorphic region (5-HTTLPR). Stressful life events were shown to predict a significantly better response to escitalopram but had no effect on response to nortriptyline...
Ludwig, Lea; Pasman, Joëlle A; Nicholson, Timothy; Aybek, Selma; David, Anthony S; Tuck, Sharon; Kanaan, Richard A; Roelofs, Karin; Carson, Alan; Stone, Jon
2018-04-01
Stressful life events and maltreatment have traditionally been considered crucial in the development of conversion (functional neurological) disorder, but the evidence underpinning this association is not clear. We aimed to assess the association between stressors and functional neurological disorder. We systematically reviewed controlled studies reporting stressors occurring in childhood or adulthood, such as stressful life events and maltreatment (including sexual, physical abuse, and emotional neglect) and functional neurological disorder. We did a meta-analysis, with assessments of methodology, sources of bias, and sensitivity analyses. 34 case-control studies, with 1405 patients, were eligible. Studies were of moderate-to-low quality. The frequency of childhood and adulthood stressors was increased in cases compared with controls. Odds ratios (OR) were higher for emotional neglect in childhood (49% for cases vs 20% for controls; OR 5·6, 95% CI 2·4-13·1) compared with sexual abuse (24% vs 10%; 3·3, 2·2-4·8) or physical abuse (30% vs 12%; 3·9, 2·2-7·2). An association with stressful life events preceding onset (OR 2·8, 95% CI 1·4-6·0) was stronger in studies with better methods (interviews; 4·3, 1·4-13·2). Heterogeneity was significant between studies (I 2 21·1-90·7%). 13 studies that specifically ascertained that the participants had not had either severe life events or any subtype of maltreatment all found a proportion of patients with functional neurological disorder reporting no stressor. Stressful life events and maltreatment are substantially more common in people with functional neurological disorder than in healthy controls and patient controls. Emotional neglect had a higher risk than traditionally emphasised sexual and physical abuse, but many cases report no stressors. This outcome supports changes to diagnostic criteria in DSM-5; stressors, although relevant to the cause in many patients, are not a core diagnostic feature. This
Directory of Open Access Journals (Sweden)
Weicai Chen
Full Text Available Major histocompatibility complex (MHC genes are the most polymorphic genes in vertebrates and encode molecules that play a crucial role in pathogen resistance. As a result of their diversity, they have received much attention in the fields of evolutionary and conservation biology. Here, we described the genetic variation of MHC class II B (MHCIIB exon 2 in a wild population of Hume's pheasant (Syrmaticus humiae, which has suffered a dramatic decline in population over the last three decades across its ranges in the face of heavy exploitation and habitat loss. Twenty-four distinct alleles were found in 73 S. humiae specimens. We found seven shared alleles among four geographical groups as well as six rare MHCIIB alleles. Most individuals displayed between one to five alleles, suggesting that there are at least three MHCIIB loci of the Hume's pheasant. The dN ⁄ dS ratio at putative antigen-binding sites (ABS was significantly greater than one, indicating balancing selection is acting on MHCIIB exon 2. Additionally, recombination and gene conversion contributed to generating MHCIIB diversity in the Hume's pheasant. One to three recombination events and seventy-five significant gene conversion events were observed within the Hume's pheasant MHCIIB loci. The phylogenetic tree and network analysis revealed that the Hume's pheasant alleles do not cluster together, but are scattered through the tree or network indicating a trans-species evolutionary mode. These findings revealed the evolution of the Hume's pheasant MHC after suffering extreme habitat fragmentation.
Roelofs, K.; Spinhoven, P.; Sandijck, P.; Moene, F.C.; Hoogduin, C.A.L.
2005-01-01
Although the presence of psychological stress factors in the evolution of conversion symptoms forms an important criterion for the DSM-IV diagnosis of conversion disorder, little is known about the nature and timing of these stress factors. Fifty-four patients with conversion disorder and 50 control
Morphogenesis in sea urchin embryos: linking cellular events to gene regulatory network states
Lyons, Deidre; Kaltenbach, Stacy; McClay, David R.
2013-01-01
Gastrulation in the sea urchin begins with ingression of the primary mesenchyme cells (PMCs) at the vegetal pole of the embryo. After entering the blastocoel the PMCs migrate, form a syncitium, and synthesize the skeleton of the embryo. Several hours after the PMCs ingress the vegetal plate buckles to initiate invagination of the archenteron. That morphogenetic process occurs in several steps. The non-skeletogenic cells produce the initial inbending of the vegetal plate. Endoderm cells then rearrange and extend the length of the gut across the blastocoel to a target near the animal pole. Finally, cells that will form part of the midgut and hindgut are added to complete gastrulation. Later, the stomodeum invaginates from the oral ectoderm and fuses with the foregut to complete the archenteron. In advance of, and during these morphogenetic events an increasingly complex gene regulatory network controls the specification and the cell biological events that conduct the gastrulation movements. PMID:23801438
Microbial conversion technologies
Energy Technology Data Exchange (ETDEWEB)
Lau, P. [National Research Council of Canada, Ottawa, ON (Canada). Bioconversion and Sustainable Development
2006-07-01
Microbes are a biomass and an valuable resource. This presentation discussed microbial conversion technologies along with background information on microbial cells, their characteristics and microbial diversity. Untapped opportunities for microbial conversion were identified. Metagenomic and genome mining approaches were also discussed, as they can provide access to uncultivated or unculturable microorganisms in communal populations and are an unlimited resource for biocatalysts, novel genes and metabolites. Genome mining was seen as an economical approach. The presentation also emphasized that the development of microbial biorefineries would require significant insights into the relevant microorganisms and that biocatalysts were the ultimate in sustainability. In addition, the presentation discussed the natural fibres initiative for biochemicals and biomaterials. Anticipated outputs were identified and work in progress of a new enzyme-retting cocktail to provide diversity and/or consistency in fibre characteristics for various applications were also presented. It was concluded that it is necessary to leverage understanding of biological processes to produce bioproducts in a clean and sustainable manner. tabs., figs.
Talking About Climate: a simple tool for everyday climate conversations
Twedt, J. R.; White, R. H.; Tigchelaar, M.; Doroschak, K.; Buchanan, R.; Lundquist, D.
2017-12-01
Public opinion research from the Yale Climate Opinion Maps shows that more than half of Americans are worried about climate change, yet over 70% of Americans rarely or never discuss it with friends or family. Sociologist Kari Marie Norgaard has written about climate denial and how the subject of climate change kills conversation in her interviews, even among people who feel concerned. At the same time, news reporting on climate is often dense with information or scientific nuance and fails to make people feel personally invested in this global issue. This is problematic, because a fair and civil response to our climate crisis will require not only the personal commitment of many, but also collaborative public discourse. For these reasons, we have developed an app that aims to foster meaningful conversation about climate change. The app draws on a database we constructed of historic climate events and relates these events to people's own lives and experiences. Our database is broad and growing, and includes climate change facts, landmark cases in environmental law, social achievements such as the IPCC earning the Nobel Peace Prize, and the personal account from a 12-year old's blog post about FEMA relocation after Hurricane Katrina. Events are stated in plain language and accompanied by open-ended questions to spark discussion. The goal of ClimateConversations is not to inform or persuade, but to support reflective, open-ended conversation, to encourage personal storytelling about climate-related events, and to foster generative dialogue on an issue that all too often causes discomfort and social division. Here we present the climate science, social science, software, and design considerations that went into developing this app. We will also present early quantitative and qualitative metrics of it's use and effectiveness both in classroom and community settings.
Conversion of the random amplified polymorphic DNA (RAPD ...
African Journals Online (AJOL)
Conversion of the random amplified polymorphic DNA (RAPD) marker UBC#116 linked to Fusarium crown and root rot resistance gene (Frl) into a co-dominant sequence characterized amplified region (SCAR) marker for marker-assisted selection of tomato.
Having "The Talk": Youth-Parent Climate Conversations
Anderson, R. K.; Flora, J. A.; Lertzman, R.; Saphir, M.
2017-12-01
Youth are concerned about climate change. Recent research conducted by the Alliance for Climate Education, in partnership with the Skoll Global Threats Fund, demonstrates that youth have agency within their families regarding climate relevant behaviors, particularly resulting from conversations that rely on listening. In this pilot project, we examined whether youth involved in a year-long climate action program will carry out climate related conversations with their parents, and whether youth who have engaged online with a climate education group, will carry out similar conversations with their parents when asked to do so via SMS. In study one, we used mixed methods to determine if youth participating in a training would carry out a climate conversation with their parents, adhere to guidelines such as reflective listening, and have positive experiences. Further, we investigated to what extent parents would experience the conversation as a positive and impactful event. Parents overall reported a positive experience, and were proud of their child's work. In study two, in a randomized controlled trial conducted entirely via SMS, we investigated whether youth would watch a brief instructional animated video, and have a conversation with a parent. Results showed the majority of youth reported gained confidence in conducting a climate conversation and intended to speak to relatives. Preliminary results indicate when youth can express their climate engagement to a parent using these techniques, they have positive experiences, gain confidence in future engagements and can influence family. The studies highlight the positive impact of climate conversations as well as the potential to scale climate conversations to reach more youth and families.
Comparative genomic analysis of Vibrio parahaemolyticus: serotype conversion and virulence
Directory of Open Access Journals (Sweden)
Gil Ana I
2011-06-01
functional categories. Conclusions Our data support the idea that the pandemic strains are closely related and that recent South American outbreaks of foodborne disease caused by V. parahaemolyticus are closely linked to outbreaks in India. Serotype conversion from O3:K6 to O4:K68 was likely due to a recombination event involving a region much larger than the O-antigen- and K-antigen-encoding gene clusters. Major differences between pathogenicity islands and mobile elements are also likely driving the evolution of V. parahaemolyticus. In addition, our analyses categorized genes that may be useful in differentiating pathogenic Vibrios at the species level.
Studies on the induction of mitotic gene conversion by ultraviolet irradiation
International Nuclear Information System (INIS)
Ito, T.; Kobayashi, K.
1975-01-01
The UV (270-nm) dose-frequency relationship for the induction of intragenic mitotic recombination at trp 5 locus in Saccharomyces cerevisiae was non-linear. Two parameters, α and a, in the proposed equation for the non-linear relationship f = (at)α were determined so as to fit the experimental data by the method of least squares. The analysis was extended over 5 cell stages during synchronous growth. It was found that (1) parameter α changed from 2.02 for unbudded small cells to 1.09 for the stage where the cell had finished the division of the nucleus, and (2) parameter a changed correspondingly from 7.25.10 -4 to 0.180.10- 4 sec -1 during the same period. One interesting outcome in this analysis was the deduction of a dose-dependent nature of relative sensitivity with respect to the stage. The determination of these two parameters enabled us to calculate dose-effect relationships beyond the limits of experimental restrictions. Such an ''imaginary'' relationship, calculated at an extremely low dose, revealed the existence of maximal sensitivity around the DNA synthesis period. It was further shown that this maximum would easily be masked even in the moderate dose range. Thus, we conclude that the validity of single dose comparisons is diminished unless α is constant regardless of the cell stage. Some considerations on the proposed parameters have been made in relation to the mechanisms of the induction of gene conversion by UV
The evolution of TEP1, an exceptionally polymorphic immunity gene in Anopheles gambiae
Directory of Open Access Journals (Sweden)
Yan Guiyun
2008-10-01
Full Text Available Abstract Background Host-parasite coevolution can result in balancing selection, which maintains genetic variation in the susceptibility of hosts to parasites. It has been suggested that variation in a thioester-containing protein called TEP1 (AGAP010815 may alter the ability of Anopheles mosquitoes to transmit Plasmodium parasites, and high divergence between alleles of this gene suggests the possible action of long-term balancing selection. We studied whether TEP1 is a case of an ancient balanced polymorphism in an animal immune system. Results We found evidence that the high divergence between TEP1 alleles is the product of genetic exchange between TEP1 and other TEP loci, i.e. gene conversion. Additionally, some TEP1 alleles showed unexpectedly low variability. Conclusion The TEP1 gene appears to be a chimera produced from at least two other TEP loci, and the divergence between TEP1 alleles is probably not caused by long-term balancing selection, but is instead due to two independent gene conversion events from one of these other genes. Nevertheless, TEP1 still shows evidence of natural selection, in particular there appears to have been recent changes in the frequency of alleles that has diminished polymorphism within each allelic class. Although the selective force driving this dynamic was not identified, given that susceptibility to Plasmodium parasites is known to be associated with allelic variation in TEP1, these changes in allele frequencies could alter the vectoring capacity of populations.
Aspirin exposure reveals novel genes associated with platelet function and cardiovascular events.
Voora, Deepak; Cyr, Derek; Lucas, Joseph; Chi, Jen-Tsan; Dungan, Jennifer; McCaffrey, Timothy A; Katz, Richard; Newby, L Kristin; Kraus, William E; Becker, Richard C; Ortel, Thomas L; Ginsburg, Geoffrey S
2013-10-01
The aim of this study was to develop ribonucleic acid (RNA) profiles that could serve as novel biomarkers for the response to aspirin. Aspirin reduces death and myocardial infarction (MI), suggesting that aspirin interacts with biological pathways that may underlie these events. Aspirin was administered, followed by whole-blood RNA microarray profiling, in a discovery cohort of healthy volunteers (HV1) (n = 50) and 2 validation cohorts of healthy volunteers (HV2) (n = 53) and outpatient cardiology patients (OPC) (n = 25). Platelet function was assessed using the platelet function score (PFS) in HV1 and HV2 and the VerifyNow Aspirin Test (Accumetrics, Inc., San Diego, California) in OPC. Bayesian sparse factor analysis identified sets of coexpressed transcripts, which were examined for associations with PFS in HV1 and validated in HV2 and OPC. Proteomic analysis confirmed the association of validated transcripts in platelet proteins. Validated gene sets were tested for association with death or MI in 2 patient cohorts (n = 587 total) from RNA samples collected at cardiac catheterization. A set of 60 coexpressed genes named the "aspirin response signature" (ARS) was associated with PFS in HV1 (r = -0.31, p = 0.03), HV2 (r = -0.34, Bonferroni p = 0.03), and OPC (p = 0.046). Corresponding proteins for the 17 ARS genes were identified in the platelet proteome, of which 6 were associated with PFS. The ARS was associated with death or MI in both patient cohorts (odds ratio: 1.2 [p = 0.01]; hazard ratio: 1.5 [p = 0.001]), independent of cardiovascular risk factors. Compared with traditional risk factors, reclassification (net reclassification index = 31% to 37%, p ≤ 0.0002) was improved by including the ARS or 1 of its genes, ITGA2B. RNA profiles of platelet-specific genes are novel biomarkers for identifying patients who do not respond adequately to aspirin and who are at risk for death or MI. Copyright © 2013 American College of Cardiology Foundation. Published by
Xia, Jun Hong; Li, Hong Lian; Li, Bi Jun; Gu, Xiao Hui; Lin, Hao Ran
2018-01-10
Hypoxia is one of the critical environmental stressors for fish in aquatic environments. Although accumulating evidences indicate that gene expression is regulated by hypoxia stress in fish, how genes undergoing differential gene expression and/or alternative splicing (AS) in response to hypoxia stress in heart are not well understood. Using RNA-seq, we surveyed and detected 289 differential expressed genes (DEG) and 103 genes that undergo differential usage of exons and splice junctions events (DUES) in heart of a hypoxia tolerant fish, Nile tilapia, Oreochromis niloticus following 12h hypoxic treatment. The spatio-temporal expression analysis validated the significant association of differential exon usages in two randomly selected DUES genes (fam162a and ndrg2) in 5 tissues (heart, liver, brain, gill and spleen) sampled at three time points (6h, 12h, and 24h) under acute hypoxia treatment. Functional analysis significantly associated the differential expressed genes with the categories related to energy conservation, protein synthesis and immune response. Different enrichment categories were found between the DEG and DUES dataset. The Isomerase activity, Oxidoreductase activity, Glycolysis and Oxidative stress process were significantly enriched for the DEG gene dataset, but the Structural constituent of ribosome and Structural molecule activity, Ribosomal protein and RNA binding protein were significantly enriched only for the DUES genes. Our comparative transcriptomic analysis reveals abundant stress responsive genes and their differential regulation function in the heart tissues of Nile tilapia under acute hypoxia stress. Our findings will facilitate future investigation on transcriptome complexity and AS regulation during hypoxia stress in fish. Copyright © 2017 Elsevier B.V. All rights reserved.
Thermally Driven Transport and Relaxation Switching Self-Powered Electromagnetic Energy Conversion.
Cao, Maosheng; Wang, Xixi; Cao, Wenqiang; Fang, Xiaoyong; Wen, Bo; Yuan, Jie
2018-06-07
Electromagnetic energy radiation is becoming a "health-killer" of living bodies, especially around industrial transformer substation and electricity pylon. Harvesting, converting, and storing waste energy for recycling are considered the ideal ways to control electromagnetic radiation. However, heat-generation and temperature-rising with performance degradation remain big problems. Herein, graphene-silica xerogel is dissected hierarchically from functions to "genes," thermally driven relaxation and charge transport, experimentally and theoretically, demonstrating a competitive synergy on energy conversion. A generic approach of "material genes sequencing" is proposed, tactfully transforming the negative effects of heat energy to superiority for switching self-powered and self-circulated electromagnetic devices, beneficial for waste energy harvesting, conversion, and storage. Graphene networks with "well-sequencing genes" (w = P c /P p > 0.2) can serve as nanogenerators, thermally promoting electromagnetic wave absorption by 250%, with broadened bandwidth covering the whole investigated frequency. This finding of nonionic energy conversion opens up an unexpected horizon for converting, storing, and reusing waste electromagnetic energy, providing the most promising way for governing electromagnetic pollution with self-powered and self-circulated electromagnetic devices. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Conversion of Deletions during Recombination in Pneumococcal Transformation
Lefevre, J. C.; Mostachfi, P.; Gasc, A. M.; Guillot, E.; Pasta, F.; Sicard, M.
1989-01-01
Genetic analysis of 16 deletions obtained in the amiA locus of pneumococcus is described. When present on donor DNA, all deletions increased drastically the frequency of wild-type recombinants in two-point crosses. This effect was maximal for deletions longer than 200 bases. It was reduced for heterologies shorter than 76 bases and did not exist for very short deletions. In three-point crosses in which the deletion was localized between two point mutations, we demonstrated that this excess of wild-type recombinants was the result of a genetic conversion. This conversion extended over several scores of bases outside the deletion. Conversion takes place during the heteroduplex stage of recombination. Therefore, in pneumococcal transformation, long heterologies participated in this heteroduplex configuration. As this conversion did not require an active DNA polymerase A gene it is proposed that the mechanism of conversion is not a DNA repair synthesis but involves breakage and ligation between DNA molecules. Conversion of deletions did not require the Hex system of correction of mismatched bases. It differs also from localized conversion. It appears that it is a process that evolved to correct errors of replication which lead to long heterologies and which are not eliminated by other systems. PMID:2599365
Conversation practices and network structure in Twitter
DEFF Research Database (Denmark)
Rossi, Luca; Magnani, Matteo
2012-01-01
The public by default nature of Twitter messages, together with the adoption of the #hashtag convention led, in few years, to the creation of a digital space able to host worldwide conversation on almost every kind of topic. From major TV shows to Natural disasters there is no contemporary event...... that does not have its own #hashtag to gather together the ongoing Twitter conversation. These topical discussions take place outside of the Twitter network made of followers and friends. Nevertheless this topical network is where many of the most studied phenomena take place. Therefore Twitter based...... communication exists on two almost autonomous levels: the Twitter network made of followers and friends that shows a certain level of stability and the topical network, characterized by a high level of contingency, that appears and disappears following the rhythm of a worldwide conversation. Despite the fact...
Supercritical Carbon Dioxide Brayton Cycle Energy Conversion System
Energy Technology Data Exchange (ETDEWEB)
Cha, Jae Eun; Kim, S. O.; Seong, S. H.; Eoh, J. H.; Lee, T. H.; Choi, S. K.; Han, J. W.; Bae, S. W
2007-12-15
This report contains the description of the S-CO{sub 2} Brayton cycle coupled to KALIMER-600 as an alternative energy conversion system. For system development, a computer code was developed to calculate heat balance of 100% power operation condition. Based on the computer code, the S-CO{sub 2} Brayton cycle energy conversion system was constructed for the KALIMER-600. Using the developed turbomachinery models, the off-design characteristics and the sensitivities of the S-CO{sub 2} turbomachinery were investigated. For the development of PCHE models, a one-dimensional analysis computer code was developed to evaluate the performance of the PCHE. Possible control schemes for power control in the KALIMER-600 S-CO{sub 2} Brayton cycle were investigated by using the MARS code. Simple power reduction and recovery event was selected and analyzed for the transient calculation. For the evaluation of Na/CO{sub 2} boundary failure event, a computer was developed to simulate the complex thermodynamic behaviors coupled with the chemical reaction between liquid sodium and CO{sub 2} gas. The long term behavior of a Na/CO{sub 2} boundary failure event and its consequences which lead to a system pressure transient were evaluated.
Supercritical Carbon Dioxide Brayton Cycle Energy Conversion System
International Nuclear Information System (INIS)
Cha, Jae Eun; Kim, S. O.; Seong, S. H.; Eoh, J. H.; Lee, T. H.; Choi, S. K.; Han, J. W.; Bae, S. W.
2007-12-01
This report contains the description of the S-CO 2 Brayton cycle coupled to KALIMER-600 as an alternative energy conversion system. For system development, a computer code was developed to calculate heat balance of 100% power operation condition. Based on the computer code, the S-CO 2 Brayton cycle energy conversion system was constructed for the KALIMER-600. Using the developed turbomachinery models, the off-design characteristics and the sensitivities of the S-CO 2 turbomachinery were investigated. For the development of PCHE models, a one-dimensional analysis computer code was developed to evaluate the performance of the PCHE. Possible control schemes for power control in the KALIMER-600 S-CO 2 Brayton cycle were investigated by using the MARS code. Simple power reduction and recovery event was selected and analyzed for the transient calculation. For the evaluation of Na/CO 2 boundary failure event, a computer was developed to simulate the complex thermodynamic behaviors coupled with the chemical reaction between liquid sodium and CO 2 gas. The long term behavior of a Na/CO 2 boundary failure event and its consequences which lead to a system pressure transient were evaluated
Applying linguistic methods to understanding smoking-related conversations on Twitter.
Sanders-Jackson, Ashley; Brown, Cati G; Prochaska, Judith J
2015-03-01
Social media, such as Twitter, have become major channels of communication and commentary on popular culture, including conversations on our nation's leading addiction: tobacco. The current study examined Twitter conversations following two tobacco-related events in the media: (1) President Obama's doctor announcing that he had quit smoking and (2) the release of a photograph of Miley Cyrus (a former Disney child star) smoking a cigarette. With a focus on high-profile individuals whose actions can draw public attention, we aimed to characterise tobacco-related conversations as an example of tobacco-related public discourse and to present a novel methodology for studying social media. Tweets were collected 11-13 November 2011 (President Obama) and 1-3 August 2011 (Miley Cyrus) and analysed for relative frequency of terms, a novel application of a linguistic methodology. The President Obama data set (N=2749 tweets) had conversations about him quitting tobacco as well as a preponderance of information on political activity, links to websites, racialised terms and mention of marijuana. Websites and terms about Obama's smoke-free status were most central to the conversation. In the Miley Cyrus data (N=4746 tweets), terms that occurred with the greatest relative frequency were positive, emotional and supportive of quitting (eg, love, and please), with words such as 'love' most central to the conversation. People are talking about tobacco-related issues on Twitter, and semantic network analysis can be used to characterise on-line conversations. Future interventions may be able to harness social media and major current events to raise awareness of smoking-related issues. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Huang, Tian; Wang, Xifeng; Si, Run; Chi, Hao; Han, Binyue; Han, Haitang; Cao, Gengsheng; Zhao, Yaofeng
2018-06-01
Compared with mammals, the bird Ig genetic system relies on gene conversion to create an Ab repertoire, with inversion of the IgA-encoding gene and very few cases of Ig subclass diversification. Although gene conversion has been studied intensively, class-switch recombination, a mechanism by which the IgH C region is exchanged, has rarely been investigated in birds. In this study, based on the published genome of pigeon ( Columba livia ) and high-throughput transcriptome sequencing of immune-related tissues, we identified a transcriptionally forward α gene and found that the pigeon IgH gene locus is arranged as μ-α-υ1-υ2. In this article, we show that both DNA deletion and inversion may result from IgA and IgY class switching, and similar junction patterns were observed for both types of class-switch recombination. We also identified two subclasses of υ genes in pigeon, which share low sequence identity. Phylogenetic analysis suggests that divergence of the two pigeon υ genes occurred during the early stage of bird evolution. The data obtained in this study provide new insight into class-switch recombination and Ig gene evolution in birds. Copyright © 2018 by The American Association of Immunologists, Inc.
Jiang, P; Stone, S; Wagner, R; Wang, S; Dayananth, P; Kozak, C A; Wold, B; Kamb, A
1995-12-01
Cyclin-dependent kinase inhibitors are a growing family of molecules that regulate important transitions in the cell cycle. At least one of these molecules, p16, has been implicated in human tumorigenesis while its close homolog, p15, is induced by cell contact and transforming growth factor-beta (TGF-beta). To investigate the evolutionary and functional features of p15 and p16, we have isolated mouse (Mus musculus) homologs of each gene. Comparative analysis of these sequences provides evidence that the genes have similar functions in mouse and human. In addition, the comparison suggests that a gene conversion event is part of the evolution of the human p15 and p16 genes.
Directory of Open Access Journals (Sweden)
Rafael Turra Alarcon
Full Text Available The aim of this paper is to replace toxic coinitiators (tertiary amines by non-toxic compounds such as glycerol and inositol (polyalcohol in dimethacrylate resins. For this purpose, mid infrared spectroscopy (MIR was used to calculate the monomers' degree of conversion (%DC; as well as simultaneous Thermogravimetric Analysis – Differential Thermal Analysis (TGA-DTA and Differential Scanning Calorimetry (DSC were conducted to evaluate thermal stability, degradation steps, and thermal events. The use of different initiator systems did not modify the thermal events or the thermal stability of each of the dimethacrylate resins. Results show a substitution of system 2 (toxicity by system 3 (low toxicity, which had a good conversion velocity and total conversion in some monomers, is plausible.
McConky, Katie Theresa
2013-01-01
This work covers topics in event coreference and event classification from spoken conversation. Event coreference is the process of identifying descriptions of the same event across sentences, documents, or structured databases. Existing event coreference work focuses on sentence similarity models or feature based similarity models requiring slot…
Pandith, Arshad A; Hussain, Aashaq; Khan, Mosin S; Shah, Zafar A; Wani, M Saleem; Siddiqi, Mushtaq A
2016-01-01
Urinary bladder cancer is a common malignancy in the West and ranks as the 7th most common cancer in our region of Kashmir, India. FGFR3 mutations are frequent in superficial urothelial carcinoma (UC) differing from the RAS gene mutational pattern. The aim of this study was to analyze the frequency and association of FGFR3 and RAS gene mutations in UC cases. Paired tumor and adjacent normal tissue specimens of 65 consecutive UC patients were examined. DNA preparations were evaluated for the occurrence of FGFR3 and RAS gene mutations by PCR-SCCP and DNA sequencing. Somatic point mutations of FGFR3 were identified in 32.3% (21 of 65). The pattern and distribution were significantly associated with low grade/stage (<0.05). The overall mutations in exon 1 and 2 in all the forms of RAS genes aggregated to 21.5% and showed no association with any clinic-pathological parameters. In total, 53.8% (35 of 65) of the tumors studied had mutations in either a RAS or FGFR3 gene, but these were totally mutually exclusive in and none of the samples showed both the mutational events in mutually exclusive RAS and FGFR3. We conclude that RAS and FGFR3 mutations in UC are mutually exclusive and non-overlapping events which reflect activation of oncogenic pathways through different elements.
Losekoot, M; Hoogendoorn, E; Olmer, R; Jansen, CCAM; Oosterwijk, JC; vandenOuweland, AMW; Halley, DJJ; Warren, ST; Willemsen, R; Oostra, BA; Bakker, E
1997-01-01
The fragile X syndrome, an X linked mental retardation syndrome, is caused by an expanded CGG repeat in the first exon of the FMR1 gene. In patients with an expanded repeat the FMR1 promoter is methylated and, consequently, the gene is silenced and no FMR1 protein (FMRP) is produced, thus leading to
Alvarez, Vanessa; Rodríguez-Sáiz, Marta; de la Fuente, Juan Luis; Gudiña, Eduardo J; Godio, Ramiro P; Martín, Juan F; Barredo, José Luis
2006-04-01
The conversion of beta-carotene into xanthophylls is a subject of great scientific and industrial interest. We cloned the crtS gene involved in astaxanthin biosynthesis from two astaxanthin producing strains of Xanthophyllomyces dendrorhous: VKPM Y2410, an astaxanthin overproducing strain, and the wild type ATCC 24203. In both cases, the ORF has a length of 3166 bp, including 17 introns, and codes for a protein of 62.6 kDa with similarity to cytochrome-P450 hydroxylases. crtS gene sequences from strains VKPM Y2410, ATCC 24203, ATCC 96594, and ATCC 96815 show several nucleotide changes, but none of them causes any amino acid substitution, except a G2268 insertion in the 13th exon of ATCC 96815 which causes a change in the reading frame. A G1470 --> A change in the 5' splicing region of intron 8 was also found in ATCC 96815. Both point mutations explain astaxanthin idiotrophy and beta-carotene accumulation in ATCC 96815. Mutants accumulating precursors of the astaxanthin biosynthetic pathway were selected from the parental strain VKPM Y2410 (red) showing different colors depending on the compound accumulated. Two of them were blocked in the biosynthesis of astaxanthin, M6 (orange; 1% astaxanthin, 71 times more beta-carotene) and M7 (orange; 1% astaxanthin, 58 times more beta-carotene, 135% canthaxanthin), whereas the rest produced lower levels of astaxanthin (5-66%) than the parental strain. When the crtS gene was expressed in M7, canthaxanthin accumulation disappeared and astaxanthin production was partially restored. Moreover, astaxanthin biosynthesis was restored when X. dendrorhous ATCC 96815 was transformed with the crtS gene. The crtS gene was heterologously expressed in Mucor circinelloides conferring to this fungus an improved capacity to synthesize beta-cryptoxanthin and zeaxanthin, two hydroxylated compounds from beta-carotene. These results show that the crtS gene is involved in the conversion of beta-carotene into xanthophylls, being potentially useful to
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Directory of Open Access Journals (Sweden)
Jorge Corbacho
Full Text Available Mature-fruit abscission (MFA in fleshy-fruit is a genetically controlled process with mechanisms that, contrary to immature-fruit abscission, has not been fully characterized. Here, we use pyrosequencing to characterize the transcriptomes of melon abscission zone (AZ at three stages during AZ-cell separation in order to understand MFA control at an early stage of AZ-activation.The results show that by early induction of MFA, the melon AZ exhibits major gene induction, while by late induction of MFA, melon AZ shows major gene repression. Although some genes displayed similar regulation in both early and late induction of abscission, such as EXT1-EXT4, EGase1, IAA2, ERF1, AP2D15, FLC, MADS2, ERAF17, SAP5 and SCL13 genes, the majority had different expression patterns. This implies that time-specific events occur during MFA, and emphasizes the value of characterizing multiple time-specific abscission transcriptomes. Analysis of gene-expression from these AZs reveal that a sequential induction of cell-wall-degrading genes is associated with the upregulation of genes involved in endo and exocytosis, and a shift in plant-hormone metabolism and signaling genes during MFA. This is accompanied by transcriptional activity of small-GTPases and synthaxins together with tubulins, dynamins, V-type ATPases and kinesin-like proteins potentially involved in MFA signaling. Early events are potentially controlled by down-regulation of MADS-box, AP2/ERF and Aux/IAA transcription-factors, and up-regulation of homeobox, zinc finger, bZIP, and WRKY transcription-factors, while late events may be controlled by up-regulation of MYB transcription-factors.Overall, the data provide a comprehensive view on MFA in fleshy-fruit, identifying candidate genes and pathways associated with early induction of MFA. Our comprehensive gene-expression profile will be very useful for elucidating gene regulatory networks of the MFA in fleshy-fruit.
The conversion of fibrinogen to fibrin: A brief history of some key events.
Doolittle, Russell F
2017-07-01
The conversion of fibrinogen to fibrin is a process that has long fascinated an army of researchers. In this brief review some early break-through observations are noted and a few later unexpected results described. Copyright © 2016 Elsevier B.V. All rights reserved.
Memory for conversation and the development of common ground.
McKinley, Geoffrey L; Brown-Schmidt, Sarah; Benjamin, Aaron S
2017-11-01
Efficient conversation is guided by the mutual knowledge, or common ground, that interlocutors form as a conversation progresses. Characterized from the perspective of commonly used measures of memory, efficient conversation should be closely associated with item memory-what was said-and context memory-who said what to whom. However, few studies have explicitly probed memory to evaluate what type of information is maintained following a communicative exchange. The current study examined how item and context memory relate to the development of common ground over the course of a conversation, and how these forms of memory vary as a function of one's role in a conversation as speaker or listener. The process of developing common ground was positively related to both item and context memory. In addition, content that was spoken was remembered better than content that was heard. Our findings illustrate how memory assessments can complement language measures by revealing the impact that basic conversational processes have on memory for what has been discussed. By taking this approach, we show that not only does the process of forming common ground facilitate communication in the present, but it also promotes an enduring record of that event, facilitating conversation into the future.
Nolan-Reyes, Charlotte; Callanan, Maureen A.; Haigh, Kirsten A.
2016-01-01
Young children tend to judge improbable events to be impossible, yet there is variability across age and across individuals. Our study examined parent-child conversations about impossible and improbable events and links between parents' explanations about those events and children's possibility judgments in a reasoning task. Regression analyses…
Kühn, Nathalie; Arce-Johnson, Patricio
2012-01-01
Berry formation is the process of ovary conversion into a functional fruit, and is characterized by abrupt changes in the content of several phytohormones, associated with pollination and fertilization. Much effort has been made in order to improve our understanding of berry development, particularly from veraison to post-harvest time. However, the period of berry formation has been poorly investigated, despite its importance. Phytohormones are involved in the control of fruit formation; hence it is important to understand the regulation of their content at this stage. Grapevine is an excellent fleshy-fruit plant model since its fruits have particularities that differentiate them from those of commonly studied organisms. For instance, berries are prepared to cope with stress by producing several antioxidants and they are non-climacteric fruits. Also its genome is fully sequenced, which allows to identify genes involved in developmental processes. In grapevine, no link has been established between pollination and phytohormone biosynthesis, until recently. Here we highlight relevant findings regarding pollination effect on gene expression related to phytohormone biosynthesis, and present unpublished results showing how quickly this effect is achieved.
Functional neuroimaging of conversion disorder: the role of ancillary activation.
Burke, Matthew J; Ghaffar, Omar; Staines, W Richard; Downar, Jonathan; Feinstein, Anthony
2014-01-01
Previous functional neuroimaging studies investigating the neuroanatomy of conversion disorder have yielded inconsistent results that may be attributed to small sample sizes and disparate methodologies. The objective of this study was to better define the functional neuroanatomical correlates of conversion disorder. Ten subjects meeting clinical criteria for unilateral sensory conversion disorder underwent fMRI during which a vibrotactile stimulus was applied to anesthetic and sensate areas. A block design was used with 4 s of stimulation followed by 26 s of rest, the pattern repeated 10 times. Event-related group averages of the BOLD response were compared between conditions. All subjects were right-handed females, with a mean age of 41. Group analyses revealed 10 areas that had significantly greater activation (p conversion symptoms are associated with a pattern of abnormal cerebral activation comprising neural networks implicated in emotional processing and sensory integration. Further study of the roles and potential interplay of these networks may provide a basis for an underlying psychobiological mechanism of conversion disorder.
Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes
Directory of Open Access Journals (Sweden)
Orla Coleman
2015-03-01
Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.
Directory of Open Access Journals (Sweden)
Christian J Gröger
Full Text Available The epithelial to mesenchymal transition (EMT represents a crucial event during cancer progression and dissemination. EMT is the conversion of carcinoma cells from an epithelial to a mesenchymal phenotype that associates with a higher cell motility as well as enhanced chemoresistance and cancer stemness. Notably, EMT has been increasingly recognized as an early event of metastasis. Numerous gene expression studies (GES have been conducted to obtain transcriptome signatures and marker genes to understand the regulatory mechanisms underlying EMT. Yet, no meta-analysis considering the multitude of GES of EMT has been performed to comprehensively elaborate the core genes in this process. Here we report the meta-analysis of 18 independent and published GES of EMT which focused on different cell types and treatment modalities. Computational analysis revealed clustering of GES according to the type of treatment rather than to cell type. GES of EMT induced via transforming growth factor-β and tumor necrosis factor-α treatment yielded uniformly defined clusters while GES of models with alternative EMT induction clustered in a more complex fashion. In addition, we identified those up- and downregulated genes which were shared between the multitude of GES. This core gene list includes well known EMT markers as well as novel genes so far not described in this process. Furthermore, several genes of the EMT-core gene list significantly correlated with impaired pathological complete response in breast cancer patients. In conclusion, this meta-analysis provides a comprehensive survey of available EMT expression signatures and shows fundamental insights into the mechanisms that are governing carcinoma progression.
Kalogeropoulos, A; Thuriaux, P
1985-03-01
A hybrid DNA (hDNA) model of recombination has been algebraically formulated, which allows the prediction of frequencies of postmeiotic segregation and conversion of a given allele and their probability of being associated with a crossing over. The model considered is essentially the "Aviemore model." In contrast to some other interpretations of recombination, it states that gene conversion can only result from the repair of heteroduplex hDNA, with postmeiotic segregation resulting from unrepaired heteroduplexes. The model also postulates that crossing over always occurs distally to the initiation site of the hDNA. Eleven types of conversion and postmeiotic segregation with or without associated crossover were considered. Their theoretical frequencies are given by 11 linear equations with ten variables, four describing heteroduplex repair, four giving the probability of hDNA formation and its topological properties and two giving the probability that crossing over occurs at the left or right of the converting allele. Using the experimental data of Kitani and coworkers on conversion at the six best studied gray alleles of Sordaria fimicola, we found that the model considered fit the data at a P level above or very close (allele h4) to the 5% level of sampling error provided that the hDNA is partly asymmetric. The best fitting solutions are such that the hDNA has an equal probability of being formed on either chromatid or, alternatively, that both DNA strands have the same probability of acting as the invading strand during hDNA formation. The two mismatches corresponding to a given allele are repaired with different efficiencies. Optimal solutions are found if one allows for repair to be more efficient on the asymmetric hDNA than on the symmetric one. In the case of allele g1, our data imply that the direction of repair is nonrandom with respect to the strand on which it occurs.
Yu, Kyung Ok; Jung, Ju; Ramzi, Ahmad Bazli; Kim, Seung Wook; Park, Chulhwan; Han, Sung Ok
2012-02-01
The conversion of low-priced glycerol to higher value products has been proposed as a way to improve the economic viability of the biofuels industry. In a previous study, the conversion of glycerol to ethanol in a metabolically engineered strain of Saccharomyces cerevisiae was accomplished by minimizing the synthesis of glycerol, the main by-product in ethanol fermentation processing. To further improve ethanol production, overexpression of the native genes involved in conversion of pyruvate to ethanol in S. cerevisiae was successfully accomplished. The overexpression of an alcohol dehydrogenase (adh1) and a pyruvate decarboxylase (pdc1) caused an increase in growth rate and glycerol consumption under fermentative conditions, which led to a slight increase of the final ethanol yield. The overall expression of the adh1 and pdc1 genes in the modified strains, combined with the lack of the fps1 and gpd2 genes, resulted in a 1.4-fold increase (about 5.4 g/L ethanol produced) in fps1Δgpd2Δ (pGcyaDak, pGupCas) (about 4.0 g/L ethanol produced). In summary, it is possible to improve the ethanol yield by overexpression of the genes involved in the conversion of pyruvate to ethanol in engineered S. cerevisiae using glycerol as substrate.
Public affairs events at Ocean Sciences Meeting
Uhlenbrock, Kristan
2012-02-01
AGU public affairs will be cohosting two special events at Ocean Sciences 2012 that offer scientists opportunities to expand their communication, policy, and media experience. Join the conversations that highlight two important topics to connect science to society.
Identification of new alternative splice events in the TCIRG1 gene in different human tissues
International Nuclear Information System (INIS)
Smirnova, Anna S.; Morgun, Andrey; Shulzhenko, Natalia; Silva, Ismael D.C.G.; Gerbase-DeLima, Maria
2005-01-01
Two transcript variants (TV) of the T cell immune regulator gene 1 (TCIRG1) have already been characterized. TV1 encodes a subunit of the osteoclast vacuolar proton pump and TV2 encodes a T cell inhibitory receptor. Based on the search in dbEST, we validated by RT-PCR six new alternative splice events in TCIRG1 in most of the 28 human tissues studied. In addition, we observed that transcripts using the TV1 transcription start site and two splice forms previously described in a patient with infantile malignant osteopetrosis are also expressed in various tissues of healthy individuals. Studies of these nine splice forms in cytoplasmic RNA of peripheral blood mononuclear cells showed that at least six of them could be efficiently exported from the nucleus. Since various products with nearly ubiquitous tissue distribution are generated from TCIRG1, this gene may be involved in other processes besides immune response and bone resorption
Boulila, Moncef
2010-06-01
To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.
Early events in the evolution of spider silk genes.
Directory of Open Access Journals (Sweden)
James Starrett
Full Text Available Silk spinning is essential to spider ecology and has had a key role in the expansive diversification of spiders. Silk is composed primarily of proteins called spidroins, which are encoded by a multi-gene family. Spidroins have been studied extensively in the derived clade, Orbiculariae (orb-weavers, from the suborder Araneomorphae ('true spiders'. Orbicularians produce a suite of different silks, and underlying this repertoire is a history of duplication and spidroin gene divergence. A second class of silk proteins, Egg Case Proteins (ECPs, is known only from the orbicularian species, Lactrodectus hesperus (Western black widow. In L. hesperus, ECPs bond with tubuliform spidroins to form egg case silk fibers. Because most of the phylogenetic diversity of spiders has not been sampled for their silk genes, there is limited understanding of spidroin gene family history and the prevalence of ECPs. Silk genes have not been reported from the suborder Mesothelae (segmented spiders, which diverged from all other spiders >380 million years ago, and sampling from Mygalomorphae (tarantulas, trapdoor spiders and basal araneomorph lineages is sparse. In comparison to orbicularians, mesotheles and mygalomorphs have a simpler silk biology and thus are hypothesized to have less diversity of silk genes. Here, we present cDNAs synthesized from the silk glands of six mygalomorph species, a mesothele, and a non-orbicularian araneomorph, and uncover a surprisingly rich silk gene diversity. In particular, we find ECP homologs in the mesothele, suggesting that ECPs were present in the common ancestor of extant spiders, and originally were not specialized to complex with tubuliform spidroins. Furthermore, gene-tree/species-tree reconciliation analysis reveals that numerous spidroin gene duplications occurred after the split between Mesothelae and Opisthothelae (Mygalomorphae plus Araneomorphae. We use the spidroin gene tree to reconstruct the evolution of amino acid
An innovative seeding technique for photon conversion reconstruction at CMS
International Nuclear Information System (INIS)
Giordano, D; Sguazzoni, G
2012-01-01
The conversion of photons into electron-positron pairs in the detector material is a nuisance in the event reconstruction of high energy physics experiments, since the measurement of the electromagnetic component of interaction products results degraded. Nonetheless this unavoidable detector effect can also be extremely useful. The reconstruction of photon conversions can be used to probe the detector material and to accurately measure soft photons that come from radiative decays in heavy flavor physics. In fact a converted photon can be measured with very high momentum resolution by exploiting the excellent reconstruction of charged tracks of a tracking detector as the one of CMS at LHC. The main issue is that photon conversion tracks are difficult to reconstruct for standard reconstruction algorithms. They are typically soft and very displaced from the primary interaction vertex. An innovative seeding technique that exploits the peculiar photon conversion topology, successfully applied in the CMS track reconstruction sequence, is presented. The performances of this technique and the substantial enhancement of photon conversion reconstruction efficiency are discussed. Application examples are given.
Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.
Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P
2009-12-01
Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.
Directory of Open Access Journals (Sweden)
Geneviève Fabre
2006-05-01
Full Text Available Considering the wide range of conversations in the autobiography, this essay will attempt to appraise the importance of these verbal exchanges in relation to the overall narrative structure of the book and to the prevalent oral tradition in Louisiana culture, as both an individual and communal expression. The variety of circumstances, the setting and staging, the interlocutors , and the complex intersection of time and place, of stories and History, will be examined; in these conversations with Miss Jane many actors participate, from the interviewer-narrator, to most characters; even the reader becomes involved.Speaking, hearing, listening, keeping silent is an elaborate ritual that performs many functions; besides conveying news or rumors, it imparts information on the times and on the life of a “representative” woman whose existence - spanning a whole century- is both singular and emblematic. Most importantly this essay will analyse the resonance of an eventful and often dramatic era on her sensibility and conversely show how her evolving sensibility informs that history and draws attention to aspects that might have passed unnoticed or be forever silenced. Jane’s desire for liberty and justice is often challenged as she faces the possibilities of life or death.Conversations build up a complex, often contradictory, but compelling portrait: torn between silence and vehemence, between memories and the urge to meet the future, Jane summons body and mind to find her way through the maze of a fast changing world; self-willed and obstinate she claims her right to speak, to express with wit and wisdom her firm belief in the word, in the ability to express deep seated convictions and faith and a whole array of feelings and emotions.
