WorldWideScience

Sample records for gene conversion events

  1. Gene conversion and reversion events in Saccharomyces cerevisiae. Model for study of gamma radiation damage

    International Nuclear Information System (INIS)

    Moreno, Damaris; Fuentes, Jorge L.; Prieto Miranda, Enrique F.; Sanchez Lamar, Angel; Baluja, Ligia

    2004-01-01

    Radiosensitivity and kinetics of induction of gene conversion and reversion events in Saccharomyces cerevisiae strain D7 to gamma radiation at dose ranges from 100 to 800 Gy and 50 to 300 Gy respectively were studied. A source of 60Co PX- -30 at a dose rate of 49,43 GY/min was utilized. The cell survival curve showed DL50 of 150 Gy. Cell death kinetics was linear and adjusted over 98 %. The induction of gene conversion events was significant in relation to control from 50 Gy on. However, gene reversion was significant only at 200 Gy. Generally speaking, gene conversion event frequencies were higher than those of reversion, which indicates that gamma radiation preferably induces recombinogenic events. Both the conversion and reversion events showed exponential dependence on gamma radiation dose. The relative benefits of this test for mutagenesis and anti-mutagenesis studies were debated in this paper

  2. Frequent gene conversion events between the X and Y homologous chromosomal regions in primates

    Directory of Open Access Journals (Sweden)

    Hirai Hirohisa

    2010-07-01

    Full Text Available Abstract Background Mammalian sex-chromosomes originated from a pair of autosomes. A step-wise cessation of recombination is necessary for the proper maintenance of sex-determination and, consequently, generates a four strata structure on the X chromosome. Each stratum shows a specific per-site nucleotide sequence difference (p-distance between the X and Y chromosomes, depending on the time of recombination arrest. Stratum 4 covers the distal half of the human X chromosome short arm and the p-distance of the stratum is ~10%, on average. However, a 100-kb region, which includes KALX and VCX, in the middle of stratum 4 shows a significantly lower p-distance (1-5%, suggesting frequent sequence exchanges or gene conversions between the X and Y chromosomes in humans. To examine the evolutionary mechanism for this low p-distance region, sequences of a corresponding region including KALX/Y from seven species of non-human primates were analyzed. Results Phylogenetic analysis of this low p-distance region in humans and non-human primate species revealed that gene conversion like events have taken place at least ten times after the divergence of New World monkeys and Catarrhini (i.e., Old World monkeys and hominoids. A KALY-converted KALX allele in white-handed gibbons also suggests a possible recent gene conversion between the X and Y chromosomes. In these primate sequences, the proximal boundary of this low p-distance region is located in a LINE element shared between the X and Y chromosomes, suggesting the involvement of this element in frequent gene conversions. Together with a palindrome on the Y chromosome, a segmental palindrome structure on the X chromosome at the distal boundary near VCX, in humans and chimpanzees, may mediate frequent sequence exchanges between X and Y chromosomes. Conclusion Gene conversion events between the X and Y homologous regions have been suggested, mainly in humans. Here, we found frequent gene conversions in the

  3. Gene conversion in the rice genome

    DEFF Research Database (Denmark)

    Xu, Shuqing; Clark, Terry; Zheng, Hongkun

    2008-01-01

    -chromosomal conversions distributed between chromosome 1 and 5, 2 and 6, and 3 and 5 are more frequent than genome average (Z-test, P ... is not tightly linked to natural selection in the rice genome. To assess the contribution of segmental duplication on gene conversion statistics, we determined locations of conversion partners with respect to inter-chromosomal segment duplication. The number of conversions associated with segmentation is less...... involved in conversion events. CONCLUSION: The evolution of gene families in the rice genome may have been accelerated by conversion with pseudogenes. Our analysis suggests a possible role for gene conversion in the evolution of pathogen-response genes....

  4. Mechanisms of Ectopic Gene Conversion

    Directory of Open Access Journals (Sweden)

    P.J. Hastings

    2010-11-01

    Full Text Available Gene conversion (conversion, the unidirectional transfer of DNA sequence information, occurs as a byproduct of recombinational repair of broken or damaged DNA molecules. Whereas excision repair processes replace damaged DNA by copying the complementary sequence from the undamaged strand of duplex DNA, recombinational mechanisms copy similar sequence, usually in another molecule, to replace the damaged sequence. In mitotic cells the other molecule is usually a sister chromatid, and the repair does not lead to genetic change. Less often a homologous chromosome or homologous sequence in an ectopic position is used. Conversion results from repair in two ways. First, if there was a double-strand gap at the site of a break, homologous sequence will be used as the template for synthesis to fill the gap, thus transferring sequence information in both strands. Second, recombinational repair uses complementary base pairing, and the heteroduplex molecule so formed is a source of conversion, both as heteroduplex and when donor (undamaged template information is retained after correction of mismatched bases in heteroduplex. There are mechanisms that favour the use of sister molecules that must fail before ectopic homology can be used. Meiotic recombination events lead to the formation of crossovers required in meiosis for orderly segregation of pairs of homologous chromosomes. These events result from recombinational repair of programmed double-strand breaks, but in contrast with mitotic recombination, meiotic recombinational events occur predominantly between homologous chromosomes, so that transfer of sequence differences by conversion is very frequent. Transient recombination events that do not form crossovers form both between homologous chromosomes and between regions of ectopic homology, and leave their mark in the occurrence of frequent non-crossover conversion, including ectopic conversion.

  5. Gene conversion events and variable degree of homogenization of rDNA loci in cultivars of Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Sochorova, Jana; Coriton, O.; Kuderová, Alena; Lunerová Bedřichová, Jana; Chevre, A.-M.; Kovařík, Aleš

    2017-01-01

    Roč. 119, č. 1 (2017), s. 13-26 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA13-10057S Institutional support: RVO:68081707 Keywords : ribosomal-rna genes * concerted evolution * intergenic spacer Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 4.041, year: 2016

  6. Life events and escape in conversion disorder.

    Science.gov (United States)

    Nicholson, T R; Aybek, S; Craig, T; Harris, T; Wojcik, W; David, A S; Kanaan, R A

    2016-09-01

    Psychological models of conversion disorder (CD) traditionally assume that psychosocial stressors are identifiable around symptom onset. In the face of limited supportive evidence such models are being challenged. Forty-three motor CD patients, 28 depression patients and 28 healthy controls were assessed using the Life Events and Difficulties Schedule in the year before symptom onset. A novel 'escape' rating for events was developed to test the Freudian theory that physical symptoms of CD could provide escape from stressors, a form of 'secondary gain'. CD patients had significantly more severe life events and 'escape' events than controls. In the month before symptom onset at least one severe event was identified in 56% of CD patients - significantly more than 21% of depression patients [odds ratio (OR) 4.63, 95% confidence interval (CI) 1.56-13.70] and healthy controls (OR 5.81, 95% CI 1.86-18.2). In the same time period 53% of CD patients had at least one 'high escape' event - again significantly higher than 14% in depression patients (OR 6.90, 95% CI 2.05-23.6) and 0% in healthy controls. Previous sexual abuse was more commonly reported in CD than controls, and in one third of female patients was contextually relevant to life events at symptom onset. The majority (88%) of life events of potential aetiological relevance were not identified by routine clinical assessments. Nine per cent of CD patients had no identifiable severe life events. Evidence was found supporting the psychological model of CD, the Freudian notion of escape and the potential aetiological relevance of childhood traumas in some patients. Uncovering stressors of potential aetiological relevance requires thorough psychosocial evaluation.

  7. Sexy gene conversions: locating gene conversions on the X-chromosome.

    Science.gov (United States)

    Lawson, Mark J; Zhang, Liqing

    2009-08-01

    Gene conversion can have a profound impact on both the short- and long-term evolution of genes and genomes. Here, we examined the gene families that are located on the X-chromosomes of human (Homo sapiens), chimpanzee (Pan troglodytes), mouse (Mus musculus) and rat (Rattus norvegicus) for evidence of gene conversion. We identified seven gene families (WD repeat protein family, Ferritin Heavy Chain family, RAS-related Protein RAB-40 family, Diphosphoinositol polyphosphate phosphohydrolase family, Transcription Elongation Factor A family, LDOC1-related family, Zinc Finger Protein ZIC, and GLI family) that show evidence of gene conversion. Through phylogenetic analyses and synteny evidence, we show that gene conversion has played an important role in the evolution of these gene families and that gene conversion has occurred independently in both primates and rodents. Comparing the results with those of two gene conversion prediction programs (GENECONV and Partimatrix), we found that both GENECONV and Partimatrix have very high false negative rates (i.e. failed to predict gene conversions), which leads to many undetected gene conversions. The combination of phylogenetic analyses with physical synteny evidence exhibits high resolution in the detection of gene conversions.

  8. DISRUPTIVE EVENT BIOSPHERE DOSE CONVERSION FACTOR ANALYSIS

    International Nuclear Information System (INIS)

    M.A. Wasiolek

    2005-01-01

    This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the total system performance assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the volcanic ash exposure scenario, and the development of dose factors for calculating inhalation dose during volcanic eruption. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA model. The Biosphere Model Report (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the Biosphere Model Report in Figure 1-1, contain detailed descriptions of the model input parameters, their development and the relationship between the parameters and specific features, events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the volcanic ash exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and from the five analyses that develop parameter values for the biosphere model (BSC 2005 [DIRS 172827]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; and BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis'' (Figure 1-1). The objective of this analysis was to develop the BDCFs for the volcanic

  9. Disruptive Event Biosphere Doser Conversion Factor Analysis

    Energy Technology Data Exchange (ETDEWEB)

    M. Wasiolek

    2000-12-28

    The purpose of this report was to document the process leading to, and the results of, development of radionuclide-, exposure scenario-, and ash thickness-specific Biosphere Dose Conversion Factors (BDCFs) for the postulated postclosure extrusive igneous event (volcanic eruption) at Yucca Mountain. BDCF calculations were done for seventeen radionuclides. The selection of radionuclides included those that may be significant dose contributors during the compliance period of up to 10,000 years, as well as radionuclides of importance for up to 1 million years postclosure. The approach documented in this report takes into account human exposure during three different phases at the time of, and after, volcanic eruption. Calculations of disruptive event BDCFs used the GENII-S computer code in a series of probabilistic realizations to propagate the uncertainties of input parameters into the output. The pathway analysis included consideration of different exposure pathway's contribution to the BDCFs. BDCFs for volcanic eruption, when combined with the concentration of radioactivity deposited by eruption on the soil surface, allow calculation of potential radiation doses to the receptor of interest. Calculation of radioactivity deposition is outside the scope of this report and so is the transport of contaminated ash from the volcano to the location of the receptor. The integration of the biosphere modeling results (BDCFs) with the outcomes of the other component models is accomplished in the Total System Performance Assessment (TSPA), in which doses are calculated to the receptor of interest from radionuclides postulated to be released to the environment from the potential repository at Yucca Mountain.

  10. Disruptive Event Biosphere Dose Conversion Factor Analysis

    Energy Technology Data Exchange (ETDEWEB)

    M. A. Wasiolek

    2003-07-21

    This analysis report, ''Disruptive Event Biosphere Dose Conversion Factor Analysis'', is one of the technical reports containing documentation of the ERMYN (Environmental Radiation Model for Yucca Mountain Nevada) biosphere model for the geologic repository at Yucca Mountain, its input parameters, and the application of the model to perform the dose assessment for the repository. The biosphere model is one of a series of process models supporting the Total System Performance Assessment (TSPA) for the Yucca Mountain repository. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of the two reports that develop biosphere dose conversion factors (BDCFs), which are input parameters for the TSPA model. The ''Biosphere Model Report'' (BSC 2003 [DIRS 164186]) describes in detail the conceptual model as well as the mathematical model and lists its input parameters. Model input parameters are developed and described in detail in five analysis report (BSC 2003 [DIRS 160964], BSC 2003 [DIRS 160965], BSC 2003 [DIRS 160976], BSC 2003 [DIRS 161239], and BSC 2003 [DIRS 161241]). The objective of this analysis was to develop the BDCFs for the volcanic ash exposure scenario and the dose factors (DFs) for calculating inhalation doses during volcanic eruption (eruption phase of the volcanic event). The volcanic ash exposure scenario is hereafter referred to as the volcanic ash scenario. For the volcanic ash scenario, the mode of radionuclide release into the biosphere is a volcanic eruption through the repository with the resulting entrainment of contaminated waste in the tephra and the subsequent atmospheric transport and dispersion of contaminated material in

  11. Disruptive Event Biosphere Dose Conversion Factor Analysis

    International Nuclear Information System (INIS)

    M. A. Wasiolek

    2003-01-01

    This analysis report, ''Disruptive Event Biosphere Dose Conversion Factor Analysis'', is one of the technical reports containing documentation of the ERMYN (Environmental Radiation Model for Yucca Mountain Nevada) biosphere model for the geologic repository at Yucca Mountain, its input parameters, and the application of the model to perform the dose assessment for the repository. The biosphere model is one of a series of process models supporting the Total System Performance Assessment (TSPA) for the Yucca Mountain repository. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of the two reports that develop biosphere dose conversion factors (BDCFs), which are input parameters for the TSPA model. The ''Biosphere Model Report'' (BSC 2003 [DIRS 164186]) describes in detail the conceptual model as well as the mathematical model and lists its input parameters. Model input parameters are developed and described in detail in five analysis report (BSC 2003 [DIRS 160964], BSC 2003 [DIRS 160965], BSC 2003 [DIRS 160976], BSC 2003 [DIRS 161239], and BSC 2003 [DIRS 161241]). The objective of this analysis was to develop the BDCFs for the volcanic ash exposure scenario and the dose factors (DFs) for calculating inhalation doses during volcanic eruption (eruption phase of the volcanic event). The volcanic ash exposure scenario is hereafter referred to as the volcanic ash scenario. For the volcanic ash scenario, the mode of radionuclide release into the biosphere is a volcanic eruption through the repository with the resulting entrainment of contaminated waste in the tephra and the subsequent atmospheric transport and dispersion of contaminated material in the biosphere. The biosphere process

  12. Disruptive Event Biosphere Dose Conversion Factor Analysis

    Energy Technology Data Exchange (ETDEWEB)

    M. Wasiolek

    2004-09-08

    This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the total system performance assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the volcanic ash exposure scenario, and the development of dose factors for calculating inhalation dose during volcanic eruption. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the Biosphere Model Report in Figure 1-1, contain detailed descriptions of the model input parameters, their development and the relationship between the parameters and specific features, events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the volcanic ash exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and from the five analyses that develop parameter values for the biosphere model (BSC 2004 [DIRS 169671]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; and BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis''. The objective of this

  13. Disruptive Event Biosphere Dose Conversion Factor Analysis

    International Nuclear Information System (INIS)

    M. Wasiolek

    2004-01-01

    This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the total system performance assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the volcanic ash exposure scenario, and the development of dose factors for calculating inhalation dose during volcanic eruption. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the Biosphere Model Report in Figure 1-1, contain detailed descriptions of the model input parameters, their development and the relationship between the parameters and specific features, events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the volcanic ash exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and from the five analyses that develop parameter values for the biosphere model (BSC 2004 [DIRS 169671]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; and BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis''. The objective of this analysis was to develop the BDCFs for the volcanic ash

  14. Differentially expressed genes in iron-induced prion protein conversion

    International Nuclear Information System (INIS)

    Kim, Minsun; Kim, Eun-hee; Choi, Bo-Ran; Woo, Hee-Jong

    2016-01-01

    The conversion of the cellular prion protein (PrP C ) to the protease-resistant isoform is the key event in chronic neurodegenerative diseases, including transmissible spongiform encephalopathies (TSEs). Increased iron in prion-related disease has been observed due to the prion protein-ferritin complex. Additionally, the accumulation and conversion of recombinant PrP (rPrP) is specifically derived from Fe(III) but not Fe(II). Fe(III)-mediated PK-resistant PrP (PrP res ) conversion occurs within a complex cellular environment rather than via direct contact between rPrP and Fe(III). In this study, differentially expressed genes correlated with prion degeneration by Fe(III) were identified using Affymetrix microarrays. Following Fe(III) treatment, 97 genes were differentially expressed, including 85 upregulated genes and 12 downregulated genes (≥1.5-fold change in expression). However, Fe(II) treatment produced moderate alterations in gene expression without inducing dramatic alterations in gene expression profiles. Moreover, functional grouping of identified genes indicated that the differentially regulated genes were highly associated with cell growth, cell maintenance, and intra- and extracellular transport. These findings showed that Fe(III) may influence the expression of genes involved in PrP folding by redox mechanisms. The identification of genes with altered expression patterns in neural cells may provide insights into PrP conversion mechanisms during the development and progression of prion-related diseases. - Highlights: • Differential genes correlated with prion degeneration by Fe(III) were identified. • Genes were identified in cell proliferation and intra- and extracellular transport. • In PrP degeneration, redox related genes were suggested. • Cbr2, Rsad2, Slc40a1, Amph and Mvd were expressed significantly.

  15. Prenatal diagnosis of the fragile X syndrome : loss of mutation owing to a double recombinant or gene conversion event at the FMR1 locus

    NARCIS (Netherlands)

    Losekoot, M; Hoogendoorn, E; Olmer, R; Jansen, CCAM; Oosterwijk, JC; vandenOuweland, AMW; Halley, DJJ; Warren, ST; Willemsen, R; Oostra, BA; Bakker, E

    1997-01-01

    The fragile X syndrome, an X linked mental retardation syndrome, is caused by an expanded CGG repeat in the first exon of the FMR1 gene. In patients with an expanded repeat the FMR1 promoter is methylated and, consequently, the gene is silenced and no FMR1 protein (FMRP) is produced, thus leading to

  16. Translational errors as an early event in prion conversion.

    Science.gov (United States)

    Hatin, I; Bidou, L; Cullin, C; Rousset, J P

    2001-01-01

    A prion is an infectious, altered form of a cellular protein which can self-propagate and affect normal phenotype. Prion conversion has been observed for mammalian and yeast proteins but molecular mechanisms that trigger this process remain unclear. Up to now, only post-translational models have been explored. In this work, we tested the hypothesis that co-translational events may be implicated in the conformation changes of the Ure2p protein of Saccharomyces cerevisiae. This protein can adopt a prion conformation leading to an [URE3] phenotype which can be easily assessed and quantified. We analyzed the effect of two antibiotics, known to affect translation, on [URE3] conversion frequency. For cells treated with G418 we observed a parallel increase of translational errors rate and frequency of [URE3] conversion. By contrast, cycloheximide which was not found to affect translational fidelity, has no influence on the induction of [URE3] phenotype. These results raise the possibility that the mechanism of prion conversion might not only involve alternative structures of strictly identical molecules but also aberrant proteins resulting from translational errors.

  17. Self-Exciting Point Process Modeling of Conversation Event Sequences

    Science.gov (United States)

    Masuda, Naoki; Takaguchi, Taro; Sato, Nobuo; Yano, Kazuo

    Self-exciting processes of Hawkes type have been used to model various phenomena including earthquakes, neural activities, and views of online videos. Studies of temporal networks have revealed that sequences of social interevent times for individuals are highly bursty. We examine some basic properties of event sequences generated by the Hawkes self-exciting process to show that it generates bursty interevent times for a wide parameter range. Then, we fit the model to the data of conversation sequences recorded in company offices in Japan. In this way, we can estimate relative magnitudes of the self excitement, its temporal decay, and the base event rate independent of the self excitation. These variables highly depend on individuals. We also point out that the Hawkes model has an important limitation that the correlation in the interevent times and the burstiness cannot be independently modulated.

  18. Analysis of 62 hybrid assembled human Y chromosomes exposes rapid structural changes and high rates of gene conversion

    DEFF Research Database (Denmark)

    Gonzalez-Izarzugaza, Jose Maria; Skov, Laurits; Maretty, Lasse

    2017-01-01

    with the chimpanzee Y chromosome. We analyzed 2.7 Mb of large inverted repeats (palindromes) for variation patterns among the two palindrome arms and identified 603 mutation and 416 gene conversions events. We find clear evidence for GC-biased gene conversion in the palindromes (and a balancing AT mutation bias...

  19. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  20. A strong deletion bias in nonallelic gene conversion.

    Directory of Open Access Journals (Sweden)

    Raquel Assis

    Full Text Available Gene conversion is the unidirectional transfer of genetic information between orthologous (allelic or paralogous (nonallelic genomic segments. Though a number of studies have examined nucleotide replacements, little is known about length difference mutations produced by gene conversion. Here, we investigate insertions and deletions produced by nonallelic gene conversion in 338 Drosophila and 10,149 primate paralogs. Using a direct phylogenetic approach, we identify 179 insertions and 614 deletions in Drosophila paralogs, and 132 insertions and 455 deletions in primate paralogs. Thus, nonallelic gene conversion is strongly deletion-biased in both lineages, with almost 3.5 times as many conversion-induced deletions as insertions. In primates, the deletion bias is considerably stronger for long indels and, in both lineages, the per-site rate of gene conversion is orders of magnitudes higher than that of ordinary mutation. Due to this high rate, deletion-biased nonallelic gene conversion plays a key role in genome size evolution, leading to the cooperative shrinkage and eventual disappearance of selectively neutral paralogs.

  1. Conversion of homothallic yeast to heterothallism trough HO gene disruption

    CSIR Research Space (South Africa)

    Van Zyl, WH

    1993-04-01

    Full Text Available A simple method was developed for the conversion of homothallic Saccharomyces cerevisiae yeaststrains to heterothallism through HO gene disruption. An integrative ho:: neo disrupted allele was constructed by cloning a dominant selectable marker...

  2. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Science.gov (United States)

    2010-01-01

    Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests

  3. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Directory of Open Access Journals (Sweden)

    Hao Weilong

    2010-12-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native

  4. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang

    2011-01-01

    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  5. Revertant mosaicism in epidermolysis bullosa caused by mitotic gene conversion

    NARCIS (Netherlands)

    Jonkman, MF; Scheffer, H; Stulp, R; Pas, HH; Nijenhuis, Albertine; Heeres, K; Owaribe, K; Pulkkinen, L; Uitto, J

    1997-01-01

    Mitotic gene conversion acting as reverse mutation has not been previously demonstrated in human. We report here that the revertant mosaicism of a compound heterozygous proband with an autosomal recessive genodermatosis, generalized atrophic benign epidermolysis bullosa, is caused by mitotic gene

  6. Gene conversion homogenizes the CMT1A paralogous repeats

    Directory of Open Access Journals (Sweden)

    Hurles Matthew E

    2001-12-01

    Full Text Available Abstract Background Non-allelic homologous recombination between paralogous repeats is increasingly being recognized as a major mechanism causing both pathogenic microdeletions and duplications, and structural polymorphism in the human genome. It has recently been shown empirically that gene conversion can homogenize such repeats, resulting in longer stretches of absolute identity that may increase the rate of non-allelic homologous recombination. Results Here, a statistical test to detect gene conversion between pairs of non-coding sequences is presented. It is shown that the 24 kb Charcot-Marie-Tooth type 1A paralogous repeats (CMT1A-REPs exhibit the imprint of gene conversion processes whilst control orthologous sequences do not. In addition, Monte Carlo simulations of the evolutionary divergence of the CMT1A-REPs, incorporating two alternative models for gene conversion, generate repeats that are statistically indistinguishable from the observed repeats. Bounds are placed on the rate of these conversion processes, with central values of 1.3 × 10-4 and 5.1 × 10-5 per generation for the alternative models. Conclusions This evidence presented here suggests that gene conversion may have played an important role in the evolution of the CMT1A-REP paralogous repeats. The rates of these processes are such that it is probable that homogenized CMT1A-REPs are polymorphic within modern populations. Gene conversion processes are similarly likely to play an important role in the evolution of other segmental duplications and may influence the rate of non-allelic homologous recombination between them.

  7. Computational challenges in modeling gene regulatory events.

    Science.gov (United States)

    Pataskar, Abhijeet; Tiwari, Vijay K

    2016-10-19

    Cellular transcriptional programs driven by genetic and epigenetic mechanisms could be better understood by integrating "omics" data and subsequently modeling the gene-regulatory events. Toward this end, computational biology should keep pace with evolving experimental procedures and data availability. This article gives an exemplified account of the current computational challenges in molecular biology.

  8. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  9. Absence of interference in association with gene conversion in Sordaria fimicola, and presence of interference in association with ordinary recombination.

    Science.gov (United States)

    Kitani, Y

    1978-07-01

    From the analysis of large samples of gene conversion asci in the g locus of Sordaria fimicola, it was found that neither the conversion event itself nor conversion-associated recombination of flanking markers cause either chiasma or chromatid interference with crossing over in a neighboring interval. The presence of more than one kind of crossover event, one causing interference the other not, is considered. The existence of two kinds of gene loci, one of single-cistron composition and the other of multiple-cistron composition, is discussed in relation to reciprocal recombination within a locus.

  10. Spontaneous and radiation induced gene conversion in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Rao, B.S.; Murthy, M.S.S.

    1977-01-01

    Spontaneous and radiation induced gene conversion to arginine independence was studied in a heteroallelic diploid strain of yeast Saccharomyces cerevisiae BZ 34. When stationary phase cells were incubated in phosphate buffer (pH 7 ) at 30 0 C under aerated condition for 48 hours, the conversion frequency increased by a factor of about 1000 times the background. This was found to be so even when the cells were incubated in saline (0.85%) or distilled water. Various conditions influencing this enhancement have been investigated. Conversion frequency enhancement was not significant under anoxic conditions and was absent at low temperatures and in log phase cells. Caffeine could inhibit this enhancement when present in the suspension medium. These results can be explained on the basis of the induction of meiosis in cells held in buffer. Microscopic examination confirmed this view. Under conditions not favourable for the onset of meiosis there is no significant enhancement in conversion frequency. In stationary phase cells exposed to series of gamma doses, the conversion frequency increases with dose. Post irradiation incubation in buffer further increases the conversion frequency. However, the increase expressed as the ratio of the conversion frequency on buffer holding to that on immediate plating decreased with increasing dose. This decrease in enhancement with increasing dose may be due to the dose dependent inhibition of meiosis. (author)

  11. Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution

    Energy Technology Data Exchange (ETDEWEB)

    Kass, D.H. [Louisiana State Univ. Medical Center, New Orleans, LA (United States). Dept. of Biochemistry and Molecular Biology; Batzer, M.A. [Lawrence Livermore National Lab., CA (United States); Deininger, P.L. [Louisiana State Univ. Medical Center, New Orleans, LA (United States). Dept. of Biochemistry and Molecular Biology]|[Alton Ochsner Medical Foundation, New Orleans, LA (United States). Lab. of Molecular Genetics

    1995-01-01

    The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome. However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.

  12. Diversification of the Primary Antibody Repertoire by AID-Mediated Gene Conversion.

    Science.gov (United States)

    Lanning, Dennis K; Knight, Katherine L

    2015-01-01

    Gene conversion, mediated by activation-induced cytidine deaminase (AID), has been found to contribute to generation of the primary antibody repertoire in several vertebrate species. Generation of the primary antibody repertoire by gene conversion of immunoglobulin (Ig) genes occurs primarily in gut-associated lymphoid tissues (GALT) and is best described in chicken and rabbit. Here, we discuss current knowledge of the mechanism of gene conversion as well as the contribution of the microbiota in promoting gene conversion of Ig genes. Finally, we propose that the antibody diversification strategy used in GALT species, such as chicken and rabbit, is conserved in a subset of human and mouse B cells.

  13. Gene genealogies indicates abundant gene conversions and independent evolutionary histories of the mating-type chromosomes in the evolutionary history of Neurospora tetrasperma

    Directory of Open Access Journals (Sweden)

    Whittle Carrie A

    2010-07-01

    Full Text Available Abstract Background The self-fertile filamentous ascomycete Neurospora tetrasperma contains a large (~7 Mbp and young (mat chromosomes. The objective of the present study is to reveal the evolutionary history, including key genomic events, associated with the various regions of the mat chromosomes among ten strains representing all the nine known species (lineages contained within the N. tetrasperma species complex. Results Comparative analysis of sequence divergence among alleles of 24 mat-linked genes (mat A and mat a indicates that a large region of suppressed recombination exists within the mat chromosome for each of nine lineages of N. tetrasperma sensu latu. The recombinationally suppressed region varies in size and gene composition among lineages, and is flanked on both ends by normally recombining regions. Genealogical analyses among lineages reveals that eight gene conversion events have occurred between homologous mat A and mat a-linked alleles of genes located within the region of restricted recombination during the evolutionary history of N. tetrasperma. Conclusions We conclude that the region of suppressed recombination in the mat chromosomes has likely been subjected to independent contraction and/or expansion during the evolutionary history of the N. tetrasperma species complex. Furthermore, we infer that gene conversion events are likely a common phenomenon within this recombinationally suppressed genomic region. We argue that gene conversions might provide an efficient mechanism of adaptive editing of functional genes, including the removal of deleterious mutations, within the young recombinationally suppressed region of the mat chromosomes.

  14. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  15. Gene conversion limits divergence of mammalian TLR1 and TLR6

    Directory of Open Access Journals (Sweden)

    Dunoyer-Geindre Sylvie

    2007-08-01

    Full Text Available Abstract Background Toll-like receptors (TLR recognize pathogen-associated molecular patterns and are important mediators of the innate immune system. TLR1 and TLR6 are paralogs and located in tandem on the same chromosome in mammals. They form heterodimers with TLR2 and bind lipopeptide components of gram-positive and gram-negative bacterial cell walls. To identify conserved stretches in TLR1 and TLR6, that may be important for their function, we compared their protein sequences in nine mammalian species(Homo sapiens, Pan troglodytes, Macaca mulatta, Mus musculus, Rattus norvegicus; Erinaceus europaeus, Bos Taurus, Sus scrofa and Canis familiaris. Results The N-terminal sequences of the orthologous proteins showed greater similarity than corresponding paralog sequences. However, we identified a region of 300 amino acids towards the C-terminus of TLR1 and TLR6, where paralogs had a greater degree of sequence identity than orthologs. Preservation of DNA sequence identity of paralogs in this region was observed in all nine mammalian species investigated, and is due to independent gene conversion events. The regions having undergone gene conversion in each species are almost identical and encode the leucine-rich repeat motifs 16 to 19, the C-terminal cap motif, the transmembrane domain and most of the intracellular Toll/interleukin-1 receptor (TIR domain. Conclusion Our results show that, for a specific conserved region, divergence of TLR1 and TLR6 is limited by gene conversion, most likely because of the need for co-evolution with multiple intracellular and extracellular binding partners. Thus, gene conversion provides a mechanism for limiting the divergence of functional regions of protein paralogs, while allowing other domains to evolve diversified functions.

  16. Gene conversion and DNA sequence polymorphism in the sex-determination gene fog-2 and its paralog ftr-1 in Caenorhabditis elegans.

    Science.gov (United States)

    Rane, Hallie S; Smith, Jessica M; Bergthorsson, Ulfar; Katju, Vaishali

    2010-07-01

    Gene conversion, a form of concerted evolution, bears enormous potential to shape the trajectory of sequence and functional divergence of gene paralogs subsequent to duplication events. fog-2, a sex-determination gene unique to Caenorhabditis elegans and implicated in the origin of hermaphroditism in this species, resulted from the duplication of ftr-1, an upstream gene of unknown function. Synonymous sequence divergence in regions of fog-2 and ftr-1 (excluding recent gene conversion tracts) suggests that the duplication occurred 46 million generations ago. Gene conversion between fog-2 and ftr-1 was previously discovered in experimental fog-2 knockout lines of C. elegans, whereby hermaphroditism was restored in mutant obligately outcrossing male-female populations. We analyzed DNA-sequence variation in fog-2 and ftr-1 within 40 isolates of C. elegans from diverse geographic locations in order to evaluate the contribution of gene conversion to genetic variation in the two gene paralogs. The analysis shows that gene conversion contributes significantly to DNA-sequence diversity in fog-2 and ftr-1 (22% and 34%, respectively) and may have the potential to alter sexual phenotypes in natural populations. A radical amino acid change in a conserved region of the F-box domain of fog-2 was found in natural isolates of C. elegans with significantly lower fecundity. We hypothesize that the lowered fecundity is due to reduced masculinization and less sperm production and that amino acid replacement substitutions and gene conversion in fog-2 may contribute significantly to variation in the degree of inbreeding and outcrossing in natural populations.

  17. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett

    2011-02-01

    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  18. Simulating the physiology of athletes during endurance sports events: modelling human energy conversion and metabolism

    NARCIS (Netherlands)

    van Beek, J.H.G.M.; Supandi, F.B.; Gavai, Anand; de Graaf, A.A.; Binsl, T.W.; Hettling, H.

    2011-01-01

    The human physiological system is stressed to its limits during endurance sports competition events.We describe a whole body computational model for energy conversion during bicycle racing. About 23 per cent of the metabolic energy is used for muscle work, the rest is converted to heat. We

  19. Simulating the physiology of athletes during endurance sports events: Modelling human energy conversion and metabolism

    NARCIS (Netherlands)

    Beek, J.H.G.M. van; Supandi, F.; Gavai, A.K.; Graaf, A.A. de; Binsl, T.W.; Hettling, H.

    2011-01-01

    The human physiological system is stressed to its limits during endurance sports competition events.We describe a whole body computational model for energy conversion during bicycle racing. About 23 per cent of the metabolic energy is used for muscle work, the rest is converted to heat. We

  20. Analysis of 62 hybrid assembled human Y chromosomes exposes rapid structural changes and high rates of gene conversion.

    Directory of Open Access Journals (Sweden)

    Laurits Skov

    2017-08-01

    Full Text Available The human Y-chromosome does not recombine across its male-specific part and is therefore an excellent marker of human migrations. It also plays an important role in male fertility. However, its evolution is difficult to fully understand because of repetitive sequences, inverted repeats and the potentially large role of gene conversion. Here we perform an evolutionary analysis of 62 Y-chromosomes of Danish descent sequenced using a wide range of library insert sizes and high coverage, thus allowing large regions of these chromosomes to be well assembled. These include 17 father-son pairs, which we use to validate variation calling. Using a recent method that can integrate variants based on both mapping and de novo assembly, we genotype 10898 SNVs and 2903 indels (max length of 27241 bp in our sample and show by father-son concordance and experimental validation that the non-recurrent SNP and indel variation on the Y chromosome tree is called very accurately. This includes variation called in a 0.9 Mb centromeric heterochromatic region, which is by far the most variable in the Y chromosome. Among the variation is also longer sequence-stretches not present in the reference genome but shared with the chimpanzee Y chromosome. We analyzed 2.7 Mb of large inverted repeats (palindromes for variation patterns among the two palindrome arms and identified 603 mutation and 416 gene conversions events. We find clear evidence for GC-biased gene conversion in the palindromes (and a balancing AT mutation bias, but irrespective of this, also a strong bias towards gene conversion towards the ancestral state, suggesting that palindromic gene conversion may alleviate Muller's ratchet. Finally, we also find a large number of large-scale gene duplications and deletions in the palindromic regions (at least 24 and find that such events can consist of complex combinations of simultaneous insertions and deletions of long stretches of the Y chromosome.

  1. Genetic variation of the Borrelia burgdorferi gene vlsE involves cassette-specific, segmental gene conversion.

    Science.gov (United States)

    Zhang, J R; Norris, S J

    1998-08-01

    The Lyme disease spirochete Borrelia burgdorferi possesses 15 silent vls cassettes and a vls expression site (vlsE) encoding a surface-exposed lipoprotein. Segments of the silent vls cassettes have been shown to recombine with the vlsE cassette region in the mammalian host, resulting in combinatorial antigenic variation. Despite promiscuous recombination within the vlsE cassette region, the 5' and 3' coding sequences of vlsE that flank the cassette region are not subject to sequence variation during these recombination events. The segments of the silent vls cassettes recombine in the vlsE cassette region through a unidirectional process such that the sequence and organization of the silent vls loci are not affected. As a result of recombination, the previously expressed segments are replaced by incoming segments and apparently degraded. These results provide evidence for a gene conversion mechanism in VlsE antigenic variation.

  2. Distinct modulation of event-related potentials during motor preparation in patients with motor conversion disorder.

    Directory of Open Access Journals (Sweden)

    Rebekah L Blakemore

    Full Text Available OBJECTIVE: Conversion paresis patients and healthy people feigning weakness both exhibit weak voluntary movement without detectable neuropathology. Uniquely, conversion patients lack a sense of conscious awareness of the origin of their impairment. We investigated whether conversion paresis patients show distinct electroencephalographic (EEG markers associated with their unconscious movement deficits. METHODS: Six unilateral upper limb conversion paresis patients, 12 feigning participants asked to mimic weakness and 12 control participants performed a precued reaction time task, requiring movements of either hand, depending on precue information. Performance measures (force, reaction and movement time, and event-related EEG potentials (ERP were compared, between groups and across hands or hemisphere, using linear mixed models. RESULTS: Feigners generated the same inter-hand difference in reaction and movement time as expressed by patients, even though no specific targets were set nor feedback given on these measures. We found novel ERP signatures specific to patients. When the symptomatic hand was precued, the P3 ERP component accompanying the precue was dramatically larger in patients than in feigning participants. Additionally, in patients the earlier N1 ERP component was diminished when the precue signalled either the symptomatic or asymptomatic hand. CONCLUSIONS: These results are consistent with previous suggestions that lack of awareness of the origin of their symptoms in conversion disorder patients may result from suppression of brain activity normally related to self-agency. In patients the diminished N1 to all precues is consistent with a generalised reduction in cognitive processing of movement-related precues. The P3 enhancement in patients is unlikely to simply reflect changes required for generation of impaired movements, because it was not seen in feigners showing the same behavioural deficits. Rather, this P3 enhancement in

  3. Coevolution of Siglec-11 and Siglec-16 via gene conversion in primates.

    Science.gov (United States)

    Hayakawa, Toshiyuki; Khedri, Zahra; Schwarz, Flavio; Landig, Corinna; Liang, Suh-Yuen; Yu, Hai; Chen, Xi; Fujito, Naoko T; Satta, Yoko; Varki, Ajit; Angata, Takashi

    2017-11-23

    Siglecs-11 and -16 are members of the sialic acid recognizing Ig-like lectin family, and expressed in same cells. Siglec-11 functions as an inhibitory receptor, whereas Siglec-16 exhibits activating properties. In humans, SIGLEC11 and SIGLEC16 gene sequences are extremely similar in the region encoding the extracellular domain due to gene conversions. Human SIGLEC11 was converted by the nonfunctional SIGLEC16P allele, and the converted SIGLEC11 allele became fixed in humans, possibly because it provides novel neuroprotective functions in brain microglia. However, the detailed evolutionary history of SIGLEC11 and SIGLEC16 in other primates remains unclear. We analyzed SIGLEC11 and SIGLEC16 gene sequences of multiple primate species, and examined glycan binding profiles of these Siglecs. The phylogenetic tree demonstrated that gene conversions between SIGLEC11 and SIGLEC16 occurred in the region including the exon encoding the sialic acid binding domain in every primate examined. Functional assays showed that glycan binding preference is similar between Siglec-11 and Siglec-16 in all analyzed hominid species. Taken together with the fact that Siglec-11 and Siglec-16 are expressed in the same cells, Siglec-11 and Siglec-16 are regarded as paired receptors that have maintained similar ligand binding preferences via gene conversions. Relaxed functional constraints were detected on the SIGLEC11 and SIGLEC16 exons that underwent gene conversions, possibly contributing to the evolutionary acceptance of repeated gene conversions. The frequency of nonfunctional SIGLEC16P alleles is much higher than that of SIGLEC16 alleles in every human population. Our findings indicate that Siglec-11 and Siglec-16 have been maintained as paired receptors by repeated gene conversions under relaxed functional constraints in the primate lineage. The high prevalence of the nonfunctional SIGLEC16P allele and the fixation of the converted SIGLEC11 imply that the loss of Siglec-16 and the gain of

  4. Conversion of Continuous-Valued Deep Networks to Efficient Event-Driven Networks for Image Classification.

    Science.gov (United States)

    Rueckauer, Bodo; Lungu, Iulia-Alexandra; Hu, Yuhuang; Pfeiffer, Michael; Liu, Shih-Chii

    2017-01-01

    Spiking neural networks (SNNs) can potentially offer an efficient way of doing inference because the neurons in the networks are sparsely activated and computations are event-driven. Previous work showed that simple continuous-valued deep Convolutional Neural Networks (CNNs) can be converted into accurate spiking equivalents. These networks did not include certain common operations such as max-pooling, softmax, batch-normalization and Inception-modules. This paper presents spiking equivalents of these operations therefore allowing conversion of nearly arbitrary CNN architectures. We show conversion of popular CNN architectures, including VGG-16 and Inception-v3, into SNNs that produce the best results reported to date on MNIST, CIFAR-10 and the challenging ImageNet dataset. SNNs can trade off classification error rate against the number of available operations whereas deep continuous-valued neural networks require a fixed number of operations to achieve their classification error rate. From the examples of LeNet for MNIST and BinaryNet for CIFAR-10, we show that with an increase in error rate of a few percentage points, the SNNs can achieve more than 2x reductions in operations compared to the original CNNs. This highlights the potential of SNNs in particular when deployed on power-efficient neuromorphic spiking neuron chips, for use in embedded applications.

  5. Conversion of Continuous-Valued Deep Networks to Efficient Event-Driven Networks for Image Classification

    Directory of Open Access Journals (Sweden)

    Bodo Rueckauer

    2017-12-01

    Full Text Available Spiking neural networks (SNNs can potentially offer an efficient way of doing inference because the neurons in the networks are sparsely activated and computations are event-driven. Previous work showed that simple continuous-valued deep Convolutional Neural Networks (CNNs can be converted into accurate spiking equivalents. These networks did not include certain common operations such as max-pooling, softmax, batch-normalization and Inception-modules. This paper presents spiking equivalents of these operations therefore allowing conversion of nearly arbitrary CNN architectures. We show conversion of popular CNN architectures, including VGG-16 and Inception-v3, into SNNs that produce the best results reported to date on MNIST, CIFAR-10 and the challenging ImageNet dataset. SNNs can trade off classification error rate against the number of available operations whereas deep continuous-valued neural networks require a fixed number of operations to achieve their classification error rate. From the examples of LeNet for MNIST and BinaryNet for CIFAR-10, we show that with an increase in error rate of a few percentage points, the SNNs can achieve more than 2x reductions in operations compared to the original CNNs. This highlights the potential of SNNs in particular when deployed on power-efficient neuromorphic spiking neuron chips, for use in embedded applications.

  6. Meiotic gene-conversion rate and tract length variation in the human genome.

    Science.gov (United States)

    Padhukasahasram, Badri; Rannala, Bruce

    2013-02-27

    Meiotic recombination occurs in the form of two different mechanisms called crossing-over and gene-conversion and both processes have an important role in shaping genetic variation in populations. Although variation in crossing-over rates has been studied extensively using sperm-typing experiments, pedigree studies and population genetic approaches, our knowledge of variation in gene-conversion parameters (ie, rates and mean tract lengths) remains far from complete. To explore variability in population gene-conversion rates and its relationship to crossing-over rate variation patterns, we have developed and validated using coalescent simulations a comprehensive Bayesian full-likelihood method that can jointly infer crossing-over and gene-conversion rates as well as tract lengths from population genomic data under general variable rate models with recombination hotspots. Here, we apply this new method to SNP data from multiple human populations and attempt to characterize for the first time the fine-scale variation in gene-conversion parameters along the human genome. We find that the estimated ratio of gene-conversion to crossing-over rates varies considerably across genomic regions as well as between populations. However, there is a great degree of uncertainty associated with such estimates. We also find substantial evidence for variation in the mean conversion tract length. The estimated tract lengths did not show any negative relationship with the local heterozygosity levels in our analysis.European Journal of Human Genetics advance online publication, 27 February 2013; doi:10.1038/ejhg.2013.30.

  7. 1000 human genomes carry widespread signatures of GC biased gene conversion.

    Science.gov (United States)

    Dutta, Rajib; Saha-Mandal, Arnab; Cheng, Xi; Qiu, Shuhao; Serpen, Jasmine; Fedorova, Larisa; Fedorov, Alexei

    2018-04-16

    GC-Biased Gene Conversion (gBGC) is one of the important theories put forward to explain profound long-range non-randomness in nucleotide compositions along mammalian chromosomes. Nucleotide changes due to gBGC are hard to distinguish from regular mutations. Here, we present an algorithm for analysis of millions of known SNPs that detects a subset of so-called "SNP flip-over" events representing recent gBGC nucleotide changes, which occurred in previous generations via non-crossover meiotic recombination. This algorithm has been applied in a large-scale analysis of 1092 sequenced human genomes. Altogether, 56,328 regions on all autosomes have been examined, which revealed 223,955 putative gBGC cases leading to SNP flip-overs. We detected a strong bias (11.7% ± 0.2% excess) in AT- > GC over GC- > AT base pair changes within the entire set of putative gBGC cases. On average, a human gamete acquires 7 SNP flip-over events, in which one allele is replaced by its complementary allele during the process of meiotic non-crossover recombination. In each meiosis event, on average, gBGC results in replacement of 7 AT base pairs by GC base pairs, while only 6 GC pairs are replaced by AT pairs. Therefore, every human gamete is enriched by one GC pair. Happening over millions of years of evolution, this bias may be a noticeable force in changing the nucleotide composition landscape along chromosomes.

  8. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Evidence for somatic gene conversion and deletion in bipolar disorder, Crohn's disease, coronary artery disease, hypertension, rheumatoid arthritis, type-1 diabetes, and type-2 diabetes

    Directory of Open Access Journals (Sweden)

    Ross Kenneth

    2011-02-01

    Full Text Available Abstract Background During gene conversion, genetic information is transferred unidirectionally between highly homologous but non-allelic regions of DNA. While germ-line gene conversion has been implicated in the pathogenesis of some diseases, somatic gene conversion has remained technically difficult to investigate on a large scale. Methods A novel analysis technique is proposed for detecting the signature of somatic gene conversion from SNP microarray data. The Wellcome Trust Case Control Consortium has gathered SNP microarray data for two control populations and cohorts for bipolar disorder (BD, cardiovascular disease (CAD, Crohn's disease (CD, hypertension (HT, rheumatoid arthritis (RA, type-1 diabetes (T1D and type-2 diabetes (T2D. Using the new analysis technique, the seven disease cohorts are analyzed to identify cohort-specific SNPs at which conversion is predicted. The quality of the predictions is assessed by identifying known disease associations for genes in the homologous duplicons, and comparing the frequency of such associations with background rates. Results Of 28 disease/locus pairs meeting stringent conditions, 22 show various degrees of disease association, compared with only 8 of 70 in a mock study designed to measure the background association rate (P -9. Additional candidate genes are identified using less stringent filtering conditions. In some cases, somatic deletions appear likely. RA has a distinctive pattern of events relative to other diseases. Similarities in patterns are apparent between BD and HT. Conclusions The associations derived represent the first evidence that somatic gene conversion could be a significant causative factor in each of the seven diseases. The specific genes provide potential insights about disease mechanisms, and are strong candidates for further study. Please see Commentary: http://www.biomedcentral.com/1741-7015/9/13/abstract.

  10. DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.

    Directory of Open Access Journals (Sweden)

    Adam J L Cook

    2007-04-01

    Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.

  11. Alteration of gene conversion patterns in Sordaria fimicola by supplementation with DNA bases.

    Science.gov (United States)

    Kitani, Y; Olive, L S

    1970-08-01

    Supplementation with DNA bases in crosses of Sordaria fimicola heterozygous for spore color markers (g(1), h(2)) within the gray-spore (g) locus has been found to cause significant alterations in patterns of gene conversion at the two mutant sites. Each base had its own characteristic effect in altering the conversion pattern, and responses of the two mutant sites to the four bases were different in several ways. Also, the responses of the two involved chromatids of the meiotic bivalent were different.

  12. Caffeine inhibits gene conversion by displacing Rad51 from ssDNA

    Science.gov (United States)

    Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.

    2015-01-01

    Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181

  13. Gene conversion of ribosomal DNA in Nicotiana tabacum is associated with undermethylated, decondensed and probably active gene units.

    Science.gov (United States)

    Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R

    2000-06-01

    We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N

  14. The conversion of fibrinogen to fibrin: A brief history of some key events.

    Science.gov (United States)

    Doolittle, Russell F

    2017-07-01

    The conversion of fibrinogen to fibrin is a process that has long fascinated an army of researchers. In this brief review some early break-through observations are noted and a few later unexpected results described. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Suppression of Tla1 gene expression for improved solar conversion efficiency and photosynthetic productivity in plants and algae

    Science.gov (United States)

    Melis, Anastasios; Mitra, Mautusi

    2010-06-29

    The invention provides method and compositions to minimize the chlorophyll antenna size of photosynthesis by decreasing TLA1 gene expression, thereby improving solar conversion efficiencies and photosynthetic productivity in plants, e.g., green microalgae, under bright sunlight conditions.

  16. Effect of methyl-β-cyclodextrin on gene expression in microbial conversion of phytosterol.

    Science.gov (United States)

    Shtratnikova, Victoria Y; Schelkunov, Mikhail I; Dovbnya, Dmitry V; Bragin, Eugeny Y; Donova, Marina V

    2017-06-01

    Modified β-cyclodextrins are widely used for the enhancement of microbial conversions of lipophilic compounds such as steroids. Multiple mechanisms of cyclodextrin-mediated enhancement of phytosterol bioconversion by mycobacteria had previously been shown to include steroid solubilization, alterations in the cell wall permeability for both steroids and nutrients, facilitation of protein leaking, and activity suppression of some steroid-transforming enzymes.In this work, we studied whether cyclodextrins might affect expression of the genes involved in the steroid catabolic pathway. Phytosterol bioconversion with 9α-hydroxy-androst-4-ene-3,17-dione accumulation by Mycobacterium sp. VKM Ac-1817D in the presence of methylated β-cyclodextrin (MCD) was investigated. RNA sequencing of the whole transcriptomes in different combinations of phytosterol and MCD showed a similar expression level of the steroid catabolism genes related to the KstR-regulon and was responsible for side chain and initial steps of steroid core oxidation; whereas, induction levels of the genes related to the KstR2-regulon were attenuated in the presence of MCD in this strain. The data were attenuated with quantitative real-time PCR.The results contribute to the understanding of cyclodextrin effects on microbial steroid conversion and provide a basis for the use of cyclodextrins as expression enhancers for studies of sterol catabolism in actinobacteria.

  17. γ-ray telescopes using conversions to e+e- pairs: event generators, angular resolution and polarimetry

    Science.gov (United States)

    Gros, P.; Bernard, D.

    2017-02-01

    We benchmark various available event generators in Geant4 and EGS5 in the light of ongoing projects for high angular-resolution pair-conversion telescopes at low energy. We compare the distributions of key kinematic variables extracted from the geometry of the three final state particles. We validate and use as reference an exact generator using the full 5D differential cross-section of the conversion process. We focus in particular on the effect of the unmeasured recoiling nucleus on the angular resolution. We show that for high resolution trackers, the choice of the generator affects the estimated resolution of the telescope. We also show that the current available generator are unable to describe accurately a linearly polarised photon source.

  18. Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

    Science.gov (United States)

    Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

    2017-04-01

    There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

  19. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  20. Novel biallelic mutations in MSH6 and PMS2 genes: gene conversion as a likely cause of PMS2 gene inactivation.

    Science.gov (United States)

    Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing

    2007-11-01

    Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.

  1. Characterization of a rabbit germ-line VH gene that is a candidate donor for VH gene conversion in mutant Alicia rabbits.

    Science.gov (United States)

    Chen, H T; Alexander, C B; Mage, R G

    1995-06-15

    Normal rabbits preferentially rearrange the 3'-most VH gene, VH1, to encode Igs with VHa allotypes, which constitute the majority of rabbit serum Igs. A gene conversion-like mechanism is employed to diversify the primary Ab repertoire. In mutant Alicia rabbits that derived from a rabbit with VHa2 allotype, the VH1 gene was deleted. Our previous studies showed that the first functional gene (VH4) or VH4-like genes were rearranged in 2- to 8-wk-old homozygous Alicia. The VH1a2-like sequences that were found in splenic mRNA from 6-wk and older Alicia rabbits still had some residues that were typical of VH4. The appearances of sequences resembling that of VH1a2 may have been caused by gene conversions that altered the sequences of the rearranged VH or there may have been rearrangement of upstream VH1a2-like genes later in development. To investigate this further, we constructed a cosmid library and isolated a VH1a2-like gene, VH12-1-6, with a sequence almost identical to VH1a2. This gene had a deleted base in the heptamer of its recombination signal sequence. However, even if this defect diminished or eliminated its ability to rearrange, the a2-like gene could have acted as a donor for gene-conversion-like alteration of rearranged VH genes. Sequence comparisons suggested that this gene or a gene like it could have acted as a donor for gene conversion in mutant Alicia and in normal rabbits.

  2. Early events in the evolution of spider silk genes.

    Directory of Open Access Journals (Sweden)

    James Starrett

    Full Text Available Silk spinning is essential to spider ecology and has had a key role in the expansive diversification of spiders. Silk is composed primarily of proteins called spidroins, which are encoded by a multi-gene family. Spidroins have been studied extensively in the derived clade, Orbiculariae (orb-weavers, from the suborder Araneomorphae ('true spiders'. Orbicularians produce a suite of different silks, and underlying this repertoire is a history of duplication and spidroin gene divergence. A second class of silk proteins, Egg Case Proteins (ECPs, is known only from the orbicularian species, Lactrodectus hesperus (Western black widow. In L. hesperus, ECPs bond with tubuliform spidroins to form egg case silk fibers. Because most of the phylogenetic diversity of spiders has not been sampled for their silk genes, there is limited understanding of spidroin gene family history and the prevalence of ECPs. Silk genes have not been reported from the suborder Mesothelae (segmented spiders, which diverged from all other spiders >380 million years ago, and sampling from Mygalomorphae (tarantulas, trapdoor spiders and basal araneomorph lineages is sparse. In comparison to orbicularians, mesotheles and mygalomorphs have a simpler silk biology and thus are hypothesized to have less diversity of silk genes. Here, we present cDNAs synthesized from the silk glands of six mygalomorph species, a mesothele, and a non-orbicularian araneomorph, and uncover a surprisingly rich silk gene diversity. In particular, we find ECP homologs in the mesothele, suggesting that ECPs were present in the common ancestor of extant spiders, and originally were not specialized to complex with tubuliform spidroins. Furthermore, gene-tree/species-tree reconciliation analysis reveals that numerous spidroin gene duplications occurred after the split between Mesothelae and Opisthothelae (Mygalomorphae plus Araneomorphae. We use the spidroin gene tree to reconstruct the evolution of amino acid

  3. Studies on the induction of mitotic gene conversion by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ito, T.; Kobayashi, K.

    1975-01-01

    Action spectra for the induction of intragenic mitotic recombination (gene conversion) at the trp 5 locus by UV are presented for three cell stages (T 0 , T 9 and T 16 ) taken from synchronously growing cultures of Saccharomyces cerevisiae. The spectra over the range from 230 to 300 nm were taken mostly in 5-nm steps. The peak in the action spectra was significantly shifted, regardless of the stage, towards the longer wavelengths as compared with that of the absorption spectrum of DNA (258nm) or even that of thymine (265nm). In one extreme case ( 16 ), the peak was shifted 17nm from the absorption peak of DNA. Further, the spectrum changed its shape as the cell stage advanced from the non-dividing (unbudded) (T 0 ) to a dividing phase (T 16 ). Furthermore, the induction cross section decreased by a large factor (about 40), regardless of the wavelength, in going from the non-dividing to a dividing phase. From observations of the high photoreversibility of induced conversions, the major primary damage was thought to be pyrimidine dimers in the DNA

  4. Escape Excel: A tool for preventing gene symbol and accession conversion errors.

    Science.gov (United States)

    Welsh, Eric A; Stewart, Paul A; Kuenzi, Brent M; Eschrich, James A

    2017-01-01

    Microsoft Excel automatically converts certain gene symbols, database accessions, and other alphanumeric text into dates, scientific notation, and other numerical representations. These conversions lead to subsequent, irreversible, corruption of the imported text. A recent survey of popular genomic literature estimates that one-fifth of all papers with supplementary gene lists suffer from this issue. Here, we present an open-source tool, Escape Excel, which prevents these erroneous conversions by generating an escaped text file that can be safely imported into Excel. Escape Excel is implemented in a variety of formats (http://www.github.com/pstew/escape_excel), including a command line based Perl script, a Windows-only Excel Add-In, an OS X drag-and-drop application, a simple web-server, and as a Galaxy web environment interface. Test server implementations are accessible as a Galaxy interface (http://apostl.moffitt.org) and simple non-Galaxy web server (http://apostl.moffitt.org:8000/). Escape Excel detects and escapes a wide variety of problematic text strings so that they are not erroneously converted into other representations upon importation into Excel. Examples of problematic strings include date-like strings, time-like strings, leading zeroes in front of numbers, and long numeric and alphanumeric identifiers that should not be automatically converted into scientific notation. It is hoped that greater awareness of these potential data corruption issues, together with diligent escaping of text files prior to importation into Excel, will help to reduce the amount of Excel-corrupted data in scientific analyses and publications.

  5. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events

    Directory of Open Access Journals (Sweden)

    Tigst Demeke

    2018-05-01

    Full Text Available Droplet digital PCR (ddPCR has been used for absolute quantification of genetically engineered (GE events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences (HMG-I/Y, FatA(A, CruA and Ccf for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A, reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes. Keywords: Canola, Digital PCR, DNA extraction, GMO, Reference genes

  6. Different test systems in Aspergillus nidulans for the evaluation of mitotic gene conversion, crossing-over and non-disjunction

    International Nuclear Information System (INIS)

    De Bertoldi, M.; Griselli, M.; Consiglio Nazionale delle Ricerche, Pisa; Barale, R.