Directory of Open Access Journals (Sweden)
Shong Lau
2014-12-01
Full Text Available Summary: Recent findings show that human fibroblasts can be directly programmed into functional neurons without passing via a proliferative stem cell intermediate. These findings open up the possibility of generating subtype-specific neurons of human origin for therapeutic use from fetal cell, from patients themselves, or from matched donors. In this study, we present an improved system for direct neural conversion of human fibroblasts. The neural reprogramming genes are regulated by the neuron-specific microRNA, miR-124, such that each cell turns off expression of the reprogramming genes once the cell has reached a stable neuronal fate. The regulated system can be combined with integrase-deficient vectors, providing a nonintegrative and self-regulated conversion system that rids problems associated with the integration of viral transgenes into the host genome. These modifications make the system suitable for clinical use and therefore represent a major step forward in the development of induced neurons for cell therapy. : Lau et al. now use miRNA targeting to build a self-regulating neural conversion system. Combined with nonintegrating vectors, this system can efficiently drive conversion of human fibroblasts into functional induced neurons (iNs suitable for clinical applications.
Directory of Open Access Journals (Sweden)
Jacobs Jeanne ME
2011-10-01
Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.
Genes contributing to prion pathogenesis
DEFF Research Database (Denmark)
Tamgüney, Gültekin; Giles, Kurt; Glidden, David V
2008-01-01
incubation times, indicating that the conversion reaction may be influenced by other gene products. To identify genes that contribute to prion pathogenesis, we analysed incubation times of prions in mice in which the gene product was inactivated, knocked out or overexpressed. We tested 20 candidate genes...... show that many genes previously implicated in prion replication have no discernible effect on the pathogenesis of prion disease. While most genes tested did not significantly affect survival times, ablation of the amyloid beta (A4) precursor protein (App) or interleukin-1 receptor, type I (Il1r1...
Cellular and molecular events leading to the development of skin cancer
International Nuclear Information System (INIS)
Melnikova, Vladislava O.; Ananthaswamy, Honnavara N.
2005-01-01
The transition from a normal cell to a neoplastic cell is a complex process and involves both genetic and epigenetic changes. The process of carcinogenesis begins when the DNA is damaged, which then leads to a cascade of events leading to the development of a tumor. Ultraviolet (UV) radiation causes DNA damage, inflammation, erythema, sunburn, immunosuppression, photoaging, gene mutations, and skin cancer. Upon DNA damage, the p53 tumor suppressor protein undergoes phosphorylation and translocation to the nucleus and aids in DNA repair or causes apoptosis. Excessive UV exposure overwhelms DNA repair mechanisms leading to induction of p53 mutations and loss of Fas-FasL interaction. Keratinocytes carrying p53 mutations acquire a growth advantage by virtue of their increased resistance to apoptosis. Thus, resistance to cell death is a key event in photocarcinogenesis and conversely, elimination of cells containing excessive UV-induced DNA damage is a key step in protecting against skin cancer development. Apoptosis-resistant keratinocytes undergo clonal expansion that eventually leads to formation of actinic keratoses and squamous cell carcinomas. In this article, we will review some of the cellular and molecular mechanisms involved in initiation and progression of UV-induced skin cancer
Cellular and molecular events leading to the development of skin cancer
Energy Technology Data Exchange (ETDEWEB)
Melnikova, Vladislava O. [Department of Immunology, University of Texas M.D. Anderson Cancer Center, P.O. Box 301402, Unit 902, Houston, TX 77030 (United States); Ananthaswamy, Honnavara N. [Department of Immunology, University of Texas M.D. Anderson Cancer Center, P.O. Box 301402, Unit 902, Houston, TX 77030 (United States)]. E-mail: hanantha@mdanderson.org
2005-04-01
The transition from a normal cell to a neoplastic cell is a complex process and involves both genetic and epigenetic changes. The process of carcinogenesis begins when the DNA is damaged, which then leads to a cascade of events leading to the development of a tumor. Ultraviolet (UV) radiation causes DNA damage, inflammation, erythema, sunburn, immunosuppression, photoaging, gene mutations, and skin cancer. Upon DNA damage, the p53 tumor suppressor protein undergoes phosphorylation and translocation to the nucleus and aids in DNA repair or causes apoptosis. Excessive UV exposure overwhelms DNA repair mechanisms leading to induction of p53 mutations and loss of Fas-FasL interaction. Keratinocytes carrying p53 mutations acquire a growth advantage by virtue of their increased resistance to apoptosis. Thus, resistance to cell death is a key event in photocarcinogenesis and conversely, elimination of cells containing excessive UV-induced DNA damage is a key step in protecting against skin cancer development. Apoptosis-resistant keratinocytes undergo clonal expansion that eventually leads to formation of actinic keratoses and squamous cell carcinomas. In this article, we will review some of the cellular and molecular mechanisms involved in initiation and progression of UV-induced skin cancer.
Children's Self-Esteem and Moral Self: Links to Parent-Child Conversations Regarding Emotion
Reese, Elaine; Bird, Amy; Tripp, Gail
2007-01-01
The current study has two aims: (1) to examine associations between the emotional content of parent-child past event conversations and two aspects of children's self-concept--moral self and self-esteem; and (2) to examine the degree to which talk about past events is uniquely associated with self-concept when compared with talk about ongoing…
News and events | Page 3 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
New website will help record vital life events to improve access to services for all ... Also, discover how online power imbalances are being tackled by Coding Rights ... global conversation about the working relationships between policymakers, ...
Kobayashi, H; Ngernprasirtsiri, J; Akazawa, T
1990-01-01
During transitional conversion of chloroplasts to chromoplasts in ripening tomato (Lycopersicon esculentum) fruits, transcripts for several plastid genes for photosynthesis decreased to undetectable levels. Run-on transcription of plastids indicated that transcriptional regulation operated as a predominant factor. We found that most of the genes in chloroplasts were actively transcribed in vitro by Escherichia coli and soluble plastid RNA polymerases, but some genes in chromoplasts seemed to ...
Dynamics of forest cover conversion in and around Bwindi ...
African Journals Online (AJOL)
Michael Horsfall
together determine the rates of deforestation in any particular place (Luoga et al., 2005). The conversions have not spared the forests in and around Bwindi impenetrable forest in Southern western Uganda. The protected forest has a unique eco-system with diverse gene reserves with worldwide interest. It is most popular for ...
Stressful life events are not associated with the development of dementia
Sundstr?m, Anna; R?nnlund, Michael; Adolfsson, Rolf; Nilsson, Lars-G?ran
2014-01-01
Background: The impact of stressful life events as a risk factor of dementia diseases is inconclusive. We sought to determine whether stressful negative life events are associated with incidental dementia in a population-based study with long-term follow-up. We also tested the hypothesis that the occurrence of positive life events could mitigate or overcome the possible adverse effects of negative life events on dementia conversion. Methods: The study involved 2,462 dementia-free participants...
[Screening and optimization of cholesterol conversion strain].
Fan, Dan; Xiong, Bingjian; Pang, Cuiping; Zhu, Xiangdong
2014-10-04
Bacterial strain SE-1 capable of transforming cholesterol was isolated from soil and characterized. The transformation products were identified. Fermentation conditions were optimized for conversion. Cholesterol was used as sole carbon source to isolate strain SE-1. Morphology, physiological and biochemical characteristics of strain SE-1 were studied. 16S rRNA gene was sequenced and subjected to phylogenetic analysis. Fermentation supernatants were extracted with chloroform, the transformation products were analyzed by silica gel thin layer chromatography and Sephadex LH20. Their structures were identified by 1H-NMR and 13C-NMR. Fermentation medium including carbon and nitrogen, methods of adding substrates and fermentation conditions for Strain SE-1 were optimized. Strain SE-1 was a Gram-negative bacterium, exhibiting the highest homologs to Burkholderia cepacia based on the physiological analysis. The sequence analysis of 16S rRNA gene of SE-1 strain and comparison with related Burkholderia show that SE-1 strain was very close to B. cepacia (Genbank No. U96927). The similarity was 99%. The result of silica gel thin layer chromatography shows that strain SE-1 transformed cholesterol to two products, 7beta-hydroxycholesterol and the minor product was 7-oxocholesterol. The optimum culture conditions were: molasses 5%, (NH4 )2SO4 0.3%, 4% of inoculation, pH 7.5 and 36 degrees C. Under the optimum culture condition, the conversion rate reached 34.4% when concentration of cholesterol-Tween 80 was 1 g/L. Cholesterol 7beta-hydroxylation conversion rate under optimal conditions was improved by 20.8%. Strain SE-1 isolated from soil is capable of converting cholesterol at lab-scale.
Dissecting engineered cell types and enhancing cell fate conversion via CellNet
Morris, Samantha A.; Cahan, Patrick; Li, Hu; Zhao, Anna M.; San Roman, Adrianna K.; Shivdasani, Ramesh A.; Collins, James J.; Daley, George Q.
2014-01-01
SUMMARY Engineering clinically relevant cells in vitro holds promise for regenerative medicine, but most protocols fail to faithfully recapitulate target cell properties. To address this, we developed CellNet, a network biology platform that determines whether engineered cells are equivalent to their target tissues, diagnoses aberrant gene regulatory networks, and prioritizes candidate transcriptional regulators to enhance engineered conversions. Using CellNet, we improved B cell to macrophage conversion, transcriptionally and functionally, by knocking down predicted B cell regulators. Analyzing conversion of fibroblasts to induced hepatocytes (iHeps), CellNet revealed an unexpected intestinal program regulated by the master regulator Cdx2. We observed long-term functional engraftment of mouse colon by iHeps, thereby establishing their broader potential as endoderm progenitors and demonstrating direct conversion of fibroblasts into intestinal epithelium. Our studies illustrate how CellNet can be employed to improve direct conversion and to uncover unappreciated properties of engineered cells. PMID:25126792
Directory of Open Access Journals (Sweden)
Wiedmer Stefanie
2017-01-01
Full Text Available The genus Eimeria (Apicomplexa, Coccidia provides a wide range of different species with different hosts to study common and variable features within the genus and its species. A common characteristic of all known Eimeria species is the oocyst, the infectious stage where its life cycle starts and ends. In our study, we utilized Eimeria nieschulzi as a model organism. This rat-specific parasite has complex oocyst morphology and can be transfected and even cultivated in vitro up to the oocyst stage. We wanted to elucidate how the known oocyst wall-forming proteins are preserved in this rodent Eimeria species compared to other Eimeria. In newly obtained genomics data, we were able to identify different gametocyte genes that are orthologous to already known gam genes involved in the oocyst wall formation of avian Eimeria species. These genes appeared putatively as single exon genes, but cDNA analysis showed alternative splicing events in the transcripts. The analysis of the translated sequence revealed different conserved motifs but also dissimilar regions in GAM proteins, as well as polymorphic regions. The occurrence of an underrepresented gam56 gene version suggests the existence of a second distinct E. nieschulzi genotype within the E. nieschulzi Landers isolate that we maintain.
Wiedmer, Stefanie; Erdbeer, Alexander; Volke, Beate; Randel, Stephanie; Kapplusch, Franz; Hanig, Sacha; Kurth, Michael
2017-01-01
The genus Eimeria (Apicomplexa, Coccidia) provides a wide range of different species with different hosts to study common and variable features within the genus and its species. A common characteristic of all known Eimeria species is the oocyst, the infectious stage where its life cycle starts and ends. In our study, we utilized Eimeria nieschulzi as a model organism. This rat-specific parasite has complex oocyst morphology and can be transfected and even cultivated in vitro up to the oocyst stage. We wanted to elucidate how the known oocyst wall-forming proteins are preserved in this rodent Eimeria species compared to other Eimeria. In newly obtained genomics data, we were able to identify different gametocyte genes that are orthologous to already known gam genes involved in the oocyst wall formation of avian Eimeria species. These genes appeared putatively as single exon genes, but cDNA analysis showed alternative splicing events in the transcripts. The analysis of the translated sequence revealed different conserved motifs but also dissimilar regions in GAM proteins, as well as polymorphic regions. The occurrence of an underrepresented gam56 gene version suggests the existence of a second distinct E. nieschulzi genotype within the E. nieschulzi Landers isolate that we maintain. PMID:29210668
The evolutionary landscape of intergenic trans-splicing events in insects
Kong, Yimeng; Zhou, Hongxia; Yu, Yao; Chen, Longxian; Hao, Pei; Li, Xuan
2015-01-01
To explore the landscape of intergenic trans-splicing events and characterize their functions and evolutionary dynamics, we conduct a mega-data study of a phylogeny containing eight species across five orders of class Insecta, a model system spanning 400 million years of evolution. A total of 1,627 trans-splicing events involving 2,199 genes are identified, accounting for 1.58% of the total genes. Homology analysis reveals that mod(mdg4)-like trans-splicing is the only conserved event that is consistently observed in multiple species across two orders, which represents a unique case of functional diversification involving trans-splicing. Thus, evolutionarily its potential for generating proteins with novel function is not broadly utilized by insects. Furthermore, 146 non-mod trans-spliced transcripts are found to resemble canonical genes from different species. Trans-splicing preserving the function of ‘breakup' genes may serve as a general mechanism for relaxing the constraints on gene structure, with profound implications for the evolution of genes and genomes. PMID:26521696
van der Merwe, Johan; Van Praet, Frank; Stockman, Bernard; Degrieck, Ivan; Vermeulen, Yvette; Casselman, Filip
2018-02-14
This study reports the factors that contribute to sternotomy conversions (SCs) and adverse intraoperative events in minimally invasive aortic valve surgery (MI-AVS) and minimally invasive Endoscopic Port Access™ atrioventricular valve surgery (MI-PAS). In total, 3780 consecutive patients with either aortic valve disease or atrioventricular valve disease underwent minimally invasive valve surgery (MIVS) at our institution between 1 February 1997 and 31 March 2016. MI-AVS was performed in 908 patients (mean age 69.2 ± 11.3 years, 45.2% women, 6.2% redo cardiac surgery) and MI-PAS in 2872 patients (mean age 64.1 ± 13.3 years, 46.7% women, 12.2% redo cardiac surgery). A cumulative total of 4415 MIVS procedures (MI-AVS = 908, MI-PAS = 3507) included 1537 valve replacements (MI-AVS = 896, MI-PAS = 641) and 2878 isolated or combined valve repairs (MI-AVS = 12, MI-PAS = 2866). SC was required in 3.0% (n = 114 of 3780) of MIVS patients, which occurred in 3.1% (n = 28 of 908) of MI-AVS patients and 3.0% (n = 86 of 2872) of MI-PAS patients, respectively. Reasons for SC in MI-AVS included inadequate visualization (n = 4, 0.4%) and arterial cannulation difficulty (n = 7, 0.8%). For MI-PAS, SC was required in 54 (2.5%) isolated mitral valve procedures (n = 2183). Factors that contributed to SC in MI-PAS included lung adhesions (n = 35, 1.2%), inadequate visualization (n = 2, 0.1%), ventricular bleeding (n = 3, 0.1%) and atrioventricular dehiscence (n = 5, 0.2%). Neurological deficit occurred in 1 (0.1%) and 3 (3.5%) MI-AVS and MI-PAS conversions, respectively. No operative or 30-day mortalities were observed in MI-AVS conversions (n = 28). The 30-day mortality associated with SC in MI-PAS (n = 86) was 10.5% (n = 9). MIVS is increasingly being recognized as the 'gold-standard' for surgical valve interventions in the context of rapidly expanding catheter-based technology and increasing
Chromosomal evolution of the PKD1 gene family in primates
Directory of Open Access Journals (Sweden)
Krawczak Michael
2008-09-01
Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative
Directory of Open Access Journals (Sweden)
Lehrke Stephanie
2008-10-01
Full Text Available Abstract Background Mutations in MYBPC3 encoding myosin binding protein C belong to the most frequent causes of hypertrophic cardiomyopathy (HCM and may also lead to dilated cardiomyopathy (DCM. MYBPC3 mutations initially were considered to cause a benign form of HCM. The aim of this study was to examine the clinical outcome of patients and their relatives with 18 different MYBPC3 mutations. Methods 87 patients with HCM and 71 patients with DCM were screened for MYBPC3 mutations by denaturing gradient gel electrophoresis and sequencing. Close relatives of mutation carriers were genotyped for the respective mutation. Relatives with mutation were then evaluated by echocardiography and magnetic resonance imaging. A detailed family history regarding adverse clinical events was recorded. Results In 16 HCM (18.4% and two DCM (2.8% index patients a mutation was detected. Seven mutations were novel. Mutation carriers exhibited no additional mutations in genes MYH7, TNNT2, TNNI3, ACTC and TPM1. Including relatives of twelve families, a total number of 42 mutation carriers was identified of which eleven (26.2% had at least one adverse event. Considering the twelve families and six single patients with mutations, 45 individuals with cardiomyopathy and nine with borderline phenotype were identified. Among the 45 patients, 23 (51.1% suffered from an adverse event. In eleven patients of seven families an unexplained sudden death was reported at the age between 13 and 67 years. Stroke or a transient ischemic attack occurred in six patients of five families. At least one adverse event occurred in eleven of twelve families. Conclusion MYBPC3 mutations can be associated with cardiac events such as progressive heart failure, stroke and sudden death even at younger age. Therefore, patients with MYBPC3 mutations require thorough clinical risk assessment.
Directory of Open Access Journals (Sweden)
Charlebois Robert L
2005-04-01
Full Text Available Abstract Background When organismal phylogenies based on sequences of single marker genes are poorly resolved, a logical approach is to add more markers, on the assumption that weak but congruent phylogenetic signal will be reinforced in such multigene trees. Such approaches are valid only when the several markers indeed have identical phylogenies, an issue which many multigene methods (such as the use of concatenated gene sequences or the assembly of supertrees do not directly address. Indeed, even when the true history is a mixture of vertical descent for some genes and lateral gene transfer (LGT for others, such methods produce unique topologies. Results We have developed software that aims to extract evidence for vertical and lateral inheritance from a set of gene trees compared against an arbitrary reference tree. This evidence is then displayed as a synthesis showing support over the tree for vertical inheritance, overlaid with explicit lateral gene transfer (LGT events inferred to have occurred over the history of the tree. Like splits-tree methods, one can thus identify nodes at which conflict occurs. Additionally one can make reasonable inferences about vertical and lateral signal, assigning putative donors and recipients. Conclusion A tool such as ours can serve to explore the reticulated dimensionality of molecular evolution, by dissecting vertical and lateral inheritance at high resolution. By this, we mean that individual nodes can be examined not only for congruence, but also for coherence in light of LGT. We assert that our tools will facilitate the comparison of phylogenetic trees, and the interpretation of conflicting data.
Principe, Gabrielle F.; Schindewolf, Erica
2012-01-01
Research on factors that can affect the accuracy of children’s autobiographical remembering has important implications for understanding the abilities of young witnesses to provide legal testimony. In this article, we review our own recent research on one factor that has much potential to induce errors in children’s event recall, namely natural memory sharing conversations with peers and parents. Our studies provide compelling evidence that not only can the content of conversations about the past intrude into later memory but that such exchanges can prompt the generation of entirely false narratives that are more detailed than true accounts of experienced events. Further, our work show that deeper and more creative participation in memory sharing dialogues can boost the damaging effects of conversationally conveyed misinformation. Implications of this collection of findings for children’s testimony are discussed. PMID:23129880
Cooke, Megan E; Meyers, Jacquelyn L; Latvala, Antti; Korhonen, Tellervo; Rose, Richard J; Kaprio, Jaakko; Salvatore, Jessica E; Dick, Danielle M
2015-10-01
The purpose of this study was to address two methodological issues that have called into question whether previously reported gene-environment interaction (GxE) effects for adolescent alcohol use are 'real'. These issues are (1) the potential correlation between the environmental moderator and the outcome across twins and (2) non-linear transformations of the behavioral outcome. Three environments that have been previously studied (peer deviance, parental knowledge, and potentially stressful life events) were examined here. For each moderator (peer deviance, parental knowledge, and potentially stressful life events), a series of models was fit to both a raw and transformed measure of monthly adolescent alcohol use in a sample that included 825 dizygotic (DZ) and 803 monozygotic (MZ) twin pairs. The results showed that the moderating effect of peer deviance was robust to transformation, and that although the significance of moderating effects of parental knowledge and potentially stressful life events were dependent on the scale of the adolescent alcohol use outcome, the overall results were consistent across transformation. In addition, the findings did not vary across statistical models. The consistency of the peer deviance results and the shift of the parental knowledge and potentially stressful life events results between trending and significant, shed some light on why previous findings for certain moderators have been inconsistent and emphasize the importance of considering both methodological issues and previous findings when conducting and interpreting GxE analyses.
Conversion disorder: current problems and potential solutions for DSM-5.
Stone, Jon; LaFrance, W Curt; Brown, Richard; Spiegel, David; Levenson, James L; Sharpe, Michael
2011-12-01
Conversion disorder in the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV-TR) describes neurological symptoms, including weakness, numbness and events resembling epilepsy or syncope, which can be positively identified as not being due to recognised neurological disease. This review combines perspectives from psychiatry, psychology and neurology to identify and discuss key problems with the current diagnostic DSM-IV criteria for conversion disorder and to make the following proposals for DSM-5: (a) abandoning the label "conversion disorder" and replacing it with an alternative term that is both theoretically neutral and potentially more acceptable to patients and practitioners; (b) relegating the requirements for "association of psychological factors" and the "exclusion of feigning" to the accompanying text; (c) adding a criterion requiring clinical findings of internal inconsistency or incongruity with recognised neurological or medical disease and altering the current 'disease exclusion' criteria to one in which the symptom must not be 'better explained' by a disease if present, (d) adding a 'cognitive symptoms' subtype. We also discuss whether conversion symptoms are better classified with other somatic symptom disorders or with dissociative disorders and how we might address the potential heterogeneity of conversion symptoms in classification. 2011 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Casula, Milena; Sini, MariaCristina; Palomba, Grazia; The Italian Melanoma Intergroup; Palmieri, Giuseppe; Muggiano, Antonio; Cossu, Antonio; Budroni, Mario; Caracò, Corrado; Ascierto, Paolo A; Pagani, Elena; Stanganelli, Ignazio; Canzanella, Sergio
2009-01-01
Several genetic alterations have been demonstrated to contribute to the development and progression of melanoma. In this study, we further investigated the impact of key-regulator genes in susceptibility and pathogenesis of such a disease. A large series (N = 846) of sporadic and familial cases originating from South Italy was screened for germline mutations in p16 CDKN2A , BRCA2, and MC1R genes by DHPLC analysis and automated DNA sequencing. Paired primary melanomas and lymph node metastases from same patients (N = 35) as well as melanoma cell lines (N = 18) were analyzed for somatic mutations in NRAS, BRAF, and p16 CDKN2A genes. For melanoma susceptibility, investigations at germline level indicated that p16 CDKN2A was exclusively mutated in 16/545 (2.9%) non-Sardinian patients, whereas BRCA2 germline mutations were observed in 4/91 (4.4%) patients from North Sardinia only. Two MC1R germline variants, Arg151Cys and Asp294His, were significantly associated with melanoma in Sardinia. Regarding genetic events involved in melanoma pathogenesis at somatic level, mutually-exclusive mutations of NRAS and BRAF genes were observed at quite same rate (about two thirds) in cultured and in vivo melanomas (either primary or metastatic lesions). Conversely, p16 CDKN2A gene alterations were observed at increased rates moving from primary to metastatic melanomas and melanoma cell lines. Activation of the ERK gene product was demonstrated to be consistently induced by a combination of molecular alterations (NRAS/BRAF mutations and p16 CDKN2A silencing). Our findings further clarified that: a) mutation prevalence in melanoma susceptibility genes may vary within each specific geographical area; b) multiple molecular events are accumulating during melanomagenesis
Family Health Conversations: How Do They Support Health?
Benzein, Eva
2014-01-01
Research shows that living with illness can be a distressing experience for the family and may result in suffering and reduced health. To meet families' needs, family systems intervention models are developed and employed in clinical contexts. For successful refinement and implementation it is important to understand how these models work. The aim of this study was therefore to describe the dialogue process and possible working mechanisms of one systems nursing intervention model, the Family Health Conversation model. A descriptive evaluation design was applied and 15 transcribed conversations with five families were analyzed within a hermeneutic tradition. Two types of interrelated dialogue events were identified: narrating and exploring. There was a flow between these events, a movement that was generated by the interaction between the participants. Our theoretically grounded interpretation showed that narrating, listening, and reconsidering in interaction may be understood as supporting family health by offering the families the opportunity to constitute self-identity and identity within the family, increasing the families' understanding of multiple ways of being and acting, to see new possibilities and to develop meaning and hope. Results from this study may hopefully contribute to the successful implementation of family systems interventions in education and clinical praxis. PMID:24800068
Paralogous Genes as a Tool to Study the Regulation of Gene Expression
DEFF Research Database (Denmark)
Hoffmann, Robert D
The genomes of plants are marked by reoccurring events of whole-genome duplication. These events are major contributors to speciation and provide the genetic material for organisms to evolve ever greater complexity. Duplicated genes, referred to as paralogs, may be retained because they acquired...... regions. These results suggest that a concurrent purifying selection acts on coding and non-coding sequences of paralogous genes in A. thaliana. Mutational analyses of the promoters from a paralogous gene pair were performed in transgenic A. thaliana plants. The results revealed a 170-bp long DNA sequence...... that forms a bifunctional cis-regulatory module; it represses gene expression in the sporophyte while activating it in pollen. This finding is important for many aspects of gene regulation and the transcriptional changes underlying gametophyte development. In conclusion, the presented thesis suggests that...
Directory of Open Access Journals (Sweden)
Pertti Happonen
Full Text Available BACKGROUND: The role of coffee intake as a risk factor for coronary heart disease (CHD has been debated for decades. We examined whether the relationship between coffee intake and incidence of CHD events is dependent on the metabolism of circulating catecholamines, as determined by functional polymorphism of the catechol-O-methyltransferase (COMT gene. METHODOLOGY/PRINCIPAL FINDINGS: In a cohort of 773 men who were 42 to 60 years old and free of symptomatic CHD at baseline in 1984-89, 78 participants experienced an acute coronary event during an average follow-up of 13 years. In logistic regression adjusting for age, smoking, family history of CHD, vitamin C deficiency, blood pressure, plasma cholesterol concentration, and diabetes, the odds ratio (90% confidence interval comparing heavy coffee drinkers with the low activity COMT genotype with those with the high activity or heterozygotic genotypes was 3.2 (1.2-8.4. Urinary adrenaline excretion increased with increasing coffee intake, being over two-fold in heavy drinkers compared with nondrinkers (p = 0.008 for trend. CONCLUSIONS/SIGNIFICANCE: Heavy coffee consumption increases the incidence of acute coronary events in men with low but not high COMT activity. Further studies are required to determine to which extent circulating catecholamines mediate the relationship between coffee intake and CHD.
International Nuclear Information System (INIS)
Oliver, Lena; Peterson, Jenny; Wilhelmsen, Katarina
2006-03-01
FOI, has performed a study on uranium conversion processes that are of importance in the production of different uranium compounds in the nuclear industry. The same conversion processes are of interest both when production of nuclear fuel and production of fissile material for nuclear weapons are considered. Countries that have nuclear weapons ambitions, with the intention to produce highly enriched uranium for weapons purposes, need some degree of uranium conversion capability depending on the uranium feed material available. This report describes the processes that are needed from uranium mining and milling to the different conversion processes for converting uranium ore concentrate to uranium hexafluoride. Uranium hexafluoride is the uranium compound used in most enrichment facilities. The processes needed to produce uranium dioxide for use in nuclear fuel and the processes needed to convert different uranium compounds to uranium metal - the form of uranium that is used in a nuclear weapon - are also presented. The production of uranium ore concentrate from uranium ore is included since uranium ore concentrate is the feed material required for a uranium conversion facility. Both the chemistry and principles or the different uranium conversion processes and the equipment needed in the processes are described. Since most of the equipment that is used in a uranium conversion facility is similar to that used in conventional chemical industry, it is difficult to determine if certain equipment is considered for uranium conversion or not. However, the chemical conversion processes where UF 6 and UF 4 are present require equipment that is made of corrosion resistant material
Suzuki, Shun'ichi; Takenaka, Yasuhiro; Onishi, Norimasa; Yokozeki, Kenzo
2005-08-01
A DNA fragment from Microbacterium liquefaciens AJ 3912, containing the genes responsible for the conversion of 5-substituted-hydantoins to alpha-amino acids, was cloned in Escherichia coli and sequenced. Seven open reading frames (hyuP, hyuA, hyuH, hyuC, ORF1, ORF2, and ORF3) were identified on the 7.5 kb fragment. The deduced amino acid sequence encoded by the hyuA gene included the N-terminal amino acid sequence of the hydantoin racemase from M. liquefaciens AJ 3912. The hyuA, hyuH, and hyuC genes were heterologously expressed in E. coli; their presence corresponded with the detection of hydantoin racemase, hydantoinase, and N-carbamoyl alpha-amino acid amido hydrolase enzymatic activities respectively. The deduced amino acid sequences of hyuP were similar to those of the allantoin (5-ureido-hydantoin) permease from Saccharomyces cerevisiae, suggesting that hyuP protein might function as a hydantoin transporter.
Effects of polymorphisms in ovine and caprine prion protein alleles on cell-free conversion
Directory of Open Access Journals (Sweden)
Eiden Martin
2011-02-01
Full Text Available Abstract In sheep polymorphisms of the prion gene (PRNP at the codons 136, 154 and 171 strongly influence the susceptibility to scrapie and bovine spongiform encephalopathy (BSE infections. In goats a number of other gene polymorphisms were found which are suspected to trigger similar effects. However, no strong correlation between polymorphisms and TSE susceptibility in goats has yet been obtained from epidemiological studies and only a low number of experimental challenge data are available at present. We have therefore studied the potential impact of these polymorphisms in vitro by cell-free conversion assays using mouse scrapie strain Me7. Mouse scrapie brain derived PrPSc served as seeds and eleven recombinant single mutation variants of sheep and goat PrPC as conversion targets. With this approach it was possible to assign reduced conversion efficiencies to specific polymorphisms, which are associated to low frequency in scrapie-affected goats or found only in healthy animals. Moreover, we could demonstrate a dominant-negative inhibition of prion polymorphisms associated with high susceptibility by alleles linked to low susceptibility in vitro.
Han, Dong; Qiao, Zhengxue; Chen, Lu; Qiu, Xiaohui; Fang, Deyu; Yang, Xiuxian; Ma, Jingsong; Chen, Mingqi; Yang, Jiarun; Wang, Lin; Zhu, Xiongzhao; Zhang, Congpei; Yang, Yanjie; Pan, Hui
2017-08-01
Recent studies suggest that vascular endothelial growth factor (VEGF) is involved in the development of major depressive disorder. The aim of this study is to investigate the interaction between vascular endothelial growth factor (VEGF) polymorphism (+405G/C, rs2010963) and negative life events in the pathogenesis of major depressive disorder (MDD). DNA genotyping was performed on peripheral blood leukocytes in 274 patients with MDD and 273 age-and sex-matched controls. The frequency and severity of negative life events were assessed by the Life Events Scale (LES). A logistics method was employed to assess the gene-environment interaction (G×E). Differences in rs2010963 genotype distributions were observed between MDD patients and controls. Significant G×E interactions between allelic variation of rs2010963 and negative life events were observed. Individuals carrying the C alleles were susceptible to MDD only when exposed to high-negative life events. These results indicate that interactions between the VEGF rs2010963 polymorphism and environment increases the risk of developing MDD. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Olesen, Mads Nikolaj; Soelberg, Kerstin; Nilsson, Anna Christine
Background: Optic neuritis (ON) is often an early inflammatory, demyelinating event of multiple sclerosis (MS). We proffer that cytokine and chemokine profiles may (a) differ between patients with MS-related ON and those with non-MS-related ON and (b) predict conversion to MS in patients presenting......-up compared to those who had not. These findings are of potential relevance to our understanding of the pathogenesis of MS and may predict conversion of ON to MS....
Yu, Pengtao; Wang, Yanhui; Coles, Neil; Xiong, Wei; Xu, Lihong
2015-01-01
The "Grain for Green Project" is a country-wide ecological program to converse marginal cropland to forest, which has been implemented in China since 2002. To quantify influence of this significant vegetation change, Guansihe Hydrological (GSH) Model, a validated physically-based distributed hydrological model, was applied to simulate runoff responses to land use change in the Guansihe watershed that is located in the upper reaches of the Yangtze River basin in Southwestern China with an area of only 21.1 km2. Runoff responses to two single rainfall events, 90 mm and 206 mm respectively, were simulated for 16 scenarios of cropland to forest conversion. The model simulations indicated that the total runoff generated after conversion to forest was strongly dependent on whether the land was initially used for dry croplands without standing water in fields or constructed (or walled) paddy fields. The simulated total runoff generated from the two rainfall events displayed limited variation for the conversion of dry croplands to forest, while it strongly decreased after paddy fields were converted to forest. The effect of paddy terraces on runoff generation was dependent on the rainfall characteristics and antecedent moisture (or saturation) conditions in the fields. The reduction in simulated runoff generated from intense rainfall events suggested that afforestation and terracing might be effective in managing runoff and had the potential to mitigate flooding in southwestern China. PMID:26192181
Importance of individual events in temporal networks
International Nuclear Information System (INIS)
Takaguchi, Taro; Masuda, Naoki; Sato, Nobuo; Yano, Kazuo
2012-01-01
Records of time-stamped social interactions between pairs of individuals (e.g. face-to-face conversations, e-mail exchanges and phone calls) constitute a so-called temporal network. A remarkable difference between temporal networks and conventional static networks is that time-stamped events rather than links are the unit elements generating the collective behavior of nodes. We propose an importance measure for single interaction events. By generalizing the concept of the advance of events proposed by Kossinets et al (2008 Proc. 14th ACM SIGKDD Int. Conf. on Knowledge Discovery and Data Mining p 435), we propose that an event is central when it carries new information about others to the two nodes involved in the event. We find that the proposed measure properly quantifies the importance of events in connecting nodes along time-ordered paths. Because of strong heterogeneity in the importance of events present in real data, a small fraction of highly important events is necessary and sufficient to sustain the connectivity of temporal networks. Nevertheless, in contrast to the behavior of scale-free networks against link removal, this property mainly results from bursty activity patterns and not heterogeneous degree distributions. (paper)
The Role of Conversation Policy in Carrying Out Agent Conversations
International Nuclear Information System (INIS)
Link, Hamilton E.; Phillips, Laurence R.
1999-01-01
Structured conversation diagrams, or conversation specifications, allow agents to have predictable interactions and achieve predefined information-based goals, but they lack the flexibility needed to function robustly in an unpredictable environment. We propose a mechanism that combines a typical conversation structure with a separately established policy to generate an actual conversation. The word ''policy'' connotes a high-level direction external to a specific planned interaction with the environment. Policies, which describe acceptable procedures and influence decisions, can be applied to broad sets of activity. Based on their observation of issues related to a policy, agents may dynamically adjust their communication patterns. The policy object describes limitations, constraints, and requirements that may affect the conversation in certain circumstances. Using this new mechanism of interaction simplifies the description of individual conversations and allows domain-specific issues to be brought to bear more easily during agent communication. By following the behavior of the conversation specification when possible and deferring to the policy to derive behavior in exceptional circumstances, an agent is able to function predictably under normal situations and still act rationally in abnormal situations. Different conversation policies applied to a given conversation specification can change the nature of the interaction without changing the specification
Directory of Open Access Journals (Sweden)
Malin Lando
2009-11-01
Full Text Available Integrative analysis of gene dosage, expression, and ontology (GO data was performed to discover driver genes in the carcinogenesis and chemoradioresistance of cervical cancers. Gene dosage and expression profiles of 102 locally advanced cervical cancers were generated by microarray techniques. Fifty-two of these patients were also analyzed with the Illumina expression method to confirm the gene expression results. An independent cohort of 41 patients was used for validation of gene expressions associated with clinical outcome. Statistical analysis identified 29 recurrent gains and losses and 3 losses (on 3p, 13q, 21q associated with poor outcome after chemoradiotherapy. The intratumor heterogeneity, assessed from the gene dosage profiles, was low for these alterations, showing that they had emerged prior to many other alterations and probably were early events in carcinogenesis. Integration of the alterations with gene expression and GO data identified genes that were regulated by the alterations and revealed five biological processes that were significantly overrepresented among the affected genes: apoptosis, metabolism, macromolecule localization, translation, and transcription. Four genes on 3p (RYBP, GBE1 and 13q (FAM48A, MED4 correlated with outcome at both the gene dosage and expression level and were satisfactorily validated in the independent cohort. These integrated analyses yielded 57 candidate drivers of 24 genetic events, including novel loci responsible for chemoradioresistance. Further mapping of the connections among genetic events, drivers, and biological processes suggested that each individual event stimulates specific processes in carcinogenesis through the coordinated control of multiple genes. The present results may provide novel therapeutic opportunities of both early and advanced stage cervical cancers.
Tanaka, Masahiko; Niimi, Aya; Tomita, Kyoichi; Homma, Yukio
2010-04-01
α1 -blockers have commonly been used as first-line medical therapy for symptomatic benign prostatic hyperplasia (BPH). Recently, a highly selective α1A -adrenoceptor antagonist, silodosin, was developed in Japan. We examined the efficacy and safety of conversion from conventional α1 -blockers to silodosin in men with BPH. Conversion to silodosin was proposed to consecutive patients on conventional α1 -blockers for symptomatic BPH for at least 6 months. The effects of conversion were examined by the International Prostate Symptom Score, quality of life index, overactive bladder symptom score, peak flow rate, residual urine volume, and adverse events at 12 weeks. The efficacy of silodosin was also evaluated by patients' impression. Eighty-one men underwent conversion, for the most part because of dissatisfaction with the efficacy of their current treatment in improving nocturia or weak stream. The International Prostate Symptom Score total score significantly improved from 12.7 ± 5.9 at baseline to 10.6 ± 5.4 at 4 weeks (P silodosin. Efficacy as judged by patients' impression was 76% (37/49) at 12 weeks of treatment. None of the overactive bladder symptom score, peak flow rate, and residual urine volume exhibited significant change. No serious adverse events were observed during the study period. Conversion to silodosin may be beneficial in men who are dissatisfied with conventional α1 -blockers for BPH, and be particularly useful in improving voiding symptoms. © 2010 Blackwell Publishing Asia Pty Ltd.
Directory of Open Access Journals (Sweden)
Gheysen Godelieve
2008-11-01
PPN GHF5 endoglucanase gene most probably consisted of the whole gene cassette, i.e. the GHF5 catalytic domain and the CBM2, rather than that it evolved by domain shuffling. Our evolutionary model for the gene structure in PPN GHF5 endoglucanases implies the occurrence of an early duplication event, and more recent gene duplications at genus or species level.
Kyndt, Tina; Haegeman, Annelies; Gheysen, Godelieve
2008-11-03
the whole gene cassette, i.e. the GHF5 catalytic domain and the CBM2, rather than that it evolved by domain shuffling. Our evolutionary model for the gene structure in PPN GHF5 endoglucanases implies the occurrence of an early duplication event, and more recent gene duplications at genus or species level.
Directory of Open Access Journals (Sweden)
Zhitao Niu
2017-11-01
Full Text Available The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1 consistent GC content evolution trends and mutational biases in single-copy (SC and inverted repeats (IRs regions; and (2 that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus.
Niu, Zhitao; Xue, Qingyun; Wang, Hui; Xie, Xuezhu; Zhu, Shuying; Liu, Wei; Ding, Xiaoyu
2017-01-01
The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC)—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1) consistent GC content evolution trends and mutational biases in single-copy (SC) and inverted repeats (IRs) regions; and (2) that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus. PMID:29099062
Jaramillo, Vinicio D Armijos; Sukno, Serenella A; Thon, Michael R
2015-01-02
Horizontal gene transfer (HGT) is the stable transmission of genetic material between organisms by means other than vertical inheritance. HGT has an important role in the evolution of prokaryotes but is relatively rare in eukaryotes. HGT has been shown to contribute to virulence in eukaryotic pathogens. We studied the importance of HGT in plant pathogenic fungi by identifying horizontally transferred genes in the genomes of three members of the genus Colletotrichum. We identified eleven HGT events from bacteria into members of the genus Colletotrichum or their ancestors. The HGT events include genes involved in amino acid, lipid and sugar metabolism as well as lytic enzymes. Additionally, the putative minimal dates of transference were calculated using a time calibrated phylogenetic tree. This analysis reveals a constant flux of genes from bacteria to fungi throughout the evolution of subphylum Pezizomycotina. Genes that are typically transferred by HGT are those that are constantly subject to gene duplication and gene loss. The functions of some of these genes suggest roles in niche adaptation and virulence. We found no evidence of a burst of HGT events coinciding with major geological events. In contrast, HGT appears to be a constant, albeit rare phenomenon in the Pezizomycotina, occurring at a steady rate during their evolution.
COMET/PRISM Muon to Electron Conversion at J-PARC
International Nuclear Information System (INIS)
Hungerford, Ed V.
2009-01-01
A new experimental search for coherent, neutrinoless, muon-to-electron conversion from a muonic atom has been proposed for the Japanese Proton Accelerator, J-PARC, now under commissioning. The experiment is completing a conceptual design which proposes a single event sensitivity in the branching ratio of lepton number violating to lepton conserving decays of ≅0.26x10 -16 . This note briefly describes the experiment and its objectives.
Kebir, Oussama; Chaumette, Boris; Krebs, Marie-Odile
2018-04-26
Conversion to psychosis is a longitudinal process during which several epigenetic changes have been described. We tested the hypothesis that epigenetic variability in the methylomes of ultra-high risk (UHR) individuals may contribute to the risk of conversion. We studied a longitudinal cohort of UHR individuals (n = 39) and compared two groups (converters, n = 14 vs. non-converters, n = 25). A longitudinal methylomic study was conducted using Infinium HumanMethylation450 BeadChip covering half a million cytosine-phosphate-guanine (CpG) sites across the human genome from whole-blood samples. We used two statistical methods to investigate the variability of methylation probes. (i) The search for longitudinal variable methylation probes (VMPs) based on median comparisons identified two VMPs in converters only. The first CpG was located in the MACROD2 gene and the second CpG was in an intergenic region at 8q24.21. (ii) The detection of outliers using variance analysis related to private epimutations identified a dozen CpGs in converters only and highlighted two genes (RAC1 and SPHK1) from the sphingolipid signaling pathway. Our study is the first to support increased methylome variability during conversion to psychosis. We speculate that stochastic factors could increase DNA methylation variability and have a role in the complex pathophysiology of conversion to psychosis as well as in other psychiatric diseases.
International Nuclear Information System (INIS)
Edao, Yuki; Sato, Katsumi; Iwai, Yasunori; Hayashi, Takumi
2017-01-01
Thoughtful consideration of abnormal events such as fire is required to design and qualify a detritiation system (DS) of a nuclear fusion facility. Since conversion of tritium to tritiated vapor over catalyst is the key process of the DS, it is indispensable to evaluate the effect of excess moisture and hydrocarbons produced by combustion of cables on tritium conversion rate considering fire events. We conducted demonstration tests on tritium conversion under the following representative conditions: (I) leakage of tritium, (II) leakage of tritium plus moisture, and (III) leakage of tritium plus hydrocarbons. Detritiation behavior in the simulated room was assessed, and the amount of catalyst to fulfill the requirement on tritium conversion rate was evaluated. The dominant parameters for detritiation are the concentration of hydrogen in air and catalyst temperature. The tritium in the simulated room was decreased for condition (I) following ventilation theory. An initial reduction in conversion rate was measured for condition (II). To recover the reduction smoothly, it is suggested to optimize the power of preheater. An increase in catalyst temperature by heat of reaction of hydrocarbon combustion was evaluated for condition (III). The heat balance of catalytic reactor is a point to be carefully investigated to avoid runaway of catalyst temperature. (author)
Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira
2016-10-13
PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.
Improvement of skeleton conversion in ICRP reference phantom conversion project
Energy Technology Data Exchange (ETDEWEB)
Wang, Zhao Jun; Yeom, Yeon Soo; Thang, Nguyen Tat; Kim, Han Sung; Han, Min Cheol; Kim, Chan Hyeong [Dept. of Nuclear Engineering, Hanyang University, Seoul (Korea, Republic of); Kim, Seong Hoon [Dept. of Radiation Oncology, College of Medicine, Hanyang University, Seoul (Korea, Republic of)
2014-11-15
In the previous skeleton conversion, most bones were directly converted from the ICRP voxel phantoms by using the 3D rendering method whereas several complex-shape bones (cranium, ribs, spines, feet, and hands) were not able to be directly converted. We alternatively employed the corresponding well-defined polygonal models and attempted to adjust them to match the voxel models. However, this approach was unsatisfactory. The shapes of the alternative models were significantly different from those of the voxel models, making it virtually impossible to exactly match the voxel models as shown in Fig. 3 (left). In order to overcome the difficulty in the complex bone conversion, the present study developed a new conversion method and converted these complex bones voxel models of the ICRP male phantom to polygonal models. The present study developed the new conversion method and successfully improved polygonal models for cranium, ribs, and spines for the ICRP male phantom. The new conversion method will be also applied to the complex bone conversion for the ICRP female phantom as well as other complex organ conversion in the future.