    1980-01-01

    The wide variety of the genetic alterations produced by environmental mutagens has increased the necessity of using experimental microorganisms to reveal the induction of such genetic events with short-term tests. Aspergillus nidulans, because of its well-developed genetic system and the availability of morphological markers seay to score, can be profitably used in mutagen testing. The constitution of particular diploid strains of A. nidulans able to detect the induction of mitotic gene conversion, mitotic crossing-over and mitotic non-disjunction with selective procedures are described and validated with standard mutagens: methyl methanesulphonate and UV radiation (lacking a specific genetic activity), benomyl and p-fluorophenylalanine (with a specific genetic activity). The possibility of using mammalian metabolic activation of promutagens in A. nidulans in vitro was tested with cyclophosphamide, with positive results in all the tested genetic systems. A method that increases the sensitivity of conidia to mutagenic treatments is described; its application appeared to be particularly useful in experiments on crossing-over and non-disjunction. (orig.)

  7. Gene conversion is strongly induced in human cells by double-strand breaks and is modulated by the expression of BCL-XL

    International Nuclear Information System (INIS)

    Wiese, Claudia; Pierce, Andrew J.; Gauny, Stacey S.; Jasin, Maria; Kronenberg, Amy

    2001-01-01

    Homology-directed repair (HDR) of DNA double-strand breaks (DSBs) is a well-established mechanism that contributes to the maintenance of genomic stability in rodent cells, and it has been assumed that HDR is of similar importance in the repair of DSBs in human cells. However, in addition to promoting genomic stability, some outcomes of homologous recombination can be deleterious, suggesting that factors exist to regulate HDR. We previously demonstrated that overexpression of BCL-2 or BCL-xL enhanced the frequency of x-ray-induced mutations involving the TK1 locus, including loss of heterozygosity (LOH) events presumed to arise by mitotic recombination. The present study was designed to test whether HDR is a prominent DSB repair pathway in human cells, and to directly determine whether ectopic expression of BCL-xL affects HDR. We used the B-lymphoblastoid cell line TK6, which expresses wild-type TP53 and resembles normal lymphocytes in undergoing apoptosis following genotoxic stress. U sing isogenic derivatives of TK6 cells (TK6-neo, TK6-bcl-xL), we find that a DSB in an integrated HDR reporter stimulates gene conversion 40-50-fold in TK6-neo cells, demonstrating that a DSB can be efficiently repaired by gene conversion in human cells. Significantly, DSB-induced gene conversion events are 3- to 4-fold more frequent in BCL-xL overexpressing cells. The results demonstrate that HDR plays an important role in maintaining genomic integrity in human cells and that ectopic expression of BCL-xL enhances HDR of DSBs. To our knowledge, this is the first study to highlight a function for BCL-xL in modulating DSB repair in human cells

  8. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events.

    Science.gov (United States)

    Demeke, Tigst; Eng, Monika

    2018-05-01

    Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.

  9. Identification of Candidate Genes and Biosynthesis Pathways Related to Fertility Conversion by Wheat KTM3315A Transcriptome Profiling

    Directory of Open Access Journals (Sweden)

    Lingli Zhang

    2017-04-01

    Full Text Available The Aegilops kotschyi thermo-sensitive cytoplasmic male sterility (K-TCMS system may facilitate hybrid wheat (Triticum aestivum L. seed multiplication and production. The K-TCMS line is completely male sterile during the normal wheat-growing season, whereas its fertility can be restored in a high-temperature environment. To elucidate the molecular mechanisms responsible for male sterility/fertility conversion and candidate genes involved with pollen development in K-TCMS, we employed RNA-seq to sequence the transcriptomes of anthers from K-TCMS line KTM3315A during development under sterile and fertile conditions. We identified 16840 differentially expressed genes (DEGs in different stages including15157 known genes (15135 nuclear genes and 22 plasmagenes and 1683 novel genes. Bioinformatics analysis identified possible metabolic pathways involved with fertility based on KEGG pathway enrichment of the DEGs expressed in fertile and sterile plants. We found that most of the genes encoding key enzyme in the phenylpropanoid biosynthesis and jasmonate biosynthesis pathways were significant upregulated in uninucleate, binuclate or trinucleate stage, which both interact with MYB transcription factors, and that link between all play essential roles in fertility conversion. The relevant DEGs were verified by quantitative RT-PCR. Thus, we suggested that phenylpropanoid biosynthesis and jasmonate biosynthesis pathways were involved in fertility conversion of K-TCMS wheat. This will provide a new perspective and an effective foundation for the research of molecular mechanisms of fertility conversion of CMS wheat. Fertility conversion mechanism in thermo-sensitive cytoplasmic male sterile/fertile wheat involves the phenylpropanoid biosynthesis pathway, jasmonate biosynthesis pathway, and MYB transcription factors.

  10. Meiotic gene conversion mutants in Saccharomyces cerevisiae. I. Isolation and characterization of PMS1-1 and PMS1-2

    International Nuclear Information System (INIS)

    Williamson, M.S.; Game, J.C.; Fogel, S.

    1985-01-01

    The PMS1 mutants, isolated on the basis of sharply elevated meiotic prototroph frequencies for two closely linked HIS4 alleles, display pleiotropic phenotypes in meiotic and mitotic cells. Two isolates carrying recessive mutations in PMS1 were characterized. They identify a function required to maintain low postmeiotic segregation (PMS) frequencies at many heterozygous sites. In addition, they are mitotic mutators. In mutant diploids, spore viability is reduced, and among survivors, gene conversion and postmeiotic segregation frequencies are increased, but reciprocal exchange frequencies are not affected. The conversion event pattern is also dramatically changed in multiply marked regions in PMS1 homozygotes. The PMS1 locus maps near MET4 on chromosome XIV. The PMS1 gene may identify an excision-resynthesis long patch mismatch correction function or a function that facilitates correction tract elongation. The PMS1 gene product may also play an important role in spontaneous mitotic mutation avoidance and correction of mismatches in heteroduplex DNA formed during spontaneous and UV-induced mitotic recombination. Based on meiotic recombination models emphasizing mismatch correction in heteroduplex DNA intermediates, this interpretation is favored, but alternative interpretations involving longer recombination intermediates in the mutants are also considered

  11. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Reasons for conversion and adverse intraoperative events in Endoscopic Port Access™ atrioventricular valve surgery and minimally invasive aortic valve surgery.

    Science.gov (United States)

    van der Merwe, Johan; Van Praet, Frank; Stockman, Bernard; Degrieck, Ivan; Vermeulen, Yvette; Casselman, Filip

    2018-02-14

    This study reports the factors that contribute to sternotomy conversions (SCs) and adverse intraoperative events in minimally invasive aortic valve surgery (MI-AVS) and minimally invasive Endoscopic Port Access™ atrioventricular valve surgery (MI-PAS). In total, 3780 consecutive patients with either aortic valve disease or atrioventricular valve disease underwent minimally invasive valve surgery (MIVS) at our institution between 1 February 1997 and 31 March 2016. MI-AVS was performed in 908 patients (mean age 69.2 ± 11.3 years, 45.2% women, 6.2% redo cardiac surgery) and MI-PAS in 2872 patients (mean age 64.1 ± 13.3 years, 46.7% women, 12.2% redo cardiac surgery). A cumulative total of 4415 MIVS procedures (MI-AVS = 908, MI-PAS = 3507) included 1537 valve replacements (MI-AVS = 896, MI-PAS = 641) and 2878 isolated or combined valve repairs (MI-AVS = 12, MI-PAS = 2866). SC was required in 3.0% (n = 114 of 3780) of MIVS patients, which occurred in 3.1% (n = 28 of 908) of MI-AVS patients and 3.0% (n = 86 of 2872) of MI-PAS patients, respectively. Reasons for SC in MI-AVS included inadequate visualization (n = 4, 0.4%) and arterial cannulation difficulty (n = 7, 0.8%). For MI-PAS, SC was required in 54 (2.5%) isolated mitral valve procedures (n = 2183). Factors that contributed to SC in MI-PAS included lung adhesions (n = 35, 1.2%), inadequate visualization (n = 2, 0.1%), ventricular bleeding (n = 3, 0.1%) and atrioventricular dehiscence (n = 5, 0.2%). Neurological deficit occurred in 1 (0.1%) and 3 (3.5%) MI-AVS and MI-PAS conversions, respectively. No operative or 30-day mortalities were observed in MI-AVS conversions (n = 28). The 30-day mortality associated with SC in MI-PAS (n = 86) was 10.5% (n = 9). MIVS is increasingly being recognized as the 'gold-standard' for surgical valve interventions in the context of rapidly expanding catheter-based technology and increasing

  13. Saccharomyces cerevisiae mutants with enhanced induced mutation and altered mitotic gene conversion.

    Science.gov (United States)

    Ivanov, E L; Kovaltzova, S V; Korolev, V G

    1989-08-01

    We have developed a method to isolate yeast (Saccharomyces cerevisiae) mutants with enhanced induced mutagenesis based on nitrous acid-induced reversion of the ade2-42 allele. Six mutants have been isolated and designated him (high induced mutagenesis), and 4 of them were studied in more detail. The him mutants displayed enhanced reversion of the ade2-42 allele, either spontaneous or induced by nitrous acid, UV light, and the base analog 6-N-hydroxylaminopurine, but not by gamma-irradiation. It is worth noting that the him mutants turned out not to be sensitive to the lethal effects of the mutagens used. The enhancement in mutation induced by nitrous acid, UV light, and 6-N-hydroxylaminopurine has been confirmed in a forward-mutation assay (induction of mutations in the ADE1, ADE2 genes). The latter agent revealed the most apparent differences between the him mutants and the wild-type strain and was, therefore, chosen for the genetic analysis of mutants, him mutations analyzed behaved as a single Mendelian trait; complementation tests indicated 3 complementation groups (HIM1, HIM2, and HIM3), each containing 1 mutant allele. Uracil-DNA glycosylase activity was determined in crude cell extracts, and no significant differences between the wild-type and him strains were detected. Spontaneous mitotic gene conversion at the ADE2 locus is altered in him1 strains, either increased or decreased, depending on the particular heteroallelic combination. Genetic evidence strongly suggests him mutations to be involved in a process of mismatch correction of molecular heteroduplexes.

  14. Studies on the induction of mitotic gene conversion by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ito, T.; Kobayashi, K.

    1975-01-01

    The UV (270-nm) dose-frequency relationship for the induction of intragenic mitotic recombination at trp 5 locus in Saccharomyces cerevisiae was non-linear. Two parameters, α and a, in the proposed equation for the non-linear relationship f = (at)α were determined so as to fit the experimental data by the method of least squares. The analysis was extended over 5 cell stages during synchronous growth. It was found that (1) parameter α changed from 2.02 for unbudded small cells to 1.09 for the stage where the cell had finished the division of the nucleus, and (2) parameter a changed correspondingly from 7.25.10 -4 to 0.180.10- 4 sec -1 during the same period. One interesting outcome in this analysis was the deduction of a dose-dependent nature of relative sensitivity with respect to the stage. The determination of these two parameters enabled us to calculate dose-effect relationships beyond the limits of experimental restrictions. Such an ''imaginary'' relationship, calculated at an extremely low dose, revealed the existence of maximal sensitivity around the DNA synthesis period. It was further shown that this maximum would easily be masked even in the moderate dose range. Thus, we conclude that the validity of single dose comparisons is diminished unless α is constant regardless of the cell stage. Some considerations on the proposed parameters have been made in relation to the mechanisms of the induction of gene conversion by UV

  15. Antigenic variation of Anaplasma marginale msp2 occurs by combinatorial gene conversion.

    Science.gov (United States)

    Brayton, Kelly A; Palmer, Guy H; Lundgren, Anna; Yi, Jooyoung; Barbet, Anthony F

    2002-03-01

    The rickettsial pathogen Anaplasma marginale establishes lifelong persistent infection in the mammalian reservoir host, during which time immune escape variants continually arise in part because of variation in the expressed copy of the immunodominant outer membrane protein MSP2. A key question is how the small 1.2 Mb A. marginale genome generates sufficient variants to allow long-term persistence in an immunocompetent reservoir host. The recombination of whole pseudogenes into the single msp2 expression site has been previously identified as one method of generating variants, but is inadequate to generate the number of variants required for persistent infection. In the present study, we demonstrate that recombination of a whole pseudogene is followed by a second level of variation in which small segments of pseudogenes recombine into the expression site by gene conversion. Evidence for four short sequential changes in the hypervariable region of msp2 coupled with the identification of nine pseudogenes from a single strain of A. marginale provides for a combinatorial number of possible expressed MSP2 variants sufficient for lifelong persistence.

  16. The impact of early trauma and recent life-events on symptom severity in patients with conversion disorder

    NARCIS (Netherlands)

    Roelofs, K.; Spinhoven, P.; Sandijck, P.; Moene, F.C.; Hoogduin, C.A.L.

    2005-01-01

    Although the presence of psychological stress factors in the evolution of conversion symptoms forms an important criterion for the DSM-IV diagnosis of conversion disorder, little is known about the nature and timing of these stress factors. Fifty-four patients with conversion disorder and 50 control

  17. Inherited differences in crossing over and gene conversion frequencies between wild strains of Sordaria fimicola from "Evolution Canyon".

    Science.gov (United States)

    Saleem, M; Lamb, B C; Nevo, E

    2001-12-01

    Recombination generates new combinations of existing genetic variation and therefore may be important in adaptation and evolution. We investigated whether there was natural genetic variation for recombination frequencies and whether any such variation was environment related and possibly adaptive. Crossing over and gene conversion frequencies often differed significantly in a consistent direction between wild strains of the fungus Sordaria fimicola isolated from a harsher or a milder microscale environment in "Evolution Canyon," Israel. First- and second-generation descendants from selfing the original strains from the harsher, more variable, south-facing slope had higher frequencies of crossing over in locus-centromere intervals and of gene conversion than those from the lusher north-facing slopes. There were some significant differences between strains within slopes, but these were less marked than between slopes. Such inherited variation could provide a basis for natural selection for optimum recombination frequencies in each environment. There were no significant differences in meiotic hybrid DNA correction frequencies between strains from the different slopes. The conversion analysis was made using only conversions to wild type, because estimations of conversion to mutant were affected by a high frequency of spontaneous mutation. There was no polarized segregation of chromosomes at meiosis I or of chromatids at meiosis II.

  18. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts.

    Science.gov (United States)

    Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T

    2015-11-27

    Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    International Nuclear Information System (INIS)

    Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.

    2015-01-01

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  20. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)

    2015-11-27

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  1. Role of Double-Strand Break End-Tethering during Gene Conversion in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Suvi Jain

    2016-04-01

    Full Text Available Correct repair of DNA double-strand breaks (DSBs is critical for maintaining genome stability. Whereas gene conversion (GC-mediated repair is mostly error-free, repair by break-induced replication (BIR is associated with non-reciprocal translocations and loss of heterozygosity. We have previously shown that a Recombination Execution Checkpoint (REC mediates this competition by preventing the BIR pathway from acting on DSBs that can be repaired by GC. Here, we asked if the REC can also determine whether the ends that are engaged in a GC-compatible configuration belong to the same break, since repair involving ends from different breaks will produce potentially deleterious translocations. We report that the kinetics of repair are markedly delayed when the two DSB ends that participate in GC belong to different DSBs (termed Trans compared to the case when both DSB ends come from the same break (Cis. However, repair in Trans still occurs by GC rather than BIR, and the overall efficiency of repair is comparable. Hence, the REC is not sensitive to the "origin" of the DSB ends. When the homologous ends for GC are in Trans, the delay in repair appears to reflect their tethering to sequences on the other side of the DSB that themselves recombine with other genomic locations with which they share sequence homology. These data support previous observations that the two ends of a DSB are usually tethered to each other and that this tethering facilitates both ends encountering the same donor sequence. We also found that the presence of homeologous/repetitive sequences in the vicinity of a DSB can distract the DSB end from finding its bona fide homologous donor, and that inhibition of GC by such homeologous sequences is markedly increased upon deleting Sgs1 but not Msh6.

  2. The Impact of Selection, Gene Conversion, and Biased Sampling on the Assessment of Microbial Demography.

    Science.gov (United States)

    Lapierre, Marguerite; Blin, Camille; Lambert, Amaury; Achaz, Guillaume; Rocha, Eduardo P C

    2016-07-01

    Recent studies have linked demographic changes and epidemiological patterns in bacterial populations using coalescent-based approaches. We identified 26 studies using skyline plots and found that 21 inferred overall population expansion. This surprising result led us to analyze the impact of natural selection, recombination (gene conversion), and sampling biases on demographic inference using skyline plots and site frequency spectra (SFS). Forward simulations based on biologically relevant parameters from Escherichia coli populations showed that theoretical arguments on the detrimental impact of recombination and especially natural selection on the reconstructed genealogies cannot be ignored in practice. In fact, both processes systematically lead to spurious interpretations of population expansion in skyline plots (and in SFS for selection). Weak purifying selection, and especially positive selection, had important effects on skyline plots, showing patterns akin to those of population expansions. State-of-the-art techniques to remove recombination further amplified these biases. We simulated three common sampling biases in microbiological research: uniform, clustered, and mixed sampling. Alone, or together with recombination and selection, they further mislead demographic inferences producing almost any possible skyline shape or SFS. Interestingly, sampling sub-populations also affected skyline plots and SFS, because the coalescent rates of populations and their sub-populations had different distributions. This study suggests that extreme caution is needed to infer demographic changes solely based on reconstructed genealogies. We suggest that the development of novel sampling strategies and the joint analyzes of diverse population genetic methods are strictly necessary to estimate demographic changes in populations where selection, recombination, and biased sampling are present. © The Author 2016. Published by Oxford University Press on behalf of the Society for

  3. Biased Gene Conversion and GC-Content Evolution in the Coding Sequences of Reptiles and Vertebrates

    Science.gov (United States)

    Figuet, Emeric; Ballenghien, Marion; Romiguier, Jonathan; Galtier, Nicolas

    2015-01-01

    Mammalian and avian genomes are characterized by a substantial spatial heterogeneity of GC-content, which is often interpreted as reflecting the effect of local GC-biased gene conversion (gBGC), a meiotic repair bias that favors G and C over A and T alleles in high-recombining genomic regions. Surprisingly, the first fully sequenced nonavian sauropsid (i.e., reptile), the green anole Anolis carolinensis, revealed a highly homogeneous genomic GC-content landscape, suggesting the possibility that gBGC might not be at work in this lineage. Here, we analyze GC-content evolution at third-codon positions (GC3) in 44 vertebrates species, including eight newly sequenced transcriptomes, with a specific focus on nonavian sauropsids. We report that reptiles, including the green anole, have a genome-wide distribution of GC3 similar to that of mammals and birds, and we infer a strong GC3-heterogeneity to be already present in the tetrapod ancestor. We further show that the dynamic of coding sequence GC-content is largely governed by karyotypic features in vertebrates, notably in the green anole, in agreement with the gBGC hypothesis. The discrepancy between third-codon positions and noncoding DNA regarding GC-content dynamics in the green anole could not be explained by the activity of transposable elements or selection on codon usage. This analysis highlights the unique value of third-codon positions as an insertion/deletion-free marker of nucleotide substitution biases that ultimately affect the evolution of proteins. PMID:25527834

  4. Recent adaptive events in human brain revealed by meta-analysis of positively selected genes.

    Directory of Open Access Journals (Sweden)

    Yue Huang

    Full Text Available BACKGROUND AND OBJECTIVES: Analysis of positively-selected genes can help us understand how human evolved, especially the evolution of highly developed cognitive functions. However, previous works have reached conflicting conclusions regarding whether human neuronal genes are over-represented among genes under positive selection. METHODS AND RESULTS: We divided positively-selected genes into four groups according to the identification approaches, compiling a comprehensive list from 27 previous studies. We showed that genes that are highly expressed in the central nervous system are enriched in recent positive selection events in human history identified by intra-species genomic scan, especially in brain regions related to cognitive functions. This pattern holds when different datasets, parameters and analysis pipelines were used. Functional category enrichment analysis supported these findings, showing that synapse-related functions are enriched in genes under recent positive selection. In contrast, immune-related functions, for instance, are enriched in genes under ancient positive selection revealed by inter-species coding region comparison. We further demonstrated that most of these patterns still hold even after controlling for genomic characteristics that might bias genome-wide identification of positively-selected genes including gene length, gene density, GC composition, and intensity of negative selection. CONCLUSION: Our rigorous analysis resolved previous conflicting conclusions and revealed recent adaptation of human brain functions.

  5. On the field-to-current conversion factors for large bipolar lightning discharge events in winter thunderstorms in Japan

    Science.gov (United States)

    Chen, Long; Zhang, Qilin; Hou, Wenhao; Tao, Yulang

    2015-07-01

    In this paper we have simulated the far-field waveform characteristic of large bipolar events (LBEs) occurred in winter thunderstorms in Japan and compared the field-to-current conversion factors (FCCFs) of LBEs with that of the lightning cloud-to-ground (CG) return stroke (RS) in summer thunderstorm. As for the physical process of LBEs, Wu et al. (2014) considered that LBEs may be very similar to the typical lightning RS (RS-like process) or caused by an initial continuous current pulse (ICC-like process) in upward lightning flashes. We assume that the lightning channel length of LBEs ranges from 500 m to 1000 m, and the height of tall object struck by LBEs is from 100 m to 300 m. By using the bouncing wave model, we found that only when the injected current waveform of LBEs is characterized with a symmetric Gaussian pulse, the simulated far-field waveform of LBEs both for RS-like process and ICC-like process is similar to that observed by Wu et al. (2014). For striking tall objects with heights from 100 m and 300 m, the FCCFs of LBEs are positively correlated with its channel length and derivatives of injected current waveform, and the FCCF for RS-like process is about similar to that for ICC-like process. However, the FCCFs of LBEs are very different from lightning RS in summer thunderstorm; that is to say, the FCCFs developed for the well-known lightning RS in summer thunderstorm are not suitable for LBEs.

  6. Structural and functional characterization of the product of disease-related factor H gene conversion.

    Science.gov (United States)

    Herbert, Andrew P; Kavanagh, David; Johansson, Conny; Morgan, Hugh P; Blaum, Bärbel S; Hannan, Jonathan P; Barlow, Paul N; Uhrín, Dušan

    2012-03-06

    Numerous complement factor H (FH) mutations predispose patients to atypical hemolytic uremic syndrome (aHUS) and other disorders arising from inadequately regulated complement activation. No unifying structural or mechanistic consequences have been ascribed to these mutants beyond impaired self-cell protection. The S1191L and V1197A mutations toward the C-terminus of FH, which occur in patients singly or together, arose from gene conversion between CFH encoding FH and CFHR1 encoding FH-related 1. We show that neither single nor double mutations structurally perturbed recombinant proteins consisting of the FH C-terminal modules, 19 and 20 (FH19-20), although all three FH19-20 mutants were poor, compared to wild-type FH19-20, at promoting hemolysis of C3b-coated erythrocytes through competition with full-length FH. Indeed, our new crystal structure of the S1191L mutant of FH19-20 complexed with an activation-specific complement fragment, C3d, was nearly identical to that of the wild-type FH19-20:C3d complex, consistent with mutants binding to C3b with wild-type-like affinity. The S1191L mutation enhanced thermal stability of module 20, whereas the V1197A mutation dramatically decreased it. Thus, although mutant proteins were folded at 37 °C, they differ in conformational rigidity. Neither single substitutions nor double substitutions increased measurably the extent of FH19-20 self-association, nor did these mutations significantly affect the affinity of FH19-20 for three glycosaminoglycans, despite critical roles of module 20 in recognizing polyanionic self-surface markers. Unexpectedly, FH19-20 mutants containing Leu1191 self-associated on a heparin-coated surface to a higher degree than on surfaces coated with dermatan or chondroitin sulfates. Thus, potentially disease-related functional distinctions between mutants, and between FH and FH-related 1, may manifest in the presence of specific glycosaminoglycans.

  7. Making memories of stressful events: a journey along epigenetic, gene transcription and signaling pathways

    Directory of Open Access Journals (Sweden)

    Johannes M.H.M. eReul

    2014-01-01

    Full Text Available Strong psychologically stressful events are known to have a long-lasting impact on behavior. The consolidation of such, largely adaptive, behavioral responses to stressful events involves changes in gene expression in limbic brain regions such as the hippocampus and amygdala. The underlying molecular mechanisms however were until recently unresolved. More than a decade ago we started to investigate the role of these hormones in signaling and epigenetic mechanisms participating in the effects of stress on gene transcription in hippocampal neurons. We discovered a novel, rapid non-genomic mechanism in which glucocorticoids via glucocorticoid receptors (GRs facilitate signaling of the ERK MAPK signaling pathway to the downstream nuclear kinases MSK1 and Elk-1 in dentate gyrus (DG granule neurons. Activation of this signaling pathway results in serine10 (S10 phosphorylation and lysine14 (K14 acetylation at histone H3 (H3S10p-K14ac, leading to the induction of the immediate early genes c-Fos and Egr-1. In addition, we found a role of the DNA methylation status of gene promoters. A series of studies showed that these molecular mechanisms play a critical role in the long-lasting consolidation of behavioral responses in the forced swim test and Morris water maze. Furthermore, an important role of GABA was found in controlling the epigenetic and gene transcriptional responses to psychological stress. Thus, psychologically stressful events evoke a long-term impact on behavior through changes in hippocampal function brought about by distinct glutamatergic and glucocorticoid-driven changes in epigenetic regulation of gene transcription which are modulated by (local GABAergic interneurons and limbic afferent inputs. These epigenetic processes may play an important role in the etiology of stress-related mental disorders such as major depressive and anxiety disorders like PTSD.

  8. Acute hypoxia stress induced abundant differential expression genes and alternative splicing events in heart of tilapia.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Li, Bi Jun; Gu, Xiao Hui; Lin, Hao Ran

    2018-01-10

    Hypoxia is one of the critical environmental stressors for fish in aquatic environments. Although accumulating evidences indicate that gene expression is regulated by hypoxia stress in fish, how genes undergoing differential gene expression and/or alternative splicing (AS) in response to hypoxia stress in heart are not well understood. Using RNA-seq, we surveyed and detected 289 differential expressed genes (DEG) and 103 genes that undergo differential usage of exons and splice junctions events (DUES) in heart of a hypoxia tolerant fish, Nile tilapia, Oreochromis niloticus following 12h hypoxic treatment. The spatio-temporal expression analysis validated the significant association of differential exon usages in two randomly selected DUES genes (fam162a and ndrg2) in 5 tissues (heart, liver, brain, gill and spleen) sampled at three time points (6h, 12h, and 24h) under acute hypoxia treatment. Functional analysis significantly associated the differential expressed genes with the categories related to energy conservation, protein synthesis and immune response. Different enrichment categories were found between the DEG and DUES dataset. The Isomerase activity, Oxidoreductase activity, Glycolysis and Oxidative stress process were significantly enriched for the DEG gene dataset, but the Structural constituent of ribosome and Structural molecule activity, Ribosomal protein and RNA binding protein were significantly enriched only for the DUES genes. Our comparative transcriptomic analysis reveals abundant stress responsive genes and their differential regulation function in the heart tissues of Nile tilapia under acute hypoxia stress. Our findings will facilitate future investigation on transcriptome complexity and AS regulation during hypoxia stress in fish. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Evidence for somatic gene conversion and deletion in bipolar disorder, Crohn's disease, coronary artery disease, hypertension, rheumatoid arthritis, type-1 diabetes, and type-2 diabetes.

    Science.gov (United States)

    Ross, Kenneth Andrew

    2011-02-03

    During gene conversion, genetic information is transferred unidirectionally between highly homologous but non-allelic regions of DNA. While germ-line gene conversion has been implicated in the pathogenesis of some diseases, somatic gene conversion has remained technically difficult to investigate on a large scale. A novel analysis technique is proposed for detecting the signature of somatic gene conversion from SNP microarray data. The Wellcome Trust Case Control Consortium has gathered SNP microarray data for two control populations and cohorts for bipolar disorder (BD), cardiovascular disease (CAD), Crohn's disease (CD), hypertension (HT), rheumatoid arthritis (RA), type-1 diabetes (T1D) and type-2 diabetes (T2D). Using the new analysis technique, the seven disease cohorts are analyzed to identify cohort-specific SNPs at which conversion is predicted. The quality of the predictions is assessed by identifying known disease associations for genes in the homologous duplicons, and comparing the frequency of such associations with background rates. Of 28 disease/locus pairs meeting stringent conditions, 22 show various degrees of disease association, compared with only 8 of 70 in a mock study designed to measure the background association rate (P conversion could be a significant causative factor in each of the seven diseases. The specific genes provide potential insights about disease mechanisms, and are strong candidates for further study.

  10. Gene conversion in yeast as a function of linear energy transfer (LET) for low-LET radiation

    International Nuclear Information System (INIS)

    Unrau, P.; Morrison, D.P.; Johnson, J.R.

    1992-05-01

    The relative biological effectiveness (RBE) for low-LET radiation is known to depend on such factors as LET and dose rate. Microdosimetric calculations indicate that the biological target size could also be an important parameter, and calculations predict that the RBE for effects produced by hits in target sizes below about 100 nm should be unity for all low LET radiation. We have measured that RBE for gene conversion in yeast (a small target) for five different low LET photon sources, and the results were consistent with an RBE of unity, which agrees with microdosimetric predictions. 4 refs

  11. A new computational method for the detection of horizontal gene transfer events.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

  12. Fusion and retrotransposition events in the evolution of the sea anemone Anemonia viridis neurotoxin genes.

    Science.gov (United States)

    Moran, Yehu; Weinberger, Hagar; Lazarus, Nimrod; Gur, Maya; Kahn, Roy; Gordon, Dalia; Gurevitz, Michael

    2009-08-01

    Sea anemones are sessile predators that use a variety of toxins to paralyze prey and foe. Among these toxins, Types I, II and III are short peptides that affect voltage-gated sodium channels. Anemonia viridis is the only sea anemone species that produces both Types I and III neurotoxin. Although the two toxin types are unrelated in sequence and three-dimensional structure, cloning and comparative analysis of their loci revealed a highly similar sequence at the 5' region, which encodes a signal peptide. This similarity was likely generated by gene fusion and could be advantageous in transcript stability and intracellular trafficking and secretion. In addition, these analyses identified the processed pseudogenes of the two gene families in the genome of A. viridis, probably resulting from retrotransposition events. As presence of processed pseudogenes in the genome requires transcription in germ-line cells, we analyzed oocyte-rich ovaries and found that indeed they contain Types I and III transcripts. This result raises questions regarding the role of toxin transcripts in these tissues. Overall, the retrotransposition and gene fusion events suggest that the genes of both Types I and III neurotoxins evolved in a similar fashion and share a partial common ancestry.

  13. Conservation of transcription factor binding events predicts gene expression across species

    Science.gov (United States)

    Hemberg, Martin; Kreiman, Gabriel

    2011-01-01

    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to function, defined as expression of the target genes. We show that (i) there is a significantly higher degree of conservation of TFBEs when the target gene is expressed in both species; (ii) there is increased conservation of binding events for groups of TFs compared to individual TFs; and (iii) conserved TFBEs have a greater impact on the expression of their target genes than non-conserved ones. These results link conservation of structural elements (TFBEs) to conservation of function (gene expression) and suggest a higher degree of functional conservation than implied by previous studies. PMID:21622661

  14. Gene-Tree Reconciliation with MUL-Trees to Resolve Polyploidy Events.

    Science.gov (United States)

    Gregg, W C Thomas; Ather, S Hussain; Hahn, Matthew W

    2017-11-01

    Polyploidy can have a huge impact on the evolution of species, and it is a common occurrence, especially in plants. The two types of polyploids-autopolyploids and allopolyploids-differ in the level of divergence between the genes that are brought together in the new polyploid lineage. Because allopolyploids are formed via hybridization, the homoeologous copies of genes within them are at least as divergent as orthologs in the parental species that came together to form them. This means that common methods for estimating the parental lineages of allopolyploidy events are not accurate, and can lead to incorrect inferences about the number of gene duplications and losses. Here, we have adapted an algorithm for topology-based gene-tree reconciliation to work with multi-labeled trees (MUL-trees). By definition, MUL-trees have some tips with identical labels, which makes them a natural representation of the genomes of polyploids. Using this new reconciliation algorithm we can: accurately place allopolyploidy events on a phylogeny, identify the parental lineages that hybridized to form allopolyploids, distinguish between allo-, auto-, and (in most cases) no polyploidy, and correctly count the number of duplications and losses in a set of gene trees. We validate our method using gene trees simulated with and without polyploidy, and revisit the history of polyploidy in data from the clades including both baker's yeast and bread wheat. Our re-analysis of the yeast data confirms the allopolyploid origin and parental lineages previously identified for this group. The method presented here should find wide use in the growing number of genomes from species with a history of polyploidy. [Polyploidy; reconciliation; whole-genome duplication.]. © The Author(s) 2017. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Genomic Evidence of Chemotrophic Metabolisms in Deep-Dwelling Chloroflexi Conferred by Ancient Horizontal Gene Transfer Events

    Science.gov (United States)

    Momper, L. M.; Magnabosco, C.; Amend, J.; Osburn, M. R.; Fournier, G. P.

    2017-12-01

    The marine and terrestrial subsurface biospheres represent quite likely the largest reservoirs for life on Earth, directly impacting surface processes and global cycles throughout Earth's history. In the deep subsurface biosphere (DSB) organic carbon and energy are often extremely scarce. However, archaea and bacteria are able to persist in the DSB to at least 3.5 km below surface [1]. Understanding how they persist, and by what metabolisms they subsist, are key questions in this biosphere. To address these questions we investigated 5 global DSB environments: one legacy mine in South Dakota, USA, 3 mines in South Africa and marine fluids circulating beneath the Juan de Fuca Ridge. Boreholes within these mines provided access to fluids buried beneath the earth's surface and sampled depths down to 3.1 km. Geochemical data were collected concomitantly with DNA for metagenomic sequencing. We examined genomes of the ancient and deeply branching Chloroflexi for metabolic capabilities and interrogated the geochemical drivers behind those metabolisms with in situ thermodynamic modeling of reaction energetics. In total, 23 Chloroflexi genomes were identified and analyzed from the 5 subsurface sites. Genes for nitrate reduction (nar) and sulfite reduction (dsr) were found in many of the South Africa Chloroflexi but were absent from genomes collected in South Dakota. Indeed, nitrate reduction was among the most energetically favorable reactions in South African fluids (10-14 kJ cell-1 sec -1 per mol of reactant) and sulfur reduction with Fe2+ or H2 was also exergonic [2]. Conversely, genes for nitrite and nitrous oxide reduction (nrf, nir and nos) were found in genomes collected in South Dakota and Juan de Fuca, but not South Africa. We examined the origin of genes conferring these metabolisms in the Chloroflexi genomes. We discovered evidence for horizontal gene transfer (HGT) for all of these putative metabolisms. Retention of these genes in Chloroflexi lineages indicates

  16. Large-scale event extraction from literature with multi-level gene normalization.

    Directory of Open Access Journals (Sweden)

    Sofie Van Landeghem

    Full Text Available Text mining for the life sciences aims to aid database curation, knowledge summarization and information retrieval through the automated processing of biomedical texts. To provide comprehensive coverage and enable full integration with existing biomolecular database records, it is crucial that text mining tools scale up to millions of articles and that their analyses can be unambiguously linked to information recorded in resources such as UniProt, KEGG, BioGRID and NCBI databases. In this study, we investigate how fully automated text mining of complex biomolecular events can be augmented with a normalization strategy that identifies biological concepts in text, mapping them to identifiers at varying levels of granularity, ranging from canonicalized symbols to unique gene and proteins and broad gene families. To this end, we have combined two state-of-the-art text mining components, previously evaluated on two community-wide challenges, and have extended and improved upon these methods by exploiting their complementary nature. Using these systems, we perform normalization and event extraction to create a large-scale resource that is publicly available, unique in semantic scope, and covers all 21.9 million PubMed abstracts and 460 thousand PubMed Central open access full-text articles. This dataset contains 40 million biomolecular events involving 76 million gene/protein mentions, linked to 122 thousand distinct genes from 5032 species across the full taxonomic tree. Detailed evaluations and analyses reveal promising results for application of this data in database and pathway curation efforts. The main software components used in this study are released under an open-source license. Further, the resulting dataset is freely accessible through a novel API, providing programmatic and customized access (http://www.evexdb.org/api/v001/. Finally, to allow for large-scale bioinformatic analyses, the entire resource is available for bulk download from

  17. The Wnt-target gene Dlk-1 is regulated by the Prmt5-associated factor Copr5 during adipogenic conversion

    Directory of Open Access Journals (Sweden)

    Conception Paul

    2015-02-01

    Full Text Available Protein arginine methyl transferase 5 (Prmt5 regulates various differentiation processes, including adipogenesis. Here, we investigated adipogenic conversion in cells and mice in which Copr5, a Prmt5- and histone-binding protein, was genetically invalidated. Compared to control littermates, the retroperitoneal white adipose tissue (WAT of Copr5 KO mice was slightly but significantly reduced between 8 and 16 week/old and contained fewer and larger adipocytes. Moreover, the adipogenic conversion of Copr5 KO embryoid bodies (EB and of primary embryo fibroblasts (Mefs was markedly delayed. Differential transcriptomic analysis identified Copr5 as a negative regulator of the Dlk-1 gene, a Wnt target gene involved in the control of adipocyte progenitors cell fate. Dlk-1 expression was upregulated in Copr5 KO Mefs and the Vascular Stromal Fraction (VSF of Copr5 KO WAT. Chromatin immunoprecipitation (ChIP show that the ablation of Copr5 has impaired both the recruitment of Prmt5 and β-catenin at the Dlk-1 promoter. Overall, our data suggest that Copr5 is involved in the transcriptional control exerted by the Wnt pathway on early steps of adipogenesis.

  18. Events

    Directory of Open Access Journals (Sweden)

    Igor V. Karyakin

    2016-02-01

    Full Text Available The 9th ARRCN Symposium 2015 was held during 21st–25th October 2015 at the Novotel Hotel, Chumphon, Thailand, one of the most favored travel destinations in Asia. The 10th ARRCN Symposium 2017 will be held during October 2017 in the Davao, Philippines. International Symposium on the Montagu's Harrier (Circus pygargus «The Montagu's Harrier in Europe. Status. Threats. Protection», organized by the environmental organization «Landesbund für Vogelschutz in Bayern e.V.» (LBV was held on November 20-22, 2015 in Germany. The location of this event was the city of Wurzburg in Bavaria.

  19. Cis-acting regulatory sequences promote high-frequency gene conversion between repeated sequences in mammalian cells.

    Science.gov (United States)

    Raynard, Steven J; Baker, Mark D

    2004-01-01

    In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.

  20. Tyrosine kinase chromosomal translocations mediate distinct and overlapping gene regulation events

    International Nuclear Information System (INIS)

    Kim, Hani; Gillis, Lisa C; Jarvis, Jordan D; Yang, Stuart; Huang, Kai; Der, Sandy; Barber, Dwayne L

    2011-01-01

    Leukemia is a heterogeneous disease commonly associated with recurrent chromosomal translocations that involve tyrosine kinases including BCR-ABL, TEL-PDGFRB and TEL-JAK2. Most studies on the activated tyrosine kinases have focused on proximal signaling events, but little is known about gene transcription regulated by these fusions. Oligonucleotide microarray was performed to compare mRNA changes attributable to BCR-ABL, TEL-PDGFRB and TEL-JAK2 after 1 week of activation of each fusion in Ba/F3 cell lines. Imatinib was used to control the activation of BCR-ABL and TEL-PDGFRB, and TEL-JAK2-mediated gene expression was examined 1 week after Ba/F3-TEL-JAK2 cells were switched to factor-independent conditions. Microarray analysis revealed between 800 to 2000 genes induced or suppressed by two-fold or greater by each tyrosine kinase, with a subset of these genes commonly induced or suppressed among the three fusions. Validation by Quantitative PCR confirmed that eight genes (Dok2, Mrvi1, Isg20, Id1, gp49b, Cxcl10, Scinderin, and collagen Vα1(Col5a1)) displayed an overlapping regulation among the three tested fusion proteins. Stat1 and Gbp1 were induced uniquely by TEL-PDGFRB. Our results suggest that BCR-ABL, TEL-PDGFRB and TEL-JAK2 regulate distinct and overlapping gene transcription profiles. Many of the genes identified are known to be involved in processes associated with leukemogenesis, including cell migration, proliferation and differentiation. This study offers the basis for further work that could lead to an understanding of the specificity of diseases caused by these three chromosomal translocations

  1. Morphogenesis in sea urchin embryos: linking cellular events to gene regulatory network states

    Science.gov (United States)

    Lyons, Deidre; Kaltenbach, Stacy; McClay, David R.

    2013-01-01

    Gastrulation in the sea urchin begins with ingression of the primary mesenchyme cells (PMCs) at the vegetal pole of the embryo. After entering the blastocoel the PMCs migrate, form a syncitium, and synthesize the skeleton of the embryo. Several hours after the PMCs ingress the vegetal plate buckles to initiate invagination of the archenteron. That morphogenetic process occurs in several steps. The non-skeletogenic cells produce the initial inbending of the vegetal plate. Endoderm cells then rearrange and extend the length of the gut across the blastocoel to a target near the animal pole. Finally, cells that will form part of the midgut and hindgut are added to complete gastrulation. Later, the stomodeum invaginates from the oral ectoderm and fuses with the foregut to complete the archenteron. In advance of, and during these morphogenetic events an increasingly complex gene regulatory network controls the specification and the cell biological events that conduct the gastrulation movements. PMID:23801438

  2. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  3. Identification of new alternative splice events in the TCIRG1 gene in different human tissues

    International Nuclear Information System (INIS)

    Smirnova, Anna S.; Morgun, Andrey; Shulzhenko, Natalia; Silva, Ismael D.C.G.; Gerbase-DeLima, Maria

    2005-01-01

    Two transcript variants (TV) of the T cell immune regulator gene 1 (TCIRG1) have already been characterized. TV1 encodes a subunit of the osteoclast vacuolar proton pump and TV2 encodes a T cell inhibitory receptor. Based on the search in dbEST, we validated by RT-PCR six new alternative splice events in TCIRG1 in most of the 28 human tissues studied. In addition, we observed that transcripts using the TV1 transcription start site and two splice forms previously described in a patient with infantile malignant osteopetrosis are also expressed in various tissues of healthy individuals. Studies of these nine splice forms in cytoplasmic RNA of peripheral blood mononuclear cells showed that at least six of them could be efficiently exported from the nucleus. Since various products with nearly ubiquitous tissue distribution are generated from TCIRG1, this gene may be involved in other processes besides immune response and bone resorption

  4. Emotion Talk in Mother-Child Conversations of the Shared Past: The Effects of Culture, Gender, and Event Valence

    Science.gov (United States)

    Fivush, Robyn; Wang, Qi

    2005-01-01

    We examined how mother-child emotional reminiscing is affected by culture, gender, and the valence of the event. Thirty-one Euro-American and 30 Chinese middle-class mothers and their 3-year-old children discussed 1 highly positive and 1 highly negative experience. Mothers and children in both cultures used a greater variety of negative emotion…

  5. Adverse events in families with hypertrophic or dilated cardiomyopathy and mutations in the MYBPC3 gene

    Directory of Open Access Journals (Sweden)

    Lehrke Stephanie

    2008-10-01

    Full Text Available Abstract Background Mutations in MYBPC3 encoding myosin binding protein C belong to the most frequent causes of hypertrophic cardiomyopathy (HCM and may also lead to dilated cardiomyopathy (DCM. MYBPC3 mutations initially were considered to cause a benign form of HCM. The aim of this study was to examine the clinical outcome of patients and their relatives with 18 different MYBPC3 mutations. Methods 87 patients with HCM and 71 patients with DCM were screened for MYBPC3 mutations by denaturing gradient gel electrophoresis and sequencing. Close relatives of mutation carriers were genotyped for the respective mutation. Relatives with mutation were then evaluated by echocardiography and magnetic resonance imaging. A detailed family history regarding adverse clinical events was recorded. Results In 16 HCM (18.4% and two DCM (2.8% index patients a mutation was detected. Seven mutations were novel. Mutation carriers exhibited no additional mutations in genes MYH7, TNNT2, TNNI3, ACTC and TPM1. Including relatives of twelve families, a total number of 42 mutation carriers was identified of which eleven (26.2% had at least one adverse event. Considering the twelve families and six single patients with mutations, 45 individuals with cardiomyopathy and nine with borderline phenotype were identified. Among the 45 patients, 23 (51.1% suffered from an adverse event. In eleven patients of seven families an unexplained sudden death was reported at the age between 13 and 67 years. Stroke or a transient ischemic attack occurred in six patients of five families. At least one adverse event occurred in eleven of twelve families. Conclusion MYBPC3 mutations can be associated with cardiac events such as progressive heart failure, stroke and sudden death even at younger age. Therefore, patients with MYBPC3 mutations require thorough clinical risk assessment.

  6. Effect of oral cladribine on time to conversion to clinically definite multiple sclerosis in patients with a first demyelinating event (ORACLE MS): a phase 3 randomised trial.

    Science.gov (United States)

    Leist, Thomas P; Comi, Giancarlo; Cree, Bruce A C; Coyle, Patricia K; Freedman, Mark S; Hartung, Hans-Peter; Vermersch, Patrick; Casset-Semanaz, Florence; Scaramozza, Matthew

    2014-03-01

    Patients who develop relapsing-remitting multiple sclerosis (MS) present with a first clinical demyelinating event. In this double-blind, multicentre, randomised, phase 3 study we investigated the effect of oral cladribine on conversion to clinically definite MS in patients with a first clinical demyelinating event, when given at the same doses shown to be effective in relapsing-remitting MS. Between Oct 21, 2008, and Oct 11, 2010, we recruited patients aged 18-55 years, inclusive, from 160 hospitals, private clinics, or treatment centres in 34 countries. Eligible patients had a first clinical demyelinating event within 75 days before screening, at least two clinically silent lesions of at least 3 mm on a T2-weighted brain MRI scan, and an Expanded Disability Status Scale score of 5.0 or lower. Patients with a first clinical demyelinating event ≤75 days before screening were randomly assigned (1:1:1) to receive cladribine tablets at cumulative doses of 5.25 mg/kg or 3.5 mg/kg or placebo. Randomisation was done with a central web-based randomisation system and was stratified by geographic region. Masking was maintained using a two-physician model. The primary endpoint of this 96-week study was time to conversion to clinically definite MS according to the Poser criteria. This study is registered with ClinicalTrials.gov, number NCT00725985. Of 903 participants assessed for eligibility, 616 patients received cladribine 5.25 mg/kg (n=204), cladribine 3.5 mg/kg (n=206), or placebo (n=206). At trial termination on Oct 25, 2011, cladribine was associated with a risk reduction versus placebo for time to conversion to clinically definite MS (hazard ratio [HR] for 5.25 mg/kg=0.38, 95% CI 0.25-0.58, pMS diagnosis compared with placebo. The safety profile of cladribine was similar to that noted in a trial in patients with relapsing-remitting MS. Further research could clarify the potential effects of oral cladribine treatment in the early stages of MS. Merck Serono SA Geneva

  7. Direct conversion of starch to ethanol using recombınant Saccharomyces cerevisiae containing glucoamylase gene

    Science.gov (United States)

    Purkan, P.; Baktir, A.; Puspaningsih, N. N. T.; Ni'mah, M.

    2017-09-01

    Saccharomyces cerevisiae is known for its high fermentative capacity, high ethanol yield and its high ethanol tolerance. The yeast is inability converting starch (relatively inexpensive substrate) into biofuel ethanol. Insertion of glucoamylase gene in yeast cell of Saccharomyces cerevisiae had been done to increase the yeast function in ethanol fermentation from starch. Transformation of yeast of S. cerevisiae with recombinant plasmid yEP-GLO1 carrying gene encoding glucoamylase (GLO1) produced the recombinant yeast which enable to degrade starch. Optimizing of bioconversion process of starch into ethanol by the yeast of recombinant Saccharomyces cerevisiae [yEP-GLO1] had been also done. Starch concentration which could be digested by recombinant yeast of S. cerevisiae [yEP-GLO1] was 10% (w/v). Bioconversion of starch having concentration 10% (b/v) using recombinant yeast of S. cerevisiae BY5207 [yEP-GLO1] could result ethanol as 20% (v/v) to alcoholmeter and 19,5% (v/v) to gas of chromatography. Otherwise, using recombinant yeast S. cerevisiae S. cerevisiae AS3324 [yEP-GLO1] resulted ethanol as 17% (v/v) to alcoholmeter and 17,5% (v/v) to gas of chromatography. The highest ethanol in starch bioconversion using both recombinant yeasts BY5207 and AS3324 could be resulted on 144 hours of fermentation time as well as in pH 5.

  8. Prevention of adverse events of interferon γ gene therapy by gene delivery of interferon γ-heparin-binding domain fusion protein in mice

    Directory of Open Access Journals (Sweden)

    Mitsuru Ando

    2014-01-01

    Full Text Available Sustained gene delivery of interferon (IFN γ can be an effective treatment, but our previous study showed high levels of IFNγ-induced adverse events, including the loss of body weight. These unwanted events could be reduced by target-specific delivery of IFNγ after in vivo gene transfer. To achieve this, we selected the heparin-binding domain (HBD of extracellular superoxide dismutase as a molecule to anchor IFNγ to the cell surface. We designed three IFNγ derivatives, IFNγ-HBD1, IFNγ-HBD2, and IFNγ-HBD3, each of which had 1, 2, or 3 HBDs, respectively. Each plasmid-encoding fusion proteins was delivered to the liver, a model target in this study, by hydrodynamic tail vein injection. The serum concentration of IFNγ-HBD2 and IFNγ-HBD3 after gene delivery was lower than that of IFNγ or IFNγ-HBD1. Gene delivery of IFNγ-HBD2, but not of IFNγ-HBD3, effectively increased the mRNA expression of IFNγ-inducible genes in the liver, suggesting liver-specific distribution of IFNγ-HBD2. Gene delivery of IFNγ-HBD2-suppressed tumor growth in the liver as efficiently as that of IFNγ with much less symptoms of adverse effects. These results indicate that the adverse events of IFNγ gene transfer can be prevented by gene delivery of IFNγ-HBD2, a fusion protein with high cell surface affinity.

  9. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    Energy Technology Data Exchange (ETDEWEB)

    Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia); Slamka, Tomas; Martinicky, David; Ilencikova, Denisa [National Cancer Institute, Department of Oncologic Genetics, Klenova 1, 833 01 Bratislava (Slovakia); Bartosova, Zdena [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia)

    2009-11-20

    Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or

  10. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    Directory of Open Access Journals (Sweden)

    Ilencikova Denisa

    2009-11-01

    Full Text Available Abstract Background Depending on the population studied, large genomic rearrangements (LGRs of the mismatch repair (MMR genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC. It has been reported that loss of heterozygosity (LOH at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. Methods The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. Results We found six rearrangements in the MSH2 gene (five deletions and dup5-6, and one aberration in the MLH1 gene (del5-6. The MSH2 deletions were of three types (del1, del1-3, del1-7. We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. Conclusion LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1

  11. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    International Nuclear Information System (INIS)

    Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova; Slamka, Tomas; Martinicky, David; Ilencikova, Denisa; Bartosova, Zdena

    2009-01-01

    Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or

  12. Conversations with children about DNA and genes using an original children's book.

    Science.gov (United States)

    Newcomb, Patricia; Hudlow, Rachel; Heilskov, Joan; Martinez, Cynthia Diane; Le, Heather

    2014-01-01

    The purpose of this evaluation was to compare parent and nurse use of an original children's book about deoxyribonucleic acid (DNA) function as a potential aid in the assent process in research. We also appraised parent's knowledge about DNA and the use of genetic testing results. We used mixed qualitative and quantitative methods. Parent-child dyads were recruited at an urban pediatric hospital. Knowledge of genetic concepts was assessed in adults with use of the Genetic Knowledge Index. Participants read the book What DNA Does with a nurse or alone and participated in interviews with investigators. The content of field notes from interviews was analyzed. Parent and child knowledge of DNA and gene function was generally poor but improved in most cases, particularly after reading with the nurse. The evaluated book is appropriate as a teaching aid in the child assent process in research or prior to genetic testing but should be presented by clinicians in most cases. Copyright © 2014 National Association of Pediatric Nurse Practitioners. Published by Elsevier Inc. All rights reserved.

  13. Extensive gene conversion at the PMS2 DNA mismatch repair locus.

    Science.gov (United States)

    Hayward, Bruce E; De Vos, Michel; Valleley, Elizabeth M A; Charlton, Ruth S; Taylor, Graham R; Sheridan, Eamonn; Bonthron, David T

    2007-05-01

    Mutations of the PMS2 DNA repair gene predispose to a characteristic range of malignancies, with either childhood onset (when both alleles are mutated) or a partially penetrant adult onset (if heterozygous). These mutations have been difficult to detect, due to interference from a family of pseudogenes located on chromosome 7. One of these, the PMS2CL pseudogene, lies within a 100-kb inverted duplication (inv dup), 700 kb centromeric to PMS2 itself on 7p22. Here, we show that the reference genomic sequences cannot be relied upon to distinguish PMS2 from PMS2CL, because of sequence transfer between the two loci. The 7p22 inv dup occurred prior to the divergence of modern ape species (15 million years ago [Mya]), but has undergone extensive sequence homogenization. This process appears to be ongoing, since there is considerable allelic diversity within the duplicated region, much of it derived from sequence exchange between PMS2 and PMS2CL. This sequence diversity can result in both false-positive and false-negative mutation analysis at this locus. Great caution is still needed in the design and interpretation of PMS2 mutation screens. 2007 Wiley-Liss, Inc.

  14. Molecular Evolution of the CYP2D Subfamily in Primates: Purifying Selection on Substrate Recognition Sites without the Frequent or Long-Tract Gene Conversion

    Science.gov (United States)

    Yasukochi, Yoshiki; Satta, Yoko

    2015-01-01

    The human cytochrome P450 (CYP) 2D6 gene is a member of the CYP2D gene subfamily, along with the CYP2D7P and CYP2D8P pseudogenes. Although the CYP2D6 enzyme has been studied extensively because of its clinical importance, the evolution of the CYP2D subfamily has not yet been fully understood. Therefore, the goal of this study was to reveal the evolutionary process of the human drug metabolic system. Here, we investigate molecular evolution of the CYP2D subfamily in primates by comparing 14 CYP2D sequences from humans to New World monkey genomes. Window analysis and statistical tests revealed that entire genomic sequences of paralogous genes were extensively homogenized by gene conversion during molecular evolution of CYP2D genes in primates. A neighbor-joining tree based on genomic sequences at the nonsubstrate recognition sites showed that CYP2D6 and CYP2D8 genes were clustered together due to gene conversion. In contrast, a phylogenetic tree using amino acid sequences at substrate recognition sites did not cluster the CYP2D6 and CYP2D8 genes, suggesting that the functional constraint on substrate specificity is one of the causes for purifying selection at the substrate recognition sites. Our results suggest that the CYP2D gene subfamily in primates has evolved to maintain the regioselectivity for a substrate hydroxylation activity between individual enzymes, even though extensive gene conversion has occurred across CYP2D coding sequences. PMID:25808902

  15. Aspirin exposure reveals novel genes associated with platelet function and cardiovascular events.

    Science.gov (United States)

    Voora, Deepak; Cyr, Derek; Lucas, Joseph; Chi, Jen-Tsan; Dungan, Jennifer; McCaffrey, Timothy A; Katz, Richard; Newby, L Kristin; Kraus, William E; Becker, Richard C; Ortel, Thomas L; Ginsburg, Geoffrey S

    2013-10-01

    The aim of this study was to develop ribonucleic acid (RNA) profiles that could serve as novel biomarkers for the response to aspirin. Aspirin reduces death and myocardial infarction (MI), suggesting that aspirin interacts with biological pathways that may underlie these events. Aspirin was administered, followed by whole-blood RNA microarray profiling, in a discovery cohort of healthy volunteers (HV1) (n = 50) and 2 validation cohorts of healthy volunteers (HV2) (n = 53) and outpatient cardiology patients (OPC) (n = 25). Platelet function was assessed using the platelet function score (PFS) in HV1 and HV2 and the VerifyNow Aspirin Test (Accumetrics, Inc., San Diego, California) in OPC. Bayesian sparse factor analysis identified sets of coexpressed transcripts, which were examined for associations with PFS in HV1 and validated in HV2 and OPC. Proteomic analysis confirmed the association of validated transcripts in platelet proteins. Validated gene sets were tested for association with death or MI in 2 patient cohorts (n = 587 total) from RNA samples collected at cardiac catheterization. A set of 60 coexpressed genes named the "aspirin response signature" (ARS) was associated with PFS in HV1 (r = -0.31, p = 0.03), HV2 (r = -0.34, Bonferroni p = 0.03), and OPC (p = 0.046). Corresponding proteins for the 17 ARS genes were identified in the platelet proteome, of which 6 were associated with PFS. The ARS was associated with death or MI in both patient cohorts (odds ratio: 1.2 [p = 0.01]; hazard ratio: 1.5 [p = 0.001]), independent of cardiovascular risk factors. Compared with traditional risk factors, reclassification (net reclassification index = 31% to 37%, p ≤ 0.0002) was improved by including the ARS or 1 of its genes, ITGA2B. RNA profiles of platelet-specific genes are novel biomarkers for identifying patients who do not respond adequately to aspirin and who are at risk for death or MI. Copyright © 2013 American College of Cardiology Foundation. Published by

  16. Gene array analysis of neural crest cells identifies transcription factors necessary for direct conversion of embryonic fibroblasts into neural crest cells

    Directory of Open Access Journals (Sweden)

    Tsutomu Motohashi

    2016-03-01

    Full Text Available Neural crest cells (NC cells are multipotent cells that emerge from the edge of the neural folds and migrate throughout the developing embryo. Although the gene regulatory network for generation of NC cells has been elucidated in detail, it has not been revealed which of the factors in the network are pivotal to directing NC identity. In this study we analyzed the gene expression profile of a pure NC subpopulation isolated from Sox10-IRES-Venus mice and investigated whether these genes played a key role in the direct conversion of Sox10-IRES-Venus mouse embryonic fibroblasts (MEFs into NC cells. The comparative molecular profiles of NC cells and neural tube cells in 9.5-day embryos revealed genes including transcription factors selectively expressed in developing trunk NC cells. Among 25 NC cell-specific transcription factor genes tested, SOX10 and SOX9 were capable of converting MEFs into SOX10-positive (SOX10+ cells. The SOX10+ cells were then shown to differentiate into neurons, glial cells, smooth muscle cells, adipocytes and osteoblasts. These SOX10+ cells also showed limited self-renewal ability, suggesting that SOX10 and SOX9 directly converted MEFs into NC cells. Conversely, the remaining transcription factors, including well-known NC cell specifiers, were unable to convert MEFs into SOX10+ NC cells. These results suggest that SOX10 and SOX9 are the key factors necessary for the direct conversion of MEFs into NC cells.