Improvement of skeleton conversion in ICRP reference phantom conversion project
International Nuclear Information System (INIS)
Wang, Zhao Jun; Yeom, Yeon Soo; Thang, Nguyen Tat; Kim, Han Sung; Han, Min Cheol; Kim, Chan Hyeong; Kim, Seong Hoon
2014-01-01
In the previous skeleton conversion, most bones were directly converted from the ICRP voxel phantoms by using the 3D rendering method whereas several complex-shape bones (cranium, ribs, spines, feet, and hands) were not able to be directly converted. We alternatively employed the corresponding well-defined polygonal models and attempted to adjust them to match the voxel models. However, this approach was unsatisfactory. The shapes of the alternative models were significantly different from those of the voxel models, making it virtually impossible to exactly match the voxel models as shown in Fig. 3 (left). In order to overcome the difficulty in the complex bone conversion, the present study developed a new conversion method and converted these complex bones voxel models of the ICRP male phantom to polygonal models. The present study developed the new conversion method and successfully improved polygonal models for cranium, ribs, and spines for the ICRP male phantom. The new conversion method will be also applied to the complex bone conversion for the ICRP female phantom as well as other complex organ conversion in the future
Ren, Jianfeng; Chung-Davidson, Yu-Wen; Yeh, Chu-Yin; Scott, Camille; Brown, Titus; Li, Weiming
2015-06-06
Lampreys are extant representatives of the jawless vertebrate lineage that diverged from jawed vertebrates around 500 million years ago. Lamprey genomes contain information crucial for understanding the evolution of gene families in vertebrates. The ATP-binding cassette (ABC) gene family is found from prokaryotes to eukaryotes. The recent availability of two lamprey draft genomes from sea lamprey Petromyzon marinus and Japanese lamprey Lethenteron japonicum presents an opportunity to infer early evolutionary events of ABC genes in vertebrates. We conducted a genome-wide survey of the ABC gene family in two lamprey draft genomes. A total of 37 ABC transporters were identified and classified into seven subfamilies; namely seven ABCA genes, 10 ABCB genes, 10 ABCC genes, three ABCD genes, one ABCE gene, three ABCF genes, and three ABCG genes. The ABCA subfamily has expanded from three genes in sea squirts, seven and nine in lampreys and zebrafish, to 13 and 16 in human and mouse. Conversely, the multiple copies of ABCB1-, ABCG1-, and ABCG2-like genes found in sea squirts have contracted in the other species examined. ABCB2 and ABCB3 seem to be new additions in gnathostomes (not in sea squirts or lampreys), which coincides with the emergence of the gnathostome-specific adaptive immune system. All the genes in the ABCD, ABCE and ABCF subfamilies were conserved and had undergone limited duplication and loss events. In the sea lamprey transcriptomes, the ABCE and ABCF gene subfamilies were ubiquitously and highly expressed in all tissues while the members in other gene subfamilies were differentially expressed. Thirteen more lamprey ABC transporter genes were identified in this study compared with a previous study. By concatenating the same gene sequences from the two lampreys, more full length sequences were obtained, which significantly improved both the assignment of gene names and the phylogenetic trees compared with a previous analysis using partial sequences. The ABC
Role of Double-Strand Break End-Tethering during Gene Conversion in Saccharomyces cerevisiae.
Directory of Open Access Journals (Sweden)
Suvi Jain
2016-04-01
Full Text Available Correct repair of DNA double-strand breaks (DSBs is critical for maintaining genome stability. Whereas gene conversion (GC-mediated repair is mostly error-free, repair by break-induced replication (BIR is associated with non-reciprocal translocations and loss of heterozygosity. We have previously shown that a Recombination Execution Checkpoint (REC mediates this competition by preventing the BIR pathway from acting on DSBs that can be repaired by GC. Here, we asked if the REC can also determine whether the ends that are engaged in a GC-compatible configuration belong to the same break, since repair involving ends from different breaks will produce potentially deleterious translocations. We report that the kinetics of repair are markedly delayed when the two DSB ends that participate in GC belong to different DSBs (termed Trans compared to the case when both DSB ends come from the same break (Cis. However, repair in Trans still occurs by GC rather than BIR, and the overall efficiency of repair is comparable. Hence, the REC is not sensitive to the "origin" of the DSB ends. When the homologous ends for GC are in Trans, the delay in repair appears to reflect their tethering to sequences on the other side of the DSB that themselves recombine with other genomic locations with which they share sequence homology. These data support previous observations that the two ends of a DSB are usually tethered to each other and that this tethering facilitates both ends encountering the same donor sequence. We also found that the presence of homeologous/repetitive sequences in the vicinity of a DSB can distract the DSB end from finding its bona fide homologous donor, and that inhibition of GC by such homeologous sequences is markedly increased upon deleting Sgs1 but not Msh6.
Directory of Open Access Journals (Sweden)
Marwa Marwa
2017-07-01
Full Text Available This study highlights the internal conversation which takes place in Oracle CorporationMalaysia. Through the study, it will be shown how conversational analysis is used toanalyze the transcription of a telephone conversation between Oracle staffs. The analysisof the transcriptions will apply a few basic concepts of conversational analysis; turntakingorganization, and the adjacency pair. The objective of the study is to find out howthe internal conversations takes place by focusing on the conversation itself, that is, theconversational structures spontaneously produced by people during talk ranging fromturn-taking strategies, how topics are introduced, conversation closings and so on. Bylooking in detail at such talk, we can gain a detailed understanding of how the staffs seethemselves in relation to the company that influence their daily lives.Keywords: conversational analysis, turn-taking, adjacency pairs
Mutagenesis of FAD2 genes in peanut with CRISPR/Cas9
The CRISPR/Cas9 system is known for its precise and efficient gene-editing of a targeted region in a variety of organisms including plants. We targeted FAD2 gene region to perform CRISPR/Cas9 gene-editing in peanut. The FAD2 gene encodes fatty acid desaturase which catalyzes the conversion of oleic ...
Genes from scratch--the evolutionary fate of de novo genes.
Schlötterer, Christian
2015-04-01
Although considered an extremely unlikely event, many genes emerge from previously noncoding genomic regions. This review covers the entire life cycle of such de novo genes. Two competing hypotheses about the process of de novo gene birth are discussed as well as the high death rate of de novo genes. Despite the high death rate, some de novo genes are retained and remain functional, even in distantly related species, through their integration into gene networks. Further studies combining gene expression with ribosome profiling in multiple populations across different species will be instrumental for an improved understanding of the evolutionary processes operating on de novo genes. Copyright © 2015 The Author. Published by Elsevier Ltd.. All rights reserved.
Biased Gene Conversion and GC-Content Evolution in the Coding Sequences of Reptiles and Vertebrates
Figuet, Emeric; Ballenghien, Marion; Romiguier, Jonathan; Galtier, Nicolas
2015-01-01
Mammalian and avian genomes are characterized by a substantial spatial heterogeneity of GC-content, which is often interpreted as reflecting the effect of local GC-biased gene conversion (gBGC), a meiotic repair bias that favors G and C over A and T alleles in high-recombining genomic regions. Surprisingly, the first fully sequenced nonavian sauropsid (i.e., reptile), the green anole Anolis carolinensis, revealed a highly homogeneous genomic GC-content landscape, suggesting the possibility that gBGC might not be at work in this lineage. Here, we analyze GC-content evolution at third-codon positions (GC3) in 44 vertebrates species, including eight newly sequenced transcriptomes, with a specific focus on nonavian sauropsids. We report that reptiles, including the green anole, have a genome-wide distribution of GC3 similar to that of mammals and birds, and we infer a strong GC3-heterogeneity to be already present in the tetrapod ancestor. We further show that the dynamic of coding sequence GC-content is largely governed by karyotypic features in vertebrates, notably in the green anole, in agreement with the gBGC hypothesis. The discrepancy between third-codon positions and noncoding DNA regarding GC-content dynamics in the green anole could not be explained by the activity of transposable elements or selection on codon usage. This analysis highlights the unique value of third-codon positions as an insertion/deletion-free marker of nucleotide substitution biases that ultimately affect the evolution of proteins. PMID:25527834
Conversion disorder: a problematic diagnosis.
Nicholson, Timothy R J; Stone, Jon; Kanaan, Richard A A
2011-11-01
The diagnosis of conversion disorder is problematic. Since doctors have conceptually and practically differentiated the symptoms from neurological ('organic') disease it has been presumed to be a psychological disorder, but the psychological mechanism, and how this differs from feigning (conscious simulation), has remained elusive. Although misdiagnosis of neurological disease as conversion disorder is uncommon, it remains a concern for clinicians, particularly for psychiatrists who may be unaware of the positive ways in which neurologists can exclude organic disease. The diagnosis is anomalous in psychiatry in that current diagnostic systems require that feigning is excluded and that the symptoms can be explained psychologically. In practice, feigning is very difficult to either disprove or prove, and a psychological explanation cannot always be found. Studies of childhood and adult psychological precipitants have tended to support the relevance of stressful life events prior to symptom onset at the group level but they are not found in a substantial proportion of cases. These problems highlight serious theoretical and practical issues not just for the current diagnostic systems but for the concept of the disorder itself. Psychology, physiology and functional imaging techniques have been used in attempts to elucidate the neurobiology of conversion disorder and to differentiate it from feigning, but while intriguing results are emerging they can only be considered preliminary. Such work looks to a future that could refine our understanding of the disorder. However, until that time, the formal diagnostic requirement for associated psychological stressors and the exclusion of feigning are of limited clinical value. Simplified criteria are suggested which will also encourage cooperation between neurology and psychiatry in the management of these patients.
Analysis of early initiating event(s) in radiation-induced thymic lymphomagenesis
International Nuclear Information System (INIS)
Muto, Masahiro; Ying Chen; Kubo, Eiko; Mita, Kazuei
1996-01-01
Since the T cell receptor rearrangement is a sequential process and unique to the progeny of each clone, we investigated the early initiating events in radiation-induced thymic lymphomagenesis by comparing the oncogenic alterations with the pattern of γ T cell receptor (TCR) rearrangements. We reported previously that after leukemogenic irradiation, preneoplastic cells developed, albeit infrequently, from thymic leukemia antigen-2 + (TL-2 + ) thymocytes. Limited numbers of TL-2 + cells from individual irradiated B10.Thy-1.1 mice were injected into B10.Thy-1.2 mice intrathymically, and the common genetic changes among the donor-type T cell lymphomas were investigated with regard to p53 gene and chromosome aberrations. The results indicated that some mutations in the p53 gene had taken place in these lymphomas, but there was no common mutation among the donor-type lymphomas from individual irradiated mice, suggesting that these mutations were late-occurring events in the process of oncogenesis. On the other hand, there were common chromosome aberrations or translocations such as trisomy 15, t(7F; 10C), t(1A; 13D) or t(6A; XB) among the donor-type lymphomas derived from half of the individual irradiated mice. This indicated that the aberrations/translocations, which occurred in single progenitor cells at the early T cell differentiation either just before or after γ T cell receptor rearrangements, might be important candidates for initiating events. In the donor-type lymphomas from the other half of the individual irradiated mice, microgenetic changes were suggested to be initial events and also might take place in single progenitor cells just before or right after γ TCR rearrangements. (author)
Conversion and assimilation of furfural and 5-(hydroxymethylfurfural by Pseudomonas putida KT2440
Directory of Open Access Journals (Sweden)
Michael T. Guarnieri
2017-06-01
Full Text Available The sugar dehydration products, furfural and 5-(hydroxymethylfurfural (HMF, are commonly formed during high-temperature processing of lignocellulose, most often in thermochemical pretreatment, liquefaction, or pyrolysis. Typically, these two aldehydes are considered major inhibitors in microbial conversion processes. Many microbes can convert these compounds to their less toxic, dead-end alcohol counterparts, furfuryl alcohol and 5-(hydroxymethylfurfuryl alcohol. Recently, the genes responsible for aerobic catabolism of furfural and HMF were discovered in Cupriavidus basilensis HMF14 to enable complete conversion of these compounds to the TCA cycle intermediate, 2-oxo-glutarate. In this work, we engineer the robust soil microbe, Pseudomonas putida KT2440, to utilize furfural and HMF as sole carbon and energy sources via complete genomic integration of the 12 kB hmf gene cluster previously reported from Burkholderia phytofirmans. The common intermediate, 2-furoic acid, is shown to be a bottleneck for both furfural and HMF metabolism. When cultured on biomass hydrolysate containing representative amounts of furfural and HMF from dilute-acid pretreatment, the engineered strain outperforms the wild type microbe in terms of reduced lag time and enhanced growth rates due to catabolism of furfural and HMF. Overall, this study demonstrates that an approach for biological conversion of furfural and HMF, relative to the typical production of dead-end alcohols, enables both enhanced carbon conversion and substantially improves tolerance to hydrolysate inhibitors. This approach should find general utility both in emerging aerobic processes for the production of fuels and chemicals from biomass-derived sugars and in the biological conversion of high-temperature biomass streams from liquefaction or pyrolysis where furfural and HMF are much more abundant than in biomass hydrolysates from pretreatment.
The Zimmer nuclear to coal conversion
International Nuclear Information System (INIS)
Baer, R.H.; Pfund, E.M.; Buchmueller, D.P.; Fletcher, J.R.
1991-01-01
This paper discusses the control, protection and monitoring systems employed on the world's first nuclear-to-coal power plant conversion, the philosophies utilized to guide the engineering of these systems and the implementation of those philosophies. Extensive use is made of programmable electronic systems to provide a state-of-the-art plant which does not compromise the proven operating interfaces and philosophies associated with AEP's six operating 1300 MW units. The technologies employed include two distributed digital control systems, a fiber optic-based network of programmable logic controllers, a distributed microprocessor-based annunciator and sequence of events system, and a plant operations computer which accesses each of the preceding systems
Conversion and assimilation of furfural and 5-(hydroxymethyl)furfural by Pseudomonas putida KT2440.
Guarnieri, Michael T; Ann Franden, Mary; Johnson, Christopher W; Beckham, Gregg T
2017-06-01
The sugar dehydration products, furfural and 5-(hydroxymethyl)furfural (HMF), are commonly formed during high-temperature processing of lignocellulose, most often in thermochemical pretreatment, liquefaction, or pyrolysis. Typically, these two aldehydes are considered major inhibitors in microbial conversion processes. Many microbes can convert these compounds to their less toxic, dead-end alcohol counterparts, furfuryl alcohol and 5-(hydroxymethyl)furfuryl alcohol. Recently, the genes responsible for aerobic catabolism of furfural and HMF were discovered in Cupriavidus basilensis HMF14 to enable complete conversion of these compounds to the TCA cycle intermediate, 2-oxo-glutarate. In this work, we engineer the robust soil microbe, Pseudomonas putida KT2440, to utilize furfural and HMF as sole carbon and energy sources via complete genomic integration of the 12 kB hmf gene cluster previously reported from Burkholderia phytofirmans . The common intermediate, 2-furoic acid, is shown to be a bottleneck for both furfural and HMF metabolism. When cultured on biomass hydrolysate containing representative amounts of furfural and HMF from dilute-acid pretreatment, the engineered strain outperforms the wild type microbe in terms of reduced lag time and enhanced growth rates due to catabolism of furfural and HMF. Overall, this study demonstrates that an approach for biological conversion of furfural and HMF, relative to the typical production of dead-end alcohols, enables both enhanced carbon conversion and substantially improves tolerance to hydrolysate inhibitors. This approach should find general utility both in emerging aerobic processes for the production of fuels and chemicals from biomass-derived sugars and in the biological conversion of high-temperature biomass streams from liquefaction or pyrolysis where furfural and HMF are much more abundant than in biomass hydrolysates from pretreatment.
Thapa, Raju; Codjoe, Julius; Ishak, Sherif; McCarter, Kevin S
2015-01-01
A number of studies have been done in the field of driver distraction, specifically on the use of cell phone for either conversation or texting while driving. Researchers have focused on the driving performance of drivers when they were actually engaged in the task; that is, during the texting or phone conversation event. However, it is still unknown whether the impact of cell phone usages ceases immediately after the end of task. The primary objective of this article is to analyze the post-event effect of cell phone usage (texting and conversation) in order to verify whether the distracting effect lingers after the actual event has ceased. This study utilizes a driving simulator study of 36 participants to test whether a significant decrease in driver performance occurs during cell phone usage and after usage. Surrogate measures used to represent lateral and longitudinal control of the vehicle were standard deviation (SD) of lane position and mean velocity, respectively. RESULTS suggest that there was no significant decrease in driver performance (both lateral and longitudinal control) during and after the cell phone conversation. For the texting event, there were significant decreases in driver performance in both the longitudinal and lateral control of the vehicle during the actual texting task. The diminished longitudinal control ceased immediately after the texting event but the diminished lateral control lingered for an average of 3.38 s. The number of text messages exchanged did not affect the magnitude or duration of the diminished lateral control. The result indicates that the distraction and subsequent elevated crash risk of texting while driving linger even after the texting event has ceased. This finding has safety and policy implications in reducing distracted driving.
Brewer, Matt T; Xiong, Nalee; Anderson, Kristi L; Carlson, Steve A
2013-08-01
To assess antimicrobial resistance and transfer of virulence genes facilitated by subtherapeutic concentrations of antimicrobials in swine intestines. 20 anesthetized pigs experimentally inoculated with donor and recipient bacteria. 4 recipient pathogenic bacteria (Salmonella enterica serotype Typhimurium, Yersinia enterocolitica, Shigella flexneri, or Proteus mirabilis) were incubated with donor bacteria in the presence of subinhibitory concentrations of 1 of 16 antimicrobials in isolated ligated intestinal loops in swine. Donor Escherichia coli contained transferrable antimicrobial resistance or virulence genes. After coincubations, intestinal contents were removed and assessed for pathogens that acquired new antimicrobial resistance or virulence genes following exposure to the subtherapeutic concentrations of antimicrobials. 3 antimicrobials (apramycin, lincomycin, and neomycin) enhanced transfer of an antimicrobial resistance plasmid from commensal E coli organisms to Yersinia and Proteus organisms, whereas 7 antimicrobials (florfenicol, hygromycin, penicillin G, roxarsone, sulfamethazine, tetracycline, and tylosin) exacerbated transfer of an integron (Salmonella genomic island 1) from Salmonella organisms to Yersinia organisms. Sulfamethazine induced the transfer of Salmonella pathogenicity island 1 from pathogenic to nonpathogenic Salmonella organisms. Six antimicrobials (bacitracin, carbadox, erythromycin, sulfathiazole, tiamulin, and virginiamycin) did not mediate any transfer events. Sulfamethazine was the only antimicrobial implicated in 2 types of transfer events. 10 of 16 antimicrobials at subinhibitory or subtherapeutic concentrations augmented specific antimicrobial resistance or transfer of virulence genes into pathogenic bacteria in isolated intestinal loops in swine. Use of subtherapeutic antimicrobials in animal feed may be associated with unwanted collateral effects.
DEFF Research Database (Denmark)
Gonzalez-Izarzugaza, Jose Maria; Skov, Laurits; Maretty, Lasse
2017-01-01
The human Y-chromosome does not recombine across its male-specific part and is therefore an excellent marker of human migrations. It also plays an important role in male fertility. However, its evolution is difficult to fully understand because of repetitive sequences, inverted repeats and the po......The human Y-chromosome does not recombine across its male-specific part and is therefore an excellent marker of human migrations. It also plays an important role in male fertility. However, its evolution is difficult to fully understand because of repetitive sequences, inverted repeats...... and the potentially large role of gene conversion. Here we perform an evolutionary analysis of 62 Y-chromosomes of Danish descent sequenced using a wide range of library insert sizes and high coverage, thus allowing large regions of these chromosomes to be well assembled. These include 17 father-son pairs, which we...... use to validate variation calling. Using a recent method that can integrate variants based on both mapping and de novo assembly, we genotype 10898 SNVs and 2903 indels (max length of 27241 bp) in our sample and show by father-son concordance and experimental validation that the non-recurrent SNP...
Maize transformation technology development for commercial event generation
Que, Qiudeng; Elumalai, Sivamani; Li, Xianggan; Zhong, Heng; Nalapalli, Samson; Schweiner, Michael; Fei, Xiaoyin; Nuccio, Michael; Kelliher, Timothy; Gu, Weining; Chen, Zhongying; Chilton, Mary-Dell M.
2014-01-01
Maize is an important food and feed crop in many countries. It is also one of the most important target crops for the application of biotechnology. Currently, there are more biotech traits available on the market in maize than in any other crop. Generation of transgenic events is a crucial step in the development of biotech traits. For commercial applications, a high throughput transformation system producing a large number of high quality events in an elite genetic background is highly desirable. There has been tremendous progress in Agrobacterium-mediated maize transformation since the publication of the Ishida et al. (1996) paper and the technology has been widely adopted for transgenic event production by many labs around the world. We will review general efforts in establishing efficient maize transformation technologies useful for transgenic event production in trait research and development. The review will also discuss transformation systems used for generating commercial maize trait events currently on the market. As the number of traits is increasing steadily and two or more modes of action are used to control key pests, new tools are needed to efficiently transform vectors containing multiple trait genes. We will review general guidelines for assembling binary vectors for commercial transformation. Approaches to increase transformation efficiency and gene expression of large gene stack vectors will be discussed. Finally, recent studies of targeted genome modification and transgene insertion using different site-directed nuclease technologies will be reviewed. PMID:25140170
Maize transformation technology development for commercial event generation.
Que, Qiudeng; Elumalai, Sivamani; Li, Xianggan; Zhong, Heng; Nalapalli, Samson; Schweiner, Michael; Fei, Xiaoyin; Nuccio, Michael; Kelliher, Timothy; Gu, Weining; Chen, Zhongying; Chilton, Mary-Dell M
2014-01-01
Maize is an important food and feed crop in many countries. It is also one of the most important target crops for the application of biotechnology. Currently, there are more biotech traits available on the market in maize than in any other crop. Generation of transgenic events is a crucial step in the development of biotech traits. For commercial applications, a high throughput transformation system producing a large number of high quality events in an elite genetic background is highly desirable. There has been tremendous progress in Agrobacterium-mediated maize transformation since the publication of the Ishida et al. (1996) paper and the technology has been widely adopted for transgenic event production by many labs around the world. We will review general efforts in establishing efficient maize transformation technologies useful for transgenic event production in trait research and development. The review will also discuss transformation systems used for generating commercial maize trait events currently on the market. As the number of traits is increasing steadily and two or more modes of action are used to control key pests, new tools are needed to efficiently transform vectors containing multiple trait genes. We will review general guidelines for assembling binary vectors for commercial transformation. Approaches to increase transformation efficiency and gene expression of large gene stack vectors will be discussed. Finally, recent studies of targeted genome modification and transgene insertion using different site-directed nuclease technologies will be reviewed.
Bazzi, Gaia; Podofillini, Stefano; Gatti, Emanuele; Gianfranceschi, Luca; Cecere, Jacopo G; Spina, Fernando; Saino, Nicola; Rubolini, Diego
2017-10-01
The timing of major life-history events, such as migration and moult, is set by endogenous circadian and circannual clocks, that have been well characterized at the molecular level. Conversely, the genetic sources of variation in phenology and in other behavioral traits have been sparsely addressed. It has been proposed that inter-individual variability in the timing of seasonal events may arise from allelic polymorphism at phenological candidate genes involved in the signaling cascade of the endogenous clocks. In this study of a long-distance migratory passerine bird, the willow warbler Phylloscopus trochilus , we investigated whether allelic variation at 5 polymorphic loci of 4 candidate genes ( Adcyap1 , Clock , Creb1 , and Npas2 ), predicted 2 major components of the annual schedule, namely timing of spring migration across the central Mediterranean sea and moult speed, the latter gauged from ptilochronological analyses of tail feathers moulted in the African winter quarters. We identified a novel Clock gene locus ( Clock region 3) showing polyQ polymorphism, which was however not significantly associated with any phenotypic trait. Npas2 allele size predicted male (but not female) spring migration date, with males bearing longer alleles migrating significantly earlier than those bearing shorter alleles. Creb1 allele size significantly predicted male (but not female) moult speed, longer alleles being associated with faster moult. All other genotype-phenotype associations were statistically non-significant. These findings provide new evidence for a role of candidate genes in modulating the phenology of different circannual activities in long-distance migratory birds, and for the occurrence of sex-specific candidate gene effects.
Uranium conversion; Urankonvertering
Energy Technology Data Exchange (ETDEWEB)
Oliver, Lena; Peterson, Jenny; Wilhelmsen, Katarina [Swedish Defence Research Agency (FOI), Stockholm (Sweden)
2006-03-15
FOI, has performed a study on uranium conversion processes that are of importance in the production of different uranium compounds in the nuclear industry. The same conversion processes are of interest both when production of nuclear fuel and production of fissile material for nuclear weapons are considered. Countries that have nuclear weapons ambitions, with the intention to produce highly enriched uranium for weapons purposes, need some degree of uranium conversion capability depending on the uranium feed material available. This report describes the processes that are needed from uranium mining and milling to the different conversion processes for converting uranium ore concentrate to uranium hexafluoride. Uranium hexafluoride is the uranium compound used in most enrichment facilities. The processes needed to produce uranium dioxide for use in nuclear fuel and the processes needed to convert different uranium compounds to uranium metal - the form of uranium that is used in a nuclear weapon - are also presented. The production of uranium ore concentrate from uranium ore is included since uranium ore concentrate is the feed material required for a uranium conversion facility. Both the chemistry and principles or the different uranium conversion processes and the equipment needed in the processes are described. Since most of the equipment that is used in a uranium conversion facility is similar to that used in conventional chemical industry, it is difficult to determine if certain equipment is considered for uranium conversion or not. However, the chemical conversion processes where UF{sub 6} and UF{sub 4} are present require equipment that is made of corrosion resistant material.
Recurrent adenylation domain replacement in the microcystin synthetase gene cluster
Directory of Open Access Journals (Sweden)
Laakso Kati
2007-10-01
Full Text Available Abstract Background Microcystins are small cyclic heptapeptide toxins produced by a range of distantly related cyanobacteria. Microcystins are synthesized on large NRPS-PKS enzyme complexes. Many structural variants of microcystins are produced simulatenously. A recombination event between the first module of mcyB (mcyB1 and mcyC in the microcystin synthetase gene cluster is linked to the simultaneous production of microcystin variants in strains of the genus Microcystis. Results Here we undertook a phylogenetic study to investigate the order and timing of recombination between the mcyB1 and mcyC genes in a diverse selection of microcystin producing cyanobacteria. Our results provide support for complex evolutionary processes taking place at the mcyB1 and mcyC adenylation domains which recognize and activate the amino acids found at X and Z positions. We find evidence for recent recombination between mcyB1 and mcyC in strains of the genera Anabaena, Microcystis, and Hapalosiphon. We also find clear evidence for independent adenylation domain conversion of mcyB1 by unrelated peptide synthetase modules in strains of the genera Nostoc and Microcystis. The recombination events replace only the adenylation domain in each case and the condensation domains of mcyB1 and mcyC are not transferred together with the adenylation domain. Our findings demonstrate that the mcyB1 and mcyC adenylation domains are recombination hotspots in the microcystin synthetase gene cluster. Conclusion Recombination is thought to be one of the main mechanisms driving the diversification of NRPSs. However, there is very little information on how recombination takes place in nature. This study demonstrates that functional peptide synthetases are created in nature through transfer of adenylation domains without the concomitant transfer of condensation domains.
Chen, Long; Zhang, Qilin; Hou, Wenhao; Tao, Yulang
2015-07-01
In this paper we have simulated the far-field waveform characteristic of large bipolar events (LBEs) occurred in winter thunderstorms in Japan and compared the field-to-current conversion factors (FCCFs) of LBEs with that of the lightning cloud-to-ground (CG) return stroke (RS) in summer thunderstorm. As for the physical process of LBEs, Wu et al. (2014) considered that LBEs may be very similar to the typical lightning RS (RS-like process) or caused by an initial continuous current pulse (ICC-like process) in upward lightning flashes. We assume that the lightning channel length of LBEs ranges from 500 m to 1000 m, and the height of tall object struck by LBEs is from 100 m to 300 m. By using the bouncing wave model, we found that only when the injected current waveform of LBEs is characterized with a symmetric Gaussian pulse, the simulated far-field waveform of LBEs both for RS-like process and ICC-like process is similar to that observed by Wu et al. (2014). For striking tall objects with heights from 100 m and 300 m, the FCCFs of LBEs are positively correlated with its channel length and derivatives of injected current waveform, and the FCCF for RS-like process is about similar to that for ICC-like process. However, the FCCFs of LBEs are very different from lightning RS in summer thunderstorm; that is to say, the FCCFs developed for the well-known lightning RS in summer thunderstorm are not suitable for LBEs.
Directory of Open Access Journals (Sweden)
Palmer Jeffrey D
2006-09-01
Full Text Available Abstract Background Horizontal gene transfer (HGT to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts, where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and
Rice, Danny W; Palmer, Jeffrey D
2006-01-01
Background Horizontal gene transfer (HGT) to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts), where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and cryptophyte plastids to the
Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis
dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana
2015-01-01
Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928
Chen, Jie; Li, Xinying; McGue, Matt
2013-01-01
Background: Confounding introduced by gene-environment correlation (rGE) may prevent one from observing a true gene-environment interaction (G × E) effect on psychopathology. The present study investigated the interacting effect of the BDNF Val66Met polymorphism and stressful life events (SLEs) on adolescent depression while controlling for the…
Yeo, In-Seok; Shim, Woo-Yong; Kim, Jung Hoe
2018-05-20
For the biological production of l-ribulose, conversion by enzymes or resting cells has been investigated. However, expensive or concentrated substrates, an additional purification step to remove borate and the requirement for cell cultivation and harvest steps before utilization of resting cells make the production process complex and unfavorable. Microbial fermentation may help overcome these limitations. In this study, we constructed a genetically engineered Candida tropicalis strain to produce l-ribulose by fermentation with a glucose/l-arabinose mixture. For the uptake of l-arabinose as a substrate and conversion of l-arabinose to l-ribulose, two heterologous genes coding for l-arabinose transporter and l-arabinose isomerase, were constitutively expressed in C. tropicalis under the GAPDH promoter. The Arabidopsis thaliana-originated l-arabinose transporter gene (STP2)-expressing strain exhibited a high l-arabinose uptake rate of 0.103 g/g cell/h and the expression of l-arabinose isomerase from Lactobacillus sakei 23 K showed 30% of conversion (9 g/L) from 30 g/L of l-arabinose. This genetically engineered strain can be used for l-ribulose production by fermentation using mixed sugars of glucose and l-arabinose. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Pierre-Louis Malosse
2009-10-01
Full Text Available Rarement la conversion – concept, événement, acte – a tenu une place telle qu’au IVe siècle après Jésus-Christ, dans les années qui mènent de la conversion d’un empereur (Constantin à celle de l’empire. Dans le monde oriental, dominé par la culture hellénique, la conversion religieuse rencontre un modèle depuis longtemps reconnu, celui de la conversion philosophique (ou à la philosophie. Entre l'une et l'autre, il existe une certaine porosité, plus ou moins consciente, comme l'attestent en des directions opposées le cas des milieux philosophiques alexandrins – y compris peut-être Arios –, ou celui de Julien. D'autre part, à l'orée du IVe siècle, la conversion chrétienne a déjà une longue histoire. La nouveauté de l'Antiquité tardive, outre le changement d'échelle, du petit nombre à la masse et du marginal à l'officiel avec le soutien de l'État, est de poser la question du rapport de la conversion religieuse à la culture traditionnelle, question qui ne se posait pas à propos de la conversion philosophique, puisque celle-ci était une composante de cette culture, question qui se pose particulièrement au moment où les convertis prétendent prendre en charge la culture. Plus précisément, il s'agit d'une confrontation avec la paideia, concept qui embrasse et unit étroitement culture et éducation. Chez les auteurs qui s’y réfèrent, que ce soit explicitement ou implicitement, la conversion se définit par rapport à la paideia tour à tour en termes d’exclusion, de concurrence et de complémentarité.Conversion –as a concept, as an event and as a deed – was seldom as imporant as it was during Forth Century AD, from the conversion of an emperor (Constantine to the conversion of the whole Empire. In the Greek speaking and thinking East, religious conversion came across philosophical conversion model, which had been known and admitted for a long time. So, philosophical conversion could
Abraham, Joanna; Kannampallil, Thomas; Brenner, Corinne; Lopez, Karen D; Almoosa, Khalid F; Patel, Bela; Patel, Vimla L
2016-02-01
Effective communication during nurse handoffs is instrumental in ensuring safe and quality patient care. Much of the prior research on nurse handoffs has utilized retrospective methods such as interviews, surveys and questionnaires. While extremely useful, an in-depth understanding of the structure and content of conversations, and the inherent relationships within the content is paramount to designing effective nurse handoff interventions. In this paper, we present a methodological framework-Sequential Conversational Analysis (SCA)-a mixed-method approach that integrates qualitative conversational analysis with quantitative sequential pattern analysis. We describe the SCA approach and provide a detailed example as a proof of concept of its use for the analysis of nurse handoff communication in a medical intensive care unit. This novel approach allows us to characterize the conversational structure, clinical content, disruptions in the conversation, and the inherently phasic nature of nurse handoff communication. The characterization of communication patterns highlights the relationships underlying the verbal content of nurse handoffs with specific emphasis on: the interactive nature of conversation, relevance of role-based (incoming, outgoing) communication requirements, clinical content focus on critical patient-related events, and discussion of pending patient management tasks. We also discuss the applicability of the SCA approach as a method for providing in-depth understanding of the dynamics of communication in other settings and domains. Copyright © 2015 Elsevier Inc. All rights reserved.
The evolutionary history of the SAL1 gene family in eutherian mammals
Directory of Open Access Journals (Sweden)
Callebaut Isabelle
2011-05-01
Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.
Phage Conversion for β-Lactam Antibiotic Resistance of Staphylococcus aureus from Foods.
Lee, Young-Duck; Park, Jong-Hyun
2016-02-01
Temperate phages have been suggested to carry virulence factors and other lysogenic conversion genes that play important roles in pathogenicity. In this study, phage TEM123 in wild-type Staphylococcus aureus from food sources was analyzed with respect to its morphology, genome sequence, and antibiotic resistance conversion ability. Phage TEM123 from a mitomycin C-induced lysate of S. aureus was isolated from foods. Morphological analysis under a transmission electron microscope revealed that it belonged to the family Siphoviridae. The genome of phage TEM123 consisted of a double-stranded DNA of 43,786 bp with a G+C content of 34.06%. A bioinformatics analysis of the phage genome identified 43 putative open reading frames (ORFs). ORF1 encoded a protein that was nearly identical to the metallo-β-lactamase enzymes that degrade β-lactam antibiotics. After transduction to S. aureus with phage TEM123, the metallo-β-lactamase gene was confirmed in the transductant by PCR and sequencing analyses. In a β-lactam antibiotic susceptibility test, the transductant was more highly resistant to β-lactam antibiotics than S. aureus S133. Phage TEM123 might play a role in the transfer of β-lactam antibiotic resistance determinants in S. aureus. Therefore, we suggest that the prophage of S. aureus with its exotoxin is a risk factor for food safety in the food chain through lateral gene transfer.
Haplotype mapping of a diploid non-meiotic organism using existing and induced aneuploidies.
Directory of Open Access Journals (Sweden)
Melanie Legrand
2008-01-01
Full Text Available Haplotype maps (HapMaps reveal underlying sequence variation and facilitate the study of recombination and genetic diversity. In general, HapMaps are produced by analysis of Single-Nucleotide Polymorphism (SNP segregation in large numbers of meiotic progeny. Candida albicans, the most common human fungal pathogen, is an obligate diploid that does not appear to undergo meiosis. Thus, standard methods for haplotype mapping cannot be used. We exploited naturally occurring aneuploid strains to determine the haplotypes of the eight chromosome pairs in the C. albicans laboratory strain SC5314 and in a clinical isolate. Comparison of the maps revealed that the clinical strain had undergone a significant amount of genome rearrangement, consisting primarily of crossover or gene conversion recombination events. SNP map haplotyping revealed that insertion and activation of the UAU1 cassette in essential and non-essential genes can result in whole chromosome aneuploidy. UAU1 is often used to construct homozygous deletions of targeted genes in C. albicans; the exact mechanism (trisomy followed by chromosome loss versus gene conversion has not been determined. UAU1 insertion into the essential ORC1 gene resulted in a large proportion of trisomic strains, while gene conversion events predominated when UAU1 was inserted into the non-essential LRO1 gene. Therefore, induced aneuploidies can be used to generate HapMaps, which are essential for analyzing genome alterations and mitotic recombination events in this clonal organism.
Luff, Paul; Gilbert, Nigel G
1986-01-01
In the past few years a branch of sociology, conversation analysis, has begun to have a significant impact on the design of human*b1computer interaction (HCI). The investigation of human*b1human dialogue has emerged as a fruitful foundation for interactive system design.****This book includes eleven original chapters by leading researchers who are applying conversation analysis to HCI. The fundamentals of conversation analysis are outlined, a number of systems are described, and a critical view of their value for HCI is offered.****Computers and Conversation will be of interest to all concerne
Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.
Lee, Seong-Hun
2014-11-01
There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.
Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene
International Nuclear Information System (INIS)
Gorodetskii, S.I.; Tkach, T.M.; Kapelinskaya, T.V.
1988-01-01
The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region
2014-01-01
Background Lateral Gene Transfer (LGT) has recently gained recognition as an important contributor to some eukaryote proteomes, but the mechanisms of acquisition and fixation in eukaryotic genomes are still uncertain. A previously defined norm for LGTs in microbial eukaryotes states that the majority are genes involved in metabolism, the LGTs are typically localized one by one, surrounded by vertically inherited genes on the chromosome, and phylogenetics shows that a broad collection of bacterial lineages have contributed to the transferome. Results A unique 34 kbp long fragment with 27 clustered genes (TvLF) of prokaryote origin was identified in the sequenced genome of the protozoan parasite Trichomonas vaginalis. Using a PCR based approach we confirmed the presence of the orthologous fragment in four additional T. vaginalis strains. Detailed sequence analyses unambiguously suggest that TvLF is the result of one single, recent LGT event. The proposed donor is a close relative to the firmicute bacterium Peptoniphilus harei. High nucleotide sequence similarity between T. vaginalis strains, as well as to P. harei, and the absence of homologs in other Trichomonas species, suggests that the transfer event took place after the radiation of the genus Trichomonas. Some genes have undergone pseudogenization and degradation, indicating that they may not be retained in the future. Functional annotations reveal that genes involved in informational processes are particularly prone to degradation. Conclusions We conclude that, although the majority of eukaryote LGTs are single gene occurrences, they may be acquired in clusters of several genes that are subsequently cleansed of evolutionarily less advantageous genes. PMID:24898731
Russell, Charles R
2013-01-01
Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll
Iterated multidimensional wave conversion
International Nuclear Information System (INIS)
Brizard, A. J.; Tracy, E. R.; Johnston, D.; Kaufman, A. N.; Richardson, A. S.; Zobin, N.
2011-01-01
Mode conversion can occur repeatedly in a two-dimensional cavity (e.g., the poloidal cross section of an axisymmetric tokamak). We report on two novel concepts that allow for a complete and global visualization of the ray evolution under iterated conversions. First, iterated conversion is discussed in terms of ray-induced maps from the two-dimensional conversion surface to itself (which can be visualized in terms of three-dimensional rooms). Second, the two-dimensional conversion surface is shown to possess a symplectic structure derived from Dirac constraints associated with the two dispersion surfaces of the interacting waves.
Nominal Performance Biosphere Dose Conversion Factor Analysis
International Nuclear Information System (INIS)
M.A. Wasiolek
2005-01-01
This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the Total System Performance Assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the groundwater exposure scenario, and the development of conversion factors for assessing compliance with the groundwater protection standards. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop BDCFs, which are input parameters for the TSPA-LA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the ''Biosphere Model Report'' in Figure 1-1, contain detailed description of the model input parameters, their development, and the relationship between the parameters and specific features events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the groundwater exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and the five analyses that develop parameter values for the biosphere model (BSC 2005 [DIRS 172827]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis'' (Figure 1-1). The objectives of this analysis are to develop BDCFs for the
Lapierre, Marguerite; Blin, Camille; Lambert, Amaury; Achaz, Guillaume; Rocha, Eduardo P C
2016-07-01
Recent studies have linked demographic changes and epidemiological patterns in bacterial populations using coalescent-based approaches. We identified 26 studies using skyline plots and found that 21 inferred overall population expansion. This surprising result led us to analyze the impact of natural selection, recombination (gene conversion), and sampling biases on demographic inference using skyline plots and site frequency spectra (SFS). Forward simulations based on biologically relevant parameters from Escherichia coli populations showed that theoretical arguments on the detrimental impact of recombination and especially natural selection on the reconstructed genealogies cannot be ignored in practice. In fact, both processes systematically lead to spurious interpretations of population expansion in skyline plots (and in SFS for selection). Weak purifying selection, and especially positive selection, had important effects on skyline plots, showing patterns akin to those of population expansions. State-of-the-art techniques to remove recombination further amplified these biases. We simulated three common sampling biases in microbiological research: uniform, clustered, and mixed sampling. Alone, or together with recombination and selection, they further mislead demographic inferences producing almost any possible skyline shape or SFS. Interestingly, sampling sub-populations also affected skyline plots and SFS, because the coalescent rates of populations and their sub-populations had different distributions. This study suggests that extreme caution is needed to infer demographic changes solely based on reconstructed genealogies. We suggest that the development of novel sampling strategies and the joint analyzes of diverse population genetic methods are strictly necessary to estimate demographic changes in populations where selection, recombination, and biased sampling are present. © The Author 2016. Published by Oxford University Press on behalf of the Society for
Harada, M.; Furukawa, R.; Yokobori, S. I.; Tajika, E.; Yamagishi, A.
2016-12-01
A significant rise in atmospheric O2 levels during the GOE (Great Oxidation Event), ca. 2.45-2.0 Ga, must have caused a great stress to biosphere, enforcing life to adapt to oxic conditions. Cyanobacteria, oxygenic photosynthetic bacteria that had been responsible for the GOE, are at the same time one of the organisms that would have been greatly affected by the rise of O2 level in the surface environments. Knowledge on the evolution of cyanobacteria is not only important to elucidate the cause of the GOE, but also helps us to better understand the adaptive evolution of life in response to the GOE. Here we performed phylogenetic analysis of an anti-oxidant enzyme Fe-SOD (iron superoxide dismutase) of cyanobacteria, to assess the adaptive evolution of life under the GOE. The rise of O2 level must have increased the level of toxic reactive oxygen species in cyanobacterial cells, thus forced them to change activities or the gene expression levels of Fe-SOD. In the present study, we focus on the change in the gene expression levels of the enzyme, which can be estimated from the promoter sequences of the gene. Promoters are DNA sequences found upstream of protein encoding regions, where RNA polymerase binds and initiates transcription. "Strong" promoters that efficiently interact with RNA polymerase induce high rates of transcription, leading to high levels of gene expression. Thus, from the temporal changes in the promoter sequences, we can estimate the variations in the gene expression levels during the geological time. Promoter sequences of Fe-SOD at each ancestral node of cyanobacteria were predicted from phylogenetic analysis, and the ancestral promoter sequences were compared to the promoters of known highly expressed genes. The similarity was low at the time of the emergence of cyanobacteria; however, increased at the branching nodes diverged 2.4 billon years ago. This roughly coincided with the onset of the GOE, implying that the transition from low to high gene
Convergent evolution of chromosomal sex-determining regions in the animal and fungal kingdoms.
Directory of Open Access Journals (Sweden)
James A Fraser
2004-12-01
Full Text Available Sexual identity is governed by sex chromosomes in plants and animals, and by mating type (MAT loci in fungi. Comparative analysis of the MAT locus from a species cluster of the human fungal pathogen Cryptococcus revealed sequential evolutionary events that fashioned this large, highly unusual region. We hypothesize that MAT evolved via four main steps, beginning with acquisition of genes into two unlinked sex-determining regions, forming independent gene clusters that then fused via chromosomal translocation. A transitional tripolar intermediate state then converted to a bipolar system via gene conversion or recombination between the linked and unlinked sex-determining regions. MAT was subsequently subjected to intra- and interallelic gene conversion and inversions that suppress recombination. These events resemble those that shaped mammalian sex chromosomes, illustrating convergent evolution in sex-determining structures in the animal and fungal kingdoms.
Co-evolution of secondary metabolite gene clusters and their host
DEFF Research Database (Denmark)
Kjærbølling, Inge; Vesth, Tammi Camilla; Frisvad, Jens Christian
Secondary metabolite gene cluster evolution is mainly driven by two events: gene duplication and annexation and horizontal gene transfer. Here we use comparative genomics of Aspergillus species to investigate the evolution of secondary metabolite (SM) gene clusters across a wide spectrum of speci....... We investigate the dynamic evolutionary relationship between the cluster and the host by examining the genes within the cluster and the number of homologous genes found within the host and in closely related species.......Secondary metabolite gene cluster evolution is mainly driven by two events: gene duplication and annexation and horizontal gene transfer. Here we use comparative genomics of Aspergillus species to investigate the evolution of secondary metabolite (SM) gene clusters across a wide spectrum of species...