  17. Analysis of 62 hybrid assembled human Y chromosomes exposes rapid structural changes and high rates of gene conversion

    DEFF Research Database (Denmark)

    Gonzalez-Izarzugaza, Jose Maria; Skov, Laurits; Maretty, Lasse

    2017-01-01

    The human Y-chromosome does not recombine across its male-specific part and is therefore an excellent marker of human migrations. It also plays an important role in male fertility. However, its evolution is difficult to fully understand because of repetitive sequences, inverted repeats and the po......The human Y-chromosome does not recombine across its male-specific part and is therefore an excellent marker of human migrations. It also plays an important role in male fertility. However, its evolution is difficult to fully understand because of repetitive sequences, inverted repeats...... and the potentially large role of gene conversion. Here we perform an evolutionary analysis of 62 Y-chromosomes of Danish descent sequenced using a wide range of library insert sizes and high coverage, thus allowing large regions of these chromosomes to be well assembled. These include 17 father-son pairs, which we...... use to validate variation calling. Using a recent method that can integrate variants based on both mapping and de novo assembly, we genotype 10898 SNVs and 2903 indels (max length of 27241 bp) in our sample and show by father-son concordance and experimental validation that the non-recurrent SNP...

  18. Mutational Biases and GC-Biased Gene Conversion Affect GC Content in the Plastomes of Dendrobium Genus

    Directory of Open Access Journals (Sweden)

    Zhitao Niu

    2017-11-01

    Full Text Available The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1 consistent GC content evolution trends and mutational biases in single-copy (SC and inverted repeats (IRs regions; and (2 that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus.

  19. Mutational Biases and GC-Biased Gene Conversion Affect GC Content in the Plastomes of Dendrobium Genus

    Science.gov (United States)

    Niu, Zhitao; Xue, Qingyun; Wang, Hui; Xie, Xuezhu; Zhu, Shuying; Liu, Wei; Ding, Xiaoyu

    2017-01-01

    The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC)—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1) consistent GC content evolution trends and mutational biases in single-copy (SC) and inverted repeats (IRs) regions; and (2) that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus. PMID:29099062

  20. The interaction of combined effects of the BDNF and PRKCG genes and negative life events in major depressive disorder.

    Science.gov (United States)

    Yang, Chunxia; Sun, Ning; Liu, Zhifen; Li, Xinrong; Xu, Yong; Zhang, Kerang

    2016-03-30

    Major depressive disorder (MDD) is a mental disorder that results from complex interplay between multiple and partially overlapping sets of susceptibility genes and environmental factors. The brain derived neurotrophic factor (BDNF) and Protein kinase C gamma type (PRKCG) are logical candidate genes in MDD. Among diverse environmental factors, negative life events have been suggested to exert a crucial impact on brain development. In the present study, we hypothesized that interactions between genetic variants in BDNF and PRKCG and negative life events may play an important role in the development of MDD. We recruited a total of 406 patients with MDD and 391 age- and gender-matched control subjects. Gene-environment interactions were analyzed using generalized multifactor dimensionality reduction (GMDR). Under a dominant model, we observed a significant three-way interaction among BDNF rs6265, PRKCG rs3745406, and negative life events. The gene-environment combination of PRKCG rs3745406 C allele, BDNF rs6265 G allele and high level of negative life events (C-G-HN) was significantly associated with MDD (OR, 5.97; 95% CI, 2.71-13.15). To our knowledge, this is the first report of evidence that the BDNF-PRKCG interaction may modify the relationship between negative life events and MDD in the Chinese population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. New gene cluster from the thermophile Bacillus fordii MH602 in the conversion of DL-5-substituted hydantoins to L-amino acids.

    Science.gov (United States)

    Mei, Yan-Zhen; Wan, Yong-Min; He, Bing-Fang; Ying, Han-Jie; Ouyang, Ping-Kai

    2009-12-01

    The thermophile Bacillus fordii MH602 was screened for stereospecifically hydrolyzing DL-5-substituted hydantoins to L-alpha-amino acids. Since the reaction at higher temperature, the advantageous for enhancement of substrate solubility and for racemization of DL-5-substituted hydantoins during the conversion were achieved. The hydantoin metabolism gene cluster from thermophile was firstly reported in this paper. The genes involved in hydantoin utilization (hyu) were isolated on an 8.2 kb DNA fragment by Restriction Site-dependent PCR, and six ORFs were identified by DNA sequence analysis. The hyu gene cluster contained four genes with novel cluster organization characteristics: the hydantoinase gene hyuH, putative transport protein hyuP, hyperprotein hyuHP, and L-carbamoylase gene hyuC. The hyuH and hyuC genes were heterogeneously expressed in E. coli. The results indicated that hyuH and hyuC are involved in the conversion of DL-5-substituted hydantoins to an N-carbamyl intermediate that is subsequently converted to L-alpha-amino acids. Hydantoinase and carbamoylase from B. fordii MH602 comparing respectively with reported hydantoinase and carbamoylase showed the highest identities of 71% and 39%. The novel cluster organization characteristics and the difference of the key enzymes between thermopile B. fordii MH602 and other mesophiles were presumed to be related to the evolutionary origins of concerned metabolism.

  2. Stressful life events and maltreatment in conversion (functional neurological) disorder: systematic review and meta-analysis of case-control studies.

    Science.gov (United States)

    Ludwig, Lea; Pasman, Joëlle A; Nicholson, Timothy; Aybek, Selma; David, Anthony S; Tuck, Sharon; Kanaan, Richard A; Roelofs, Karin; Carson, Alan; Stone, Jon

    2018-04-01

    Stressful life events and maltreatment have traditionally been considered crucial in the development of conversion (functional neurological) disorder, but the evidence underpinning this association is not clear. We aimed to assess the association between stressors and functional neurological disorder. We systematically reviewed controlled studies reporting stressors occurring in childhood or adulthood, such as stressful life events and maltreatment (including sexual, physical abuse, and emotional neglect) and functional neurological disorder. We did a meta-analysis, with assessments of methodology, sources of bias, and sensitivity analyses. 34 case-control studies, with 1405 patients, were eligible. Studies were of moderate-to-low quality. The frequency of childhood and adulthood stressors was increased in cases compared with controls. Odds ratios (OR) were higher for emotional neglect in childhood (49% for cases vs 20% for controls; OR 5·6, 95% CI 2·4-13·1) compared with sexual abuse (24% vs 10%; 3·3, 2·2-4·8) or physical abuse (30% vs 12%; 3·9, 2·2-7·2). An association with stressful life events preceding onset (OR 2·8, 95% CI 1·4-6·0) was stronger in studies with better methods (interviews; 4·3, 1·4-13·2). Heterogeneity was significant between studies (I 2 21·1-90·7%). 13 studies that specifically ascertained that the participants had not had either severe life events or any subtype of maltreatment all found a proportion of patients with functional neurological disorder reporting no stressor. Stressful life events and maltreatment are substantially more common in people with functional neurological disorder than in healthy controls and patient controls. Emotional neglect had a higher risk than traditionally emphasised sexual and physical abuse, but many cases report no stressors. This outcome supports changes to diagnostic criteria in DSM-5; stressors, although relevant to the cause in many patients, are not a core diagnostic feature. This

  3. DNA methyl transferase (DNMT gene polymorphisms could be a primary event in epigenetic susceptibility to schizophrenia.

    Directory of Open Access Journals (Sweden)

    Koramannil Radha Saradalekshmi

    Full Text Available DNA methylation has been implicated in the etiopathology of various complex disorders. DNA methyltransferases are involved in maintaining and establishing new methylation patterns. The aim of the present study was to investigate the inherent genetic variations within DNA methyltransferase genes in predisposing to susceptibility to schizophrenia. We screened for polymorphisms in DNA methyltransferases, DNMT1, DNMT3A, DNMT3B and DNMT3L in 330 schizophrenia patients and 302 healthy controls for association with Schizophrenia in south Indian population. These polymorphisms were also tested for subgroup analysis with patient's gender, age of onset and family history. DNMT1 rs2114724 (genotype P = .004, allele P = 0.022 and rs2228611 (genotype P = 0.004, allele P = 0.022 were found to be significantly associated at genotypic and allelic level with Schizophrenia in South Indian population. DNMT3B rs2424932 genotype (P = 0.023 and allele (P = 0.0063 increased the risk of developing schizophrenia in males but not in females. DNMT3B rs1569686 (genotype P = 0.027, allele P = 0.033 was found to be associated with early onset of schizophrenia and also with family history and early onset (genotype P = 0.009. DNMT3L rs2070565 (genotype P = 0.007, allele P = 0.0026 confers an increased risk of developing schizophrenia at an early age in individuals with family history. In-silico prediction indicated functional relevance of these SNPs in regulating the gene. These observations might be crucial in addressing and understanding the genetic control of methylation level differences from ethnic viewpoint. Functional significance of genotype variations within the DNMTs indeed suggest that the genetic nature of methyltransferases should be considered while addressing epigenetic events mediated by methylation in Schizophrenia.

  4. Dependence of the expression of the radiation-induced gene conversion to arginine independence in diploid yeast on the amino acid concentration: effect on allelic mapping

    International Nuclear Information System (INIS)

    Murthy, M.S.S.; Rao, B.S.; Deorukhakar, V.V.

    1976-01-01

    The yield of radiation-induced gene conversion to arginine independence in diploid yeast depended on the concentration of the amino acid both in the plating medium and in the intracellular pool. By depletion of the level of arginine in the intracellular pool of amino acid or by provision of arginine at 0.4 mg/l of the plating medium, the yield was varied by a factor as high as 20. This may be important in studies of the genetic mapping of alleles based on the slope of conversion frequency versus dose line

  5. In Silico Prediction of Horizontal Gene Transfer Events in Lactobacillus bulgaricus and Streptococcus thermophilus Reveals Protocooperation in Yogurt Manufacturing▿ †

    Science.gov (United States)

    Liu, Mengjin; Siezen, Roland J.; Nauta, Arjen

    2009-01-01

    Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions. PMID:19395564

  6. In silico prediction of horizontal gene transfer events in Lactobacillus bulgaricus and Streptococcus thermophilus reveals protocooperation in yogurt manufacturing.

    Science.gov (United States)

    Liu, Mengjin; Siezen, Roland J; Nauta, Arjen

    2009-06-01

    Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions.

  7. Interaction between serotonin transporter gene variants and life events predicts response to antidepressants in the GENDEP project

    DEFF Research Database (Denmark)

    Keers, R.; Uher, R.; Huezo-Diaz, P.

    2011-01-01

    , and several polymorphisms in the serotonin transporter gene (SLC6A4) have been genotyped including the serotonin transporter-linked polymorphic region (5-HTTLPR). Stressful life events were shown to predict a significantly better response to escitalopram but had no effect on response to nortriptyline...

  8. Conversion to Sirolimus Ameliorates Cyclosporine-Induced Nephropathy in the Rat: Focus on Serum, Urine, Gene, and Protein Renal Expression Biomarkers

    Directory of Open Access Journals (Sweden)

    José Sereno

    2014-01-01

    Full Text Available Protocols of conversion from cyclosporin A (CsA to sirolimus (SRL have been widely used in immunotherapy after transplantation to prevent CsA-induced nephropathy, but the molecular mechanisms underlying these protocols remain nuclear. This study aimed to identify the molecular pathways and putative biomarkers of CsA-to-SRL conversion in a rat model. Four animal groups (n=6 were tested during 9 weeks: control, CsA, SRL, and conversion (CsA for 3 weeks followed by SRL for 6 weeks. Classical and emergent serum, urinary, and kidney tissue (gene and protein expression markers were assessed. Renal lesions were analyzed in hematoxylin and eosin, periodic acid-Schiff, and Masson’s trichrome stains. SRL-treated rats presented proteinuria and NGAL (serum and urinary as the best markers of renal impairment. Short CsA treatment presented slight or even absent kidney lesions and TGF-β, NF-κβ, mTOR, PCNA, TP53, KIM-1, and CTGF as relevant gene and protein changes. Prolonged CsA exposure aggravated renal damage, without clear changes on the traditional markers, but with changes in serums TGF-β and IL-7, TBARs clearance, and kidney TGF-β and mTOR. Conversion to SRL prevented CsA-induced renal damage evolution (absent/mild grade lesions, while NGAL (serum versus urine seems to be a feasible biomarker of CsA replacement to SRL.

  9. Organization of genes responsible for the stereospecific conversion of hydantoins to alpha-amino acids in Arthrobacter aurescens DSM 3747.

    Science.gov (United States)

    Wiese, A; Syldatk, C; Mattes, R; Altenbuchner, J

    2001-09-01

    Arthrobacter aurescens DSM 3747 hydrolyzes stereospecifically 5'-monosubstituted hydantoins to alpha-amino acids. The genes involved in hydantoin utilization (hyu) were isolated on an 8.7-kb DNA fragment, and by DNA sequence analysis eight ORFs were identified. The hyu gene cluster includes four genes: hyuP encoding a putative transport protein, the hydantoin racemase gene hyuA, the hydantoinase gene hyuH, and the carbamoylase gene hyuC. The four genes are transcribed in the same direction. Upstream of hyuP and in opposite orientation to the hyu genes, three ORFs were found showing similarities to cytochrome P450 monooxygenase (ORF1, incomplete), to membrane proteins (ORF2), and to ferredoxin (ORF3). ORF8 was found downstream of hyuC and again in opposite orientation to the hyu genes. The gene product of ORF8 displayed similarities to the LacI/GalR family of transcriptional regulators. Reverse transcriptase PCR experiments and Northern blot analysis revealed that the genes hyuPAHC are coexpressed in A. aurescens after induction with 3-N-CH3-IMH. The expression of the hyu operon was not regulated by the putative regulator ORF8 as shown by gene disruption and mobility-shift experiments.

  10. The Influence of Major Life Events on Economic Attitudes in a World of Gene-Environment Interplay.

    Science.gov (United States)

    Hatemi, Peter K

    2013-10-01

    The role of "genes" on political attitudes has gained attention across disciplines. However, person-specific experiences have yet to be incorporated into models that consider genetic influences. Relying on a gene-environment interplay approach, this study explicates how life-events, such as losing one's job or suffering a financial loss, influence economic policy attitudes. The results indicate genetic and environmental variance on support for unions, immigration, capitalism, socialism and property tax is moderated by financial risks. Changes in the magnitude of genetic influences, however, are temporary. After two years, the phenotypic effects of the life events remain on most attitudes, but changes in the sources of individual differences do not. Univariate twin models that estimate the independent contributions of genes and environment on the variation of attitudes appear to provide robust baseline indicators of sources of individual differences. These estimates, however, are not event or day specific. In this way, genetic influences add stability, while environment cues change, and this process is continually updated.

  11. Evolution of GHF5 endoglucanase gene structure in plant-parasitic nematodes: no evidence for an early domain shuffling event.

    Science.gov (United States)

    Kyndt, Tina; Haegeman, Annelies; Gheysen, Godelieve

    2008-11-03

    the whole gene cassette, i.e. the GHF5 catalytic domain and the CBM2, rather than that it evolved by domain shuffling. Our evolutionary model for the gene structure in PPN GHF5 endoglucanases implies the occurrence of an early duplication event, and more recent gene duplications at genus or species level.

  12. Evolution of GHF5 endoglucanase gene structure in plant-parasitic nematodes: no evidence for an early domain shuffling event

    Directory of Open Access Journals (Sweden)

    Gheysen Godelieve

    2008-11-01

    PPN GHF5 endoglucanase gene most probably consisted of the whole gene cassette, i.e. the GHF5 catalytic domain and the CBM2, rather than that it evolved by domain shuffling. Our evolutionary model for the gene structure in PPN GHF5 endoglucanases implies the occurrence of an early duplication event, and more recent gene duplications at genus or species level.

  13. A Conversation Well Worth Remembering

    Science.gov (United States)

    Woolven-Allen, John

    2009-01-01

    To mark the 200th anniversary of Charles Darwin's birth, a special event was held at Oxford, which included a "Conversation" between Professor Richard Dawkins and Bishop Richard Harries. Here we present a personal reminiscence of the event.

  14. Specific Genes Associated with Adverse Events of Methylphenidate Use in the Pediatric Population

    DEFF Research Database (Denmark)

    Joensen, Beinta; Meyer, Morten; Aagaard, Lise

    2017-01-01

    were significantly associated with the following genes: appetite reduction (CES1*G); buccal-lingual movements (T1065G); diastolic blood pressure (ADRA2A Mspl C/C-GC); emotionality (DAT1*9/9); irritability (SNAP25 T1065G); picking (DRD4*7/DRD4*4); social withdrawal (DRD4*7/DRD4*4); somatic complaints...

  15. Gene-Environment Interaction Effects of Peer Deviance, Parental Knowledge and Stressful Life Events on Adolescent Alcohol Use.

    Science.gov (United States)

    Cooke, Megan E; Meyers, Jacquelyn L; Latvala, Antti; Korhonen, Tellervo; Rose, Richard J; Kaprio, Jaakko; Salvatore, Jessica E; Dick, Danielle M

    2015-10-01

    The purpose of this study was to address two methodological issues that have called into question whether previously reported gene-environment interaction (GxE) effects for adolescent alcohol use are 'real'. These issues are (1) the potential correlation between the environmental moderator and the outcome across twins and (2) non-linear transformations of the behavioral outcome. Three environments that have been previously studied (peer deviance, parental knowledge, and potentially stressful life events) were examined here. For each moderator (peer deviance, parental knowledge, and potentially stressful life events), a series of models was fit to both a raw and transformed measure of monthly adolescent alcohol use in a sample that included 825 dizygotic (DZ) and 803 monozygotic (MZ) twin pairs. The results showed that the moderating effect of peer deviance was robust to transformation, and that although the significance of moderating effects of parental knowledge and potentially stressful life events were dependent on the scale of the adolescent alcohol use outcome, the overall results were consistent across transformation. In addition, the findings did not vary across statistical models. The consistency of the peer deviance results and the shift of the parental knowledge and potentially stressful life events results between trending and significant, shed some light on why previous findings for certain moderators have been inconsistent and emphasize the importance of considering both methodological issues and previous findings when conducting and interpreting GxE analyses.

  16. Deduction of probable events of lateral gene transfer through comparison of phylogenetic trees by recursive consolidation and rearrangement

    Directory of Open Access Journals (Sweden)

    Charlebois Robert L

    2005-04-01

    Full Text Available Abstract Background When organismal phylogenies based on sequences of single marker genes are poorly resolved, a logical approach is to add more markers, on the assumption that weak but congruent phylogenetic signal will be reinforced in such multigene trees. Such approaches are valid only when the several markers indeed have identical phylogenies, an issue which many multigene methods (such as the use of concatenated gene sequences or the assembly of supertrees do not directly address. Indeed, even when the true history is a mixture of vertical descent for some genes and lateral gene transfer (LGT for others, such methods produce unique topologies. Results We have developed software that aims to extract evidence for vertical and lateral inheritance from a set of gene trees compared against an arbitrary reference tree. This evidence is then displayed as a synthesis showing support over the tree for vertical inheritance, overlaid with explicit lateral gene transfer (LGT events inferred to have occurred over the history of the tree. Like splits-tree methods, one can thus identify nodes at which conflict occurs. Additionally one can make reasonable inferences about vertical and lateral signal, assigning putative donors and recipients. Conclusion A tool such as ours can serve to explore the reticulated dimensionality of molecular evolution, by dissecting vertical and lateral inheritance at high resolution. By this, we mean that individual nodes can be examined not only for congruence, but also for coherence in light of LGT. We assert that our tools will facilitate the comparison of phylogenetic trees, and the interpretation of conflicting data.

  17. Gene conversion at the gray locus of Sordaria fimicola: fit of the experimental data to a hybrid DNA model of recombination.

    Science.gov (United States)

    Kalogeropoulos, A; Thuriaux, P

    1985-03-01

    A hybrid DNA (hDNA) model of recombination has been algebraically formulated, which allows the prediction of frequencies of postmeiotic segregation and conversion of a given allele and their probability of being associated with a crossing over. The model considered is essentially the "Aviemore model." In contrast to some other interpretations of recombination, it states that gene conversion can only result from the repair of heteroduplex hDNA, with postmeiotic segregation resulting from unrepaired heteroduplexes. The model also postulates that crossing over always occurs distally to the initiation site of the hDNA. Eleven types of conversion and postmeiotic segregation with or without associated crossover were considered. Their theoretical frequencies are given by 11 linear equations with ten variables, four describing heteroduplex repair, four giving the probability of hDNA formation and its topological properties and two giving the probability that crossing over occurs at the left or right of the converting allele. Using the experimental data of Kitani and coworkers on conversion at the six best studied gray alleles of Sordaria fimicola, we found that the model considered fit the data at a P level above or very close (allele h4) to the 5% level of sampling error provided that the hDNA is partly asymmetric. The best fitting solutions are such that the hDNA has an equal probability of being formed on either chromatid or, alternatively, that both DNA strands have the same probability of acting as the invading strand during hDNA formation. The two mismatches corresponding to a given allele are repaired with different efficiencies. Optimal solutions are found if one allows for repair to be more efficient on the asymmetric hDNA than on the symmetric one. In the case of allele g1, our data imply that the direction of repair is nonrandom with respect to the strand on which it occurs.

  18. Conservation of transcription factor binding events predicts gene expression across species

    OpenAIRE

    Hemberg, Martin; Kreiman, Gabriel

    2011-01-01

    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to funct...

  19. Pollination: a key event controlling the expression of genes related to phytohormone biosynthesis during grapevine berry formation.

    Science.gov (United States)

    Kühn, Nathalie; Arce-Johnson, Patricio

    2012-01-01

    Berry formation is the process of ovary conversion into a functional fruit, and is characterized by abrupt changes in the content of several phytohormones, associated with pollination and fertilization. Much effort has been made in order to improve our understanding of berry development, particularly from veraison to post-harvest time. However, the period of berry formation has been poorly investigated, despite its importance. Phytohormones are involved in the control of fruit formation; hence it is important to understand the regulation of their content at this stage. Grapevine is an excellent fleshy-fruit plant model since its fruits have particularities that differentiate them from those of commonly studied organisms. For instance, berries are prepared to cope with stress by producing several antioxidants and they are non-climacteric fruits. Also its genome is fully sequenced, which allows to identify genes involved in developmental processes. In grapevine, no link has been established between pollination and phytohormone biosynthesis, until recently. Here we highlight relevant findings regarding pollination effect on gene expression related to phytohormone biosynthesis, and present unpublished results showing how quickly this effect is achieved.

  20. MHC class IIB Exon 2 Polymorphism in the Grey Partridge (Perdix perdix) is shaped by selection, recombination and gene conversion

    Czech Academy of Sciences Publication Activity Database

    Promerová, Marta; Králová, Tereza; Bryjová, Anna; Albrecht, Tomáš; Bryja, Josef

    2013-01-01

    Roč. 8, č. 7 (2013), e69135 E-ISSN 1932-6203 R&D Projects: GA ČR GA206/08/1281 Institutional support: RVO:68081766 Keywords : major histocompatibility complex (MHC) * snipe Gallinago-media * Class-I genes * minimal-essential-MHC Subject RIV: EG - Zoology Impact factor: 3.534, year: 2013

  1. Discrete gene replication events drive coupling between the cell cycle and circadian clocks.

    Science.gov (United States)

    Paijmans, Joris; Bosman, Mark; Ten Wolde, Pieter Rein; Lubensky, David K

    2016-04-12

    Many organisms possess both a cell cycle to control DNA replication and a circadian clock to anticipate changes between day and night. In some cases, these two rhythmic systems are known to be coupled by specific, cross-regulatory interactions. Here, we use mathematical modeling to show that, additionally, the cell cycle generically influences circadian clocks in a nonspecific fashion: The regular, discrete jumps in gene-copy number arising from DNA replication during the cell cycle cause a periodic driving of the circadian clock, which can dramatically alter its behavior and impair its function. A clock built on negative transcriptional feedback either phase-locks to the cell cycle, so that the clock period tracks the cell division time, or exhibits erratic behavior. We argue that the cyanobacterium Synechococcus elongatus has evolved two features that protect its clock from such disturbances, both of which are needed to fully insulate it from the cell cycle and give it its observed robustness: a phosphorylation-based protein modification oscillator, together with its accompanying push-pull read-out circuit that responds primarily to the ratios of different phosphoform concentrations, makes the clock less susceptible to perturbations in protein synthesis; the presence of multiple, asynchronously replicating copies of the same chromosome diminishes the effect of replicating any single copy of a gene.

  2. Catechol-o-methyltransferase gene polymorphism modifies the effect of coffee intake on incidence of acute coronary events.

    Directory of Open Access Journals (Sweden)

    Pertti Happonen

    Full Text Available BACKGROUND: The role of coffee intake as a risk factor for coronary heart disease (CHD has been debated for decades. We examined whether the relationship between coffee intake and incidence of CHD events is dependent on the metabolism of circulating catecholamines, as determined by functional polymorphism of the catechol-O-methyltransferase (COMT gene. METHODOLOGY/PRINCIPAL FINDINGS: In a cohort of 773 men who were 42 to 60 years old and free of symptomatic CHD at baseline in 1984-89, 78 participants experienced an acute coronary event during an average follow-up of 13 years. In logistic regression adjusting for age, smoking, family history of CHD, vitamin C deficiency, blood pressure, plasma cholesterol concentration, and diabetes, the odds ratio (90% confidence interval comparing heavy coffee drinkers with the low activity COMT genotype with those with the high activity or heterozygotic genotypes was 3.2 (1.2-8.4. Urinary adrenaline excretion increased with increasing coffee intake, being over two-fold in heavy drinkers compared with nondrinkers (p = 0.008 for trend. CONCLUSIONS/SIGNIFICANCE: Heavy coffee consumption increases the incidence of acute coronary events in men with low but not high COMT activity. Further studies are required to determine to which extent circulating catecholamines mediate the relationship between coffee intake and CHD.

  3. Postnatal events in intestinal gene expression and splenic cell composition is altered in NOD mice

    DEFF Research Database (Denmark)

    Damlund, Dina Silke Malling; Metzdorff, Stine Broeng; Kristensen, Matilde Bylov

    2013-01-01

    microbiota seems to play an important role in the development and control of T1D. We hypothesized that NOD mice in the perinatal period respond differently than mice not prone to develop T1D (C57/Bl6), and we investigated the differences in postnatal expression of genes in gut, spleen, liver and pancreas......Evidence suggests that colonisation pattern of the gut in the early postnatal period is highly correlated with the risk of developing type 1 diabetes (T1D). We have recently shown that colonization in SPF mice accelerates gut maturation and that at postnatal day (PND) 1, in comparison with germ...... free mice, certain chemokines, including Cxcl2 encoding macrophage inflammatory protein (MIP)-2 and involved in attraction of neutrophils was downregulated in the gut epithelium. The non-obese diabetes (NOD) mouse is widely used as a model for studying the pathogenesis of T1D. The neonatal gut...

  4. Depletion of Key Meiotic Genes and Transcriptome-Wide Abiotic Stress Reprogramming Mark Early Preparatory Events Ahead of Apomeiotic Transition

    Directory of Open Access Journals (Sweden)

    Jubin N Shah

    2016-10-01

    Full Text Available Molecular dissection of apomixis - an asexual reproductive mode - is anticipated to solve the enigma of loss of meiotic sex, and to help fixing elite agronomic traits. The Brassicaceae genus Boechera comprises of both sexual and apomictic species, permitting comparative analyses of meiotic circumvention (apomeiosis and parthenogenesis. Whereas previous studies reported local transcriptome changes during these events, it remained unclear whether global changes associated with hybridization, polyploidy and environmental adaptation that arose during evolution of Boechera might hint as (epigenetic regulators of early development prior apomictic initiation. To identify these signatures during vegetative stages, we compared seedling RNA-seq transcriptomes of an obligate triploid apomict and a diploid sexual, both isolated from a drought-prone habitat. Uncovered were several genes differentially expressed between sexual and apomictic seedlings, including homologues of meiotic genes ASYNAPTIC 1 (ASY1 and MULTIPOLAR SPINDLE 1 (MPS1 that were down-regulated in apomicts. An intriguing class of apomict-specific deregulated genes included several NAC transcription factors, homologues of which are known to be transcriptionally reprogrammed during abiotic stress in other plants. Deregulation of both meiotic and stress-response genes during seedling stages might possibly be important in preparation for meiotic circumvention, as similar transcriptional alteration was discernible in apomeiotic floral buds too. Furthermore, we noted that the apomict showed better tolerance to osmotic stress in vitro than the sexual, in conjunction with significant upregulation of a subset of NAC genes. In support of the current model that DNA methylation epigenetically regulates stress, ploidy, hybridization and apomixis, we noted that ASY1, MPS1 and NAC019 homologues were deregulated in Boechera seedlings upon DNA demethylation, and ASY1 in particular seems to be repressed by

  5. A serotonin transporter gene polymorphism (5-HTTLPR), drinking-to-cope motivation, and negative life events among college students.

    Science.gov (United States)

    Armeli, Stephen; Conner, Tamlin S; Covault, Jonathan; Tennen, Howard; Kranzler, Henry R

    2008-11-01

    This study was performed to examine whether a polymorphism (5-HTTLPR) in the serotonin transporter gene was related to college students' reports of relief drinking (drinking-to-cope motives) and whether it moderated the associations between negative life events and drinking to cope. We examined reward drinking (drinking-to-enhance motives) as a comparison and to see whether these effects varied across gender. Using an Internet-based survey, college students (N = 360; 192 women) self-reported on drinking motives and negative life events for up to 4 years. Study participants provided saliva for genotyping the triallelic (LA vs LG or S) variants of 5-HTTLPR. Among men, individuals with two risk alleles (LG or S), compared with individuals with the LA/LA allele, displayed lower drinking-to-cope motives. Among women, individuals with one risk allele (either LG or S), compared with individuals with the LA/LA allele, displayed stronger drinking-to-enhance motives. The association between yearly changes in negative life events and drinking-to-cope motives varied across 5-HTTLPR genotype and gender and was strongest in the positive direction for women with the LA/LA variant. Our findings are not consistent with prior speculation that stronger positive associations between life stress and alcohol use among individuals with the LG or S allele are the result of increased use of alcohol as a method for coping with stress. The importance of examining gender differences in the relations between 5-HTTLPR, substance use, and related constructs is also noted.

  6. Paraoxonase 1 (Q192R) gene polymorphism, coronary heart disease and the risk of a new acute coronary event.

    Science.gov (United States)

    Martínez-Quintana, Efrén; Rodríguez-González, Fayna; Medina-Gil, José María; Garay-Sánchez, Paloma; Tugores, Antonio

    Paraoxonase 1 (PON1) plays a major role in the oxidation of low density lipoprotein and in the prevention of coronary atherogenesis. In this context, coding region polymorphisms of PON1 gene, responsible for the enzyme activity, has become of interest as a marker for atherogenesis. A study and follow-up was conducted on 529 patients with an acute coronary event in order to assess the association between the PON1 Q192R (rs662;A/G) polymorphism, the type of acute coronary syndrome, cardiovascular risk factors (arterial hypertension, diabetes mellitus, dyslipidaemia, and smoking), the extent and severity of coronary atherosclerosis, and the medium-term clinical follow-up. The QQ genotype was found in 245 (46.3%) patients, with 218 (41.2%) patients showing the QR genotype, and 66 (14.5%) patients had the RR genotype. No significant differences were found between the QQ and QR/RR genotypes as regards the clinical characteristics, the analytical data, and the angiographic variables. Similarly, Kaplan-Meier survival analysis showed no significant differences in presenting with a new acute coronary event (p=0.598), cardiac mortality (p=0.701), stent thrombosis (p=0.508), or stent re-stenosis (p=0.598) between QQ and QR/RR genotypes during the follow-up period (3.3±2.2 years). In patients with an acute coronary syndrome, the PON1 Q192R genotypes did not influence the risk of suffering a new acute coronary event during the medium-term follow-up. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

  7. Mouse Mammary Tumor Virus Promoter-Containing Retroviral Promoter Conversion Vectors for Gene-Directed Enzyme Prodrug Therapy are Functional in Vitro and in Vivo

    Directory of Open Access Journals (Sweden)

    Reinhard Klein

    2008-01-01

    Full Text Available Gene directed-enzyme prodrug therapy (GDEPT is an approach for sensitization of tumor cells to an enzymatically activated, otherwise nontoxic, prodrug. Cytochrome P450 2B1 (CYP2B1 metabolizes the prodrugs cyclophosphamide (CPA and ifosfamide (IFA to produce the cytotoxic substances phosphoramide mustard and isophosphoramide mustard as well as the byproduct acrolein. We have constructed a retroviral promoter conversion (ProCon vector for breast cancer GDEPT. The vector allows expression of CYP2B1 from the mouse mammary tumor virus (MMTV promoter known to be active in the mammary glands of transgenic animals. It is anticipated to be used for the generation of encapsulated viral vector producing cells which, when placed inside or close to a tumor, will act as suppliers of the therapeutic CYP2B1 protein as well as of the therapeutic vector itself. The generated vector was effectively packaged by virus producing cells and allowed the production of high levels of enzymatically active CYP2B1 in infected cells which sensitized them to killing upon treatment with both IFA and CPA. Determination of the respective IC50 values demonstrated that the effective IFA dose was reduced by sixteen folds. Infection efficiencies in vivo were determined using a reporter gene-bearing vector in a mammary cancer cell-derived xenograft tumor mouse model.

  8. Exercise-Induced Rhabdomyolysis and Stress-Induced Malignant Hyperthermia Events, Association with Malignant Hyperthermia Susceptibility, and RYR1 Gene Sequence Variations

    Directory of Open Access Journals (Sweden)

    Antonella Carsana

    2013-01-01

    Full Text Available Exertional rhabdomyolysis (ER and stress-induced malignant hyperthermia (MH events are syndromes that primarily afflict military recruits in basic training and athletes. Events similar to those occurring in ER and in stress-induced MH events are triggered after exposure to anesthetic agents in MH-susceptible (MHS patients. MH is an autosomal dominant hypermetabolic condition that occurs in genetically predisposed subjects during general anesthesia, induced by commonly used volatile anesthetics and/or the neuromuscular blocking agent succinylcholine. Triggering agents cause an altered intracellular calcium regulation. Mutations in RYR1 gene have been found in about 70% of MH families. The RYR1 gene encodes the skeletal muscle calcium release channel of the sarcoplasmic reticulum, commonly known as ryanodine receptor type 1 (RYR1. The present work reviews the documented cases of ER or of stress-induced MH events in which RYR1 sequence variations, associated or possibly associated to MHS status, have been identified.

  9. Predictability of Conversation Partners

    Science.gov (United States)

    Takaguchi, Taro; Nakamura, Mitsuhiro; Sato, Nobuo; Yano, Kazuo; Masuda, Naoki

    2011-08-01

    Recent developments in sensing technologies have enabled us to examine the nature of human social behavior in greater detail. By applying an information-theoretic method to the spatiotemporal data of cell-phone locations, [C. Song , ScienceSCIEAS0036-8075 327, 1018 (2010)] found that human mobility patterns are remarkably predictable. Inspired by their work, we address a similar predictability question in a different kind of human social activity: conversation events. The predictability in the sequence of one’s conversation partners is defined as the degree to which one’s next conversation partner can be predicted given the current partner. We quantify this predictability by using the mutual information. We examine the predictability of conversation events for each individual using the longitudinal data of face-to-face interactions collected from two company offices in Japan. Each subject wears a name tag equipped with an infrared sensor node, and conversation events are marked when signals are exchanged between sensor nodes in close proximity. We find that the conversation events are predictable to a certain extent; knowing the current partner decreases the uncertainty about the next partner by 28.4% on average. Much of the predictability is explained by long-tailed distributions of interevent intervals. However, a predictability also exists in the data, apart from the contribution of their long-tailed nature. In addition, an individual’s predictability is correlated with the position of the individual in the static social network derived from the data. Individuals confined in a community—in the sense of an abundance of surrounding triangles—tend to have low predictability, and those bridging different communities tend to have high predictability.

  10. Predictability of Conversation Partners

    Directory of Open Access Journals (Sweden)

    Taro Takaguchi

    2011-09-01

    Full Text Available Recent developments in sensing technologies have enabled us to examine the nature of human social behavior in greater detail. By applying an information-theoretic method to the spatiotemporal data of cell-phone locations, [C. Song et al., Science 327, 1018 (2010SCIEAS0036-8075] found that human mobility patterns are remarkably predictable. Inspired by their work, we address a similar predictability question in a different kind of human social activity: conversation events. The predictability in the sequence of one’s conversation partners is defined as the degree to which one’s next conversation partner can be predicted given the current partner. We quantify this predictability by using the mutual information. We examine the predictability of conversation events for each individual using the longitudinal data of face-to-face interactions collected from two company offices in Japan. Each subject wears a name tag equipped with an infrared sensor node, and conversation events are marked when signals are exchanged between sensor nodes in close proximity. We find that the conversation events are predictable to a certain extent; knowing the current partner decreases the uncertainty about the next partner by 28.4% on average. Much of the predictability is explained by long-tailed distributions of interevent intervals. However, a predictability also exists in the data, apart from the contribution of their long-tailed nature. In addition, an individual’s predictability is correlated with the position of the individual in the static social network derived from the data. Individuals confined in a community—in the sense of an abundance of surrounding triangles—tend to have low predictability, and those bridging different communities tend to have high predictability.

  11. C-reactive protein gene C1444T polymorphism and risk of recurrent ischemic events in patients with symptomatic intracranial atherostenoses.

    Science.gov (United States)

    Arenillas, Juan F; Massot, Andreu; Alvarez-Sabín, Jose; Fernandez-Cadenas, Israel; del Rio-Espinola, Albert; Chacon, Pilar; Quintana, Manuel; Molina, Carlos A; Rovira, Alex; Montaner, Joan

    2009-01-01

    High levels of C-reactive protein (CRP) are associated with an increased risk of further ischemic events in patients with symptomatic intracranial atherosclerotic disease (ICAD). It remains unknown to which extent this increased risk might be genetically predetermined. We aimed to investigate the relationship between a common genetic polymorphism of the CRP gene and the risk of recurrent ischemic events in symptomatic ICAD patients. We studied 75 consecutive patients with a first-ever cerebral ischemic event attributable to symptomatic ICAD. Blood samples were drawn 3 months after the qualifying event. Genomic DNA was isolated and the C1444T single nucleotide polymorphism (SNP) of the CRP gene was determined. The blood concentration of CRP was also measured. Patients underwent long-term clinical follow-up to detect the occurrence of further major ischemic events. During a median follow-up time of 23 months, 18 patients (24%) suffered a major ischemic event (10 ischemic strokes, 3 transient ischemic attacks and 5 myocardial infarctions). Raised CRP levels at baseline (p = 0.02) and the presence of the T allele within the CRP C1444T SNP were associated with a higher risk of recurrent ischemic events (p = 0.02). Kaplan-Meier and multivariable Cox regression analyses adjusted for age, sex, vascular risk factors and CRP level identified that the presence of the T allele in the studied polymorphism predicted the occurrence of further ischemic events (hazard ratio 3.6, 95% confidence interval 1.2-11.1; p = 0.025). The presence of the T allele within the CRP gene C1444T polymorphism may be associated with a higher risk of further ischemic events in symptomatic ICAD patients. (c) 2009 S. Karger AG, Basel.

  12. Interleukin-1 beta gene deregulation associated with chromosomal rearrangement: A candidate initiating event for murine radiation-myeloid leukemogenesis

    International Nuclear Information System (INIS)

    Silver, A.; Boultwood, J.; Breckon, G.; Masson, W.; Adam, J.; Shaw, A.R.; Cox, R.

    1989-01-01

    The incidence of acute myeloid leukemia (AML) in CBA/H mice following exposure to single acute doses of ionizing radiation has previously been determined. A high proportion of these AMLs are characterized by rearrangement of murine chromosome 2 in the C2 and/or E5-F regions, and there is evidence that these events are a direct consequence of radiation damage to multipotential hemopoietic cells. Using a combination of in situ chromosome hybridization and mRNA analyses, we show that the cytokine gene interleukin-1 beta (IL-1 beta) is encoded in the chromosome 2 F region and is translocated in a chromosome 2---2 rearrangement in an x-ray-induced AML (N36). Also, IL-1 beta is specifically deregulated in N36 and in two other chromosome 2-rearranged AMLs but not in a fourth, which has two cytogenetically normal chromosome 2 copies. We suggest that radiation-induced specific chromosome 2 rearrangement associated with IL-1 beta deregulation may initiate murine leukemogenesis through the uncoupling of normal proliferative control mechanisms in multipotential hemopoietic cells

  13. Uranium conversion

    International Nuclear Information System (INIS)

    Oliver, Lena; Peterson, Jenny; Wilhelmsen, Katarina

    2006-03-01

    FOI, has performed a study on uranium conversion processes that are of importance in the production of different uranium compounds in the nuclear industry. The same conversion processes are of interest both when production of nuclear fuel and production of fissile material for nuclear weapons are considered. Countries that have nuclear weapons ambitions, with the intention to produce highly enriched uranium for weapons purposes, need some degree of uranium conversion capability depending on the uranium feed material available. This report describes the processes that are needed from uranium mining and milling to the different conversion processes for converting uranium ore concentrate to uranium hexafluoride. Uranium hexafluoride is the uranium compound used in most enrichment facilities. The processes needed to produce uranium dioxide for use in nuclear fuel and the processes needed to convert different uranium compounds to uranium metal - the form of uranium that is used in a nuclear weapon - are also presented. The production of uranium ore concentrate from uranium ore is included since uranium ore concentrate is the feed material required for a uranium conversion facility. Both the chemistry and principles or the different uranium conversion processes and the equipment needed in the processes are described. Since most of the equipment that is used in a uranium conversion facility is similar to that used in conventional chemical industry, it is difficult to determine if certain equipment is considered for uranium conversion or not. However, the chemical conversion processes where UF 6 and UF 4 are present require equipment that is made of corrosion resistant material

  14. Conversation Analysis.

    Science.gov (United States)

    Schiffrin, Deborah

    1990-01-01

    Summarizes the current state of research in conversation analysis, referring primarily to six different perspectives that have developed from the philosophy, sociology, anthropology, and linguistics disciplines. These include pragmatics; speech act theory; interactional sociolinguistics; ethnomethodology; ethnography of communication; and…

  15. Low-dose gamma-rays and simulated solar particle event protons modify splenocyte gene and cytokine expression patterns

    International Nuclear Information System (INIS)

    Rizvi, A.; Pecaut, M.J.; Gridley, D.S.

    2011-01-01

    The goal was to investigate the T helper (Th) response in splenocytes of mice exposed to low-dose/low-dose-rate (LDR) γ-rays, simulated solar particle event protons (sSPE), or combination of both. C57BL/6 mice were exposed to LDR γ-radiation ( 57 Co) to a total dose of 0.05 Gray (Gy) at 0.024 cGy/h, either with or without subsequent exposure to 2 Gy sSPE protons. Expression of genes related to Th cells was evaluated immediately after exposure (day 0). On day 21, intra- and extracellular cytokine production was assessed after activation with anti-CD3 monoclonal antibodies (mAb) or phorbol 12-myristate 13-acetate/ionophore (PMA/I). Five genes were significantly modulated on day 0 in one or more of the irradiated groups compared to controls (p<0.05): Ccl11, Ccr5, Cd80, Inha, and Il9. On day 21, numbers of cells positive for interferon-γ were high in the LDR + sSPE group versus 0 Gy and LDR γ-rays (p<0.05), but there was no difference in interleukin (IL)-2 and tumor necrosis factor (TNF)-α. Levels of secreted cytokines after anti-CD3 mAb activation were high for 5 (maximum intensity projection (MIP)-1α, GM-CSF, interferon (IFN)-γ, TNF-α, IL-13) and low for 2 (IL-7, IL-9) in all irradiated groups. Priming with LDR photons had a significant effect on IFN-γ and IL-17 compared to sSPE protons alone; IL-2 was low only in the LDR + sSPE group. The cytokine patterns after anti-phorbol myristate acetate (PMA)/ionomycin (I) activation were different compared to anti-CD3 mAb and with fewer differences among groups. The data show that total-body exposure to space-relevant radiation has profound effects on Th cell status and that priming with LDR γ-rays can in some cases modulate the response to sSPE. (author)

  16. Transcriptomic events involved in melon mature-fruit abscission comprise the sequential induction of cell-wall degrading genes coupled to a stimulation of endo and exocytosis.

    Directory of Open Access Journals (Sweden)

    Jorge Corbacho

    Full Text Available Mature-fruit abscission (MFA in fleshy-fruit is a genetically controlled process with mechanisms that, contrary to immature-fruit abscission, has not been fully characterized. Here, we use pyrosequencing to characterize the transcriptomes of melon abscission zone (AZ at three stages during AZ-cell separation in order to understand MFA control at an early stage of AZ-activation.The results show that by early induction of MFA, the melon AZ exhibits major gene induction, while by late induction of MFA, melon AZ shows major gene repression. Although some genes displayed similar regulation in both early and late induction of abscission, such as EXT1-EXT4, EGase1, IAA2, ERF1, AP2D15, FLC, MADS2, ERAF17, SAP5 and SCL13 genes, the majority had different expression patterns. This implies that time-specific events occur during MFA, and emphasizes the value of characterizing multiple time-specific abscission transcriptomes. Analysis of gene-expression from these AZs reveal that a sequential induction of cell-wall-degrading genes is associated with the upregulation of genes involved in endo and exocytosis, and a shift in plant-hormone metabolism and signaling genes during MFA. This is accompanied by transcriptional activity of small-GTPases and synthaxins together with tubulins, dynamins, V-type ATPases and kinesin-like proteins potentially involved in MFA signaling. Early events are potentially controlled by down-regulation of MADS-box, AP2/ERF and Aux/IAA transcription-factors, and up-regulation of homeobox, zinc finger, bZIP, and WRKY transcription-factors, while late events may be controlled by up-regulation of MYB transcription-factors.Overall, the data provide a comprehensive view on MFA in fleshy-fruit, identifying candidate genes and pathways associated with early induction of MFA. Our comprehensive gene-expression profile will be very useful for elucidating gene regulatory networks of the MFA in fleshy-fruit.

  17. Opposing Forces of A/T-Biased Mutations and G/C-Biased Gene Conversions Shape the Genome of the Nematode Pristionchus pacificus

    Science.gov (United States)

    Weller, Andreas M.; Rödelsperger, Christian; Eberhardt, Gabi; Molnar, Ruxandra I.; Sommer, Ralf J.

    2014-01-01

    Base substitution mutations are a major source of genetic novelty and mutation accumulation line (MAL) studies revealed a nearly universal AT bias in de novo mutation spectra. While a comparison of de novo mutation spectra with the actual nucleotide composition in the genome suggests the existence of general counterbalancing mechanisms, little is known about the evolutionary and historical details of these opposing forces. Here, we correlate MAL-derived mutation spectra with patterns observed from population resequencing. Variation observed in natural populations has already been subject to evolutionary forces. Distinction between rare and common alleles, the latter of which are close to fixation and of presumably older age, can provide insight into mutational processes and their influence on genome evolution. We provide a genome-wide analysis of de novo mutations in 22 MALs of the nematode Pristionchus pacificus and compare the spectra with natural variants observed in resequencing of 104 natural isolates. MALs show an AT bias of 5.3, one of the highest values observed to date. In contrast, the AT bias in natural variants is much lower. Specifically, rare derived alleles show an AT bias of 2.4, whereas common derived alleles close to fixation show no AT bias at all. These results indicate the existence of a strong opposing force and they suggest that the GC content of the P. pacificus genome is in equilibrium. We discuss GC-biased gene conversion as a potential mechanism acting against AT-biased mutations. This study provides insight into genome evolution by combining MAL studies with natural variation. PMID:24414549

  18. Oncogenic Activation of Fibroblast Growth Factor Receptor-3 and RAS Genes as Non-Overlapping Mutual Exclusive Events in Urinary Bladder Cancer.

    Science.gov (United States)

    Pandith, Arshad A; Hussain, Aashaq; Khan, Mosin S; Shah, Zafar A; Wani, M Saleem; Siddiqi, Mushtaq A

    2016-01-01

    Urinary bladder cancer is a common malignancy in the West and ranks as the 7th most common cancer in our region of Kashmir, India. FGFR3 mutations are frequent in superficial urothelial carcinoma (UC) differing from the RAS gene mutational pattern. The aim of this study was to analyze the frequency and association of FGFR3 and RAS gene mutations in UC cases. Paired tumor and adjacent normal tissue specimens of 65 consecutive UC patients were examined. DNA preparations were evaluated for the occurrence of FGFR3 and RAS gene mutations by PCR-SCCP and DNA sequencing. Somatic point mutations of FGFR3 were identified in 32.3% (21 of 65). The pattern and distribution were significantly associated with low grade/stage (<0.05). The overall mutations in exon 1 and 2 in all the forms of RAS genes aggregated to 21.5% and showed no association with any clinic-pathological parameters. In total, 53.8% (35 of 65) of the tumors studied had mutations in either a RAS or FGFR3 gene, but these were totally mutually exclusive in and none of the samples showed both the mutational events in mutually exclusive RAS and FGFR3. We conclude that RAS and FGFR3 mutations in UC are mutually exclusive and non-overlapping events which reflect activation of oncogenic pathways through different elements.

  19. Pictorial Conversations.

    Science.gov (United States)

    Hooper, Kristina

    1982-01-01

    Provides the rationale for considering communication in a graphic domain and suggests a specific goal for designing work stations which provide graphic capabilities in educational settings. The central element of this recommendation is the "pictorial conversation", a highly interactive exchange that includes pictures as the central elements.…

  20. Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

    Science.gov (United States)

    Boulila, Moncef

    2010-06-01

    To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

  1. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  2. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  3. Effects of subtherapeutic concentrations of antimicrobials on gene acquisition events in Yersinia, Proteus, Shigella, and Salmonella recipient organisms in isolated ligated intestinal loops of swine.

    Science.gov (United States)

    Brewer, Matt T; Xiong, Nalee; Anderson, Kristi L; Carlson, Steve A

    2013-08-01

    To assess antimicrobial resistance and transfer of virulence genes facilitated by subtherapeutic concentrations of antimicrobials in swine intestines. 20 anesthetized pigs experimentally inoculated with donor and recipient bacteria. 4 recipient pathogenic bacteria (Salmonella enterica serotype Typhimurium, Yersinia enterocolitica, Shigella flexneri, or Proteus mirabilis) were incubated with donor bacteria in the presence of subinhibitory concentrations of 1 of 16 antimicrobials in isolated ligated intestinal loops in swine. Donor Escherichia coli contained transferrable antimicrobial resistance or virulence genes. After coincubations, intestinal contents were removed and assessed for pathogens that acquired new antimicrobial resistance or virulence genes following exposure to the subtherapeutic concentrations of antimicrobials. 3 antimicrobials (apramycin, lincomycin, and neomycin) enhanced transfer of an antimicrobial resistance plasmid from commensal E coli organisms to Yersinia and Proteus organisms, whereas 7 antimicrobials (florfenicol, hygromycin, penicillin G, roxarsone, sulfamethazine, tetracycline, and tylosin) exacerbated transfer of an integron (Salmonella genomic island 1) from Salmonella organisms to Yersinia organisms. Sulfamethazine induced the transfer of Salmonella pathogenicity island 1 from pathogenic to nonpathogenic Salmonella organisms. Six antimicrobials (bacitracin, carbadox, erythromycin, sulfathiazole, tiamulin, and virginiamycin) did not mediate any transfer events. Sulfamethazine was the only antimicrobial implicated in 2 types of transfer events. 10 of 16 antimicrobials at subinhibitory or subtherapeutic concentrations augmented specific antimicrobial resistance or transfer of virulence genes into pathogenic bacteria in isolated intestinal loops in swine. Use of subtherapeutic antimicrobials in animal feed may be associated with unwanted collateral effects.

  4. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  5. Conversion of Questionnaire Data

    International Nuclear Information System (INIS)

    Powell, Danny H.; Elwood, Robert H. Jr.

    2011-01-01

    During the survey, respondents are asked to provide qualitative answers (well, adequate, needs improvement) on how well material control and accountability (MC and A) functions are being performed. These responses can be used to develop failure probabilities for basic events performed during routine operation of the MC and A systems. The failure frequencies for individual events may be used to estimate total system effectiveness using a fault tree in a probabilistic risk analysis (PRA). Numeric risk values are required for the PRA fault tree calculations that are performed to evaluate system effectiveness. So, the performance ratings in the questionnaire must be converted to relative risk values for all of the basic MC and A tasks performed in the facility. If a specific material protection, control, and accountability (MPC and A) task is being performed at the 'perfect' level, the task is considered to have a near zero risk of failure. If the task is performed at a less than perfect level, the deficiency in performance represents some risk of failure for the event. As the degree of deficiency in performance increases, the risk of failure increases. If a task that should be performed is not being performed, that task is in a state of failure. The failure probabilities of all basic events contribute to the total system risk. Conversion of questionnaire MPC and A system performance data to numeric values is a separate function from the process of completing the questionnaire. When specific questions in the questionnaire are answered, the focus is on correctly assessing and reporting, in an adjectival manner, the actual performance of the related MC and A function. Prior to conversion, consideration should not be given to the numeric value that will be assigned during the conversion process. In the conversion process, adjectival responses to questions on system performance are quantified based on a log normal scale typically used in human error analysis (see A

  6. Quantum conversion

    OpenAIRE

    Mazilu, Michael

    2015-01-01

    ICOAM 2015 The electromagnetic momentum transferred transferred to scattering particles is proportional to the intensity of the incident fields, however, the momentum of single photons ℏk does not naturally appear in these classical expressions. Here, we discuss an alternative to Maxwell's stress tensor that renders the classical electromagnetic field momentum compatible to the quantum mechanical one. This is achieved through the introduction of the quantum conversion which allows the tran...

  7. Conversational sensemaking

    Science.gov (United States)

    Preece, Alun; Webberley, Will; Braines, Dave

    2015-05-01

    Recent advances in natural language question-answering systems and context-aware mobile apps create opportunities for improved sensemaking in a tactical setting. Users equipped with mobile devices act as both sensors (able to acquire information) and effectors (able to act in situ), operating alone or in collectives. The currently- dominant technical approaches follow either a pull model (e.g. Apple's Siri or IBM's Watson which respond to users' natural language queries) or a push model (e.g. Google's Now which sends notifications to a user based on their context). There is growing recognition that users need more flexible styles of conversational interaction, where they are able to freely ask or tell, be asked or told, seek explanations and clarifications. Ideally such conversations should involve a mix of human and machine agents, able to collaborate in collective sensemaking activities with as few barriers as possible. Desirable capabilities include adding new knowledge, collaboratively building models, invoking specific services, and drawing inferences. As a step towards this goal, we collect evidence from a number of recent pilot studies including natural experiments (e.g. situation awareness in the context of organised protests) and synthetic experiments (e.g. human and machine agents collaborating in information seeking and spot reporting). We identify some principles and areas of future research for "conversational sensemaking".

  8. Conversational sensing

    Science.gov (United States)

    Preece, Alun; Gwilliams, Chris; Parizas, Christos; Pizzocaro, Diego; Bakdash, Jonathan Z.; Braines, Dave

    2014-05-01

    Recent developments in sensing technologies, mobile devices and context-aware user interfaces have made it pos- sible to represent information fusion and situational awareness for Intelligence, Surveillance and Reconnaissance (ISR) activities as a conversational process among actors at or near the tactical edges of a network. Motivated by use cases in the domain of Company Intelligence Support Team (CoIST) tasks, this paper presents an approach to information collection, fusion and sense-making based on the use of natural language (NL) and controlled nat- ural language (CNL) to support richer forms of human-machine interaction. The approach uses a conversational protocol to facilitate a ow of collaborative messages from NL to CNL and back again in support of interactions such as: turning eyewitness reports from human observers into actionable information (from both soldier and civilian sources); fusing information from humans and physical sensors (with associated quality metadata); and assisting human analysts to make the best use of available sensing assets in an area of interest (governed by man- agement and security policies). CNL is used as a common formal knowledge representation for both machine and human agents to support reasoning, semantic information fusion and generation of rationale for inferences, in ways that remain transparent to human users. Examples are provided of various alternative styles for user feedback, including NL, CNL and graphical feedback. A pilot experiment with human subjects shows that a prototype conversational agent is able to gather usable CNL information from untrained human subjects.

  9. Interactions between the vascular endothelial growth factor gene polymorphism and life events in susceptibility to major depressive disorder in a Chinese population.

    Science.gov (United States)

    Han, Dong; Qiao, Zhengxue; Chen, Lu; Qiu, Xiaohui; Fang, Deyu; Yang, Xiuxian; Ma, Jingsong; Chen, Mingqi; Yang, Jiarun; Wang, Lin; Zhu, Xiongzhao; Zhang, Congpei; Yang, Yanjie; Pan, Hui

    2017-08-01

    Recent studies suggest that vascular endothelial growth factor (VEGF) is involved in the development of major depressive disorder. The aim of this study is to investigate the interaction between vascular endothelial growth factor (VEGF) polymorphism (+405G/C, rs2010963) and negative life events in the pathogenesis of major depressive disorder (MDD). DNA genotyping was performed on peripheral blood leukocytes in 274 patients with MDD and 273 age-and sex-matched controls. The frequency and severity of negative life events were assessed by the Life Events Scale (LES). A logistics method was employed to assess the gene-environment interaction (G×E). Differences in rs2010963 genotype distributions were observed between MDD patients and controls. Significant G×E interactions between allelic variation of rs2010963 and negative life events were observed. Individuals carrying the C alleles were susceptible to MDD only when exposed to high-negative life events. These results indicate that interactions between the VEGF rs2010963 polymorphism and environment increases the risk of developing MDD. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Gene expression profiling of preovulatory follicle in the buffalo cow: effects of increased IGF-I concentration on periovulatory events.

    Directory of Open Access Journals (Sweden)

    Jyotsna U Rao

    Full Text Available The preovulatory follicle in response to gonadotropin surge undergoes dramatic biochemical, and morphological changes orchestrated by expression changes in hundreds of genes. Employing well characterized bovine preovulatory follicle model, granulosa cells (GCs and follicle wall were collected from the preovulatory follicle before, 1, 10 and 22 h post peak LH surge. Microarray analysis performed on GCs revealed that 450 and 111 genes were differentially expressed at 1 and 22 h post peak LH surge, respectively. For validation, qPCR and immunocytochemistry analyses were carried out for some of the differentially expressed genes. Expression analysis of many of these genes showed distinct expression patterns in GCs and the follicle wall. To study molecular functions and genetic networks, microarray data was analyzed using Ingenuity Pathway Analysis which revealed majority of the differentially expressed genes to cluster within processes like steroidogenesis, cell survival and cell differentiation. In the ovarian follicle, IGF-I is established to be an important regulator of the above mentioned molecular functions. Thus, further experiments were conducted to verify the effects of increased intrafollicular IGF-I levels on the expression of genes associated with the above mentioned processes. For this purpose, buffalo cows were administered with exogenous bGH to transiently increase circulating and intrafollicular concentrations of IGF-I. The results indicated that increased intrafollicular concentrations of IGF-I caused changes in expression of genes associated with steroidogenesis (StAR, SRF and apoptosis (BCL-2, FKHR, PAWR. These results taken together suggest that onset of gonadotropin surge triggers activation of various biological pathways and that the effects of growth factors and peptides on gonadotropin actions could be examined during preovulatory follicle development.

  11. Temporal variations in the gene expression levels of cyanobacterial anti-oxidant enzymes through geological history: implications for biological evolution during the Great Oxidation Event

    Science.gov (United States)

    Harada, M.; Furukawa, R.; Yokobori, S. I.; Tajika, E.; Yamagishi, A.

    2016-12-01

    A significant rise in atmospheric O2 levels during the GOE (Great Oxidation Event), ca. 2.45-2.0 Ga, must have caused a great stress to biosphere, enforcing life to adapt to oxic conditions. Cyanobacteria, oxygenic photosynthetic bacteria that had been responsible for the GOE, are at the same time one of the organisms that would have been greatly affected by the rise of O2 level in the surface environments. Knowledge on the evolution of cyanobacteria is not only important to elucidate the cause of the GOE, but also helps us to better understand the adaptive evolution of life in response to the GOE. Here we performed phylogenetic analysis of an anti-oxidant enzyme Fe-SOD (iron superoxide dismutase) of cyanobacteria, to assess the adaptive evolution of life under the GOE. The rise of O2 level must have increased the level of toxic reactive oxygen species in cyanobacterial cells, thus forced them to change activities or the gene expression levels of Fe-SOD. In the present study, we focus on the change in the gene expression levels of the enzyme, which can be estimated from the promoter sequences of the gene. Promoters are DNA sequences found upstream of protein encoding regions, where RNA polymerase binds and initiates transcription. "Strong" promoters that efficiently interact with RNA polymerase induce high rates of transcription, leading to high levels of gene expression. Thus, from the temporal changes in the promoter sequences, we can estimate the variations in the gene expression levels during the geological time. Promoter sequences of Fe-SOD at each ancestral node of cyanobacteria were predicted from phylogenetic analysis, and the ancestral promoter sequences were compared to the promoters of known highly expressed genes. The similarity was low at the time of the emergence of cyanobacteria; however, increased at the branching nodes diverged 2.4 billon years ago. This roughly coincided with the onset of the GOE, implying that the transition from low to high gene

  12. Low TLR7 gene expression in atherosclerotic plaques is associated with major adverse cardio- and cerebrovascular events

    DEFF Research Database (Denmark)

    Karadimou, Glykeria; Folkersen, Lasse; Berg, Martin

    2016-01-01

    Aims: Processes in the development of atherosclerotic lesions can lead to plaque rupture or erosion, which can in turn elicit myocardial infarction or ischaemic stroke. The aims of this study were to determine whether Toll-like receptor 7 (TLR7) gene expression levels influence patient outcome an...

  13. Identification and analysis of Eimeria nieschulzi gametocyte genes reveal splicing events of gam genes and conserved motifs in the wall-forming proteins within the genus Eimeria (Coccidia, Apicomplexa

    Directory of Open Access Journals (Sweden)

    Wiedmer Stefanie

    2017-01-01

    Full Text Available The genus Eimeria (Apicomplexa, Coccidia provides a wide range of different species with different hosts to study common and variable features within the genus and its species. A common characteristic of all known Eimeria species is the oocyst, the infectious stage where its life cycle starts and ends. In our study, we utilized Eimeria nieschulzi as a model organism. This rat-specific parasite has complex oocyst morphology and can be transfected and even cultivated in vitro up to the oocyst stage. We wanted to elucidate how the known oocyst wall-forming proteins are preserved in this rodent Eimeria species compared to other Eimeria. In newly obtained genomics data, we were able to identify different gametocyte genes that are orthologous to already known gam genes involved in the oocyst wall formation of avian Eimeria species. These genes appeared putatively as single exon genes, but cDNA analysis showed alternative splicing events in the transcripts. The analysis of the translated sequence revealed different conserved motifs but also dissimilar regions in GAM proteins, as well as polymorphic regions. The occurrence of an underrepresented gam56 gene version suggests the existence of a second distinct E. nieschulzi genotype within the E. nieschulzi Landers isolate that we maintain.

  14. Identification and analysis of Eimeria nieschulzi gametocyte genes reveal splicing events of gam genes and conserved motifs in the wall-forming proteins within the genus Eimeria (Coccidia, Apicomplexa)

    Science.gov (United States)

    Wiedmer, Stefanie; Erdbeer, Alexander; Volke, Beate; Randel, Stephanie; Kapplusch, Franz; Hanig, Sacha; Kurth, Michael

    2017-01-01

    The genus Eimeria (Apicomplexa, Coccidia) provides a wide range of different species with different hosts to study common and variable features within the genus and its species. A common characteristic of all known Eimeria species is the oocyst, the infectious stage where its life cycle starts and ends. In our study, we utilized Eimeria nieschulzi as a model organism. This rat-specific parasite has complex oocyst morphology and can be transfected and even cultivated in vitro up to the oocyst stage. We wanted to elucidate how the known oocyst wall-forming proteins are preserved in this rodent Eimeria species compared to other Eimeria. In newly obtained genomics data, we were able to identify different gametocyte genes that are orthologous to already known gam genes involved in the oocyst wall formation of avian Eimeria species. These genes appeared putatively as single exon genes, but cDNA analysis showed alternative splicing events in the transcripts. The analysis of the translated sequence revealed different conserved motifs but also dissimilar regions in GAM proteins, as well as polymorphic regions. The occurrence of an underrepresented gam56 gene version suggests the existence of a second distinct E. nieschulzi genotype within the E. nieschulzi Landers isolate that we maintain. PMID:29210668

  15. Recombination Events Involving the atp9 Gene Are Associated with Male Sterility of CMS PET2 in Sunflower.

    Science.gov (United States)

    Reddemann, Antje; Horn, Renate

    2018-03-11

    Cytoplasmic male sterility (CMS) systems represent ideal mutants to study the role of mitochondria in pollen development. In sunflower, CMS PET2 also has the potential to become an alternative CMS source for commercial sunflower hybrid breeding. CMS PET2 originates from an interspecific cross of H. petiolaris and H. annuus as CMS PET1, but results in a different CMS mechanism. Southern analyses revealed differences for atp6 , atp9 and cob between CMS PET2, CMS PET1 and the male-fertile line HA89. A second identical copy of atp6 was present on an additional CMS PET2-specific fragment. In addition, the atp9 gene was duplicated. However, this duplication was followed by an insertion of 271 bp of unknown origin in the 5' coding region of the atp9 gene in CMS PET2, which led to the creation of two unique open reading frames orf288 and orf231 . The first 53 bp of orf288 are identical to the 5' end of atp9 . Orf231 consists apart from the first 3 bp, being part of the 271-bp-insertion, of the last 228 bp of atp9 . These CMS PET2-specific orfs are co-transcribed. All 11 editing sites of the atp9 gene present in orf231 are fully edited. The anther-specific reduction of the co-transcript in fertility-restored hybrids supports the involvement in male-sterility based on CMS PET2.

  16. Recombination Events Involving the atp9 Gene Are Associated with Male Sterility of CMS PET2 in Sunflower

    Directory of Open Access Journals (Sweden)

    Antje Reddemann

    2018-03-01

    Full Text Available Cytoplasmic male sterility (CMS systems represent ideal mutants to study the role of mitochondria in pollen development. In sunflower, CMS PET2 also has the potential to become an alternative CMS source for commercial sunflower hybrid breeding. CMS PET2 originates from an interspecific cross of H. petiolaris and H. annuus as CMS PET1, but results in a different CMS mechanism. Southern analyses revealed differences for atp6, atp9 and cob between CMS PET2, CMS PET1 and the male-fertile line HA89. A second identical copy of atp6 was present on an additional CMS PET2-specific fragment. In addition, the atp9 gene was duplicated. However, this duplication was followed by an insertion of 271 bp of unknown origin in the 5′ coding region of the atp9 gene in CMS PET2, which led to the creation of two unique open reading frames orf288 and orf231. The first 53 bp of orf288 are identical to the 5′ end of atp9. Orf231 consists apart from the first 3 bp, being part of the 271-bp-insertion, of the last 228 bp of atp9. These CMS PET2-specific orfs are co-transcribed. All 11 editing sites of the atp9 gene present in orf231 are fully edited. The anther-specific reduction of the co-transcript in fertility-restored hybrids supports the involvement in male-sterility based on CMS PET2.

  17. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  18. Preferrential rearrangement in normal rabbits of the 3' VHa allotype gene that is deleted in Alicia mutants; somatic hypermutation/conversion may play a major role in generating the heterogeneity of rabbit heavy chain variable region sequences.

    Science.gov (United States)

    Allegrucci, M; Young-Cooper, G O; Alexander, C B; Newman, B A; Mage, R G

    1991-02-01

    The rabbit is unique in having well-defined allotypes in the variable region of the heavy chain. Products of the VHa locus, (with alleles a1, a2, and a3), account for the majority of the serum immunoglobulins. A small percentage of the serum immunoglobulins are a-negative. In 1986, Kelus and Weiss described a mutation that depressed the expression of the Ig VH a2 genes in an a1/a2 rabbit. From this animal the Alicia rabbit strain was developed and the mutation was termed ali. We previously showed, using Southern analysis and the transverse alternating field electrophoresis technique, that the difference between the ali rabbit and normal is a relatively small deletion including some of the most 3' VH genes. The most JH proximal 3' VH1 genes in DNA from normal rabbits of a1, a2 and a3 haplotypes encode a1, a2 and a3 molecules respectively, and it has been suggested that these genes are responsible for allelic inheritance of VHa allotypes. The present study suggests that the 3' end of the VH locus probably plays a key role in regulation of VH gene expression in rabbits because VH gene(s) in this region are the target(s) of preferential VDJ rearrangements. This raises the possibility that mechanisms such as somatic gene conversion and hypermutation are at work to generate the antibody repertoire in this species. Our data support the view that the 3' VH1 gene may be the preferred target for rearrangement in normal rabbits, and for the normal chromosome in heterozygous ali animals. However, homozygous ali rabbits with a deletion that removed the a2-encoding VH1 on both chromosomes do survive, rearrange other VH genes and produce normal levels of immunoglobulins as well as a significant percentage of B cells which bear the a2 allotype. This challenges the view that one VH gene, VH1, is solely responsible for the inheritance pattern of VHa allotypes.

  19. Neurotensin receptor 1 gene activation by the Tcf/beta-catenin pathway is an early event in human colonic adenomas.

    Science.gov (United States)

    Souazé, Frédérique; Viardot-Foucault, Véronique; Roullet, Nicolas; Toy-Miou-Leong, Mireille; Gompel, Anne; Bruyneel, Erik; Comperat, Eva; Faux, Maree C; Mareel, Marc; Rostène, William; Fléjou, Jean-François; Gespach, Christian; Forgez, Patricia

    2006-04-01

    Alterations in the Wnt/APC (adenomatous polyposis coli) signalling pathway, resulting in beta-catenin/T cell factor (Tcf)-dependent transcriptional gene activation, are frequently detected in familial and sporadic colon cancers. The neuropeptide neurotensin (NT) is widely distributed in the gastrointestinal tract. Its proliferative and survival effects are mediated by a G-protein coupled receptor, the NT1 receptor. NT1 receptor is not expressed in normal colon epithelial cells, but is over expressed in a number of cancer cells and tissues suggesting a link to the outgrowth of human colon cancer. Our results demonstrate that the upregulation of NT1 receptor occurring in colon cancer is the result of Wnt/APC signalling pathway activation. We first established the functionality of the Tcf response element within the NT1 receptor promoter. Consequently, we observed the activation of NT1 receptor gene by agents causing beta-catenin cytosolic accumulation, as well as a strong decline of endogenous receptor when wt-APC was restored. At the cellular level, the re-establishment of wt-APC phenotype resulted in the impaired functionality of NT1 receptor, like the breakdown in NT-induced intracellular calcium mobilization and the loss of NT pro-invasive effect. We corroborated the Wnt/APC signalling pathway on the NT1 receptor promoter activation with human colon carcinogenesis, and showed that NT1 receptor gene activation was perfectly correlated with nuclear or cytoplasmic beta-catenin localization while NT1 receptor was absent when beta-catenin was localized at the cell-cell junction in early adenomas of patients with familial adenomatous polyposis, hereditary non-polyposis colorectal cancer and loss of heterozygosity tumours. In this report we establish a novel link in vitro between the Tcf/beta-catenin pathway and NT1 receptor promoter activation.

  20. Centrosome clustering and cyclin D1 gene amplification in double minutes are common events in chromosomal unstable bladder tumors

    International Nuclear Information System (INIS)

    Rey, Javier del; Prat, Esther; Ponsa, Immaculada; Lloreta, Josep; Gelabert, Antoni; Algaba, Ferran; Camps, Jordi; Miró, Rosa

    2010-01-01

    Aneuploidy, centrosome abnormalities and gene amplification are hallmarks of chromosome instability (CIN) in cancer. Yet there are no studies of the in vivo behavior of these phenomena within the same bladder tumor. Twenty-one paraffin-embedded bladder tumors were analyzed by conventional comparative genome hybridization and fluorescence in situ hybridization (FISH) with a cyclin D1 gene (CCND1)/centromere 11 dual-color probe. Immunofluorescent staining of α, β and γ tubulin was also performed. Based on the CIN index, defined as the percentage of cells not displaying the modal number for chromosome 11, tumors were classified as CIN-negative and CIN-positive. Fourteen out of 21 tumors were considered CIN-positive. All T1G3 tumors were included in the CIN-positive group whereas the majority of Ta samples were classified as CIN-negative tumors. Centrosome clustering was observed in six out of 12 CIN-positive tumors analyzed. CCND1 amplification in homogeneously staining regions was present in six out of 14 CIN-positive tumors; three of them also showed amplification of this gene in double minutes. Complex in vivo behavior of CCND1 amplicon in bladder tumor cells has been demonstrated by accurate FISH analysis on paraffin-embedded tumors. Positive correlation between high heterogeneity, centrosome abnormalities and CCND1 amplification was found in T1G3 bladder carcinomas. This is the first study to provide insights into the coexistence of CCND1 amplification in homogeneously staining regions and double minutes in primary bladder tumors. It is noteworthy that those patients whose tumors showed double minutes had a significantly shorter overall survival rate (p < 0.001)

  1. Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution

    Directory of Open Access Journals (Sweden)

    Tartar Aurélien

    2010-06-01

    Full Text Available Abstract Background Glutamine synthetase (GS is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae, and additional green algal (Chlorophyceae and Prasinophytae and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB and eukaryotic (GSIIE GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT. Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida. However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting

  2. The Interacting Effect of the BDNF Val66Met Polymorphism and Stressful Life Events on Adolescent Depression Is Not an Artifact of Gene-Environment Correlation: Evidence from a Longitudinal Twin Study

    Science.gov (United States)

    Chen, Jie; Li, Xinying; McGue, Matt

    2013-01-01

    Background: Confounding introduced by gene-environment correlation (rGE) may prevent one from observing a true gene-environment interaction (G × E) effect on psychopathology. The present study investigated the interacting effect of the BDNF Val66Met polymorphism and stressful life events (SLEs) on adolescent depression while controlling for the…

  3. Association of a Chromosomal Rearrangement Event with Mouse Posterior Polymorphous Corneal Dystrophy and Alterations in Csrp2bp, Dzank1, and Ovol2 Gene Expression.

    Directory of Open Access Journals (Sweden)

    Anna L Shen

    Full Text Available We have previously described a mouse model of human posterior polymorphous corneal dystrophy (PPCD and localized the causative mutation to a 6.2 Mbp region of chromosome 2, termed Ppcd1. We now show that the gene rearrangement linked to mouse Ppcd1 is a 3.9 Mbp chromosomal inversion flanked by 81 Kbp and 542 bp deletions. This recombination event leads to deletion of Csrp2bp Exons 8 through 11, Dzank1 Exons 20 and 21, and the pseudogene Znf133. In addition, we identified translocation of novel downstream sequences to positions adjacent to Csrp2bp Exon 7 and Dzank1 Exon 20. Twelve novel fusion transcripts involving Csrp2bp or Dzank1 linked to downstream sequences have been identified. Eight are expressed at detectable levels in PPCD1 but not wildtype eyes. Upregulation of two Csrp2bp fusion transcripts, as well as upregulation of the adjacent gene, Ovol2, was observed. Absence of the PPCD1 phenotype in animals haploinsufficient for Csrp2bp or both Csrp2bp and Dzank1 rules out haploinsufficiency of these genes as a cause of mouse PPCD1. Complementation experiments confirm that PPCD1 embryonic lethality is due to disruption of Csrp2bp expression. The ocular expression pattern of Csrp2bp is consistent with a role for this protein in corneal development and pathogenesis of PPCD1.

  4. Conversations with Miss Jane

    Directory of Open Access Journals (Sweden)

    Geneviève Fabre

    2006-05-01

    Full Text Available Considering the wide range of conversations in the autobiography, this essay will attempt to appraise the importance of these verbal exchanges in relation to the overall narrative structure of the book and to the prevalent oral tradition in Louisiana culture, as both an individual and communal expression. The variety of circumstances, the setting and staging, the interlocutors , and the complex intersection of time and place, of stories and History, will be examined; in these conversations with Miss Jane many actors participate, from  the interviewer-narrator, to most characters; even the reader becomes involved.Speaking, hearing, listening, keeping silent is an elaborate ritual that performs many functions; besides conveying news or rumors, it imparts information on the times and on the life of a “representative” woman whose existence - spanning a whole century- is both singular and emblematic. Most importantly this essay will analyse the resonance of an eventful and often dramatic era on her sensibility and conversely show how her evolving sensibility informs that history and draws attention to aspects that might have passed unnoticed or be forever silenced. Jane’s desire for liberty and justice is often challenged as she faces the possibilities of life or death.Conversations build up a complex, often contradictory, but compelling portrait: torn between silence and vehemence, between memories and the urge to meet the future, Jane summons body and mind to find her way through the maze of a fast changing world; self-willed and obstinate she claims her right to speak, to express with wit and wisdom her firm belief in the word, in the ability to express deep seated convictions and faith and a whole array of feelings and emotions.

  5. The crtS gene of Xanthophyllomyces dendrorhous encodes a novel cytochrome-P450 hydroxylase involved in the conversion of beta-carotene into astaxanthin and other xanthophylls.

    Science.gov (United States)

    Alvarez, Vanessa; Rodríguez-Sáiz, Marta; de la Fuente, Juan Luis; Gudiña, Eduardo J; Godio, Ramiro P; Martín, Juan F; Barredo, José Luis

    2006-04-01

    The conversion of beta-carotene into xanthophylls is a subject of great scientific and industrial interest. We cloned the crtS gene involved in astaxanthin biosynthesis from two astaxanthin producing strains of Xanthophyllomyces dendrorhous: VKPM Y2410, an astaxanthin overproducing strain, and the wild type ATCC 24203. In both cases, the ORF has a length of 3166 bp, including 17 introns, and codes for a protein of 62.6 kDa with similarity to cytochrome-P450 hydroxylases. crtS gene sequences from strains VKPM Y2410, ATCC 24203, ATCC 96594, and ATCC 96815 show several nucleotide changes, but none of them causes any amino acid substitution, except a G2268 insertion in the 13th exon of ATCC 96815 which causes a change in the reading frame. A G1470 --> A change in the 5' splicing region of intron 8 was also found in ATCC 96815. Both point mutations explain astaxanthin idiotrophy and beta-carotene accumulation in ATCC 96815. Mutants accumulating precursors of the astaxanthin biosynthetic pathway were selected from the parental strain VKPM Y2410 (red) showing different colors depending on the compound accumulated. Two of them were blocked in the biosynthesis of astaxanthin, M6 (orange; 1% astaxanthin, 71 times more beta-carotene) and M7 (orange; 1% astaxanthin, 58 times more beta-carotene, 135% canthaxanthin), whereas the rest produced lower levels of astaxanthin (5-66%) than the parental strain. When the crtS gene was expressed in M7, canthaxanthin accumulation disappeared and astaxanthin production was partially restored. Moreover, astaxanthin biosynthesis was restored when X. dendrorhous ATCC 96815 was transformed with the crtS gene. The crtS gene was heterologously expressed in Mucor circinelloides conferring to this fungus an improved capacity to synthesize beta-cryptoxanthin and zeaxanthin, two hydroxylated compounds from beta-carotene. These results show that the crtS gene is involved in the conversion of beta-carotene into xanthophylls, being potentially useful to

  6. Association of single nucleotide polymorphisms in a glutamate receptor gene (GRM8) with theta power of event-related oscillations and alcohol dependence.

    Science.gov (United States)

    Chen, Andrew C H; Tang, Yongqiang; Rangaswamy, Madhavi; Wang, Jen C; Almasy, Laura; Foroud, Tatiana; Edenberg, Howard J; Hesselbrock, Victor; Nurnberger, John; Kuperman, Samuel; O'Connor, Sean J; Schuckit, Marc A; Bauer, Lance O; Tischfield, Jay; Rice, John P; Bierut, Laura; Goate, Alison; Porjesz, Bernice

    2009-04-05

    Evidence suggests the P3 amplitude of the event-related potential and its underlying superimposed event-related oscillations (EROs), primarily in the theta (4-5 Hz) and delta (1-3 Hz) frequencies, as endophenotypes for the risk of alcoholism and other disinhibitory disorders. Major neurochemical substrates contributing to theta and delta rhythms and P3 involve strong GABAergic, cholinergic and glutamatergic system interactions. The aim of this study was to test the potential associations between single nucleotide polymorphisms (SNPs) in glutamate receptor genes and ERO quantitative traits. GRM8 was selected because it maps at chromosome 7q31.3-q32.1 under the peak region where we previously identified significant linkage (peak LOD = 3.5) using a genome-wide linkage scan of the same phenotype (event-related theta band for the target visual stimuli). Neural activities recorded from scalp electrodes during a visual oddball task in which rare target elicited P3s were analyzed in a subset of the Collaborative Study on the Genetics of Alcoholism (COGA) sample comprising 1,049 Caucasian subjects from 209 families (with 472 DSM-IV alcohol dependent individuals). The family-based association test (FBAT) detected significant association (P power to target visual stimuli, and also with alcohol dependence, even after correction for multiple comparisons by false discovery rate (FDR). Our results suggest that variation in GRM8 may be involved in modulating event-related theta oscillations during information processing and also in vulnerability to alcoholism. These findings underscore the utility of electrophysiology and the endophenotype approach in the genetic study of psychiatric disorders. (c) 2008 Wiley-Liss, Inc.

  7. Resistance to dual-gene Bt maize in Spodoptera frugiperda: selection, inheritance, and cross-resistance to other transgenic events.

    Science.gov (United States)

    Santos-Amaya, Oscar F; Rodrigues, João V C; Souza, Thadeu C; Tavares, Clébson S; Campos, Silverio O; Guedes, Raul N C; Pereira, Eliseu J G

    2015-12-17

    Transgenic crop "pyramids" producing two or more Bacillus thuringiensis (Bt) toxins active against the same pest are used to delay evolution of resistance in insect pest populations. Laboratory and greenhouse experiments were performed with fall armyworm, Spodoptera frugiperda, to characterize resistance to Bt maize producing Cry1A.105 and Cry2Ab and test some assumptions of the "pyramid" resistance management strategy. Selection of a field-derived strain of S. frugiperda already resistant to Cry1F maize with Cry1A.105 + Cry2Ab maize for ten generations produced resistance that allowed the larvae to colonize and complete the life cycle on these Bt maize plants. Greenhouse experiments revealed that the resistance was completely recessive (Dx = 0), incomplete, autosomal, and without maternal effects or cross-resistance to the Vip3Aa20 toxin produced in other Bt maize events. This profile of resistance supports some of the assumptions of the pyramid strategy for resistance management. However, laboratory experiments with purified Bt toxin and plant leaf tissue showed that resistance to Cry1A.105 + Cry2Ab2 maize further increased resistance to Cry1Fa, which indicates that populations of fall armyworm have high potential for developing resistance to some currently available pyramided maize used against this pest, especially where resistance to Cry1Fa was reported in the field.

  8. Molecular cloning and expression of the hyu genes from Microbacterium liquefaciens AJ 3912, responsible for the conversion of 5-substituted hydantoins to alpha-amino acids, in Escherichia coli.

    Science.gov (United States)

    Suzuki, Shun'ichi; Takenaka, Yasuhiro; Onishi, Norimasa; Yokozeki, Kenzo

    2005-08-01

    A DNA fragment from Microbacterium liquefaciens AJ 3912, containing the genes responsible for the conversion of 5-substituted-hydantoins to alpha-amino acids, was cloned in Escherichia coli and sequenced. Seven open reading frames (hyuP, hyuA, hyuH, hyuC, ORF1, ORF2, and ORF3) were identified on the 7.5 kb fragment. The deduced amino acid sequence encoded by the hyuA gene included the N-terminal amino acid sequence of the hydantoin racemase from M. liquefaciens AJ 3912. The hyuA, hyuH, and hyuC genes were heterologously expressed in E. coli; their presence corresponded with the detection of hydantoin racemase, hydantoinase, and N-carbamoyl alpha-amino acid amido hydrolase enzymatic activities respectively. The deduced amino acid sequences of hyuP were similar to those of the allantoin (5-ureido-hydantoin) permease from Saccharomyces cerevisiae, suggesting that hyuP protein might function as a hydantoin transporter.

  9. Association of Allelic Interaction of Single Nucleotide Polymorphisms of Influx and Efflux Transporters Genes With Nonhematologic Adverse Events of Docetaxel in Breast Cancer Patients.

    Science.gov (United States)

    Jabir, Rafid Salim; Ho, Gwo Fuang; Annuar, Muhammad Azrif Bin Ahmad; Stanslas, Johnson

    2018-05-04

    Nonhematologic adverse events (AEs) of docetaxel constitute an extra burden in the treatment of cancer patients and necessitate either a dose reduction or an outright switch of docetaxel for other regimens. These AEs are frequently associated with genetic polymorphisms of genes encoding for proteins involved docetaxel disposition. Therefore, we investigated that association in Malaysian breast cancer patients. A total of 110 Malaysian breast cancer patients were enrolled in the present study, and their blood samples were investigated for different single nucleotide polymorphisms using polymerase chain reaction restriction fragment length polymorphism. AEs were evaluated using the Common Terminology Criteria for Adverse Events, version 4.0. Fatigue, nausea, oral mucositis, and vomiting were the most common nonhematologic AEs. Rash was associated with heterozygous and mutant genotypes of ABCB1 3435C>T (P A/T reported more fatigue than those carrying the heterozygous genotype GA (P T polymorphism could be a potential predictive biomarker of docetaxel-induced rash, and homozygous wild-type ABCB1 2677G>A/T might predict for a greater risk of fatigue. In addition, the concurrent presence of specific alleles could be predictive of vomiting, nausea, and oral mucositis. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Association between ß2-adrenergic receptor gene polymorphisms and adverse events of ritodrine in the treatment of preterm labor: a prospective observational study.

    Science.gov (United States)

    Chung, Jee Eun; Choi, Soo An; Hwang, Han Sung; Park, Jin Young; Lee, Kyung Eun; Yee, Jeong; Kim, Young Ju; Gwak, Hye Sun

    2017-11-13

    Ritodrine, a tocolytic β2-agonist, has been used extensively in Europe and Asia despite its safety concerns. This study was designed to identify associations between β2-adrenergic receptor (ADRB2) polymorphisms and adverse drug events (ADEs) in patients with preterm labor treated with ritodrine. This follow-up study was prospectively conducted at Ewha Womans University Mokdong Hospital in Korea. Five single nucleotide polymorphisms (SNPs) of the ADRB2 gene (rs1042713, rs1042714, rs1042717, rs1042718, and rs1042719) were analyzed in 186 pregnant women with preterm labor. Patients with the AA genotype of rs1042717 had significantly lower incidence of ADEs compared to those with the G allele (p = 0.009). In multivariate analysis, one of the predictors of ADEs was the maximum infusion rate of ritodrine (AOR 4.47, 95% CI 1.31-15.25). Rs1042719 was also a significant factor for ritodrine-induced ADEs. The CC genotype carriers had 78% decreased risk of ADEs compared to those with other genotypes. This study demonstrates that ADEs induced by ritodrine are associated with ADRB2 gene polymorphisms, as well as the infusion rate of ritodrine in pregnant women with preterm labor.

  11. LimTox: a web tool for applied text mining of adverse event and toxicity associations of compounds, drugs and genes.

    Science.gov (United States)

    Cañada, Andres; Capella-Gutierrez, Salvador; Rabal, Obdulia; Oyarzabal, Julen; Valencia, Alfonso; Krallinger, Martin

    2017-07-03

    A considerable effort has been devoted to retrieve systematically information for genes and proteins as well as relationships between them. Despite the importance of chemical compounds and drugs as a central bio-entity in pharmacological and biological research, only a limited number of freely available chemical text-mining/search engine technologies are currently accessible. Here we present LimTox (Literature Mining for Toxicology), a web-based online biomedical search tool with special focus on adverse hepatobiliary reactions. It integrates a range of text mining, named entity recognition and information extraction components. LimTox relies on machine-learning, rule-based, pattern-based and term lookup strategies. This system processes scientific abstracts, a set of full text articles and medical agency assessment reports. Although the main focus of LimTox is on adverse liver events, it enables also basic searches for other organ level toxicity associations (nephrotoxicity, cardiotoxicity, thyrotoxicity and phospholipidosis). This tool supports specialized search queries for: chemical compounds/drugs, genes (with additional emphasis on key enzymes in drug metabolism, namely P450 cytochromes-CYPs) and biochemical liver markers. The LimTox website is free and open to all users and there is no login requirement. LimTox can be accessed at: http://limtox.bioinfo.cnio.es. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Influence of Nitrous Oxide Anesthesia, B-Vitamins, and MTHFR gene polymorphisms on Perioperative Cardiac Events: The Vitamins in Nitrous Oxide (VINO) Randomized Trial

    Science.gov (United States)

    Nagele, Peter; Brown, Frank; Francis, Amber; Scott, Mitchell G.; Gage, Brian F.; Miller, J. Philip

    2013-01-01

    Background Nitrous oxide causes an acute increase in plasma homocysteine that is more pronounced in patients with the MTHFR C677T or A1298C gene variant. In this randomized controlled trial we sought to determine if patients carrying the MTHFR C677T or A1298C variant had a higher risk for perioperative cardiac events after nitrous oxide anesthesia and if this risk could be mitigated by B-vitamins. Methods We randomized adult patients with cardiac risk factors undergoing noncardiac surgery to receive nitrous oxide plus intravenous B-vitamins before and after surgery or to nitrous oxide and placebo. Serial cardiac biomarkers and 12-lead electrocardiograms were obtained. The primary study endpoint was the incidence of myocardial injury, as defined by cardiac troponin I elevation within the first 72 hours after surgery. Results A total of 500 patients completed the trial. Patients who were homozygous for either MTHFR C677T or A1298C gene variant (n= 98; 19.6%) had no increased rate of postoperative cardiac troponin I elevation compared to wild-type and heterozygous patients (11.2% vs. 14.0%; relative risk 0.96, 95% CI 0.85 to 1.07, p=0.48). B-vitamins blunted the rise in homocysteine, but had no effect on cardiac troponin I elevation compared to patients receiving placebo (13.2% vs. 13.6%; relative risk 1.02, 95% CI 0.78 to 1.32, p=0.91). Conclusions Neither MTHFR C677T and A1298C gene variant nor acute homocysteine increase are associated with perioperative cardiac troponin elevation after nitrousoxide anesthesia. B-vitamins blunt nitrous oxide-induced homocysteine increase but have no effect on cardiac troponin elevation. PMID:23856660

  13. Influence of nitrous oxide anesthesia, B-vitamins, and MTHFR gene polymorphisms on perioperative cardiac events: the vitamins in nitrous oxide (VINO) randomized trial.

    Science.gov (United States)

    Nagele, Peter; Brown, Frank; Francis, Amber; Scott, Mitchell G; Gage, Brian F; Miller, J Philip

    2013-07-01

    Nitrous oxide causes an acute increase in plasma homocysteine that is more pronounced in patients with the methylenetetrahydrofolate reductase (MTHFR) C677T or A1298C gene variant. In this randomized controlled trial, the authors sought to determine whether patients carrying the MTHFR C677T or A1298C variant had a higher risk for perioperative cardiac events after nitrous oxide anesthesia and whether this risk could be mitigated by B-vitamins. The authors randomized adult patients with cardiac risk factors undergoing noncardiac surgery, to receive nitrous oxide plus intravenous B-vitamins before and after surgery, or to nitrous oxide and placebo. Serial cardiac biomarkers and 12-lead electrocardiograms were obtained. The primary study endpoint was the incidence of myocardial injury, as defined by cardiac troponin I increase within the first 72 h after surgery. A total of 500 patients completed the trial. Patients who were homozygous for either MTHFR C677T, or A1298C gene variant (n=98; 19.6%) had no increased rate of postoperative cardiac troponin I increase compared with wild-type and heterozygous patients (11.2 vs. 14.0%; relative risk 0.96; 95% CI, 0.85-1.07; P=0.48). B-vitamins blunted the rise in homocysteine, but had no effect on cardiac troponin I increase compared with patients receiving placebo (13.2 vs. 13.6%; relative risk 1.02; 95% CI 0.78 to 1.32; P=0.91). Neither MTHFR C677T and A1298C gene variant, nor acute homocysteine increase are associated with perioperative cardiac troponin increase after nitrous oxide anesthesia. B-vitamins blunt nitrous oxide-induced homocysteine increase but have no effect on cardiac troponin I increase.

  14. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner.

    Science.gov (United States)

    Pai, Vaibhav P; Willocq, Valerie; Pitcairn, Emily J; Lemire, Joan M; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A; Levin, Michael

    2017-10-15

    Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels ( I h currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal , Lefty , and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. © 2017. Published by The Company of Biologists Ltd.

  15. Codelivery for Paclitaxel and Bcl-2 Conversion Gene by PHB-PDMAEMA Amphiphilic Cationic Copolymer for Effective Drug Resistant Cancer Therapy.

    Science.gov (United States)

    Wang, Xiaoyuan; Liow, Sing Shy; Wu, Qiaoqiong; Li, Chuang; Owh, Cally; Li, Zibiao; Loh, Xian Jun; Wu, Yun-Long

    2017-11-01

    Antiapoptotic Bcl-2 protein's upregulated expression is a key reason for drug resistance leading to failure of chemotherapy. In this report, a series of biocompatible amphiphilic cationic poly[(R)-3-hydroxybutyrate] (PHB)-b-poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA) copolymer, comprising hydrophobic PHB block and cationic PDMAEMA block, is designed to codeliver hydrophobic chemotherapeutic paclitaxel and Bcl-2 converting gene Nur77/ΔDBD with enhanced stability, due to the micelle formation by hydrophobic PHB segment. This copolymer shows less toxicity but similar gene transfection efficiency to polyethyenimine (25k). More importantly, this codelivery approach by PHB-PDMAEMA leads to increased drug resistant HepG2/Bcl-2 cancer cell death, by increased expression of Nur77 proteins in the Bcl-2 present intracellular mitochondria. This work signifies for the first time that cationic amphiphilic PHB-b-PDMAEMA copolymers can be utilized for the drug and gene codelivery to drug resistant cancer cells with high expression of antiapoptosis Bcl-2 protein and the positive results are encouraging for the further design of codelivery platforms for combating drug resistant cancer cells. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Microbial conversion technologies

    Energy Technology Data Exchange (ETDEWEB)

    Lau, P. [National Research Council of Canada, Ottawa, ON (Canada). Bioconversion and Sustainable Development

    2006-07-01

    Microbes are a biomass and an valuable resource. This presentation discussed microbial conversion technologies along with background information on microbial cells, their characteristics and microbial diversity. Untapped opportunities for microbial conversion were identified. Metagenomic and genome mining approaches were also discussed, as they can provide access to uncultivated or unculturable microorganisms in communal populations and are an unlimited resource for biocatalysts, novel genes and metabolites. Genome mining was seen as an economical approach. The presentation also emphasized that the development of microbial biorefineries would require significant insights into the relevant microorganisms and that biocatalysts were the ultimate in sustainability. In addition, the presentation discussed the natural fibres initiative for biochemicals and biomaterials. Anticipated outputs were identified and work in progress of a new enzyme-retting cocktail to provide diversity and/or consistency in fibre characteristics for various applications were also presented. It was concluded that it is necessary to leverage understanding of biological processes to produce bioproducts in a clean and sustainable manner. tabs., figs.

  17. Overexpression of the genes PDC1 and ADH1 activates glycerol conversion to ethanol in the thermotolerant yeast Ogataea (Hansenula) polymorpha.

    Science.gov (United States)

    Kata, Iwona; Semkiv, Marta V; Ruchala, Justyna; Dmytruk, Kostyantyn V; Sibirny, Andriy A

    2016-08-01

    Conversion of byproduct from biodiesel production glycerol to high-value compounds is of great importance. Ethanol is considered a promising product of glycerol bioconversion. The methylotrophic thermotolerant yeast Ogataea (Hansenula) polymorpha is of great interest for this purpose as the glycerol byproduct contains methanol and heavy metals as contaminants, and this yeast utilizes methanol and is relatively resistant to heavy metals. Besides, O. polymorpha shows robust growth on glycerol and produces ethanol from various carbon sources. The thermotolerance of this yeast is an additional advantage, allowing increased fermentation temperature to 45-48 °C, leading to increased rate of the fermentation process and a fall in the cost of distillation. The wild-type strain of O. polymorpha produces insignificant amounts of ethanol from glycerol (0.8 g/l). Overexpression of PDC1 coding for pyruvate decarboxylase enhanced ethanol production up to 3.1 g/l, whereas simultaneous overexpression of PDC1 and ADH1 (coding for alcohol dehydrogenase) led to further increase in ethanol production from glycerol. Moreover, the increased temperature of fermentation up to 45 °C stimulated the production of ethanol from glycerol used as the only carbon source up to 5.0 g/l, which exceeds the data obtained by methylotrophic yeast strains reported so far. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  18. Real-time polymerase chain reaction-based approach for quantification of the pat gene in the T25 Zea mays event.

    Science.gov (United States)

    Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy

    2004-01-01

    In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement

  19. Biocatalytic Conversion of Avermectin to 4"-Oxo-Avermectin: Characterization of Biocatalytically Active Bacterial Strains and of Cytochrome P450 Monooxygenase Enzymes and Their Genes

    Science.gov (United States)

    Jungmann, Volker; Molnár, István; Hammer, Philip E.; Hill, D. Steven; Zirkle, Ross; Buckel, Thomas G.; Buckel, Dagmar; Ligon, James M.; Pachlatko, J. Paul

    2005-01-01

    4"-Oxo-avermectin is a key intermediate in the manufacture of the agriculturally important insecticide emamectin benzoate from the natural product avermectin. Seventeen biocatalytically active Streptomyces strains with the ability to oxidize avermectin to 4"-oxo-avermectin in a regioselective manner have been discovered in a screen of 3,334 microorganisms. The enzymes responsible for this oxidation reaction in these biocatalytically active strains were found to be cytochrome P450 monooxygenases (CYPs) and were termed Ema1 to Ema17. The genes for Ema1 to Ema17 have been cloned, sequenced, and compared to reveal a new subfamily of CYPs. Ema1 to Ema16 have been overexpressed in Escherichia coli and purified as His-tagged recombinant proteins, and their basic enzyme kinetic parameters have been determined. PMID:16269732

  20. Engineering the central pathways in Lactococcus lactis: functional expression of the phosphofructokinase (pfk) and alternative oxidase (aox1) genes from Aspergillus niger in Lactococcus lactis facilitates improved carbon conversion rates under oxidizing conditions.

    Science.gov (United States)

    Papagianni, Maria; Avramidis, Nicholaos

    2012-08-10

    The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Special issue: Plasma Conversion

    NARCIS (Netherlands)

    Nozaki, T.; Bogaerts, A.; Tu, X.; van de Sanden, M. C. M.

    2017-01-01

    With growing concern of energy and environmental issues, the combination of plasma and heterogeneous catalysts receives special attention in greenhouse gas conversion, nitrogen fixation and hydrocarbon chemistry. Plasma gas conversion driven by renewable electricity is particularly important for the

  2. A Model for Conversation

    DEFF Research Database (Denmark)

    Ayres, Phil

    2012-01-01

    This essay discusses models. It examines what models are, the roles models perform and suggests various intentions that underlie their construction and use. It discusses how models act as a conversational partner, and how they support various forms of conversation within the conversational activity...

  3. Direct Conversion of Energy.

    Science.gov (United States)

    Corliss, William R.

    This publication is one of a series of information booklets for the general public published by the United States Atomic Energy Commission. Direct energy conversion involves energy transformation without moving parts. The concepts of direct and dynamic energy conversion plus the laws governing energy conversion are investigated. Among the topics…

  4. Does pedagogical documentation support maternal reminiscing conversations?

    Directory of Open Access Journals (Sweden)

    Bethany Fleck

    2015-12-01

    Full Text Available When parents talk with their children about lessons learned in school, they are participating in reminiscing of an unshared event. This study sought to understand if pedagogical documentation, from the Reggio Approach to early childhood education, would support and enhance the conversation. Mother–child dyads reminisced two separate times about preschool lessons, one time with documentation available to them and one time without. Transcripts were coded extracting variables indicative of high and low maternal reminiscing styles. Results indicate that mother and child conversation characteristics were more highly elaborative when documentation was present than when it was not. In addition, children added more information to the conversation supporting the notion that such conversations enhanced memory for lessons. Documentation could be used as a support tool for conversations and children’s memory about lessons learned in school.

  5. MSH6- or PMS2-deficiency causes re-replication in DT40 B cells, but it has little effect on immunoglobulin gene conversion or on repair of AID-generated uracils

    Science.gov (United States)

    Campo, Vanina A.; Patenaude, Anne-Marie; Kaden, Svenja; Horb, Lori; Firka, Daniel; Jiricny, Josef; Di Noia, Javier M.

    2013-01-01

    The mammalian antibody repertoire is shaped by somatic hypermutation (SHM) and class switch recombination (CSR) of the immunoglobulin (Ig) loci of B lymphocytes. SHM and CSR are triggered by non-canonical, error-prone processing of G/U mismatches generated by activation-induced deaminase (AID). In birds, AID does not trigger SHM, but it triggers Ig gene conversion (GC), a ‘homeologous’ recombination process involving the Ig variable region and proximal pseudogenes. Because recombination fidelity is controlled by the mismatch repair (MMR) system, we investigated whether MMR affects GC in the chicken B cell line DT40. We show here that Msh6−/− and Pms2−/− DT40 cells display cell cycle defects, including genomic re-replication. However, although IgVλ GC tracts in MMR-deficient cells were slightly longer than in normal cells, Ig GC frequency, donor choice or the number of mutations per sequence remained unaltered. The finding that the avian MMR system, unlike that of mammals, does not seem to contribute towards the processing of G/U mismatches in vitro could explain why MMR is unable to initiate Ig GC in this species, despite initiating SHM and CSR in mammalian cells. Moreover, as MMR does not counteract or govern Ig GC, we report a rare example of ‘homeologous’ recombination insensitive to MMR. PMID:23314153

  6. Elements of energy conversion

    CERN Document Server

    Russell, Charles R

    2013-01-01

    Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll

  7. Iterated multidimensional wave conversion

    International Nuclear Information System (INIS)

    Brizard, A. J.; Tracy, E. R.; Johnston, D.; Kaufman, A. N.; Richardson, A. S.; Zobin, N.

    2011-01-01

    Mode conversion can occur repeatedly in a two-dimensional cavity (e.g., the poloidal cross section of an axisymmetric tokamak). We report on two novel concepts that allow for a complete and global visualization of the ray evolution under iterated conversions. First, iterated conversion is discussed in terms of ray-induced maps from the two-dimensional conversion surface to itself (which can be visualized in terms of three-dimensional rooms). Second, the two-dimensional conversion surface is shown to possess a symplectic structure derived from Dirac constraints associated with the two dispersion surfaces of the interacting waves.

  8. Computers and conversation

    CERN Document Server

    Luff, Paul; Gilbert, Nigel G

    1986-01-01

    In the past few years a branch of sociology, conversation analysis, has begun to have a significant impact on the design of human*b1computer interaction (HCI). The investigation of human*b1human dialogue has emerged as a fruitful foundation for interactive system design.****This book includes eleven original chapters by leading researchers who are applying conversation analysis to HCI. The fundamentals of conversation analysis are outlined, a number of systems are described, and a critical view of their value for HCI is offered.****Computers and Conversation will be of interest to all concerne

  9. The mitochondrial genome of the stingless bee Melipona bicolor (Hymenoptera, Apidae, Meliponini: sequence, gene organization and a unique tRNA translocation event conserved across the tribe Meliponini

    Directory of Open Access Journals (Sweden)

    Daniela Silvestre

    2008-01-01

    Full Text Available At present a complete mtDNA sequence has been reported for only two hymenopterans, the Old World honey bee, Apis mellifera and the sawfly Perga condei. Among the bee group, the tribe Meliponini (stingless bees has some distinction due to its Pantropical distribution, great number of species and large importance as main pollinators in several ecosystems, including the Brazilian rain forest. However few molecular studies have been conducted on this group of bees and few sequence data from mitochondrial genomes have been described. In this project, we PCR amplified and sequenced 78% of the mitochondrial genome of the stingless bee Melipona bicolor (Apidae, Meliponini. The sequenced region contains all of the 13 mitochondrial protein-coding genes, 18 of 22 tRNA genes, and both rRNA genes (one of them was partially sequenced. We also report the genome organization (gene content and order, gene translation, genetic code, and other molecular features, such as base frequencies, codon usage, gene initiation and termination. We compare these characteristics of M. bicolor to those of the mitochondrial genome of A. mellifera and other insects. A highly biased A+T content is a typical characteristic of the A. mellifera mitochondrial genome and it was even more extreme in that of M. bicolor. Length and compositional differences between M. bicolor and A. mellifera genes were detected and the gene order was compared. Eleven tRNA gene translocations were observed between these two species. This latter finding was surprising, considering the taxonomic proximity of these two bee tribes. The tRNA Lys gene translocation was investigated within Meliponini and showed high conservation across the Pantropical range of the tribe.

  10. Assessing molecular initiating events (MIEs), key events (KEs) and modulating factors (MFs) for styrene responses in mouse lungs using whole genome gene expression profiling following 1-day and multi-week exposures.

    Science.gov (United States)

    Andersen, Melvin E; Cruzan, George; Black, Michael B; Pendse, Salil N; Dodd, Darol; Bus, James S; Sarang, Satinder S; Banton, Marcy I; Waites, Robbie; McMullen, Patrick D

    2017-11-15

    Styrene increased lung tumors in mice at chronic inhalation exposures of 20ppm and greater. MIEs, KEs and MFs were examined using gene expression in three strains of male mice (the parental C57BL/6 strain, a CYP2F2(-/-) knock out and a CYP2F2(-/-) transgenic containing human CYP2F1, 2A13 and 2B6). Exposures were for 1-day and 1, 4 and 26weeks. After 1-day exposures at 1, 5, 10, 20, 40 and 120ppm significant increases in differentially expressed genes (DEGs) occurred only in parental strain lungs where there was already an increase in DEGs at 5ppm and then many thousands of DEGs by 120ppm. Enrichment for 1-day and 1-week exposures included cell cycle, mitotic M-M/G1 phases, DNA-synthesis and metabolism of lipids and lipoproteins pathways. The numbers of DEGs decreased steadily over time with no DEGs meeting both statistical significance and fold-change criteria at 26weeks. At 4 and 26weeks, some key transcription factors (TFs) - Nr1d1, Nr1d2, Dbp, Tef, Hlf, Per3, Per2 and Bhlhe40 - were upregulated (|FC|>1.5), while others - Npas, Arntl, Nfil3, Nr4a1, Nr4a2, and Nr4a3 - were down-regulated. At all times, consistent changes in gene expression only occurred in the parental strain. Our results support a MIE for styrene of direct mitogenicity from mouse-specific CYP2F2-mediated metabolites activating Nr4a signaling. Longer-term MFs include down-regulation of Nr4a genes and shifts in both circadian clock TFs and other TFs, linking circadian clock to cellular metabolism. We found no gene expression changes indicative of cytotoxicity or activation of p53-mediated DNA-damage pathways. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Energy conversion alternatives study

    Science.gov (United States)

    Shure, L. T.

    1979-01-01

    Comparison of coal based energy systems is given. Study identifies and compares various advanced energy conversion systems using coal or coal derived fuels for baselaoad electric power generation. Energy Conversion Alternatives Study (ECAS) reports provede government, industry, and general public with technically consistent basis for comparison of system's options of interest for fossilfired electric-utility application.

  12. Hydrothermal conversion of biomass

    NARCIS (Netherlands)

    Knezevic, D.

    2009-01-01

    This thesis presents research of hydrothermal conversion of biomass (HTC). In this process, hot compressed water (subcritical water) is used as the reaction medium. Therefore this technique is suitable for conversion of wet biomass/ waste streams. By working at high pressures, the evaporation of

  13. Conversations in African Philosophy

    African Journals Online (AJOL)

    JONATHAN

    Conversational philosophy is articulated by Jonathan O. Chimakonam as the new wave of philosophical practice both in “place” and in “space”. This journal adopts and promotes this approach to philosophizing for African philosophy. Readers are encouraged to submit their conversational piece (maximum of 2000 words) ...

  14. Microwave plasma mode conversion

    International Nuclear Information System (INIS)

    Torres, H.S.; Sakanaka, P.H.; Villarroel, C.H.

    1985-01-01

    The behavior of hot electrons during the process of laser-produced plasma is studied. The basic equations of mode conversion from electromagnetic waves to electrostatic waves are presented. It is shown by mode conversion, that, the resonant absorption and parametric instabilities appear simultaneously, but in different plasma regions. (M.C.K.) [pt

  15. Political conversations on Facebook

    DEFF Research Database (Denmark)

    Sørensen, Mads P.

    2016-01-01

    Political conversations are according to theories on deliberative democracy essential to well-functioning democracies. Traditionally these conversations have taken place in face-to-face settings, in e.g. party meetings and town meetings. However, social media such as Facebook and Twitter offers new...... possibilities for online political conversations between citizens and politicians. This paper examines the presence on Facebook and Twitter of Members of the Danish national Parliament, the Folketing, and focusses on a quantitative mapping of the political conversation activities taking place in the threads...... following Facebook posts from Danish Members of Parliament (MPs). The paper shows that, in comparison with previous findings from other countries, Danish MPs have a relatively high degree of engagement in political conversations with citizens on Facebook – and that a large number of citizens follow MPs...

  16. Event Investigation

    International Nuclear Information System (INIS)

    Korosec, D.

    2000-01-01

    The events in the nuclear industry are investigated from the license point of view and from the regulatory side too. It is well known the importance of the event investigation. One of the main goals of such investigation is to prevent the circumstances leading to the event and the consequences of the event. The protection of the nuclear workers against nuclear hazard, and the protection of general public against dangerous effects of an event could be achieved by systematic approach to the event investigation. Both, the nuclear safety regulatory body and the licensee shall ensure that operational significant events are investigated in a systematic and technically sound manner to gather information pertaining to the probable causes of the event. One of the results should be appropriate feedback regarding the lessons of the experience to the regulatory body, nuclear industry and general public. In the present paper a general description of systematic approach to the event investigation is presented. The systematic approach to the event investigation works best where cooperation is present among the different divisions of the nuclear facility or regulatory body. By involving management and supervisors the safety office can usually improve their efforts in the whole process. The end result shall be a program which serves to prevent events and reduce the time and efforts solving the root cause which initiated each event. Selection of the proper method for the investigation and an adequate review of the findings and conclusions lead to the higher level of the overall nuclear safety. (author)

  17. Genome-wide high-resolution mapping of UV-induced mitotic recombination events in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Yi Yin

    2013-10-01

    Full Text Available In the yeast Saccharomyces cerevisiae and most other eukaryotes, mitotic recombination is important for the repair of double-stranded DNA breaks (DSBs. Mitotic recombination between homologous chromosomes can result in loss of heterozygosity (LOH. In this study, LOH events induced by ultraviolet (UV light are mapped throughout the genome to a resolution of about 1 kb using single-nucleotide polymorphism (SNP microarrays. UV doses that have little effect on the viability of diploid cells stimulate crossovers more than 1000-fold in wild-type cells. In addition, UV stimulates recombination in G1-synchronized cells about 10-fold more efficiently than in G2-synchronized cells. Importantly, at high doses of UV, most conversion events reflect the repair of two sister chromatids that are broken at approximately the same position whereas at low doses, most conversion events reflect the repair of a single broken chromatid. Genome-wide mapping of about 380 unselected crossovers, break-induced replication (BIR events, and gene conversions shows that UV-induced recombination events occur throughout the genome without pronounced hotspots, although the ribosomal RNA gene cluster has a significantly lower frequency of crossovers.

  18. Molecular evolution of the keratin associated protein gene family in mammals, role in the evolution of mammalian hair.

    Science.gov (United States)

    Wu, Dong-Dong; Irwin, David M; Zhang, Ya-Ping

    2008-08-23

    Hair is unique to mammals. Keratin associated proteins (KRTAPs), which contain two major groups: high/ultrahigh cysteine and high glycine-tyrosine, are one of the major components of hair and play essential roles in the formation of rigid and resistant hair shafts. The KRTAP family was identified as being unique to mammals, and near-complete KRTAP gene repertoires for eight mammalian genomes were characterized in this study. An expanded KRTAP gene repertoire was found in rodents. Surprisingly, humans have a similar number of genes as other primates despite the relative hairlessness of humans. We identified several new subfamilies not previously reported in the high/ultrahigh cysteine KRTAP genes. Genes in many subfamilies of the high/ultrahigh cysteine KRTAP genes have evolved by concerted evolution with frequent gene conversion events, yielding a higher GC base content for these gene sequences. In contrast, the high glycine-tyrosine KRTAP genes have evolved more dynamically, with fewer gene conversion events and thus have a lower GC base content, possibly due to positive selection. Most of the subfamilies emerged early in the evolution of mammals, thus we propose that the mammalian ancestor should have a diverse KRTAP gene repertoire. We propose that hair content characteristics have evolved and diverged rapidly among mammals because of rapid divergent evolution of KRTAPs between species. In contrast, subfamilies of KRTAP genes have been homogenized within each species due to concerted evolution.

  19. Event-related potentials (ERP and SGIP1 gene polymorphisms in alcoholics: relation to family history of alcoholism and drug usage

    Directory of Open Access Journals (Sweden)

    Roman Chwedorowicz

    2016-09-01

    The present study demonstrated a possible association of target P300 evoked theta and of alcohol dependence with SNPs from the gene SGIP1 in the region of rs10889635, but further studies are required.

  20. Concerted and nonconcerted evolution of the Hsp70 gene superfamily in two sibling species of nematodes.

    Science.gov (United States)

    Nikolaidis, Nikolas; Nei, Masatoshi

    2004-03-01

    We have identified the Hsp70 gene superfamily of the nematode Caenorhabditis briggsae and investigated the evolution of these genes in comparison with Hsp70 genes from C. elegans, Drosophila, and yeast. The Hsp70 genes are classified into three monophyletic groups according to their subcellular localization, namely, cytoplasm (CYT), endoplasmic reticulum (ER), and mitochondria (MT). The Hsp110 genes can be classified into the polyphyletic CYT group and the monophyletic ER group. The different Hsp70 and Hsp110 groups appeared to evolve following the model of divergent evolution. This model can also explain the evolution of the ER and MT genes. On the other hand, the CYT genes are divided into heat-inducible and constitutively expressed genes. The constitutively expressed genes have evolved more or less following the birth-and-death process, and the rates of gene birth and gene death are different between the two nematode species. By contrast, some heat-inducible genes show an intraspecies phylogenetic clustering. This suggests that they are subject to sequence homogenization resulting from gene conversion-like events. In addition, the heat-inducible genes show high levels of sequence conservation in both intra-species and inter-species comparisons, and in most cases, amino acid sequence similarity is higher than nucleotide sequence similarity. This indicates that purifying selection also plays an important role in maintaining high sequence similarity among paralogous Hsp70 genes. Therefore, we suggest that the CYT heat-inducible genes have been subjected to a combination of purifying selection, birth-and-death process, and gene conversion-like events.