Hearsay Ethnography: Conversational Journals as a Method for Studying Culture in Action.
Watkins, Susan Cotts; Swidler, Ann
2009-04-01
Social scientists have long struggled to develop methods adequate to their theoretical understanding of meaning as collective and dynamic. While culture is widely understood as an emergent property of collectivities, the methods we use keep pulling us back towards interview-situated accounts and an image of culture as located in individual experience. Scholars who seek to access supra-individual semiotic structures by studying public rituals and other collectively-produced texts then have difficulty capturing the dynamic processes through which such meanings are created and changed in situ. To try to capture more effectively the way meaning is produced and re-produced in everyday life, we focus here on conversational interactions-the voices and actions that constitute the relational space among actors. Conversational journals provide us with a method: the analysis of texts produced by cultural insiders who keep journals of who-said-what-to-whom in conversations they overhear or events they participate in during the course of their daily lives. We describe the method, distinguishing it from other approaches and noting its drawbacks. We then illustrate the methodological advantages of conversational journals with examples from our texts. We end with a discussion of the method's potential in our setting as well as in other places and times.
Directory of Open Access Journals (Sweden)
Ana Durvalina Bomtorin
Full Text Available Juvenile hormone (JH controls key events in the honey bee life cycle, viz. caste development and age polyethism. We quantified transcript abundance of 24 genes involved in the JH biosynthetic pathway in the corpora allata-corpora cardiaca (CA-CC complex. The expression of six of these genes showing relatively high transcript abundance was contrasted with CA size, hemolymph JH titer, as well as JH degradation rates and JH esterase (jhe transcript levels. Gene expression did not match the contrasting JH titers in queen and worker fourth instar larvae, but jhe transcript abundance and JH degradation rates were significantly lower in queen larvae. Consequently, transcriptional control of JHE is of importance in regulating larval JH titers and caste development. In contrast, the same analyses applied to adult worker bees allowed us inferring that the high JH levels in foragers are due to increased JH synthesis. Upon RNAi-mediated silencing of the methyl farnesoate epoxidase gene (mfe encoding the enzyme that catalyzes methyl farnesoate-to-JH conversion, the JH titer was decreased, thus corroborating that JH titer regulation in adult honey bees depends on this final JH biosynthesis step. The molecular pathway differences underlying JH titer regulation in larval caste development versus adult age polyethism lead us to propose that mfe and jhe genes be assayed when addressing questions on the role(s of JH in social evolution.
Bomtorin, Ana Durvalina; Mackert, Aline; Rosa, Gustavo Conrado Couto; Moda, Livia Maria; Martins, Juliana Ramos; Bitondi, Márcia Maria Gentile; Hartfelder, Klaus; Simões, Zilá Luz Paulino
2014-01-01
Juvenile hormone (JH) controls key events in the honey bee life cycle, viz. caste development and age polyethism. We quantified transcript abundance of 24 genes involved in the JH biosynthetic pathway in the corpora allata-corpora cardiaca (CA-CC) complex. The expression of six of these genes showing relatively high transcript abundance was contrasted with CA size, hemolymph JH titer, as well as JH degradation rates and JH esterase (jhe) transcript levels. Gene expression did not match the contrasting JH titers in queen and worker fourth instar larvae, but jhe transcript abundance and JH degradation rates were significantly lower in queen larvae. Consequently, transcriptional control of JHE is of importance in regulating larval JH titers and caste development. In contrast, the same analyses applied to adult worker bees allowed us inferring that the high JH levels in foragers are due to increased JH synthesis. Upon RNAi-mediated silencing of the methyl farnesoate epoxidase gene (mfe) encoding the enzyme that catalyzes methyl farnesoate-to-JH conversion, the JH titer was decreased, thus corroborating that JH titer regulation in adult honey bees depends on this final JH biosynthesis step. The molecular pathway differences underlying JH titer regulation in larval caste development versus adult age polyethism lead us to propose that mfe and jhe genes be assayed when addressing questions on the role(s) of JH in social evolution.
Infrared up-conversion microscope
DEFF Research Database (Denmark)
2014-01-01
There is presented an up-conversion infrared microscope (110) arranged for imaging an associated object (130), wherein the up-conversion infrared microscope (110) comprises a non-linear crystal (120) arranged for up-conversion of infrared electromagnetic radiation, and wherein an objective optical...
Infrared up-conversion telescope
DEFF Research Database (Denmark)
2014-01-01
There is presented to an up-conversion infrared telescope (110) arranged for imaging an associated scene (130), wherein the up-conversion infrared telescope (110) comprises a non-linear crystal (120) arranged for up-conversion of infrared electromagnetic radiation, and wherein a first optical...
Is conversion a syntactic or a lexical process of word formation?
Directory of Open Access Journals (Sweden)
Alexandra Soares Rodrigues
2013-01-01
Full Text Available Conversion is sometimes described as a syntactic phenomenon by which a lexical item changes its lexical category according to the syntactic environment where it is inserted. This syntactic-ordered approach comes from theoretical fields that conceive the lexicon as the domain of irregularity, whilst regular patterns are treated in syntax (Chomsky 1995. However, Portuguese converted deverbal nouns (remendo ‘event of mending’, curte ‘event of having fun’, trinca ‘event of biting’ manifest a structural behaviour that permits us to situate their formation in the lexicon instead of in the syntax. According to the theoretical allusion we made above, this would characterise converted deverbal nouns as lacking a regular pattern. However, what we mean is that the lexicon is not the field of irregularity. Apart from the irregular material that must be stored in long term memory as to be used by speakers, such as inherited lexemes (e.g. rato ‘mouse’, cão ‘dog’, rir ‘to laugh’, verde ‘green’, etc., the lexicon is the domain of word formation, which is constraint-based (Rodrigues 2008, 2009. This means the word formation part of the lexicon is constrained by regular patterns that are neither directional in principle, nor syntactic in nature. We follow Jackendoff (2002 conception on the lexicon, conceiving it an interface of syntax, phonology and semantics. Converted deverbal nouns formation seems to agree with this conception, since it depends on phonological, semantic and syntactical constraints (Rodrigues 2004, 2009. Portuguese verb-into-noun conversion is not a simple case of syntactic environment. This is specially visible when we confront this lexical conversion with a purely syntactic type of nominalisation (Kerleroux 1996, such as the one that occurs in O estudar matemática traz-me vantagens. ‘Studying maths brings me advantages’ or O remendar roupa é um recurso nesta época. ‘Mending cloths is a good resource
Directory of Open Access Journals (Sweden)
Reinhard Klein
2008-01-01
Full Text Available Gene directed-enzyme prodrug therapy (GDEPT is an approach for sensitization of tumor cells to an enzymatically activated, otherwise nontoxic, prodrug. Cytochrome P450 2B1 (CYP2B1 metabolizes the prodrugs cyclophosphamide (CPA and ifosfamide (IFA to produce the cytotoxic substances phosphoramide mustard and isophosphoramide mustard as well as the byproduct acrolein. We have constructed a retroviral promoter conversion (ProCon vector for breast cancer GDEPT. The vector allows expression of CYP2B1 from the mouse mammary tumor virus (MMTV promoter known to be active in the mammary glands of transgenic animals. It is anticipated to be used for the generation of encapsulated viral vector producing cells which, when placed inside or close to a tumor, will act as suppliers of the therapeutic CYP2B1 protein as well as of the therapeutic vector itself. The generated vector was effectively packaged by virus producing cells and allowed the production of high levels of enzymatically active CYP2B1 in infected cells which sensitized them to killing upon treatment with both IFA and CPA. Determination of the respective IC50 values demonstrated that the effective IFA dose was reduced by sixteen folds. Infection efficiencies in vivo were determined using a reporter gene-bearing vector in a mammary cancer cell-derived xenograft tumor mouse model.
Directory of Open Access Journals (Sweden)
Elsa Petit
Full Text Available Clostridium phytofermentans was isolated from forest soil and is distinguished by its capacity to directly ferment plant cell wall polysaccharides into ethanol as the primary product, suggesting that it possesses unusual catabolic pathways. The objective of the present study was to understand the molecular mechanisms of biomass conversion to ethanol in a single organism, Clostridium phytofermentans, by analyzing its complete genome and transcriptome during growth on plant carbohydrates. The saccharolytic versatility of C. phytofermentans is reflected in a diversity of genes encoding ATP-binding cassette sugar transporters and glycoside hydrolases, many of which may have been acquired through horizontal gene transfer. These genes are frequently organized as operons that may be controlled individually by the many transcriptional regulators identified in the genome. Preferential ethanol production may be due to high levels of expression of multiple ethanol dehydrogenases and additional pathways maximizing ethanol yield. The genome also encodes three different proteinaceous bacterial microcompartments with the capacity to compartmentalize pathways that divert fermentation intermediates to various products. These characteristics make C. phytofermentans an attractive resource for improving the efficiency and speed of biomass conversion to biofuels.
DEFF Research Database (Denmark)
Ayres, Phil
2012-01-01
This essay discusses models. It examines what models are, the roles models perform and suggests various intentions that underlie their construction and use. It discusses how models act as a conversational partner, and how they support various forms of conversation within the conversational activity...
Armeli, Stephen; Conner, Tamlin S; Covault, Jonathan; Tennen, Howard; Kranzler, Henry R
2008-11-01
This study was performed to examine whether a polymorphism (5-HTTLPR) in the serotonin transporter gene was related to college students' reports of relief drinking (drinking-to-cope motives) and whether it moderated the associations between negative life events and drinking to cope. We examined reward drinking (drinking-to-enhance motives) as a comparison and to see whether these effects varied across gender. Using an Internet-based survey, college students (N = 360; 192 women) self-reported on drinking motives and negative life events for up to 4 years. Study participants provided saliva for genotyping the triallelic (LA vs LG or S) variants of 5-HTTLPR. Among men, individuals with two risk alleles (LG or S), compared with individuals with the LA/LA allele, displayed lower drinking-to-cope motives. Among women, individuals with one risk allele (either LG or S), compared with individuals with the LA/LA allele, displayed stronger drinking-to-enhance motives. The association between yearly changes in negative life events and drinking-to-cope motives varied across 5-HTTLPR genotype and gender and was strongest in the positive direction for women with the LA/LA variant. Our findings are not consistent with prior speculation that stronger positive associations between life stress and alcohol use among individuals with the LG or S allele are the result of increased use of alcohol as a method for coping with stress. The importance of examining gender differences in the relations between 5-HTTLPR, substance use, and related constructs is also noted.
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
Bull, L; Holland, O; Blackmore, S
2000-01-01
In this article we examine the effects of the emergence of a new replicator, memes, on the evolution of a pre-existing replicator, genes. Using a version of the NKCS model we examine the effects of increasing the rate of meme evolution in relation to the rate of gene evolution, for various degrees of interdependence between the two replicators. That is, the effects of memes' (suggested) more rapid rate of evolution in comparison to that of genes is investigated using a tunable model of coevolution. It is found that, for almost any degree of interdependence between the two replicators, as the rate of meme evolution increases, a phase transition-like dynamic occurs under which memes have a significantly detrimental effect on the evolution of genes, quickly resulting in the cessation of effective gene evolution. Conversely, the memes experience a sharp increase in benefit from increasing their rate of evolution. We then examine the effects of enabling genes to reduce the percentage of gene-detrimental evolutionary steps taken by memes. Here a critical region emerges as the comparative rate of meme evolution increases, such that if genes cannot effectively select memes a high percentage of the time, they suffer from meme evolution as if they had almost no selective capability.
Nominal Performance Biosphere Dose Conversion Factor Analysis
Energy Technology Data Exchange (ETDEWEB)
M. Wasiolek
2004-09-08
This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the Total System Performance Assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the groundwater exposure scenario, and the development of conversion factors for assessing compliance with the groundwater protection standard. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA-LA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the ''Biosphere Model Report'' in Figure 1-1, contain detailed description of the model input parameters, their development, and the relationship between the parameters and specific features events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the groundwater exposure scenario. The objectives of this analysis are to develop BDCFs for the groundwater exposure scenario for the three climate states considered in the TSPA-LA as well as conversion factors for evaluating compliance with the groundwater protection standard. The BDCFs will be used in performance assessment for calculating all-pathway annual doses for a given concentration of radionuclides in groundwater. The conversion factors will be used for calculating gross alpha particle
Nominal Performance Biosphere Dose Conversion Factor Analysis
International Nuclear Information System (INIS)
M. Wasiolek
2004-01-01
This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the Total System Performance Assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the groundwater exposure scenario, and the development of conversion factors for assessing compliance with the groundwater protection standard. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA-LA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the ''Biosphere Model Report'' in Figure 1-1, contain detailed description of the model input parameters, their development, and the relationship between the parameters and specific features events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the groundwater exposure scenario. The objectives of this analysis are to develop BDCFs for the groundwater exposure scenario for the three climate states considered in the TSPA-LA as well as conversion factors for evaluating compliance with the groundwater protection standard. The BDCFs will be used in performance assessment for calculating all-pathway annual doses for a given concentration of radionuclides in groundwater. The conversion factors will be used for calculating gross alpha particle activity in groundwater and the annual dose
Engineering Escherichia coli for methanol conversion.
Müller, Jonas E N; Meyer, Fabian; Litsanov, Boris; Kiefer, Patrick; Potthoff, Eva; Heux, Stéphanie; Quax, Wim J; Wendisch, Volker F; Brautaset, Trygve; Portais, Jean-Charles; Vorholt, Julia A
2015-03-01
Methylotrophic bacteria utilize methanol and other reduced one-carbon compounds as their sole source of carbon and energy. For this purpose, these bacteria evolved a number of specialized enzymes and pathways. Here, we used a synthetic biology approach to select and introduce a set of "methylotrophy genes" into Escherichia coli based on in silico considerations and flux balance analysis to enable methanol dissimilation and assimilation. We determined that the most promising approach allowing the utilization of methanol was the implementation of NAD-dependent methanol dehydrogenase and the establishment of the ribulose monophosphate cycle by expressing the genes for hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexuloisomerase (Phi). To test for the best-performing enzymes in the heterologous host, a number of enzyme candidates from different donor organisms were selected and systematically analyzed for their in vitro and in vivo activities in E. coli. Among these, Mdh2, Hps and Phi originating from Bacillus methanolicus were found to be the most effective. Labeling experiments using (13)C methanol with E. coli producing these enzymes showed up to 40% incorporation of methanol into central metabolites. The presence of the endogenous glutathione-dependent formaldehyde oxidation pathway of E. coli did not adversely affect the methanol conversion rate. Taken together, the results of this study represent a major advancement towards establishing synthetic methylotrophs by gene transfer. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Adamovich, M.I.; Alexandrov, Y.A.; Aggarwal, M.M.
1992-03-01
Non-statistical fluctuations are used to probe the dynamical behaviour of multiparticle production in heavy ion interactions at ultra-relativistic energies. In a one-dimensional analysis a 1/ρ-scaling is established and it is furthermore found that effects from higher order particle correlations are small. In a two-dimensional analysis it is shown that a small background of particle-pairs with a narrow opening angle can distort the observed signal. As an example we estimate of the influence of γ-conversion and find that in our experiment γ-conversion alone gives results consistent with the experimental observations from a two-dimensional analysis. Whereas a two-dimensional analysis filters events where two particles are extremely close in phase space, the one-dimensional analysis picks out events with particles clustered in pseudorapidity, which are at the same time diluted in the azimuthal plane. (au)
Directory of Open Access Journals (Sweden)
Nathalie Alazard-Dany
2009-03-01
Full Text Available The human parvovirus Adeno-Associated Virus (AAV type 2 can only replicate in cells co-infected with a helper virus, such as Adenovirus or Herpes Simplex Virus type 1 (HSV-1; whereas, in the absence of a helper virus, it establishes a latent infection. Previous studies demonstrated that the ternary HSV-1 helicase/primase (HP complex (UL5/8/52 and the single-stranded DNA-Binding Protein (ICP8 were sufficient to induce AAV-2 replication in transfected cells. We independently showed that, in the context of a latent AAV-2 infection, the HSV-1 ICP0 protein was able to activate rep gene expression. The present study was conducted to integrate these observations and to further explore the requirement of other HSV-1 proteins during early AAV replication steps, i.e. rep gene expression and AAV DNA replication. Using a cellular model that mimics AAV latency and composite constructs coding for various sets of HSV-1 genes, we first confirmed the role of ICP0 for rep gene expression and demonstrated a synergistic effect of ICP4 and, to a lesser extent, ICP22. Conversely, ICP27 displayed an inhibitory effect. Second, our analyses showed that the effect of ICP0, ICP4, and ICP22 on rep gene expression was essential for the onset of AAV DNA replication in conjunction with the HP complex and ICP8. Third, and most importantly, we demonstrated that the HSV-1 DNA polymerase complex (UL30/UL42 was critical to enhance AAV DNA replication to a significant level in transfected cells and that its catalytic activity was involved in this process. Altogether, this work represents the first comprehensive study recapitulating the series of early events taking place during HSV-1-induced AAV replication.
National Research Council Canada - National Science Library
Traum, David R
2006-01-01
.... On the other hand, the full spectrum of communication between interacting agents includes cases in which multiple segments of conversation can be interleaved with other, sometimes unrelated actions and events (e.g., a cocktail party...
Four questions and a conversation: Can theory enrich conversation partner training?
DEFF Research Database (Denmark)
Pound, Carole; Ahlsén, Elisabeth; Simmons-Mackie, NIna
Background and aimsConversation partner training (CPT) is an umbrella term for different approaches to intervention aiming to facilitate and improve communication between people with aphasia (PWA) and their conversation partners (CP). Some approaches are grounded in a bottom-up approach...... and interactions. Philosophically informed by existential-phenomenological perspectives, the humanisation framework encourages reflection on what practices can make people feel more (or less) human. Reviewing experiences of conversation against the eight suggested dimensions of what it means to be human may offer...
Corliss, William R.
This publication is one of a series of information booklets for the general public published by the United States Atomic Energy Commission. Direct energy conversion involves energy transformation without moving parts. The concepts of direct and dynamic energy conversion plus the laws governing energy conversion are investigated. Among the topics…
Humor and the Emeritus Professor: An Interview with Gene Roth
Vivona, Brian
2015-01-01
This essay is a compilation of several conversations with Dr. Gene Roth, Distinguished Teaching Professor Emeritus at Northern Illinois University. Dr. Roth is past President of the Academy of Human Resource Development, and although he is well known for his efforts in bringing humor into the field of HRD, he is not the same Gene Roth that played…
Supercritical CO2 Brayton Cycle Energy Conversion System Coupled with SFR
International Nuclear Information System (INIS)
Cha, Jae Eun; Kim, S. O.; Seong, S. H.; Eoh, J. H.; Lee, T. H.; Choi, S. K.; Han, J. W.; Bae, S. W.
2008-12-01
This report contains the description of the S-CO 2 Brayton cycle coupled to KALIMER-600 as an alternative energy conversion system. For a system development, a computer code was developed to calculate heat balance of normal operation condition. Based on the computer code, the S-CO 2 Brayton cycle energy conversion system was constructed for the KALIMER-600. Computer codes were developed to analysis for the S-CO 2 turbomachinery. Based on the design codes, the design parameters were prepared to configure the KALIMER-600 S-CO 2 turbomachinery models. A one-dimensional analysis computer code was developed to evaluate the performance of the previous PCHE heat exchangers and a design data for the typical type PCHE was produced. In parallel with the PCHE-type heat exchanger design, an airfoil shape fin PCHE heat exchanger was newly designed. The new design concept was evaluated by three-dimensional CFD analyses. Possible control schemes for power control in the KALIMER-600 S-CO 2 Brayton cycle were investigated by using the MARS code. The MMS-LMR code was also developed to analyze the transient phenomena in a SFR with a supercritical CO 2 Brayton cycle to develop the control logic. Simple power reduction and recovery event was selected and analyzed for the transient calculation. For the evaluation of Na-CO 2 boundary failure event, a computer was developed to simulate the complex thermodynamic behaviors coupled with the chemical reaction between liquid sodium and CO 2 gas. The long term behavior of a Na-CO 2 boundary failure event and its consequences which lead to a system pressure transient were evaluated
Association between serotonin 2A receptor genetic variations, stressful life events and suicide.
Ghasemi, Asghar; Seifi, Morteza; Baybordi, Fatemeh; Danaei, Nasim; Samadi Rad, Bahram
2018-06-05
Life events are series of events that disrupt a person's psychological equilibrium and may enhance the development of a disorder such as suicide. Several studies have assessed a relationship between 5-hydroxytryptamine (serotonin) 2A receptor (5-HTR2A) gene polymorphisms with an increased risk of suicide. However, there has been no study about the association between three 5-HTR2A gene polymorphisms, A1438G (rs6311), T102C (rs6313) and C1354T (rs6314), suicide, stressful life, and loss events in a same time. Relatives of 191 suicide victims were interviewed using a semi-structured questionnaire designed according to Iranian culture. Venous blood was taken from all subjects for DNA isolation. 5-HTR2A polymorphisms in a total of 191 suicide victims and 218 healthy controls were genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Chi-squared and Fisher's exact tests were used to compare genotype and allele frequencies between suicide and control groups. Correction for multiple comparisons was calculated using Bonferroni correction. There was a significant association between the 102 C/C genotype of 5-HTR2A gene and suicide (к 2 = 8.700, P = 0.012). Furthermore, we found that suicide victims with a 102 C/C genotype had a significantly higher number of stressful life and loss events (P suicide victims and control participants and there was no association between genotype distribution and higher number of stressful life and loss events (P > 0.05). Our results suggest that C102T (rs6313) polymorphism of 5-HTR2A gene may be involved in the susceptibility to suicide, higher number of stressful life and loss events, but A1438G (rs6311) and C1354T (rs6314) polymorphisms of 5-HTR2A gene were not associated with suicide, higher number of stressful life and loss events. Copyright © 2018 Elsevier B.V. All rights reserved.
Characterizing Turbulent Events at a Tidal Energy Site from Acoustic Doppler Velocity Observations
McCaffrey, Katherine; Fox-Kemper, Baylor; Hamlington, Peter
2013-11-01
As interest in marine renewable energy increases, observations are crucial to understanding the environments encountered by energy conversion devices. Data obtained from an acoustic Doppler current profiler and an acoustic Doppler velocimeter at two locations in the Puget Sound, WA are used to perform a detailed analysis of the turbulent environment that is expected to be present at a turbine placed in a tidal strait. Metrics such as turbulence intensity, structure functions, probability density functions, intermittency, coherent turbulence kinetic energy, anisotropy invariants, and linear combinations of eigenvalues are used to characterize the turbulence. The results indicate that coherent turbulence kinetic energy and turbulence intensity can be used to identify and parameterize different turbulent events in the flow. An analysis of the anisotropy characteristics leads to a physical description of turbulent events (defined using both turbulence intensity and coherent turbulent kinetic energy) as being dominated by one component of the Reynolds stresses. During non-turbulent events, the flow is dominated by two Reynolds stress components. The importance of these results for the development of realistic models of energy conversion devices is outlined. Cooperative Institute for Research in Environmental Sciences, Department of Atmospheric and Oceanic Sciences.
Integration through relatedness in the conversational model: a case study.
Haliburn, Joan
2009-02-01
The aim of this paper is to demonstrate the principles of the conversational model in two therapies with a patient, at 16 years of age and again 20 years later. Described is the first therapy of L, which commenced in hospital and continued twice weekly after discharge. L was an acutely disturbed 16-year-old female admitted for 4 months to the psychiatry ward, a dynamically oriented milieu of a University teaching hospital where I was training. This is followed by a brief description of L's second therapy. Supervision was through audiotape of sessions. At the conclusion of the first therapy, L was functioning well. Five years later, she married and had a child. She was referred to me again after she attempted suicide following an acute stressful event which resulted in hospitalization. She is more aware and reflective at present but continues to be vulnerable. Attention to certain aspects of the psychotherapeutic relationship is important as demonstrated in the conversational model.
Directory of Open Access Journals (Sweden)
Jubin N Shah
2016-10-01
Full Text Available Molecular dissection of apomixis - an asexual reproductive mode - is anticipated to solve the enigma of loss of meiotic sex, and to help fixing elite agronomic traits. The Brassicaceae genus Boechera comprises of both sexual and apomictic species, permitting comparative analyses of meiotic circumvention (apomeiosis and parthenogenesis. Whereas previous studies reported local transcriptome changes during these events, it remained unclear whether global changes associated with hybridization, polyploidy and environmental adaptation that arose during evolution of Boechera might hint as (epigenetic regulators of early development prior apomictic initiation. To identify these signatures during vegetative stages, we compared seedling RNA-seq transcriptomes of an obligate triploid apomict and a diploid sexual, both isolated from a drought-prone habitat. Uncovered were several genes differentially expressed between sexual and apomictic seedlings, including homologues of meiotic genes ASYNAPTIC 1 (ASY1 and MULTIPOLAR SPINDLE 1 (MPS1 that were down-regulated in apomicts. An intriguing class of apomict-specific deregulated genes included several NAC transcription factors, homologues of which are known to be transcriptionally reprogrammed during abiotic stress in other plants. Deregulation of both meiotic and stress-response genes during seedling stages might possibly be important in preparation for meiotic circumvention, as similar transcriptional alteration was discernible in apomeiotic floral buds too. Furthermore, we noted that the apomict showed better tolerance to osmotic stress in vitro than the sexual, in conjunction with significant upregulation of a subset of NAC genes. In support of the current model that DNA methylation epigenetically regulates stress, ploidy, hybridization and apomixis, we noted that ASY1, MPS1 and NAC019 homologues were deregulated in Boechera seedlings upon DNA demethylation, and ASY1 in particular seems to be repressed by
Messerle, H K; Declaris, Nicholas
2013-01-01
Energy Conversion Statics deals with equilibrium situations and processes linking equilibrium states. A development of the basic theory of energy conversion statics and its applications is presented. In the applications the emphasis is on processes involving electrical energy. The text commences by introducing the general concept of energy with a survey of primary and secondary energy forms, their availability, and use. The second chapter presents the basic laws of energy conversion. Four postulates defining the overall range of applicability of the general theory are set out, demonstrating th
Uranium Conversion & Enrichment
Energy Technology Data Exchange (ETDEWEB)
Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-02-06
The isotopes of uranium that are found in nature, and hence in ‘fresh’ Yellowcake’, are not in relative proportions that are suitable for power or weapons applications. The goal of conversion then is to transform the U3O8 yellowcake into UF6. Conversion and enrichment of uranium is usually required to obtain material with enough 235U to be usable as fuel in a reactor or weapon. The cost, size, and complexity of practical conversion and enrichment facilities aid in nonproliferation by design.
DEFF Research Database (Denmark)
Aakjær, Marie Kirstejn; Andrade, David; Dexters, Peter
and in regards to rehabilitation efforts. In the context of prisons UDI is inspired by the complexity approach (Stacey 2005). We seek to facilitate freely flowing conversations between inmates, staff and managers – pushing the boundaries of existing norms, roles and beliefs. In the end however we rely...... relations by changing conversations. Through the theoretical framework of the complexity approach, we discuss how this may lead to organizational change. Finally we suggest that inviting inmates to take part in conversations about core organizational development may be a fundamental strategy in trying...
Political conversations on Facebook
DEFF Research Database (Denmark)
Sørensen, Mads P.
2016-01-01
Political conversations are according to theories on deliberative democracy essential to well-functioning democracies. Traditionally these conversations have taken place in face-to-face settings, in e.g. party meetings and town meetings. However, social media such as Facebook and Twitter offers new...... possibilities for online political conversations between citizens and politicians. This paper examines the presence on Facebook and Twitter of Members of the Danish national Parliament, the Folketing, and focusses on a quantitative mapping of the political conversation activities taking place in the threads...... following Facebook posts from Danish Members of Parliament (MPs). The paper shows that, in comparison with previous findings from other countries, Danish MPs have a relatively high degree of engagement in political conversations with citizens on Facebook – and that a large number of citizens follow MPs...
[Conversation analysis for improving nursing communication].
Yi, Myungsun
2007-08-01
Nursing communication has become more important than ever before because quality of nursing services largely depends on the quality of communication in a very competitive health care environment. This article was to introduce ways to improve nursing communication using conversation analysis. This was a review study on conversation analysis, critically examining previous studies in nursing communication and interpersonal relationships. This study provided theoretical backgrounds and basic assumptions of conversation analysis which was influenced by ethnomethodology, phenomenology, and sociolinguistic. In addition, the characteristics and analysis methods of conversation analysis were illustrated in detail. Lastly, how conversation analysis could help improve communication was shown, by examining researches using conversation analysis not only for ordinary conversations but also for extraordinary or difficult conversations such as conversations between patients with dementia and their professional nurses. Conversation analysis can help in improving nursing communication by providing various structures and patterns as well as prototypes of conversation, and by suggesting specific problems and problem-solving strategies in communication.
Methylation of miRNA genes and oncogenesis.
Loginov, V I; Rykov, S V; Fridman, M V; Braga, E A
2015-02-01
Interaction between microRNA (miRNA) and messenger RNA of target genes at the posttranscriptional level provides fine-tuned dynamic regulation of cell signaling pathways. Each miRNA can be involved in regulating hundreds of protein-coding genes, and, conversely, a number of different miRNAs usually target a structural gene. Epigenetic gene inactivation associated with methylation of promoter CpG-islands is common to both protein-coding genes and miRNA genes. Here, data on functions of miRNAs in development of tumor-cell phenotype are reviewed. Genomic organization of promoter CpG-islands of the miRNA genes located in inter- and intragenic areas is discussed. The literature and our own results on frequency of CpG-island methylation in miRNA genes from tumors are summarized, and data regarding a link between such modification and changed activity of miRNA genes and, consequently, protein-coding target genes are presented. Moreover, the impact of miRNA gene methylation on key oncogenetic processes as well as affected signaling pathways is discussed.
Herbert, Andrew P; Kavanagh, David; Johansson, Conny; Morgan, Hugh P; Blaum, Bärbel S; Hannan, Jonathan P; Barlow, Paul N; Uhrín, Dušan
2012-03-06
Numerous complement factor H (FH) mutations predispose patients to atypical hemolytic uremic syndrome (aHUS) and other disorders arising from inadequately regulated complement activation. No unifying structural or mechanistic consequences have been ascribed to these mutants beyond impaired self-cell protection. The S1191L and V1197A mutations toward the C-terminus of FH, which occur in patients singly or together, arose from gene conversion between CFH encoding FH and CFHR1 encoding FH-related 1. We show that neither single nor double mutations structurally perturbed recombinant proteins consisting of the FH C-terminal modules, 19 and 20 (FH19-20), although all three FH19-20 mutants were poor, compared to wild-type FH19-20, at promoting hemolysis of C3b-coated erythrocytes through competition with full-length FH. Indeed, our new crystal structure of the S1191L mutant of FH19-20 complexed with an activation-specific complement fragment, C3d, was nearly identical to that of the wild-type FH19-20:C3d complex, consistent with mutants binding to C3b with wild-type-like affinity. The S1191L mutation enhanced thermal stability of module 20, whereas the V1197A mutation dramatically decreased it. Thus, although mutant proteins were folded at 37 °C, they differ in conformational rigidity. Neither single substitutions nor double substitutions increased measurably the extent of FH19-20 self-association, nor did these mutations significantly affect the affinity of FH19-20 for three glycosaminoglycans, despite critical roles of module 20 in recognizing polyanionic self-surface markers. Unexpectedly, FH19-20 mutants containing Leu1191 self-associated on a heparin-coated surface to a higher degree than on surfaces coated with dermatan or chondroitin sulfates. Thus, potentially disease-related functional distinctions between mutants, and between FH and FH-related 1, may manifest in the presence of specific glycosaminoglycans.
Interaction between genetic polymorphisms and stressful life events in first episode depression
DEFF Research Database (Denmark)
Bukh, Jens Drachmann; Bock, Camilla; Vinberg, Maj
2009-01-01
of depression among participants. METHOD: We applied a case-only design, including 290 ethnically homogeneous patients suffering exclusively from first episode depression. Psychiatric mo-morbidity, personality traits and disorders and stressful life events in a six months period preceding onset of depression......BACKGROUND: A polymorphism in the serotonin transporter (5-HTT) gene seems to moderate the influence of stressful life events on depression. However, the results from previous studies of gene-environment interactions in depression are inconsistent and might be confounded by the history......A, 2A, and 2C. RESULTS: The low activity variants of the 5-HTT-linked polymorphic region in the serotonin transporter gene and the Met-allele of a single nucleotide polymorphism (Val66Met) in the gene encoding brain derived neurotrophic factor were independently associated with the presence...
Gastrointestinal symptoms among swimmers following rain events at a beach impacted by urban runoff
Gastrointestinal symptoms among swimmers following rain events at a beach impacted by urban runoff Timothy J. Wade, Reagan R. Converse, Elizabeth A. Sams, Ann H. Williams, Edward Hudgens, Alfred P. Dufour Gastrointestinal symptoms among swimmers have been associated with fecal ...
Conversion Ratio between Botox®, Dysport®, and Xeomin® in Clinical Practice
Directory of Open Access Journals (Sweden)
Francesco Scaglione
2016-03-01
Full Text Available Botulinum neurotoxin has revolutionized the treatment of spasticity and is now administered worldwide. There are currently three leading botulinum neurotoxin type A products available in the Western Hemisphere: onabotulinum toxin-A (ONA Botox®, abobotulinum toxin-A (ABO, Dysport®, and incobotulinum toxin A (INCO, Xeomin®. Although the efficacies are similar, there is an intense debate regarding the comparability of various preparations. Here we will address the clinical issues of potency and conversion ratios, as well as safety issues such as toxin spread and immunogenicity, to provide guidance for BoNT-A use in clinical practice. INCO was shown to be as effective as ONA with a comparable adverse event profile when a clinical conversion ratio of 1:1 was used. The available clinical and preclinical data suggest that a conversion ratio ABO:ONA of 3:1—or even lower—could be appropriate for treating spasticity, cervical dystonia, and blepharospasm or hemifacial spasm. A higher conversion ratio may lead to an overdosing of ABO. While uncommon, distant spread may occur; however, several factors other than the pharmaceutical preparation are thought to affect spread. Finally, whereas the three products have similar efficacy when properly dosed, ABO has a better cost-efficacy profile.
Queer Genes: Realism, Sexuality and Science.
Griffiths, David Andrew
2016-10-19
What are 'gay genes' and are they real? This article looks at key research into these hypothesized gay genes, made possible, in part, by the Human Genome Project. I argue that the complexity of both genetics and human sexuality demands a truly critical approach: one that takes into account feminist epistemologies of science and queer approaches to the body, while putting into conversation resources from agential realism and critical realism. This approach is able to maintain the agential complexity of genetic materiality, while also critically challenging the seemingly stable relationships between sex, gender and sexuality.
Mitochondrial tRNA gene translocations in highly eusocial bees
Directory of Open Access Journals (Sweden)
Daniela Silvestre
2006-01-01
Full Text Available Mitochondrial gene rearrangement events, especially involving tRNA genes, have been described more frequently as more complete mitochondrial genome sequences are becoming available. In the present work, we analyzed mitochondrial tRNA gene rearrangements between two bee species belonging to the tribes Apini and Meliponini within the "corbiculate Apidae". Eleven tRNA genes are in different genome positions or strands. The molecular events responsible for each translocation are explained. Considering the high number of rearrangements observed, the data presented here contradict the general rule of high gene order conservation among closely related organisms, and also represent a powerful molecular tool to help solve questions about phylogeny and evolution in bees.
Nominal Performance Biosphere Dose Conversion Factor Analysis
Energy Technology Data Exchange (ETDEWEB)
M.A. Wasiolek
2005-04-28
This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the Total System Performance Assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the groundwater exposure scenario, and the development of conversion factors for assessing compliance with the groundwater protection standards. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop BDCFs, which are input parameters for the TSPA-LA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the ''Biosphere Model Report'' in Figure 1-1, contain detailed description of the model input parameters, their development, and the relationship between the parameters and specific features events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the groundwater exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and the five analyses that develop parameter values for the biosphere model (BSC 2005 [DIRS 172827]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis
Directory of Open Access Journals (Sweden)
Romy M W Kremers
Full Text Available Impaired coagulation factor synthesis in cirrhosis causes a reduction of most pro- and anticoagulant factors. Cirrhosis patients show no clear bleeding or thrombotic phenotype, although they are at risk for both types of hemostatic event. Thrombin generation (TG is a global coagulation test and its outcome depends on underlying pro- and anticoagulant processes (prothrombin conversion and thrombin inactivation. We quantified the prothrombin conversion and thrombin inactivation during TG in 30 healthy subjects and 52 Child-Pugh (CP- A, 15 CP-B and 6 CP-C cirrhosis patients to test the hypothesis that coagulation is rebalanced in liver cirrhosis patients. Both prothrombin conversion and thrombin inactivation are reduced in cirrhosis patients. The effect on pro- and anticoagulant processes partially cancel each other out and as a result TG is comparable at 5 pM tissue factor between healthy subjects and patients. This supports the hypothesis of rebalanced hemostasis, as TG in cirrhosis patients remains within the normal range, despite large changes in prothrombin conversion and thrombin inactivation. Nevertheless, in silico analysis shows that normalization of either prothrombin conversion or thrombin inactivation to physiological levels, by for example the administration of prothrombin complex concentrates would cause an elevation of TG, whereas the normalization of both simultaneously maintains a balanced TG. Therefore, cirrhosis patients might require adapted hemostatic treatment.
Postoperative conversion disorder.
Afolabi, Kola; Ali, Sameer; Gahtan, Vivian; Gorji, Reza; Li, Fenghua; Nussmeier, Nancy A
2016-05-01
Conversion disorder is a psychiatric disorder in which psychological stress causes neurologic deficits. A 28-year-old female surgical patient had uneventful general anesthesia and emergence but developed conversion disorder 1 hour postoperatively. She reported difficulty speaking, right-hand numbness and weakness, and right-leg paralysis. Neurologic examination and imaging revealed no neuronal damage, herniation, hemorrhage, or stroke. The patient mentioned failing examinations the day before surgery and discontinuing her prescribed antidepressant medication, leading us to diagnose conversion disorder, with eventual confirmation by neuroimaging and follow-up examinations. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Vicente, R.; Dellamano, J.C.
1989-12-01
A set of mathematical equations was developed and used to estimate the radiological significance of each radionuclide potentially present in the uranium refining industry effluents. The equations described the evolution in time of the radionuclides activities in the uranium fuel cycle, from mining and milling, through the yellowcake, till the conversion effluents. Some radionuclides that are not usually monitored in conversion effluents (e.g. Pa-231 and Ac-227) were found to be potentially relevant from the radiological point of view in conversion facilities, and are certainly relevant in mining and milling industry, at least in a few waste streams. (author) [pt
5 CFR 317.302 - Conversion procedures.
2010-01-01
... conversion. (2) Pay. Upon conversion to the Senior Executive Service, an employee's SES rate will be... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Conversion procedures. 317.302 Section... IN THE SENIOR EXECUTIVE SERVICE Conversion to the Senior Executive Service § 317.302 Conversion...
Developing a safety report for an existing conversion facility
International Nuclear Information System (INIS)
Carisse, Hess
2013-01-01
A review of the process used to meet the regulatory requirements for a Safety Report at an existing conversion facility is described. This paper will cover the establishment of the regulatory criteria, selection of appropriate methodologies, identification of events and modeling of credible events. Once established there is on-going maintenance to deal with design changes and the need for periodic reviews will also be discussed. Challenges in dealing with the various phases, including incorporation of historical licensing documents, and lessons learned are presented. Of specific interest is the failure of the selected methodology to deal with infrastructure issues. One aspect of lessons learned that will be explored is the lack of an available mechanism for sharing information with similar fuel cycle facilities which is compounded by the fact that there are a small number of fuel cycle facilities compared to nuclear power plants. Possible approaches to dealing with this issue are also discussed. (authors)
Plant thymidine kinase 1: a novel efficient suicide gene for malignant glioma therapy
DEFF Research Database (Denmark)
Khan, Z.; Knecht, Wolfgang; Willer, Mette
2010-01-01
The prognosis for malignant gliomas remains poor, and new treatments are urgently needed. Targeted suicide gene therapy exploits the enzymatic conversion of a prodrug, such as a nucleoside analog, into a cytotoxic compound. Although this therapeutic strategy has been considered a promising regimen...... suicide gene therapy system in combination with stem cell mediated gene delivery promises new treatment of malignant gliomas....
Conversational flow promotes solidarity.
Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H
2013-01-01
Social interaction is fundamental to the development of various aspects of "we-ness". Previous research has focused on the role the content of interaction plays in establishing feelings of unity, belongingness and shared reality (a cluster of variables referred to as solidarity here). The present paper is less concerned with content, but focuses on the form of social interaction. We propose that the degree to which conversations flow smoothly or not is, of itself, a cue to solidarity. We test this hypothesis in samples of unacquainted and acquainted dyads who communicate via headsets. Conversational flow is disrupted by introducing a delay in the auditory feedback (vs. no delay). Results of three studies show that smoothly coordinated conversations (compared with disrupted conversations and a control condition) increase feelings of belonging and perceptions of group entitativity, independently of conversation content. These effects are driven by the subjective experience of conversational flow. Our data suggest that this process occurs largely beyond individuals' control. We conclude that the form of social interaction is a powerful cue for inferring group solidarity. Implications for the impact of modern communication technology on developing a shared social identity are discussed.
Conversational flow promotes solidarity.
Directory of Open Access Journals (Sweden)
Namkje Koudenburg
Full Text Available Social interaction is fundamental to the development of various aspects of "we-ness". Previous research has focused on the role the content of interaction plays in establishing feelings of unity, belongingness and shared reality (a cluster of variables referred to as solidarity here. The present paper is less concerned with content, but focuses on the form of social interaction. We propose that the degree to which conversations flow smoothly or not is, of itself, a cue to solidarity. We test this hypothesis in samples of unacquainted and acquainted dyads who communicate via headsets. Conversational flow is disrupted by introducing a delay in the auditory feedback (vs. no delay. Results of three studies show that smoothly coordinated conversations (compared with disrupted conversations and a control condition increase feelings of belonging and perceptions of group entitativity, independently of conversation content. These effects are driven by the subjective experience of conversational flow. Our data suggest that this process occurs largely beyond individuals' control. We conclude that the form of social interaction is a powerful cue for inferring group solidarity. Implications for the impact of modern communication technology on developing a shared social identity are discussed.
Nuclear spin conversion in formaldehyde
Chapovsky, Pavel L.
2000-01-01
Theoretical model of the nuclear spin conversion in formaldehyde (H2CO) has been developed. The conversion is governed by the intramolecular spin-rotation mixing of molecular ortho and para states. The rate of conversion has been found equal 1.4*10^{-4}~1/s*Torr. Temperature dependence of the spin conversion has been predicted to be weak in the wide temperature range T=200-900 K.
Convergent evolution of gene networks by single-gene duplications in higher eukaryotes.
Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich
2004-03-01
By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.
Horizontal gene transfer in an acid mine drainage microbial community.
Guo, Jiangtao; Wang, Qi; Wang, Xiaoqi; Wang, Fumeng; Yao, Jinxian; Zhu, Huaiqiu
2015-07-04
Horizontal gene transfer (HGT) has been widely identified in complete prokaryotic genomes. However, the roles of HGT among members of a microbial community and in evolution remain largely unknown. With the emergence of metagenomics, it is nontrivial to investigate such horizontal flow of genetic materials among members in a microbial community from the natural environment. Because of the lack of suitable methods for metagenomics gene transfer detection, microorganisms from a low-complexity community acid mine drainage (AMD) with near-complete genomes were used to detect possible gene transfer events and suggest the biological significance. Using the annotation of coding regions by the current tools, a phylogenetic approach, and an approximately unbiased test, we found that HGTs in AMD organisms are not rare, and we predicted 119 putative transferred genes. Among them, 14 HGT events were determined to be transfer events among the AMD members. Further analysis of the 14 transferred genes revealed that the HGT events affected the functional evolution of archaea or bacteria in AMD, and it probably shaped the community structure, such as the dominance of G-plasma in archaea in AMD through HGT. Our study provides a novel insight into HGT events among microorganisms in natural communities. The interconnectedness between HGT and community evolution is essential to understand microbial community formation and development.
Directory of Open Access Journals (Sweden)
Gadagkar Sudhindra R
2010-04-01
Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions
Investigation of tissue-specific human orthologous alternative splice events in pig
DEFF Research Database (Denmark)
Hillig, Ann-Britt Nygaard; Jørgensen, Claus Bøttcher; Salicio, Susanna Cirera
2010-01-01
Alternative splicing of pre-mRNA can contribute to differences between tissues or cells either by regulating gene expression or creating proteins with various functions encoded by one gene. The number of investigated alternative splice events in pig has so far been limited. In this study we have ...... in preservation of open reading frame are indicative of a functional significance of the splice variants of the gene....