  1. Parametric down conversion of X-rays, recent experiments

    CERN Document Server

    Adams, B; Novikov, D V; Materlik, G; Mills, D M

    2001-01-01

    Parametric down conversion of X-ray photons in diamond crystals was detected in six experiments, all using the phase matching scheme first employed in the X-ray regime by Eisenberger and McCall (Eisenberger and McCall, Phys. Rev. Lett. 26 (1971) 684). The conversion events were detected by a combination of time correlation spectroscopy and energy discrimination. The time correlation spectra gave a direct comparison of the conversion rate over the accidental coincidence rate.

  2. Reported Speech in Conversational Storytelling during Nursing Shift Handover Meetings

    Science.gov (United States)

    Bangerter, Adrian; Mayor, Eric; Pekarek Doehler, Simona

    2011-01-01

    Shift handovers in nursing units involve formal transmission of information and informal conversation about non-routine events. Informal conversation often involves telling stories. Direct reported speech (DRS) was studied in handover storytelling in two nursing care units. The study goal is to contribute to a better understanding of conversation…

  3. Uranium conversion; Urankonvertering

    Energy Technology Data Exchange (ETDEWEB)

    Oliver, Lena; Peterson, Jenny; Wilhelmsen, Katarina [Swedish Defence Research Agency (FOI), Stockholm (Sweden)

    2006-03-15

    FOI, has performed a study on uranium conversion processes that are of importance in the production of different uranium compounds in the nuclear industry. The same conversion processes are of interest both when production of nuclear fuel and production of fissile material for nuclear weapons are considered. Countries that have nuclear weapons ambitions, with the intention to produce highly enriched uranium for weapons purposes, need some degree of uranium conversion capability depending on the uranium feed material available. This report describes the processes that are needed from uranium mining and milling to the different conversion processes for converting uranium ore concentrate to uranium hexafluoride. Uranium hexafluoride is the uranium compound used in most enrichment facilities. The processes needed to produce uranium dioxide for use in nuclear fuel and the processes needed to convert different uranium compounds to uranium metal - the form of uranium that is used in a nuclear weapon - are also presented. The production of uranium ore concentrate from uranium ore is included since uranium ore concentrate is the feed material required for a uranium conversion facility. Both the chemistry and principles or the different uranium conversion processes and the equipment needed in the processes are described. Since most of the equipment that is used in a uranium conversion facility is similar to that used in conventional chemical industry, it is difficult to determine if certain equipment is considered for uranium conversion or not. However, the chemical conversion processes where UF{sub 6} and UF{sub 4} are present require equipment that is made of corrosion resistant material.

  4. Comparative genomic analysis of Vibrio parahaemolyticus: serotype conversion and virulence

    Directory of Open Access Journals (Sweden)

    Gil Ana I

    2011-06-01

    functional categories. Conclusions Our data support the idea that the pandemic strains are closely related and that recent South American outbreaks of foodborne disease caused by V. parahaemolyticus are closely linked to outbreaks in India. Serotype conversion from O3:K6 to O4:K68 was likely due to a recombination event involving a region much larger than the O-antigen- and K-antigen-encoding gene clusters. Major differences between pathogenicity islands and mobile elements are also likely driving the evolution of V. parahaemolyticus. In addition, our analyses categorized genes that may be useful in differentiating pathogenic Vibrios at the species level.

  5. Solar energy conversion systems

    CERN Document Server

    Brownson, Jeffrey R S

    2013-01-01

    Solar energy conversion requires a different mind-set from traditional energy engineering in order to assess distribution, scales of use, systems design, predictive economic models for fluctuating solar resources, and planning to address transient cycles and social adoption. Solar Energy Conversion Systems examines solar energy conversion as an integrative design process, applying systems thinking methods to a solid knowledge base for creators of solar energy systems. This approach permits different levels of access for the emerging broad audience of scientists, engineers, architects, planners

  6. Energy conversion statics

    CERN Document Server

    Messerle, H K; Declaris, Nicholas

    2013-01-01

    Energy Conversion Statics deals with equilibrium situations and processes linking equilibrium states. A development of the basic theory of energy conversion statics and its applications is presented. In the applications the emphasis is on processes involving electrical energy. The text commences by introducing the general concept of energy with a survey of primary and secondary energy forms, their availability, and use. The second chapter presents the basic laws of energy conversion. Four postulates defining the overall range of applicability of the general theory are set out, demonstrating th

  7. Uranium Conversion & Enrichment

    Energy Technology Data Exchange (ETDEWEB)

    Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-02-06

    The isotopes of uranium that are found in nature, and hence in ‘fresh’ Yellowcake’, are not in relative proportions that are suitable for power or weapons applications. The goal of conversion then is to transform the U3O8 yellowcake into UF6. Conversion and enrichment of uranium is usually required to obtain material with enough 235U to be usable as fuel in a reactor or weapon. The cost, size, and complexity of practical conversion and enrichment facilities aid in nonproliferation by design.

  8. Postoperative conversion disorder.

    Science.gov (United States)

    Afolabi, Kola; Ali, Sameer; Gahtan, Vivian; Gorji, Reza; Li, Fenghua; Nussmeier, Nancy A

    2016-05-01

    Conversion disorder is a psychiatric disorder in which psychological stress causes neurologic deficits. A 28-year-old female surgical patient had uneventful general anesthesia and emergence but developed conversion disorder 1 hour postoperatively. She reported difficulty speaking, right-hand numbness and weakness, and right-leg paralysis. Neurologic examination and imaging revealed no neuronal damage, herniation, hemorrhage, or stroke. The patient mentioned failing examinations the day before surgery and discontinuing her prescribed antidepressant medication, leading us to diagnose conversion disorder, with eventual confirmation by neuroimaging and follow-up examinations. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Uranium conversion wastes

    International Nuclear Information System (INIS)

    Vicente, R.; Dellamano, J.C.

    1989-12-01

    A set of mathematical equations was developed and used to estimate the radiological significance of each radionuclide potentially present in the uranium refining industry effluents. The equations described the evolution in time of the radionuclides activities in the uranium fuel cycle, from mining and milling, through the yellowcake, till the conversion effluents. Some radionuclides that are not usually monitored in conversion effluents (e.g. Pa-231 and Ac-227) were found to be potentially relevant from the radiological point of view in conversion facilities, and are certainly relevant in mining and milling industry, at least in a few waste streams. (author) [pt

  10. Freely flowing conversations

    DEFF Research Database (Denmark)

    Aakjær, Marie Kirstejn; Andrade, David; Dexters, Peter

    and in regards to rehabilitation efforts. In the context of prisons UDI is inspired by the complexity approach (Stacey 2005). We seek to facilitate freely flowing conversations between inmates, staff and managers – pushing the boundaries of existing norms, roles and beliefs. In the end however we rely...... relations by changing conversations. Through the theoretical framework of the complexity approach, we discuss how this may lead to organizational change. Finally we suggest that inviting inmates to take part in conversations about core organizational development may be a fundamental strategy in trying...

  11. Conversion of the random amplified polymorphic DNA (RAPD ...

    African Journals Online (AJOL)

    Conversion of the random amplified polymorphic DNA (RAPD) marker UBC#116 linked to Fusarium crown and root rot resistance gene (Frl) into a co-dominant sequence characterized amplified region (SCAR) marker for marker-assisted selection of tomato.

  12. SENTINEL EVENTS

    Directory of Open Access Journals (Sweden)

    Andrej Robida

    2004-09-01

    Full Text Available Background. The Objective of the article is a two year statistics on sentinel events in hospitals. Results of a survey on sentinel events and the attitude of hospital leaders and staff are also included. Some recommendations regarding patient safety and the handling of sentinel events are given.Methods. In March 2002 the Ministry of Health introduce a voluntary reporting system on sentinel events in Slovenian hospitals. Sentinel events were analyzed according to the place the event, its content, and root causes. To show results of the first year, a conference for hospital directors and medical directors was organized. A survey was conducted among the participants with the purpose of gathering information about their view on sentinel events. One hundred questionnaires were distributed.Results. Sentinel events. There were 14 reports of sentinel events in the first year and 7 in the second. In 4 cases reports were received only after written reminders were sent to the responsible persons, in one case no reports were obtained. There were 14 deaths, 5 of these were in-hospital suicides, 6 were due to an adverse event, 3 were unexplained. Events not leading to death were a suicide attempt, a wrong side surgery, a paraplegia after spinal anaesthesia, a fall with a femoral neck fracture, a damage of the spleen in the event of pleural space drainage, inadvertent embolization with absolute alcohol into a femoral artery and a physical attack on a physician by a patient. Analysis of root causes of sentinel events showed that in most cases processes were inadequate.Survey. One quarter of those surveyed did not know about the sentinel events reporting system. 16% were having actual problems when reporting events and 47% beleived that there was an attempt to blame individuals. Obstacles in reporting events openly were fear of consequences, moral shame, fear of public disclosure of names of participants in the event and exposure in mass media. The majority of

  13. Public affairs events at Ocean Sciences Meeting

    Science.gov (United States)

    Uhlenbrock, Kristan

    2012-02-01

    AGU public affairs will be cohosting two special events at Ocean Sciences 2012 that offer scientists opportunities to expand their communication, policy, and media experience. Join the conversations that highlight two important topics to connect science to society.

  14. Mining Conversational Social Video

    OpenAIRE

    Biel, Joan-Isaac

    2013-01-01

    The ubiquity of social media in our daily life, the intense user participation, and the explo- sion of multimedia content have generated an extraordinary interest from computer and social scientists to investigate the traces left by users to understand human behavior online. From this perspective, YouTube can be seen as the largest collection of audiovisual human behavioral data, among which conversational video blogs (vlogs) are one of the basic formats. Conversational vlogs have evolved fro...

  15. Persuasion detection in conversation

    OpenAIRE

    Gilbert, Henry T.

    2010-01-01

    Approved for public release; distribution is unlimited In this thesis, we present a system for annotating persuasion in conversation based on a social-psychological model. We augmented the social model developed by James Cialdini with some of our own categories for annotators to label. The conversations consisted of 37 hostage negotiation transcripts from private and public sources, with all personal information removed from the private source transcripts. We evaluated the level of agre...

  16. Perspective on direct conversion

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, W B

    1963-10-15

    The objective of direct conversion is high electrical output for minimum total cost, and not always high conversion efficiency. The wide range of techniques embracing cryogenics and hot plasma derives from the special requirements of source, environment, and application. Sources include solar and other radiation, nuclear fission and fusion, chemical energy, and heat. Environments and applications range from space vehicles to submarines and from giant power networks to isolated buoys and pocket devices. (auth)

  17. Event Modeling

    DEFF Research Database (Denmark)

    Bækgaard, Lars

    2001-01-01

    The purpose of this chapter is to discuss conceptual event modeling within a context of information modeling. Traditionally, information modeling has been concerned with the modeling of a universe of discourse in terms of information structures. However, most interesting universes of discourse...... are dynamic and we present a modeling approach that can be used to model such dynamics.We characterize events as both information objects and change agents (Bækgaard 1997). When viewed as information objects events are phenomena that can be observed and described. For example, borrow events in a library can...

  18. Conversational flow promotes solidarity.

    Science.gov (United States)

    Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H

    2013-01-01

    Social interaction is fundamental to the development of various aspects of "we-ness". Previous research has focused on the role the content of interaction plays in establishing feelings of unity, belongingness and shared reality (a cluster of variables referred to as solidarity here). The present paper is less concerned with content, but focuses on the form of social interaction. We propose that the degree to which conversations flow smoothly or not is, of itself, a cue to solidarity. We test this hypothesis in samples of unacquainted and acquainted dyads who communicate via headsets. Conversational flow is disrupted by introducing a delay in the auditory feedback (vs. no delay). Results of three studies show that smoothly coordinated conversations (compared with disrupted conversations and a control condition) increase feelings of belonging and perceptions of group entitativity, independently of conversation content. These effects are driven by the subjective experience of conversational flow. Our data suggest that this process occurs largely beyond individuals' control. We conclude that the form of social interaction is a powerful cue for inferring group solidarity. Implications for the impact of modern communication technology on developing a shared social identity are discussed.

  19. Conversational flow promotes solidarity.

    Directory of Open Access Journals (Sweden)

    Namkje Koudenburg

    Full Text Available Social interaction is fundamental to the development of various aspects of "we-ness". Previous research has focused on the role the content of interaction plays in establishing feelings of unity, belongingness and shared reality (a cluster of variables referred to as solidarity here. The present paper is less concerned with content, but focuses on the form of social interaction. We propose that the degree to which conversations flow smoothly or not is, of itself, a cue to solidarity. We test this hypothesis in samples of unacquainted and acquainted dyads who communicate via headsets. Conversational flow is disrupted by introducing a delay in the auditory feedback (vs. no delay. Results of three studies show that smoothly coordinated conversations (compared with disrupted conversations and a control condition increase feelings of belonging and perceptions of group entitativity, independently of conversation content. These effects are driven by the subjective experience of conversational flow. Our data suggest that this process occurs largely beyond individuals' control. We conclude that the form of social interaction is a powerful cue for inferring group solidarity. Implications for the impact of modern communication technology on developing a shared social identity are discussed.

  20. The C50T polymorphism of the cyclooxygenase-I gene and the risk of thrombotic events during low-dose therapy with acetyl salicylic acid

    NARCIS (Netherlands)

    Clappers, Nick; van Oijen, Martijn G. H.; Sundaresan, Santosh; Brouwer, Marc A.; te Morsche, Rene H. M.; Keuper, Wessel; Peters, Wilbert H. M.; Drenth, Joost P. H.; Verheugt, Freek W. A.

    2008-01-01

    prevents thrombotic events by inhibiting platelet cyclooxygenase-I (COX-1), thus reducing thromboxane A2 formation and platelet aggregation.The C50T polymorphism of COX-1 is associated with an impaired inhibition of both thromboxane production and in-vitro platelet aggregation by aspirin.We studied

  1. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  2. Conversion disorder: a problematic diagnosis.

    Science.gov (United States)

    Nicholson, Timothy R J; Stone, Jon; Kanaan, Richard A A

    2011-11-01

    The diagnosis of conversion disorder is problematic. Since doctors have conceptually and practically differentiated the symptoms from neurological ('organic') disease it has been presumed to be a psychological disorder, but the psychological mechanism, and how this differs from feigning (conscious simulation), has remained elusive. Although misdiagnosis of neurological disease as conversion disorder is uncommon, it remains a concern for clinicians, particularly for psychiatrists who may be unaware of the positive ways in which neurologists can exclude organic disease. The diagnosis is anomalous in psychiatry in that current diagnostic systems require that feigning is excluded and that the symptoms can be explained psychologically. In practice, feigning is very difficult to either disprove or prove, and a psychological explanation cannot always be found. Studies of childhood and adult psychological precipitants have tended to support the relevance of stressful life events prior to symptom onset at the group level but they are not found in a substantial proportion of cases. These problems highlight serious theoretical and practical issues not just for the current diagnostic systems but for the concept of the disorder itself. Psychology, physiology and functional imaging techniques have been used in attempts to elucidate the neurobiology of conversion disorder and to differentiate it from feigning, but while intriguing results are emerging they can only be considered preliminary. Such work looks to a future that could refine our understanding of the disorder. However, until that time, the formal diagnostic requirement for associated psychological stressors and the exclusion of feigning are of limited clinical value. Simplified criteria are suggested which will also encourage cooperation between neurology and psychiatry in the management of these patients.

  3. Boiler conversions for biomass

    Energy Technology Data Exchange (ETDEWEB)

    Kinni, J [Tampella Power Inc., Tampere (Finland)

    1997-12-31

    Boiler conversions from grate- and oil-fired boilers to bubbling fluidized bed combustion have been most common in pulp and paper industry. Water treatment sludge combustion, need for additional capacity and tightened emission limits have been the driving forces for the conversion. To accomplish a boiler conversion for biofuel, the lower part of the boiler is replaced with a fluidized bed bottom and new fuel, ash and air systems are added. The Imatran Voima Rauhalahti pulverized-peat-fired boiler was converted to bubbling fluidized bed firing in 1993. In the conversion the boiler capacity was increased by 10 % to 295 MWth and NO{sub x} emissions dropped. In the Kymmene Kuusankoski boiler, the reason for conversion was the combustion of high chlorine content biosludge. The emissions have been under general European limits. During the next years, the emission limits will tighten and the boilers will be designed for most complete combustion and compounds, which can be removed from flue gases, will be taken care of after the boiler. (orig.) 3 refs.

  4. Boiler conversions for biomass

    Energy Technology Data Exchange (ETDEWEB)

    Kinni, J. [Tampella Power Inc., Tampere (Finland)

    1996-12-31

    Boiler conversions from grate- and oil-fired boilers to bubbling fluidized bed combustion have been most common in pulp and paper industry. Water treatment sludge combustion, need for additional capacity and tightened emission limits have been the driving forces for the conversion. To accomplish a boiler conversion for biofuel, the lower part of the boiler is replaced with a fluidized bed bottom and new fuel, ash and air systems are added. The Imatran Voima Rauhalahti pulverized-peat-fired boiler was converted to bubbling fluidized bed firing in 1993. In the conversion the boiler capacity was increased by 10 % to 295 MWth and NO{sub x} emissions dropped. In the Kymmene Kuusankoski boiler, the reason for conversion was the combustion of high chlorine content biosludge. The emissions have been under general European limits. During the next years, the emission limits will tighten and the boilers will be designed for most complete combustion and compounds, which can be removed from flue gases, will be taken care of after the boiler. (orig.) 3 refs.

  5. Witnessing stressful events induces glutamatergic synapse pathway alterations and gene set enrichment of positive EPSP regulation within the VTA of adult mice: An ontology based approach

    Science.gov (United States)

    Brewer, Jacob S.

    It is well known that exposure to severe stress increases the risk for developing mood disorders. Currently, the neurobiological and genetic mechanisms underlying the functional effects of psychological stress are poorly understood. Presenting a major obstacle to the study of psychological stress is the inability of current animal models of stress to distinguish between physical and psychological stressors. A novel paradigm recently developed by Warren et al., is able to tease apart the effects of physical and psychological stress in adult mice by allowing these mice to "witness," the social defeat of another mouse thus removing confounding variables associated with physical stressors. Using this 'witness' model of stress and RNA-Seq technology, the current study aims to study the genetic effects of psychological stress. After, witnessing the social defeat of another mouse, VTA tissue was extracted, sequenced, and analyzed for differential expression. Since genes often work together in complex networks, a pathway and gene ontology (GO) analysis was performed using data from the differential expression analysis. The pathway and GO analyzes revealed a perturbation of the glutamatergic synapse pathway and an enrichment of positive excitatory post-synaptic potential regulation. This is consistent with the excitatory synapse theory of depression. Together these findings demonstrate a dysregulation of the mesolimbic reward pathway at the gene level as a result of psychological stress potentially contributing to depressive like behaviors.

  6. Conversation practices and network structure in Twitter

    DEFF Research Database (Denmark)

    Rossi, Luca; Magnani, Matteo

    2012-01-01

    The public by default nature of Twitter messages, together with the adoption of the #hashtag convention led, in few years, to the creation of a digital space able to host worldwide conversation on almost every kind of topic. From major TV shows to Natural disasters there is no contemporary event...... that does not have its own #hashtag to gather together the ongoing Twitter conversation. These topical discussions take place outside of the Twitter network made of followers and friends. Nevertheless this topical network is where many of the most studied phenomena take place. Therefore Twitter based...... communication exists on two almost autonomous levels: the Twitter network made of followers and friends that shows a certain level of stability and the topical network, characterized by a high level of contingency, that appears and disappears following the rhythm of a worldwide conversation. Despite the fact...

  7. Photovoltaic solar energy conversion

    CERN Document Server

    Bauer, Gottfried H

    2015-01-01

    This concise primer on photovoltaic solar energy conversion invites readers to reflect on the conversion of solar light into energy at the most fundamental level and encourages newcomers to the field to help find meaningful answers on how photovoltaic solar energy conversion can work (better), eventually contributing to its ongoing advancement. The book is based on lectures given to graduate students in the Physics Department at the University of Oldenburg over the last two decades, yet also provides an easy-to-follow introduction for doctoral and postdoctoral students from related disciplines such as the materials sciences and electrical engineering. Inspired by classic textbooks in the field, it reflects the author’s own ideas on how to understand, visualize and eventually teach the microscopic physical mechanisms and effects, while keeping the text as concise as possible so as to introduce interested readers to the field and balancing essential knowledge with open questions.

  8. Catalytic Conversion of Carbohydrates

    DEFF Research Database (Denmark)

    Osmundsen, Christian Mårup

    a renewable route to aromatics. The conversion of biomass by high temperature processes is a desirable prospect due to the high volumetric production rates which can be achieved, and the ability of these types of processes to convert a wide range of substrates. Current processes however typically have rather...... with the production of commodity chemicals from the most abundantly available renewable source of carbon, carbohydrates. The production of alkyl lactates by the Lewis acid catalyzed conversion of hexoses is an interesting alternative to current fermentation based processes. A range of stannosilicates were...... to be an efficient initial conversion step in the utilization of biomass for chemicals production. The shift from an oil based chemical industry to one based on renewable resources is bound to happen sooner or later, however the environmental problems associated with the burning of fossil resources means...

  9. A simple model for the influence of meiotic conversion tracts on GC content.

    Directory of Open Access Journals (Sweden)

    Marie-Claude Marsolier-Kergoat

    Full Text Available A strong correlation between GC content and recombination rate is observed in many eukaryotes, which is thought to be due to conversion events linked to the repair of meiotic double-strand breaks. In several organisms, the length of conversion tracts has been shown to decrease exponentially with increasing distance from the sites of meiotic double-strand breaks. I show here that this behavior leads to a simple analytical model for the evolution and the equilibrium state of the GC content of sequences devoid of meiotic double-strand break sites. In the yeast Saccharomyces cerevisiae, meiotic double-strand breaks are practically excluded from protein-coding sequences. A good fit was observed between the predictions of the model and the variations of the average GC content of the third codon position (GC3 of S. cerevisiae genes. Moreover, recombination parameters that can be extracted by fitting the data to the model coincide with experimentally determined values. These results thus indicate that meiotic recombination plays an important part in determining the fluctuations of GC content in yeast coding sequences. The model also accounted for the different patterns of GC variations observed in the genes of Candida species that exhibit a variety of sexual lifestyles, and hence a wide range of meiotic recombination rates. Finally, the variations of the average GC3 content of human and chicken coding sequences could also be fitted by the model. These results suggest the existence of a widespread pattern of GC variation in eukaryotic genes due to meiotic recombination, which would imply the generality of two features of meiotic recombination: its association with GC-biased gene conversion and the quasi-exclusion of meiotic double-strand breaks from coding sequences. Moreover, the model points out to specific constraints on protein fragments encoded by exon terminal sequences, which are the most affected by the GC bias.

  10. Converse Barrier Certificate Theorem

    DEFF Research Database (Denmark)

    Wisniewski, Rafael; Sloth, Christoffer

    2013-01-01

    This paper presents a converse barrier certificate theorem for a generic dynamical system.We show that a barrier certificate exists for any safe dynamical system defined on a compact manifold. Other authors have developed a related result, by assuming that the dynamical system has no singular...... points in the considered subset of the state space. In this paper, we redefine the standard notion of safety to comply with generic dynamical systems with multiple singularities. Afterwards, we prove the converse barrier certificate theorem and illustrate the differences between ours and previous work...

  11. Dose conversion factors

    International Nuclear Information System (INIS)

    Kocher, D.C.; Eckerman, K.F.

    1992-01-01

    The following is discussed in this report: concepts and quantities used in calculating radiation dose from internal and external exposure. Tabulations of dose conversion factor for internal and external exposure to radionuclides. Dose conversion factors give dose per unit intake (internal) or dose per unit concentration in environment (external). Intakes of radionuclides for internal exposure and concentrations of radionuclides in environment for external exposure are assumed to be known. Intakes and concentrations are obtained, e.g., from analyses of environmental transport and exposure pathways. differences between dosimetry methods for radionuclides and hazardous chemicals are highlighted

  12. Ocean wave energy conversion

    CERN Document Server

    McCormick, Michael E

    2007-01-01

    This volume will prove of vital interest to those studying the use of renewable resources. Scientists, engineers, and inventors will find it a valuable review of ocean wave mechanics as well as an introduction to wave energy conversion. It presents physical and mathematical descriptions of the nine generic wave energy conversion techniques, along with their uses and performance characteristics.Author Michael E. McCormick is the Corbin A. McNeill Professor of Naval Engineering at the U.S. Naval Academy. In addition to his timely and significant coverage of possible environmental effects associa

  13. Magnetohydrodynamic energy conversion

    International Nuclear Information System (INIS)

    Rosa, R.J.

    1987-01-01

    The object of this book is to present a review of the basic principles and practical aspects of magnetohydrodynamic (MHD) energy conversion. The author has tried to give qualitative semiphysical arguments where possible for the benefit of the reader who is unfamiliar with plasma physics. The aim of MHD energy conversion is to apply to a specific practical goal a part of what has become a vast area of science called plasma physics. The author has attempted to note in the text where a broader view might be fruitful and to give appropriate references

  14. A Novel Heterozygous Intronic Mutation in the FBN1 Gene Contributes to FBN1 RNA Missplicing Events in the Marfan Syndrome

    Directory of Open Access Journals (Sweden)

    Mario Torrado

    2018-01-01

    Full Text Available Marfan syndrome (MFS is an autosomal dominantly inherited connective tissue disorder, mostly caused by mutations in the fibrillin-1 (FBN1 gene. We, by using targeted next-generation sequence analysis, identified a novel intronic FBN1 mutation (the c.2678-15C>A variant in a MFS patient with aortic dilatation. The computational predictions showed that the heterozygous c.2678-15C>A intronic variant might influence the splicing process by differentially affecting canonical versus cryptic splice site utilization within intron 22 of the FBN1 gene. RT-PCR and Western blot analyses, using FBN1 minigenes transfected into HeLa and COS-7 cells, revealed that the c.2678-15C>A variant disrupts normal splicing of intron 22 leading to aberrant 13-nt intron 22 inclusion, frameshift, and premature termination codon. Collectively, the results strongly suggest that the c.2678-15C>A variant could lead to haploinsufficiency of the FBN1 functional protein and structural connective tissue fragility in MFS complicated by aorta dilation, a finding that further expands on the genetic basis of aortic pathology.

  15. Catalytic Conversion of Biofuels

    DEFF Research Database (Denmark)

    Jørgensen, Betina

    This thesis describes the catalytic conversion of bioethanol into higher value chemicals. The motivation has been the unavoidable coming depletion of the fossil resources. The thesis is focused on two ways of utilising ethanol; the steam reforming of ethanol to form hydrogen and the partial oxida...

  16. Electrochemical solar energy conversion

    International Nuclear Information System (INIS)

    Gerischer, H.

    1991-01-01

    The principles of solar energy conversion in photoelectrochemical cells are briefly reviewed. Cells for the generation of electric power and for energy storage in form of electrochemical energy are described. These systems are compared with solid state photovoltaic devices, and the inherent difficulties for the operation of the electrochemical systems are analyzed. (author). 28 refs, 10 figs

  17. Converse Barrier Certificate Theorems

    DEFF Research Database (Denmark)

    Wisniewski, Rafael; Sloth, Christoffer

    2016-01-01

    This paper shows that a barrier certificate exists for any safe dynamical system. Specifically, we prove converse barrier certificate theorems for a class of structurally stable dynamical systems. Other authors have developed a related result by assuming that the dynamical system has neither...

  18. Wavelength conversion devices

    DEFF Research Database (Denmark)

    Mikkelsen, Benny; Durhuus, Terji; Jørgensen, Carsten

    1996-01-01

    system requirements. The ideal wavelength converter should be transparent to the bit rate and signal format and provide an unchirped output signal with both a high extinction ratio and a large signal-to-noise ratio. It should allow conversion to both shorter and longer wavelengths with equal performance...

  19. Conversation and research

    NARCIS (Netherlands)

    Schuurman, Jan Gerrit; Veermans, K.H.

    2001-01-01

    Gordon Pask’s conversation theory was created in the 1970s. The theory encompasses a high-level framework for studying interactions between actors in artificial situations where people co-operate, have conflicts, follow rules, negotiate outcomes, invent new rules together, etc. Sadly, the theory is

  20. Catalyst for hydrocarbon conversion

    International Nuclear Information System (INIS)

    Duhaut, P.; Miquel, J.

    1975-01-01

    A description is given for a catalyst and process for hydrocarbon conversions, e.g., reforming. The catalyst contains an alumina carrier, platinum, iridium, at least one metal selected from uranium, vanadium, and gallium, and optionally halogen in the form of metal halide of one of the aforesaid components. (U.S.)

  1. The Nanticoke conversion study

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-04-01

    A study was conducted to assess the conversion of the Nanticoke coal-fired power plant to cleaner burning natural gas combined-cycle gas turbines. The Nanticoke Generating Station on Lake Erie is responsible for more than 50 per cent of Ontario Power Generation's (OPG) coal-fired electricity production. The OPG is proposing to work towards compliance with the newly signed Ozone Annex to the 1991 Canada-United States Air Quality Agreement which will require fossil-fueled power plants in southern Ontario to reduce their smog-causing nitrogen oxides emissions by about 50 per cent by 2007. This study assessed the emission reduction benefits and financial costs of conversion compared to continuing to operate Nanticoke as a coal-fired plant. The analysis includes a base case set of data on fuel prices, retrofit costs, fuel efficiencies, annual capacity factors and other parameters. It was determined that conversion would cost the average household less than $3 per month on their electricity bill. Conversion would also reduce emissions nitrogen oxide, a major smog pollutant, by 83 per cent and the particulates that form the most health-threatening portion of smog would be reduced by 100 per cent. 15 tabs., 1 fig.

  2. Leadership is a conversation.

    Science.gov (United States)

    Groysberg, Boris; Slind, Michael

    2012-06-01

    Globalization and new technologies have sharply reduced the efficacy of command-and-control management and its accompanying forms of corporate communication. In the course of a recent research project, the authors concluded that by talking with employees, rather than simply issuing orders, leaders can promote operational flexibility, employee engagement, and tight strategic alignment. Groysberg and Slind have identified four elements of organizational conversation that reflect the essential attributes of interpersonal conversation: intimacy, interactivity, inclusion, and intentionality. Intimacy shifts the focus from a top-down distribution of information to a bottom-up exchange of ideas. Organizational conversation is less corporate in tone and more casual. And it's less about issuing and taking orders than about asking and answering questions. Interactivity entails shunning the simplicity of monologue and embracing the unpredictable vitality of dialogue. Traditional one-way media-print and broadcast, in particular-give way to social media buttressed by social thinking. Inclusion turns employees into full-fledged conversation partners, entitling them to provide their own ideas, often on company channels. They can create content and act as brand ambassadors, thought leaders, and storytellers. Intentionality enables leaders and employees to derive strategically relevant action from the push and pull of discussion and debate.

  3. Predicting AD conversion

    DEFF Research Database (Denmark)

    Liu, Yawu; Mattila, Jussi; Ruiz, Miguel �ngel Mu�oz

    2013-01-01

    To compare the accuracies of predicting AD conversion by using a decision support system (PredictAD tool) and current research criteria of prodromal AD as identified by combinations of episodic memory impairment of hippocampal type and visual assessment of medial temporal lobe atrophy (MTA) on MRI...

  4. Conversion tables. Appendix I

    International Nuclear Information System (INIS)

    McKerrell, H.

    1975-01-01

    Tables are presented for the conversion of standard (5568 year half-life) C-14 dates to calendar years. The major part of the data converts C-14 dates to tree-ring years: additional data are given, based on the Egyptian historical curve. (U.K.)

  5. Wavelength conversion technology

    DEFF Research Database (Denmark)

    Stubkjær, Kristian

    1998-01-01

    Optical wavelength conversion is currently attracting much interest. This is because it enables full flexibility and eases management of WDM fibre networks. The tutorial will review existing and potential application areas. Examples of node architectures and network demonstrators that use wavelen...

  6. Our Digital Conversion

    Science.gov (United States)

    Edwards, Mark

    2012-01-01

    In this article, the author describes their digital conversion initiative at Mooresville Graded School District. The project has placed a MacBook Air laptop in the hands of every 3rd through 12th grader and their teachers in the district over the past four years, with over 5,000 computers distributed. But they believe their academic successes have…

  7. Fusion events

    International Nuclear Information System (INIS)

    Aboufirassi, M; Angelique, J.C.; Bizard, G.; Bougault, R.; Brou, R.; Buta, A.; Colin, J.; Cussol, D.; Durand, D.; Genoux-Lubain, A.; Horn, D.; Kerambrun, A.; Laville, J.L.; Le Brun, C.; Lecolley, J.F.; Lefebvres, F.; Lopez, O.; Louvel, M.; Meslin, C.; Metivier, V.; Nakagawa, T.; Peter, J.; Popescu, R.; Regimbart, R.; Steckmeyer, J.C.; Tamain, B.; Vient, E.; Wieloch, A.; Yuasa-Nakagawa, K.

    1998-01-01

    The fusion reactions between low energy heavy ions have a very high cross section. First measurements at energies around 30-40 MeV/nucleon indicated no residue of either complete or incomplete fusion, thus demonstrating the disappearance of this process. This is explained as being due to the high amount o energies transferred to the nucleus, what leads to its total dislocation in light fragments and particles. Exclusive analyses have permitted to mark clearly the presence of fusion processes in heavy systems at energies above 30-40 MeV/nucleon. Among the complete events of the Kr + Au reaction at 60 MeV/nucleon the majority correspond to binary collisions. Nevertheless, for the most considerable energy losses, a class of events do occur for which the detected fragments appears to be emitted from a unique source. These events correspond to an incomplete projectile-target fusion followed by a multifragmentation. Such events were singled out also in the reaction Xe + Sn at 50 MeV/nucleon. For the events in which the energy dissipation was maximal it was possible to isolate an isotropic group of events showing all the characteristics of fusion nuclei. The fusion is said to be incomplete as pre-equilibrium Z = 1 and Z = 2 particles are emitted. The cross section is of the order of 25 mb. Similar conclusions were drown for the systems 36 Ar + 27 Al and 64 Zn + nat Ti. A cross section value of ∼ 20 mb was determined at 55 MeV/nucleon in the first case, while the measurement of evaporation light residues in the last system gave an upper limit of 20-30 mb for the cross section at 50 MeV/nucleon

  8. Arabidopsis thaliana population analysis reveals high plasticity of the genomic region spanning MSH2, AT3G18530 and AT3G18535 genes and provides evidence for NAHR-driven recurrent CNV events occurring in this location.

    Science.gov (United States)

    Zmienko, Agnieszka; Samelak-Czajka, Anna; Kozlowski, Piotr; Szymanska, Maja; Figlerowicz, Marek

    2016-11-08

    Intraspecies copy number variations (CNVs), defined as unbalanced structural variations of specific genomic loci, ≥1 kb in size, are present in the genomes of animals and plants. A growing number of examples indicate that CNVs may have functional significance and contribute to phenotypic diversity. In the model plant Arabidopsis thaliana at least several hundred protein-coding genes might display CNV; however, locus-specific genotyping studies in this plant have not been conducted. We analyzed the natural CNVs in the region overlapping MSH2 gene that encodes the DNA mismatch repair protein, and AT3G18530 and AT3G18535 genes that encode poorly characterized proteins. By applying multiplex ligation-dependent probe amplification and droplet digital PCR we genotyped those genes in 189 A. thaliana accessions. We found that AT3G18530 and AT3G18535 were duplicated (2-14 times) in 20 and deleted in 101 accessions. MSH2 was duplicated in 12 accessions (up to 12-14 copies) but never deleted. In all but one case, the MSH2 duplications were associated with those of AT3G18530 and AT3G18535. Considering the structure of the CNVs, we distinguished 5 genotypes for this region, determined their frequency and geographical distribution. We defined the CNV breakpoints in 35 accessions with AT3G18530 and AT3G18535 deletions and tandem duplications and showed that they were reciprocal events, resulting from non-allelic homologous recombination between 99 %-identical sequences flanking these genes. The widespread geographical distribution of the deletions supported by the SNP and linkage disequilibrium analyses of the genomic sequence confirmed the recurrent nature of this CNV. We characterized in detail for the first time the complex multiallelic CNV in Arabidopsis genome. The region encoding MSH2, AT3G18530 and AT3G18535 genes shows enormous variation of copy numbers among natural ecotypes, being a remarkable example of high Arabidopsis genome plasticity. We provided the molecular

  9. A novel Robertsonian translocation event leads to transfer of a stem rust resistance gene (Sr52) effective against race Ug99 from Dasypyrum villosum into bread wheat.

    Science.gov (United States)

    Qi, L L; Pumphrey, M O; Friebe, Bernd; Zhang, P; Qian, C; Bowden, R L; Rouse, M N; Jin, Y; Gill, B S

    2011-06-01

    Stem rust (Puccinia graminis f. sp. tritici Eriks. & E. Henn.) (the causal agent of wheat stem rust) race Ug99 (also designated TTKSK) and its derivatives have defeated several important stem rust resistance genes widely used in wheat (Triticum aestivum L.) production, rendering much of the worldwide wheat acreage susceptible. In order to identify new resistance sources, a large collection of wheat relatives and genetic stocks maintained at the Wheat Genetic and Genomic Resources Center was screened. The results revealed that most accessions of the diploid relative Dasypyrum villosum (L.) Candargy were highly resistant. The screening of a set of wheat-D. villosum chromosome addition lines revealed that the wheat-D. villosum disomic addition line DA6V#3 was moderately resistant to race Ug99. The objective of the present study was to produce and characterize compensating wheat-D. villosum whole arm Robertsonian translocations (RobTs) involving chromosomes 6D of wheat and 6V#3 of D. villosum through the mechanism of centric breakage-fusion. Seven 6V#3-specific EST-STS markers were developed for screening F(2) progeny derived from plants double-monosomic for chromosomes 6D and 6V#3. Surprisingly, although 6D was the target chromosome, all recovered RobTs involved chromosome 6A implying a novel mechanism for the origin of RobTs. Homozygous translocations (T6AS·6V#3L and T6AL·6V#3S) with good plant vigor and full fertility were selected from F(3) families. A stem rust resistance gene was mapped to the long arm 6V#3L in T6AS·6V#3L and was designated as Sr52. Sr52 is temperature-sensitive and is most effective at 16°C, partially effective at 24°C, and ineffective at 28°C. The T6AS·6V#3L stock is a new source of resistance to Ug99, is cytogenetically stable, and may be useful in wheat improvement.

  10. Wind energy conversion system

    Science.gov (United States)

    Longrigg, Paul

    1987-01-01

    The wind energy conversion system includes a wind machine having a propeller connected to a generator of electric power, the propeller rotating the generator in response to force of an incident wind. The generator converts the power of the wind to electric power for use by an electric load. Circuitry for varying the duty factor of the generator output power is connected between the generator and the load to thereby alter a loading of the generator and the propeller by the electric load. Wind speed is sensed electro-optically to provide data of wind speed upwind of the propeller, to thereby permit tip speed ratio circuitry to operate the power control circuitry and thereby optimize the tip speed ratio by varying the loading of the propeller. Accordingly, the efficiency of the wind energy conversion system is maximized.

  11. Same β-globin gene mutation is present on nine different β-thalassemia chromosomes in a Sardinian population

    International Nuclear Information System (INIS)

    Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.

    1987-01-01

    The predominant β-thalassemia in Sardinia is the β 0 type in which no β-globin chains are synthesized in the homozygous state. The authors determined the β-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same β/sup 39(CAG→TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the β-globin gene region

  12. Clinical linguistics: conversational reflections.

    Science.gov (United States)

    Crystal, David

    2013-04-01

    This is a report of the main points I made in an informal "conversation" with Paul Fletcher and the audience at the 14th ICPLA conference in Cork. The observations arose randomly, as part of an unstructured 1-h Q&A, so they do not provide a systematic account of the subject, but simply reflect the issues which were raised by the conference participants during that time.

  13. Post-event processing in social anxiety.

    Science.gov (United States)

    Dannahy, Laura; Stopa, Lusia

    2007-06-01

    Clark and Wells' [1995. A cognitive model of social phobia. In: R. Heimberg, M. Liebowitz, D.A. Hope, & F.R. Schneier (Eds.) Social phobia: Diagnosis, assessment and treatment (pp. 69-93). New York: Guildford Press.] cognitive model of social phobia proposes that following a social event, individuals with social phobia will engage in post-event processing, during which they conduct a detailed review of the event. This study investigated the relationship between self-appraisals of performance and post-event processing in individuals high and low in social anxiety. Participants appraised their performance immediately after a conversation with an unknown individual and prior to an anticipated second conversation task 1 week later. The frequency and valence of post-event processing during the week following the conversation was also assessed. The study also explored differences in the metacognitive processes of high and low socially anxious participants. The high socially anxious group experienced more anxiety, predicted worse performance, underestimated their actual performance, and engaged in more post-event processing than low socially anxious participants. The degree of negative post-event processing was linked to the extent of social anxiety and negative appraisals of performance, both immediately after the conversation task and 1 week later. Differences were also observed in some metacognitive processes. The results are discussed in relation to current theory and previous research.

  14. Nuclear spin conversion in formaldehyde

    OpenAIRE

    Chapovsky, Pavel L.

    2000-01-01

    Theoretical model of the nuclear spin conversion in formaldehyde (H2CO) has been developed. The conversion is governed by the intramolecular spin-rotation mixing of molecular ortho and para states. The rate of conversion has been found equal 1.4*10^{-4}~1/s*Torr. Temperature dependence of the spin conversion has been predicted to be weak in the wide temperature range T=200-900 K.

  15. Microbial Energy Conversion

    Energy Technology Data Exchange (ETDEWEB)

    Buckley, Merry [American Society for Microbiology (ASM), Washington, DC (United States); Wall, Judy D. [Univ. of Missouri, Columbia, MO (United States)

    2006-10-01

    The American Academy of Microbiology convened a colloquium March 10-12, 2006, in San Francisco, California, to discuss the production of energy fuels by microbial conversions. The status of research into various microbial energy technologies, the advantages and disadvantages of each of these approaches, research needs in the field, and education and training issues were examined, with the goal of identifying routes for producing biofuels that would both decrease the need for fossil fuels and reduce greenhouse gas emissions. Currently, the choices for providing energy are limited. Policy makers and the research community must begin to pursue a broader array of potential energy technologies. A diverse energy portfolio that includes an assortment of microbial energy choices will allow communities and consumers to select the best energy solution for their own particular needs. Funding agencies and governments alike need to prepare for future energy needs by investing both in the microbial energy technologies that work today and in the untested technologies that will serve the world’s needs tomorrow. More mature bioprocesses, such as ethanol production from starchy materials and methane from waste digestors, will find applications in the short term. However, innovative techniques for liquid fuel or biohydrogen production are among the longer term possibilities that should also be vigorously explored, starting now. Microorganisms can help meet human energy needs in any of a number of ways. In their most obvious role in energy conversion, microorganisms can generate fuels, including ethanol, hydrogen, methane, lipids, and butanol, which can be burned to produce energy. Alternatively, bacteria can be put to use in microbial fuel cells, where they carry out the direct conversion of biomass into electricity. Microorganisms may also be used some day to make oil and natural gas technologies more efficient by sequestering carbon or by assisting in the recovery of oil and

  16. Infrared up-conversion microscope

    DEFF Research Database (Denmark)

    2014-01-01

    There is presented an up-conversion infrared microscope (110) arranged for imaging an associated object (130), wherein the up-conversion infrared microscope (110) comprises a non-linear crystal (120) arranged for up-conversion of infrared electromagnetic radiation, and wherein an objective optical...

  17. Infrared up-conversion telescope

    DEFF Research Database (Denmark)

    2014-01-01

    There is presented to an up-conversion infrared telescope (110) arranged for imaging an associated scene (130), wherein the up-conversion infrared telescope (110) comprises a non-linear crystal (120) arranged for up-conversion of infrared electromagnetic radiation, and wherein a first optical...

  18. The FLIC conversion codes

    International Nuclear Information System (INIS)

    Basher, J.C.

    1965-05-01

    This report describes the FORTRAN programmes, FLIC 1 and FLIC 2. These programmes convert programmes coded in one dialect of FORTRAN to another dialect of the same language. FLIC 1 is a general pattern recognition and replacement programme whereas FLIC 2 contains extensions directed towards the conversion of FORTRAN II and S2 programmes to EGTRAN 1 - the dialect now in use on the Winfrith KDF9. FII or S2 statements are replaced where possible by their E1 equivalents; other statements which may need changing are flagged. (author)

  19. Zinc phosphate conversion coatings

    Science.gov (United States)

    Sugama, Toshifumi

    1997-01-01

    Zinc phosphate conversion coatings for producing metals which exhibit enhanced corrosion prevention characteristics are prepared by the addition of a transition-metal-compound promoter comprising a manganese, iron, cobalt, nickel, or copper compound and an electrolyte such as polyacrylic acid, polymethacrylic acid, polyitaconic acid and poly-L-glutamic acid to a phosphating solution. These coatings are further improved by the incorporation of Fe ions. Thermal treatment of zinc phosphate coatings to generate .alpha.-phase anhydrous zinc phosphate improves the corrosion prevention qualities of the resulting coated metal.

  20. The FLIC conversion codes

    Energy Technology Data Exchange (ETDEWEB)

    Basher, J C [General Reactor Physics Division, Atomic Energy Establishment, Winfrith, Dorchester, Dorset (United Kingdom)

    1965-05-15

    This report describes the FORTRAN programmes, FLIC 1 and FLIC 2. These programmes convert programmes coded in one dialect of FORTRAN to another dialect of the same language. FLIC 1 is a general pattern recognition and replacement programme whereas FLIC 2 contains extensions directed towards the conversion of FORTRAN II and S2 programmes to EGTRAN 1 - the dialect now in use on the Winfrith KDF9. FII or S2 statements are replaced where possible by their E1 equivalents; other statements which may need changing are flagged. (author)

  1. Moodle 20 Course Conversion

    CERN Document Server

    Wild, Ian

    2011-01-01

    With clear instructions and plenty of screenshots, this book provides all the support and guidance you will need as you begin to convert your teaching to Moodle. Step-by-step tutorials use real-world examples to show you how to convert to Moodle in the most efficient and effective ways possible. Moodle Course Conversion carefully illustrates how Moodle can be used to teach content and ideas and clearly demonstrates the advantages of doing so. This book is for teachers, tutors, and lecturers who already have a large body of teaching material and want to use Moodle to enhance their course, rathe

  2. Solar energy conversion

    CERN Document Server

    Likhtenshtein, Gertz I

    2012-01-01

    Finally filling a gap in the literature for a text that also adopts the chemist?s view of this hot topic, Prof Likhtenshtein, an experienced author and internationally renowned scientist, considers different physical and engineering aspects in solar energy conversion. From theory to real-life systems, he shows exactly which chemical reactions take place when converting light energy, providing an overview of the chemical perspective from fundamentals to molecular harvesting systems and solar cells. This essential guide will thus help researchers in academia and industry better understa

  3. Keep Meaning in Conversational Coordination

    Directory of Open Access Journals (Sweden)

    Elena Clare Cuffari

    2014-12-01

    Full Text Available Coordination is a widely employed term across recent quantitative and qualitative approaches to intersubjectivity, particularly approaches that give embodiment and enaction central explanatory roles. With a focus on linguistic and bodily coordination in conversational contexts, I review the operational meaning of coordination in recent empirical research and related theorizing of embodied intersubjectivity. This discussion articulates what must be involved in treating linguistic meaning as dynamic processes of coordination. The coordination approach presents languaging as a set of dynamic self-organizing processes and actions on multiple timescales and across multiple modalities that come about and work in certain domains (those jointly constructed in social, interactive, high-order sense-making. These processes go beyond meaning at the level that is available to first-person experience. I take one crucial consequence of this to be the ubiquitously moral nature of languaging with others. Languaging coordinates experience, among other levels of behavior and event. Ethical effort is called for by the automatic autonomy-influencing forces of languaging as coordination.

  4. Conversion program in Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Jonsson, E.B. [Studsvik Nuclear AB, Nykoeping (Sweden)

    1997-08-01

    The conversion of the Swedish 50 MW R2 reactor from HEU to LEU fuel has been successfully accomplished over a 16 cycles long process. The conversion started in January 1991 with the introduction of 6 LEU assemblies in the 8*8 core. The first all LEU core was loaded in March 1993 and physics measurements were performed for the final licensing reports. A total of 142 LEU fuel assemblies have been irradiated up until September 1994 without any fuel incident. The operating licence for the R2 reactor was renewed in mid 1994 taking into account new fuel type. The Swedish Nuclear Inspectorate (SKI) pointed out one crucial problem with the LEU operation, that the back end of the LEU fuel cycle has not yet been solved. For the HEU fuel Sweden had the reprocessing alternative. The country is now relying heavily on the success of the USDOEs Off Site Fuels Policy to take back the spent fuel from the research reactors. They have in the meantime increased their intermediate storage facilities. There is, however, a limit both in time and space for storage of MTR-type of assemblies in water. The penalty of the lower thermal neutron flux in LEU cores has been reduced by improvements of the new irradiation rigs and by fine tuning the core calculations. The Studsvik code package, CASMO-SIMULATE, widely used for ICFM in LWRs has been modified to suit the compact MTR type of core.

  5. Communal biomass conversion plants

    International Nuclear Information System (INIS)

    1991-06-01

    The Coordinating Committee set up by the Danish government in 1986 were given the responsibility of investigating the potentials for biomass conversion plants in Denmark, especially in relation to agricultural, environmental and energy aspects. The results of the Committee's plan of management for this project are presented. This main report covers 13 background reports which deal with special aspects in detail. The report describes the overall plan of management, the demonstration and follow-up programme and the individual biogas demonstration plants. Information gained from these investigations is presented. The current general status, (with emphasis on the technical and economical aspects) and the prospects for the future are discussed. The interest other countries have shown in Danish activities within the field of biogas production is described, and the possibilities for Danish export of technology and know-how in this relation are discussed. It is claimed that Denmark is the first country that has instigated a coordinated development programme for biomass conversion plants. (AB) 24 refs

  6. Event Index - a LHCb Event Search System

    CERN Document Server

    INSPIRE-00392208; Kazeev, Nikita; Redkin, Artem

    2015-12-23

    LHC experiments generate up to $10^{12}$ events per year. This paper describes Event Index - an event search system. Event Index's primary function is quickly selecting subsets of events from a combination of conditions, such as the estimated decay channel or stripping lines output. Event Index is essentially Apache Lucene optimized for read-only indexes distributed over independent shards on independent nodes.

  7. Simulating events

    Energy Technology Data Exchange (ETDEWEB)

    Ferretti, C; Bruzzone, L [Techint Italimpianti, Milan (Italy)

    2000-06-01

    The Petacalco Marine terminal on the Pacific coast in the harbour of Lazaro Carclenas (Michoacan) in Mexico, provides coal to the thermoelectric power plant at Pdte Plutarco Elias Calles in the port area. The plant is being converted from oil to burn coal to generate 2100 MW of power. The article describes the layout of the terminal and equipment employed in the unloading, coal stacking, coal handling areas and the receiving area at the power plant. The contractor Techint Italimpianti has developed a software system, MHATIS, for marine terminal management which is nearly complete. The discrete event simulator with its graphic interface provides a real-type decision support system for simulating changes to the terminal operations and evaluating impacts. The article describes how MHATIS is used. 7 figs.

  8. Event generators

    International Nuclear Information System (INIS)

    Durand, D.; Gulminelli, F.; Lopez, O.; Vient, E.

    1998-01-01

    The results concerning the heavy ion collision simulations at Fermi energies by means of phenomenological models obtained in the last two years ar presented. The event generators are essentially following the phase of elaboration of analysis methods of data obtained by INDRA or NAUTILUS 4 π multidetectors. To identify and correctly quantify a phenomenon or a physical quantity it is necessary to verify by simulation the feasibility and validity of the analysis and also to estimate the bias introduced by the experimental filter. Many studies have shown this, for instance: the determination of the collision reaction plan for flow studies, determination of kinematical characteristics of the quasi-projectiles, and the excitation energy measurement stored in the hot nuclei. To Eugene, the currently utilised generator, several improvements were added: introduction of space-time correlations between the different products emitted in the decay of excited nuclei by calculating the trajectories of the particles in the final phase of the reaction; taking into account in the decay cascade of the discrete levels of the lighter fragments; the possibility of the schematically description of the explosion of the nucleus by simultaneous emission of multi-fragments. Thus, by comparing the calculations with the data relative to heavy systems studied with the NAUTILUS assembly it was possible to extract the time scales in the nuclear fragmentation. The utilisation of these event generators was extended to the analysis of INDRA data concerning the determination of the vaporization threshold in the collisions Ar + Ni and also the research of the expansion effects in the collisions Xe + Sn at 50 MeV/u

  9. Conversation with Meir Sternberg

    Directory of Open Access Journals (Sweden)

    Federico Pianzola

    2011-07-01

    Full Text Available Below are the videos of the interview recorded the 21st May 2011 in Fribourg (CH, in occasion of the first RRN conference. Conversation with Meir Sternberg. Part 1 of 8 - Narratology: classical and postclassical studies. Part 2 of 8 - The development of an original theoretical framework. Part 3 of 8 - Sternberg and Genette: different ways for the same problems. Part 4 of 8 - «There are no forms except in terms of functions». Part 5 of 8 - A life writing articles: so many papers and just four books. Part 6 of 8 - Two arguments against mimetical approaches to narrative. Part 7 of 8 - «Narrative is not given, it is a construct». Part 8 of 8 - The proteus principle. the many-to-many correspondence between forms and functions.

  10. Thermodynamics and energy conversion

    CERN Document Server

    Struchtrup, Henning

    2014-01-01

    This textbook gives a thorough treatment of engineering thermodynamics with applications to classical and modern energy conversion devices.   Some emphasis lies on the description of irreversible processes, such as friction, heat transfer and mixing, and the evaluation of the related work losses. Better use of resources requires high efficiencies, therefore the reduction of irreversible losses should be seen as one of the main goals of a thermal engineer. This book provides the necessary tools.   Topics include: car and aircraft engines,  including Otto, Diesel and Atkinson cycles, by-pass turbofan engines, ramjet and scramjet;  steam and gas power plants, including advanced regenerative systems, solar tower, and compressed air energy storage; mixing and separation, including reverse osmosis, osmotic powerplants, and carbon sequestration; phase equilibrium and chemical equilibrium, distillation, chemical reactors, combustion processes, and fuel cells; the microscopic definition of entropy.    The book i...

  11. Communal biomass conversion plants

    International Nuclear Information System (INIS)

    Holm-Nielsen, J.B.; Huntingford, S.; Halberg, N.

    1993-03-01

    The aim was to show the agricultural advantages of farmers being in connection with Communal Biogas Plant. Whether a more environmentally protectire distribution of plant nutrients from animal manure takes place through a biogas plants distribution system, whether the nitrogen in the digested slurry is better utilized and whether the connection results in slurry transportation-time reduction, are discussed. The average amount of nitrogen from animal manure used per hectare was reduced. The area of manure distribution was larger. The nitrogen efficiency was increased when using digested slurry and purchase of N mineral fertilizer decreased, resulting in considerable reduction in nitrogen leaching. The amount of slurry delivered to the local storage tanks was approximately 45 per cent of the total amount treated on the biogas plant. Conditions of manure transport improved greatly as this was now the responsibility of the communal biomass conversion plant administrators. (AB) (24 refs.)

  12. Power conversion technologies

    Energy Technology Data Exchange (ETDEWEB)

    Newton, M. A.

    1997-02-01

    The Power Conversion Technologies thrust area identifies and sponsors development activities that enhance the capabilities of engineering at Lawrence Livermore National Laboratory (LLNL) in the area of solid- state power electronics. Our primary objective is to be a resource to existing and emerging LLNL programs that require advanced solid-state power electronic technologies.. Our focus is on developing and integrating technologies that will significantly impact the capability, size, cost, and reliability of future power electronic systems. During FY-96, we concentrated our research efforts on the areas of (1) Micropower Impulse Radar (MIR); (2) novel solid-state opening switches; (3) advanced modulator technology for accelerators; (4) compact accelerators; and (5) compact pulse generators.

  13. The Role of Conversation Policy in Carrying Out Agent Conversations

    International Nuclear Information System (INIS)

    Link, Hamilton E.; Phillips, Laurence R.