Safety And Transient Analyses For Full Core Conversion Of The Dalat Nuclear Research Reactor
International Nuclear Information System (INIS)
Luong Ba Vien; Le Vinh Vinh; Huynh Ton Nghiem; Nguyen Kien Cuong
2011-01-01
Preparing for full core conversion of Dalat Nuclear Research Reactor (DNRR), safety and transient analyses were carried out to confirm about ability to operate safely of proposed Low Enriched Uranium (LEU) working core. The initial LEU core consisting 92 LEU fuel assemblies and 12 Beryllium rods was analyzed under initiating events of uncontrolled withdrawal of a control rod, cooling pump failure, earthquake and fuel cladding fail. Working LEU core response were evaluated under these initial events based on RELAP/Mod3.2 computer code and other supported codes like ORIGEN, MCNP and MACCS2. Obtained results showed that safety of the reactor is maintained for all transients/accidents analyzed. (author)
Conversation after Right Hemisphere Brain Damage: Motivations for Applying Conversation Analysis
Barnes, Scott; Armstrong, Elizabeth
2010-01-01
Despite the well documented pragmatic deficits that can arise subsequent to Right Hemisphere Brain Damage (RHBD), few researchers have directly studied everyday conversations involving people with RHBD. In recent years, researchers have begun applying Conversation Analysis (CA) to the everyday talk of people with aphasia. This research programme…
Convergent evolution of gene networks by single-gene duplications in higher eukaryotes
Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich
2004-01-01
By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...
Petrov, Kaloyan; Popova, Luiza; Petrova, Penka
2017-06-01
Lactobacillus paracasei DSM 23505 is able to produce high amounts of lactic acid (LA) by simultaneous saccharification and fermentation (SSF) of inulin. Aiming to obtain the highest possible amounts of LA and fructose, the present study is devoted to evaluate the impact of bivalent metal ions on the process of inulin conversion. It was shown that Mn 2+ strongly increases the activity of the purified key enzyme β-fructosidase. In vivo, batch fermentation kinetics revealed that the high Mn 2+ concentrations accelerated inulin hydrolysis by raise of the inulinase activity, and increased sugars conversion to LA through enhancement of the whole glycolytic flux. The highest LA concentration and yield were reached by addition of 15 mM Mn 2+ -151 g/L (corresponding to 40% increase) and 0.83 g/g, respectively. However, the relative quantification by real-time reverse transcription assay showed that the presence of Mn 2+ decreases the expression levels of fosE gene encoding β-fructosidase. Contrariwise, the full exclusion of metal ions resulted in fosE gene expression enhancement, blocked fructose transport, and hindered fructose conversion thus leading to huge fructose accumulation. During fed-batch with optimized medium and fermentation parameters, the fructose content reached 35.9% (w/v), achieving yield of 467 g fructose from 675 g inulin containing chicory flour powder (0.69 g/g). LA received in course of the batch fermentation and fructose gained by the fed-batch are the highest amounts ever obtained from inulin, thus disclosing the key role of Mn 2+ as a powerful tool to guide inulin conversion to targeted bio-chemicals.
Huang, Jinjin; Xia, Ji; Yang, Zhen; Guan, Feifei; Cui, Di; Guan, Guohua; Jiang, Wei; Li, Ying
2014-01-01
We previously cloned a 1,3-specific lipase gene from the fungus Rhizomucor miehei and expressed it in methylotrophic yeast Pichia pastoris strain GS115. The enzyme produced (termed RML) was able to catalyze methanolysis of soybean oil and showed strong position specificity. However, the enzyme activity and amount of enzyme produced were not adequate for industrial application. Our goal in the present study was to improve the enzyme properties of RML in order to apply it for the conversion of microalgae oil to biofuel. Several new expression plasmids were constructed by adding the propeptide of the target gene, optimizing the signal peptide, and varying the number of target gene copies. Each plasmid was transformed separately into P. pastoris strain X-33. Screening by flask culture showed maximal (21.4-fold increased) enzyme activity for the recombinant strain with two copies of the target gene; the enzyme was termed Lipase GH2. The expressed protein with the propeptide (pRML) was a stable glycosylated protein, because of glycosylation sites in the propeptide. Quantitative real-time RT-PCR analysis revealed two major reasons for the increase in enzyme activity: (1) the modified recombinant expression system gave an increased transcription level of the target gene (rml), and (2) the enzyme was suitable for expression in host cells without causing endoplasmic reticulum (ER) stress. The modified enzyme had improved thermostability and methanol or ethanol tolerance, and was applicable directly as free lipase (fermentation supernatant) in the catalytic esterification and transesterification reaction. After reaction for 24 hours at 30°C, the conversion rate of microalgae oil to biofuel was above 90%. Our experimental results show that signal peptide optimization in the expression plasmid, addition of the gene propeptide, and proper gene dosage significantly increased RML expression level and enhanced the enzymatic properties. The target enzyme was the major component of
Heterogeneity of Human Neutrophil CD177 Expression Results from CD177P1 Pseudogene Conversion.
Directory of Open Access Journals (Sweden)
Zuopeng Wu
2016-05-01
Full Text Available Most humans harbor both CD177neg and CD177pos neutrophils but 1-10% of people are CD177null, placing them at risk for formation of anti-neutrophil antibodies that can cause transfusion-related acute lung injury and neonatal alloimmune neutropenia. By deep sequencing the CD177 locus, we catalogued CD177 single nucleotide variants and identified a novel stop codon in CD177null individuals arising from a single base substitution in exon 7. This is not a mutation in CD177 itself, rather the CD177null phenotype arises when exon 7 of CD177 is supplied entirely by the CD177 pseudogene (CD177P1, which appears to have resulted from allelic gene conversion. In CD177 expressing individuals the CD177 locus contains both CD177P1 and CD177 sequences. The proportion of CD177hi neutrophils in the blood is a heritable trait. Abundance of CD177hi neutrophils correlates with homozygosity for CD177 reference allele, while heterozygosity for ectopic CD177P1 gene conversion correlates with increased CD177neg neutrophils, in which both CD177P1 partially incorporated allele and paired intact CD177 allele are transcribed. Human neutrophil heterogeneity for CD177 expression arises by ectopic allelic conversion. Resolution of the genetic basis of CD177null phenotype identifies a method for screening for individuals at risk of CD177 isoimmunisation.
Prostate Cancer Epigenetics: A Review on Gene Regulation
Diaw, Lena; Woodson, Karen; Gillespie, John W.
2007-01-01
Prostate cancer is the most common cancer in men in western countries, and its incidence is increasing steadily worldwide. Molecular changes including both genetic and epigenetic events underlying the development and progression of this disease are still not well understood. Epigenetic events are involved in gene regulation and occur through different mechanisms such as DNA methylation and histone modifi cations. Both DNA methylation and histone modifi cations affect gene regulation and play ...
South African pension fund conversions: Dealing with environmental change
Directory of Open Access Journals (Sweden)
D. T. George
2007-12-01
Full Text Available Purpose: The purpose of this paper is to analyse South African pension fund conversions from defined benefit to defined contribution structures and to develop a model for dealing with environmental change. Design/Methodology/Approach: Qualitative research methodology was used. Industry experts were interviewed to obtain a macro view of the phenomenon and specific manifestations of the phenomenon were also considered in case studies.Feedback from semi-structured interviews was categorised into several emergent themes. Within-case and cross-case analyses were conducted. Findings: Results indicated that an environmental shock exerted a substantial influence on the course of events. Under these: • Various factors combined to drive organisational evolution (i.e. adaptation to the environment. • Adaptation speed was inappropriate and exceeded that which was required for sufficient thought. • Uncertainty and vacuum circumstances arose leading to consequences that require redress. • The relative power of the stakeholders changed and influenced the strategic outcome. • An imbalance in stakeholder interests arose and ethical factors became consequential. • Business acted to restore certainty for itself. Implications: This paper provides insight into organisational behaviour during periods of environmental shock. Environmental shock can be defined as "a condition that arises where business or societal rules are inadequate, or do not exist, to deal with unfolding events". An environmental shock has greater magnitude than a competitive shock, and can include several competitive shocks. Originality/Value: Analysis of pension fund conversions revealed organisational behaviour during periods of environmental shock and the emerging model can be applied in other instances of environmental shock, such as broad-based black economic empowerment (B-B BEE, land redistribution, sanctions and constitutional development.
La conversion de Paul, regards croisés Paul’s conversion. Cross perspectives
Directory of Open Access Journals (Sweden)
Elian Cuvillier
2009-09-01
Full Text Available Au plan historique, les traditions relatives à la conversion de Paul, chutant de son cheval sur le chemin de Damas, confrontent l’exégète à trois problèmes importants : y avait-il un cheval, cela se passait-il sur le chemin de Damas et était-ce bien une conversion ? Entendues avec l’humour et la distance critique nécessaires, ces trois questions constituent les trois chapitres de cet article. Le premier « Y avait-il un cheval ? » s’intéresse à l’histoire de la réception de l’épisode de la conversion de Paul, en particulier dans la peinture et la littérature. Le second « Cela se passait-il sur le chemin de Damas ? » est consacrée au récit que l’auteur du livre des Actes propose de la conversion de Paul, récit qui constitue, bien souvent, la porte d’entrée exclusive pour aborder le thème. Le troisième « Etait-ce bien une conversion ? » analyse les témoignages de l’apôtre lui-même à travers deux passages clés de ses épîtres authentiques.Historically speaking, the traditions concerning the conversion of Paul, falling from his horse on the road to Damascus, confront the exegete with three important problems : was there a horse, did it happen on the road to Damacus and was it really a conversion ? These three questions, considered with humor and critical distance, constitute the three sections of this article. The first part « Was there a horse ? » considers the history of the reception of the episode of the conversion of Paul, particularly in art and literature. The second one « Did it happen on the road to Damascus ? » is devoted to the story of the conversion of Paul proposed by the author of the book of Acts, which is very often the exclusive entrance to the discussion of this theme. The third section « Was it really a conversion ? » analyzes the account given by the apostle himself in two key passages of his authentic epistles.
Kobayashi, H; Ngernprasirtsiri, J; Akazawa, T
1990-01-01
During transitional conversion of chloroplasts to chromoplasts in ripening tomato (Lycopersicon esculentum) fruits, transcripts for several plastid genes for photosynthesis decreased to undetectable levels. Run-on transcription of plastids indicated that transcriptional regulation operated as a predominant factor. We found that most of the genes in chloroplasts were actively transcribed in vitro by Escherichia coli and soluble plastid RNA polymerases, but some genes in chromoplasts seemed to be silent when assayed by the in vitro systems. The regulatory step, therefore, was ascribed to DNA templates. The analysis of modified base composition revealed the presence of methylated bases in chromoplast DNA, in which 5-methylcytosine was most abundant. The presence of 5-methylcytosine detected by isoschizomeric endonucleases and Southern hybridization was correlated with the undetectable transcription activity of each gene in the run-on assay and in vitro transcription experiments. It is thus concluded that the suppression of transcription mediated by DNA methylation is one of the mechanisms governing gene expression in plastids converting from chloroplasts to chromoplasts. Images Fig. 1 Fig. 2 Fig. 3. Fig. 4. Fig. 5. PMID:2303026
Energy Technology Data Exchange (ETDEWEB)
Halliday, Gary M. [Dermatology Research Laboratories, Division of Medicine, Melanoma and Skin Cancer Research Institute, Royal Prince Alfred Hospital at the University of Sydney, Sydney, NSW (Australia)]. E-mail: garyh@med.usyd.edu.au
2005-04-01
Ultraviolet (UV) radiation causes inflammation, gene mutation and immunosuppression in the skin. These biological changes are responsible for photocarcinogenesis. UV radiation in sunlight is divided into two wavebands, UVB and UVA, both of which contribute to these biological changes, and therefore probably to skin cancer in humans and animal models. Oxidative damage caused by UV contributes to inflammation, gene mutation and immunosuppression. This article reviews evidence for the hypothesis that UV oxidative damage to these processes contributes to photocarcinogenesis. UVA makes a larger impact on oxidative stress in the skin than UVB by inducing reactive oxygen and nitrogen species which damage DNA, protein and lipids and which also lead to NAD+ depletion, and therefore energy loss from the cell. Lipid peroxidation induces prostaglandin production that in association with UV-induced nitric oxide production causes inflammation. Inflammation drives benign human solar keratosis (SK) to undergo malignant conversion into squamous cell carcinoma (SCC) probably because the inflammatory cells produce reactive oxygen species, thus increasing oxidative damage to DNA and the immune system. Reactive oxygen or nitrogen appears to cause the increase in mutational burden as SK progress into SCC in humans. UVA is particularly important in causing immunosuppression in both humans and mice, and UV lipid peroxidation induced prostaglandin production and UV activation of nitric oxide synthase is important mediators of this event. Other immunosuppressive events are likely to be initiated by UV oxidative stress. Antioxidants have also been shown to reduce photocarcinogenesis. While most of this evidence comes from studies in mice, there is supporting evidence in humans that UV-induced oxidative damage contributes to inflammation, gene mutation and immunosuppression. Available evidence implicates oxidative damage as an important contributor to sunlight-induced carcinogenesis in humans.
International Nuclear Information System (INIS)
Halliday, Gary M.
2005-01-01
Ultraviolet (UV) radiation causes inflammation, gene mutation and immunosuppression in the skin. These biological changes are responsible for photocarcinogenesis. UV radiation in sunlight is divided into two wavebands, UVB and UVA, both of which contribute to these biological changes, and therefore probably to skin cancer in humans and animal models. Oxidative damage caused by UV contributes to inflammation, gene mutation and immunosuppression. This article reviews evidence for the hypothesis that UV oxidative damage to these processes contributes to photocarcinogenesis. UVA makes a larger impact on oxidative stress in the skin than UVB by inducing reactive oxygen and nitrogen species which damage DNA, protein and lipids and which also lead to NAD+ depletion, and therefore energy loss from the cell. Lipid peroxidation induces prostaglandin production that in association with UV-induced nitric oxide production causes inflammation. Inflammation drives benign human solar keratosis (SK) to undergo malignant conversion into squamous cell carcinoma (SCC) probably because the inflammatory cells produce reactive oxygen species, thus increasing oxidative damage to DNA and the immune system. Reactive oxygen or nitrogen appears to cause the increase in mutational burden as SK progress into SCC in humans. UVA is particularly important in causing immunosuppression in both humans and mice, and UV lipid peroxidation induced prostaglandin production and UV activation of nitric oxide synthase is important mediators of this event. Other immunosuppressive events are likely to be initiated by UV oxidative stress. Antioxidants have also been shown to reduce photocarcinogenesis. While most of this evidence comes from studies in mice, there is supporting evidence in humans that UV-induced oxidative damage contributes to inflammation, gene mutation and immunosuppression. Available evidence implicates oxidative damage as an important contributor to sunlight-induced carcinogenesis in humans
Conversational Agents in E-Learning
Kerry, Alice; Ellis, Richard; Bull, Susan
This paper discusses the use of natural language or 'conversational' agents in e-learning environments. We describe and contrast the various applications of conversational agent technology represented in the e-learning literature, including tutors, learning companions, language practice and systems to encourage reflection. We offer two more detailed examples of conversational agents, one which provides learning support, and the other support for self-assessment. Issues and challenges for developers of conversational agent systems for e-learning are identified and discussed.
Boiler conversions for biomass
Energy Technology Data Exchange (ETDEWEB)
Kinni, J [Tampella Power Inc., Tampere (Finland)
1997-12-31
Boiler conversions from grate- and oil-fired boilers to bubbling fluidized bed combustion have been most common in pulp and paper industry. Water treatment sludge combustion, need for additional capacity and tightened emission limits have been the driving forces for the conversion. To accomplish a boiler conversion for biofuel, the lower part of the boiler is replaced with a fluidized bed bottom and new fuel, ash and air systems are added. The Imatran Voima Rauhalahti pulverized-peat-fired boiler was converted to bubbling fluidized bed firing in 1993. In the conversion the boiler capacity was increased by 10 % to 295 MWth and NO{sub x} emissions dropped. In the Kymmene Kuusankoski boiler, the reason for conversion was the combustion of high chlorine content biosludge. The emissions have been under general European limits. During the next years, the emission limits will tighten and the boilers will be designed for most complete combustion and compounds, which can be removed from flue gases, will be taken care of after the boiler. (orig.) 3 refs.
Boiler conversions for biomass
Energy Technology Data Exchange (ETDEWEB)
Kinni, J. [Tampella Power Inc., Tampere (Finland)
1996-12-31
Boiler conversions from grate- and oil-fired boilers to bubbling fluidized bed combustion have been most common in pulp and paper industry. Water treatment sludge combustion, need for additional capacity and tightened emission limits have been the driving forces for the conversion. To accomplish a boiler conversion for biofuel, the lower part of the boiler is replaced with a fluidized bed bottom and new fuel, ash and air systems are added. The Imatran Voima Rauhalahti pulverized-peat-fired boiler was converted to bubbling fluidized bed firing in 1993. In the conversion the boiler capacity was increased by 10 % to 295 MWth and NO{sub x} emissions dropped. In the Kymmene Kuusankoski boiler, the reason for conversion was the combustion of high chlorine content biosludge. The emissions have been under general European limits. During the next years, the emission limits will tighten and the boilers will be designed for most complete combustion and compounds, which can be removed from flue gases, will be taken care of after the boiler. (orig.) 3 refs.
A mediation skills model to manage disclosure of errors and adverse events to patients.
Liebman, Carol B; Hyman, Chris Stern
2004-01-01
In 2002 Pennsylvania became the first state to impose on hospitals a statutory duty to notify patients in writing of a serious event. If the disclosure conversations are carefully planned, properly executed, and responsive to patients' needs, this new requirement creates possible benefits for both patient safety and litigation risk management. This paper describes a model for accomplishing these goals that encourages health care providers to communicate more effectively with patients following an adverse event or medical error, learn from mistakes, respond to the concerns of patients and families after an adverse event, and arrive at a fair and cost-effective resolution of valid claims.
Prostate Cancer Epigenetics: A Review on Gene Regulation
Directory of Open Access Journals (Sweden)
Lena Diaw
2007-01-01
Full Text Available Prostate cancer is the most common cancer in men in western countries, and its incidence is increasing steadily worldwide. Molecular changes including both genetic and epigenetic events underlying the development and progression of this disease are still not well understood. Epigenetic events are involved in gene regulation and occur through different mechanisms such as DNA methylation and histone modifi cations. Both DNA methylation and histone modifi cations affect gene regulation and play important roles either independently or by interaction in tumor initiation and progression. This review will discuss the genes associated with epigenetic alterations in prostate cancer progression: their regulation and importance as possible markers for the disease.
Solar energy conversion systems
Brownson, Jeffrey R S
2013-01-01
Solar energy conversion requires a different mind-set from traditional energy engineering in order to assess distribution, scales of use, systems design, predictive economic models for fluctuating solar resources, and planning to address transient cycles and social adoption. Solar Energy Conversion Systems examines solar energy conversion as an integrative design process, applying systems thinking methods to a solid knowledge base for creators of solar energy systems. This approach permits different levels of access for the emerging broad audience of scientists, engineers, architects, planners
Martínez-Quintana, Efrén; Rodríguez-González, Fayna; Medina-Gil, José María; Garay-Sánchez, Paloma; Tugores, Antonio
Paraoxonase 1 (PON1) plays a major role in the oxidation of low density lipoprotein and in the prevention of coronary atherogenesis. In this context, coding region polymorphisms of PON1 gene, responsible for the enzyme activity, has become of interest as a marker for atherogenesis. A study and follow-up was conducted on 529 patients with an acute coronary event in order to assess the association between the PON1 Q192R (rs662;A/G) polymorphism, the type of acute coronary syndrome, cardiovascular risk factors (arterial hypertension, diabetes mellitus, dyslipidaemia, and smoking), the extent and severity of coronary atherosclerosis, and the medium-term clinical follow-up. The QQ genotype was found in 245 (46.3%) patients, with 218 (41.2%) patients showing the QR genotype, and 66 (14.5%) patients had the RR genotype. No significant differences were found between the QQ and QR/RR genotypes as regards the clinical characteristics, the analytical data, and the angiographic variables. Similarly, Kaplan-Meier survival analysis showed no significant differences in presenting with a new acute coronary event (p=0.598), cardiac mortality (p=0.701), stent thrombosis (p=0.508), or stent re-stenosis (p=0.598) between QQ and QR/RR genotypes during the follow-up period (3.3±2.2 years). In patients with an acute coronary syndrome, the PON1 Q192R genotypes did not influence the risk of suffering a new acute coronary event during the medium-term follow-up. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.
Magnitude conversion to unified moment magnitude using orthogonal regression relation
Das, Ranjit; Wason, H. R.; Sharma, M. L.
2012-05-01
Homogenization of earthquake catalog being a pre-requisite for seismic hazard assessment requires region based magnitude conversion relationships. Linear Standard Regression (SR) relations fail when both the magnitudes have measurement errors. To accomplish homogenization, techniques like Orthogonal Standard Regression (OSR) are thus used. In this paper a technique is proposed for using such OSR for preparation of homogenized earthquake catalog in moment magnitude Mw. For derivation of orthogonal regression relation between mb and Mw, a data set consisting of 171 events with observed body wave magnitudes (mb,obs) and moment magnitude (Mw,obs) values has been taken from ISC and GCMT databases for Northeast India and adjoining region for the period 1978-2006. Firstly, an OSR relation given below has been developed using mb,obs and Mw,obs values corresponding to 150 events from this data set. M=1.3(±0.004)m-1.4(±0.130), where mb,proxy are body wave magnitude values of the points on the OSR line given by the orthogonality criterion, for observed (mb,obs, Mw,obs) points. A linear relation is then developed between these 150 mb,obs values and corresponding mb,proxy values given by the OSR line using orthogonality criterion. The relation obtained is m=0.878(±0.03)m+0.653(±0.15). The accuracy of the above procedure has been checked with the rest of the data i.e., 21 events values. The improvement in the correlation coefficient value between mb,obs and Mw estimated using the proposed procedure compared to the correlation coefficient value between mb,obs and Mw,obs shows the advantage of OSR relationship for homogenization. The OSR procedure developed in this study can be used to homogenize any catalog containing various magnitudes (e.g., ML, mb, MS) with measurement errors, by their conversion to unified moment magnitude Mw. The proposed procedure also remains valid in case the magnitudes have measurement errors of different orders, i.e. the error variance ratio is
Direct conversion of fusion energy
International Nuclear Information System (INIS)
Johansson, Markus
2003-03-01
Deuterium and tritium are expected to be used as fuel in the first fusion reactors. Energy is released as kinetic energy of ions and neutrons, when deuterium reacts with tritium. One way to convert the kinetic energy to electrical energy, is to let the ions and neutrons hit the reactor wall and convert the heat that is caused by the particle bombardment to electrical energy with ordinary thermal conversion. If the kinetic energy of the ions instead is converted directly to electrical energy, a higher efficiency of the energy conversion is possible. The majority of the fusion energy is released as kinetic energy of neutrons, when deuterium reacts with tritium. Fusion reactions such as the D-D reactions, the D- 3 He reaction and the p- 11 B reaction, where a larger part of the fusion energy becomes kinetic energy of charged particles, appears therefore more suitable for direct conversion. Since they have lower reactivity than the D-T reaction, they need a larger βB 2 0 to give sufficiently high fusion power density. Because of this, the fusion configurations spherical torus (ST) and field-reversed configuration (FRC), where high β values are possible, appear interesting. Rosenbluth and Hinton come to the conclusion that efficient direct conversion isn't possible in closed field line systems and that open geometries, which facilitate direct conversion, provide inadequate confinement for D- 3 He. It is confirmed in this study that it doesn't seem possible to achieve as high direct conversion efficiency in closed systems as in open systems. ST and FRC fusion power plants that utilize direct conversion seem however interesting. Calculations with the help of Maple indicate that the reactor parameters needed for a D-D ST and a D 3 He ST hopefully are possible to achieve. The best energy conversion option for a D-D or D 3 He ST appears to be direct electrodynamic conversion (DEC) together with ordinary thermal conversion or liquid metal MHD conversion (LMMHD). For a D
Direct conversion of fusion energy
Energy Technology Data Exchange (ETDEWEB)
Johansson, Markus
2003-03-01
Deuterium and tritium are expected to be used as fuel in the first fusion reactors. Energy is released as kinetic energy of ions and neutrons, when deuterium reacts with tritium. One way to convert the kinetic energy to electrical energy, is to let the ions and neutrons hit the reactor wall and convert the heat that is caused by the particle bombardment to electrical energy with ordinary thermal conversion. If the kinetic energy of the ions instead is converted directly to electrical energy, a higher efficiency of the energy conversion is possible. The majority of the fusion energy is released as kinetic energy of neutrons, when deuterium reacts with tritium. Fusion reactions such as the D-D reactions, the D-{sup 3}He reaction and the p-{sup 11}B reaction, where a larger part of the fusion energy becomes kinetic energy of charged particles, appears therefore more suitable for direct conversion. Since they have lower reactivity than the D-T reaction, they need a larger {beta}B{sup 2}{sub 0} to give sufficiently high fusion power density. Because of this, the fusion configurations spherical torus (ST) and field-reversed configuration (FRC), where high {beta} values are possible, appear interesting. Rosenbluth and Hinton come to the conclusion that efficient direct conversion isn't possible in closed field line systems and that open geometries, which facilitate direct conversion, provide inadequate confinement for D-{sup 3}He. It is confirmed in this study that it doesn't seem possible to achieve as high direct conversion efficiency in closed systems as in open systems. ST and FRC fusion power plants that utilize direct conversion seem however interesting. Calculations with the help of Maple indicate that the reactor parameters needed for a D-D ST and a D{sub 3} He ST hopefully are possible to achieve. The best energy conversion option for a D-D or D{sub 3} He ST appears to be direct electrodynamic conversion (DEC) together with ordinary thermal conversion
[Neuropsychological assessment in conversion disorder].
Demır, Süleyman; Çelıkel, Feryal Çam; Taycan, Serap Erdoğan; Etıkan, İlker
2013-01-01
Conversion disorder is characterized by functional impairment in motor, sensory, or neurovegetative systems that cannot be explained by a general medical condition. Diagnostic systems emphasize the absence of an organic basis for the dysfunction observed in conversion disorder. Nevertheless, there is a growing body of data on the specific functional brain correlates of conversion symptoms, particularly those obtained via neuroimaging and neurophysiological assessment. The present study aimed to determine if there are differences in measures of cognitive functioning between patients with conversion disorder and healthy controls. The hypothesis of the study was that the patients with conversion disorder would have poorer neurocognitive performance than the controls. The patient group included 43 patients diagnosed as conversion disorder and other psychiatric comorbidities according to DSM-IV-TR. Control group 1 included 44 patients diagnosed with similar psychiatric comorbidities, but not conversion diosorder, and control group 2 included 43 healthy individuals. All participants completed a sociodemographic questionnaire and were administered the SCID-I and a neuropsychological test battery of 6 tests, including the Serial Digit Learning Test (SDLT), Auditory Verbal Learning Test (AVLT), Wechsler Memory Scale, Stroop Color Word Interference Test, Benton Judgment of Line Orientation Test (BJLOT), and Cancellation Test. The patient group had significantly poorer performance on the SDLT, AVLT, Stroop Color Word Interference Test, and BJLOT than both control groups. The present findings highlight the differences between the groups in learning and memory, executive and visuospatial functions, and attention, which seemed to be specific to conversion disorder.
Hyperthermophilic endoglucanase for in planta lignocellulose conversion
Directory of Open Access Journals (Sweden)
Klose Holger
2012-08-01
Full Text Available Abstract Background The enzymatic conversion of lignocellulosic plant biomass into fermentable sugars is a crucial step in the sustainable and environmentally friendly production of biofuels. However, a major drawback of enzymes from mesophilic sources is their suboptimal activity under established pretreatment conditions, e.g. high temperatures, extreme pH values and high salt concentrations. Enzymes from extremophiles are better adapted to these conditions and could be produced by heterologous expression in microbes, or even directly in the plant biomass. Results Here we show that a cellulase gene (sso1354 isolated from the hyperthermophilic archaeon Sulfolobus solfataricus can be expressed in plants, and that the recombinant enzyme is biologically active and exhibits the same properties as the wild type form. Since the enzyme is inactive under normal plant growth conditions, this potentially allows its expression in plants without negative effects on growth and development, and subsequent heat-inducible activation. Furthermore we demonstrate that the recombinant enzyme acts in high concentrations of ionic liquids and can therefore degrade α-cellulose or even complex cell wall preparations under those pretreatment conditions. Conclusion The hyperthermophilic endoglucanase SSO1354 with its unique features is an excellent tool for advanced biomass conversion. Here we demonstrate its expression in planta and the possibility for post harvest activation. Moreover the enzyme is suitable for combined pretreatment and hydrolysis applications.
Distinctive patterns of evolution of the δ-globin gene (HBD in primates.
Directory of Open Access Journals (Sweden)
Ana Moleirinho
Full Text Available In most vertebrates, hemoglobin (Hb is a heterotetramer composed of two dissimilar globin chains, which change during development according to the patterns of expression of α- and β-globin family members. In placental mammals, the β-globin cluster includes three early-expressed genes, ε(HBE-γ(HBG-ψβ(HBBP1, and the late expressed genes, δ (HBD and β (HBB. While HBB encodes the major adult β-globin chain, HBD is weakly expressed or totally silent. Paradoxically, in human populations HBD shows high levels of conservation typical of genes under strong evolutionary constraints, possibly due to a regulatory role in the fetal-to-adult switch unique of Anthropoid primates. In this study, we have performed a comprehensive phylogenetic and comparative analysis of the two adult β-like globin genes in a set of diverse mammalian taxa, focusing on the evolution and functional divergence of HBD in primates. Our analysis revealed that anthropoids are an exception to a general pattern of concerted evolution in placental mammals, showing a high level of sequence conservation at HBD, less frequent and shorter gene conversion events. Moreover, this lineage is unique in the retention of a functional GATA-1 motif, known to be involved in the control of the developmental expression of the β-like globin genes. We further show that not only the mode but also the rate of evolution of the δ-globin gene in higher primates are strictly associated with the fetal/adult β-cluster developmental switch. To gain further insight into the possible functional constraints that have been shaping the evolutionary history of HBD in primates, we calculated dN/dS (ω ratios under alternative models of gene evolution. Although our results indicate that HBD might have experienced different selective pressures throughout primate evolution, as shown by different ω values between apes and Old World Monkeys + New World Monkeys (0.06 versus 0.43, respectively, these estimates
Hendriks, Hanneke; van den Putte, Bas; de Bruijn, Gert-Jan
2014-10-01
Health campaign effects may be improved by taking interpersonal communication processes into account. The current study, which employed an experimental, pretest-posttest, randomized exposure design (N = 208), investigated whether the emotions induced by anti-alcohol messages influence conversational valence about alcohol and subsequent persuasion outcomes. The study produced three main findings. First, an increase in the emotion fear induced a negative conversational valence about alcohol. Second, fear was most strongly induced by a disgusting message, whereas a humorous appeal induced the least fear. Third, a negative conversational valence elicited healthier binge drinking attitudes, subjective norms, perceived behavioral control, intentions, and behaviors. Thus, health campaign planners and health researchers should pay special attention to the emotional characteristics of health messages and should focus on inducing a healthy conversational valence.
A new search for conversion of muonium to antimuonium
International Nuclear Information System (INIS)
Matthias, B.E.
1991-10-01
To search for conversion of muonium (M ≡ μ + e - ) to antimuonium (anti M ≡ μ - e + ) with very low background, a new signature was implemented that required the time-coincident detection of the decay e - (≤ 53 MeV) with the atomic e + (∼ 13 eV) from decay of an anti M atom. A 20 MeV/c μ + beam was stopped in a 9 mg/cm 2 SiO 2 powder target. Muonium, formed in the powder, diffused into a vacuum region at thermal velocities and was observed for a coincidence of anti M decay products. Any decay e - was charge and momentum analyzed in a dipole magnet and tracked by an array of MWPCs; any atomic e + was electrostatically collected, accelerated to 5.7 keV, and magnetically transported to a microchannel plate detector. To calibrate the signature, M was observed for the first time by coincidence of its decay e + and its atomic e - . A maximum likelihood analysis of the position distribution of decay origins finds no anti M events and less than 2 at 90% confidence. This places an upper limit on the conversion probability per atom of S anti M -7 (90% C.L.), which corresponds to an upper limit of G M anti M F (90% C.L.) on the effective coupling constant for a (V - A) conversion coupling. In a class of left-right symmetric models, the value of G M anti M may be in this range. 116 refs., 45 figs., 10 tabs
U.S. Domestic Reactor Conversion Programs
International Nuclear Information System (INIS)
Woolstenhulme, Eric
2008-01-01
The Conversion Projects Include: the revision of the facilities safety basis documents and supporting analysis, the fabrication of new LEU fuel, the change-out of the reactor core, and the removal of the used HEU fuel (by INL University Fuels Program or DOE-NE). The major entities involved are: the U.S. Nuclear Regulatory Commission, the University reactor department, the fuel and hardware fabricators, the Spent fuel receipt facilities, the Spent fuel shipping services, and the U.S. Department of Energy and their subcontractors. Three major Reactor Conversion Program milestones have been accomplished since 2006: the conversion of the TRIGA reactor at Texas A and M University Nuclear Science Center, the conversion of the University of Florida Training Reactor, and the conversion of the Purdue University Reactor. Four Reactor Conversion Program milestones yet to be accomplished in 2008 and 2009: the Washington State University Nuclear Radiation Center reactor, the Oregon State University TRIGA Reactor, the University of Wisconsin Nuclear Reactor, and the Neutron Radiography Reactor Facility. NNSA is committed to doing things cheaper, better, smarter, safer through a 'Lessons Learned' process. The conversion team assessed each major activity grouping: Project Initiation, Conversion Proposal Development, Fuel Fabrication and Hardware, Core Conversion, and Spent Nuclear Fuel Removal. Issues were identified and recommendations were given
Special issue: Plasma Conversion
Nozaki, T.; Bogaerts, A.; Tu, X.; van de Sanden, M. C. M.
2017-01-01
With growing concern of energy and environmental issues, the combination of plasma and heterogeneous catalysts receives special attention in greenhouse gas conversion, nitrogen fixation and hydrocarbon chemistry. Plasma gas conversion driven by renewable electricity is particularly important for the
The molecular evolution of cytochrome P450 genes within and between drosophila species.
Good, Robert T; Gramzow, Lydia; Battlay, Paul; Sztal, Tamar; Batterham, Philip; Robin, Charles
2014-04-20
We map 114 gene gains and 74 gene losses in the P450 gene family across the phylogeny of 12 Drosophila species by examining the congruence of gene trees and species trees. Although the number of P450 genes varies from 74 to 94 in the species examined, we infer that there were at least 77 P450 genes in the ancestral Drosophila genome. One of the most striking observations in the data set is the elevated loss of P450 genes in the Drosophila sechellia lineage. The gain and loss events are not evenly distributed among the P450 genes-with 30 genes showing no gene gains or losses whereas others show as many as 20 copy number changes among the species examined. The P450 gene clades showing the fewest number of gene gain and loss events tend to be those evolving with the most purifying selection acting on the protein sequences, although there are exceptions, such as the rapid rate of amino acid replacement observed in the single copy phantom (Cyp306a1) gene. Within D. melanogaster, we observe gene copy number polymorphism in ten P450 genes including multiple cases of interparalog chimeras. Nonallelic homologous recombination (NAHR) has been associated with deleterious mutations in humans, but here we provide a second possible example of an NAHR event in insect P450s being adaptive. Specifically, we find that a polymorphic Cyp12a4/Cyp12a5 chimera correlates with resistance to an insecticide. Although we observe such interparalog exchange in our within-species data sets, we have little evidence of it between species, raising the possibility that such events may occur more frequently than appreciated but are masked by subsequent sequence change. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Haque, Md Mazharul; Washington, Simon
2014-01-01
The use of mobile phones while driving is more prevalent among young drivers-a less experienced cohort with elevated crash risk. The objective of this study was to examine and better understand the reaction times of young drivers to a traffic event originating in their peripheral vision whilst engaged in a mobile phone conversation. The CARRS-Q advanced driving simulator was used to test a sample of young drivers on various simulated driving tasks, including an event that originated within the driver's peripheral vision, whereby a pedestrian enters a zebra crossing from a sidewalk. Thirty-two licensed drivers drove the simulator in three phone conditions: baseline (no phone conversation), hands-free and handheld. In addition to driving the simulator each participant completed questionnaires related to driver demographics, driving history, usage of mobile phones while driving, and general mobile phone usage history. The participants were 21-26 years old and split evenly by gender. Drivers' reaction times to a pedestrian in the zebra crossing were modelled using a parametric accelerated failure time (AFT) duration model with a Weibull distribution. Also tested where two different model specifications to account for the structured heterogeneity arising from the repeated measures experimental design. The Weibull AFT model with gamma heterogeneity was found to be the best fitting model and identified four significant variables influencing the reaction times, including phone condition, driver's age, license type (provisional license holder or not), and self-reported frequency of usage of handheld phones while driving. The reaction times of drivers were more than 40% longer in the distracted condition compared to baseline (not distracted). Moreover, the impairment of reaction times due to mobile phone conversations was almost double for provisional compared to open license holders. A reduction in the ability to detect traffic events in the periphery whilst distracted
Genome wide identification of aberrant alternative splicing events in myotonic dystrophy type 2.
Perfetti, Alessandra; Greco, Simona; Fasanaro, Pasquale; Bugiardini, Enrico; Cardani, Rosanna; Garcia-Manteiga, Jose M; Manteiga, Jose M Garcia; Riba, Michela; Cittaro, Davide; Stupka, Elia; Meola, Giovanni; Martelli, Fabio
2014-01-01
Myotonic dystrophy type 2 (DM2) is a genetic, autosomal dominant disease due to expansion of tetraplet (CCTG) repetitions in the first intron of the ZNF9/CNBP gene. DM2 is a multisystemic disorder affecting the skeletal muscle, the heart, the eye and the endocrine system. According to the proposed pathological mechanism, the expanded tetraplets have an RNA toxic effect, disrupting the splicing of many mRNAs. Thus, the identification of aberrantly spliced transcripts is instrumental for our understanding of the molecular mechanisms underpinning the disease. The aim of this study was the identification of new aberrant alternative splicing events in DM2 patients. By genome wide analysis of 10 DM2 patients and 10 controls (CTR), we identified 273 alternative spliced exons in 218 genes. While many aberrant splicing events were already identified in the past, most were new. A subset of these events was validated by qPCR assays in 19 DM2 and 15 CTR subjects. To gain insight into the molecular pathways involving the identified aberrantly spliced genes, we performed a bioinformatics analysis with Ingenuity system. This analysis indicated a deregulation of development, cell survival, metabolism, calcium signaling and contractility. In conclusion, our genome wide analysis provided a database of aberrant splicing events in the skeletal muscle of DM2 patients. The affected genes are involved in numerous pathways and networks important for muscle physio-pathology, suggesting that the identified variants may contribute to DM2 pathogenesis.
Tweeting Supertyphoon Haiyan: Evolving Functions of Twitter during and after a Disaster Event
David, Clarissa C.; Ong, Jonathan Corpus; Legara, Erika Fille T.
2016-01-01
When disaster events capture global attention users of Twitter form transient interest communities that disseminate information and other messages online. This paper examines content related to Typhoon Haiyan (locally known as Yolanda) as it hit the Philippines and triggered international humanitarian response and media attention. It reveals how Twitter conversations about disasters evolve over time, showing an issue attention cycle on a social media platform. The paper examines different functions of Twitter and the information hubs that drive and sustain conversation about the event. Content analysis shows that the majority of tweets contain information about the typhoon or its damage, and disaster relief activities. There are differences in types of content between the most retweeted messages and posts that are original tweets. Original tweets are more likely to come from ordinary users, who are more likely to tweet emotions, messages of support, and political content compared with official sources and key information hubs that include news organizations, aid organization, and celebrities. Original tweets reveal use of the site beyond information to relief coordination and response. PMID:27019425
Tweeting Supertyphoon Haiyan: Evolving Functions of Twitter during and after a Disaster Event.
Directory of Open Access Journals (Sweden)
Clarissa C David
Full Text Available When disaster events capture global attention users of Twitter form transient interest communities that disseminate information and other messages online. This paper examines content related to Typhoon Haiyan (locally known as Yolanda as it hit the Philippines and triggered international humanitarian response and media attention. It reveals how Twitter conversations about disasters evolve over time, showing an issue attention cycle on a social media platform. The paper examines different functions of Twitter and the information hubs that drive and sustain conversation about the event. Content analysis shows that the majority of tweets contain information about the typhoon or its damage, and disaster relief activities. There are differences in types of content between the most retweeted messages and posts that are original tweets. Original tweets are more likely to come from ordinary users, who are more likely to tweet emotions, messages of support, and political content compared with official sources and key information hubs that include news organizations, aid organization, and celebrities. Original tweets reveal use of the site beyond information to relief coordination and response.
Improved pulse-height store for A/D conversion
Energy Technology Data Exchange (ETDEWEB)
Casoli, P [Montedel S.p.a., Laben Division, Via Bassini 15, Milano, Italy; Maranesi, P [Politecnico di Milano (Italy). Centro Studi Nucleari E. Fermi
1979-11-15
A new pulse-height store is described. Suitable contrivances improve integral linearity and reduce the differential errors that generally occur at signal amplitudes near the lower threshold. No degradations appear at high rates of input events. The electrical specifications of the pulse-height store are determined through a series of measurements described in the final part of the paper. In order to test the circuit in the most significant way, it has been connected to a fast successive-approximation conversion module which uses the sliding-scale technique for channel width equalisation, thus implementing a complete analog-to-digital converter (ADC) for nuclear spectrometry. The performances of the pulse-height store have been deduced from the behavior of the whole system.
Directory of Open Access Journals (Sweden)
Aldo Nicosia
Full Text Available Gene family encoding small Heat-Shock Proteins (sHSPs containing α-crystallin domain are found both in prokaryotic and eukaryotic organisms; however, there is limited knowledge of their evolution. In this study, two small HSP genes termed AvHSP28.6 and AvHSP27, both organized in one intron and two exons, were characterised in the Mediterranean snakelocks anemone Anemonia viridis. The release of the genome sequence of Hydra magnipapillata and Nematostella vectensis enabled a comprehensive study of the molecular evolution of α-crystallin gene family among cnidarians. Most of the H. magnipapillata sHSP genes share the same gene organization described for AvHSP28.6 and AvHSP27, differing from the sHSP genes of N. vectensis which mainly show an intronless architecture. The different genomic organization of sHSPs, the phylogenetic analyses based on protein sequences, and the relationships among Cnidarians, suggest that the A.viridis sHSPs represent the common ancestor from which H. magnipapillata genes directly evolved through segmental genome duplication. Additionally retroposition events may be considered responsible for the divergence of sHSP genes of N. vectensis from A. viridis. Analyses of transcriptional expression profile showed that AvHSP28.6 was constitutively expressed among different tissues from both ectodermal and endodermal layers of the adult sea anemones, under normal physiological conditions and also under different stress condition. Specifically, we profiled the transcriptional activation of AvHSP28.6 after challenges with different abiotic/biotic stresses showing induction by extreme temperatures, heavy metals exposure and immune stimulation. Conversely, no AvHSP27 transcript was detected in such dissected tissues, in adult whole body cDNA library or under stress conditions. Hence, the involvement of AvHSP28.6 gene in the sea anemone defensome is strongly suggested.
Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Gianguzza, Fabrizio; Cuttitta, Angela; Costa, Salvatore
2014-01-01
Gene family encoding small Heat-Shock Proteins (sHSPs containing α-crystallin domain) are found both in prokaryotic and eukaryotic organisms; however, there is limited knowledge of their evolution. In this study, two small HSP genes termed AvHSP28.6 and AvHSP27, both organized in one intron and two exons, were characterised in the Mediterranean snakelocks anemone Anemonia viridis. The release of the genome sequence of Hydra magnipapillata and Nematostella vectensis enabled a comprehensive study of the molecular evolution of α-crystallin gene family among cnidarians. Most of the H. magnipapillata sHSP genes share the same gene organization described for AvHSP28.6 and AvHSP27, differing from the sHSP genes of N. vectensis which mainly show an intronless architecture. The different genomic organization of sHSPs, the phylogenetic analyses based on protein sequences, and the relationships among Cnidarians, suggest that the A.viridis sHSPs represent the common ancestor from which H. magnipapillata genes directly evolved through segmental genome duplication. Additionally retroposition events may be considered responsible for the divergence of sHSP genes of N. vectensis from A. viridis. Analyses of transcriptional expression profile showed that AvHSP28.6 was constitutively expressed among different tissues from both ectodermal and endodermal layers of the adult sea anemones, under normal physiological conditions and also under different stress condition. Specifically, we profiled the transcriptional activation of AvHSP28.6 after challenges with different abiotic/biotic stresses showing induction by extreme temperatures, heavy metals exposure and immune stimulation. Conversely, no AvHSP27 transcript was detected in such dissected tissues, in adult whole body cDNA library or under stress conditions. Hence, the involvement of AvHSP28.6 gene in the sea anemone defensome is strongly suggested.
Natural Gene Therapy in Dystrophic Epidermolysis Bullosa
van den Akker, Peter C.; Nijenhuis, Albertine; Hofstra, Robert M. W.; Jonkman, Marcel F.; Pasmooij, Anna M. G.; Meijer, G.
Background: Dystrophic epidermolysis bullosa is a genetic blistering disorder caused by mutations in the type VII collagen gene, COL7A1. In revertant mosaicism, germline mutations are corrected by somatic events resulting in a mosaic disease distribution. This "natural gene therapy" phenomenon long
Asahi, Shigeo; Kusaki, Kazuki; Harada, Yukihiro; Kita, Takashi
2018-01-17
Development of high-efficiency solar cells is one of the attractive challenges in renewable energy technologies. Photon up-conversion can reduce the transmission loss and is one of the promising concepts which improve conversion efficiency. Here we present an analysis of the conversion efficiency, which can be increased by up-conversion in a single-junction solar cell with a hetero-interface that boosts the output voltage. We confirm that an increase in the quasi-Fermi gap and substantial photocurrent generation result in a high conversion efficiency.
Rigter, A.; Bossers, A.
2005-01-01
Conversion of the host-encoded protease-sensitive cellular prion protein (PrPC) into the scrapie-associated protease-resistant isoform (PrPSc) of prion protein (PrP) is the central event in transmissible spongiform encephalopathies or prion diseases. Differences in transmissibility and
Ownership conversions and nursing home performance.
Grabowski, David C; Stevenson, David G
2008-08-01
To examine the effects of ownership conversions on nursing home performance. Online Survey, Certification, and Reporting system data from 1993 to 2004, and the Minimum Data Set (MDS) facility reports from 1998 to 2004. Regression specification incorporating facility fixed effects, with terms to identify trends in the pre- and postconversion periods. The annual rate of nursing home conversions almost tripled between 1994 and 2004. Our regression results indicate converting facilities are generally different throughout the pre/postconversion years, suggesting little causal effect of ownership conversions on nursing home performance. Before and after conversion, nursing homes converting from nonprofit to for-profit status generally exhibit deterioration in their performance, while nursing homes converting from for-profit to nonprofit status generally exhibit improvement. Policy makers have expressed concern regarding the implications of ownership conversions for nursing home performance. Our results imply that regulators and policy makers should not only monitor the outcomes of nursing home conversions, but also the targets of these conversions.
Zhou, Miaojin; Hu, Zhiqing; Qiu, Liyan; Zhou, Tao; Feng, Mai; Hu, Qian; Zeng, Baitao; Li, Zhuo; Sun, Qianru; Wu, Yong; Liu, Xionghao; Wu, Lingqian; Liang, Desheng
2018-05-09
Spinal muscular atrophy (SMA) is a kind of neuromuscular disease characterized by progressive motor neuron loss in the spinal cord. It is caused by mutations in the survival motor neuron 1 (SMN1) gene. SMN1 has a paralogous gene, survival motor neuron 2 (SMN2), in humans that is present in almost all SMA patients. The generation and genetic correction of SMA patient-specific induced pluripotent stem cells (iPSCs) is a viable, autologous therapeutic strategy for the disease. Here, c-Myc-free and non-integrating iPSCs were generated from the urine cells of an SMA patient using an episomal iPSC reprogramming vector, and a unique crRNA was designed that does not have similar sequences (≤3 mismatches) anywhere in the human reference genome. In situ gene conversion of the SMN2 gene to an SMN1-like gene in SMA-iPSCs was achieved using CRISPR/Cpf1 and single-stranded oligodeoxynucleotide with a high efficiency of 4/36. Seamlessly gene-converted iPSC lines contained no exogenous sequences and retained a normal karyotype. Significantly, the SMN expression and gems localization were rescued in the gene-converted iPSCs and their derived motor neurons. This is the first report of an efficient gene conversion mediated by Cpf1 homology-directed repair in human cells and may provide a universal gene therapeutic approach for most SMA patients.
MYC is a metastasis gene for non-small-cell lung cancer.
Directory of Open Access Journals (Sweden)
Ulf R Rapp
Full Text Available BACKGROUND: Metastasis is a process by which cancer cells learn to form satellite tumors in distant organs and represents the principle cause of death of patients with solid tumors. NSCLC is the most lethal human cancer due to its high rate of metastasis. METHODOLOGY/PRINCIPAL FINDINGS: Lack of a suitable animal model has so far hampered analysis of metastatic progression. We have examined c-MYC for its ability to induce metastasis in a C-RAF-driven mouse model for non-small-cell lung cancer. c-MYC alone induced frank tumor growth only after long latency at which time secondary mutations in K-Ras or LKB1 were detected reminiscent of human NSCLC. Combination with C-RAF led to immediate acceleration of tumor growth, conversion to papillary epithelial cells and angiogenic switch induction. Moreover, addition of c-MYC was sufficient to induce macrometastasis in liver and lymph nodes with short latency associated with lineage switch events. Thus we have generated the first conditional model for metastasis of NSCLC and identified a gene, c-MYC that is able to orchestrate all steps of this process. CONCLUSIONS/SIGNIFICANCE: Potential markers for detection of metastasis were identified and validated for diagnosis of human biopsies. These markers may represent targets for future therapeutic intervention as they include genes such as Gata4 that are exclusively expressed during lung development.
Puinean, Alin M; Foster, Stephen P; Oliphant, Linda; Denholm, Ian; Field, Linda M; Millar, Neil S; Williamson, Martin S; Bass, Chris
2010-06-24
The aphid Myzus persicae is a globally significant crop pest that has evolved high levels of resistance to almost all classes of insecticide. To date, the neonicotinoids, an economically important class of insecticides that target nicotinic acetylcholine receptors (nAChRs), have remained an effective control measure; however, recent reports of resistance in M. persicae represent a threat to the long-term efficacy of this chemical class. In this study, the mechanisms underlying resistance to the neonicotinoid insecticides were investigated using biological, biochemical, and genomic approaches. Bioassays on a resistant M. persicae clone (5191A) suggested that P450-mediated detoxification plays a primary role in resistance, although additional mechanism(s) may also contribute. Microarray analysis, using an array populated with probes corresponding to all known detoxification genes in M. persicae, revealed constitutive over-expression (22-fold) of a single P450 gene (CYP6CY3); and quantitative PCR showed that the over-expression is due, at least in part, to gene amplification. This is the first report of a P450 gene amplification event associated with insecticide resistance in an agriculturally important insect pest. The microarray analysis also showed over-expression of several gene sequences that encode cuticular proteins (2-16-fold), and artificial feeding assays and in vivo penetration assays using radiolabeled insecticide provided direct evidence of a role for reduced cuticular penetration in neonicotinoid resistance. Conversely, receptor radioligand binding studies and nucleotide sequencing of nAChR subunit genes suggest that target-site changes are unlikely to contribute to resistance to neonicotinoid insecticides in M. persicae.
Methylated genes as new cancer biomarkers
DEFF Research Database (Denmark)
Brunner, Nils; Duffy, M.J; Napieralski, R.
2009-01-01
Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested that meas......Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested...... that measurement of the methylation status of the promoter regions of specific genes can aid early detection of cancer, determine prognosis and predict therapy responses. Promising DNA methylation biomarkers include the use of methylated GSTP1 for aiding the early diagnosis of prostate cancer, methylated PITX2...... for predicting outcome in lymph node-negative breast cancer patients and methylated MGMT in predicting benefit from alkylating agents in patients with glioblastomas. However, prior to clinical utilisation, these findings require validation in prospective clinical studies. Furthermore, assays for measuring gene...
Hydrothermal conversion of biomass
Knezevic, D.
2009-01-01
This thesis presents research of hydrothermal conversion of biomass (HTC). In this process, hot compressed water (subcritical water) is used as the reaction medium. Therefore this technique is suitable for conversion of wet biomass/ waste streams. By working at high pressures, the evaporation of
Kara, Önder; Maurice, Matthew J; Mouracade, Pascal; Malkoç, Ercan; Dagenais, Julien; Nelson, Ryan J; Chavali, Jaya Sai S; Stein, Robert J; Fergany, Amr; Kaouk, Jihad H
2017-07-01
We sought to identify the preoperative factors associated with conversion from robotic partial nephrectomy to radical nephrectomy. We report the incidence of this event. Using our institutional review board approved database, we abstracted data on 1,023 robotic partial nephrectomies performed at our center between 2010 and 2015. Standard and converted cases were compared in terms of patients and tumor characteristics, and perioperative, functional and oncologic outcomes. Logistic regression analysis was done to identify predictors of radical conversion. The overall conversion rate was 3.1% (32 of 1,023 cases). The most common reasons for conversion were tumor involvement of hilar structures (8 cases or 25%), failure to achieve negative margins on frozen section (7 or 21.8%), suspicion of advanced disease (5 or 15.6%) and failure to progress (5 or 15.6%). Patients requiring conversion were older and had a higher Charlson score (both p partial nephrectomy cases had similar short-term oncologic outcomes but better renal functional preservation (p partial nephrectomy conversion to radical nephrectomy was 3.1%, including 2.2% of preoperatively anticipated nephrectomy cases. Increasing tumor size and complexity, and poor preoperative renal function are the main predictors of conversion. Copyright © 2017 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Koramannil Radha Saradalekshmi
Full Text Available DNA methylation has been implicated in the etiopathology of various complex disorders. DNA methyltransferases are involved in maintaining and establishing new methylation patterns. The aim of the present study was to investigate the inherent genetic variations within DNA methyltransferase genes in predisposing to susceptibility to schizophrenia. We screened for polymorphisms in DNA methyltransferases, DNMT1, DNMT3A, DNMT3B and DNMT3L in 330 schizophrenia patients and 302 healthy controls for association with Schizophrenia in south Indian population. These polymorphisms were also tested for subgroup analysis with patient's gender, age of onset and family history. DNMT1 rs2114724 (genotype P = .004, allele P = 0.022 and rs2228611 (genotype P = 0.004, allele P = 0.022 were found to be significantly associated at genotypic and allelic level with Schizophrenia in South Indian population. DNMT3B rs2424932 genotype (P = 0.023 and allele (P = 0.0063 increased the risk of developing schizophrenia in males but not in females. DNMT3B rs1569686 (genotype P = 0.027, allele P = 0.033 was found to be associated with early onset of schizophrenia and also with family history and early onset (genotype P = 0.009. DNMT3L rs2070565 (genotype P = 0.007, allele P = 0.0026 confers an increased risk of developing schizophrenia at an early age in individuals with family history. In-silico prediction indicated functional relevance of these SNPs in regulating the gene. These observations might be crucial in addressing and understanding the genetic control of methylation level differences from ethnic viewpoint. Functional significance of genotype variations within the DNMTs indeed suggest that the genetic nature of methyltransferases should be considered while addressing epigenetic events mediated by methylation in Schizophrenia.
Directory of Open Access Journals (Sweden)
Ayu Nyoman Aryani
2017-01-01
Full Text Available Conversation is a social interaction among societies. In this case, gender differences in daily communication lead to men’s and women’s different point of views in performing styles of the conversations. Misunderstanding is likely to occur in crosssex conversations when the idea or thought are understood differently by men and women. This study was intended to analyze the use of conversational styles by men and women and also investigate the misunderstanding phenomena that happened in cross-sex conversations. The researcher identified that the conversational styles used by Alex as a male character in the cross-sex conversations were qualifiers, controlling the topics, verbal fillers, intensifiers, swear words, compound requests, tag questions, questions, interruptions, overlapping, and talk domination. Meanwhile, Gigi, as a female character used qualifiers, controlling the topics, verbal fillers, intensifiers, swear words, tag questions, questions, interruptions, overlapping, talk domination, and silence. In answering the second question, the researcher discovered factors that affected the misunderstanding in the cross-sex conversations between Alex and Gigi were involvement versus independence and message versus metamessage. DOI: https://doi.org/10.24071/llt.2016.190101
Beauchamp, Nicholas J.; van Achterberg, Tanja A. E.; Engelse, Marten A.; Pannekoek, Hans; de Vries, Carlie J. M.
2003-01-01
Migration and proliferation of vascular smooth muscle cells (SMCs) are key events in atherosclerosis. However, little is known about alterations in gene expression upon transition of the quiescent, contractile SMC to the proliferative SMC. We performed serial analysis of gene expression (SAGE) of
Vertical Scan-Conversion for Filling Purposes
Hersch, R. D.
1988-01-01
Conventional scan-conversion algorithms were developed independently of filling algorithms. They cause many problems, when used for filling purposes. However, today's raster printers and plotters require extended use of filling, especially for the generation of typographic characters and graphic line art. A new scan-conversion algorithm, called vertical scan-conversion has been specifically designed to meet the requirements of parity scan line fill algorithms. Vertical scan-conversion ensures...
Keep Meaning in Conversational Coordination
Directory of Open Access Journals (Sweden)
Elena Clare Cuffari
2014-12-01
Full Text Available Coordination is a widely employed term across recent quantitative and qualitative approaches to intersubjectivity, particularly approaches that give embodiment and enaction central explanatory roles. With a focus on linguistic and bodily coordination in conversational contexts, I review the operational meaning of coordination in recent empirical research and related theorizing of embodied intersubjectivity. This discussion articulates what must be involved in treating linguistic meaning as dynamic processes of coordination. The coordination approach presents languaging as a set of dynamic self-organizing processes and actions on multiple timescales and across multiple modalities that come about and work in certain domains (those jointly constructed in social, interactive, high-order sense-making. These processes go beyond meaning at the level that is available to first-person experience. I take one crucial consequence of this to be the ubiquitously moral nature of languaging with others. Languaging coordinates experience, among other levels of behavior and event. Ethical effort is called for by the automatic autonomy-influencing forces of languaging as coordination.
Coffey, Lee; Owens, Erica; Tambling, Karen; O'Neill, David; O'Connor, Laura; O'Reilly, Catherine
2010-11-01
Nitriles are widespread in the environment as a result of biological and industrial activity. Nitrile hydratases catalyse the hydration of nitriles to the corresponding amide and are often associated with amidases, which catalyze the conversion of amides to the corresponding acids. Nitrile hydratases have potential as biocatalysts in bioremediation and biotransformation applications, and several successful examples demonstrate the advantages. In this work a real-time PCR assay was designed for the detection of Fe-type nitrile hydratase genes from environmental isolates purified from nitrile-enriched soils and seaweeds. Specific PCR primers were also designed for amplification and sequencing of the genes. Identical or highly homologous nitrile hydratase genes were detected from isolates of numerous genera from geographically diverse sites, as were numerous novel genes. The genes were also detected from isolates of genera not previously reported to harbour nitrile hydratases. The results provide further evidence that many bacteria have acquired the genes via horizontal gene transfer. The real-time PCR assay should prove useful in searching for nitrile hydratases that could have novel substrate specificities and therefore potential in industrial applications.
Chen, Andrew C H; Tang, Yongqiang; Rangaswamy, Madhavi; Wang, Jen C; Almasy, Laura; Foroud, Tatiana; Edenberg, Howard J; Hesselbrock, Victor; Nurnberger, John; Kuperman, Samuel; O'Connor, Sean J; Schuckit, Marc A; Bauer, Lance O; Tischfield, Jay; Rice, John P; Bierut, Laura; Goate, Alison; Porjesz, Bernice
2009-04-05
Evidence suggests the P3 amplitude of the event-related potential and its underlying superimposed event-related oscillations (EROs), primarily in the theta (4-5 Hz) and delta (1-3 Hz) frequencies, as endophenotypes for the risk of alcoholism and other disinhibitory disorders. Major neurochemical substrates contributing to theta and delta rhythms and P3 involve strong GABAergic, cholinergic and glutamatergic system interactions. The aim of this study was to test the potential associations between single nucleotide polymorphisms (SNPs) in glutamate receptor genes and ERO quantitative traits. GRM8 was selected because it maps at chromosome 7q31.3-q32.1 under the peak region where we previously identified significant linkage (peak LOD = 3.5) using a genome-wide linkage scan of the same phenotype (event-related theta band for the target visual stimuli). Neural activities recorded from scalp electrodes during a visual oddball task in which rare target elicited P3s were analyzed in a subset of the Collaborative Study on the Genetics of Alcoholism (COGA) sample comprising 1,049 Caucasian subjects from 209 families (with 472 DSM-IV alcohol dependent individuals). The family-based association test (FBAT) detected significant association (P power to target visual stimuli, and also with alcohol dependence, even after correction for multiple comparisons by false discovery rate (FDR). Our results suggest that variation in GRM8 may be involved in modulating event-related theta oscillations during information processing and also in vulnerability to alcoholism. These findings underscore the utility of electrophysiology and the endophenotype approach in the genetic study of psychiatric disorders. (c) 2008 Wiley-Liss, Inc.
Musliner, K L; Østergaard, S D
2018-05-01
Conversion from unipolar depression (UD) to bipolar disorder (BD) is a clinically important event that should lead to treatment modifications. Unfortunately, recognition of this transition is often delayed. Therefore, the objective of this study was to identify predictors of diagnostic conversion from UD to BD. Historical prospective cohort study based on 91 587 individuals diagnosed with UD in Danish hospital psychiatry between 1995 and 2016. The association between a series of potential predictors and the conversion from UD to BD during follow-up (702 710 person-years) was estimated by means of Cox regression with death as competing risk. During follow-up, 3910 individuals with UD developed BD. The cumulative incidence of conversion was slightly higher in females (8.7%, 95% CI: 8.2-9.3) compared to males (7.7%, 95% CI: 7.0-8.4). The strongest predictor of conversion from UD to BD was parental history of BD (adjusted hazard ratio (aHR) = 2.60, 95% CI: 2.20-3.07)). Other predictors included psychotic depression at the index UD episode (aHR = 1.73, 95% CI: 1.48-2.02), a prior/concomitant non-affective psychosis (aHR = 1.73, 95% CI: 1.51-1.99), and in-patient treatment at the index episode (aHR = 1.76, 95% CI: 1.63-1.91). Diagnostic conversion from UD to BD is predicted by severe depression requiring in-patient treatment, psychotic symptomatology, and parental history of BD. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Power conversion unit for the South African direct cycle HTGR
International Nuclear Information System (INIS)
Liebenberg, J.J.
1997-01-01
The system parameters chosen to optimise the thermal efficiency of the Eskom PBMR whilst maintaining component simplicity is discussed. Power Conversion Unit components, which are now at a preliminary design stage comprise a precooler, two turbo units consisting of a turbine driven compressor, recuperator and a power turbine, driving an alternator. Design aspects of every component is mentioned and the inventory method of poorer control is explained with reference to start-up and and shut-down events, the system an effective load following device, down to 4% of full power. Application of the same design principles for HTGRs smaller than 25 MWe is discussed. (author)
Optical analysis of down-conversion OLEDs
Krummacher, Benjamin; Klein, Markus; von Malm, Norwin; Winnacker, Albrecht
2008-02-01
Phosphor down-conversion of blue organic light-emitting diodes (OLEDs) is one approach to generate white light, which offers the possibility of easy color tuning, a simple device architecture and color stability over lifetime. In this article previous work on down-conversion devices in the field of organic solid state lighting is briefly reviewed. Further, bottom emitting down-conversion OLEDs are studied from an optical point of view. Therefore the physical processes occurring in the down-conversion layer are translated into a model which is implemented in a ray tracing simulation. By comparing its predictions to experimental results the model is confirmed. For the experiments a blue-emitting polymer OLED (PLED) panel optically coupled to a series of down-conversion layers is used. Based on results obtained from ray tracing simulation some of the implications of the model for the performance of down-conversion OLEDs are discussed. In particular it is analysed how the effective reflectance of the underlying blue OLED and the particle size distribution of the phosphor powder embedded in the matrix of the down-conversion layer influence extraction efficiency.
Responsive turns in Indonesian informal conversation
Directory of Open Access Journals (Sweden)
M.J. van Naerssen
2015-04-01
Full Text Available People have all sorts of expectations about how interlocutors will and should behave linguistically when engaged in a conversation. These conversational norms are usually implicit and are sometimes difficult to master in a language that is new to you. This paper presents a model of different types of responses in informal conversation, illustrated with Indonesian examples. It builds upon the conversation analytic notion of preference; distinguishing preferred – or constructive – responses and dispreferred – or competitive – responses. The model is meant as a tool to cross-linguistically compare response behaviour to gain insight in language specific expectations about interaction in informal conversation.
Biomass Thermochemical Conversion Program: 1986 annual report
Energy Technology Data Exchange (ETDEWEB)
Schiefelbein, G.F.; Stevens, D.J.; Gerber, M.A.
1987-01-01
Wood and crop residues constitute a vast majority of the biomass feedstocks available for conversion, and thermochemical processes are well suited for conversion of these materials. Thermochemical conversion processes can generate a variety of products such as gasoline hydrocarbon fuels, natural gas substitutes, or heat energy for electric power generation. The US Department of Energy is sponsoring research on biomass conversion technologies through its Biomass Thermochemical Conversion Program. Pacific Northwest Laboratory has been designated the Technical Field Management Office for the Biomass Thermochemical Conversion Program with overall responsibility for the Program. This report briefly describes the Thermochemical Conversion Program structure and summarizes the activities and major accomplishments during fiscal year 1986. 88 refs., 31 figs., 5 tabs.
Conversations in African Philosophy
African Journals Online (AJOL)
JONATHAN
Conversational philosophy is articulated by Jonathan O. Chimakonam as the new wave of philosophical practice both in “place” and in “space”. This journal adopts and promotes this approach to philosophizing for African philosophy. Readers are encouraged to submit their conversational piece (maximum of 2000 words) ...
Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo
2005-05-18
To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.
Badescu, Viorel; Landsberg, Peter T.
1995-08-01
The general theory developed in part I was applied to build up two models of photovoltaic conversion. To this end two different systems were analyzed. The first system consists of the whole absorber (converter), for which the balance equations for energy and entropy are written and then used to derive an upper bound for solar energy conversion. The second system covers a part of the absorber (converter), namely the valence and conduction electronic bands. The balance of energy is used in this case to derive, under additional assumptions, another upper limit for the conversion efficiency. This second system deals with the real location where the power is generated. Both models take into consideration the radiation polarization and reflection, and the effects of concentration. The second model yields a more accurate upper bound for the conversion efficiency. A generalized solar cell equation is derived. It is proved that other previous theories are particular cases of the present more general formalism.
Computer code conversion using HISTORIAN
International Nuclear Information System (INIS)
Matsumoto, Kiyoshi; Kumakura, Toshimasa.
1990-09-01
When a computer program written for a computer A is converted for a computer B, in general, the A version source program is rewritten for B version. However, in this way of program conversion, the following inconvenient problems arise. 1) The original statements to be rewritten for B version are lost. 2) If the original statements of the A version rewritten for B version would remain as comment lines, the B version source program becomes quite large. 3) When update directives of the program are mailed from the organization which developed the program or when some modifications are needed for the program, it is difficult to point out the part to be updated or modified in the B version source program. To solve these problems, the conversion method using the general-purpose software management aid system, HISTORIAN, has been introduced. This conversion method makes a large computer code a easy-to-use program for use to update, modify or improve after the conversion. This report describes the planning and procedures of the conversion method and the MELPROG-PWR/MOD1 code conversion from the CRAY version to the JAERI FACOM version as an example. This report would provide useful information for those who develop or introduce large programs. (author)
Frequency conversion of structured light.
Steinlechner, Fabian; Hermosa, Nathaniel; Pruneri, Valerio; Torres, Juan P
2016-02-15
Coherent frequency conversion of structured light, i.e. the ability to manipulate the carrier frequency of a wave front without distorting its spatial phase and intensity profile, provides the opportunity for numerous novel applications in photonic technology and fundamental science. In particular, frequency conversion of spatial modes carrying orbital angular momentum can be exploited in sub-wavelength resolution nano-optics and coherent imaging at a wavelength different from that used to illuminate an object. Moreover, coherent frequency conversion will be crucial for interfacing information stored in the high-dimensional spatial structure of single and entangled photons with various constituents of quantum networks. In this work, we demonstrate frequency conversion of structured light from the near infrared (803 nm) to the visible (527 nm). The conversion scheme is based on sum-frequency generation in a periodically poled lithium niobate crystal pumped with a 1540-nm Gaussian beam. We observe frequency-converted fields that exhibit a high degree of similarity with the input field and verify the coherence of the frequency-conversion process via mode projection measurements with a phase mask and a single-mode fiber. Our results demonstrate the suitability of exploiting the technique for applications in quantum information processing and coherent imaging.
Overcoming difficult conversations in clinical supervision
Directory of Open Access Journals (Sweden)
Williams B
2016-06-01
Full Text Available Brett Williams,1 Christine King,1 Tanya Edlington,21Department of Community Emergency Health and Paramedic Practice, Monash University, Franskton, VIC, 2The Conversation Clinic Pty Ltd, Melbourne, VIC, Australia Background: Clinical supervisors are responsible for managing many facets of clinical learning and face a range of challenges when the need for "difficult" conversations arises, including the need to manage conflict and relationships. Methods: Spotlight on Conversations Workshop was developed to improve the capacity of clinical supervisors to engage in difficult conversations. They were designed to challenge the mindset of clinical supervisors about difficult conversations with students, the consequences of avoiding difficult conversations, and to offer activities for practicing difficult conversations. Preworkshop, postworkshop, and 4-month follow-up evaluations assessed improvements in knowledge, intent to improve, and confidence along with workshop satisfaction. Results: Nine workshops were delivered in a range of locations across Victoria, Australia, involving a total of 117 clinical supervisors. Preworkshop evaluations illustrated that more than half of the participants had avoided up to two difficult conversations in the last month in their workplace. Postworkshop evaluation at 4 months showed very high levels of satisfaction with the workshop's relevancy, content, and training, as well as participants' intention to apply knowledge and skills. Also shown were significant changes in participants' confidence to have difficult conversations not only with students but also with other peers and colleagues. In follow-up in-depth interviews with 20 of the 117 participants, 75% said they had made definite changes in their practice because of what they learned in the workshop and another 10% said they would make changes to their practice, but had not had the opportunity yet to do so. Conclusion: We conclude that the Spotlight on
International Nuclear Information System (INIS)
Leal, Glauco F.; Ramos, Luiz A.; Barrett, Dean H.; Curvelo, Antonio Aprígio S.; Rodella, Cristiane B.
2015-01-01
Graphical abstract: - Highlights: • A new method to determine the catalytic conversion of cellulose using TGA has been developed. • TGA is able to differentiate between carbon from cellulose and carbon from the catalyst. • Building an analytical curve from TGA results enables the accurate determination of cellulose conversion. - Abstract: The ability to determine the quantity of solid reactant that has been transformed after a catalytic reaction is fundamental in accurately defining the conversion of the catalyst. This quantity is also central when investigating the recyclability of a solid catalyst as well as process control in an industrial catalytic application. However, when using carbon-supported catalysts for the conversion of cellulose this value is difficult to obtain using only a gravimetric method. The difficulty lies in weighing errors caused by loss of the solid mixture (catalyst and non-converted cellulose) after the reaction and/or moisture adsorption by the substrate. These errors are then propagated into the conversion calculation giving erroneous results. Thus, a quantitative method using thermogravimetric analysis (TGA) has been developed to determine the quantity of cellulose after a catalytic reaction by using a tungsten carbide catalyst supported on activated carbon. Stepped separation of TGA curves was used for quantitative analysis where three thermal events were identified: moisture loss, cellulose decomposition and CO/CO 2 formation. An analytical curve was derived and applied to quantify the residual cellulose after catalytic reactions which were performed at various temperatures and reaction times. The catalytic conversion was calculated and compared to the standard gravimetric method. Results showed that catalytic cellulose conversion can be determined using TGA and exhibits lower uncertainty (±2%) when compared to gravimetric determination (±5%). Therefore, it is a simple and relatively inexpensive method to determine catalytic
Paradoxical therapy in conversion disorder
ATAOĞLU, Ahmet
1998-01-01
Paradoxical therapy consists of suggesting that the patient intentionally engages in the unwanted behaviour, such as performing complusive ritual or bringing on a conversion attack. In this study paradoxical intention (PI) was used with to half of the patients with conversion disorders, while the other half were treated with diazepam in order to examine the efficiency of the PI versus diazepam in conversion disorder. Patients treated with PI appeared to have a greater improvement r...
Microwave plasma mode conversion
International Nuclear Information System (INIS)
Torres, H.S.; Sakanaka, P.H.; Villarroel, C.H.
1985-01-01
The behavior of hot electrons during the process of laser-produced plasma is studied. The basic equations of mode conversion from electromagnetic waves to electrostatic waves are presented. It is shown by mode conversion, that, the resonant absorption and parametric instabilities appear simultaneously, but in different plasma regions. (M.C.K.) [pt
Conversing as Metaphor of Human Thinking: Is Mind like a Conversation?
Sorsana, Christine; Trognon, Alain
2018-06-01
How can researchers shape their ideas so that they understand the mind better? This theoretical paper discusses the merits of the conversation metaphor as a means of analyzing the human mind. We will develop arguments concerning conversation as i) a situated and distributed activity, ii) a "product" in perpetual construction, and iii) the amount of credence and belief we afford it. Finally, we will advocate for metaphorical tools that promote a more dynamic conceptualization of human thinking.
Gene duplication as a major force in evolution
Indian Academy of Sciences (India)
Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...
Astronomy on Tap: A New Event Series for Outreach and Professional Development
Rice, Emily L.; Schwamb, M. E.; Muna, D.
2014-01-01
We have established an innovative public outreach event series called Astronomy on Tap. The venues, format, timing, and content of the events aim to bring science to the public in an informal, engaging, creative way and to reach a larger, more diverse audience than typical public science lectures at academic and cultural institutions. Each event is held on a weekday evening at a bar and features several short astronomy-related presentations, usually electronic slides with other media formats encouraged. The presenters are typically early-career scientists (grad students, postdocs and new faculty) and occasionally educators, writers, and artists with experience relevant to astronomy. The informal and interactive environment is encouraged by allowing ample time for questions and conversations between presenters and the audience before, during, and after presentations. We also have a designated host who provides introductions, interludes, games, prizes, and give aways. The events serve as professional development by providing opportunities for early-career scientists to practice communication and presentation skills in a decidedly non-academic environment. We have successfully held over ten events in three cities in 2012-2013 and received extremely positive feedback from presenters, attendees, and venue staff. We present key practical considerations for hosting a similar event and share initial evaluation results collected at events in October 2013.
Directory of Open Access Journals (Sweden)
Vitulli Federico
2008-04-01
Full Text Available Abstract Background Since its discovery more than 100 years ago, potato (Solanum tuberosum tuber cold-induced sweetening (CIS has been extensively investigated. Several carbohydrate-associated genes would seem to be involved in the process. However, many uncertainties still exist, as the relative contribution of each gene to the process is often unclear, possibly as the consequence of the heterogeneity of experimental systems. Some enzymes associated with CIS, such as β-amylases and invertases, have still to be identified at a sequence level. In addition, little is known about the early events that trigger CIS and on the involvement/association with CIS of genes different from carbohydrate-associated genes. Many of these uncertainties could be resolved by profiling experiments, but no GeneChip is available for the potato, and the production of the potato cDNA spotted array (TIGR has recently been discontinued. In order to obtain an overall picture of early transcriptional events associated with CIS, we investigated whether the commercially-available tomato Affymetrix GeneChip could be used to identify which potato cold-responsive gene family members should be further studied in detail by Real-Time (RT-PCR (qPCR. Results A tomato-potato Global Match File was generated for the interpretation of various aspects of the heterologous dataset, including the retrieval of best matching potato counterparts and annotation, and the establishment of a core set of highly homologous genes. Several cold-responsive genes were identified, and their expression pattern was studied in detail by qPCR over 26 days. We detected biphasic behaviour of mRNA accumulation for carbohydrate-associated genes and our combined GeneChip-qPCR data identified, at a sequence level, enzymatic activities such as β-amylases and invertases previously reported as being involved in CIS. The GeneChip data also unveiled important processes accompanying CIS, such as the induction of redox
Ayu Nyoman Aryani
2017-01-01
Conversation is a social interaction among societies. In this case, gender differences in daily communication lead to men’s and women’s different point of views in performing styles of the conversations. Misunderstanding is likely to occur in crosssex conversations when the idea or thought are understood differently by men and women. This study was intended to analyze the use of conversational styles by men and women and also investigate the misunderstanding phenomena that happened in cross-s...
Conversational evidence in therapeutic dialogue.
Strong, Tom; Busch, Robbie; Couture, Shari
2008-07-01
Family therapists' participation in therapeutic dialogue with clients is typically informed by evidence of how such dialogue is developing. In this article, we propose that conversational evidence, the kind that can be empirically analyzed using discourse analyses, be considered a contribution to widening psychotherapy's evidence base. After some preliminaries about what we mean by conversational evidence, we provide a genealogy of evaluative practice in psychotherapy, and examine qualitative evaluation methods for their theoretical compatibilities with social constructionist approaches to family therapy. We then move on to examine the notion of accomplishment in therapeutic dialogue given how such accomplishments can be evaluated using conversation analysis. We conclude by considering a number of research and pedagogical implications we associate with conversational evidence.
Effective communication during difficult conversations.
Polito, Jacquelyn M
2013-06-01
A strong interest and need exist in the workplace today to master the skills of conducting difficult conversations. Theories and strategies abound, yet none seem to have found the magic formula with universal appeal and success. If it is such an uncomfortable skill to master is it better to avoid or initiate such conversations with employees? Best practices and evidence-based management guide us to the decision that quality improvement dictates effective communication, even when difficult. This brief paper will offer some suggestions for strategies to manage difficult conversations with employees. Mastering the skills of conducting difficult conversations is clearly important to keeping lines of communication open and productive. Successful communication skills may actually help to avert confrontation through employee engagement, commitment and appropriate corresponding behavior
5 CFR 536.303 - Geographic conversion.
2010-01-01
... after geographic conversion is the employee's existing payable rate of basic pay in effect immediately before the action. (b) Geographic conversion when a retained rate employee's official worksite is changed... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Geographic conversion. 536.303 Section...
Enzymatic Upgrading of Heavy Crudes via Partial Oxidation or Conversion of PAHs
Energy Technology Data Exchange (ETDEWEB)
Borole, A P; Davison, B H; Kuritz, T
2002-07-01
The objective of this program was to investigate new enzyme-based technologies for upgrading of heavy oils. Enzymes were selected for screening from those capable of conversion of polyaromatic hydrocarbons (PAHs) reported in the literature. Oxidative reactions of PAHs using hydrogen peroxide as an oxidant with conversion to partially oxidized products were used. The enzymes (lignin peroxidase, cytochrome c) were tested in various organic solvents and found to loose activity in pure organic solvents. A thermodynamic analysis revealed lack of effective interaction between the substrate and enzyme as the cause for low activity. The protein cytochrome c was modified to work in organic media by chemical hydrophobic group attachment. Two different modifications were made: attachment of polyethylene glycol (PEG) and alkyl groups. Alkyl groups, being small could be attached at interior locations within the core of the enzyme and possibly near the active site. Increase in the threshold solvent concentration where maximum enzyme activity occurred indicated potential of this strategy for effective enzyme-substrate interaction. Further improvements in enzyme activity called for other diverse methods due to the unavailability of sufficient chemical modification sites. Genetic techniques were therefore explored for further improvements. These experiments focused on cloning of a gene for the fungal enzyme lignin peroxidase (lip) into yeast Pichia pastoris, which would allow easy manipulation of the gene. However, differences in the fungal and yeast cellular machinery impeded significant expression of the fungal enzyme. Several strategies were explored to allow higher-level expression of the enzyme, which was required for enzyme improvement. The strategies used in this investigation are described in the report. Industrial in-kind support was available throughout the project period. review of the research results was carried out on a regular basis (bimonthly reports and annual
Analysis of pan-genome to identify the core genes and essential genes of Brucella spp.
Yang, Xiaowen; Li, Yajie; Zang, Juan; Li, Yexia; Bie, Pengfei; Lu, Yanli; Wu, Qingmin
2016-04-01
Brucella spp. are facultative intracellular pathogens, that cause a contagious zoonotic disease, that can result in such outcomes as abortion or sterility in susceptible animal hosts and grave, debilitating illness in humans. For deciphering the survival mechanism of Brucella spp. in vivo, 42 Brucella complete genomes from NCBI were analyzed for the pan-genome and core genome by identification of their composition and function of Brucella genomes. The results showed that the total 132,143 protein-coding genes in these genomes were divided into 5369 clusters. Among these, 1710 clusters were associated with the core genome, 1182 clusters with strain-specific genes and 2477 clusters with dispensable genomes. COG analysis indicated that 44 % of the core genes were devoted to metabolism, which were mainly responsible for energy production and conversion (COG category C), and amino acid transport and metabolism (COG category E). Meanwhile, approximately 35 % of the core genes were in positive selection. In addition, 1252 potential essential genes were predicted in the core genome by comparison with a prokaryote database of essential genes. The results suggested that the core genes in Brucella genomes are relatively conservation, and the energy and amino acid metabolism play a more important role in the process of growth and reproduction in Brucella spp. This study might help us to better understand the mechanisms of Brucella persistent infection and provide some clues for further exploring the gene modules of the intracellular survival in Brucella spp.
24 CFR 972.109 - Conversion of developments.
2010-04-01
... writing whether it has approved the conversion plan. Units that are vacant or vacated on or after the... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Conversion of developments. 972.109... DEVELOPMENT CONVERSION OF PUBLIC HOUSING TO TENANT-BASED ASSISTANCE Required Conversion of Public Housing...
[Management of patients with conversion disorder].
Vermeulen, Marinus; Hoekstra, Jan; Kuipers-van Kooten, Mariëtte J; van der Linden, Els A M
2014-01-01
The symptoms of conversion disorder are not due to conscious simulation. There should be no doubt that the symptoms of conversion disorder are genuine, even if scans do not reveal any abnormalities. The management of patients with conversion disorder starts with an explanation of the diagnosis. The essence of this explanation is that patients first hear about what the diagnosis actually means and only after this about what they do not have. When explaining the diagnosis it is a good idea to use metaphors. The treatment of patients with conversion disorder is carried out together with a physical therapist. The collaboration of healthcare professionals who are involved in the treatment of a patient with conversion disorder should preferably be coordinated by the patient's general practitioner.
Conversion of adult endothelium to immunocompetent haematopoietic stem cells.
Lis, Raphael; Karrasch, Charles C; Poulos, Michael G; Kunar, Balvir; Redmond, David; Duran, Jose G Barcia; Badwe, Chaitanya R; Schachterle, William; Ginsberg, Michael; Xiang, Jenny; Tabrizi, Arash Rafii; Shido, Koji; Rosenwaks, Zev; Elemento, Olivier; Speck, Nancy A; Butler, Jason M; Scandura, Joseph M; Rafii, Shahin
2017-05-25
Developmental pathways that orchestrate the fleeting transition of endothelial cells into haematopoietic stem cells remain undefined. Here we demonstrate a tractable approach for fully reprogramming adult mouse endothelial cells to haematopoietic stem cells (rEC-HSCs) through transient expression of the transcription-factor-encoding genes Fosb, Gfi1, Runx1, and Spi1 (collectively denoted hereafter as FGRS) and vascular-niche-derived angiocrine factors. The induction phase (days 0-8) of conversion is initiated by expression of FGRS in mature endothelial cells, which results in endogenous Runx1 expression. During the specification phase (days 8-20), RUNX1 + FGRS-transduced endothelial cells commit to a haematopoietic fate, yielding rEC-HSCs that no longer require FGRS expression. The vascular niche drives a robust self-renewal and expansion phase of rEC-HSCs (days 20-28). rEC-HSCs have a transcriptome and long-term self-renewal capacity similar to those of adult haematopoietic stem cells, and can be used for clonal engraftment and serial primary and secondary multi-lineage reconstitution, including antigen-dependent adaptive immune function. Inhibition of TGFβ and CXCR7 or activation of BMP and CXCR4 signalling enhanced generation of rEC-HSCs. Pluripotency-independent conversion of endothelial cells into autologous authentic engraftable haematopoietic stem cells could aid treatment of haematological disorders.
Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.
Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet
2016-02-01
Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Herring, Christopher D.; Kenealy, William R.; Shaw, A. Joe; Raman, Babu; Tschaplinski, Timothy J.; Brown, Steven D.; Davison, Brian H.; Covalla, Sean F.; Sillers, W. Ryan; Xu, Haowen; Tsakraklides, Vasiliki; Hogsett, David A.
2012-01-24
This project addressed the need for economical technology for the conversion of lignocellulosic biomass to fuels, specifically the conversion of pretreated hardwood to ethanol. The technology developed is a set of strains of the bacterium Thermoanaerobacterium saccharolyticum and an associated fermentation process for pretreated hardwood. Tools for genetic engineering and analysis of the organism were developed, including a markerless mutation method, a complete genome sequence and a set of gene expression profiles that show the activity of its genes under a variety of conditions relevant to lignocellulose conversion. Improved strains were generated by selection and genetic engineering to be able to produce higher amounts of ethanol (up to 70 g/L) and to be able to better tolerate inhibitory compounds from pretreated hardwood. Analysis of these strains has generated useful insight into the genetic basis for desired properties of biofuel producing organisms. Fermentation conditions were tested and optimized to achieve ethanol production targets established in the original project proposal. The approach proposed was to add cellulase enzymes to the fermentation, a method called Simultaneous Saccharification and Fermentation (SSF). We had reason to think SSF would be an efficient approach because the optimal temperature and pH for the enzymes and bacterium are very close. Unfortunately, we discovered that commercially available cellulases are inactivated in thermophilic SSF by a combination of low redox potential and ethanol. Despite this, progress was made against the fermentation targets using bacterial cellulases. Thermoanaerobacterium saccharolyticum may still prove to be a commercially viable technology should cellulase enzyme issues be addressed. Moreover, the organism was demonstrated to produce ethanol at approximately theoretical yield from oligomeric hemicellulose extracts, an ability that may prove to be uniquely valuable in pretreatment configurations in
Energy conversion alternatives study
Shure, L. T.
1979-01-01
Comparison of coal based energy systems is given. Study identifies and compares various advanced energy conversion systems using coal or coal derived fuels for baselaoad electric power generation. Energy Conversion Alternatives Study (ECAS) reports provede government, industry, and general public with technically consistent basis for comparison of system's options of interest for fossilfired electric-utility application.
Directory of Open Access Journals (Sweden)
Preeti Arya
Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K
2014-01-01
Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Conversion Disorder Comorbidity and Childhood Trauma.
Akyüz, Fatma; Gökalp, Peykan G; Erdiman, Sezgin; Oflaz, Serap; Karşidağ, Çağatay
2017-03-01
The aim of this study is to examine the socio-demographic and clinical characteristics, the presence of comorbidity, and the link with childhood traumatic experiences in patients with conversion disorder (CD) in a psychiatric outpatient clinic. A total of 60 literate, female patients between 18 and 65 years of age who were referred to the general psychiatry outpatient clinic and who were diagnosed with conversion disorder according to the DSM-IV diagnostic criteria were included in the study. A questionnaire on sociodemographic and clinical characteristics, the Brief Psychiatric Rating Scale (BPRS), the Hamilton Depression Rating Scale (HDRS), the Hamilton Anxiety Rating Scale (HARS), the Childhood Trauma Questionnaire (CTQ), and the Dissociative Events Scale (DES) were used to assess the cases. The mean age of the participants was 36.27±11.18 years. 72% of the patients were married and 63% were primary school graduates. The most common symptoms were asthenia (100%), aphasia (96.7%), and crying-convulsions (93%). The most common co-morbidities were depression (50%) and dissociative disorders (48.3%). Among the patients, 53.3% reported a history of exposure to physical violence and 25% reported a history of sexual assault in childhood. Assessment of the Childhood Traumatic Questionnaire revealed a significant positive relation between emotional, physical, and sexual abuse scores and DES score. CD has not yet been fully analyzed in detail in health institutions; co-existence of another mental disorder and the presence of traumatic experiences in the past further complicate the issue. Consideration of these factors during treatment will have a positive impact on the course and prognosis of the disorder.
Analysis of internal conversion coefficients
International Nuclear Information System (INIS)
Coursol, N.; Gorozhankin, V.M.; Yakushev, E.A.; Briancon, C.; Vylov, Ts.
2000-01-01
An extensive database has been assembled that contains the three most widely used sets of calculated internal conversion coefficients (ICC): [Hager R.S., Seltzer E.C., 1968. Internal conversion tables. K-, L-, M-shell Conversion coefficients for Z=30 to Z=103, Nucl. Data Tables A4, 1-237; Band I.M., Trzhaskovskaya M.B., 1978. Tables of gamma-ray internal conversion coefficients for the K-, L- and M-shells, 10≤Z≤104, Special Report of Leningrad Nuclear Physics Institute; Roesel F., Fries H.M., Alder K., Pauli H.C., 1978. Internal conversion coefficients for all atomic shells, At. Data Nucl. Data Tables 21, 91-289] and also includes new Dirac-Fock calculations [Band I.M. and Trzhaskovskaya M.B., 1993. Internal conversion coefficients for low-energy nuclear transitions, At. Data Nucl. Data Tables 55, 43-61]. This database is linked to a computer program to plot ICCs and their combinations (sums and ratios) as a function of Z and energy, as well as relative deviations of ICC or their combinations for any pair of tabulated data. Examples of these analyses are presented for the K-shell and total ICCs of the gamma-ray standards [Hansen H.H., 1985. Evaluation of K-shell and total internal conversion coefficients for some selected nuclear transitions, Eur. Appl. Res. Rept. Nucl. Sci. Tech. 11.6 (4) 777-816] and for the K-shell and total ICCs of high multipolarity transitions (total, K-, L-, M-shells of E3 and M3 and K-shell of M4). Experimental data sets are also compared with the theoretical values of these specific calculations
Remodeling of ribosomal genes in somatic cells by Xenopus egg extract
DEFF Research Database (Denmark)
Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne
2011-01-01
Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...
[Hydroxylamine conversion by anammox enrichment].