    1999-01-01

    Structured conversation diagrams, or conversation specifications, allow agents to have predictable interactions and achieve predefined information-based goals, but they lack the flexibility needed to function robustly in an unpredictable environment. We propose a mechanism that combines a typical conversation structure with a separately established policy to generate an actual conversation. The word ''policy'' connotes a high-level direction external to a specific planned interaction with the environment. Policies, which describe acceptable procedures and influence decisions, can be applied to broad sets of activity. Based on their observation of issues related to a policy, agents may dynamically adjust their communication patterns. The policy object describes limitations, constraints, and requirements that may affect the conversation in certain circumstances. Using this new mechanism of interaction simplifies the description of individual conversations and allows domain-specific issues to be brought to bear more easily during agent communication. By following the behavior of the conversation specification when possible and deferring to the policy to derive behavior in exceptional circumstances, an agent is able to function predictably under normal situations and still act rationally in abnormal situations. Different conversation policies applied to a given conversation specification can change the nature of the interaction without changing the specification

  14. Events diary

    Science.gov (United States)

    2000-01-01

    as Imperial College, the Royal Albert Hall, the Royal College of Art, the Natural History and Science Museums and the Royal Geographical Society. Under the heading `Shaping the future together' BA2000 will explore science, engineering and technology in their wider cultural context. Further information about this event on 6 - 12 September may be obtained from Sandra Koura, BA2000 Festival Manager, British Association for the Advancement of Science, 23 Savile Row, London W1X 2NB (tel: 0171 973 3075, e-mail: sandra.koura@britassoc.org.uk ). Details of the creating SPARKS events may be obtained from creating.sparks@britassoc.org.uk or from the website www.britassoc.org.uk . Other events 3 - 7 July, Porto Alegre, Brazil VII Interamerican conference on physics education: The preparation of physicists and physics teachers in contemporary society. Info: IACPE7@if.ufrgs.br or cabbat1.cnea.gov.ar/iacpe/iacpei.htm 27 August - 1 September, Barcelona, Spain GIREP conference: Physics teacher education beyond 2000. Info: www.blues.uab.es/phyteb/index.html

  15. Event Displays for the Visualization of CMS Events

    CERN Document Server

    Jones, Christopher Duncan

    2010-01-01

    During the last year the CMS experiment engaged in consolidation of its existing event display programs. The core of the new system is based on the Fireworks event display program which was by-design directly integrated with the CMS Event Data Model (EDM) and the light version of the software framework (FWLite). The Event Visualization Environment (EVE) of the ROOT framework is used to manage a consistent set of 3D and 2D views, selection, user-feedback and user-interaction with the graphics windows; several EVE components were developed by CMS in collaboration with the ROOT project. In event display operation simple plugins are registered into the system to perform conversion from EDM collections into their visual representations which are then managed by the application. Full event navigation and filtering as well as collection-level filtering is supported. The same data-extraction principle can also be applied when Fireworks will eventually operate as a service within the full software framework.

  16. Event Display for the Visualization of CMS Events

    Science.gov (United States)

    Bauerdick, L. A. T.; Eulisse, G.; Jones, C. D.; Kovalskyi, D.; McCauley, T.; Mrak Tadel, A.; Muelmenstaedt, J.; Osborne, I.; Tadel, M.; Tu, Y.; Yagil, A.

    2011-12-01

    During the last year the CMS experiment engaged in consolidation of its existing event display programs. The core of the new system is based on the Fireworks event display program which was by-design directly integrated with the CMS Event Data Model (EDM) and the light version of the software framework (FWLite). The Event Visualization Environment (EVE) of the ROOT framework is used to manage a consistent set of 3D and 2D views, selection, user-feedback and user-interaction with the graphics windows; several EVE components were developed by CMS in collaboration with the ROOT project. In event display operation simple plugins are registered into the system to perform conversion from EDM collections into their visual representations which are then managed by the application. Full event navigation and filtering as well as collection-level filtering is supported. The same data-extraction principle can also be applied when Fireworks will eventually operate as a service within the full software framework.

  17. Event Display for the Visualization of CMS Events

    International Nuclear Information System (INIS)

    Bauerdick, L A T; Eulisse, G; Jones, C D; McCauley, T; Osborne, I; Kovalskyi, D; Tadel, A Mrak; Muelmenstaedt, J; Tadel, M; Tu, Y; Yagil, A

    2011-01-01

    During the last year the CMS experiment engaged in consolidation of its existing event display programs. The core of the new system is based on the Fireworks event display program which was by-design directly integrated with the CMS Event Data Model (EDM) and the light version of the software framework (FWLite). The Event Visualization Environment (EVE) of the ROOT framework is used to manage a consistent set of 3D and 2D views, selection, user-feedback and user-interaction with the graphics windows; several EVE components were developed by CMS in collaboration with the ROOT project. In event display operation simple plugins are registered into the system to perform conversion from EDM collections into their visual representations which are then managed by the application. Full event navigation and filtering as well as collection-level filtering is supported. The same data-extraction principle can also be applied when Fireworks will eventually operate as a service within the full software framework.

  18. Paradoxical therapy in conversion disorder

    OpenAIRE

    ATAOĞLU, Ahmet

    1998-01-01

    Paradoxical therapy consists of suggesting that the patient intentionally engages in the unwanted behaviour, such as performing complusive ritual or bringing on a conversion attack. In this study paradoxical intention (PI) was used with to half of the patients with conversion disorders, while the other half were treated with diazepam in order to examine the efficiency of the PI versus diazepam in conversion disorder. Patients treated with PI appeared to have a greater improvement r...

  19. Geophysical events

    Science.gov (United States)

    This is a summary of SEAN Bulletin, 13(3), March 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-002 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid.

  20. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  1. Applications of Location Similarity Measures and Conceptual Spaces to Event Coreference and Classification

    Science.gov (United States)

    McConky, Katie Theresa

    2013-01-01

    This work covers topics in event coreference and event classification from spoken conversation. Event coreference is the process of identifying descriptions of the same event across sentences, documents, or structured databases. Existing event coreference work focuses on sentence similarity models or feature based similarity models requiring slot…

  2. Optimized breeding strategies for multiple trait integration: II. Process efficiency in event pyramiding and trait fixation.

    Science.gov (United States)

    Peng, Ting; Sun, Xiaochun; Mumm, Rita H

    2014-01-01

    Multiple trait integration (MTI) is a multi-step process of converting an elite variety/hybrid for value-added traits (e.g. transgenic events) through backcross breeding. From a breeding standpoint, MTI involves four steps: single event introgression, event pyramiding, trait fixation, and version testing. This study explores the feasibility of marker-aided backcross conversion of a target maize hybrid for 15 transgenic events in the light of the overall goal of MTI of recovering equivalent performance in the finished hybrid conversion along with reliable expression of the value-added traits. Using the results to optimize single event introgression (Peng et al. Optimized breeding strategies for multiple trait integration: I. Minimizing linkage drag in single event introgression. Mol Breed, 2013) which produced single event conversions of recurrent parents (RPs) with ≤8 cM of residual non-recurrent parent (NRP) germplasm with ~1 cM of NRP germplasm in the 20 cM regions flanking the event, this study focused on optimizing process efficiency in the second and third steps in MTI: event pyramiding and trait fixation. Using computer simulation and probability theory, we aimed to (1) fit an optimal breeding strategy for pyramiding of eight events into the female RP and seven in the male RP, and (2) identify optimal breeding strategies for trait fixation to create a 'finished' conversion of each RP homozygous for all events. In addition, next-generation seed needs were taken into account for a practical approach to process efficiency. Building on work by Ishii and Yonezawa (Optimization of the marker-based procedures for pyramiding genes from multiple donor lines: I. Schedule of crossing between the donor lines. Crop Sci 47:537-546, 2007a), a symmetric crossing schedule for event pyramiding was devised for stacking eight (seven) events in a given RP. Options for trait fixation breeding strategies considered selfing and doubled haploid approaches to achieve homozygosity

  3. Nanomaterials for photovoltaic conversion

    International Nuclear Information System (INIS)

    Davenas, J.; Ltaief, A.; Barlier, V.; Boiteux, G.; Bouazizi, A.

    2008-01-01

    A promising route for photovoltaic conversion has emerged from the combination of electroactive nanomaterials and small bandgap polymers. The formation of bulk heterojunctions resulting from the extended interfaces leads to efficient dissociation of the charge pairs generated under sunlight shown by the rapid extinction of the polymer photoluminescence for increasing contents of fullerenes or TiO 2 nanoparticles in MEH-PPV or PVK. Unconventional elaboration routes of the blends have been developed to increase the nanofiller dispersion and inhibit phase separation at high concentration. The size reduction of the acceptor domains led to a complete quenching of the radiative recombinations, obtained by specific solvent processing of MEH-PPV / C 60 nanocomposites or sol gel elaboration of TiO 2 nanoparticles in a PVK film. A simultaneous increase of the photocurrents could be achieved by the dispersion and size optimisation of the nanofillers. In situ generation of silver particles in MEH-PPV provides an example of enhanced charge separation induced by the plasmon resonance at the metal/polymer interface. The strong influence of the molecular morphology on the nanocomposite properties emphasizes the large improvements which can still be gained on the performances of organic solar cells

  4. Overview of fuel conversion

    International Nuclear Information System (INIS)

    Green, A.E.S.

    1991-01-01

    The conversion of solid fuels to cleaner-burning and more user-friendly solid liquid or gaseous fuels spans many technologies. In this paper, the authors consider coal, residual oil, oil shale, tar sends tires, municipal oil waste and biomass as feedstocks and examine the processes which can be used in the production of synthetic fuels for the transportation sector. The products of mechanical processing to potentially usable fuels include coal slurries, micronized coal, solvent refined coal, vegetable oil and powdered biomall. The thermochemical and biochemical processes considered include high temperature carbide production, liquefaction, gasification, pyrolysis, hydrolysis-fermentation and anaerobic digestion. The products include syngas, synthetic natural gas, methanol, ethanol and other hydrocarbon oxygenates synthetic gasoline and diesel and jet engine oils. The authors discuss technical and economic aspects of synthetic fuel production giving particular attention and literature references to technologies not discussed in the five chapters which follow. Finally the authors discuss economic energy, and environmental aspects of synthetic fuels and their relationship to the price of imported oil

  5. Geothermal energy conversion facility

    Energy Technology Data Exchange (ETDEWEB)

    Kutscher, C.F.

    1997-12-31

    With the termination of favorable electricity generation pricing policies, the geothermal industry is exploring ways to improve the efficiency of existing plants and make them more cost-competitive with natural gas. The Geothermal Energy Conversion Facility (GECF) at NREL will allow researchers to study various means for increasing the thermodynamic efficiency of binary cycle geothermal plants. This work has received considerable support from the US geothermal industry and will be done in collaboration with industry members and utilities. The GECF is being constructed on NREL property at the top of South Table Mountain in Golden, Colorado. As shown in Figure 1, it consists of an electrically heated hot water loop that provides heating to a heater/vaporizer in which the working fluid vaporizes at supercritical or subcritical pressures as high as 700 psia. Both an air-cooled and water-cooled condenser will be available for condensing the working fluid. In order to minimize construction costs, available equipment from the similar INEL Heat Cycle Research Facility is being utilized.

  6. News and events | Page 3 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    New website will help record vital life events to improve access to services for all ... Also, discover how online power imbalances are being tackled by Coding Rights ... global conversation about the working relationships between policymakers, ...

  7. Tree value conversion standards revisited

    Science.gov (United States)

    Paul S. DeBald; Martin E. Dale; Martin E. Dale

    1991-01-01

    Updated tree value conversion standards (TVCS) are presented for 12 important hardwood species of the oak-hickory forest. These updated standards-developed for each species by butt-log grade, merchantable height, and diameter at breast height-reflect the changes in lumber prices and in conversion costs which have occurred since 1976 when the original TVCS were...

  8. Optimization theory for ballistic conversion

    NARCIS (Netherlands)

    Xie, Yanbo; Versluis, Michel; van den Berg, Albert; Eijkel, Jan C.T.

    2016-01-01

    The growing demand of renewable energy stimulates the exploration of new materials and methods for clean energy. We recently demonstrated a high efficiency and power density energy conversion mechanism by using jetted charged microdroplets, termed as ballistic energy conversion. Hereby, we model and

  9. Career conversations in vocational schools

    NARCIS (Netherlands)

    Mittendorff, K.M.; Brok, den P.J.; Beijaard, D.

    2010-01-01

    The purpose of this study was to examine career conversations between teachers and students in competence-based vocational education in the Netherlands. A total of 32 career conversations were observed and analysed with respect to four elements: content, teacher activities, student activities and

  10. [Neuropsychological assessment in conversion disorder].

    Science.gov (United States)

    Demır, Süleyman; Çelıkel, Feryal Çam; Taycan, Serap Erdoğan; Etıkan, İlker

    2013-01-01

    Conversion disorder is characterized by functional impairment in motor, sensory, or neurovegetative systems that cannot be explained by a general medical condition. Diagnostic systems emphasize the absence of an organic basis for the dysfunction observed in conversion disorder. Nevertheless, there is a growing body of data on the specific functional brain correlates of conversion symptoms, particularly those obtained via neuroimaging and neurophysiological assessment. The present study aimed to determine if there are differences in measures of cognitive functioning between patients with conversion disorder and healthy controls. The hypothesis of the study was that the patients with conversion disorder would have poorer neurocognitive performance than the controls. The patient group included 43 patients diagnosed as conversion disorder and other psychiatric comorbidities according to DSM-IV-TR. Control group 1 included 44 patients diagnosed with similar psychiatric comorbidities, but not conversion diosorder, and control group 2 included 43 healthy individuals. All participants completed a sociodemographic questionnaire and were administered the SCID-I and a neuropsychological test battery of 6 tests, including the Serial Digit Learning Test (SDLT), Auditory Verbal Learning Test (AVLT), Wechsler Memory Scale, Stroop Color Word Interference Test, Benton Judgment of Line Orientation Test (BJLOT), and Cancellation Test. The patient group had significantly poorer performance on the SDLT, AVLT, Stroop Color Word Interference Test, and BJLOT than both control groups. The present findings highlight the differences between the groups in learning and memory, executive and visuospatial functions, and attention, which seemed to be specific to conversion disorder.

  11. Memory for conversation and the development of common ground.

    Science.gov (United States)

    McKinley, Geoffrey L; Brown-Schmidt, Sarah; Benjamin, Aaron S

    2017-11-01

    Efficient conversation is guided by the mutual knowledge, or common ground, that interlocutors form as a conversation progresses. Characterized from the perspective of commonly used measures of memory, efficient conversation should be closely associated with item memory-what was said-and context memory-who said what to whom. However, few studies have explicitly probed memory to evaluate what type of information is maintained following a communicative exchange. The current study examined how item and context memory relate to the development of common ground over the course of a conversation, and how these forms of memory vary as a function of one's role in a conversation as speaker or listener. The process of developing common ground was positively related to both item and context memory. In addition, content that was spoken was remembered better than content that was heard. Our findings illustrate how memory assessments can complement language measures by revealing the impact that basic conversational processes have on memory for what has been discussed. By taking this approach, we show that not only does the process of forming common ground facilitate communication in the present, but it also promotes an enduring record of that event, facilitating conversation into the future.

  12. Dynamics of forest cover conversion in and around Bwindi ...

    African Journals Online (AJOL)

    Michael Horsfall

    together determine the rates of deforestation in any particular place (Luoga et al., 2005). The conversions have not spared the forests in and around Bwindi impenetrable forest in Southern western Uganda. The protected forest has a unique eco-system with diverse gene reserves with worldwide interest. It is most popular for ...

  13. Conversion of Deletions during Recombination in Pneumococcal Transformation

    Science.gov (United States)

    Lefevre, J. C.; Mostachfi, P.; Gasc, A. M.; Guillot, E.; Pasta, F.; Sicard, M.

    1989-01-01

    Genetic analysis of 16 deletions obtained in the amiA locus of pneumococcus is described. When present on donor DNA, all deletions increased drastically the frequency of wild-type recombinants in two-point crosses. This effect was maximal for deletions longer than 200 bases. It was reduced for heterologies shorter than 76 bases and did not exist for very short deletions. In three-point crosses in which the deletion was localized between two point mutations, we demonstrated that this excess of wild-type recombinants was the result of a genetic conversion. This conversion extended over several scores of bases outside the deletion. Conversion takes place during the heteroduplex stage of recombination. Therefore, in pneumococcal transformation, long heterologies participated in this heteroduplex configuration. As this conversion did not require an active DNA polymerase A gene it is proposed that the mechanism of conversion is not a DNA repair synthesis but involves breakage and ligation between DNA molecules. Conversion of deletions did not require the Hex system of correction of mismatched bases. It differs also from localized conversion. It appears that it is a process that evolved to correct errors of replication which lead to long heterologies and which are not eliminated by other systems. PMID:2599365

  14. Improvement of skeleton conversion in ICRP reference phantom conversion project

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhao Jun; Yeom, Yeon Soo; Thang, Nguyen Tat; Kim, Han Sung; Han, Min Cheol; Kim, Chan Hyeong [Dept. of Nuclear Engineering, Hanyang University, Seoul (Korea, Republic of); Kim, Seong Hoon [Dept. of Radiation Oncology, College of Medicine, Hanyang University, Seoul (Korea, Republic of)

    2014-11-15

    In the previous skeleton conversion, most bones were directly converted from the ICRP voxel phantoms by using the 3D rendering method whereas several complex-shape bones (cranium, ribs, spines, feet, and hands) were not able to be directly converted. We alternatively employed the corresponding well-defined polygonal models and attempted to adjust them to match the voxel models. However, this approach was unsatisfactory. The shapes of the alternative models were significantly different from those of the voxel models, making it virtually impossible to exactly match the voxel models as shown in Fig. 3 (left). In order to overcome the difficulty in the complex bone conversion, the present study developed a new conversion method and converted these complex bones voxel models of the ICRP male phantom to polygonal models. The present study developed the new conversion method and successfully improved polygonal models for cranium, ribs, and spines for the ICRP male phantom. The new conversion method will be also applied to the complex bone conversion for the ICRP female phantom as well as other complex organ conversion in the future.

  15. Improvement of skeleton conversion in ICRP reference phantom conversion project

    International Nuclear Information System (INIS)

    Wang, Zhao Jun; Yeom, Yeon Soo; Thang, Nguyen Tat; Kim, Han Sung; Han, Min Cheol; Kim, Chan Hyeong; Kim, Seong Hoon

    2014-01-01

    In the previous skeleton conversion, most bones were directly converted from the ICRP voxel phantoms by using the 3D rendering method whereas several complex-shape bones (cranium, ribs, spines, feet, and hands) were not able to be directly converted. We alternatively employed the corresponding well-defined polygonal models and attempted to adjust them to match the voxel models. However, this approach was unsatisfactory. The shapes of the alternative models were significantly different from those of the voxel models, making it virtually impossible to exactly match the voxel models as shown in Fig. 3 (left). In order to overcome the difficulty in the complex bone conversion, the present study developed a new conversion method and converted these complex bones voxel models of the ICRP male phantom to polygonal models. The present study developed the new conversion method and successfully improved polygonal models for cranium, ribs, and spines for the ICRP male phantom. The new conversion method will be also applied to the complex bone conversion for the ICRP female phantom as well as other complex organ conversion in the future

  16. Nominal Performance Biosphere Dose Conversion Factor Analysis

    International Nuclear Information System (INIS)

    M. Wasiolek

    2004-01-01

    This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the Total System Performance Assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the groundwater exposure scenario, and the development of conversion factors for assessing compliance with the groundwater protection standard. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA-LA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the ''Biosphere Model Report'' in Figure 1-1, contain detailed description of the model input parameters, their development, and the relationship between the parameters and specific features events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the groundwater exposure scenario. The objectives of this analysis are to develop BDCFs for the groundwater exposure scenario for the three climate states considered in the TSPA-LA as well as conversion factors for evaluating compliance with the groundwater protection standard. The BDCFs will be used in performance assessment for calculating all-pathway annual doses for a given concentration of radionuclides in groundwater. The conversion factors will be used for calculating gross alpha particle activity in groundwater and the annual dose

  17. [Screening and optimization of cholesterol conversion strain].

    Science.gov (United States)

    Fan, Dan; Xiong, Bingjian; Pang, Cuiping; Zhu, Xiangdong

    2014-10-04

    Bacterial strain SE-1 capable of transforming cholesterol was isolated from soil and characterized. The transformation products were identified. Fermentation conditions were optimized for conversion. Cholesterol was used as sole carbon source to isolate strain SE-1. Morphology, physiological and biochemical characteristics of strain SE-1 were studied. 16S rRNA gene was sequenced and subjected to phylogenetic analysis. Fermentation supernatants were extracted with chloroform, the transformation products were analyzed by silica gel thin layer chromatography and Sephadex LH20. Their structures were identified by 1H-NMR and 13C-NMR. Fermentation medium including carbon and nitrogen, methods of adding substrates and fermentation conditions for Strain SE-1 were optimized. Strain SE-1 was a Gram-negative bacterium, exhibiting the highest homologs to Burkholderia cepacia based on the physiological analysis. The sequence analysis of 16S rRNA gene of SE-1 strain and comparison with related Burkholderia show that SE-1 strain was very close to B. cepacia (Genbank No. U96927). The similarity was 99%. The result of silica gel thin layer chromatography shows that strain SE-1 transformed cholesterol to two products, 7beta-hydroxycholesterol and the minor product was 7-oxocholesterol. The optimum culture conditions were: molasses 5%, (NH4 )2SO4 0.3%, 4% of inoculation, pH 7.5 and 36 degrees C. Under the optimum culture condition, the conversion rate reached 34.4% when concentration of cholesterol-Tween 80 was 1 g/L. Cholesterol 7beta-hydroxylation conversion rate under optimal conditions was improved by 20.8%. Strain SE-1 isolated from soil is capable of converting cholesterol at lab-scale.

  18. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  19. Having "The Talk": Youth-Parent Climate Conversations

    Science.gov (United States)

    Anderson, R. K.; Flora, J. A.; Lertzman, R.; Saphir, M.

    2017-12-01

    Youth are concerned about climate change. Recent research conducted by the Alliance for Climate Education, in partnership with the Skoll Global Threats Fund, demonstrates that youth have agency within their families regarding climate relevant behaviors, particularly resulting from conversations that rely on listening. In this pilot project, we examined whether youth involved in a year-long climate action program will carry out climate related conversations with their parents, and whether youth who have engaged online with a climate education group, will carry out similar conversations with their parents when asked to do so via SMS. In study one, we used mixed methods to determine if youth participating in a training would carry out a climate conversation with their parents, adhere to guidelines such as reflective listening, and have positive experiences. Further, we investigated to what extent parents would experience the conversation as a positive and impactful event. Parents overall reported a positive experience, and were proud of their child's work. In study two, in a randomized controlled trial conducted entirely via SMS, we investigated whether youth would watch a brief instructional animated video, and have a conversation with a parent. Results showed the majority of youth reported gained confidence in conducting a climate conversation and intended to speak to relatives. Preliminary results indicate when youth can express their climate engagement to a parent using these techniques, they have positive experiences, gain confidence in future engagements and can influence family. The studies highlight the positive impact of climate conversations as well as the potential to scale climate conversations to reach more youth and families.

  20. Direct conversion of fusion energy

    International Nuclear Information System (INIS)

    Johansson, Markus

    2003-03-01

    Deuterium and tritium are expected to be used as fuel in the first fusion reactors. Energy is released as kinetic energy of ions and neutrons, when deuterium reacts with tritium. One way to convert the kinetic energy to electrical energy, is to let the ions and neutrons hit the reactor wall and convert the heat that is caused by the particle bombardment to electrical energy with ordinary thermal conversion. If the kinetic energy of the ions instead is converted directly to electrical energy, a higher efficiency of the energy conversion is possible. The majority of the fusion energy is released as kinetic energy of neutrons, when deuterium reacts with tritium. Fusion reactions such as the D-D reactions, the D- 3 He reaction and the p- 11 B reaction, where a larger part of the fusion energy becomes kinetic energy of charged particles, appears therefore more suitable for direct conversion. Since they have lower reactivity than the D-T reaction, they need a larger βB 2 0 to give sufficiently high fusion power density. Because of this, the fusion configurations spherical torus (ST) and field-reversed configuration (FRC), where high β values are possible, appear interesting. Rosenbluth and Hinton come to the conclusion that efficient direct conversion isn't possible in closed field line systems and that open geometries, which facilitate direct conversion, provide inadequate confinement for D- 3 He. It is confirmed in this study that it doesn't seem possible to achieve as high direct conversion efficiency in closed systems as in open systems. ST and FRC fusion power plants that utilize direct conversion seem however interesting. Calculations with the help of Maple indicate that the reactor parameters needed for a D-D ST and a D 3 He ST hopefully are possible to achieve. The best energy conversion option for a D-D or D 3 He ST appears to be direct electrodynamic conversion (DEC) together with ordinary thermal conversion or liquid metal MHD conversion (LMMHD). For a D

  1. Conversion of Abbandoned Military Areas

    Directory of Open Access Journals (Sweden)

    Daiva Marcinkevičiūtė

    2011-03-01

    Full Text Available The article analyses the situation of abandoned military sites, their value and significance of their conservation. It also reviews their impact on their environment and their potential in tourism, environmental, economic and social spheres. Further the positive experiences in military sites' conversion are studied. The importance of society's involvement in the conversions is discussed. The situation of XIX-XX age's military object's, the significance of their conservation and their potential in tourism market is separately analysed. The results of two researches are introduced, one of which inquires about the Lithuanian military objects' potential in tourism sphere, another one explores the possibilities of conversion. Article in Lithuanian

  2. Direct conversion of fusion energy

    Energy Technology Data Exchange (ETDEWEB)

    Johansson, Markus

    2003-03-01

    Deuterium and tritium are expected to be used as fuel in the first fusion reactors. Energy is released as kinetic energy of ions and neutrons, when deuterium reacts with tritium. One way to convert the kinetic energy to electrical energy, is to let the ions and neutrons hit the reactor wall and convert the heat that is caused by the particle bombardment to electrical energy with ordinary thermal conversion. If the kinetic energy of the ions instead is converted directly to electrical energy, a higher efficiency of the energy conversion is possible. The majority of the fusion energy is released as kinetic energy of neutrons, when deuterium reacts with tritium. Fusion reactions such as the D-D reactions, the D-{sup 3}He reaction and the p-{sup 11}B reaction, where a larger part of the fusion energy becomes kinetic energy of charged particles, appears therefore more suitable for direct conversion. Since they have lower reactivity than the D-T reaction, they need a larger {beta}B{sup 2}{sub 0} to give sufficiently high fusion power density. Because of this, the fusion configurations spherical torus (ST) and field-reversed configuration (FRC), where high {beta} values are possible, appear interesting. Rosenbluth and Hinton come to the conclusion that efficient direct conversion isn't possible in closed field line systems and that open geometries, which facilitate direct conversion, provide inadequate confinement for D-{sup 3}He. It is confirmed in this study that it doesn't seem possible to achieve as high direct conversion efficiency in closed systems as in open systems. ST and FRC fusion power plants that utilize direct conversion seem however interesting. Calculations with the help of Maple indicate that the reactor parameters needed for a D-D ST and a D{sub 3} He ST hopefully are possible to achieve. The best energy conversion option for a D-D or D{sub 3} He ST appears to be direct electrodynamic conversion (DEC) together with ordinary thermal conversion

  3. Chemical Conversion of Human Fibroblasts into Functional Schwann Cells

    Directory of Open Access Journals (Sweden)

    Eva C. Thoma

    2014-10-01

    Full Text Available Direct transdifferentiation of somatic cells is a promising approach to obtain patient-specific cells for numerous applications. However, conversion across germ-layer borders often requires ectopic gene expression with unpredictable side effects. Here, we present a gene-free approach that allows efficient conversion of human fibroblasts via a transient progenitor stage into Schwann cells, the major glial cell type of peripheral nerves. Using a multikinase inhibitor, we transdifferentiated fibroblasts into transient neural precursors that were subsequently further differentiated into Schwann cells. The resulting induced Schwann cells (iSCs expressed numerous Schwann cell-specific proteins and displayed neurosupportive and myelination capacity in vitro. Thus, we established a strategy to obtain mature Schwann cells from human postnatal fibroblasts under chemically defined conditions without the introduction of ectopic genes.

  4. Genes contributing to prion pathogenesis

    DEFF Research Database (Denmark)

    Tamgüney, Gültekin; Giles, Kurt; Glidden, David V

    2008-01-01

    incubation times, indicating that the conversion reaction may be influenced by other gene products. To identify genes that contribute to prion pathogenesis, we analysed incubation times of prions in mice in which the gene product was inactivated, knocked out or overexpressed. We tested 20 candidate genes...... show that many genes previously implicated in prion replication have no discernible effect on the pathogenesis of prion disease. While most genes tested did not significantly affect survival times, ablation of the amyloid beta (A4) precursor protein (App) or interleukin-1 receptor, type I (Il1r1...

  5. Vaccine Adverse Events

    Science.gov (United States)

    ... for Biologics Evaluation & Research Vaccine Adverse Events Vaccine Adverse Events Share Tweet Linkedin Pin it More sharing ... in the primary immunization series in infants Report Adverse Event Report a Vaccine Adverse Event Contact FDA ( ...

  6. 5 CFR 317.302 - Conversion procedures.

    Science.gov (United States)

    2010-01-01

    ... conversion. (2) Pay. Upon conversion to the Senior Executive Service, an employee's SES rate will be... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Conversion procedures. 317.302 Section... IN THE SENIOR EXECUTIVE SERVICE Conversion to the Senior Executive Service § 317.302 Conversion...

  7. Conversational evidence in therapeutic dialogue.

    Science.gov (United States)

    Strong, Tom; Busch, Robbie; Couture, Shari

    2008-07-01

    Family therapists' participation in therapeutic dialogue with clients is typically informed by evidence of how such dialogue is developing. In this article, we propose that conversational evidence, the kind that can be empirically analyzed using discourse analyses, be considered a contribution to widening psychotherapy's evidence base. After some preliminaries about what we mean by conversational evidence, we provide a genealogy of evaluative practice in psychotherapy, and examine qualitative evaluation methods for their theoretical compatibilities with social constructionist approaches to family therapy. We then move on to examine the notion of accomplishment in therapeutic dialogue given how such accomplishments can be evaluated using conversation analysis. We conclude by considering a number of research and pedagogical implications we associate with conversational evidence.

  8. HYDROKINETIC ENERGY CONVERSION SYSTEMS: PROSPECTS ...

    African Journals Online (AJOL)

    eobe

    Hydrokinetic energy conversion systems utilize the kinetic energy of flowing water bodies with little or no head to generate ... generator. ... Its principle of operation is analogous to that of wind ..... Crisis-solar and wind power systems, 2009,.

  9. Conversion electrons in the SDC

    International Nuclear Information System (INIS)

    Wicklund, A.B.

    1991-01-01

    We summarize a preliminary analysis of the rates for conversion electrons in the SDC detector, relative to other interesting sources of prompt electrons. We have used Papageno V3.30, and other available NLO calculations to estimate inclusive rates in the central region (η less than 2.0), and we have cross checked these using CDF data at 1.8 TeV. We have considered three sources of ''isolated'' electrons, namely inclusive W/Z production; top quark (Mt=140); and QCD prompt photon production, followed by conversion in 10% XO. This value approximates the inner silicon detector at SDC. Additional conversions will occur in the outer tracking chamber, but the trigger and track reconstruction efficiency will be lower. We have also considered ''nonisolated'' leptons coming from inclusive bottom production, photon conversions resulting from π 0 ,η production in jets, and high pt hadrons faking electrons

  10. Energy conversion at dipolarization fronts

    Science.gov (United States)

    Khotyaintsev, Yu. V.; Divin, A.; Vaivads, A.; André, M.; Markidis, S.

    2017-02-01

    We use multispacecraft observations by Cluster in the Earth's magnetotail and 3-D particle-in-cell simulations to investigate conversion of electromagnetic energy at the front of a fast plasma jet. We find that the major energy conversion is happening in the Earth (laboratory) frame, where the electromagnetic energy is being transferred from the electromagnetic field to particles. This process operates in a region with size of the order several ion inertial lengths across the jet front, and the primary contribution to E·j is coming from the motional electric field and the ion current. In the frame of the front we find fluctuating energy conversion with localized loads and generators at sub-ion scales which are primarily related to the lower hybrid drift instability excited at the front; however, these provide relatively small net energy conversion.

  11. Ocean energy conversion - A reality

    Digital Repository Service at National Institute of Oceanography (India)

    Sarkar, A.

    -depth analysis of application and achievements of OTEC, tidal energy, impact of astronomical forces on tide, prospects of tidal power plants, wave energy conversion and its mathematical approach for both linear and non-linear waves, economic viability, problems...

  12. Enzymes for improved biomass conversion

    Science.gov (United States)

    Brunecky, Roman; Himmel, Michael E.

    2016-02-02

    Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.

  13. Hydrogen photoproduction by photoelectrochemical conversion

    International Nuclear Information System (INIS)

    Anon.

    1989-01-01

    The water-splitting reaction by photoelectrochemical processes has gained much more attention than any of many reactions proposed for solar generation of energy-rich molecules (fuels). The conversion efficiency of the photosystem is the key factor. The higher the efficiency, the more economically feasible will be the conversion scheme. The conversion efficiency is a function of the semiconductor properties, light intensity, spectral quality, properties of the electrolyte, counterelectrode, cell configuration, etc. The semiconductor parameters include band gap, absorption coefficient and diffusion length. The area and material used for a counterelectrode are important when considering polarization losses in a two-electrode system. Besides, the stability problem is also a very important one to meet the requirement for practical applications. This paper reviews some important issues on photoelectrochemical generation of hydrogen by water splitting. It includes energy conversion efficiency, market assessment and cost goal, state of the technology, and future directions for research

  14. Effective communication during difficult conversations.

    Science.gov (United States)

    Polito, Jacquelyn M

    2013-06-01

    A strong interest and need exist in the workplace today to master the skills of conducting difficult conversations. Theories and strategies abound, yet none seem to have found the magic formula with universal appeal and success. If it is such an uncomfortable skill to master is it better to avoid or initiate such conversations with employees? Best practices and evidence-based management guide us to the decision that quality improvement dictates effective communication, even when difficult. This brief paper will offer some suggestions for strategies to manage difficult conversations with employees. Mastering the skills of conducting difficult conversations is clearly important to keeping lines of communication open and productive. Successful communication skills may actually help to avert confrontation through employee engagement, commitment and appropriate corresponding behavior

  15. Electron spectrometers with internal conversion

    International Nuclear Information System (INIS)

    Suita, J.C.; Lemos Junior, O.F.; Auler, L.T.; Silva, A.G. da

    1981-01-01

    The efforts that the Department of Physics (DEFI) of Institute of Nuclear Engineering (IEN) are being made aiming at adjusting the electron spectrometers with internal conversion to its necessity, are shown. (E.G.) [pt

  16. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  17. Nominal Performance Biosphere Dose Conversion Factor Analysis

    Energy Technology Data Exchange (ETDEWEB)

    M.A. Wasiolek

    2005-04-28

    This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the Total System Performance Assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the groundwater exposure scenario, and the development of conversion factors for assessing compliance with the groundwater protection standards. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop BDCFs, which are input parameters for the TSPA-LA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the ''Biosphere Model Report'' in Figure 1-1, contain detailed description of the model input parameters, their development, and the relationship between the parameters and specific features events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the groundwater exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and the five analyses that develop parameter values for the biosphere model (BSC 2005 [DIRS 172827]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis

  18. Nominal Performance Biosphere Dose Conversion Factor Analysis

    International Nuclear Information System (INIS)

    M.A. Wasiolek

    2005-01-01

    This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the Total System Performance Assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the groundwater exposure scenario, and the development of conversion factors for assessing compliance with the groundwater protection standards. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop BDCFs, which are input parameters for the TSPA-LA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the ''Biosphere Model Report'' in Figure 1-1, contain detailed description of the model input parameters, their development, and the relationship between the parameters and specific features events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the groundwater exposure scenario. This analysis receives direct input from the outputs of the ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) and the five analyses that develop parameter values for the biosphere model (BSC 2005 [DIRS 172827]; BSC 2004 [DIRS 169672]; BSC 2004 [DIRS 169673]; BSC 2004 [DIRS 169458]; BSC 2004 [DIRS 169459]). The results of this report are further analyzed in the ''Biosphere Dose Conversion Factor Importance and Sensitivity Analysis'' (Figure 1-1). The objectives of this analysis are to develop BDCFs for the

  19. Computer code conversion using HISTORIAN

    International Nuclear Information System (INIS)

    Matsumoto, Kiyoshi; Kumakura, Toshimasa.

    1990-09-01

    When a computer program written for a computer A is converted for a computer B, in general, the A version source program is rewritten for B version. However, in this way of program conversion, the following inconvenient problems arise. 1) The original statements to be rewritten for B version are lost. 2) If the original statements of the A version rewritten for B version would remain as comment lines, the B version source program becomes quite large. 3) When update directives of the program are mailed from the organization which developed the program or when some modifications are needed for the program, it is difficult to point out the part to be updated or modified in the B version source program. To solve these problems, the conversion method using the general-purpose software management aid system, HISTORIAN, has been introduced. This conversion method makes a large computer code a easy-to-use program for use to update, modify or improve after the conversion. This report describes the planning and procedures of the conversion method and the MELPROG-PWR/MOD1 code conversion from the CRAY version to the JAERI FACOM version as an example. This report would provide useful information for those who develop or introduce large programs. (author)

  20. Frequency conversion of structured light.

    Science.gov (United States)

    Steinlechner, Fabian; Hermosa, Nathaniel; Pruneri, Valerio; Torres, Juan P

    2016-02-15

    Coherent frequency conversion of structured light, i.e. the ability to manipulate the carrier frequency of a wave front without distorting its spatial phase and intensity profile, provides the opportunity for numerous novel applications in photonic technology and fundamental science. In particular, frequency conversion of spatial modes carrying orbital angular momentum can be exploited in sub-wavelength resolution nano-optics and coherent imaging at a wavelength different from that used to illuminate an object. Moreover, coherent frequency conversion will be crucial for interfacing information stored in the high-dimensional spatial structure of single and entangled photons with various constituents of quantum networks. In this work, we demonstrate frequency conversion of structured light from the near infrared (803 nm) to the visible (527 nm). The conversion scheme is based on sum-frequency generation in a periodically poled lithium niobate crystal pumped with a 1540-nm Gaussian beam. We observe frequency-converted fields that exhibit a high degree of similarity with the input field and verify the coherence of the frequency-conversion process via mode projection measurements with a phase mask and a single-mode fiber. Our results demonstrate the suitability of exploiting the technique for applications in quantum information processing and coherent imaging.

  1. Conversion factors and oil statistics

    International Nuclear Information System (INIS)

    Karbuz, Sohbet

    2004-01-01

    World oil statistics, in scope and accuracy, are often far from perfect. They can easily lead to misguided conclusions regarding the state of market fundamentals. Without proper attention directed at statistic caveats, the ensuing interpretation of oil market data opens the door to unnecessary volatility, and can distort perception of market fundamentals. Among the numerous caveats associated with the compilation of oil statistics, conversion factors, used to produce aggregated data, play a significant role. Interestingly enough, little attention is paid to conversion factors, i.e. to the relation between different units of measurement for oil. Additionally, the underlying information regarding the choice of a specific factor when trying to produce measurements of aggregated data remains scant. The aim of this paper is to shed some light on the impact of conversion factors for two commonly encountered issues, mass to volume equivalencies (barrels to tonnes) and for broad energy measures encountered in world oil statistics. This paper will seek to demonstrate how inappropriate and misused conversion factors can yield wildly varying results and ultimately distort oil statistics. Examples will show that while discrepancies in commonly used conversion factors may seem trivial, their impact on the assessment of a world oil balance is far from negligible. A unified and harmonised convention for conversion factors is necessary to achieve accurate comparisons and aggregate oil statistics for the benefit of both end-users and policy makers

  2. Pluripotency gene expression and growth control in cultures of peripheral blood monocytes during their conversion into programmable cells of monocytic origin (PCMO: evidence for a regulatory role of autocrine activin and TGF-β.

    Directory of Open Access Journals (Sweden)

    Hendrik Ungefroren

    Full Text Available Previous studies have shown that peripheral blood monocytes can be converted in vitro to a stem cell-like cell termed PCMO as evidenced by the re-expression of pluripotency-associated genes, transient proliferation, and the ability to adopt the phenotype of hepatocytes and insulin-producing cells upon tissue-specific differentiation. However, the regulatory interactions between cultured cells governing pluripotency and mitotic activity have remained elusive. Here we asked whether activin(s and TGF-β(s, are involved in PCMO generation. De novo proliferation of PCMO was higher under adherent vs. suspended culture conditions as revealed by the appearance of a subset of Ki67-positive monocytes and correlated with down-regulation of p21WAF1 beyond day 2 of culture. Realtime-PCR analysis showed that PCMO express ActRIIA, ALK4, TβRII, ALK5 as well as TGF-β1 and the βA subunit of activin. Interestingly, expression of ActRIIA and ALK4, and activin A levels in the culture supernatants increased until day 4 of culture, while levels of total and active TGF-β1 strongly declined. PCMO responded to both growth factors in an autocrine fashion with intracellular signaling as evidenced by a rise in the levels of phospho-Smad2 and a drop in those of phospho-Smad3. Stimulation of PCMO with recombinant activins (A, B, AB and TGF-β1 induced phosphorylation of Smad2 but not Smad3. Inhibition of autocrine activin signaling by either SB431542 or follistatin reduced both Smad2 activation and Oct4A/Nanog upregulation. Inhibition of autocrine TGF-β signaling by either SB431542 or anti-TGF-β antibody reduced Smad3 activation and strongly increased the number of Ki67-positive cells. Furthermore, anti-TGF-β antibody moderately enhanced Oct4A/Nanog expression. Our data show that during PCMO generation pluripotency marker expression is controlled positively by activin/Smad2 and negatively by TGF-β/Smad3 signaling, while relief from growth inhibition is primarily the

  3. Engineering Escherichia coli for methanol conversion.

    Science.gov (United States)

    Müller, Jonas E N; Meyer, Fabian; Litsanov, Boris; Kiefer, Patrick; Potthoff, Eva; Heux, Stéphanie; Quax, Wim J; Wendisch, Volker F; Brautaset, Trygve; Portais, Jean-Charles; Vorholt, Julia A

    2015-03-01

    Methylotrophic bacteria utilize methanol and other reduced one-carbon compounds as their sole source of carbon and energy. For this purpose, these bacteria evolved a number of specialized enzymes and pathways. Here, we used a synthetic biology approach to select and introduce a set of "methylotrophy genes" into Escherichia coli based on in silico considerations and flux balance analysis to enable methanol dissimilation and assimilation. We determined that the most promising approach allowing the utilization of methanol was the implementation of NAD-dependent methanol dehydrogenase and the establishment of the ribulose monophosphate cycle by expressing the genes for hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexuloisomerase (Phi). To test for the best-performing enzymes in the heterologous host, a number of enzyme candidates from different donor organisms were selected and systematically analyzed for their in vitro and in vivo activities in E. coli. Among these, Mdh2, Hps and Phi originating from Bacillus methanolicus were found to be the most effective. Labeling experiments using (13)C methanol with E. coli producing these enzymes showed up to 40% incorporation of methanol into central metabolites. The presence of the endogenous glutathione-dependent formaldehyde oxidation pathway of E. coli did not adversely affect the methanol conversion rate. Taken together, the results of this study represent a major advancement towards establishing synthetic methylotrophs by gene transfer. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  4. Information for Consumers about Alternative Fuel Conversions

    Science.gov (United States)

    Here are some factors to be aware of if you are considering fuel conversion, including background information on fuel conversion, instructions for demonstrating compliance, and other related information.

  5. Topology of Event Horizon

    OpenAIRE

    Siino, Masaru

    1997-01-01

    The topologies of event horizons are investigated. Considering the existence of the endpoint of the event horizon, it cannot be differentiable. Then there are the new possibilities of the topology of the event horizon though they are excluded in smooth event horizons. The relation between the topology of the event horizon and the endpoint of it is revealed. A torus event horizon is caused by two-dimensional endpoints. One-dimensional endpoints provide the coalescence of spherical event horizo...

  6. Analysis of internal conversion coefficients

    International Nuclear Information System (INIS)

    Coursol, N.; Gorozhankin, V.M.; Yakushev, E.A.; Briancon, C.; Vylov, Ts.

    2000-01-01

    An extensive database has been assembled that contains the three most widely used sets of calculated internal conversion coefficients (ICC): [Hager R.S., Seltzer E.C., 1968. Internal conversion tables. K-, L-, M-shell Conversion coefficients for Z=30 to Z=103, Nucl. Data Tables A4, 1-237; Band I.M., Trzhaskovskaya M.B., 1978. Tables of gamma-ray internal conversion coefficients for the K-, L- and M-shells, 10≤Z≤104, Special Report of Leningrad Nuclear Physics Institute; Roesel F., Fries H.M., Alder K., Pauli H.C., 1978. Internal conversion coefficients for all atomic shells, At. Data Nucl. Data Tables 21, 91-289] and also includes new Dirac-Fock calculations [Band I.M. and Trzhaskovskaya M.B., 1993. Internal conversion coefficients for low-energy nuclear transitions, At. Data Nucl. Data Tables 55, 43-61]. This database is linked to a computer program to plot ICCs and their combinations (sums and ratios) as a function of Z and energy, as well as relative deviations of ICC or their combinations for any pair of tabulated data. Examples of these analyses are presented for the K-shell and total ICCs of the gamma-ray standards [Hansen H.H., 1985. Evaluation of K-shell and total internal conversion coefficients for some selected nuclear transitions, Eur. Appl. Res. Rept. Nucl. Sci. Tech. 11.6 (4) 777-816] and for the K-shell and total ICCs of high multipolarity transitions (total, K-, L-, M-shells of E3 and M3 and K-shell of M4). Experimental data sets are also compared with the theoretical values of these specific calculations

  7. The Zimmer nuclear to coal conversion

    International Nuclear Information System (INIS)

    Baer, R.H.; Pfund, E.M.; Buchmueller, D.P.; Fletcher, J.R.

    1991-01-01

    This paper discusses the control, protection and monitoring systems employed on the world's first nuclear-to-coal power plant conversion, the philosophies utilized to guide the engineering of these systems and the implementation of those philosophies. Extensive use is made of programmable electronic systems to provide a state-of-the-art plant which does not compromise the proven operating interfaces and philosophies associated with AEP's six operating 1300 MW units. The technologies employed include two distributed digital control systems, a fiber optic-based network of programmable logic controllers, a distributed microprocessor-based annunciator and sequence of events system, and a plant operations computer which accesses each of the preceding systems

  8. [Conversation analysis for improving nursing communication].

    Science.gov (United States)

    Yi, Myungsun

    2007-08-01

    Nursing communication has become more important than ever before because quality of nursing services largely depends on the quality of communication in a very competitive health care environment. This article was to introduce ways to improve nursing communication using conversation analysis. This was a review study on conversation analysis, critically examining previous studies in nursing communication and interpersonal relationships. This study provided theoretical backgrounds and basic assumptions of conversation analysis which was influenced by ethnomethodology, phenomenology, and sociolinguistic. In addition, the characteristics and analysis methods of conversation analysis were illustrated in detail. Lastly, how conversation analysis could help improve communication was shown, by examining researches using conversation analysis not only for ordinary conversations but also for extraordinary or difficult conversations such as conversations between patients with dementia and their professional nurses. Conversation analysis can help in improving nursing communication by providing various structures and patterns as well as prototypes of conversation, and by suggesting specific problems and problem-solving strategies in communication.

  9. Hyperthermophilic endoglucanase for in planta lignocellulose conversion

    Directory of Open Access Journals (Sweden)

    Klose Holger

    2012-08-01

    Full Text Available Abstract Background The enzymatic conversion of lignocellulosic plant biomass into fermentable sugars is a crucial step in the sustainable and environmentally friendly production of biofuels. However, a major drawback of enzymes from mesophilic sources is their suboptimal activity under established pretreatment conditions, e.g. high temperatures, extreme pH values and high salt concentrations. Enzymes from extremophiles are better adapted to these conditions and could be produced by heterologous expression in microbes, or even directly in the plant biomass. Results Here we show that a cellulase gene (sso1354 isolated from the hyperthermophilic archaeon Sulfolobus solfataricus can be expressed in plants, and that the recombinant enzyme is biologically active and exhibits the same properties as the wild type form. Since the enzyme is inactive under normal plant growth conditions, this potentially allows its expression in plants without negative effects on growth and development, and subsequent heat-inducible activation. Furthermore we demonstrate that the recombinant enzyme acts in high concentrations of ionic liquids and can therefore degrade α-cellulose or even complex cell wall preparations under those pretreatment conditions. Conclusion The hyperthermophilic endoglucanase SSO1354 with its unique features is an excellent tool for advanced biomass conversion. Here we demonstrate its expression in planta and the possibility for post harvest activation. Moreover the enzyme is suitable for combined pretreatment and hydrolysis applications.

  10. Event segmentation ability uniquely predicts event memory.

    Science.gov (United States)

    Sargent, Jesse Q; Zacks, Jeffrey M; Hambrick, David Z; Zacks, Rose T; Kurby, Christopher A; Bailey, Heather R; Eisenberg, Michelle L; Beck, Taylor M

    2013-11-01

    Memory for everyday events plays a central role in tasks of daily living, autobiographical memory, and planning. Event memory depends in part on segmenting ongoing activity into meaningful units. This study examined the relationship between event segmentation and memory in a lifespan sample to answer the following question: Is the ability to segment activity into meaningful events a unique predictor of subsequent memory, or is the relationship between event perception and memory accounted for by general cognitive abilities? Two hundred and eight adults ranging from 20 to 79years old segmented movies of everyday events and attempted to remember the events afterwards. They also completed psychometric ability tests and tests measuring script knowledge for everyday events. Event segmentation and script knowledge both explained unique variance in event memory above and beyond the psychometric measures, and did so as strongly in older as in younger adults. These results suggest that event segmentation is a basic cognitive mechanism, important for memory across the lifespan. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Energy conversion and utilization technologies

    International Nuclear Information System (INIS)

    1988-01-01

    The DOE Energy Conversion and Utilization Technologies (ECUT) Program continues its efforts to expand the generic knowledge base in emerging technological areas that support energy conservation initiatives by both the DOE end-use sector programs and US private industry. ECUT addresses specific problems associated with the efficiency limits and capabilities to use alternative fuels in energy conversion and end-use. Research is aimed at understanding and improving techniques, processes, and materials that push the thermodynamic efficiency of energy conversion and usage beyond the state of the art. Research programs cover the following areas: combustion, thermal sciences, materials, catalysis and biocatalysis, and tribology. Six sections describe the status of direct contact heat exchange; the ECUT biocatalysis project; a computerized tribology information system; ceramic surface modification; simulation of internal combustion engine processes; and materials-by-design. These six sections have been indexed separately for inclusion on the database. (CK)

  12. Environmental effects of energy conversion

    International Nuclear Information System (INIS)

    Hansmeyer, K.H.; Fortak, H.; Knoepp, H.; Lindackers, K.H.; Schafhausen, F.; Schoedel, J.P.

    1984-01-01

    The article presents an analysis of energy conversion systems by the ''Council of Environmental Experts'' in order to correct the erroneous assumption that small energy conversion systems will also be small-scale and negligible emitters of pollutants. The additional pollution caused by Neurath power plant is considered to be low, at least in its immediate vicinity, owing to the implementation of the most recent technical developments. The environmental effects of energy conversion processes are discussed, including the waste heat problem and processes for water-cooling of power plants. General aspects of a new concept of energy taxation are discussed which is to reduce energy consumption. The problem of radioactive waste is discussed from spent fuel storage and reprocessing to the decommissioning of older power plants. The author points out that also new fossil-fuel technologies will pollute the environment. (orig.) [de

  13. Blind-date Conversation Joining

    Directory of Open Access Journals (Sweden)

    Luca Cesari

    2013-07-01

    Full Text Available We focus on a form of joining conversations among multiple parties in service-oriented applications where a client may asynchronously join an existing conversation without need to know in advance any information about it. More specifically, we show how the correlation mechanism provided by orchestration languages enables a form of conversation joining that is completely transparent to clients and that we call 'blind-date joining'. We provide an implementation of this strategy by using the standard orchestration language WS-BPEL. We then present its formal semantics by resorting to COWS, a process calculus specifically designed for modelling service-oriented applications. We illustrate our approach by means of a simple, but realistic, case study from the online games domain.

  14. [Hydroxylamine conversion by anammox enrichment].

    Science.gov (United States)

    Hu, Anhui; Zheng, Ping; Lu, Huifeng; Ding, Shuang; Wang, Caihua

    2010-04-01

    Hydroxylamine is an important intermediate product of anammox. This study was focused on the characteristics of hydroxylamine and nitrite conversions by anammox enrichment. The changes of nitrogenous substrates and related products with time were measured using batch tests with anammox enrichment as inoculum. Since hydroxylamine didn't react with nitrite in uninoculated control culture, these two compounds were chemically stable. Both of them decreased with time in anammox enrichment inoculated cultures, in which ammonia as intermediate product would be produced and converted with the maximum concentration being 0.338 mg/L. The total nitrogen concentration decreased from 4.694 mmol/L to 0.812 mmol/L with conversion rate 82.7% in the end. When hydroxylamine and nitrite concentrations were about 2.5 mmol/L respectively, the maximum specific sludge conversion rates of hydroxylamine was 0.535 mmol/(gVSS.h), which was 1.81 times bigger than that of ammonia in ammonia reaction system; the maximum specific sludge rate of total nitrogen was slightly higher than that in ammonia reaction system. When hydroxylamine concentration increased to 5.0 mmol/L, the hydroxylamine and nitrite conversion rates promoted by 26.7% and 120.7% respectively; and the maximum ammonia accumulated was 1.810 mmol/L. When nitrite concentration increased to 5.0 mmol/L, the hydroxylamine and nitrite conversion rates promoted by 6.9% and 9.0% respectively; and the maximum ammonia accumulated was 0.795 mmol/L. Anammox enrichment was capable of converting hydroxylamine and nitrite simultaneously and had the higher conversion rate of hydroxylamine than ammonia conversion rate. Hydroxylamine and nitrite conversion rates were less affected by increase in nitrite concentration, but more significantly influenced by increase in hydroxylamine. The maximum ammonia concentration accumulated would rise as the result of increasing both hydroxylamine and nitrite. The result of experiment was consistent with pathway

  15. Wavelength conversion techniques and devices

    DEFF Research Database (Denmark)

    Danielsen, Søren Lykke; Mikkelsen, Benny; Hansen, Peter Bukhave

    1997-01-01

    Taking into account the requirements to the converters e.g., bit rate transparency (at least up to 10 Gbit/s), polarisation independence, wavelength independence, moderate input power levels, high signal-to-noise ratio and high extinction ratio interferometric wavelength convertors are very...... interesting for use in WDM optical fibre networks. However, the perfect converter has probably not yet been fabricated and new techniques such as conversion relying on cross-absorption modulation in electro-absorption modulators might also be considered in pursue of effective conversion devices...

  16. Solar energy conversion. Chemical aspects

    Energy Technology Data Exchange (ETDEWEB)

    Likhtenshtein, Gertz [Ben-Gurion Univ. of the Negev, Beersheba (Israel). Dept. of Chemistry

    2012-07-01

    Finally filling a gap in the literature for a text that also adopts the chemist's view of this hot topic, Professor Likhtenshtein, an experienced author and internationally renowned scientist, considers different physical and engineering aspects in solar energy conversion. From theory to real-life systems, he shows exactly which chemical reactions take place when converting light energy, providing an overview of the chemical perspective from fundamentals to molecular harvesting systems and solar cells. This essential guide will thus help researchers in academia and industry better understand solar energy conversion, and so ultimately help this promising, multibillion euro/dollar field to expand. (orig.)

  17. A perspective on direct conversion

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, W. B.

    1963-10-15

    As flowing energy, electricity is sought for its versatility. Its generation from some other flow or release of energy without mechanical power, or even sometimes heat, as intermediary is called direct conversion. The objective is high electrical output for minimum total cost and not always high conversion efficiency. The wide range of techniques embracing cryogenics and hot plasma derives from the special requirements of source, environment and application. Sources include solar and other radiation, nuclear fission and fusion, chemical energy and heat. Environments and applications range from space vehicles to submarines and from giant power networks to isolated buoys and pocket devices. (author)

  18. A perspective on direct conversion

    International Nuclear Information System (INIS)

    Lewis, W.B.

    1963-10-01

    As flowing energy, electricity is sought for its versatility. Its generation from some other flow or release of energy without mechanical power, or even sometimes heat, as intermediary is called direct conversion. The objective is high electrical output for minimum total cost and not always high conversion efficiency. The wide range of techniques embracing cryogenics and hot plasma derives from the special requirements of source, environment and application. Sources include solar and other radiation, nuclear fission and fusion, chemical energy and heat. Environments and applications range from space vehicles to submarines and from giant power networks to isolated buoys and pocket devices. (author)

  19. Nominal Performance Biosphere Dose Conversion Factor Analysis

    Energy Technology Data Exchange (ETDEWEB)

    M. Wasiolek

    2004-09-08

    This analysis report is one of the technical reports containing documentation of the Environmental Radiation Model for Yucca Mountain, Nevada (ERMYN), a biosphere model supporting the Total System Performance Assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis report describes the development of biosphere dose conversion factors (BDCFs) for the groundwater exposure scenario, and the development of conversion factors for assessing compliance with the groundwater protection standard. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows the interrelationships among the products (i.e., analysis and model reports) developed for biosphere modeling and provides an understanding of how this analysis report contributes to biosphere modeling. This report is one of two reports that develop biosphere BDCFs, which are input parameters for the TSPA-LA model. The ''Biosphere Model Report'' (BSC 2004 [DIRS 169460]) describes in detail the ERMYN conceptual model and mathematical model. The input parameter reports, shown to the right of the ''Biosphere Model Report'' in Figure 1-1, contain detailed description of the model input parameters, their development, and the relationship between the parameters and specific features events and processes (FEPs). This report describes biosphere model calculations and their output, the BDCFs, for the groundwater exposure scenario. The objectives of this analysis are to develop BDCFs for the groundwater exposure scenario for the three climate states considered in the TSPA-LA as well as conversion factors for evaluating compliance with the groundwater protection standard. The BDCFs will be used in performance assessment for calculating all-pathway annual doses for a given concentration of radionuclides in groundwater. The conversion factors will be used for calculating gross alpha particle

  20. Children's Self-Esteem and Moral Self: Links to Parent-Child Conversations Regarding Emotion

    Science.gov (United States)

    Reese, Elaine; Bird, Amy; Tripp, Gail

    2007-01-01

    The current study has two aims: (1) to examine associations between the emotional content of parent-child past event conversations and two aspects of children's self-concept--moral self and self-esteem; and (2) to examine the degree to which talk about past events is uniquely associated with self-concept when compared with talk about ongoing…

  1. Talking About Climate: a simple tool for everyday climate conversations

    Science.gov (United States)

    Twedt, J. R.; White, R. H.; Tigchelaar, M.; Doroschak, K.; Buchanan, R.; Lundquist, D.

    2017-12-01

    Public opinion research from the Yale Climate Opinion Maps shows that more than half of Americans are worried about climate change, yet over 70% of Americans rarely or never discuss it with friends or family. Sociologist Kari Marie Norgaard has written about climate denial and how the subject of climate change kills conversation in her interviews, even among people who feel concerned. At the same time, news reporting on climate is often dense with information or scientific nuance and fails to make people feel personally invested in this global issue. This is problematic, because a fair and civil response to our climate crisis will require not only the personal commitment of many, but also collaborative public discourse. For these reasons, we have developed an app that aims to foster meaningful conversation about climate change. The app draws on a database we constructed of historic climate events and relates these events to people's own lives and experiences. Our database is broad and growing, and includes climate change facts, landmark cases in environmental law, social achievements such as the IPCC earning the Nobel Peace Prize, and the personal account from a 12-year old's blog post about FEMA relocation after Hurricane Katrina. Events are stated in plain language and accompanied by open-ended questions to spark discussion. The goal of ClimateConversations is not to inform or persuade, but to support reflective, open-ended conversation, to encourage personal storytelling about climate-related events, and to foster generative dialogue on an issue that all too often causes discomfort and social division. Here we present the climate science, social science, software, and design considerations that went into developing this app. We will also present early quantitative and qualitative metrics of it's use and effectiveness both in classroom and community settings.

  2. Restoring nature: continuing the conversation

    Science.gov (United States)

    Paul H. Gobster; R. Bruce Hull

    2001-01-01

    In the course of our lives we are sometimes confronted by events that jolt us out of our everyday experience. These events can be positive-the birth of a child, a move to a new region or country, the rediscovery of a species thought to be lost from an ecosystem. Such events can also be negative-the death of a loved one, a lost political battle, the bulldozing of a...

  3. Functional neuroimaging of conversion disorder: the role of ancillary activation.

    Science.gov (United States)

    Burke, Matthew J; Ghaffar, Omar; Staines, W Richard; Downar, Jonathan; Feinstein, Anthony

    2014-01-01

    Previous functional neuroimaging studies investigating the neuroanatomy of conversion disorder have yielded inconsistent results that may be attributed to small sample sizes and disparate methodologies. The objective of this study was to better define the functional neuroanatomical correlates of conversion disorder. Ten subjects meeting clinical criteria for unilateral sensory conversion disorder underwent fMRI during which a vibrotactile stimulus was applied to anesthetic and sensate areas. A block design was used with 4 s of stimulation followed by 26 s of rest, the pattern repeated 10 times. Event-related group averages of the BOLD response were compared between conditions. All subjects were right-handed females, with a mean age of 41. Group analyses revealed 10 areas that had significantly greater activation (p conversion symptoms are associated with a pattern of abnormal cerebral activation comprising neural networks implicated in emotional processing and sensory integration. Further study of the roles and potential interplay of these networks may provide a basis for an underlying psychobiological mechanism of conversion disorder.

  4. Conversion disorder: current problems and potential solutions for DSM-5.

    Science.gov (United States)

    Stone, Jon; LaFrance, W Curt; Brown, Richard; Spiegel, David; Levenson, James L; Sharpe, Michael

    2011-12-01

    Conversion disorder in the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV-TR) describes neurological symptoms, including weakness, numbness and events resembling epilepsy or syncope, which can be positively identified as not being due to recognised neurological disease. This review combines perspectives from psychiatry, psychology and neurology to identify and discuss key problems with the current diagnostic DSM-IV criteria for conversion disorder and to make the following proposals for DSM-5: (a) abandoning the label "conversion disorder" and replacing it with an alternative term that is both theoretically neutral and potentially more acceptable to patients and practitioners; (b) relegating the requirements for "association of psychological factors" and the "exclusion of feigning" to the accompanying text; (c) adding a criterion requiring clinical findings of internal inconsistency or incongruity with recognised neurological or medical disease and altering the current 'disease exclusion' criteria to one in which the symptom must not be 'better explained' by a disease if present, (d) adding a 'cognitive symptoms' subtype. We also discuss whether conversion symptoms are better classified with other somatic symptom disorders or with dissociative disorders and how we might address the potential heterogeneity of conversion symptoms in classification. 2011 Elsevier Inc. All rights reserved.

  5. An innovative seeding technique for photon conversion reconstruction at CMS

    International Nuclear Information System (INIS)

    Giordano, D; Sguazzoni, G

    2012-01-01

    The conversion of photons into electron-positron pairs in the detector material is a nuisance in the event reconstruction of high energy physics experiments, since the measurement of the electromagnetic component of interaction products results degraded. Nonetheless this unavoidable detector effect can also be extremely useful. The reconstruction of photon conversions can be used to probe the detector material and to accurately measure soft photons that come from radiative decays in heavy flavor physics. In fact a converted photon can be measured with very high momentum resolution by exploiting the excellent reconstruction of charged tracks of a tracking detector as the one of CMS at LHC. The main issue is that photon conversion tracks are difficult to reconstruct for standard reconstruction algorithms. They are typically soft and very displaced from the primary interaction vertex. An innovative seeding technique that exploits the peculiar photon conversion topology, successfully applied in the CMS track reconstruction sequence, is presented. The performances of this technique and the substantial enhancement of photon conversion reconstruction efficiency are discussed. Application examples are given.

  6. Evolution of energy conversion plants

    International Nuclear Information System (INIS)

    Osnaghi, C.

    2001-01-01

    The paper concerns the evolution and the future development of energy conversion plants and puts into evidence the great importance of the scientific and technological improvement in machines design, in order to optimize the use of energy resources and to improve ambient compatibility [it

  7. Direct digital conversion detector technology

    Science.gov (United States)

    Mandl, William J.; Fedors, Richard

    1995-06-01

    Future imaging sensors for the aerospace and commercial video markets will depend on low cost, high speed analog-to-digital (A/D) conversion to efficiently process optical detector signals. Current A/D methods place a heavy burden on system resources, increase noise, and limit the throughput. This paper describes a unique method for incorporating A/D conversion right on the focal plane array. This concept is based on Sigma-Delta sampling, and makes optimum use of the active detector real estate. Combined with modern digital signal processors, such devices will significantly increase data rates off the focal plane. Early conversion to digital format will also decrease the signal susceptibility to noise, lowering the communications bit error rate. Computer modeling of this concept is described, along with results from several simulation runs. A potential application for direct digital conversion is also reviewed. Future uses for this technology could range from scientific instruments to remote sensors, telecommunications gear, medical diagnostic tools, and consumer products.

  8. Restarts in Conversation and Literature.

    Science.gov (United States)

    Person, Raymond F., Jr.

    1996-01-01

    Analyzes restarts, a common feature of conversation, in literary discourse. The term "restart" refers to the repetition of a word or words within an utterance by the same speaker. Restarts in literary discourse are of two types: (1) those produced by the characters in their "real" narrative world and (2) those produced by the narrators themselves.…

  9. Direct Energy Conversion Literature Abstracts

    Science.gov (United States)

    1962-12-01

    TMMOELECTRIC 6 CONVERSION SYSTEMS. compiled by Edda 7p.. Aug.1960. (Spec. Bibl. 430) Barber. 48p., Mar. 1962. (Lit. Search 392) (Contract NAS 7-100) Covers...2865 BaranskiiP.I ............... 2905, 2945 Brogan, T.R. .............. 3322 Barber, Edda ................. . 2866 Brooklyn Polytechnic

  10. Photovoltaic conversion of laser energy

    Science.gov (United States)

    Stirn, R. J.

    1976-01-01

    The Schottky barrier photovoltaic converter is suggested as an alternative to the p/n junction photovoltaic devices for the conversion of laser energy to electrical energy. The structure, current, output, and voltage output of the Schottky device are summarized. The more advanced concepts of the multilayer Schottky barrier cell and the AMOS solar cell are briefly considered.

  11. Conversations to Transform Geometry Class

    Science.gov (United States)

    Szydlik, Jennifer Earles; Parrott, Amy; Belnap, Jason Knight

    2016-01-01

    Classroom culture is negotiated and established through both conversations and practices. Traditionally, teachers and researchers have focused primarily on the individual and social construction of mathematical content--that is, students' conceptual understanding and procedural skills--through mathematical actions and practices. This article…

  12. Conversation Analysis and Applied Linguistics.

    Science.gov (United States)

    Schegloff, Emanuel A.; Koshik, Irene; Jacoby, Sally; Olsher, David

    2002-01-01

    Offers biographical guidance on several major areas of conversation-analytic work--turn-taking, repair, and word selection--and indicates past or potential points of contact with applied linguistics. Also discusses areas of applied linguistic work. (Author/VWL)

  13. Facilitating Conversations about Managerial Identities

    DEFF Research Database (Denmark)

    Madsen, Mona Toft

    -based organization in the engineering consulting sector b) a reflection meeting, where the same three managers were gathered, and conversations were facilitated based on identity work in the context of earlier interviews. More specifically, three themes were discussed; flat organizational structure, tensions between...

  14. Humor and Embodied Conversational Agents

    NARCIS (Netherlands)

    Nijholt, Antinus

    This report surveys the role of humor in human-to-human interaction and the possible role of humor in human-computer interaction. The aim is to see whether it is useful for embodied conversational agents to integrate humor capabilities in their internal model of intelligence, emotions and

  15. Energy Conversion and Storage Program

    Energy Technology Data Exchange (ETDEWEB)

    Cairns, E.J.

    1992-03-01

    The Energy Conversion and Storage Program applies chemistry and materials science principles to solve problems in (1) production of new synthetic fuels, (2) development of high-performance rechargeable batteries and fuel cells, (3) development of advanced thermochemical processes for energy conversion, (4) characterization of complex chemical processes, and (5) application of novel materials for energy conversion and transmission. Projects focus on transport-process principles, chemical kinetics, thermodynamics, separation processes, organic and physical chemistry, novel materials, and advanced methods of analysis. Electrochemistry research aims to develop advanced power systems for electric vehicle and stationary energy storage applications. Topics include identification of new electrochemical couples for advanced rechargeable batteries, improvements in battery and fuel-cell materials, and the establishment of engineering principles applicable to electrochemical energy storage and conversion. Chemical Applications research includes topics such as separations, catalysis, fuels, and chemical analyses. Included in this program area are projects to develop improved, energy-efficient methods for processing waste streams from synfuel plants and coal gasifiers. Other research projects seek to identify and characterize the constituents of liquid fuel-system streams and to devise energy-efficient means for their separation. Materials Applications research includes the evaluation of the properties of advanced materials, as well as the development of novel preparation techniques. For example, the use of advanced techniques, such as sputtering and laser ablation, are being used to produce high-temperature superconducting films.

  16. Event dependent sampling of recurrent events

    DEFF Research Database (Denmark)

    Kvist, Tine Kajsa; Andersen, Per Kragh; Angst, Jules

    2010-01-01

    The effect of event-dependent sampling of processes consisting of recurrent events is investigated when analyzing whether the risk of recurrence increases with event count. We study the situation where processes are selected for study if an event occurs in a certain selection interval. Motivation...... retrospective and prospective disease course histories are used. We examine two methods to correct for the selection depending on which data are used in the analysis. In the first case, the conditional distribution of the process given the pre-selection history is determined. In the second case, an inverse...

  17. Autonomous renewable energy conversion system

    Energy Technology Data Exchange (ETDEWEB)

    Valtchev, V. [Technical University of Varna (Bulgaria). Dept. of Electronics; Bossche, A. van den; Ghijselen, J.; Melkebeek, J. [University of Gent (Belgium). Dept. of Electrical Power Engineering

    2000-02-01

    This paper briefly reviews the need for renewable power generation and describes a medium-power Autonomous Renewable Energy Conversion System (ARECS), integrating conversion of wind and solar energy sources. The objectives of the paper are to extract maximum power from the proposed wind energy conversion scheme and to transfer this power and the power derived by the photovoltaic system in a high efficiency way to a local isolated load. The wind energy conversion operates at variable shaft speed yielding an improved annual energy production over constant speed systems. An induction generator (IG) has been used because of its reduced cost, robustness, absence of separate DC source for excitation, easier dismounting and maintenance. The maximum energy transfer of the wind energy is assured by a simple and reliable control strategy adjusting the stator frequency of the IG so that the power drawn is equal to the peak power production of the wind turbine at any wind speed. The presented control strategy also provides an optimal efficiency operation of the IG by applying a quadratic dependence between the IG terminal voltage and frequency V {approx} f{sup 2}. For improving the total system efficiency, high efficiency converters have been designed and implemented. The modular principle of the proposed DC/DC conversion provides the possibility for modifying the system structure depending on different conditions. The configuration of the presented ARECS and the implementation of the proposed control algorithm for optimal power transfer are fully discussed. The stability and dynamic performance as well as the different operation modes of the proposed control and the operation of the converters are illustrated and verified on an experimental prototype. (author)

  18. The national conversion pilot project

    International Nuclear Information System (INIS)

    Van Der Puy, M.; Francis, G.; Konczal, M.

    1994-01-01

    The Department of Energy is now faced with the prospect of terminating traditional defense production missions at several Department of Energy sites. Because of this, there is a critical need to develop a DOE process to convert former defense production facilities to private use so that underutilized workers and facilities may be used to minimize the impact on the United States economy. The purpose of the National Conversation Pilot Project (NCPP) at Rocky Flats near Denver, Colorado is to explore and demonstrate the feasibility of economic conversion of DOE facilities, in a manner consistent with ongoing site waste management and cleanup activities, and non-prejudicial to future land use planning decisions. The NCPP is divided into three stages: The first stage, now under way, is one of detailed planning for cleanup and building maintenance activities. The second stage involves building cleanup necessary to support the proposed industrial activities, maintenance of equipment and building infrastructure necessary to assure protection of human health and the environment, declassification work, and some small scale research and development activities. Stage III would involve DOE metals recycling. Specific approval from the DOE is required prior to each project stage. To ensure stakeholder involvement, a steering committee will advise the DOE on the desirability to proceed with the project from stage to stage. A key question in the conversion process is whether a competitive economic and regulatory environment can be created on a DOE facility, allowing an onsite conversion business to effectively compete with offsite businesses. If successful, the Rocky Flats project could become the model for economic conversion at other DOE facilities

  19. Conversion of homothallic yeast to heterothallism through to gene disruption

    CSIR Research Space (South Africa)

    Van Zyl, WH

    1993-04-01

    Full Text Available ). DNA content. The cellular DNA of stationary-phase cells (5 x 109 cells per sample) was extracted with perchloric acid and the DNA content determined in duplicate according to the diphenylamine method described by Stewart (1975). Herring sperm DNA...

  20. The evolution of TEP1, an exceptionally polymorphic immunity gene in Anopheles gambiae

    Directory of Open Access Journals (Sweden)

    Yan Guiyun

    2008-10-01

    Full Text Available Abstract Background Host-parasite coevolution can result in balancing selection, which maintains genetic variation in the susceptibility of hosts to parasites. It has been suggested that variation in a thioester-containing protein called TEP1 (AGAP010815 may alter the ability of Anopheles mosquitoes to transmit Plasmodium parasites, and high divergence between alleles of this gene suggests the possible action of long-term balancing selection. We studied whether TEP1 is a case of an ancient balanced polymorphism in an animal immune system. Results We found evidence that the high divergence between TEP1 alleles is the product of genetic exchange between TEP1 and other TEP loci, i.e. gene conversion. Additionally, some TEP1 alleles showed unexpectedly low variability. Conclusion The TEP1 gene appears to be a chimera produced from at least two other TEP loci, and the divergence between TEP1 alleles is probably not caused by long-term balancing selection, but is instead due to two independent gene conversion events from one of these other genes. Nevertheless, TEP1 still shows evidence of natural selection, in particular there appears to have been recent changes in the frequency of alleles that has diminished polymorphism within each allelic class. Although the selective force driving this dynamic was not identified, given that susceptibility to Plasmodium parasites is known to be associated with allelic variation in TEP1, these changes in allele frequencies could alter the vectoring capacity of populations.

  1. Event generators for address event representation transmitters

    Science.gov (United States)

    Serrano-Gotarredona, Rafael; Serrano-Gotarredona, Teresa; Linares Barranco, Bernabe

    2005-06-01

    Address Event Representation (AER) is an emergent neuromorphic interchip communication protocol that allows for real-time virtual massive connectivity between huge number neurons located on different chips. By exploiting high speed digital communication circuits (with nano-seconds timings), synaptic neural connections can be time multiplexed, while neural activity signals (with mili-seconds timings) are sampled at low frequencies. Also, neurons generate 'events' according to their activity levels. More active neurons generate more events per unit time, and access the interchip communication channel more frequently, while neurons with low activity consume less communication bandwidth. In a typical AER transmitter chip, there is an array of neurons that generate events. They send events to a peripheral circuitry (let's call it "AER Generator") that transforms those events to neurons coordinates (addresses) which are put sequentially on an interchip high speed digital bus. This bus includes a parallel multi-bit address word plus a Rqst (request) and Ack (acknowledge) handshaking signals for asynchronous data exchange. There have been two main approaches published in the literature for implementing such "AER Generator" circuits. They differ on the way of handling event collisions coming from the array of neurons. One approach is based on detecting and discarding collisions, while the other incorporates arbitration for sequencing colliding events . The first approach is supposed to be simpler and faster, while the second is able to handle much higher event traffic. In this article we will concentrate on the second arbiter-based approach. Boahen has been publishing several techniques for implementing and improving the arbiter based approach. Originally, he proposed an arbitration squeme by rows, followed by a column arbitration. In this scheme, while one neuron was selected by the arbiters to transmit his event out of the chip, the rest of neurons in the array were

  2. Resonant spin-flavor conversion of supernova neutrinos: Dependence on electron mole fraction

    International Nuclear Information System (INIS)

    Yoshida, Takashi; Takamura, Akira; Kimura, Keiichi; Yokomakura, Hidekazu; Kawagoe, Shio; Kajino, Toshitaka

    2009-01-01

    Detailed dependence of resonant spin-flavor (RSF) conversion of supernova neutrinos on electron mole fraction Y e is investigated. Supernova explosion forms a hot-bubble and neutrino-driven wind region of which electron mole fraction exceeds 0.5 in several seconds after the core collapse. When a higher resonance of the RSF conversion is located in the innermost region, flavor change of the neutrinos strongly depends on the sign of 1-2Y e . At an adiabatic high RSF resonance the flavor conversion of ν e ↔ν μ,τ occurs in Y e e >0.5 and inverted mass hierarchy. In other cases of Y e values and mass hierarchies, the conversion of ν e ↔ν μ,τ occurs. The final ν e spectrum is evaluated in the cases of Y e e >0.5 taking account of the RSF conversion. Based on the obtained result, time variation of the event number ratios of low ν e energy to high ν e energy is discussed. In normal mass hierarchy, an enhancement of the event ratio should be seen in the period when the electron fraction in the innermost region exceeds 0.5. In inverted mass hierarchy, on the other hand, a dip of the event ratio should be observed. Therefore, the time variation of the event number ratio is useful to investigate the effect of the RSF conversion.

  3. Importance of individual events in temporal networks

    International Nuclear Information System (INIS)

    Takaguchi, Taro; Masuda, Naoki; Sato, Nobuo; Yano, Kazuo

    2012-01-01

    Records of time-stamped social interactions between pairs of individuals (e.g. face-to-face conversations, e-mail exchanges and phone calls) constitute a so-called temporal network. A remarkable difference between temporal networks and conventional static networks is that time-stamped events rather than links are the unit elements generating the collective behavior of nodes. We propose an importance measure for single interaction events. By generalizing the concept of the advance of events proposed by Kossinets et al (2008 Proc. 14th ACM SIGKDD Int. Conf. on Knowledge Discovery and Data Mining p 435), we propose that an event is central when it carries new information about others to the two nodes involved in the event. We find that the proposed measure properly quantifies the importance of events in connecting nodes along time-ordered paths. Because of strong heterogeneity in the importance of events present in real data, a small fraction of highly important events is necessary and sufficient to sustain the connectivity of temporal networks. Nevertheless, in contrast to the behavior of scale-free networks against link removal, this property mainly results from bursty activity patterns and not heterogeneous degree distributions. (paper)

  4. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in sea lamprey and Japanese lamprey.

    Science.gov (United States)

    Ren, Jianfeng; Chung-Davidson, Yu-Wen; Yeh, Chu-Yin; Scott, Camille; Brown, Titus; Li, Weiming

    2015-06-06

    Lampreys are extant representatives of the jawless vertebrate lineage that diverged from jawed vertebrates around 500 million years ago. Lamprey genomes contain information crucial for understanding the evolution of gene families in vertebrates. The ATP-binding cassette (ABC) gene family is found from prokaryotes to eukaryotes. The recent availability of two lamprey draft genomes from sea lamprey Petromyzon marinus and Japanese lamprey Lethenteron japonicum presents an opportunity to infer early evolutionary events of ABC genes in vertebrates. We conducted a genome-wide survey of the ABC gene family in two lamprey draft genomes. A total of 37 ABC transporters were identified and classified into seven subfamilies; namely seven ABCA genes, 10 ABCB genes, 10 ABCC genes, three ABCD genes, one ABCE gene, three ABCF genes, and three ABCG genes. The ABCA subfamily has expanded from three genes in sea squirts, seven and nine in lampreys and zebrafish, to 13 and 16 in human and mouse. Conversely, the multiple copies of ABCB1-, ABCG1-, and ABCG2-like genes found in sea squirts have contracted in the other species examined. ABCB2 and ABCB3 seem to be new additions in gnathostomes (not in sea squirts or lampreys), which coincides with the emergence of the gnathostome-specific adaptive immune system. All the genes in the ABCD, ABCE and ABCF subfamilies were conserved and had undergone limited duplication and loss events. In the sea lamprey transcriptomes, the ABCE and ABCF gene subfamilies were ubiquitously and highly expressed in all tissues while the members in other gene subfamilies were differentially expressed. Thirteen more lamprey ABC transporter genes were identified in this study compared with a previous study. By concatenating the same gene sequences from the two lampreys, more full length sequences were obtained, which significantly improved both the assignment of gene names and the phylogenetic trees compared with a previous analysis using partial sequences. The ABC

  5. Event-by-event jet quenching

    Energy Technology Data Exchange (ETDEWEB)

    Fries, R.J.; Rodriguez, R.; Ramirez, E.

    2010-08-14

    High momentum jets and hadrons can be used as probes for the quark gluon plasma (QGP) formed in nuclear collisions at high energies. We investigate the influence of fluctuations in the fireball on jet quenching observables by comparing propagation of light quarks and gluons through averaged, smooth QGP fireballs with event-by-event jet quenching using realistic inhomogeneous fireballs. We find that the transverse momentum and impact parameter dependence of the nuclear modification factor R{sub AA} can be fit well in an event-by-event quenching scenario within experimental errors. However the transport coefficient {cflx q} extracted from fits to the measured nuclear modification factor R{sub AA} in averaged fireballs underestimates the value from event-by-event calculations by up to 50%. On the other hand, after adjusting {cflx q} to fit R{sub AA} in the event-by-event analysis we find residual deviations in the azimuthal asymmetry v{sub 2} and in two-particle correlations, that provide a possible faint signature for a spatial tomography of the fireball. We discuss a correlation function that is a measure for spatial inhomogeneities in a collision and can be constrained from data.

  6. Event-by-event jet quenching

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez, R. [Cyclotron Institute and Physics Department, Texas A and M University, College Station, TX 77843 (United States); Fries, R.J., E-mail: rjfries@comp.tamu.ed [Cyclotron Institute and Physics Department, Texas A and M University, College Station, TX 77843 (United States); RIKEN/BNL Research Center, Brookhaven National Laboratory, Upton, NY 11973 (United States); Ramirez, E. [Physics Department, University of Texas El Paso, El Paso, TX 79968 (United States)

    2010-09-27

    High momentum jets and hadrons can be used as probes for the quark gluon plasma (QGP) formed in nuclear collisions at high energies. We investigate the influence of fluctuations in the fireball on jet quenching observables by comparing propagation of light quarks and gluons through averaged, smooth QGP fireballs with event-by-event jet quenching using realistic inhomogeneous fireballs. We find that the transverse momentum and impact parameter dependence of the nuclear modification factor R{sub AA} can be fit well in an event-by-event quenching scenario within experimental errors. However the transport coefficient q extracted from fits to the measured nuclear modification factor R{sub AA} in averaged fireballs underestimates the value from event-by-event calculations by up to 50%. On the other hand, after adjusting q to fit R{sub AA} in the event-by-event analysis we find residual deviations in the azimuthal asymmetry v{sub 2} and in two-particle correlations, that provide a possible faint signature for a spatial tomography of the fireball. We discuss a correlation function that is a measure for spatial inhomogeneities in a collision and can be constrained from data.

  7. Event-by-event fluctuations at SPS

    CERN Document Server

    Appelshauser, Harald; Adamova, D.; Agakichiev, G.; Belaga, V.; Braun-Munzinger, P.; Castillo, A.; Cherlin, A.; Damjanovic, S.; Dietel, T.; Dietrich, L.; Drees, A.; Esumi, S.I.; Filimonov, K.; Fomenko, K.; Fraenkel, Z.; Garabatos, C.; Glassel, P.; Hering, G.; Holeczek, J.; Kushpil, V.; Lenkeit, B.; Ludolphs, W.; Maas, A.; Marn, A.; Milosevic, J.; Milov, A.; Miskowiec, D.; Panebrattsev, Yu.; Petchenova, O.; Petracek, V.; Pfeiffer, A.; Rak, J.; Ravinovich, I.; Rehak, P.; Schmitz, W.; Schukraft, J.; Sedykh, S.; Shimansky, S.; Slvova, J.; Stachel, J.; Sumbera, M.; Tilsner, H.; Tserruya, Itzhak; Wessels, J.P.; Wienold, T.; Windelband, B.; Wurm, J.P.; Xie, W.; Yurevich, S.; Yurevich, V.; Appelshauser, Harald; Sako, Hiro

    2005-01-01

    Results on event-by-event fluctuations of the mean transverse momentum and net charge in Pb-Au collisions, measured by the CERES Collaboration at CERN-SPS, are presented. We discuss the centrality and beam energy dependence and compare our data to cascade calculations.

  8. Transcriptional regulation and DNA methylation in plastids during transitional conversion of chloroplasts to chromoplasts.

    OpenAIRE

    Kobayashi, H; Ngernprasirtsiri, J; Akazawa, T

    1990-01-01

    During transitional conversion of chloroplasts to chromoplasts in ripening tomato (Lycopersicon esculentum) fruits, transcripts for several plastid genes for photosynthesis decreased to undetectable levels. Run-on transcription of plastids indicated that transcriptional regulation operated as a predominant factor. We found that most of the genes in chloroplasts were actively transcribed in vitro by Escherichia coli and soluble plastid RNA polymerases, but some genes in chromoplasts seemed to ...

  9. Analog-to-digital conversion

    CERN Document Server

    Pelgrom, Marcel

    2017-01-01

    This textbook is appropriate for use in graduate-level curricula in analog-to-digital conversion, as well as for practicing engineers in need of a state-of-the-art reference on data converters. It discusses various analog-to-digital conversion principles, including sampling, quantization, reference generation, nyquist architectures and sigma-delta modulation. This book presents an overview of the state of the art in this field and focuses on issues of optimizing accuracy and speed, while reducing the power level. This new, third edition emphasizes novel calibration concepts, the specific requirements of new systems, the consequences of 22-nm technology and the need for a more statistical approach to accuracy. Pedagogical enhancements to this edition include additional, new exercises, solved examples to introduce all key, new concepts and warnings, remarks and hints, from a practitioner’s perspective, wherever appropriate. Considerable background information and practical tips, from designing a PCB, to lay-o...

  10. Hemicellulose conversion by anaerobic digestion

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, S; Honry, M P; Christopher, R W

    1985-01-01

    This research was undertaken to study the digestibility of the hemicellulose fractions of an aquatic biomass, a land-based biomass and a biomass-waste blend under various fermentation conditions. The conversion of hemicellulose was higher than those of cellulose and protein under the mesophilic condition. Hemicellulose was converted at a much lower efficency than cellulose during thermophilic digestion. In contrast, cellulose conversion was about the same under mesophilic and thermophilic conditions. Cellulose was utilized in preference to hemicellulose during mesophilic fermentation of nitrogen-supplemented Bermuda grass. It was speculated that Bermuda grass cellulose was converted at a higher efficiency than hemicellulose in the pressure of external nitrogen because the metabolism of the breakdown product (glucose) of cellulose required the least investment of enzymes and energy. 4 references.

  11. IMAGE CONVERSION FOR LASER PYROGRAPHY

    Directory of Open Access Journals (Sweden)

    Adrian PETRU

    2015-12-01

    Full Text Available All previous studies of pyrography have been focussed on colour obtained through modifying the work parameters. This paper analyses colour nuances obtained by laser woodworking by measuring colour changes digitally. The investigated parameter is colour reproduction by laser technology, using different image conversion methods (Halftone Round, Jarvis, and so on. The changes of image reproduction are analysed globally and colour by colour. The results show that the colour nuances are represented to a more and less degree, according to the conversion method selected. To evaluate the aesthetic changes, CIEL*a*b* colour measurements were applied. The results show that laser burning on wood surfaces has a great influence on wood colour. These findings will be useful to develop innovative design possibilities for wood surfaces for furniture and other products.

  12. Progress in understanding conversion disorder

    Science.gov (United States)

    Allin, Matthew; Streeruwitz, Anna; Curtis, Vivienne

    2005-01-01

    Conversion disorder has a history that may reach back into antiquity, and it continues to present a clinical challenge to both psychiatrists and neurologists. This article reviews the current state of knowledge surrounding the prevalence, etiology, and neurobiology of conversion disorder. There have been improvements in the accuracy of diagnosis that are possibly related to improved technologies such as neuroimaging. Once the diagnosis is made, it is important to develop a therapeutic alliance between the patient and the medical team, and where comorbid psychiatric diagnoses have been made, these need to be adequately treated. While there have been no formal trials of medication or psychoanalytic treatments in this disorder, case reports suggest that a combination of antidepressants, psychotherapy, and a multidisciplinary approach to rehabilitation may be beneficial. PMID:18568070

  13. Rating Instructional Conversations: A Guide

    OpenAIRE

    Rueda, Robert; Goldenberg, Claude; Gallimore, Ronald

    1992-01-01

    The current focus on more effective ways to foster literacy in school-age children, especially language minority students, has led to the development of alternative instructional approaches. One such approach is the instructional conversation (IC), based on early work in the Hawaiian Kamehameha Elementary Education Project (KEEP), on neo-Vygotskian theory, and on recent classroom-based research on reading comprehension. The present report outlines preliminary efforts to operationaliz...

  14. FRM-II conversion revisited

    International Nuclear Information System (INIS)

    Glaser, A.; Pistner, C.; Liebert, W.

    2000-01-01

    The possibilities for a conversion of the currently constructed research reactor FRM-II has been extensively discussed at various RERTR meetings over the past years. In order to support the ongoing decision-making process in Germany, we prepared computer simulations providing extra information on the scientific usability of the converted reactor based on designs proposed by ANL and TUM. The most important results of these calculations are presented and discussed. Special attention is thereby given to the specific German context. (author)

  15. Conversation Analysis and Classroom Interaction

    Institute of Scientific and Technical Information of China (English)

    DING A-ning; LI Fan; CUI Jing

    2015-01-01

    Conversation Analysis shows the evidence of the social nature of people’s action including talk-in-interaction from a micro-level perspective. The method for basing its analysis on the authentic data rather than the retrospective interviews for gain⁃ing the participants’perception makes it unique in discovering the emic perspective of the social interaction. CA, often called as a“micro”methodology, provides theoretical insights and useful analytical tool for exploring the interaction in classrooms.

  16. A Conversation with Adam Heller

    OpenAIRE

    Heller, A; Cairns, EJ

    2015-01-01

    © 2015 by Annual Reviews. All rights reserved. Adam Heller, Ernest Cockrell Sr. Chair in Engineering Emeritus of the John J. McKetta Department of Chemical Engineering at The University of Texas at Austin, recalls his childhood in the Holocaust and his contributions to science and technology that earned him the US National Medal of Technology and Innovation in a conversation with Elton J. Cairns, Professor of Chemical and Biomolecular Engineering at the University of California, Berkeley. Dr....

  17. The National Conversion Pilot Project

    International Nuclear Information System (INIS)

    Roberts, A.V.

    1995-01-01

    The National Conversion Pilot Project (NCPP) is a recycling project under way at the U.S. Department of Energy (DOE) Rocky Flats Environmental Technology Site (RFETS) in Colorado. The recycling aim of the project is threefold: to reuse existing nuclear weapon component production facilities for the production of commercially marketable products, to reuse existing material (uranium, beryllium, and radioactively contaminated scrap metals) for the production of these products, and to reemploy former Rocky Flats workers in this process

  18. Metylcyclohexane conversion to light olefins

    Directory of Open Access Journals (Sweden)

    SCOFIELD C.F.

    1998-01-01

    Full Text Available This study consists in the evaluation of the catalytic properties of zeolites with different structures in the conversion of methylcyclohexane to light olefins. Results obtained suggest that the steric constrictions of the catalysts used play an important role in hydrogen transfer reactions. Higher selectivities for light olefins (C3= and C4= were observed for zeolites having more closed structures, like MFI and ferrerite, when compared to those having more open ones, like beta, omega and faujasite.

  19. Metylcyclohexane conversion to light olefins

    OpenAIRE

    SCOFIELD, C.F.; BENAZZI, E.; CAUFFRIEZ, H.; MARCILLY, C.

    1998-01-01

    This study consists in the evaluation of the catalytic properties of zeolites with different structures in the conversion of methylcyclohexane to light olefins. Results obtained suggest that the steric constrictions of the catalysts used play an important role in hydrogen transfer reactions. Higher selectivities for light olefins (C3= and C4=) were observed for zeolites having more closed structures, like MFI and ferrerite, when compared to those having more open ones, like beta, omega and fa...

  20. Conversion Disorder Comorbidity and Childhood Trauma.

    Science.gov (United States)

    Akyüz, Fatma; Gökalp, Peykan G; Erdiman, Sezgin; Oflaz, Serap; Karşidağ, Çağatay

    2017-03-01

    The aim of this study is to examine the socio-demographic and clinical characteristics, the presence of comorbidity, and the link with childhood traumatic experiences in patients with conversion disorder (CD) in a psychiatric outpatient clinic. A total of 60 literate, female patients between 18 and 65 years of age who were referred to the general psychiatry outpatient clinic and who were diagnosed with conversion disorder according to the DSM-IV diagnostic criteria were included in the study. A questionnaire on sociodemographic and clinical characteristics, the Brief Psychiatric Rating Scale (BPRS), the Hamilton Depression Rating Scale (HDRS), the Hamilton Anxiety Rating Scale (HARS), the Childhood Trauma Questionnaire (CTQ), and the Dissociative Events Scale (DES) were used to assess the cases. The mean age of the participants was 36.27±11.18 years. 72% of the patients were married and 63% were primary school graduates. The most common symptoms were asthenia (100%), aphasia (96.7%), and crying-convulsions (93%). The most common co-morbidities were depression (50%) and dissociative disorders (48.3%). Among the patients, 53.3% reported a history of exposure to physical violence and 25% reported a history of sexual assault in childhood. Assessment of the Childhood Traumatic Questionnaire revealed a significant positive relation between emotional, physical, and sexual abuse scores and DES score. CD has not yet been fully analyzed in detail in health institutions; co-existence of another mental disorder and the presence of traumatic experiences in the past further complicate the issue. Consideration of these factors during treatment will have a positive impact on the course and prognosis of the disorder.

  1. Genetic variation of the major histocompatibility complex (MHC class II B gene in the threatened Hume's pheasant, Syrmaticus humiae.

    Directory of Open Access Journals (Sweden)

    Weicai Chen

    Full Text Available Major histocompatibility complex (MHC genes are the most polymorphic genes in vertebrates and encode molecules that play a crucial role in pathogen resistance. As a result of their diversity, they have received much attention in the fields of evolutionary and conservation biology. Here, we described the genetic variation of MHC class II B (MHCIIB exon 2 in a wild population of Hume's pheasant (Syrmaticus humiae, which has suffered a dramatic decline in population over the last three decades across its ranges in the face of heavy exploitation and habitat loss. Twenty-four distinct alleles were found in 73 S. humiae specimens. We found seven shared alleles among four geographical groups as well as six rare MHCIIB alleles. Most individuals displayed between one to five alleles, suggesting that there are at least three MHCIIB loci of the Hume's pheasant. The dN ⁄ dS ratio at putative antigen-binding sites (ABS was significantly greater than one, indicating balancing selection is acting on MHCIIB exon 2. Additionally, recombination and gene conversion contributed to generating MHCIIB diversity in the Hume's pheasant. One to three recombination events and seventy-five significant gene conversion events were observed within the Hume's pheasant MHCIIB loci. The phylogenetic tree and network analysis revealed that the Hume's pheasant alleles do not cluster together, but are scattered through the tree or network indicating a trans-species evolutionary mode. These findings revealed the evolution of the Hume's pheasant MHC after suffering extreme habitat fragmentation.

  2. Role of protein farnesylation events in the ABA-mediated regulation of the Pinoresinol-Lariciresinol Reductase 1 (LuPLR1) gene expression and lignan biosynthesis in flax (Linum usitatissimum L.).

    Science.gov (United States)

    Corbin, Cyrielle; Decourtil, Cédric; Marosevic, Djurdjica; Bailly, Marlène; Lopez, Tatiana; Renouard, Sullivan; Doussot, Joël; Dutilleul, Christelle; Auguin, Daniel; Giglioli-Guivarc'h, Nathalie; Lainé, Eric; Lamblin, Frédéric; Hano, Christophe

    2013-11-01

    A Linum usitatissimum LuERA1 gene encoding a putative ortholog of the ERA1 (Enhanced Response to ABA 1) gene of Arabidopsis thaliana (encoding the beta subunit of a farnesyltransferase) was analyzed in silico and for its expression in flax. The gene and the protein sequences are highly similar to other sequences already characterized in plants and all the features of a farnesyltransferase were detected. Molecular modeling of LuERA1 protein confirmed its farnesyltransferase nature. LuERA1 is expressed in the vegetative organs and also in the outer seedcoat of the flaxseed, where it could modulate the previously observed regulation operated by ABA on lignan synthesis. This effect could be mediated by the regulation of the transcription of a key gene for lignan synthesis in flax, the LuPLR1 gene, encoding a pinoresinol lariciresinol reductase. The positive effect of manumycin A, a specific inhibitor of farnesyltransferase, on lignan biosynthesis in flax cell suspension systems supports the hypothesis of the involvement of such an enzyme in the negative regulation of ABA action. In Arabidopsis, ERA1 is able to negatively regulate the ABA effects and the mutant era1 has an enhanced sensitivity to ABA. When expressed in an Arabidopsis cell suspension (heterologous system) LuERA1 is able to reverse the effect of the era1 mutation. RNAi experiments in flax targeting the farnesyltransferase β-subunit encoded by the LuERA1 gene led to an increase LuPLR1 expression level associated with an increased content of lignan in transgenic calli. Altogether these results strongly suggest a role of the product of this LuERA1 gene in the ABA-mediated upregulation of lignan biosynthesis in flax cells through the activation of LuPLR1 promoter. This ABA signaling pathway involving ERA1 probably acts through the ABRE box found in the promoter sequence of LuPLR1, a key gene for lignan synthesis in flax, as demonstrated by LuPLR1 gene promoter-reporter experiments in flax cells using wild

  3. High conversion burner type reactor

    International Nuclear Information System (INIS)

    Higuchi, Shin-ichi; Kawashima, Masatoshi

    1987-01-01

    Purpose: To simply and easily dismantle and reassemble densified fuel assemblies taken out of a high conversion ratio area thereby improve the neutron and fuel economy. Constitution: The burner portion for the purpose of fuel combustion is divided into a first burner region in adjacent with the high conversion ratio area at the center of the reactor core, and a second burner region formed to the outer circumference thereof and two types of fuels are charged therein. Densified fuel assemblies charged in the high conversion ratio area are separatably formed as fuel assemblies for use in the two types of burners. In this way, dense fuel assembly is separated into two types of fuel assemblies for use in burner of different number and arranging density of fuel elements which can be directly charged to the burner portion and facilitate the dismantling and reassembling of the fuel assemblies. Further, since the two types of fuel assemblies are charged in the burner portion, utilization factor for the neutron fuels can be improved. (Kamimura, M.)

  4. Measurements of weak conversion lines

    International Nuclear Information System (INIS)

    Feoktistov, A.I.; Frantsev, Yu.E.

    1979-01-01

    Described is a new methods for measuring weak conversion lines with the help of the β spectrometer of the π √ 2 type which permits to increase the reliability of the results obtained. According to this method the measurements were carried out by short series with the storage of the information obtained on the punched tape. The spectrometer magnetic field was stabilized during the measuring of the conversion spectra with the help of three nmr recorders. Instead of the dependence of the pulse calculation rate on the magnetic field value was measured the dependence of the calculation rate on the value of the voltage applied between the source and the spectrometer chamber. A short description of the automatic set-up for measuring conversion lines according to the method proposed is given. The main set-up elements are the voltage multiplexer timer, printer, scaler and the pulse analyzer. With the help of the above methods obtained is the K 1035, 8 keV 182 Ta line. It is obtained as a result of the composition of 96 measurement series. Each measurement time constitutes 640 s 12 points are taken on the line

  5. Episodes, events, and models

    Directory of Open Access Journals (Sweden)

    Sangeet eKhemlani

    2015-10-01

    Full Text Available We describe a novel computational theory of how individuals segment perceptual information into representations of events. The theory is inspired by recent findings in the cognitive science and cognitive neuroscience of event segmentation. In line with recent theories, it holds that online event segmentation is automatic, and that event segmentation yields mental simulations of events. But it posits two novel principles as well: first, discrete episodic markers track perceptual and conceptual changes, and can be retrieved to construct event models. Second, the process of retrieving and reconstructing those episodic markers is constrained and prioritized. We describe a computational implementation of the theory, as well as a robotic extension of the theory that demonstrates the processes of online event segmentation and event model construction. The theory is the first unified computational account of event segmentation and temporal inference. We conclude by demonstrating now neuroimaging data can constrain and inspire the construction of process-level theories of human reasoning.

  6. Dynamics of Charged Events

    International Nuclear Information System (INIS)

    Bachas, Constantin; Bunster, Claudio; Henneaux, Marc

    2009-01-01

    In three spacetime dimensions the world volume of a magnetic source is a single point, an event. We make the event dynamical by regarding it as the imprint of a flux-carrying particle impinging from an extra dimension. This can be generalized to higher spacetime dimensions and to extended events. We exhibit universal observable consequences of the existence of events and argue that events are as important as particles or branes. We explain how events arise on the world volume of membranes in M theory, and in a Josephson junction in superconductivity.

  7. The global event system

    International Nuclear Information System (INIS)

    Winans, J.

    1994-01-01

    The support for the global event system has been designed to allow an application developer to control the APS event generator and receiver boards. This is done by the use of four new record types. These records are customized and are only supported by the device support modules for the APS event generator and receiver boards. The use of the global event system and its associated records should not be confused with the vanilla EPICS events and the associated event records. They are very different

  8. Experimental techniques of conversion coefficient measurements

    International Nuclear Information System (INIS)

    Hamilton, J.H.

    1975-01-01

    Discusses briefly the history of conversion electron spectra measurements, and the interpretation of the collected data. Then provides a comprehensive review of techniques presently available to measure the conversion coefficients. (Auth.)

  9. Conversion Disorder Presenting As Neuritic Leprosy

    Directory of Open Access Journals (Sweden)

    Sayal SK

    2000-01-01

    Full Text Available Conversion disorder is not normally listed amongst the conditions in differential diagnosis of leprosy neuropathy. A case conversion reaction who was initially diagnosed as neuritic leprosy is reported. Patient responded to narcosuggestion and psychotherapy.

  10. Event by event physics in ALICE

    CERN Document Server

    Christakoglou, Panos

    2009-01-01

    Fluctuations of thermodynamic quantities are fundamental for the study of the QGP phase transition. The ALICE experiment is well suited for precise event-by-event measurements of various quantities. In this article, we review the capabilities of ALICE to study the fluctuations of several key observables such as the net charge, the temperature, and the particle ratios. Among the observables related to correlations, we review the balance functions and the long range correlations.

  11. Practicing Possibilities: Parents' Explanations of Unusual Events and Children's Possibility Thinking

    Science.gov (United States)

    Nolan-Reyes, Charlotte; Callanan, Maureen A.; Haigh, Kirsten A.

    2016-01-01

    Young children tend to judge improbable events to be impossible, yet there is variability across age and across individuals. Our study examined parent-child conversations about impossible and improbable events and links between parents' explanations about those events and children's possibility judgments in a reasoning task. Regression analyses…

  12. Interrogative suggestibility in patients with conversion disorders.

    Science.gov (United States)

    Foong, J; Lucas, P A; Ron, M A

    1997-09-01

    We tested the hypothesis that increased interrogative suggestibility may contribute to the shaping and maintaining of conversions symptoms. Interrogative suggestibility was measured in 12 patients with conversion disorder and 10 control patients with confirmed neurological disease matched for age, premorbid intelligence, and as closely as possible in terms of their neurological symptoms to the patients with conversion disorder. Our observations do not support the contention that individual differences in interrogative suggestibility are of importance in the etiology of conversion disorders.

  13. Vertical Scan-Conversion for Filling Purposes

    OpenAIRE

    Hersch, R. D.

    1988-01-01

    Conventional scan-conversion algorithms were developed independently of filling algorithms. They cause many problems, when used for filling purposes. However, today's raster printers and plotters require extended use of filling, especially for the generation of typographic characters and graphic line art. A new scan-conversion algorithm, called vertical scan-conversion has been specifically designed to meet the requirements of parity scan line fill algorithms. Vertical scan-conversion ensures...

  14. Differential intrathecal inflammatory markers in acute optic neuritis and later conversion to multiple sclerosis

    DEFF Research Database (Denmark)

    Olesen, Mads Nikolaj; Soelberg, Kerstin; Nilsson, Anna Christine

    Background: Optic neuritis (ON) is often an early inflammatory, demyelinating event of multiple sclerosis (MS). We proffer that cytokine and chemokine profiles may (a) differ between patients with MS-related ON and those with non-MS-related ON and (b) predict conversion to MS in patients presenting......-up compared to those who had not. These findings are of potential relevance to our understanding of the pathogenesis of MS and may predict conversion of ON to MS....

  15. Conferences and Events

    International Development Research Centre (IDRC) Digital Library (Canada)

    André Lavoie

    2016-06-14

    Jun 14, 2016 ... Approved by the Management Executive Committee. - 1 - ... Event ‒ represents activities related to IDRC operations and may include both ... Events include business meetings; corporate, branch or divisional management.

  16. Initiating events frequency determination

    International Nuclear Information System (INIS)

    Simic, Z.; Mikulicic, V.; Vukovic, I.

    2004-01-01

    The paper describes work performed for the Nuclear Power Station (NPS). Work is related to the periodic initiating events frequency update for the Probabilistic Safety Assessment (PSA). Data for all relevant NPS initiating events (IE) were reviewed. The main focus was on events occurring during most recent operating history (i.e., last four years). The final IE frequencies were estimated by incorporating both NPS experience and nuclear industry experience. Each event was categorized according to NPS individual plant examination (IPE) initiating events grouping approach. For the majority of the IE groups, few, or no events have occurred at the NPS. For those IE groups with few or no NPS events, the final estimate was made by means of a Bayesian update with general nuclear industry values. Exceptions are rare loss-of-coolant-accidents (LOCA) events, where evaluation of engineering aspects is used in order to determine frequency.(author)

  17. Adaptive Feedback Improving Learningful Conversations at Workplace

    Science.gov (United States)

    Gaeta, Matteo; Mangione, Giuseppina Rita; Miranda, Sergio; Orciuoli, Francesco

    2013-01-01

    This work proposes the definition of an Adaptive Conversation-based Learning System (ACLS) able to foster computer-mediated tutorial dialogues at the workplace in order to increase the probability to generate meaningful learning during conversations. ACLS provides a virtual assistant selecting the best partner to involve in the conversation and…

  18. 5 CFR 534.506 - Conversion provisions.

    Science.gov (United States)

    2010-01-01

    ... conversion, other than to the minimum rate under 5 U.S.C. 5376, the increase must be approved by the head of... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Conversion provisions. 534.506 Section... OTHER SYSTEMS Pay for Senior-Level and Scientific and Professional Positions § 534.506 Conversion...

  19. 5 CFR 536.303 - Geographic conversion.

    Science.gov (United States)

    2010-01-01

    ... after geographic conversion is the employee's existing payable rate of basic pay in effect immediately before the action. (b) Geographic conversion when a retained rate employee's official worksite is changed... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Geographic conversion. 536.303 Section...

  20. Valproate in Conversion Disorder: A Case Report

    OpenAIRE

    Messina, Antonino; Fogliani, Anna Maria

    2010-01-01

    Few data are in literature about the pharmacological treatment of conversion disorder and there are not any studies about the use of Valproate extended release (ER) in treating conversion disorder. In this article, we are reporting a case of an Italian woman with a diagnosis of conversion disorder treated effectively and quickly by Valproate ER.

  1. 47 CFR 80.761 - Conversion graphs.

    Science.gov (United States)

    2010-10-01

    ... MARITIME SERVICES Standards for Computing Public Coast Station VHF Coverage § 80.761 Conversion graphs. The following graphs must be employed where conversion from one to the other of the indicated types of units is... 47 Telecommunication 5 2010-10-01 2010-10-01 false Conversion graphs. 80.761 Section 80.761...

  2. Advertising Effectiveness In Events

    OpenAIRE

    Jain, Sushilkumar

    2012-01-01

    Confronted with decreasing effectiveness of the classic marketing communications, events have become an increasingly popular alternative for marketers. Events constitute one of the most exciting and fastest growing forms of leisure and business. With time, the decreasing effectiveness of classical marketing communications boosted the use of events for marketing and making brand awareness. Event marketing is seen as the unique opportunity to integrate the firm’s communication activities like p...

  3. A Mosque event

    DEFF Research Database (Denmark)

    Simonsen, Kirsten; Neergaard, Maja de; Koefoed, Lasse Martin

    2017-01-01

    and public imaginations attached to it. And they are connected to a specific event – the opening of the mosque. In the first part, a conceptual framework is presented bringing together literature on three notions: encounters, visibility and the event. Following this, the paper explores the opening event...

  4. On semirecurrent events

    International Nuclear Information System (INIS)

    Dvurechenskij, A.

    1984-01-01

    In some problems of the mathematical theory of particle counters, film or filmless measurements of track ionization in high energy physics,queueing theory, random walks, etc., the classes of emirecurrent and m-semirecurrent events, which generalize the recurrent events and the recurrent events with delay, appeared. In the paper their basic properties, and some relationships between them are shown

  5. Dissecting engineered cell types and enhancing cell fate conversion via CellNet

    Science.gov (United States)

    Morris, Samantha A.; Cahan, Patrick; Li, Hu; Zhao, Anna M.; San Roman, Adrianna K.; Shivdasani, Ramesh A.; Collins, James J.; Daley, George Q.

    2014-01-01

    SUMMARY Engineering clinically relevant cells in vitro holds promise for regenerative medicine, but most protocols fail to faithfully recapitulate target cell properties. To address this, we developed CellNet, a network biology platform that determines whether engineered cells are equivalent to their target tissues, diagnoses aberrant gene regulatory networks, and prioritizes candidate transcriptional regulators to enhance engineered conversions. Using CellNet, we improved B cell to macrophage conversion, transcriptionally and functionally, by knocking down predicted B cell regulators. Analyzing conversion of fibroblasts to induced hepatocytes (iHeps), CellNet revealed an unexpected intestinal program regulated by the master regulator Cdx2. We observed long-term functional engraftment of mouse colon by iHeps, thereby establishing their broader potential as endoderm progenitors and demonstrating direct conversion of fibroblasts into intestinal epithelium. Our studies illustrate how CellNet can be employed to improve direct conversion and to uncover unappreciated properties of engineered cells. PMID:25126792

  6. Algal Energy Conversion and Capture

    Science.gov (United States)

    Hazendonk, P.

    2015-12-01

    We address the potential for energy conversions and capture for: energy generation; reduction in energy use; reduction in greenhouse gas emissions; remediation of water and air pollution; protection and enhancement of soil fertility. These processes have the potential to sequester carbon at scales that may have global impact. Energy conversion and capture strategies evaluate energy use and production from agriculture, urban areas and industries, and apply existing and emerging technologies to reduce and recapture energy embedded in waste products. The basis of biocrude production from Micro-algal feedstocks: 1) The nutrients from the liquid fraction of waste streams are concentrated and fed into photo bioreactors (essentially large vessels in which microalgae are grown) along with CO2 from flue gasses from down stream processes. 2) The algae are processed to remove high value products such as proteins and beta-carotenes. The advantage of algae feedstocks is the high biomass productivity is 30-50 times that of land based crops and the remaining biomass contains minimal components that are difficult to convert to biocrude. 3) The remaining biomass undergoes hydrothermal liquefaction to produces biocrude and biochar. The flue gasses of this process can be used to produce electricity (fuel cell) and subsequently fed back into the photobioreactor. The thermal energy required for this process is small, hence readily obtained from solar-thermal sources, and furthermore no drying or preprocessing is required keeping the energy overhead extremely small. 4) The biocrude can be upgraded and refined as conventional crude oil, creating a range of liquid fuels. In principle this process can be applied on the farm scale to the municipal scale. Overall, our primary food production is too dependent on fossil fuels. Energy conversion and capture can make food production sustainable.

  7. Conversion of Semipalatinsk test site

    International Nuclear Information System (INIS)

    Cherepnin, Yu. S.

    1997-01-01

    The conversion of the former defense enterprises of STS (Semipalatinsk Test Sate) started under very difficult conditions, when not only research and production activity, but all social life of Kurchatov city were conversed which was caused by a fast curtailment and restationing of Russian military units from the test site. A real risk of a complete destruction of the whole research and production structure of the city existed. From this point of view, the decision of the Republic of Kazakhstan Government to create the National Nuclear Center on the base of the test site research enterprises was actual and timely. During 1993, three research institutes of NNC RK - Institute of Atomic Energy, Institute of Geophysics Research and Institute of Radiation Safety and Environment were established. This decision, under conditions of the Ussr disintegration and liquidation of the test site military divisions, allowed to preserve the qualified personnel, to provide and follow-up the operation of nuclear dangerous facilities, to develop and start the realization of the full scale conversion program.At present time, directions and structure of basic research work in NNC RK are as follows: - liquidation of nuclear explosions consequences; - liquidation of technological infrastructure used for preparation and conduction of nuclear weapon testing; - creation of technology, equipment and places for acceptance and storage of radioactive wastes; - working out of atomic energy development conception in Kazakhstan; - study of reactor core melt behavior under severe accidents in NPP; - development of methods and means of nuclear testing detection, continuous monitoring of nuclear explosions; - experimental work on a study of structure materials behavior of ITER thermonuclear reactor; - creation of industries requiring a lage implementation of science

  8. Natural gas conversion. Part VI

    International Nuclear Information System (INIS)

    Iglesia, E.; Spivey, J.J.; Fleisch, T.H.

    2001-01-01

    This volume contains peer-reviewed manuscripts describing the scientific and technological advances presented at the 6th Natural Gas Conversion Symposium held in Alaska in June 2001. This symposium continues the tradition of excellence and the status as the premier technical meeting in this area established by previous meetings. The 6th Natural Gas Conversion Symposium is conducted under the overall direction of the Organizing Committee. The Program Committee was responsible for the review, selection, editing of most of the manuscripts included in this volume. A standing International Advisory Board has ensured the effective long-term planning and the continuity and technical excellence of these meetings. The titles of the contributions are: Impact of syngas generation technology selection on a GTL FPSO; Methane conversion via microwave plasma initiated by a metal initiator; Mechanism of carbon deposit/removal in methane dry reforming on supported metal catalysts; Catalyst-assisted oxidative dehydrogenation of light paraffins in short contact time reactors; Catalytic dehydrogenation of propane over a PtSn/SiO 2 catalyst with oxygen addition: selective oxidation of H2 in the presence of hydrocarbons; Hydroconversion of a mixture of long chain n-paraffins to middle distillate: effect of the operating parameters and products properties; Decomposition/reformation processes and CH4 combustion activity of PdO over Al2O3 supported catalysts for gas turbine applications; Lurgi's mega-methanol technology opens the door for a new era in down-stream applications;Expanding markets for GTL fuels and specialty products; Some critical issues in the analysis of partial oxidation reactions in monolith reactors

  9. High temperature thermoelectric energy conversion

    International Nuclear Information System (INIS)

    Wood, C.

    1986-01-01

    Considerable advances were made in the late '50's and early early '60's in the theory and development of materials for high-temperature thermoelectric energy conversion. This early work culminated in a variety of materials, spanning a range of temperatures, with the product of the figure of merit, Z, and temperature, T, i.e., the dimensionless figure of merit, ZT, of the order of one. This experimental limitation appeared to be universal and led a number of investigators to explore the possibility that a ZT - also represents a theoretical limitation. It was found not to be so

  10. Responsive turns in Indonesian informal conversation

    Directory of Open Access Journals (Sweden)

    M.J. van Naerssen

    2015-04-01

    Full Text Available People have all sorts of expectations about how interlocutors will and should behave linguistically when engaged in a conversation. These conversational norms are usually implicit and are sometimes difficult to master in a language that is new to you. This paper presents a model of different types of responses in informal conversation, illustrated with Indonesian examples. It builds upon the conversation analytic notion of preference; distinguishing preferred – or constructive – responses and dispreferred – or competitive – responses. The model is meant as a tool to cross-linguistically compare response behaviour to gain insight in language specific expectations about interaction in informal conversation.