Hu, Anhui; Zheng, Ping; Lu, Huifeng; Ding, Shuang; Wang, Caihua
2010-04-01
Hydroxylamine is an important intermediate product of anammox. This study was focused on the characteristics of hydroxylamine and nitrite conversions by anammox enrichment. The changes of nitrogenous substrates and related products with time were measured using batch tests with anammox enrichment as inoculum. Since hydroxylamine didn't react with nitrite in uninoculated control culture, these two compounds were chemically stable. Both of them decreased with time in anammox enrichment inoculated cultures, in which ammonia as intermediate product would be produced and converted with the maximum concentration being 0.338 mg/L. The total nitrogen concentration decreased from 4.694 mmol/L to 0.812 mmol/L with conversion rate 82.7% in the end. When hydroxylamine and nitrite concentrations were about 2.5 mmol/L respectively, the maximum specific sludge conversion rates of hydroxylamine was 0.535 mmol/(gVSS.h), which was 1.81 times bigger than that of ammonia in ammonia reaction system; the maximum specific sludge rate of total nitrogen was slightly higher than that in ammonia reaction system. When hydroxylamine concentration increased to 5.0 mmol/L, the hydroxylamine and nitrite conversion rates promoted by 26.7% and 120.7% respectively; and the maximum ammonia accumulated was 1.810 mmol/L. When nitrite concentration increased to 5.0 mmol/L, the hydroxylamine and nitrite conversion rates promoted by 6.9% and 9.0% respectively; and the maximum ammonia accumulated was 0.795 mmol/L. Anammox enrichment was capable of converting hydroxylamine and nitrite simultaneously and had the higher conversion rate of hydroxylamine than ammonia conversion rate. Hydroxylamine and nitrite conversion rates were less affected by increase in nitrite concentration, but more significantly influenced by increase in hydroxylamine. The maximum ammonia concentration accumulated would rise as the result of increasing both hydroxylamine and nitrite. The result of experiment was consistent with pathway
Energy Technology Data Exchange (ETDEWEB)
Buckley, Merry [American Society for Microbiology (ASM), Washington, DC (United States); Wall, Judy D. [Univ. of Missouri, Columbia, MO (United States)
2006-10-01
The American Academy of Microbiology convened a colloquium March 10-12, 2006, in San Francisco, California, to discuss the production of energy fuels by microbial conversions. The status of research into various microbial energy technologies, the advantages and disadvantages of each of these approaches, research needs in the field, and education and training issues were examined, with the goal of identifying routes for producing biofuels that would both decrease the need for fossil fuels and reduce greenhouse gas emissions. Currently, the choices for providing energy are limited. Policy makers and the research community must begin to pursue a broader array of potential energy technologies. A diverse energy portfolio that includes an assortment of microbial energy choices will allow communities and consumers to select the best energy solution for their own particular needs. Funding agencies and governments alike need to prepare for future energy needs by investing both in the microbial energy technologies that work today and in the untested technologies that will serve the world’s needs tomorrow. More mature bioprocesses, such as ethanol production from starchy materials and methane from waste digestors, will find applications in the short term. However, innovative techniques for liquid fuel or biohydrogen production are among the longer term possibilities that should also be vigorously explored, starting now. Microorganisms can help meet human energy needs in any of a number of ways. In their most obvious role in energy conversion, microorganisms can generate fuels, including ethanol, hydrogen, methane, lipids, and butanol, which can be burned to produce energy. Alternatively, bacteria can be put to use in microbial fuel cells, where they carry out the direct conversion of biomass into electricity. Microorganisms may also be used some day to make oil and natural gas technologies more efficient by sequestering carbon or by assisting in the recovery of oil and
Allegrucci, M; Young-Cooper, G O; Alexander, C B; Newman, B A; Mage, R G
1991-02-01
The rabbit is unique in having well-defined allotypes in the variable region of the heavy chain. Products of the VHa locus, (with alleles a1, a2, and a3), account for the majority of the serum immunoglobulins. A small percentage of the serum immunoglobulins are a-negative. In 1986, Kelus and Weiss described a mutation that depressed the expression of the Ig VH a2 genes in an a1/a2 rabbit. From this animal the Alicia rabbit strain was developed and the mutation was termed ali. We previously showed, using Southern analysis and the transverse alternating field electrophoresis technique, that the difference between the ali rabbit and normal is a relatively small deletion including some of the most 3' VH genes. The most JH proximal 3' VH1 genes in DNA from normal rabbits of a1, a2 and a3 haplotypes encode a1, a2 and a3 molecules respectively, and it has been suggested that these genes are responsible for allelic inheritance of VHa allotypes. The present study suggests that the 3' end of the VH locus probably plays a key role in regulation of VH gene expression in rabbits because VH gene(s) in this region are the target(s) of preferential VDJ rearrangements. This raises the possibility that mechanisms such as somatic gene conversion and hypermutation are at work to generate the antibody repertoire in this species. Our data support the view that the 3' VH1 gene may be the preferred target for rearrangement in normal rabbits, and for the normal chromosome in heterozygous ali animals. However, homozygous ali rabbits with a deletion that removed the a2-encoding VH1 on both chromosomes do survive, rearrange other VH genes and produce normal levels of immunoglobulins as well as a significant percentage of B cells which bear the a2 allotype. This challenges the view that one VH gene, VH1, is solely responsible for the inheritance pattern of VHa allotypes.
Reconciliation of Gene and Species Trees
Directory of Open Access Journals (Sweden)
L. Y. Rusin
2014-01-01
Full Text Available The first part of the paper briefly overviews the problem of gene and species trees reconciliation with the focus on defining and algorithmic construction of the evolutionary scenario. Basic ideas are discussed for the aspects of mapping definitions, costs of the mapping and evolutionary scenario, imposing time scales on a scenario, incorporating horizontal gene transfers, binarization and reconciliation of polytomous trees, and construction of species trees and scenarios. The review does not intend to cover the vast diversity of literature published on these subjects. Instead, the authors strived to overview the problem of the evolutionary scenario as a central concept in many areas of evolutionary research. The second part provides detailed mathematical proofs for the solutions of two problems: (i inferring a gene evolution along a species tree accounting for various types of evolutionary events and (ii trees reconciliation into a single species tree when only gene duplications and losses are allowed. All proposed algorithms have a cubic time complexity and are mathematically proved to find exact solutions. Solving algorithms for problem (ii can be naturally extended to incorporate horizontal transfers, other evolutionary events, and time scales on the species tree.
Energy Technology Data Exchange (ETDEWEB)
Qiyue, Hu; Mingyue, Lun [Suzhou Medical Coll., JS (China)
1995-07-01
Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G{sub 1} phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM{sub 9} cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation.
International Nuclear Information System (INIS)
Hu Qiyue; Lun Mingyue
1995-07-01
Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G 1 phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM 9 cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation
Zaragoza Scherman, Alejandra; Salgado, Sinué; Shao, Zhifang; Berntsen, Dorthe
2015-01-01
The aim of this study was to investigate whether cultural differences exist in event centrality, emotional distress and well-being in a total of 565 adults above age 40 from Mexico, Greenland, China and Denmark. Participants completed questionnaires to determine their level of post-traumatic stress disorder and depression symptoms, and of life satisfaction. They also completed event centrality scales for their most positive and most negative life events. Across cultures, participants rated positive events as more central to their identity and life stories, compared with negative events. Furthermore, participants with higher levels of emotional distress rated negative events as more central to their identity and life story, compared with participants with lower scores. However, a converse pattern was not found for positive events. Finally, participants with higher scores of life satisfaction tended to rate positive events as more central and negative events as less central to their identity and life story, compared with participants with lower scores. It is concluded that across cultures, positive events are considered more central to identity and life story than negative events and that event centrality ratings tend to be affected in similar ways by higher versus lower levels of emotional distress or well-being.
5 CFR 534.506 - Conversion provisions.
2010-01-01
... conversion, other than to the minimum rate under 5 U.S.C. 5376, the increase must be approved by the head of... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Conversion provisions. 534.506 Section... OTHER SYSTEMS Pay for Senior-Level and Scientific and Professional Positions § 534.506 Conversion...
47 CFR 80.761 - Conversion graphs.
2010-10-01
... MARITIME SERVICES Standards for Computing Public Coast Station VHF Coverage § 80.761 Conversion graphs. The following graphs must be employed where conversion from one to the other of the indicated types of units is... 47 Telecommunication 5 2010-10-01 2010-10-01 false Conversion graphs. 80.761 Section 80.761...
Ferredoxin Gene Mutation in Iranian Trichomonas Vaginalis Isolates
Directory of Open Access Journals (Sweden)
Soudabeh Heidari
2013-09-01
Full Text Available Background: Trichomonas vaginalis causes trichomoniasis and metronidazole is its chosen drug for treatment. Ferredoxin has role in electron transport and carbohydrate metabolism and the conversion of an inactive form of metronidazole (CO to its active form (CPR. Ferredoxin gene mutations reduce gene expression and increase its resistance to metronidazole. In this study, the frequency of ferredoxin gene mutations in clinical isolates of T.vaginalis in Tehran has been studied.Methods: Forty six clinical T. vaginalis isolates of vaginal secretions and urine sediment were collected from Tehran Province since 2011 till 2012. DNA was extracted and ferredoxin gene was amplified by PCR technique. The ferredoxin gene PCR products were sequenced to determine gene mutations.Results: In four isolates (8.69% point mutation at nucleotide position -239 (the translation start codon of the ferredoxin gene were detected in which adenosine were converted to thymine.Conclusion: Mutation at nucleotide -239 ferredoxin gene reduces translational regulatory protein’s binding affinity which concludes reduction of ferredoxin expression. For this reduction, decrease in activity and decrease in metronidazole drug delivery into the cells occur. Mutations in these four isolates may lead to resistance of them to metronidazole.
Learning science in small groups: The relationship of conversation to conceptual understanding
McDonald, James Tarleton
The purpose of this study was to investigate the relationship between conversation and conceptual understanding of erosion. The objective of this study was to investigate how fifth grade students' conceptions of erosion changed while they used stream tables and worked in groups of four within an inquiry-based curriculum. This study used symbolic interactionism and sociocognitive frameworks to interpret science learning in the elementary classroom. The research focused on the conceptual understanding of the focal group students, their use of classroom discourse to talk about their understandings of erosion, and the expertise that emerged while using stream tables. This study took place over a one-semester long study on erosion. Key informants were eight fifth graders. The data sources consisted of children's journals; transcripts of audiotaped interviews with the key informants before, during, and after the erosion unit; transcripts of videotapes of the students using the stream tables; and field notes recording children's discourse and activity. Individual and group cases were constructed during the study. The knowledge of the eight focal group children was placed on a hierarchy of conceptual understanding that contained 8 components of the erosion process. All four of the students whose ideas were examined in depth gained in their conceptual understanding of erosion. Students' individual expertise enhanced their own conceptual understanding. The contribution of classroom discourse and expertise to conceptual understanding differed between the two focal groups. Group 1 used essential expertise to sustain generative conversations, maximizing their learning opportunities. Students in Group 1 got along with one another, rotated assigned roles and jobs, and were able to start their own generative conversations. Members of Group 1 asked generative questions, connected stream table events to real life situations, and involved everyone in the group. Group 2 engaged in a
The Conversion of Wiswesser Line Notations to Ring Codes. I. The Conversion of Ring Systems
Granito, Charles E.; And Others
1972-01-01
The computerized conversion of Wiswesser Line Notations to Ring Codes, using a two-part approach, and the set of computer programs generated for the conversion of ring systems are described. (9 references) (Author)
The conversational interface talking to smart devices
McTear, Michael; Griol, David
2016-01-01
This book provides a comprehensive introduction to the conversational interface, which is becoming the main mode of interaction with virtual personal assistants, smart devices, various types of wearables, and social robots. The book consists of four parts: Part I presents the background to conversational interfaces, examining past and present work on spoken language interaction with computers; Part II covers the various technologies that are required to build a conversational interface along with practical chapters and exercises using open source tools; Part III looks at interactions with smart devices, wearables, and robots, and then goes on to discusses the role of emotion and personality in the conversational interface; Part IV examines methods for evaluating conversational interfaces and discusses future directions. · Presents a comprehensive overview of the various technologies that underlie conversational user interfaces; · Combines descriptions of conversational user interface technologies with a gui...
Loss of 5-hydroxymethylcytosine is linked to gene body hypermethylation in kidney cancer.
Chen, Ke; Zhang, Jing; Guo, Zhongqiang; Ma, Qin; Xu, Zhengzheng; Zhou, Yuanyuan; Xu, Ziying; Li, Zhongwu; Liu, Yiqiang; Ye, Xiongjun; Li, Xuesong; Yuan, Bifeng; Ke, Yuwen; He, Chuan; Zhou, Liqun; Liu, Jiang; Ci, Weimin
2016-01-01
Both 5-methylcytosine (5mC) and its oxidized form 5-hydroxymethylcytosine (5hmC) have been proposed to be involved in tumorigenesis. Because the readout of the broadly used 5mC mapping method, bisulfite sequencing (BS-seq), is the sum of 5mC and 5hmC levels, the 5mC/5hmC patterns and relationship of these two modifications remain poorly understood. By profiling real 5mC (BS-seq corrected by Tet-assisted BS-seq, TAB-seq) and 5hmC (TAB-seq) levels simultaneously at single-nucleotide resolution, we here demonstrate that there is no global loss of 5mC in kidney tumors compared with matched normal tissues. Conversely, 5hmC was globally lost in virtually all kidney tumor tissues. The 5hmC level in tumor tissues is an independent prognostic marker for kidney cancer, with lower levels of 5hmC associated with shorter overall survival. Furthermore, we demonstrated that loss of 5hmC is linked to hypermethylation in tumors compared with matched normal tissues, particularly in gene body regions. Strikingly, gene body hypermethylation was significantly associated with silencing of the tumor-related genes. Downregulation of IDH1 was identified as a mechanism underlying 5hmC loss in kidney cancer. Restoring 5hmC levels attenuated the invasion capacity of tumor cells and suppressed tumor growth in a xenograft model. Collectively, our results demonstrate that loss of 5hmC is both a prognostic marker and an oncogenic event in kidney cancer by remodeling the DNA methylation pattern.
NORMAL NASAL GENE EXPRESSION LEVELS USING CDNA ARRAY TECHNOLOGY
Normal Nasal Gene Expression Levels Using cDNA Array Technology. The nasal epithelium is a target site for chemically-induced toxicity and carcinogenicity. To detect and analyze genetic events which contribute to nasal tumor development, we first defined the gene expressi...
International Nuclear Information System (INIS)
Kocher, D.C.; Eckerman, K.F.
1992-01-01
The following is discussed in this report: concepts and quantities used in calculating radiation dose from internal and external exposure. Tabulations of dose conversion factor for internal and external exposure to radionuclides. Dose conversion factors give dose per unit intake (internal) or dose per unit concentration in environment (external). Intakes of radionuclides for internal exposure and concentrations of radionuclides in environment for external exposure are assumed to be known. Intakes and concentrations are obtained, e.g., from analyses of environmental transport and exposure pathways. differences between dosimetry methods for radionuclides and hazardous chemicals are highlighted
Magnetohydrodynamic energy conversion
International Nuclear Information System (INIS)
Rosa, R.J.
1987-01-01
The object of this book is to present a review of the basic principles and practical aspects of magnetohydrodynamic (MHD) energy conversion. The author has tried to give qualitative semiphysical arguments where possible for the benefit of the reader who is unfamiliar with plasma physics. The aim of MHD energy conversion is to apply to a specific practical goal a part of what has become a vast area of science called plasma physics. The author has attempted to note in the text where a broader view might be fruitful and to give appropriate references
Wiese, A; Syldatk, C; Mattes, R; Altenbuchner, J
2001-09-01
Arthrobacter aurescens DSM 3747 hydrolyzes stereospecifically 5'-monosubstituted hydantoins to alpha-amino acids. The genes involved in hydantoin utilization (hyu) were isolated on an 8.7-kb DNA fragment, and by DNA sequence analysis eight ORFs were identified. The hyu gene cluster includes four genes: hyuP encoding a putative transport protein, the hydantoin racemase gene hyuA, the hydantoinase gene hyuH, and the carbamoylase gene hyuC. The four genes are transcribed in the same direction. Upstream of hyuP and in opposite orientation to the hyu genes, three ORFs were found showing similarities to cytochrome P450 monooxygenase (ORF1, incomplete), to membrane proteins (ORF2), and to ferredoxin (ORF3). ORF8 was found downstream of hyuC and again in opposite orientation to the hyu genes. The gene product of ORF8 displayed similarities to the LacI/GalR family of transcriptional regulators. Reverse transcriptase PCR experiments and Northern blot analysis revealed that the genes hyuPAHC are coexpressed in A. aurescens after induction with 3-N-CH3-IMH. The expression of the hyu operon was not regulated by the putative regulator ORF8 as shown by gene disruption and mobility-shift experiments.
International Nuclear Information System (INIS)
Somrani, Saida; Banu, Mihai; Jemal, Mohamed; Rey, Christian
2005-01-01
The conversion of amorphous tricalcium phosphate with different hydration ratio into apatite in water at 25 deg. C has been studied by microcalorimetry and several physical-chemical methods. The hydrolytic transformation was dominated by two strong exothermic events. A fast, relatively weak, wetting process and a very slow but strong heat release assigned to a slow internal rehydration and the crystallization of the amorphous phase into an apatite. The exothermic phenomenon related to the rehydration exceeded the crystalline transformation enthalpy. Rehydration occurred before the conversion of the amorphous phase into apatite and determined the advancement of the hydrolytic reaction. The apatitic phases formed evolved slightly with time after their formation. The crystallinity increased whereas the amount of HPO 4 2- ion decreased. These data allow a better understanding of the behavior of biomaterials involving amorphous phases such as hydroxyapatite plasma-sprayed coatings
Blind-date Conversation Joining
Directory of Open Access Journals (Sweden)
Luca Cesari
2013-07-01
Full Text Available We focus on a form of joining conversations among multiple parties in service-oriented applications where a client may asynchronously join an existing conversation without need to know in advance any information about it. More specifically, we show how the correlation mechanism provided by orchestration languages enables a form of conversation joining that is completely transparent to clients and that we call 'blind-date joining'. We provide an implementation of this strategy by using the standard orchestration language WS-BPEL. We then present its formal semantics by resorting to COWS, a process calculus specifically designed for modelling service-oriented applications. We illustrate our approach by means of a simple, but realistic, case study from the online games domain.
Varrault, Annie; Dantec, Christelle; Le Digarcher, Anne; Chotard, Laëtitia; Bilanges, Benoit; Parrinello, Hugues; Dubois, Emeric; Rialle, Stéphanie; Severac, Dany; Bouschet, Tristan; Journot, Laurent
2017-10-13
PLAGL1/ZAC1 undergoes parental genomic imprinting, is paternally expressed, and is a member of the imprinted gene network (IGN). It encodes a zinc finger transcription factor with anti-proliferative activity and is a candidate tumor suppressor gene on 6q24 whose expression is frequently lost in various neoplasms. Conversely, gain of PLAGL1 function is responsible for transient neonatal diabetes mellitus, a rare genetic disease that results from defective pancreas development. In the present work, we showed that Plagl1 up-regulation was not associated with DNA damage-induced cell cycle arrest. It was rather associated with physiological cell cycle exit that occurred with contact inhibition, growth factor withdrawal, or cell differentiation. To gain insights into Plagl1 mechanism of action, we identified Plagl1 target genes by combining chromatin immunoprecipitation and genome-wide transcriptomics in transfected cell lines. Plagl1-elicited gene regulation correlated with multiple binding to the proximal promoter region through a GC-rich motif. Plagl1 target genes included numerous genes involved in signaling, cell adhesion, and extracellular matrix composition, including collagens. Plagl1 targets also included 22% of the 409 genes that make up the IGN. Altogether, this work identified Plagl1 as a transcription factor that coordinated the regulation of a subset of IGN genes and controlled extracellular matrix composition. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Biomass thermochemical conversion program: 1987 annual report
Energy Technology Data Exchange (ETDEWEB)
Schiefelbein, G.F.; Stevens, D.J.; Gerber, M.A.
1988-01-01
The objective of the Biomass Thermochemical Conversion Program is to generate a base of scientific data and conversion process information that will lead to establishment of cost-effective processes for conversion of biomass resources into clean fuels. To accomplish this objective, in fiscal year 1987 the Thermochemical Conversion Program sponsored research activities in the following four areas: Liquid Hydrocarbon Fuels Technology; Gasification Technology; Direct Combustion Technology; Program Support Activities. In this report an overview of the Thermochemical Conversion Program is presented. Specific research projects are then described. Major accomplishments for 1987 are summarized.
Biomass thermochemical conversion program. 1985 annual report
Energy Technology Data Exchange (ETDEWEB)
Schiefelbein, G.F.; Stevens, D.J.; Gerber, M.A.
1986-01-01
Wood and crop residues constitute a vast majority of the biomass feedstocks available for conversion, and thermochemical processes are well suited for conversion of these materials. The US Department of Energy (DOE) is sponsoring research on this conversion technology for renewable energy through its Biomass Thermochemical Conversion Program. The Program is part of DOE's Biofuels and Municipal Waste Technology Division, Office of Renewable Technologies. This report briefly describes the Thermochemical Conversion Program structure and summarizes the activities and major accomplishments during fiscal year 1985. 32 figs., 4 tabs.
Sequence specificity of mutagenesis in the cI gene of bacteriophage lambda
International Nuclear Information System (INIS)
Skopek, T.R.; Wood, R.D.; Hutchinson, F.
1985-01-01
Studies of DNA base sequence alterations have shown that for every agent the mutagenic process is specific with respect to the types of base changes induced and the location of the changes in the DNA. Analysis of the types of mutations produced by mutagenic agents can provide insight into the mechanism of mutation and can suggest which DNA lesions may be involved in the actual mutagenic event. We have developed a system for the analysis of chemically induced base sequence alterations in the cI repressor gene of bacteriophage lambda using DNA sequencing techniques. To illustrate the utility of this type of analysis, we present the results obtained with ultraviolet light (UV). Irradiation of target DNA with UV alone, or UV followed by photoreactivating light (which removes dimers), produces mostly transitions at pyrimidine-pyrimidine sites. Conversely, irradiation with 313 nm light plus acetophenone (which produces only thymine dimers) produces mostly transversions at low efficiency. This and other evidence suggests that the actual premutagenic UV lesion in E. coli may not be pyrimidine-pyrimidine dimers, but rather pyr(6-4)pyo photoproducts
Cañada, Andres; Capella-Gutierrez, Salvador; Rabal, Obdulia; Oyarzabal, Julen; Valencia, Alfonso; Krallinger, Martin
2017-07-03
A considerable effort has been devoted to retrieve systematically information for genes and proteins as well as relationships between them. Despite the importance of chemical compounds and drugs as a central bio-entity in pharmacological and biological research, only a limited number of freely available chemical text-mining/search engine technologies are currently accessible. Here we present LimTox (Literature Mining for Toxicology), a web-based online biomedical search tool with special focus on adverse hepatobiliary reactions. It integrates a range of text mining, named entity recognition and information extraction components. LimTox relies on machine-learning, rule-based, pattern-based and term lookup strategies. This system processes scientific abstracts, a set of full text articles and medical agency assessment reports. Although the main focus of LimTox is on adverse liver events, it enables also basic searches for other organ level toxicity associations (nephrotoxicity, cardiotoxicity, thyrotoxicity and phospholipidosis). This tool supports specialized search queries for: chemical compounds/drugs, genes (with additional emphasis on key enzymes in drug metabolism, namely P450 cytochromes-CYPs) and biochemical liver markers. The LimTox website is free and open to all users and there is no login requirement. LimTox can be accessed at: http://limtox.bioinfo.cnio.es. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Preece, Alun; Webberley, Will; Braines, Dave
2015-05-01
Recent advances in natural language question-answering systems and context-aware mobile apps create opportunities for improved sensemaking in a tactical setting. Users equipped with mobile devices act as both sensors (able to acquire information) and effectors (able to act in situ), operating alone or in collectives. The currently- dominant technical approaches follow either a pull model (e.g. Apple's Siri or IBM's Watson which respond to users' natural language queries) or a push model (e.g. Google's Now which sends notifications to a user based on their context). There is growing recognition that users need more flexible styles of conversational interaction, where they are able to freely ask or tell, be asked or told, seek explanations and clarifications. Ideally such conversations should involve a mix of human and machine agents, able to collaborate in collective sensemaking activities with as few barriers as possible. Desirable capabilities include adding new knowledge, collaboratively building models, invoking specific services, and drawing inferences. As a step towards this goal, we collect evidence from a number of recent pilot studies including natural experiments (e.g. situation awareness in the context of organised protests) and synthetic experiments (e.g. human and machine agents collaborating in information seeking and spot reporting). We identify some principles and areas of future research for "conversational sensemaking".
2014-01-01
The l-arabinose isomerase (l-AI) and the d-xylose isomerase (d-XI) encoding genes from Lactobacillus reuteri (DSMZ 17509) were cloned and overexpressed in Escherichia coli BL21 (DE3). The proteins were purified to homogeneity by one-step affinity chromatography and characterized biochemically. l-AI displayed maximum activity at 65 °C and pH 6.0, whereas d-XI showed maximum activity at 65 °C and pH 5.0. Both enzymes require divalent metal ions. The genes were also ligated into the inducible lactobacillal expression vectors pSIP409 and pSIP609, the latter containing a food grade auxotrophy marker instead of an antibiotic resistance marker, and the l-AI- and d-XI-encoding sequences/genes were coexpressed in the food grade host Lactobacillus plantarum. The recombinant enzymes were tested for applications in carbohydrate conversion reactions of industrial relevance. The purified l-AI converted d-galactose to d-tagatose with a maximum conversion rate of 35%, and the d-XI isomerized d-glucose to d-fructose with a maximum conversion rate of 48% at 60 °C. PMID:24443973
Conversion factors and oil statistics
International Nuclear Information System (INIS)
Karbuz, Sohbet
2004-01-01
World oil statistics, in scope and accuracy, are often far from perfect. They can easily lead to misguided conclusions regarding the state of market fundamentals. Without proper attention directed at statistic caveats, the ensuing interpretation of oil market data opens the door to unnecessary volatility, and can distort perception of market fundamentals. Among the numerous caveats associated with the compilation of oil statistics, conversion factors, used to produce aggregated data, play a significant role. Interestingly enough, little attention is paid to conversion factors, i.e. to the relation between different units of measurement for oil. Additionally, the underlying information regarding the choice of a specific factor when trying to produce measurements of aggregated data remains scant. The aim of this paper is to shed some light on the impact of conversion factors for two commonly encountered issues, mass to volume equivalencies (barrels to tonnes) and for broad energy measures encountered in world oil statistics. This paper will seek to demonstrate how inappropriate and misused conversion factors can yield wildly varying results and ultimately distort oil statistics. Examples will show that while discrepancies in commonly used conversion factors may seem trivial, their impact on the assessment of a world oil balance is far from negligible. A unified and harmonised convention for conversion factors is necessary to achieve accurate comparisons and aggregate oil statistics for the benefit of both end-users and policy makers
NFIA co-localizes with PPARγ and transcriptionally controls the brown fat gene program
DEFF Research Database (Denmark)
Hiraike, Yuta; Waki, Hironori; Yu, Jing
2017-01-01
. NFIA and the master transcriptional regulator of adipogenesis, PPARγ, co-localize at the brown-fat-specific enhancers. Moreover, the binding of NFIA precedes and facilitates the binding of PPARγ, leading to increased chromatin accessibility and active transcription. Introduction of NFIA into myoblasts...... results in brown adipocyte differentiation. Conversely, the brown fat of NFIA-knockout mice displays impaired expression of the brown-fat-specific genes and reciprocal elevation of muscle genes. Finally, expression of NFIA and the brown-fat-specific genes is positively correlated in human brown fat...
Conversational AI: The Science Behind the Alexa Prize
Ram, Ashwin; Prasad, Rohit; Khatri, Chandra; Venkatesh, Anu; Gabriel, Raefer; Liu, Qing; Nunn, Jeff; Hedayatnia, Behnam; Cheng, Ming; Nagar, Ashish; King, Eric; Bland, Kate; Wartick, Amanda; Pan, Yi; Song, Han
2018-01-01
Conversational agents are exploding in popularity. However, much work remains in the area of social conversation as well as free-form conversation over a broad range of domains and topics. To advance the state of the art in conversational AI, Amazon launched the Alexa Prize, a 2.5-million-dollar university competition where sixteen selected university teams were challenged to build conversational agents, known as socialbots, to converse coherently and engagingly with humans on popular topics ...
Gaspar, John G; Street, Whitney N; Windsor, Matthew B; Carbonari, Ronald; Kaczmarski, Henry; Kramer, Arthur F; Mathewson, Kyle E
2014-12-01
Cell-phone use impairs driving safety and performance. This impairment may stem from the remote partner's lack of awareness about the driving situation. In this study, pairs of participants completed a driving simulator task while conversing naturally in the car and while talking on a hands-free cell phone. In a third condition, the driver drove while the remote conversation partner could see video of both the road ahead and the driver's face. We tested the extent to which this additional visual information diminished the negative effects of cell-phone distraction and increased situational awareness. Collision rates for unexpected merging events were high when participants drove in a cell-phone condition but were reduced when they were in a videophone condition, reaching a level equal to that observed when they drove with an in-car passenger or drove alone. Drivers and their partners made shorter utterances and made longer, more frequent traffic references when they spoke in the videophone rather than the cell-phone condition. Providing a view of the driving scene allows remote partners to help drivers by modulating their conversation and referring to traffic more often. © The Author(s) 2014.
Richards, Jennifer S; Hartman, Catharina A; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Arias Vásquez, Alejandro; Buitelaar, Jan K
The differential susceptibility theory states that children differ in their susceptibility towards environmental experiences, partially due to plasticity genes. Individuals carrying specific variants in such genes will be more disadvantaged in negative but, conversely, more advantaged in positive
Energy conversion at dipolarization fronts
Khotyaintsev, Yu. V.; Divin, A.; Vaivads, A.; André, M.; Markidis, S.
2017-02-01
We use multispacecraft observations by Cluster in the Earth's magnetotail and 3-D particle-in-cell simulations to investigate conversion of electromagnetic energy at the front of a fast plasma jet. We find that the major energy conversion is happening in the Earth (laboratory) frame, where the electromagnetic energy is being transferred from the electromagnetic field to particles. This process operates in a region with size of the order several ion inertial lengths across the jet front, and the primary contribution to E·j is coming from the motional electric field and the ion current. In the frame of the front we find fluctuating energy conversion with localized loads and generators at sub-ion scales which are primarily related to the lower hybrid drift instability excited at the front; however, these provide relatively small net energy conversion.
Passenger and Cell Phone Conversations in Simulated Driving
Drews, Frank A.; Pasupathi, Monisha; Strayer, David L.
2008-01-01
This study examines how conversing with passengers in a vehicle differs from conversing on a cell phone while driving. We compared how well drivers were able to deal with the demands of driving when conversing on a cell phone, conversing with a passenger, and when driving without any distraction. In the conversation conditions, participants were…
The Nanticoke conversion study
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-04-01
A study was conducted to assess the conversion of the Nanticoke coal-fired power plant to cleaner burning natural gas combined-cycle gas turbines. The Nanticoke Generating Station on Lake Erie is responsible for more than 50 per cent of Ontario Power Generation's (OPG) coal-fired electricity production. The OPG is proposing to work towards compliance with the newly signed Ozone Annex to the 1991 Canada-United States Air Quality Agreement which will require fossil-fueled power plants in southern Ontario to reduce their smog-causing nitrogen oxides emissions by about 50 per cent by 2007. This study assessed the emission reduction benefits and financial costs of conversion compared to continuing to operate Nanticoke as a coal-fired plant. The analysis includes a base case set of data on fuel prices, retrofit costs, fuel efficiencies, annual capacity factors and other parameters. It was determined that conversion would cost the average household less than $3 per month on their electricity bill. Conversion would also reduce emissions nitrogen oxide, a major smog pollutant, by 83 per cent and the particulates that form the most health-threatening portion of smog would be reduced by 100 per cent. 15 tabs., 1 fig.
Directory of Open Access Journals (Sweden)
Ebrahim Shahbazi
2016-04-01
Full Text Available Direct conversion of somatic cells into neural stem cells (NSCs by defined factors holds great promise for mechanistic studies, drug screening, and potential cell therapies for different neurodegenerative diseases. Here, we report that a single zinc-finger transcription factor, Zfp521, is sufficient for direct conversion of human fibroblasts into long-term self-renewable and multipotent NSCs. In vitro, Zfp521-induced NSCs maintained their characteristics in the absence of exogenous factor expression and exhibited morphological, molecular, developmental, and functional properties that were similar to control NSCs. In addition, the single-seeded induced NSCs were able to form NSC colonies with efficiency comparable with control NSCs and expressed NSC markers. The converted cells were capable of surviving, migrating, and attaining neural phenotypes after transplantation into neonatal mouse and adult rat brains, without forming tumors. Moreover, the Zfp521-induced NSCs predominantly expressed rostral genes. Our results suggest a facilitated approach for establishing human NSCs through Zfp521-driven conversion of fibroblasts.
Neurologists' understanding and management of conversion disorder.
Kanaan, Richard A; Armstrong, David; Wessely, Simon Charles
2011-09-01
Conversion disorder is largely managed by neurologists, for whom it presents great challenges to understanding and management. This study aimed to quantify these challenges, examining how neurologists understand conversion disorder, and what they tell their patients. A postal survey of all consultant neurologists in the UK registered with the Association of British Neurologists. 349 of 591 practising consultant neurologists completed the survey. They saw conversion disorder commonly. While they endorsed psychological models for conversion, they diagnosed it according to features of the clinical presentation, most importantly inconsistency and abnormal illness behaviour. Most of the respondents saw feigning as entangled with conversion disorder, with a minority seeing one as a variant of the other. They were quite willing to discuss psychological factors as long as the patient was receptive but were generally unwilling to discuss feigning even though they saw it as their responsibility. Those who favoured models in terms of feigning were older, while younger, female neurologists preferred psychological models, believed conversion would one day be understood neurologically and found communicating with their conversion patients easier than it had been in the past. Neurologists accept psychological models for conversion disorder but do not employ them in their diagnosis; they do not see conversion as clearly different from feigning. This may be changing as younger, female neurologists endorse psychological views more clearly and find it easier to discuss with their patients.
Large-video-display-format conversion
Haan, de G.
2000-01-01
High-quality video-format converters apply motion estimation and motion compensation to prevent jitter resulting from picture-rate conversion, and aliasing due to de-interlacing, in sequences with motion. Although initially considered as too expensive, high-quality conversion is now economically
Teaching autistic children conversational speech using video modeling.
Charlop, M H; Milstein, J P
1989-01-01
We assessed the effects of video modeling on acquisition and generalization of conversational skills among autistic children. Three autistic boys observed videotaped conversations consisting of two people discussing specific toys. When criterion for learning was met, generalization of conversational skills was assessed with untrained topics of conversation; new stimuli (toys); unfamiliar persons, siblings, and autistic peers; and other settings. The results indicated that the children learned through video modeling, generalized their conversational skills, and maintained conversational speech over a 15-month period. Video modeling shows much promise as a rapid and effective procedure for teaching complex verbal skills such as conversational speech. PMID:2793634
Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN
Li, Zhen; Van de Peer, Yves; De Smet, Riet
2016-01-01
Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215
Disruption, vertical displacement event and halo current characterization for ITER
International Nuclear Information System (INIS)
Wesley, J.; Fujisawa, N.; Ortolani, S.; Putvinski, S.; Rosenbluth, M.N.
1997-01-01
Characteristics, in ITER, of plasma disruptions, vertical displacement events (VDEs) and the conversion of plasma current to runaway electron current in a disruption are presented. In addition to the well known potential of disruptions to produce rapid thermal energy and plasma current quenches and theoretical predictions that show the likelihood of ∼ 50% runaway conversion, an assessment of VDE and halo current characteristics in vertically elongated tokamaks shows that disruptions in ITER will result in VDEs with peak in-vessel halo currents of up to 50% of the predisruption plasma current and with toroidal peaking factors (peak/average current density) of up to 4:1. However, the assessment also shows an inverse correlation between the halo current magnitude and the toroidal peaking factor; hence, ITER VDEs can be expected to have a product of normalized halo current magnitude times toroidal peaking factor of ≤ 75%. (author). 3 refs, 2 figs, 3 tabs
Directory of Open Access Journals (Sweden)
Geisilaine Soares dos Reis
2014-01-01
Conclusions: The present data suggest that Brazilian individuals with polymorphisms of the BMP4 gene have a higher risk to develop CAKUT, especially the malformations related to nephrogenesis and initial branching such as MDK and UPJO. Conversely, VUR appeared not to be related to BMP4 gene.
Combinatorial events of insertion sequences and ICE in Gram-negative bacteria.
Toleman, Mark A; Walsh, Timothy R
2011-09-01
The emergence of antibiotic and antimicrobial resistance in Gram-negative bacteria is incremental and linked to genetic elements that function in a so-called 'one-ended transposition' manner, including ISEcp1, ISCR elements and Tn3-like transposons. The power of these elements lies in their inability to consistently recognize one of their own terminal sequences, while recognizing more genetically distant surrogate sequences. This has the effect of mobilizing the DNA sequence found adjacent to their initial location. In general, resistance in Gram-negatives is closely linked to a few one-off events. These include the capture of the class 1 integron by a Tn5090-like transposon; the formation of the 3' conserved segment (3'-CS); and the fusion of the ISCR1 element to the 3'-CS. The structures formed by these rare events have been massively amplified and disseminated in Gram-negative bacteria, but hitherto, are rarely found in Gram-positives. Such events dominate current resistance gene acquisition and are instrumental in the construction of large resistance gene islands on chromosomes and plasmids. Similar combinatorial events appear to have occurred between conjugative plasmids and phages constructing hybrid elements called integrative and conjugative elements or conjugative transposons. These elements are beginning to be closely linked to some of the more powerful resistance mechanisms such as the extended spectrum β-lactamases, metallo- and AmpC type β-lactamases. Antibiotic resistance in Gram-negative bacteria is dominated by unusual combinatorial mistakes of Insertion sequences and gene fusions which have been selected and amplified by antibiotic pressure enabling the formation of extended resistance islands. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Career conversations in vocational schools
Mittendorff, K.M.; Brok, den P.J.; Beijaard, D.
2010-01-01
The purpose of this study was to examine career conversations between teachers and students in competence-based vocational education in the Netherlands. A total of 32 career conversations were observed and analysed with respect to four elements: content, teacher activities, student activities and
Optimization theory for ballistic conversion
Xie, Yanbo; Versluis, Michel; van den Berg, Albert; Eijkel, Jan C.T.
2016-01-01
The growing demand of renewable energy stimulates the exploration of new materials and methods for clean energy. We recently demonstrated a high efficiency and power density energy conversion mechanism by using jetted charged microdroplets, termed as ballistic energy conversion. Hereby, we model and
Accurate Gene Expression-Based Biodosimetry Using a Minimal Set of Human Gene Transcripts
Energy Technology Data Exchange (ETDEWEB)
Tucker, James D., E-mail: jtucker@biology.biosci.wayne.edu [Department of Biological Sciences, Wayne State University, Detroit, Michigan (United States); Joiner, Michael C. [Department of Radiation Oncology, Wayne State University, Detroit, Michigan (United States); Thomas, Robert A.; Grever, William E.; Bakhmutsky, Marina V. [Department of Biological Sciences, Wayne State University, Detroit, Michigan (United States); Chinkhota, Chantelle N.; Smolinski, Joseph M. [Department of Electrical and Computer Engineering, Wayne State University, Detroit, Michigan (United States); Divine, George W. [Department of Public Health Sciences, Henry Ford Hospital, Detroit, Michigan (United States); Auner, Gregory W. [Department of Electrical and Computer Engineering, Wayne State University, Detroit, Michigan (United States)
2014-03-15
Purpose: Rapid and reliable methods for conducting biological dosimetry are a necessity in the event of a large-scale nuclear event. Conventional biodosimetry methods lack the speed, portability, ease of use, and low cost required for triaging numerous victims. Here we address this need by showing that polymerase chain reaction (PCR) on a small number of gene transcripts can provide accurate and rapid dosimetry. The low cost and relative ease of PCR compared with existing dosimetry methods suggest that this approach may be useful in mass-casualty triage situations. Methods and Materials: Human peripheral blood from 60 adult donors was acutely exposed to cobalt-60 gamma rays at doses of 0 (control) to 10 Gy. mRNA expression levels of 121 selected genes were obtained 0.5, 1, and 2 days after exposure by reverse-transcriptase real-time PCR. Optimal dosimetry at each time point was obtained by stepwise regression of dose received against individual gene transcript expression levels. Results: Only 3 to 4 different gene transcripts, ASTN2, CDKN1A, GDF15, and ATM, are needed to explain ≥0.87 of the variance (R{sup 2}). Receiver-operator characteristics, a measure of sensitivity and specificity, of 0.98 for these statistical models were achieved at each time point. Conclusions: The actual and predicted radiation doses agree very closely up to 6 Gy. Dosimetry at 8 and 10 Gy shows some effect of saturation, thereby slightly diminishing the ability to quantify higher exposures. Analyses of these gene transcripts may be advantageous for use in a field-portable device designed to assess exposures in mass casualty situations or in clinical radiation emergencies.
Conversion electrons in the SDC
International Nuclear Information System (INIS)
Wicklund, A.B.
1991-01-01
We summarize a preliminary analysis of the rates for conversion electrons in the SDC detector, relative to other interesting sources of prompt electrons. We have used Papageno V3.30, and other available NLO calculations to estimate inclusive rates in the central region (η less than 2.0), and we have cross checked these using CDF data at 1.8 TeV. We have considered three sources of ''isolated'' electrons, namely inclusive W/Z production; top quark (Mt=140); and QCD prompt photon production, followed by conversion in 10% XO. This value approximates the inner silicon detector at SDC. Additional conversions will occur in the outer tracking chamber, but the trigger and track reconstruction efficiency will be lower. We have also considered ''nonisolated'' leptons coming from inclusive bottom production, photon conversions resulting from π 0 ,η production in jets, and high pt hadrons faking electrons
Hydrogen photoproduction by photoelectrochemical conversion
International Nuclear Information System (INIS)
Anon.
1989-01-01
The water-splitting reaction by photoelectrochemical processes has gained much more attention than any of many reactions proposed for solar generation of energy-rich molecules (fuels). The conversion efficiency of the photosystem is the key factor. The higher the efficiency, the more economically feasible will be the conversion scheme. The conversion efficiency is a function of the semiconductor properties, light intensity, spectral quality, properties of the electrolyte, counterelectrode, cell configuration, etc. The semiconductor parameters include band gap, absorption coefficient and diffusion length. The area and material used for a counterelectrode are important when considering polarization losses in a two-electrode system. Besides, the stability problem is also a very important one to meet the requirement for practical applications. This paper reviews some important issues on photoelectrochemical generation of hydrogen by water splitting. It includes energy conversion efficiency, market assessment and cost goal, state of the technology, and future directions for research
CDK5RAP2 gene and tau pathophysiology in late-onset sporadic Alzheimer's disease.
Miron, Justin; Picard, Cynthia; Nilsson, Nathalie; Frappier, Josée; Dea, Doris; Théroux, Louise; Poirier, Judes
2018-06-01
Because currently known Alzheimer's disease (AD) single-nucleotide polymorphisms only account for a small fraction of the genetic variance in this disease, there is a need to identify new variants associated with AD. Our team performed a genome-wide association study in the Quebec Founder Population isolate to identify novel protective or risk genetic factors for late-onset sporadic AD and examined the impact of these variants on gene expression and AD pathology. The rs10984186 variant is associated with an increased risk of developing AD and with a higher CDK5RAP2 mRNA prevalence in the hippocampus. On the other hand, the rs4837766 variant, which is among the best cis-expression quantitative trait loci in the CDK5RAP2 gene, is associated with lower mild cognitive impairment/AD risk and conversion rate. The rs10984186 risk and rs4837766 protective polymorphic variants of the CDK5RAP2 gene might act as potent genetic modifiers for AD risk and/or conversion by modulating the expression of this gene. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Evaluation of Features, Events, and Processes (FEP) for the Biosphere Model
Energy Technology Data Exchange (ETDEWEB)
M. Wasiolek; P. Rogers
2004-10-27
The purpose of this analysis report is to evaluate and document the inclusion or exclusion of biosphere features, events, and processes (FEPs) with respect to modeling used to support the total system performance assessment (TSPA) for the license application (LA). A screening decision, either ''Included'' or ''Excluded'', is given for each FEP along with the corresponding technical basis for the excluded FEPs and the descriptions of how the included FEPs were incorporated in the biosphere model. This information is required by the U.S. Nuclear Regulatory Commission (NRC) regulations at 10 CFR 63.114 (d, e, and f) [DIRS 156605]. The FEPs addressed in this report concern characteristics of the reference biosphere, the receptor, and the environmental transport and receptor exposure pathways for the groundwater and volcanic ash exposure scenarios considered in biosphere modeling. This revision provides the summary of the implementation of included FEPs in TSPA-LA, (i.e., how the FEP is included); for excluded FEPs, this analysis provides the technical basis for exclusion from TSPA-LA (i.e., why the FEP is excluded). This report is one of the 10 documents constituting the biosphere model documentation suite. A graphical representation of the documentation hierarchy for the biosphere model is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling. The ''Biosphere Model Report'' describes in detail the biosphere conceptual model and mathematical model. The input parameter reports shown to the right of the ''Biosphere Model Report'' contain detailed descriptions of the model input parameters and their development. Outputs from these six reports are used in the ''Nominal Performance Biosphere Dose Conversion Factor Analysis and Disruptive Event Biosphere Dose Conversion Factor Analysis
Brait, A.; Brait, A.; Seshan, Kulathuiyer; Lercher, J.A.
1998-01-01
The physicochemical properties of six steam-stabilized, commercial FCC catalysts were compared in respect of their catalytic activity for n-hexane conversion. The conversion of n-hexane over these catalysts could be fully explained by three reaction pathways: protolytic cracking, protolytic
Integration of the Gene Ontology into an object-oriented architecture
Directory of Open Access Journals (Sweden)
Zheng W Jim
2005-05-01
Full Text Available Abstract Background To standardize gene product descriptions, a formal vocabulary defined as the Gene Ontology (GO has been developed. GO terms have been categorized into biological processes, molecular functions, and cellular components. However, there is no single representation that integrates all the terms into one cohesive model. Furthermore, GO definitions have little information explaining the underlying architecture that forms these terms, such as the dynamic and static events occurring in a process. In contrast, object-oriented models have been developed to show dynamic and static events. A portion of the TGF-beta signaling pathway, which is involved in numerous cellular events including cancer, differentiation and development, was used to demonstrate the feasibility of integrating the Gene Ontology into an object-oriented model. Results Using object-oriented models we have captured the static and dynamic events that occur during a representative GO process, "transforming growth factor-beta (TGF-beta receptor complex assembly" (GO:0007181. Conclusion We demonstrate that the utility of GO terms can be enhanced by object-oriented technology, and that the GO terms can be integrated into an object-oriented model by serving as a basis for the generation of object functions and attributes.
A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.
Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M
2017-11-17
The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.
International Nuclear Information System (INIS)
Silver, A.; Boultwood, J.; Breckon, G.; Masson, W.; Adam, J.; Shaw, A.R.; Cox, R.
1989-01-01
The incidence of acute myeloid leukemia (AML) in CBA/H mice following exposure to single acute doses of ionizing radiation has previously been determined. A high proportion of these AMLs are characterized by rearrangement of murine chromosome 2 in the C2 and/or E5-F regions, and there is evidence that these events are a direct consequence of radiation damage to multipotential hemopoietic cells. Using a combination of in situ chromosome hybridization and mRNA analyses, we show that the cytokine gene interleukin-1 beta (IL-1 beta) is encoded in the chromosome 2 F region and is translocated in a chromosome 2---2 rearrangement in an x-ray-induced AML (N36). Also, IL-1 beta is specifically deregulated in N36 and in two other chromosome 2-rearranged AMLs but not in a fourth, which has two cytogenetically normal chromosome 2 copies. We suggest that radiation-induced specific chromosome 2 rearrangement associated with IL-1 beta deregulation may initiate murine leukemogenesis through the uncoupling of normal proliferative control mechanisms in multipotential hemopoietic cells
A fast method for calculating reliable event supports in tree reconciliations via Pareto optimality.
To, Thu-Hien; Jacox, Edwin; Ranwez, Vincent; Scornavacca, Celine
2015-11-14
Given a gene and a species tree, reconciliation methods attempt to retrieve the macro-evolutionary events that best explain the discrepancies between the two tree topologies. The DTL parsimonious approach searches for a most parsimonious reconciliation between a gene tree and a (dated) species tree, considering four possible macro-evolutionary events (speciation, duplication, transfer, and loss) with specific costs. Unfortunately, many events are erroneously predicted due to errors in the input trees, inappropriate input cost values or because of the existence of several equally parsimonious scenarios. It is thus crucial to provide a measure of the reliability for predicted events. It has been recently proposed that the reliability of an event can be estimated via its frequency in the set of most parsimonious reconciliations obtained using a variety of reasonable input cost vectors. To compute such a support, a straightforward but time-consuming approach is to generate the costs slightly departing from the original ones, independently compute the set of all most parsimonious reconciliations for each vector, and combine these sets a posteriori. Another proposed approach uses Pareto-optimality to partition cost values into regions which induce reconciliations with the same number of DTL events. The support of an event is then defined as its frequency in the set of regions. However, often, the number of regions is not large enough to provide reliable supports. We present here a method to compute efficiently event supports via a polynomial-sized graph, which can represent all reconciliations for several different costs. Moreover, two methods are proposed to take into account alternative input costs: either explicitly providing an input cost range or allowing a tolerance for the over cost of a reconciliation. Our methods are faster than the region based method, substantially faster than the sampling-costs approach, and have a higher event-prediction accuracy on
Detection of Horizontal Gene Transfers from Phylogenetic Comparisons
Pylro, Victor Satler; Vespoli, Luciano de Souza; Duarte, Gabriela Frois; Yotoko, Karla Suemy Clemente
2012-01-01
Bacterial phylogenies have become one of the most important challenges for microbial ecology. This field started in the mid-1970s with the aim of using the sequence of the small subunit ribosomal RNA (16S) tool to infer bacterial phylogenies. Phylogenetic hypotheses based on other sequences usually give conflicting topologies that reveal different evolutionary histories, which in some cases may be the result of horizontal gene transfer events. Currently, one of the major goals of molecular biology is to understand the role that horizontal gene transfer plays in species adaptation and evolution. In this work, we compared the phylogenetic tree based on 16S with the tree based on dszC, a gene involved in the cleavage of carbon-sulfur bonds. Bacteria of several genera perform this survival task when living in environments lacking free mineral sulfur. The biochemical pathway of the desulphurization process was extensively studied due to its economic importance, since this step is expensive and indispensable in fuel production. Our results clearly show that horizontal gene transfer events could be detected using common phylogenetic methods with gene sequences obtained from public sequence databases. PMID:22675653
Preece, Alun; Gwilliams, Chris; Parizas, Christos; Pizzocaro, Diego; Bakdash, Jonathan Z.; Braines, Dave
2014-05-01
Recent developments in sensing technologies, mobile devices and context-aware user interfaces have made it pos- sible to represent information fusion and situational awareness for Intelligence, Surveillance and Reconnaissance (ISR) activities as a conversational process among actors at or near the tactical edges of a network. Motivated by use cases in the domain of Company Intelligence Support Team (CoIST) tasks, this paper presents an approach to information collection, fusion and sense-making based on the use of natural language (NL) and controlled nat- ural language (CNL) to support richer forms of human-machine interaction. The approach uses a conversational protocol to facilitate a ow of collaborative messages from NL to CNL and back again in support of interactions such as: turning eyewitness reports from human observers into actionable information (from both soldier and civilian sources); fusing information from humans and physical sensors (with associated quality metadata); and assisting human analysts to make the best use of available sensing assets in an area of interest (governed by man- agement and security policies). CNL is used as a common formal knowledge representation for both machine and human agents to support reasoning, semantic information fusion and generation of rationale for inferences, in ways that remain transparent to human users. Examples are provided of various alternative styles for user feedback, including NL, CNL and graphical feedback. A pilot experiment with human subjects shows that a prototype conversational agent is able to gather usable CNL information from untrained human subjects.
Groysberg, Boris; Slind, Michael
2012-06-01
Globalization and new technologies have sharply reduced the efficacy of command-and-control management and its accompanying forms of corporate communication. In the course of a recent research project, the authors concluded that by talking with employees, rather than simply issuing orders, leaders can promote operational flexibility, employee engagement, and tight strategic alignment. Groysberg and Slind have identified four elements of organizational conversation that reflect the essential attributes of interpersonal conversation: intimacy, interactivity, inclusion, and intentionality. Intimacy shifts the focus from a top-down distribution of information to a bottom-up exchange of ideas. Organizational conversation is less corporate in tone and more casual. And it's less about issuing and taking orders than about asking and answering questions. Interactivity entails shunning the simplicity of monologue and embracing the unpredictable vitality of dialogue. Traditional one-way media-print and broadcast, in particular-give way to social media buttressed by social thinking. Inclusion turns employees into full-fledged conversation partners, entitling them to provide their own ideas, often on company channels. They can create content and act as brand ambassadors, thought leaders, and storytellers. Intentionality enables leaders and employees to derive strategically relevant action from the push and pull of discussion and debate.
Response inhibition in motor conversion disorder.
Voon, Valerie; Ekanayake, Vindhya; Wiggs, Edythe; Kranick, Sarah; Ameli, Rezvan; Harrison, Neil A; Hallett, Mark
2013-05-01
Conversion disorders (CDs) are unexplained neurological symptoms presumed to be related to a psychological issue. Studies focusing on conversion paralysis have suggested potential impairments in motor initiation or execution. Here we studied CD patients with aberrant or excessive motor movements and focused on motor response inhibition. We also assessed cognitive measures in multiple domains. We compared 30 CD patients and 30 age-, sex-, and education-matched healthy volunteers on a motor response inhibition task (go/no go), along with verbal motor response inhibition (color-word interference) and measures of attention, sustained attention, processing speed, language, memory, visuospatial processing, and executive function including planning and verbal fluency. CD patients had greater impairments in commission errors on the go/no go task (P conversion. Patients with nonepileptic seizures, a different form of conversion disorder, are commonly reported to have lower IQ and multiple cognitive deficits. Our results point toward potential differences between conversion disorder subgroups. © 2013 Movement Disorder Society. Copyright © 2013 Movement Disorder Society.
Catalytic Conversion of Carbohydrates
DEFF Research Database (Denmark)
Osmundsen, Christian Mårup
a renewable route to aromatics. The conversion of biomass by high temperature processes is a desirable prospect due to the high volumetric production rates which can be achieved, and the ability of these types of processes to convert a wide range of substrates. Current processes however typically have rather...... with the production of commodity chemicals from the most abundantly available renewable source of carbon, carbohydrates. The production of alkyl lactates by the Lewis acid catalyzed conversion of hexoses is an interesting alternative to current fermentation based processes. A range of stannosilicates were...... to be an efficient initial conversion step in the utilization of biomass for chemicals production. The shift from an oil based chemical industry to one based on renewable resources is bound to happen sooner or later, however the environmental problems associated with the burning of fossil resources means...
Direct digital conversion detector technology
Mandl, William J.; Fedors, Richard
1995-06-01
Future imaging sensors for the aerospace and commercial video markets will depend on low cost, high speed analog-to-digital (A/D) conversion to efficiently process optical detector signals. Current A/D methods place a heavy burden on system resources, increase noise, and limit the throughput. This paper describes a unique method for incorporating A/D conversion right on the focal plane array. This concept is based on Sigma-Delta sampling, and makes optimum use of the active detector real estate. Combined with modern digital signal processors, such devices will significantly increase data rates off the focal plane. Early conversion to digital format will also decrease the signal susceptibility to noise, lowering the communications bit error rate. Computer modeling of this concept is described, along with results from several simulation runs. A potential application for direct digital conversion is also reviewed. Future uses for this technology could range from scientific instruments to remote sensors, telecommunications gear, medical diagnostic tools, and consumer products.
Conversion of autoimmune hypothyroidism to hyperthyroidism
Furqan, Saira; Haque, Naeem-ul; Islam, Najmul
2014-01-01
Background Graves’ disease and Hashimoto’s thyroiditis are the two autoimmune spectrum of thyroid disease. Cases of conversion from hyperthyroidism to hypothyroidism have been reported but conversion from hypothyroidism to hyperthyroidism is very rare. Although such cases have been reported rarely in the past we are now seeing such conversions from hypothyroidism to hyperthyroidism more frequently in clinical practice. Case presentation We are reporting three cases of middle aged Asian female...
Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling
2014-01-13
Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.
Directory of Open Access Journals (Sweden)
Irina Bogdarina
2010-02-01
Full Text Available Adverse events in pregnancy may 'programme' offspring for the later development of cardiovascular disease and hypertension. Previously, using a rodent model of programmed hypertension we have demonstrated the role of the renin-angiotensin system in this process. More recently we showed that a maternal low protein diet resulted in undermethylation of the At1b angiotensin receptor promoter and the early overexpression of this gene in the adrenal of offspring. Here, we investigate the hypothesis that maternal glucocorticoid modulates this effect on fetal DNA methylation and gene expression. We investigated whether treatment of rat dams with the 11beta-hydroxylase inhibitor metyrapone, could prevent the epigenetic and gene expression changes we observed. Offspring of mothers subjected to a low protein diet in pregnancy showed reduced adrenal Agtr1b methylation and increased adrenal gene expression as we observed previously. Treatment of mothers with metyrapone for the first 14 days of pregnancy reversed these changes and prevented the appearance of hypertension in the offspring at 4 weeks of age. As a control for non-specific effects of programmed hypertension we studied offspring of mothers treated with dexamethasone from day 15 of pregnancy and showed that, whilst they had raised blood pressure, they failed to show any evidence of Agtr1b methylation or increase in gene expression. We conclude that maternal glucocorticoid in early pregnancy may induce changes in methylation and expression of the Agtr1b gene as these are clearly reversed by an 11 beta-hydroxylase inhibitor. However in later pregnancy a converse effect with dexamethasone could not be demonstrated and this may reflect either an alternative mechanism of this glucocorticoid or a stage-specific influence.
Schiffrin, Deborah
1990-01-01
Summarizes the current state of research in conversation analysis, referring primarily to six different perspectives that have developed from the philosophy, sociology, anthropology, and linguistics disciplines. These include pragmatics; speech act theory; interactional sociolinguistics; ethnomethodology; ethnography of communication; and…
Chen, Albert Tzong-Yang; Guo, Chunfang; Itani, Omar A; Budaitis, Breane G; Williams, Travis W; Hopkins, Christopher E; McEachin, Richard C; Pande, Manjusha; Grant, Ana R; Yoshina, Sawako; Mitani, Shohei; Hu, Patrick J
2015-10-01
FoxO transcription factors promote longevity across taxa. How they do so is poorly understood. In the nematode Caenorhabditis elegans, the A- and F-isoforms of the FoxO transcription factor DAF-16 extend life span in the context of reduced DAF-2 insulin-like growth factor receptor (IGFR) signaling. To elucidate the mechanistic basis for DAF-16/FoxO-dependent life span extension, we performed an integrative analysis of isoform-specific daf-16/FoxO mutants. In contrast to previous studies suggesting that DAF-16F plays a more prominent role in life span control than DAF-16A, isoform-specific daf-16/FoxO mutant phenotypes and whole transcriptome profiling revealed a predominant role for DAF-16A over DAF-16F in life span control, stress resistance, and target gene regulation. Integration of these datasets enabled the prioritization of a subset of 92 DAF-16/FoxO target genes for functional interrogation. Among 29 genes tested, two DAF-16A-specific target genes significantly influenced longevity. A loss-of-function mutation in the conserved gene gst-20, which is induced by DAF-16A, reduced life span extension in the context of daf-2/IGFR RNAi without influencing longevity in animals subjected to control RNAi. Therefore, gst-20 promotes DAF-16/FoxO-dependent longevity. Conversely, a loss-of-function mutation in srr-4, a gene encoding a seven-transmembrane-domain receptor family member that is repressed by DAF-16A, extended life span in control animals, indicating that DAF-16/FoxO may extend life span at least in part by reducing srr-4 expression. Our discovery of new longevity genes underscores the efficacy of our integrative strategy while providing a general framework for identifying specific downstream gene regulatory events that contribute substantially to transcription factor functions. As FoxO transcription factors have conserved functions in promoting longevity and may be dysregulated in aging-related diseases, these findings promise to illuminate fundamental
Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen
2017-07-01
In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.
Reis, Micael; Silva, Ana C; Vieira, Cristina P; Vieira, Jorge
2016-07-07
Mucins have been implicated in many different biological processes, such as protection from mechanical damage, microorganisms, and toxic molecules, as well as providing a luminal scaffold during development. Nevertheless, it is conceivable that mucins have the potential to modulate food absorption as well, and thus contribute to the definition of several important phenotypic traits. Here we show that the Drosophila melanogaster Muc68E gene is 40- to 60-million-yr old, and is present in Drosophila species of the subgenus Sophophora only. The central repeat region of this gene is fast evolving, and shows evidence for repeated expansions/contractions. This and/or frequent gene conversion events lead to the homogenization of its repeats. The amino acid pattern P[ED][ED][ST][ST][ST] is found in the repeat region of Muc68E proteins from all Drosophila species studied, and can occur multiple times within a single conserved repeat block, and thus may have functional significance. Muc68E is a nonessential gene under laboratory conditions, but Muc68E mutant flies are smaller and lighter than controls at birth. However, at 4 d of age, Muc68E mutants are heavier, recover faster from chill-coma, and are more resistant to starvation than control flies, although they have the same percentage of lipids as controls. Mutant flies have enlarged abdominal size 1 d after chill-coma recovery, which is associated with higher lipid content. These results suggest that Muc68E has a role in metabolism modulation, food absorption, and/or feeding patterns in larvae and adults, and under normal and stress conditions. Such biological function is novel for mucin genes. Copyright © 2016 Reis et al.
Interfacing feedstock logistics with bioenergy conversion
Energy Technology Data Exchange (ETDEWEB)
Sokhansanj, S. [British Columbia Univ., Vancouver, BC (Canada). Oak Ridge National Lab
2010-07-01
The interface between biomass production and biomass conversion platforms was investigated. Functional relationships were assembled in a modeling platform to simulate the flow of biomass feedstock from farm and forest to a densification plant. The model considers key properties of biomass for downstream pre-processing and conversion. These properties include moisture content, cellulose, hemicelluloses, lignin, ash, particle size, specific density and bulk density. The model simulates logistical operations such as grinding to convert biomass to pellets that are supplied to a biorefinery for conversion to heat, power, or biofuels. Equations were developed to describe the physical aspects of each unit operation. The effect that each of the process variables has on the efficiency of the conversion processes was described.
Persuasive Conversational Agent with Persuasion Tactics
Narita, Tatsuya; Kitamura, Yasuhiko
Persuasive conversational agents persuade people to change their attitudes or behaviors through conversation, and are expected to be applied as virtual sales clerks in e-shopping sites. As an approach to create such an agent, we have developed a learning agent with the Wizard of Oz method in which a person called Wizard talks to the user pretending to be the agent. The agent observes the conversations between the Wizard and the user, and learns how to persuade people. In this method, the Wizard has to reply to most of the user's inputs at the beginning, but the burden gradually falls because the agent learns how to reply as the conversation model grows.
Fusion events lead to truncation of FOS in epithelioid hemangioma of bone
DEFF Research Database (Denmark)
van IJzendoorn, David G P; de Jong, Danielle; Romagosa, Cleofe
2015-01-01
in exon 4 of the FOS gene and the fusion event led to the introduction of a stop codon. In all instances, the truncation of the FOS gene would result in the loss of the transactivation domain (TAD). Using FISH probes we found a break in the FOS gene in two additional cases, in none of these cases...... differential diagnosis of vascular tumors of bone. Our data suggest that the translocation causes truncation of the FOS protein, with loss of the TAD, which is thereby a novel mechanism involved in tumorigenesis....
Persuasion detection in conversation
Gilbert, Henry T.
2010-01-01
Approved for public release; distribution is unlimited In this thesis, we present a system for annotating persuasion in conversation based on a social-psychological model. We augmented the social model developed by James Cialdini with some of our own categories for annotators to label. The conversations consisted of 37 hostage negotiation transcripts from private and public sources, with all personal information removed from the private source transcripts. We evaluated the level of agre...
Perspective on direct conversion
Energy Technology Data Exchange (ETDEWEB)
Lewis, W B
1963-10-15
The objective of direct conversion is high electrical output for minimum total cost, and not always high conversion efficiency. The wide range of techniques embracing cryogenics and hot plasma derives from the special requirements of source, environment, and application. Sources include solar and other radiation, nuclear fission and fusion, chemical energy, and heat. Environments and applications range from space vehicles to submarines and from giant power networks to isolated buoys and pocket devices. (auth)
DEFF Research Database (Denmark)
Linde, S; Welinder, B S; Nielsen, Jens Høiriis
1993-01-01
. Most mammals produce a single insulin, but in rodents two non-allelic insulin genes are expressed. There is an inverse ratio between the two insulins in rats and mice, the reason for this being unknown. It has been suggested that differences in transcription, translation (biosynthesis) and...... PIM (intact proinsulin or its intermediates) has been incompletely determined. Studies of the biosynthesis of proinsulins and their conversion with the purpose of revealing some of these points depend on accessible reversed-phase high-performance liquid chromatographic (RP-HPLC) analyses capable...
Reflection during Portfolio-Based Conversations
Oosterbaan, Anne E.; van der Schaaf, Marieke F.; Baartman, Liesbeth K. J.; Stokking, Karel M.
2010-01-01
This study aims to explore the relationship between the occurrence of reflection (and non-reflection) and thinking activities (e.g., orientating, selecting, analysing) during portfolio-based conversations. Analysis of 21 transcripts of portfolio-based conversations revealed that 20% of the segments were made up of reflection (content reflection…
Conversion Disorder- Mind versus Body: A Review.
Ali, Shahid; Jabeen, Shagufta; Pate, Rebecca J; Shahid, Marwah; Chinala, Sandhya; Nathani, Milankumar; Shah, Rida
2015-01-01
In this article, the authors accentuate the signs and symptoms of conversion disorder and the significance of clinical judgment and expertise in order to reach the right diagnosis. The authors review the literature and provide information on the etiology, prevalence, diagnostic criteria, and the treatment methods currently employed in the management of conversion disorder. Of note, the advancements of neuropsychology and brain imaging have led to emergence of a relatively sophisticated picture of the neuroscientific psychopathology of complex mental illnesses, including conversion disorder. The available evidence suggests new methods with which to test hypotheses about the neural circuits underlying conversion symptoms. In context of this, the authors also explore the neurobiological understanding of conversion disorder.
Conversion Disorder— Mind versus Body: A Review
Jabeen, Shagufta; Pate, Rebecca J.; Shahid, Marwah; Chinala, Sandhya; Nathani, Milankumar; Shah, Rida
2015-01-01
In this article, the authors accentuate the signs and symptoms of conversion disorder and the significance of clinical judgment and expertise in order to reach the right diagnosis. The authors review the literature and provide information on the etiology, prevalence, diagnostic criteria, and the treatment methods currently employed in the management of conversion disorder. Of note, the advancements of neuropsychology and brain imaging have led to emergence of a relatively sophisticated picture of the neuroscientific psychopathology of complex mental illnesses, including conversion disorder. The available evidence suggests new methods with which to test hypotheses about the neural circuits underlying conversion symptoms. In context of this, the authors also explore the neurobiological understanding of conversion disorder. PMID:26155375
Chung, Jee Eun; Choi, Soo An; Hwang, Han Sung; Park, Jin Young; Lee, Kyung Eun; Yee, Jeong; Kim, Young Ju; Gwak, Hye Sun
2017-11-13
Ritodrine, a tocolytic β2-agonist, has been used extensively in Europe and Asia despite its safety concerns. This study was designed to identify associations between β2-adrenergic receptor (ADRB2) polymorphisms and adverse drug events (ADEs) in patients with preterm labor treated with ritodrine. This follow-up study was prospectively conducted at Ewha Womans University Mokdong Hospital in Korea. Five single nucleotide polymorphisms (SNPs) of the ADRB2 gene (rs1042713, rs1042714, rs1042717, rs1042718, and rs1042719) were analyzed in 186 pregnant women with preterm labor. Patients with the AA genotype of rs1042717 had significantly lower incidence of ADEs compared to those with the G allele (p = 0.009). In multivariate analysis, one of the predictors of ADEs was the maximum infusion rate of ritodrine (AOR 4.47, 95% CI 1.31-15.25). Rs1042719 was also a significant factor for ritodrine-induced ADEs. The CC genotype carriers had 78% decreased risk of ADEs compared to those with other genotypes. This study demonstrates that ADEs induced by ritodrine are associated with ADRB2 gene polymorphisms, as well as the infusion rate of ritodrine in pregnant women with preterm labor.
Generaal, Ellen; Vogelzangs, Nicole; Macfarlane, Gary J; Geenen, Rinie; Smit, Johannes H; de Geus, Eco J C N; Dekker, Joost; Penninx, Brenda W J H
Dysfunction of biological stress systems and adverse life events, independently and in interaction, have been hypothesized to predict chronic pain persistence. Conversely, these factors may hamper the improvement of chronic pain. Longitudinal evidence is currently lacking. We examined whether: 1)
Proinflammatory cytokine levels in patients with conversion disorder.
Tiyekli, Utkan; Calıyurt, Okan; Tiyekli, Nimet Dilek
2013-06-01
It was aimed to evaluate the relationship between proinflammatory cytokine levels and conversion disorder both commonly known as stress regulated. Baseline proinflammatory cytokine levels-[Tumour necrosis factor alpha (TNF-α), Interleukin-1 beta (IL-1β), Interleukin-6 (IL-6)]-were evaluated with enzyme-linked immunosorbent assay in 35 conversion disorder patients and 30 healthy controls. Possible changes in proinflammatory cytokine levels were evaluated again, after their acute phase in conversion disorder patients. Statistically significant decreased serum TNF-α levels were obtained in acute phase of conversion disorder. Those levels increased after acute conversion phase. There were no statistically significant difference observed between groups in serum IL-1β and (IL-6) levels. Stress associated with conversion disorder may suppress immune function in acute conversion phase and may have diagnostic and therapeutic value.
He, Haiqi; Ni, Bing; Tian, Yi; Tian, Zhiqiang; Chen, Yanke; Liu, Zhengwen; Yang, Xiaomei; Lv, Yi; Zhang, Yong
2014-03-01
CD4(+) FOXP3(+) regulatory T (Treg) cells constitute a heterogeneous and plastic T-cell lineage that plays a pivotal role in maintaining immune homeostasis and immune tolerance. However, the fate of human Treg cells after loss of FOXP3 expression and the epigenetic mechanisms contributing to such a phenotype switch remain to be fully elucidated. In the current study, we demonstrate that human CD4(+) CD25(high) CD127(low/-) Treg cells convert to two subpopulations with distinctive FOXP3(+) and FOXP3(-) phenotypes following in vitro culture with anti-CD3/CD28 and interleukin-2. Digital gene expression analysis showed that upon in vitro expansion, human Treg cells down-regulated Treg cell signature genes, such as FOXP3, CTLA4, ICOS, IKZF2 and LRRC32, but up-regulated a set of T helper lineage-associated genes, especially T helper type 2 (Th2)-associated, such as GATA3, GFI1 and IL13. Subsequent chromatin immunoprecipitation-sequencing of these subpopulations yielded genome-wide maps of their H3K4me3 and H3K27me3 profiles. Surprisingly, reprogramming of Treg cells was associated with differential histone modifications, as evidenced by decreased abundance of permissive H3K4me3 within the down-regulated Treg cell signature genes, such as FOXP3, CTLA4 and LRRC32 loci, and increased abundance of H3K4me3 within the Th2-associated genes, such as IL4 and IL5; however, the H3K27me3 modification profile was not significantly different between the two subpopulations. In conclusion, this study revealed that loss of FOXP3 expression from human Treg cells during in vitro expansion can induce reprogramming to a T helper cell phenotype with a gene expression signature dominated by Th2 lineage-associated genes, and that this cell type conversion may be mediated by histone methylation events. © 2013 John Wiley & Sons Ltd.
He, Haiqi; Ni, Bing; Tian, Yi; Tian, Zhiqiang; Chen, Yanke; Liu, Zhengwen; Yang, Xiaomei; Lv, Yi; Zhang, Yong
2014-01-01
CD4+ FOXP3+ regulatory T (Treg) cells constitute a heterogeneous and plastic T-cell lineage that plays a pivotal role in maintaining immune homeostasis and immune tolerance. However, the fate of human Treg cells after loss of FOXP3 expression and the epigenetic mechanisms contributing to such a phenotype switch remain to be fully elucidated. In the current study, we demonstrate that human CD4+ CD25high CD127low/− Treg cells convert to two subpopulations with distinctive FOXP3+ and FOXP3− phenotypes following in vitro culture with anti-CD3/CD28 and interleukin-2. Digital gene expression analysis showed that upon in vitro expansion, human Treg cells down-regulated Treg cell signature genes, such as FOXP3, CTLA4, ICOS, IKZF2 and LRRC32, but up-regulated a set of T helper lineage-associated genes, especially T helper type 2 (Th2)-associated, such as GATA3, GFI1 and IL13. Subsequent chromatin immunoprecipitation-sequencing of these subpopulations yielded genome-wide maps of their H3K4me3 and H3K27me3 profiles. Surprisingly, reprogramming of Treg cells was associated with differential histone modifications, as evidenced by decreased abundance of permissive H3K4me3 within the down-regulated Treg cell signature genes, such as FOXP3, CTLA4 and LRRC32 loci, and increased abundance of H3K4me3 within the Th2-associated genes, such as IL4 and IL5; however, the H3K27me3 modification profile was not significantly different between the two subpopulations. In conclusion, this study revealed that loss of FOXP3 expression from human Treg cells during in vitro expansion can induce reprogramming to a T helper cell phenotype with a gene expression signature dominated by Th2 lineage-associated genes, and that this cell type conversion may be mediated by histone methylation events. PMID:24152290
Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts
Directory of Open Access Journals (Sweden)
Sara E. Howden
2015-12-01
Full Text Available The derivation of genetically modified induced pluripotent stem (iPS cells typically involves multiple steps, requiring lengthy cell culture periods, drug selection, and several clonal events. We report the generation of gene-targeted iPS cell lines following a single electroporation of patient-specific fibroblasts using episomal-based reprogramming vectors and the Cas9/CRISPR system. Simultaneous reprogramming and gene targeting was tested and achieved in two independent fibroblast lines with targeting efficiencies of up to 8% of the total iPS cell population. We have successfully targeted the DNMT3B and OCT4 genes with a fluorescent reporter and corrected the disease-causing mutation in both patient fibroblast lines: one derived from an adult with retinitis pigmentosa, the other from an infant with severe combined immunodeficiency. This procedure allows the generation of gene-targeted iPS cell lines with only a single clonal event in as little as 2 weeks and without the need for drug selection, thereby facilitating “seamless” single base-pair changes.
High frame-rate neutron radiography of dynamic events
International Nuclear Information System (INIS)
Bossi, R.H.; Robinson, A.H.; Barton, J.P.
1981-01-01
A system has been developed to perform neutron radiographic analysis of dynamic events having a duration of several milliseconds. The system has been operated in the range of 2000 to 10,000 frames/second. Synchronization has provided high-speed-motion neutron radiographs for evaluation of the firing cycle of 7.62 mm munition rounds within a steel rifle barrel. The system has also been used to demonstrate the ability to produce neutron radiographic movies of two-phase flow. The equipment uses the Oregon State University TRIGA reactor capable of pulsing to 3000 MW peak power, a neutron beam collimator, a scintillator neutron conversion screen coupled to an image intensifier, and a 16 mm high speed movie camera. The peak neutron flux incident at the object position is approximately 4 x 10 11 n/cm 2 s with a pulse, full width at half maximum, of 9 ms. Special studies have been performed on the scintillator conversion screens and on the effects of statistical limitations on the image quality. Modulation transfer function analysis has been used to assist in the evaluation of the system performance
High frame-rate neutron radiography of dynamic events
International Nuclear Information System (INIS)
Bossi, R.H.; Robinson, A.H.; Barton, J.P.
1983-01-01
A system has been developed to perform neutron radiographic analysis of dynamic events having a duration of several milliseconds. The system has been operated in the range of 2000 to 10,000 frames/second. Synchronization has provided high-speed-motion neutron radiographs for evaluation of the firing cycle of 7.62 mm munition rounds within a steel rifle barrel. The system has also been used to demonstrate the ability to produce neutron radiographic movies of two phase flow. The equipment uses the Oregon State University TRIGA reactor capable of pulsing to 3000 MW peak power, a neutron beam collimator, a scintillator neutron conversion screen coupled to an image intensifier, and a 16 mm high speed movie camera. The peak neutron flux incident at the object position is approximately 4 x 10 11 n/cm 2 s with a pulse, full width at half maximum, of 9 ms. Special studies have been performed on the scintillator conversion screens and on the effects of statistical limitations on the image quality. Modulation transfer function analysis has been used to assist in the evaluation of the system performance. (Auth.)
Natural Variation in Synthesis and Catabolism Genes Influences Dhurrin Content in Sorghum
Directory of Open Access Journals (Sweden)
Chad M. Hayes
2015-07-01
Full Text Available Cyanogenic glucosides are natural compounds found in more than 1000 species of angiosperms that produce HCN and are deemed undesirable for agricultural use. However, these compounds are important components of the primary defensive mechanisms of many plant species. One of the best-studied cyanogenic glucosides is dhurrin [(--hydroxymandelonitrile-β--glucopyranoside], which is produced primarily in sorghum [ (L. Moench]. The biochemical basis for dhurrin metabolism is well established; however, little information is available on its genetic control. Here, we dissect the genetic control of leaf dhurrin content through a genome-wide association study (GWAS using a panel of 700 diverse converted sorghum lines (conversion panel previously subjected to pre-breeding and selected for short stature (∼1 m in height and photoperiod insensitivity. The conversion panel was grown for 2 yr in three environments. Wide variation for leaf dhurrin content was found in the sorghum conversion panel, with the Caudatum group exhibiting the highest dhurrin content and the Guinea group showing the lowest dhurrin content. A GWAS using a mixed linear model revealed significant associations (a false discovery rate [FDR] < 0.05 close to both UGT 185B1 in the canonical biosynthetic gene cluster on chromosome 1 and close to the catabolic dhurrinase loci on chromosome 8. Dhurrin content was associated consistently with biosynthetic genes in the two N-fertilized environments, while dhurrin content was associated with catabolic loci in the environment without supplemental N. These results suggest that genes for both biosynthesis and catabolism are important in determining natural variation for leaf dhurrin in sorghum in different environments.
Interrogative suggestibility in patients with conversion disorders.
Foong, J; Lucas, P A; Ron, M A
1997-09-01
We tested the hypothesis that increased interrogative suggestibility may contribute to the shaping and maintaining of conversions symptoms. Interrogative suggestibility was measured in 12 patients with conversion disorder and 10 control patients with confirmed neurological disease matched for age, premorbid intelligence, and as closely as possible in terms of their neurological symptoms to the patients with conversion disorder. Our observations do not support the contention that individual differences in interrogative suggestibility are of importance in the etiology of conversion disorders.
Conversion of Abbandoned Military Areas
Directory of Open Access Journals (Sweden)
Daiva Marcinkevičiūtė
2011-03-01
Full Text Available The article analyses the situation of abandoned military sites, their value and significance of their conservation. It also reviews their impact on their environment and their potential in tourism, environmental, economic and social spheres. Further the positive experiences in military sites' conversion are studied. The importance of society's involvement in the conversions is discussed. The situation of XIX-XX age's military object's, the significance of their conservation and their potential in tourism market is separately analysed. The results of two researches are introduced, one of which inquires about the Lithuanian military objects' potential in tourism sphere, another one explores the possibilities of conversion. Article in Lithuanian
Antecedents of hospital ownership conversions, mergers, and closures.
Sloan, Frank A; Ostermann, Jan; Conover, Christopher J
2003-01-01
This study assesses the determinants of conversions in hospital ownership from 1986 through 1996. To place such changes in context, we also analyze causes of hospital mergers and closures, which are often alternatives to hospital ownership conversion. A consistent result from our analysis is that an important antecedent of ownership conversions is a low profit margin. Conversions from private nonprofit or government ownership to for-profit status are preceded by chronically low margins and high debt-to-asset ratios. By contrast, conversions from for-profit ownership occur quickly following declines in margins. Many mergers seem motivated by a desire to increase market power--a consideration not evident for conversions.
On predictability of rare events leveraging social media: a machine learning perspective
Le, Lei; Ferrara, Emilio; Flammini, Alessandro
2015-01-01
Information extracted from social media streams has been leveraged to forecast the outcome of a large number of real-world events, from political elections to stock market fluctuations. An increasing amount of studies demonstrates how the analysis of social media conversations provides cheap access to the wisdom of the crowd. However, extents and contexts in which such forecasting power can be effectively leveraged are still unverified at least in a systematic way. It is also unclear how soci...
Wakao, Junko; Kishida, Tsunao; Fumino, Shigehisa; Kimura, Koseki; Yamamoto, Kenta; Kotani, Shin-Ichiro; Mizushima, Katsura; Naito, Yuji; Yoshikawa, Toshikazu; Tajiri, Tatsuro; Mazda, Osam
2017-06-24
The skeletal muscle consists of contractile myofibers and plays essential roles for maintenance of body posture, movement, and metabolic regulation. During the development and regeneration of the skeletal muscle tissue, the myoblasts fuse into multinucleated myotubes that subsequently form myofibers. Transplantation of myoblasts may make possible a novel regenerative therapy against defects or dysfunction of the skeletal muscle. It is reported that rodent fibroblasts are converted into myoblast-like cells and fuse to form syncytium after forced expression of exogenous myogenic differentiation 1 (MYOD1) that is a key transcription factor for myoblast differentiation. But human fibroblasts are less efficiently converted into myoblasts and rarely fused by MYOD1 alone. Here we found that transduction of v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog (MYCL) gene in combination with MYOD1 gene induced myoblast-like phenotypes in human fibroblasts more strongly than MYOD1 gene alone. The rate of conversion was approximately 90%. The directly converted myoblasts (dMBs) underwent fusion in an ERK5 pathway-dependent manner. The dMBs also formed myofiber-like structure in vivo after an inoculation into mice at the subcutaneous tissue. The present results strongly suggest that the combination of MYCL plus MYOD1 may promote direct conversion of human fibroblasts into functional myoblasts that could potentially be used for regenerative therapy for muscle diseases and congenital muscle defects. Copyright © 2017 Elsevier Inc. All rights reserved.
Mathematical Simulation of High-Conversion Binary Copolymerization
Institute of Scientific and Technical Information of China (English)
JiangWei; QinJiguang
2005-01-01
A new model for mathematical simulation of high-conversion binary copolymerization was established by combination of the concept of the three stage polymerization model (TSPM) proposed by Qin et al. for bulk free radical homopolymerization with the North equation to describe high-conversion copolymerization reaction exhibiting a strong gel effect, and the mathematical expressions of this new model were derived. Like TSPM, the new model also assmnes that the whole course of binary copolymerization can be divided into three different stages: low conversion, gel effect and glass effect stages. In addition, the reaction rate constants and the initiator efficiency at each copolymerization stage do not vary with conversion. Based on the expressions derived, a plot method for determining the overall rate constants and critical conversions was proposed. The literature data on conversion history for styrene (St)-methyl methacrylate (MMA) and ethylene glycol dimethacrylate (EGDMA)-MMA copolymerizations were treated to examine the model, which shows that the model is satisfactory.
Directory of Open Access Journals (Sweden)
Bruce janz
2016-12-01
Full Text Available I respond to Jonathan Chimakonam’s paper in which he presents an approach to dialogue in philosophical space, and raises questions about my own approach. I raise four questions to his understanding of conversation. First, I ask him for more details on his conception of conversation. Second, what happens if not everyone cares to enter into conversation? Third, is conversation a prerequisite to philosophy, or a part of philosophy? And fourth, how does wonder fit into conversation in and about place?
Perceived synchrony for realistic and dynamic audiovisual events.
Eg, Ragnhild; Behne, Dawn M
2015-01-01
In well-controlled laboratory experiments, researchers have found that humans can perceive delays between auditory and visual signals as short as 20 ms. Conversely, other experiments have shown that humans can tolerate audiovisual asynchrony that exceeds 200 ms. This seeming contradiction in human temporal sensitivity can be attributed to a number of factors such as experimental approaches and precedence of the asynchronous signals, along with the nature, duration, location, complexity and repetitiveness of the audiovisual stimuli, and even individual differences. In order to better understand how temporal integration of audiovisual events occurs in the real world, we need to close the gap between the experimental setting and the complex setting of everyday life. With this work, we aimed to contribute one brick to the bridge that will close this gap. We compared perceived synchrony for long-running and eventful audiovisual sequences to shorter sequences that contain a single audiovisual event, for three types of content: action, music, and speech. The resulting windows of temporal integration showed that participants were better at detecting asynchrony for the longer stimuli, possibly because the long-running sequences contain multiple corresponding events that offer audiovisual timing cues. Moreover, the points of subjective simultaneity differ between content types, suggesting that the nature of a visual scene could influence the temporal perception of events. An expected outcome from this type of experiment was the rich variation among participants' distributions and the derived points of subjective simultaneity. Hence, the designs of similar experiments call for more participants than traditional psychophysical studies. Heeding this caution, we conclude that existing theories on multisensory perception are ready to be tested on more natural and representative stimuli.
Mining Conversational Social Video
Biel, Joan-Isaac
2013-01-01
The ubiquity of social media in our daily life, the intense user participation, and the explo- sion of multimedia content have generated an extraordinary interest from computer and social scientists to investigate the traces left by users to understand human behavior online. From this perspective, YouTube can be seen as the largest collection of audiovisual human behavioral data, among which conversational video blogs (vlogs) are one of the basic formats. Conversational vlogs have evolved fro...
Photovoltaic solar energy conversion
Bauer, Gottfried H
2015-01-01
This concise primer on photovoltaic solar energy conversion invites readers to reflect on the conversion of solar light into energy at the most fundamental level and encourages newcomers to the field to help find meaningful answers on how photovoltaic solar energy conversion can work (better), eventually contributing to its ongoing advancement. The book is based on lectures given to graduate students in the Physics Department at the University of Oldenburg over the last two decades, yet also provides an easy-to-follow introduction for doctoral and postdoctoral students from related disciplines such as the materials sciences and electrical engineering. Inspired by classic textbooks in the field, it reflects the author’s own ideas on how to understand, visualize and eventually teach the microscopic physical mechanisms and effects, while keeping the text as concise as possible so as to introduce interested readers to the field and balancing essential knowledge with open questions.
An Overview of Biomolecular Event Extraction from Scientific Documents.
Vanegas, Jorge A; Matos, Sérgio; González, Fabio; Oliveira, José L
2015-01-01
This paper presents a review of state-of-the-art approaches to automatic extraction of biomolecular events from scientific texts. Events involving biomolecules such as genes, transcription factors, or enzymes, for example, have a central role in biological processes and functions and provide valuable information for describing physiological and pathogenesis mechanisms. Event extraction from biomedical literature has a broad range of applications, including support for information retrieval, knowledge summarization, and information extraction and discovery. However, automatic event extraction is a challenging task due to the ambiguity and diversity of natural language and higher-level linguistic phenomena, such as speculations and negations, which occur in biological texts and can lead to misunderstanding or incorrect interpretation. Many strategies have been proposed in the last decade, originating from different research areas such as natural language processing, machine learning, and statistics. This review summarizes the most representative approaches in biomolecular event extraction and presents an analysis of the current state of the art and of commonly used methods, features, and tools. Finally, current research trends and future perspectives are also discussed.
An Overview of Biomolecular Event Extraction from Scientific Documents
Directory of Open Access Journals (Sweden)
Jorge A. Vanegas
2015-01-01
Full Text Available This paper presents a review of state-of-the-art approaches to automatic extraction of biomolecular events from scientific texts. Events involving biomolecules such as genes, transcription factors, or enzymes, for example, have a central role in biological processes and functions and provide valuable information for describing physiological and pathogenesis mechanisms. Event extraction from biomedical literature has a broad range of applications, including support for information retrieval, knowledge summarization, and information extraction and discovery. However, automatic event extraction is a challenging task due to the ambiguity and diversity of natural language and higher-level linguistic phenomena, such as speculations and negations, which occur in biological texts and can lead to misunderstanding or incorrect interpretation. Many strategies have been proposed in the last decade, originating from different research areas such as natural language processing, machine learning, and statistics. This review summarizes the most representative approaches in biomolecular event extraction and presents an analysis of the current state of the art and of commonly used methods, features, and tools. Finally, current research trends and future perspectives are also discussed.
Amadasi, Sara; Holliday, Adrian
2018-01-01
In an interview with a postgraduate student about her intercultural experience of recently arriving for study abroad, it was found that the two researchers and the student were engaged in a mutual exploration of cultural identity. The interview events became conversational and took the form of small culture formation on the go in which each…
Experimental techniques of conversion coefficient measurements
International Nuclear Information System (INIS)
Hamilton, J.H.
1975-01-01
Discusses briefly the history of conversion electron spectra measurements, and the interpretation of the collected data. Then provides a comprehensive review of techniques presently available to measure the conversion coefficients. (Auth.)
Comparative Screening of Digestion Tract Toxic Genes in Proteus mirabilis.
Shi, Xiaolu; Lin, Yiman; Qiu, Yaqun; Li, Yinghui; Jiang, Min; Chen, Qiongcheng; Jiang, Yixiang; Yuan, Jianhui; Cao, Hong; Hu, Qinghua; Huang, Shenghe
2016-01-01
Proteus mirabilis is a common urinary tract pathogen, and may induce various inflammation symptoms. Its notorious ability to resist multiple antibiotics and to form urinary tract stones makes its treatment a long and painful process, which is further challenged by the frequent horizontal gene transferring events in P. mirabilis genomes. Three strains of P. mirabilis C02011/C04010/C04013 were isolated from a local outbreak of a food poisoning event in Shenzhen, China. Our hypothesis is that new genes may have been acquired horizontally to exert the digestion tract infection and toxicity. The functional characterization of these three genomes shows that each of them independently acquired dozens of virulent genes horizontally from the other microbial genomes. The representative strain C02011 induces the symptoms of both vomit and diarrhea, and has recently acquired a complete type IV secretion system and digestion tract toxic genes from the other bacteria.