  11. Biomass thermochemical conversion program: 1987 annual report

    Energy Technology Data Exchange (ETDEWEB)

    Schiefelbein, G.F.; Stevens, D.J.; Gerber, M.A.

    1988-01-01

    The objective of the Biomass Thermochemical Conversion Program is to generate a base of scientific data and conversion process information that will lead to establishment of cost-effective processes for conversion of biomass resources into clean fuels. To accomplish this objective, in fiscal year 1987 the Thermochemical Conversion Program sponsored research activities in the following four areas: Liquid Hydrocarbon Fuels Technology; Gasification Technology; Direct Combustion Technology; Program Support Activities. In this report an overview of the Thermochemical Conversion Program is presented. Specific research projects are then described. Major accomplishments for 1987 are summarized.

  12. Biomass thermochemical conversion program. 1985 annual report

    Energy Technology Data Exchange (ETDEWEB)

    Schiefelbein, G.F.; Stevens, D.J.; Gerber, M.A.

    1986-01-01

    Wood and crop residues constitute a vast majority of the biomass feedstocks available for conversion, and thermochemical processes are well suited for conversion of these materials. The US Department of Energy (DOE) is sponsoring research on this conversion technology for renewable energy through its Biomass Thermochemical Conversion Program. The Program is part of DOE's Biofuels and Municipal Waste Technology Division, Office of Renewable Technologies. This report briefly describes the Thermochemical Conversion Program structure and summarizes the activities and major accomplishments during fiscal year 1985. 32 figs., 4 tabs.

  13. Electrophysiological correlates of grapheme-phoneme conversion.

    Science.gov (United States)

    Huang, Koongliang; Itoh, Kosuke; Suwazono, Shugo; Nakada, Tsutomu

    2004-08-19

    The cortical processes underlying grapheme-phoneme conversion were investigated by event-related potentials (ERPs). The task consisted of silent reading or vowel-matching of three Japanese hiragana characters, each representing a consonant-vowel syllable. At earlier latencies, typical components of the visual ERP, namely, P1 (110 ms), N1 (170 ms) and P2 (300 ms), were elicited in the temporo-occipital area for both tasks as well as control task (observing the orthographic shapes of three Korean characters). Following these earlier components, two sustained negativities were identified. The earlier sustained negativity, referred here to as SN1, was found in both the silent-reading and vowel-matching task but not in the control task. The scalp distribution of SN1 was over the left occipito-temporal area, with maximum amplitude over O1. The amplitude of SN1 was larger in the vowel-matching task compared to the silent-reading task, consistent with previous reports that ERP amplitude correlates with task difficulty. SN2, the later sustained negativity, was only observed in the vowel-matching task. The scalp distribution of SN2 was over the midsagittal centro-parietal area with maximum amplitude over Cz. Elicitation of SN2 in the vowel-matching task suggested that the vowel-matching task requires a wider range of neural activities exceeding the established conventional area of language processing.

  14. Gene Therapy

    Science.gov (United States)

    Gene therapy Overview Gene therapy involves altering the genes inside your body's cells in an effort to treat or stop disease. Genes contain your ... that don't work properly can cause disease. Gene therapy replaces a faulty gene or adds a new ...

  15. Overview of biomass conversion technologies

    International Nuclear Information System (INIS)

    Noor, S.; Latif, A.; Jan, M.

    2011-01-01

    A large part of the biomass is used for non-commercial purposes and mostly for cooking and heating, but the use is not sustainable, because it destroys soil-nutrients, causes indoor and outdoor pollution, adds to greenhouse gases, and results in health problems. Commercial use of biomass includes household fuelwood in industrialized countries and bio-char (charcoal) and firewood in urban and industrial areas in developing countries. The most efficient way of biomass utilization is through gasification, in which the gas produced by biomass gasification can either be used to generate power in an ordinary steam-cycle or be converted into motor fuel. In the latter case, there are two alternatives, namely, the synthesis of methanol and methanol-based motor fuels, or Fischer-Tropsch hydrocarbon synthesis. This paper deals with the technological overview of the state-of-the-art key biomass-conversion technologies that can play an important role in the future. The conversion routes for production of Heat, power and transportation fuel have been summarized in this paper, viz. combustion, gasification, pyrolysis, digestion, fermentation and extraction. (author)

  16. Bilingualism accentuates children's conversational understanding.

    Directory of Open Access Journals (Sweden)

    Michael Siegal

    Full Text Available BACKGROUND: Although bilingualism is prevalent throughout the world, little is known about the extent to which it influences children's conversational understanding. Our investigation involved children aged 3-6 years exposed to one or more of four major languages: English, German, Italian, and Japanese. In two experiments, we examined the children's ability to identify responses to questions as violations of conversational maxims (to be informative and avoid redundancy, to speak the truth, be relevant, and be polite. PRINCIPAL FINDINGS: In Experiment 1, with increasing age, children showed greater sensitivity to maxim violations. Children in Italy who were bilingual in German and Italian (with German as the dominant language L1 significantly outperformed Italian monolinguals. In Experiment 2, children in England who were bilingual in English and Japanese (with English as L1 significantly outperformed Japanese monolinguals in Japan with vocabulary age partialled out. CONCLUSIONS: As the monolingual and bilingual groups had a similar family SES background (Experiment 1 and similar family cultural identity (Experiment 2, these results point to a specific role for early bilingualism in accentuating children's developing ability to appreciate effective communicative responses.

  17. Electromagnetic wave energy conversion research

    Science.gov (United States)

    Bailey, R. L.; Callahan, P. S.

    1975-01-01

    Known electromagnetic wave absorbing structures found in nature were first studied for clues of how one might later design large area man-made radiant-electric converters. This led to the study of the electro-optics of insect dielectric antennae. Insights were achieved into how these antennae probably operate in the infrared 7-14um range. EWEC theoretical models and relevant cases were concisely formulated and justified for metal and dielectric absorber materials. Finding the electromagnetic field solutions to these models is a problem not yet solved. A rough estimate of losses in metal, solid dielectric, and hollow dielectric waveguides indicates future radiant-electric EWEC research should aim toward dielectric materials for maximum conversion efficiency. It was also found that the absorber bandwidth is a theoretical limitation on radiant-electric conversion efficiency. Ideally, the absorbers' wavelength would be centered on the irradiating spectrum and have the same bandwith as the irradiating wave. The EWEC concept appears to have a valid scientific basis, but considerable more research is needed before it is thoroughly understood, especially for the complex randomly polarized, wide band, phase incoherent spectrum of the sun. Specific recommended research areas are identified.

  18. Astrophysicists' conversational connections on Twitter.

    Directory of Open Access Journals (Sweden)

    Kim Holmberg

    Full Text Available Because Twitter and other social media are increasingly used for analyses based on altmetrics, this research sought to understand what contexts, affordance use, and social activities influence the tweeting behavior of astrophysicists. Thus, the presented study has been guided by three research questions that consider the influence of astrophysicists' activities (i.e., publishing and tweeting frequency and of their tweet construction and affordance use (i.e. use of hashtags, language, and emotions on the conversational connections they have on Twitter. We found that astrophysicists communicate with a variety of user types (e.g. colleagues, science communicators, other researchers, and educators and that in the ego networks of the astrophysicists clear groups consisting of users with different professional roles can be distinguished. Interestingly, the analysis of noun phrases and hashtags showed that when the astrophysicists address the different groups of very different professional composition they use very similar terminology, but that they do not talk to each other (i.e. mentioning other user names in tweets. The results also showed that in those areas of the ego networks that tweeted more the sentiment of the tweets tended to be closer to neutral, connecting frequent tweeting with information sharing activities rather than conversations or expressing opinions.

  19. Analog-to-digital conversion

    CERN Document Server

    Pelgrom, Marcel J. M

    2013-01-01

    This textbook is appropriate for use in graduate-level curricula in analog to digital conversion, as well as for practicing engineers in need of a state-of-the-art reference on data converters.  It discusses various analog-to-digital conversion principles, including sampling, quantization, reference generation, nyquist architectures and sigma-delta modulation.  This book presents an overview of the state-of-the-art in this field and focuses on issues of optimizing accuracy and speed, while reducing the power level. This new, second edition emphasizes novel calibration concepts, the specific requirements of new systems, the consequences of 45-nm technology and the need for a more statistical approach to accuracy.  Pedagogical enhancements to this edition include more than twice the exercises available in the first edition, solved examples to introduce all key, new concepts and warnings, remarks and hints, from a practitioner’s perspective, wherever appropriate.  Considerable background information and pr...

  20. [Neurology of hysteria (conversion disorder)].

    Science.gov (United States)

    Sonoo, Masahiro

    2014-07-01

    Hysteria has served as an important driving force in the development of both neurology and psychiatry. Jean Martin Charcot's devotion to mesmerism for treating hysterical patients evoked the invention of psychoanalysis by Sigmund Freud. Meanwhile, Joseph Babinski took over the challenge to discriminate between organic and hysterical patients from Charcot and found Babinski's sign, the greatest milestone in modern neurological symptomatology. Nowadays, the usage of the term hysteria is avoided. However, new terms and new classifications are complicated and inconsistent between the two representative taxonomies, the DSM-IV and ICD-10. In the ICD-10, even the alternative term conversion disorder, which was becoming familiar to neurologists, has also disappeared as a group name. The diagnosis of hysteria remains important in clinical neurology. Extensive exclusive diagnoses and over investigation, including various imaging studies, should be avoided because they may prolong the disease course and fix their symptoms. Psychological reasons that seem to explain the conversion are not considered reliable. Positive neurological signs suggesting nonorganic etiologies are the most reliable measures for diagnosing hysteria, as Babinski first argued. Hysterical paresis has several characteristics, such as giving-way weakness or peculiar distributions of weakness. Signs to uncover nonorganic paresis utilizing synergy include Hoover's test and the Sonoo abductor test.

  1. Light-voltage conversion apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Fujioka, Yoshiki

    1987-09-19

    In a light-voltage conversion unit, when input signal is applied, the output signal to the control circuit has quick rise-up time and slow breaking time. In order to improve this, a short-circuit transistor is placed at the diode, and this transistor is forced ON, when an output signal to the control circuit is lowered down to a constant voltage, to short-circuit between the output terminals. This, however, has a demerit of high power consumption by a transistor. In this invention, by connecting a light-emitting element which gets ON at the first transition and a light-emitting element which gets ON at the last transition, placing a light receiving element in front of each light-emitting element, when an input signal is applied; thus a load is driven only with ON signal of each light-emitting element, eliminating the delay in the last transition. All of these give a quick responsive light-voltage conversion without unnecessary power consumption. (5 figs)

  2. Integration through relatedness in the conversational model: a case study.

    Science.gov (United States)

    Haliburn, Joan

    2009-02-01

    The aim of this paper is to demonstrate the principles of the conversational model in two therapies with a patient, at 16 years of age and again 20 years later. Described is the first therapy of L, which commenced in hospital and continued twice weekly after discharge. L was an acutely disturbed 16-year-old female admitted for 4 months to the psychiatry ward, a dynamically oriented milieu of a University teaching hospital where I was training. This is followed by a brief description of L's second therapy. Supervision was through audiotape of sessions. At the conclusion of the first therapy, L was functioning well. Five years later, she married and had a child. She was referred to me again after she attempted suicide following an acute stressful event which resulted in hospitalization. She is more aware and reflective at present but continues to be vulnerable. Attention to certain aspects of the psychotherapeutic relationship is important as demonstrated in the conversational model.

  3. The conversational interface talking to smart devices

    CERN Document Server

    McTear, Michael; Griol, David

    2016-01-01

    This book provides a comprehensive introduction to the conversational interface, which is becoming the main mode of interaction with virtual personal assistants, smart devices, various types of wearables, and social robots. The book consists of four parts: Part I presents the background to conversational interfaces, examining past and present work on spoken language interaction with computers; Part II covers the various technologies that are required to build a conversational interface along with practical chapters and exercises using open source tools; Part III looks at interactions with smart devices, wearables, and robots, and then goes on to discusses the role of emotion and personality in the conversational interface; Part IV examines methods for evaluating conversational interfaces and discusses future directions. · Presents a comprehensive overview of the various technologies that underlie conversational user interfaces; · Combines descriptions of conversational user interface technologies with a gui...

  4. Biomass Thermochemical Conversion Program: 1986 annual report

    Energy Technology Data Exchange (ETDEWEB)

    Schiefelbein, G.F.; Stevens, D.J.; Gerber, M.A.

    1987-01-01

    Wood and crop residues constitute a vast majority of the biomass feedstocks available for conversion, and thermochemical processes are well suited for conversion of these materials. Thermochemical conversion processes can generate a variety of products such as gasoline hydrocarbon fuels, natural gas substitutes, or heat energy for electric power generation. The US Department of Energy is sponsoring research on biomass conversion technologies through its Biomass Thermochemical Conversion Program. Pacific Northwest Laboratory has been designated the Technical Field Management Office for the Biomass Thermochemical Conversion Program with overall responsibility for the Program. This report briefly describes the Thermochemical Conversion Program structure and summarizes the activities and major accomplishments during fiscal year 1986. 88 refs., 31 figs., 5 tabs.

  5. Event-by-Event Observables and Fluctuations

    International Nuclear Information System (INIS)

    Petersen, Hannah

    2013-01-01

    In this talk the status and open questions of the phenomenological description of all the stages of a heavy ion reaction are highlighted. Special emphasis is put on event-by-event fluctuations and associated observables. The first part is concentrated on high RHIC and LHC energies and the second part reviews the challenges for modeling heavy ion reactions at lower beam energies in a more realistic fashion. Overall, the main conclusion is that sophisticated theoretical dynamical approaches that describe many observables in the same framework are essential for the quantitative understanding of the properties of hot and dense nuclear matter

  6. Supercritical Carbon Dioxide Brayton Cycle Energy Conversion System

    Energy Technology Data Exchange (ETDEWEB)

    Cha, Jae Eun; Kim, S. O.; Seong, S. H.; Eoh, J. H.; Lee, T. H.; Choi, S. K.; Han, J. W.; Bae, S. W

    2007-12-15

    This report contains the description of the S-CO{sub 2} Brayton cycle coupled to KALIMER-600 as an alternative energy conversion system. For system development, a computer code was developed to calculate heat balance of 100% power operation condition. Based on the computer code, the S-CO{sub 2} Brayton cycle energy conversion system was constructed for the KALIMER-600. Using the developed turbomachinery models, the off-design characteristics and the sensitivities of the S-CO{sub 2} turbomachinery were investigated. For the development of PCHE models, a one-dimensional analysis computer code was developed to evaluate the performance of the PCHE. Possible control schemes for power control in the KALIMER-600 S-CO{sub 2} Brayton cycle were investigated by using the MARS code. Simple power reduction and recovery event was selected and analyzed for the transient calculation. For the evaluation of Na/CO{sub 2} boundary failure event, a computer was developed to simulate the complex thermodynamic behaviors coupled with the chemical reaction between liquid sodium and CO{sub 2} gas. The long term behavior of a Na/CO{sub 2} boundary failure event and its consequences which lead to a system pressure transient were evaluated.

  7. Supercritical Carbon Dioxide Brayton Cycle Energy Conversion System

    International Nuclear Information System (INIS)

    Cha, Jae Eun; Kim, S. O.; Seong, S. H.; Eoh, J. H.; Lee, T. H.; Choi, S. K.; Han, J. W.; Bae, S. W.

    2007-12-01

    This report contains the description of the S-CO 2 Brayton cycle coupled to KALIMER-600 as an alternative energy conversion system. For system development, a computer code was developed to calculate heat balance of 100% power operation condition. Based on the computer code, the S-CO 2 Brayton cycle energy conversion system was constructed for the KALIMER-600. Using the developed turbomachinery models, the off-design characteristics and the sensitivities of the S-CO 2 turbomachinery were investigated. For the development of PCHE models, a one-dimensional analysis computer code was developed to evaluate the performance of the PCHE. Possible control schemes for power control in the KALIMER-600 S-CO 2 Brayton cycle were investigated by using the MARS code. Simple power reduction and recovery event was selected and analyzed for the transient calculation. For the evaluation of Na/CO 2 boundary failure event, a computer was developed to simulate the complex thermodynamic behaviors coupled with the chemical reaction between liquid sodium and CO 2 gas. The long term behavior of a Na/CO 2 boundary failure event and its consequences which lead to a system pressure transient were evaluated

  8. Comparative analysis of Homo sapiens and Mus musculus cyclin-dependent kinase (CDK) inhibitor genes p16 (MTS1) and p15 (MTS2).

    Science.gov (United States)

    Jiang, P; Stone, S; Wagner, R; Wang, S; Dayananth, P; Kozak, C A; Wold, B; Kamb, A

    1995-12-01

    Cyclin-dependent kinase inhibitors are a growing family of molecules that regulate important transitions in the cell cycle. At least one of these molecules, p16, has been implicated in human tumorigenesis while its close homolog, p15, is induced by cell contact and transforming growth factor-beta (TGF-beta). To investigate the evolutionary and functional features of p15 and p16, we have isolated mouse (Mus musculus) homologs of each gene. Comparative analysis of these sequences provides evidence that the genes have similar functions in mouse and human. In addition, the comparison suggests that a gene conversion event is part of the evolution of the human p15 and p16 genes.

  9. Identifying jet quantum numbers event by event

    International Nuclear Information System (INIS)

    Teper, M.J.

    1979-12-01

    A method is proposed to identify the parton that gives rise to any particular jet. The method improves with the number of particles in the jet, and should indicate which of the jets in a three jet event at PETRA is the gluon jet. (author)

  10. Gastrointestinal symptoms among swimmers following rain events at a beach impacted by urban runoff

    Science.gov (United States)

    Gastrointestinal symptoms among swimmers following rain events at a beach impacted by urban runoff Timothy J. Wade, Reagan R. Converse, Elizabeth A. Sams, Ann H. Williams, Edward Hudgens, Alfred P. Dufour Gastrointestinal symptoms among swimmers have been associated with fecal ...

  11. Microturbine Power Conversion Technology Review

    Energy Technology Data Exchange (ETDEWEB)

    Staunton, R.H.

    2003-07-21

    In this study, the Oak Ridge National Laboratory (ORNL) is performing a technology review to assess the market for commercially available power electronic converters that can be used to connect microturbines to either the electric grid or local loads. The intent of the review is to facilitate an assessment of the present status of marketed power conversion technology to determine how versatile the designs are for potentially providing different services to the grid based on changes in market direction, new industry standards, and the critical needs of the local service provider. The project includes data gathering efforts and documentation of the state-of-the-art design approaches that are being used by microturbine manufacturers in their power conversion electronics development and refinement. This project task entails a review of power converters used in microturbines sized between 20 kW and 1 MW. The power converters permit microturbine generators, with their non-synchronous, high frequency output, to interface with the grid or local loads. The power converters produce 50- to 60-Hz power that can be used for local loads or, using interface electronics, synchronized for connection to the local feeder and/or microgrid. The power electronics enable operation in a stand-alone mode as a voltage source or in grid-connect mode as a current source. Some microturbines are designed to automatically switch between the two modes. The information obtained in this data gathering effort will provide a basis for determining how close the microturbine industry is to providing services such as voltage regulation, combined control of both voltage and current, fast/seamless mode transfers, enhanced reliability, reduced cost converters, reactive power supply, power quality, and other ancillary services. Some power quality improvements will require the addition of storage devices; therefore, the task should also determine what must be done to enable the power conversion circuits to

  12. Meta-analysis of gene expression signatures defining the epithelial to mesenchymal transition during cancer progression.

    Directory of Open Access Journals (Sweden)

    Christian J Gröger

    Full Text Available The epithelial to mesenchymal transition (EMT represents a crucial event during cancer progression and dissemination. EMT is the conversion of carcinoma cells from an epithelial to a mesenchymal phenotype that associates with a higher cell motility as well as enhanced chemoresistance and cancer stemness. Notably, EMT has been increasingly recognized as an early event of metastasis. Numerous gene expression studies (GES have been conducted to obtain transcriptome signatures and marker genes to understand the regulatory mechanisms underlying EMT. Yet, no meta-analysis considering the multitude of GES of EMT has been performed to comprehensively elaborate the core genes in this process. Here we report the meta-analysis of 18 independent and published GES of EMT which focused on different cell types and treatment modalities. Computational analysis revealed clustering of GES according to the type of treatment rather than to cell type. GES of EMT induced via transforming growth factor-β and tumor necrosis factor-α treatment yielded uniformly defined clusters while GES of models with alternative EMT induction clustered in a more complex fashion. In addition, we identified those up- and downregulated genes which were shared between the multitude of GES. This core gene list includes well known EMT markers as well as novel genes so far not described in this process. Furthermore, several genes of the EMT-core gene list significantly correlated with impaired pathological complete response in breast cancer patients. In conclusion, this meta-analysis provides a comprehensive survey of available EMT expression signatures and shows fundamental insights into the mechanisms that are governing carcinoma progression.

  13. Conversation Simulation and Sensible Surprises

    Science.gov (United States)

    Hutchens, Jason L.

    I have entered the Loebner Prize five times, winning the "most humanlike program" category in 1996 with a surly ELIZA-clone named HeX, but failed to repeat the performance in subsequent years with more sophisticated techniques. Whether this is indicative of an unanticipated improvement in "conversation simulation" technology, or whether it highlights the strengths of ELIZA-style trickery, is as an exercise for the reader. In 2000, I was invited to assume the role of Chief Scientist at Artificial Intelligence Ltd. (Ai) on a project inspired by the advice given by Alan Turing in the final section of his classic paper - our quest was to build a "child machine" that could learn and use language from scratch. In this chapter, I will discuss both of these experiences, presenting my thoughts regarding the Chinese Room argument and Artificial Intelligence (AI) in between.

  14. Fundamentals of thermophotovoltaic energy conversion

    CERN Document Server

    Chubb, Donald L

    2007-01-01

    This is a text book presenting the fundamentals of thermophotovoltaic(TPV) energy conversion suitable for an upper undergraduate or first year graduate course. In addition it can serve as a reference or design aid for engineers developing TPV systems. Mathematica design programs for interference filters and a planar TPV system are included on a CD-Rom disk. Each chapter includes a summary and concludes with a set of problems. The first chapter presents the electromagnetic theory and radiation transfer theory necessary to calculate the optical properties of the components in a TPV optical cavity. Using a simplified model, Chapter 2 develops expressions for the maximum efficiency and power density for an ideal TPV system. The next three chapters consider the three major components in a TPV system; the emitter, filter and photovoltaic(PV) array. Chapter 3 applies the electromagnetic theory and radiation transfer theory presented in Chapter 1 in the calculation of spectral emittance. From the spectral emittance t...

  15. Supported Conversation for hospital staff

    DEFF Research Database (Denmark)

    Forchhammer, Hysse B; Løvholt, Annelise P.; Mathiesen, Lone Lundbak

    in communication and interaction, Supported Conversation for Adults with Aphasia (SCA) was adapted and implemented in a large neurological department at Rigshospitalet-Glostrup in Copenhagen. Method 152 staff members representing different health professionals were assigned to one of eleven courses during a six...... month period. Each course had 10-12 participants and lasted 6 hours, including instruction in the SCA principles, video analysis, interdisciplinary group work, and practice sessions with PWAs. Self-assessed learning outcomes were evaluated with a brief questionnaire filled out by staff members...... in communication, also showed significant improvements across all staff groups. After the course, more time to spend with patients was perceived as the most important factor to further increase communication success with PWA. Conclusion The results show that interdisciplinary SCA-courses successfully increase...

  16. Conversation Analysis in Applied Linguistics

    DEFF Research Database (Denmark)

    Kasper, Gabriele; Wagner, Johannes

    2014-01-01

    on applied CA, the application of basic CA's principles, methods, and findings to the study of social domains and practices that are interactionally constituted. We consider three strands—foundational, social problem oriented, and institutional applied CA—before turning to recent developments in CA research...... on learning and development. In conclusion, we address some emerging themes in the relationship of CA and applied linguistics, including the role of multilingualism, standard social science methods as research objects, CA's potential for direct social intervention, and increasing efforts to complement CA......For the last decade, conversation analysis (CA) has increasingly contributed to several established fields in applied linguistics. In this article, we will discuss its methodological contributions. The article distinguishes between basic and applied CA. Basic CA is a sociological endeavor concerned...

  17. Tacit to explicit knowledge conversion.

    Science.gov (United States)

    Cairó Battistutti, Osvaldo; Bork, Dominik

    2017-11-01

    The ability to create, use and transfer knowledge may allow the creation or improvement of new products or services. But knowledge is often tacit: It lives in the minds of individuals, and therefore, it is difficult to transfer it to another person by means of the written word or verbal expression. This paper addresses this important problem by introducing a methodology, consisting of a four-step process that facilitates tacit to explicit knowledge conversion. The methodology utilizes conceptual modeling, thus enabling understanding and reasoning through visual knowledge representation. This implies the possibility of understanding concepts and ideas, visualized through conceptual models, without using linguistic or algebraic means. The proposed methodology is conducted in a metamodel-based tool environment whose aim is efficient application and ease of use.

  18. Conversion of Ulba Metallurgy Plant

    International Nuclear Information System (INIS)

    Onoprienko, O.

    1996-01-01

    General Information 'Ulba Metallurgical plant' Joint Stock Company successfully operates for more than 46 years. The plant was established by MINSREDMASH, USSR and at the present moment has finished complexes for production of nuclear fuel for atomic power stations, tantalum and superconducting materials production, beryllium, hydrofluoric acid manufacture and engineering production. Problem Essence In spite of the monopoly possession of tantalum manufacture, beryllium and uranium fuel, superconducting materials in Commonwealth of Independent States countries, company has serious financial problems due to the critical situation in Commonwealth of Independent States countries, production ties collapse and fast market demand decrease for the Ulba Metallurgical Plant Joint Stock Company products. The alternative decision is to create substitute productions, conversion integrating and introducing new products to the world market

  19. A Map Enters the Conversation

    DEFF Research Database (Denmark)

    Munk, Anders Kristian

    Over the past decade STS scholars have been engaged in a continuous dialogue about the performativity of their methods and the interventions of their research practices. A frequently posed question is how STS can make a difference to its fields of study, what John Law has called its different...... 'modes of mattering'. In this paper I explore what difference digital cartography can make to STS practice. I draw on three examples from my own work where digitally mediated maps have entered the conversation and made critical, often surprising, differences to the research process. In my first example...... the map is brought along as an ethnographic device on a piece of fieldwork, in my second example it serves as the central collaborative object in a participatory design project, and in my third example the map becomes the object of contestation as it finds itself centre stage in the controversy...

  20. Soundscapes, events, resistance

    Directory of Open Access Journals (Sweden)

    Andrea Mubi Brighenti

    2008-12-01

    Full Text Available Put it bluntly, a soundscape is the sonic counterpart, or component, of landscape. From such minimal assumption, some interesting consequences follow: just as landscape is far from being a simple stage-set upon which events take place, soundscape, too, is itself evental, i.e., it consists of events. Not only because its nature, far from being acoustics is always ‘psychoacoustics’, as Murray Schafer (1977/1994 first argued. Processes of environmental perception are of course there.

  1. Power conversion unit for the South African direct cycle HTGR

    International Nuclear Information System (INIS)

    Liebenberg, J.J.

    1997-01-01

    The system parameters chosen to optimise the thermal efficiency of the Eskom PBMR whilst maintaining component simplicity is discussed. Power Conversion Unit components, which are now at a preliminary design stage comprise a precooler, two turbo units consisting of a turbine driven compressor, recuperator and a power turbine, driving an alternator. Design aspects of every component is mentioned and the inventory method of poorer control is explained with reference to start-up and and shut-down events, the system an effective load following device, down to 4% of full power. Application of the same design principles for HTGRs smaller than 25 MWe is discussed. (author)

  2. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis

    Science.gov (United States)

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928

  3. Features, Events, and Processes: Disruptive Events

    International Nuclear Information System (INIS)

    J. King

    2004-01-01

    The primary purpose of this analysis is to evaluate seismic- and igneous-related features, events, and processes (FEPs). These FEPs represent areas of natural system processes that have the potential to produce disruptive events (DE) that could impact repository performance and are related to the geologic processes of tectonism, structural deformation, seismicity, and igneous activity. Collectively, they are referred to as the DE FEPs. This evaluation determines which of the DE FEPs are excluded from modeling used to support the total system performance assessment for license application (TSPA-LA). The evaluation is based on the data and results presented in supporting analysis reports, model reports, technical information, or corroborative documents that are cited in the individual FEP discussions in Section 6.2 of this analysis report

  4. Features, Events, and Processes: Disruptive Events

    Energy Technology Data Exchange (ETDEWEB)

    J. King

    2004-03-31

    The primary purpose of this analysis is to evaluate seismic- and igneous-related features, events, and processes (FEPs). These FEPs represent areas of natural system processes that have the potential to produce disruptive events (DE) that could impact repository performance and are related to the geologic processes of tectonism, structural deformation, seismicity, and igneous activity. Collectively, they are referred to as the DE FEPs. This evaluation determines which of the DE FEPs are excluded from modeling used to support the total system performance assessment for license application (TSPA-LA). The evaluation is based on the data and results presented in supporting analysis reports, model reports, technical information, or corroborative documents that are cited in the individual FEP discussions in Section 6.2 of this analysis report.

  5. Stressful life events are not associated with the development of dementia

    OpenAIRE

    Sundstr?m, Anna; R?nnlund, Michael; Adolfsson, Rolf; Nilsson, Lars-G?ran

    2014-01-01

    Background: The impact of stressful life events as a risk factor of dementia diseases is inconclusive. We sought to determine whether stressful negative life events are associated with incidental dementia in a population-based study with long-term follow-up. We also tested the hypothesis that the occurrence of positive life events could mitigate or overcome the possible adverse effects of negative life events on dementia conversion. Methods: The study involved 2,462 dementia-free participants...

  6. Safeguards summary event list (SSEL)

    International Nuclear Information System (INIS)

    Davidson, J.J.; MacMurdy, P.H.

    1980-12-01

    The List contains nine categories of events involving NRC licensed material or licensees. It is deliberately broad in scope for two main reasons. First, the list is designed to serve as a reference document. It is as complete and accurate as possible. Second, the list is intended to provide as broad a perspective of the nature of licensee-related events as possible. The nine categories of events are as follows: bomb-related events; intrusion events; missing and/or allegedly stolen events; transportation-related events; vandalism events; arson events; firearms-related events; sabotage events; and miscellaneous events

  7. Features, Events, and Processes: Disruptive Events

    Energy Technology Data Exchange (ETDEWEB)

    P. Sanchez

    2004-11-08

    The purpose of this analysis report is to evaluate and document the inclusion or exclusion of the disruptive events features, events, and processes (FEPs) with respect to modeling used to support the total system performance assessment for license application (TSPA-LA). A screening decision, either ''Included'' or ''Excluded,'' is given for each FEP, along with the technical basis for screening decisions. This information is required by the U.S. Nuclear Regulatory Commission (NRC) at 10 CFR 63.114 (d), (e), and (f) [DIRS 156605]. The FEPs addressed in this report deal with both seismic and igneous disruptive events, such as fault displacements through the repository and an igneous intrusion into the repository. For included FEPs, this analysis summarizes the implementation of the FEP in TSPA-LA (i.e., how the FEP is included). For excluded FEPs, this analysis provides the technical basis for exclusion from TSPA-LA (i.e., why the FEP is excluded). Previous versions of this report were developed to support the total system performance assessments (TSPA) for various prior repository designs. This revision addresses the repository design for the license application (LA).

  8. Features, Events, and Processes: Disruptive Events

    International Nuclear Information System (INIS)

    P. Sanchez

    2004-01-01

    The purpose of this analysis report is to evaluate and document the inclusion or exclusion of the disruptive events features, events, and processes (FEPs) with respect to modeling used to support the total system performance assessment for license application (TSPA-LA). A screening decision, either ''Included'' or ''Excluded,'' is given for each FEP, along with the technical basis for screening decisions. This information is required by the U.S. Nuclear Regulatory Commission (NRC) at 10 CFR 63.114 (d), (e), and (f) [DIRS 156605]. The FEPs addressed in this report deal with both seismic and igneous disruptive events, such as fault displacements through the repository and an igneous intrusion into the repository. For included FEPs, this analysis summarizes the implementation of the FEP in TSPA-LA (i.e., how the FEP is included). For excluded FEPs, this analysis provides the technical basis for exclusion from TSPA-LA (i.e., why the FEP is excluded). Previous versions of this report were developed to support the total system performance assessments (TSPA) for various prior repository designs. This revision addresses the repository design for the license application (LA)

  9. Conversion of autoimmune hypothyroidism to hyperthyroidism

    OpenAIRE

    Furqan, Saira; Haque, Naeem-ul; Islam, Najmul

    2014-01-01

    Background Graves’ disease and Hashimoto’s thyroiditis are the two autoimmune spectrum of thyroid disease. Cases of conversion from hyperthyroidism to hypothyroidism have been reported but conversion from hypothyroidism to hyperthyroidism is very rare. Although such cases have been reported rarely in the past we are now seeing such conversions from hypothyroidism to hyperthyroidism more frequently in clinical practice. Case presentation We are reporting three cases of middle aged Asian female...

  10. Human Performance Event Database

    International Nuclear Information System (INIS)

    Trager, E. A.

    1998-01-01

    The purpose of this paper is to describe several aspects of a Human Performance Event Database (HPED) that is being developed by the Nuclear Regulatory Commission. These include the background, the database structure and basis for the structure, the process for coding and entering event records, the results of preliminary analyses of information in the database, and plans for the future. In 1992, the Office for Analysis and Evaluation of Operational Data (AEOD) within the NRC decided to develop a database for information on human performance during operating events. The database was needed to help classify and categorize the information to help feedback operating experience information to licensees and others. An NRC interoffice working group prepared a list of human performance information that should be reported for events and the list was based on the Human Performance Investigation Process (HPIP) that had been developed by the NRC as an aid in investigating events. The structure of the HPED was based on that list. The HPED currently includes data on events described in augmented inspection team (AIT) and incident investigation team (IIT) reports from 1990 through 1996, AEOD human performance studies from 1990 through 1993, recent NRR special team inspections, and licensee event reports (LERs) that were prepared for the events. (author)

  11. The Agency of Event

    DEFF Research Database (Denmark)

    Nicholas, Paul; Tamke, Martin; Riiber, Jacob

    2014-01-01

    This paper explores the notion of agency within event-based models. We present an event-based modeling approach that links interdependent generative, analytic and decision making sub-models within a system of exchange. Two case study projects demonstrate the underlying modeling concepts and metho...

  12. Intermediate mass dimuon events

    International Nuclear Information System (INIS)

    Moser, H.-G.

    1985-01-01

    We report the observation of 67 dimuon events at the CERN p anti p collider with the UA1 detector. The events will be interpreted in terms of the Drell-Yan mechanism, J/PSI and UPSILON decays and heavy flavour production. (author)

  13. The Blayais event

    International Nuclear Information System (INIS)

    2000-01-01

    This document provides the main events occurred to the Blayais installation during the year 2000. For each events, the detailed chronology, the situation analysis, the crisis management and the public information are provided. Some recommendations are also provided by the nuclear safety authorities. (A.L.B.)

  14. U.S. Domestic Reactor Conversion Programs

    International Nuclear Information System (INIS)

    Woolstenhulme, Eric

    2008-01-01

    The Conversion Projects Include: the revision of the facilities safety basis documents and supporting analysis, the fabrication of new LEU fuel, the change-out of the reactor core, and the removal of the used HEU fuel (by INL University Fuels Program or DOE-NE). The major entities involved are: the U.S. Nuclear Regulatory Commission, the University reactor department, the fuel and hardware fabricators, the Spent fuel receipt facilities, the Spent fuel shipping services, and the U.S. Department of Energy and their subcontractors. Three major Reactor Conversion Program milestones have been accomplished since 2006: the conversion of the TRIGA reactor at Texas A and M University Nuclear Science Center, the conversion of the University of Florida Training Reactor, and the conversion of the Purdue University Reactor. Four Reactor Conversion Program milestones yet to be accomplished in 2008 and 2009: the Washington State University Nuclear Radiation Center reactor, the Oregon State University TRIGA Reactor, the University of Wisconsin Nuclear Reactor, and the Neutron Radiography Reactor Facility. NNSA is committed to doing things cheaper, better, smarter, safer through a 'Lessons Learned' process. The conversion team assessed each major activity grouping: Project Initiation, Conversion Proposal Development, Fuel Fabrication and Hardware, Core Conversion, and Spent Nuclear Fuel Removal. Issues were identified and recommendations were given

  15. Neurologists' understanding and management of conversion disorder.

    Science.gov (United States)

    Kanaan, Richard A; Armstrong, David; Wessely, Simon Charles

    2011-09-01

    Conversion disorder is largely managed by neurologists, for whom it presents great challenges to understanding and management. This study aimed to quantify these challenges, examining how neurologists understand conversion disorder, and what they tell their patients. A postal survey of all consultant neurologists in the UK registered with the Association of British Neurologists. 349 of 591 practising consultant neurologists completed the survey. They saw conversion disorder commonly. While they endorsed psychological models for conversion, they diagnosed it according to features of the clinical presentation, most importantly inconsistency and abnormal illness behaviour. Most of the respondents saw feigning as entangled with conversion disorder, with a minority seeing one as a variant of the other. They were quite willing to discuss psychological factors as long as the patient was receptive but were generally unwilling to discuss feigning even though they saw it as their responsibility. Those who favoured models in terms of feigning were older, while younger, female neurologists preferred psychological models, believed conversion would one day be understood neurologically and found communicating with their conversion patients easier than it had been in the past. Neurologists accept psychological models for conversion disorder but do not employ them in their diagnosis; they do not see conversion as clearly different from feigning. This may be changing as younger, female neurologists endorse psychological views more clearly and find it easier to discuss with their patients.

  16. Conversational Agents in E-Learning

    Science.gov (United States)

    Kerry, Alice; Ellis, Richard; Bull, Susan

    This paper discusses the use of natural language or 'conversational' agents in e-learning environments. We describe and contrast the various applications of conversational agent technology represented in the e-learning literature, including tutors, learning companions, language practice and systems to encourage reflection. We offer two more detailed examples of conversational agents, one which provides learning support, and the other support for self-assessment. Issues and challenges for developers of conversational agent systems for e-learning are identified and discussed.

  17. Single conversion stage amplifier - SICAM

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.

    2005-12-15

    This Ph.D. thesis presents a thorough analysis of the so called SICAM - SIngle Converter stage AMplifier approach to building direct energy conversion audio power amplifiers. The mainstream approach for building isolated audio power amplifiers today consists of isolated DC power supply and Class D amplifier, which essentially represents a two stage solution, where each of the components can be viewed as separate and independent part. The proposed SICAM solution strives for direct energy conversion from the mains to the audio output, by dedicating the operation of the components one to another and integrating their functions, so that the final audio power amplifier represents a single-stage topology with higher efficiency, lower volume, less board space, lower component count and subsequently lower cost. The SICAM approach is both applicable to non-isolated and isolated audio power amplifiers, but the problems encountered in these two cases are different. Non-isolated SICAM solutions are intended for both AC mains-connected and battery-powered devices. In non-isolated mains-connected SICAMs the main idea is to simplify the power supply or even provide integrated power factor correction (PFC) functions, while still maintaining low component stress and good audio performance by generally decreasing the input voltage level to the Class D audio power amplifier. On the other hand, non-isolated battery-powered SICAMs have to cope with the ever changing battery voltage and provide output voltage levels which are both lower and higher than the battery voltage, while still being simple and single-stage energy conversion solutions. In isolated SICAMs the isolation transformer adjusts the voltage level on the secondary side to the desired level, so the main challenges here are decreasing the size of the magnetic core and reducing the number and size of bulky reactive components as much as possible. The main focus of this thesis is directed towards the isolated SICAMs and

  18. Developing a safety report for an existing conversion facility

    International Nuclear Information System (INIS)

    Carisse, Hess

    2013-01-01

    A review of the process used to meet the regulatory requirements for a Safety Report at an existing conversion facility is described. This paper will cover the establishment of the regulatory criteria, selection of appropriate methodologies, identification of events and modeling of credible events. Once established there is on-going maintenance to deal with design changes and the need for periodic reviews will also be discussed. Challenges in dealing with the various phases, including incorporation of historical licensing documents, and lessons learned are presented. Of specific interest is the failure of the selected methodology to deal with infrastructure issues. One aspect of lessons learned that will be explored is the lack of an available mechanism for sharing information with similar fuel cycle facilities which is compounded by the fact that there are a small number of fuel cycle facilities compared to nuclear power plants. Possible approaches to dealing with this issue are also discussed. (authors)

  19. Electronuclear conversion of fertile to fissile material

    International Nuclear Information System (INIS)

    Van Atta, C.M.; Lee, J.D.; Heckrotte, W.

    1976-01-01

    The electronuclear conversion of fertile to fissile material by accelerator-produced neutrons is discussed. Experimental and theoretical results obtained in the MTA program (1949--1954) on the production of low-energy (less than 20-MeV) neutrons by high-energy proton, deuteron, and neutron bombardment of target materials are briefly reviewed. More recent calculations of the cascade process, by which the low-energy neutrons are produced, are discussed. A system is described by which 500- to 600-MeV deuterons incident on a lithium primary target can be converted to high-energy neutrons, which can be multiplied by spallation cascades and nuclear excitation to produce low-energy neutrons in a depleted-uranium or thorium secondary target. Fission events producing heat and additional neutrons are produced. The evaporation and fission neutrons would be captured, and fissile material would be produced. The production rates for 239 Pu and 233 U are estimated for 0.25-A and 0.375-A deuteron beams from an Alvarez linac. The capital and operating costs are estimated, and the resulting costs of fissile materials are calculated. The cost of generating power in reactors using the fissile material so produced as make-up fuel is also estimated. The energy multiplication (power generated in reactors so fueled/power consumed by the accelerator) ranges from about 10 to about 50 depending upon the make-up of the secondary target; depleted uranium, thorium, or a combination of the two. An experimental and theoretical program to facilitate optimization of the parameters of a production installation is described. 13 figures, 14 tables

  20. Conversations with Holocaust survivor residents.

    Science.gov (United States)

    Hirst, Sandra P; LeNavenec, Carole Lynne; Aldiabat, Khaldoun

    2011-03-01

    Traumatic events in one's younger years can have an impact on how an individual copes with later life. One traumatic experience for Jewish individuals was the Holocaust. Some of these people are moving into long-term care facilities. It was within this context that the research question emerged: What are Holocaust survivor residents' perceptions of a life lived as they move into a long-term care facility? For this qualitative study, Holocaust survivors were individually interviewed. Findings emphasize that nursing care needs to ensure that Holocaust survivor residents participate in activities, receive timely health care, and receive recognition of their life experiences. Copyright 2011, SLACK Incorporated.

  1. NASA thermionic-conversion program

    International Nuclear Information System (INIS)

    Morris, J.F.

    1977-01-01

    NASA's program for applied research and technology (ART) in thermionic energy conversion (TEC) has made worthwhile contributions in a relatively short time: Many of these accomplishments are incremental, yet important. And their integration has yielded gains in performance as well as in the knowledge necessary to point productive directions for future work. Both promise and problems derive from the degrees of freedom allowed by the current programmatic emphasis on out-of-core thermionics. Materials and designs previously prohibited by in-core nucleonics and geometries now offer new potentialities. But as a result a major TEC-ART responsibility is the efficient reduction of the glitter of diverse possibilities to the hard glint of reality. As always high-temperature material effects are crucial to the level and duration of TEC performance: New electrodes must increase and maintain power output regardless of emitter-vapor deposition on collectors. They must also serve compatibly with hot-shell alloys. And while space TEC must face high-temperature vaporization problems externally as well as internally, terrestrial TEC must tolerate hot corrosive atmospheres outside and near-vacuum inside. Furthermore, some modes for decreasing interelectrode losses appear to require rather demanding converter geometries to produce practical power densities. In these areas and others significant progress is being made in the NASA TEC-ART Program

  2. Phase conversion for fusion lasers

    International Nuclear Information System (INIS)

    Kessler, T.; Castle, W.; Sampat, N.; Skupsky, S.; Smith, D.; Swales, S.

    1988-01-01

    An essential requirement for direct drive laser fusion is the uniform irradiation of spherical targets that are located in the quasi-far field of a laser system. A major impediment to irradiation uniformity with high-power solid-state laser systems is the presence of a hot-spot structure at the target plane. The hot-spot intensity nonuniformities are caused by spatial variations in the near-field phase front of each laser beam. Although for many tabletop applications diffraction-limited laser performance can be obtained through static phase correction, adaptive optics, or phase conjugation, such approaches are either excessively expensive, difficult to implement, or not yet available for large-aperture, high-peak-power laser beams. An alternative to phase correcting a wavefront involves modifying the laser beam's coherence properties thereby changing its focusing characteristics. The method of induced spatial incoherence (ISI) involves a reduction in both spatial and temporal coherence. Other methods are based on modifications of only the spatial coherence of a laser beam. A phase conversion technology which incorporates a distribution of near-field phases to either perform static phase correction or induce spatial incoherence offers a route toward increasingly higher levels of irradiation uniformity

  3. Energy Conversion Alternatives Study (ECAS)

    Science.gov (United States)

    1977-01-01

    ECAS compared various advanced energy conversion systems that can use coal or coal-derived fuels for baseload electric power generation. It was conducted in two phases. Phase 1 consisted of parametric studies. From these results, 11 concepts were selected for further study in Phase 2. For each of the Phase 2 systems and a common set of ground rules, performance, cost, environmental intrusion, and natural resource requirements were estimated. In addition, the contractors defined the state of the associated technology, identified the advances required, prepared preliminary research and development plans, and assessed other factors that would affect the implementation of each type of powerplant. The systems studied in Phase 2 include steam systems with atmospheric- and pressurized-fluidized-bed boilers; combined cycle gas turbine/steam systems with integrated gasifiers or fired by a semiclean, coal derived fuel; a potassium/steam system with a pressurized-fluidized-bed boiler; a closed-cycle gas turbine/organic system with a high-temperature, atmospheric-fluidized-bed furnace; a direct-coal-fired, open- cycle magnetohydrodynamic/steam system; and a molten-carbonate fuel cell/steam system with an integrated gasifier. The sensitivity of the results to changes in the ground rules and the impact of uncertainties in capital cost estimates were also examined.

  4. Tropospheric effects of energy conversion

    International Nuclear Information System (INIS)

    Derwent, R.G.

    1992-01-01

    The tropospheric concentrations of a number of trace gases are increasing due to man's activities. For some trace gases, their atmospheric life cycles are not fully understood and it is difficult to be certain about the role of man's activities. Emissions from the energy industries and energy conversion processes represent an important subset of source terms in these life cycles, along with agriculture, deforestation, cement manufacture, biomass burning, process industries and natural biospheric processes. Global Warming Potentials (GWPs) allow the tropospheric effects of a range of climate forcing trace gases to be assessed on a comparable basis. If a short term view of the commitment to global warming is adopted then the contribution from other trace gases may approach and exceed that of carbon dioxide, itself. Over longer time horizons, the long atmospheric lifetime of carbon dioxide shows through as a major influence and the contributions from the other trace gases appear to be much smaller, representing an additional 13-18% contribution on top of that from CO 2 itself

  5. Energy conversion in polyelectrolyte hydrogels

    Science.gov (United States)

    Olvera de La Cruz, Monica; Erbas, Aykut; Olvera de la Cruz Team

    Energy conversion and storage have been an active field of research in nanotechnology parallel to recent interests towards renewable energy. Polyelectrolyte (PE) hydrogels have attracted considerable attention in this field due to their mechanical flexibility and stimuli-responsive properties. Ideally, when a hydrogel is deformed, applied mechanical work can be converted into electrostatic, elastic and steric-interaction energies. In this talk, we discuss the results of our extensive molecular dynamics simulations of PE hydrogels. We demonstrate that, on deformation, hydrogels adjust their deformed state predominantly by altering electrostatic interactions between their charged groups rather than excluded-volume and bond energies. This is due to the hydrogel's inherent tendency to preserve electro-neutrality in its interior, in combination with correlations imposed by backbone charges. Our findings are valid for a wide range of compression ratios and ionic strengths. The electrostatic-energy alterations that we observe in our MD simulations may induce pH or redox-potential changes inside the hydrogels. The resulting energetic difference can be harvested, for instance, analogously to a Carnot engine, or facilitated for sensor applications. Center for Bio-inspired Energy Science (CBES).

  6. Ocean thermal-energy conversion

    Energy Technology Data Exchange (ETDEWEB)

    Ford, G; Niblett, C; Walker, L

    1983-03-01

    Ocean thermal-energy conversion (OTEC) is a novel 'alternative' energy technology that has created much interest in a number of countries; namely, the USA, Japan, France, Sweden, Holland, India and most recently, the UK. In particular, the first three of these have had programmes to develop the required technology. However, most interest has been centred in the USA, where the current hiatus in Federal funding provides a timely opportunity to assess progress. This paper offers a survey of the prevailing position there; outlining the outstanding technical and associated problems, and likely future developments. Non-USA programmes are only mentioned to contrast them with the American position. At present, it does not appear that OTEC plants will be commercially viable on a widespread basis even in the tropics. This is particularly true of the larger plants (400 MWe, MWe = megawatts of electrical energy, the final output of a power station) towards which the American programme is ultimately geared. There does seem to be a strong possibility that small OTEC plants, around 40 MWe or less, can be commercial in certain circumstances. This would be possible when one or, preferably, more of the following conditions are met: (i) where a land-based rather than 'at sea' plant is possible, (ii) where alternative energy supplies are at a premium, i.e. islands or regions without indigenous energy supplies, and (iii) where conditions are such that an OTEC plant could operate in conjunction with either or both an aquaculture or desalination plant.

  7. Catalytic conversion of light alkanes

    Energy Technology Data Exchange (ETDEWEB)

    Lyons, J.E.

    1992-06-30

    The second Quarterly Report of 1992 on the Catalytic Conversion of Light Alkanes reviews the work done between April 1, 1992 and June 31, 1992 on the Cooperative Agreement. The mission of this work is to devise a new catalyst which can be used in a simple economic process to convert the light alkanes in natural gas to oxygenate products that can either be used as clean-burning, high octane liquid fuels, as fuel components or as precursors to liquid hydrocarbon uwspomdon fuel. During the past quarter we have continued to design, prepare, characterize and test novel catalysts for the mild selective reaction of light hydrocarbons with air or oxygen to produce alcohols directly. These catalysts are designed to form active metal oxo (MO) species and to be uniquely active for the homolytic cleavage of the carbon-hydrogen bonds in light alkanes producing intermediates which can form alcohols. We continue to investigate three molecular environments for the active catalytic species that we are trying to generate: electron-deficient macrocycles (PHASE I), polyoxometallates (PHASE II), and regular oxidic lattices including zeolites and related structures as well as other molecular surface structures having metal oxo groups (PHASE I).

  8. Analog-to-digital conversion

    CERN Document Server

    Pelgrom, Marcel J M

    2010-01-01

    The design of an analog-to-digital converter or digital-to-analog converter is one of the most fascinating tasks in micro-electronics. In a converter the analog world with all its intricacies meets the realm of the formal digital abstraction. Both disciplines must be understood for an optimum conversion solution. In a converter also system challenges meet technology opportunities. Modern systems rely on analog-to-digital converters as an essential part of the complex chain to access the physical world. And processors need the ultimate performance of digital-to-analog converters to present the results of their complex algorithms. The same progress in CMOS technology that enables these VLSI digital systems creates new challenges for analog-to-digital converters: lower signal swings, less power and variability issues. Last but not least, the analog-to-digital converter must follow the cost reduction trend. These changing boundary conditions require micro-electronics engineers to consider their design choices for...

  9. Overcoming difficult conversations in clinical supervision

    Directory of Open Access Journals (Sweden)

    Williams B

    2016-06-01

    Full Text Available Brett Williams,1 Christine King,1 Tanya Edlington,21Department of Community Emergency Health and Paramedic Practice, Monash University, Franskton, VIC, 2The Conversation Clinic Pty Ltd, Melbourne, VIC, Australia Background: Clinical supervisors are responsible for managing many facets of clinical learning and face a range of challenges when the need for "difficult" conversations arises, including the need to manage conflict and relationships. Methods: Spotlight on Conversations Workshop was developed to improve the capacity of clinical supervisors to engage in difficult conversations. They were designed to challenge the mindset of clinical supervisors about difficult conversations with students, the consequences of avoiding difficult conversations, and to offer activities for practicing difficult conversations. Preworkshop, postworkshop, and 4-month follow-up evaluations assessed improvements in knowledge, intent to improve, and confidence along with workshop satisfaction. Results: Nine workshops were delivered in a range of locations across Victoria, Australia, involving a total of 117 clinical supervisors. Preworkshop evaluations illustrated that more than half of the participants had avoided up to two difficult conversations in the last month in their workplace. Postworkshop evaluation at 4 months showed very high levels of satisfaction with the workshop's relevancy, content, and training, as well as participants' intention to apply knowledge and skills. Also shown were significant changes in participants' confidence to have difficult conversations not only with students but also with other peers and colleagues. In follow-up in-depth interviews with 20 of the 117 participants, 75% said they had made definite changes in their practice because of what they learned in the workshop and another 10% said they would make changes to their practice, but had not had the opportunity yet to do so. Conclusion: We conclude that the Spotlight on

  10. SYNTHESIS, THERMAL STUDIES AND CONVERSION DEGREE OF DIMETHACRYLATE POLYMERS USING NEW NON-TOXIC COINITIATORS

    Directory of Open Access Journals (Sweden)

    Rafael Turra Alarcon

    Full Text Available The aim of this paper is to replace toxic coinitiators (tertiary amines by non-toxic compounds such as glycerol and inositol (polyalcohol in dimethacrylate resins. For this purpose, mid infrared spectroscopy (MIR was used to calculate the monomers' degree of conversion (%DC; as well as simultaneous Thermogravimetric Analysis – Differential Thermal Analysis (TGA-DTA and Differential Scanning Calorimetry (DSC were conducted to evaluate thermal stability, degradation steps, and thermal events. The use of different initiator systems did not modify the thermal events or the thermal stability of each of the dimethacrylate resins. Results show a substitution of system 2 (toxicity by system 3 (low toxicity, which had a good conversion velocity and total conversion in some monomers, is plausible.

  11. The Conversion of Wiswesser Line Notations to Ring Codes. I. The Conversion of Ring Systems

    Science.gov (United States)

    Granito, Charles E.; And Others

    1972-01-01

    The computerized conversion of Wiswesser Line Notations to Ring Codes, using a two-part approach, and the set of computer programs generated for the conversion of ring systems are described. (9 references) (Author)

  12. Discourse analysis: Conversational analysis of the internal conversation in Oracle Corporation Malaysia

    Directory of Open Access Journals (Sweden)

    Marwa Marwa

    2017-07-01

    Full Text Available This study highlights the internal conversation which takes place in Oracle CorporationMalaysia. Through the study, it will be shown how conversational analysis is used toanalyze the transcription of a telephone conversation between Oracle staffs. The analysisof the transcriptions will apply a few basic concepts of conversational analysis; turntakingorganization, and the adjacency pair. The objective of the study is to find out howthe internal conversations takes place by focusing on the conversation itself, that is, theconversational structures spontaneously produced by people during talk ranging fromturn-taking strategies, how topics are introduced, conversation closings and so on. Bylooking in detail at such talk, we can gain a detailed understanding of how the staffs seethemselves in relation to the company that influence their daily lives.Keywords: conversational analysis, turn-taking, adjacency pairs

  13. Role of key-regulator genes in melanoma susceptibility and pathogenesis among patients from South Italy

    International Nuclear Information System (INIS)

    Casula, Milena; Sini, MariaCristina; Palomba, Grazia; The Italian Melanoma Intergroup; Palmieri, Giuseppe; Muggiano, Antonio; Cossu, Antonio; Budroni, Mario; Caracò, Corrado; Ascierto, Paolo A; Pagani, Elena; Stanganelli, Ignazio; Canzanella, Sergio

    2009-01-01

    Several genetic alterations have been demonstrated to contribute to the development and progression of melanoma. In this study, we further investigated the impact of key-regulator genes in susceptibility and pathogenesis of such a disease. A large series (N = 846) of sporadic and familial cases originating from South Italy was screened for germline mutations in p16 CDKN2A , BRCA2, and MC1R genes by DHPLC analysis and automated DNA sequencing. Paired primary melanomas and lymph node metastases from same patients (N = 35) as well as melanoma cell lines (N = 18) were analyzed for somatic mutations in NRAS, BRAF, and p16 CDKN2A genes. For melanoma susceptibility, investigations at germline level indicated that p16 CDKN2A was exclusively mutated in 16/545 (2.9%) non-Sardinian patients, whereas BRCA2 germline mutations were observed in 4/91 (4.4%) patients from North Sardinia only. Two MC1R germline variants, Arg151Cys and Asp294His, were significantly associated with melanoma in Sardinia. Regarding genetic events involved in melanoma pathogenesis at somatic level, mutually-exclusive mutations of NRAS and BRAF genes were observed at quite same rate (about two thirds) in cultured and in vivo melanomas (either primary or metastatic lesions). Conversely, p16 CDKN2A gene alterations were observed at increased rates moving from primary to metastatic melanomas and melanoma cell lines. Activation of the ERK gene product was demonstrated to be consistently induced by a combination of molecular alterations (NRAS/BRAF mutations and p16 CDKN2A silencing). Our findings further clarified that: a) mutation prevalence in melanoma susceptibility genes may vary within each specific geographical area; b) multiple molecular events are accumulating during melanomagenesis

  14. Spontaneous conversion of first onset atrial fibrillation

    DEFF Research Database (Denmark)

    Lindberg, Søren Østergaard; Hansen, Sidsel; Nielsen, Tonny

    2011-01-01

    Background  We studied all patients admitted to hospital with first onset atrial fibrillation (AF) to determine the probability of spontaneous conversion to sinus rhythm and to identify factors predictive of such a conversion. Methods and Results  We retrospectively reviewed charts of 438...

  15. Optimization theory for ballistic energy conversion

    NARCIS (Netherlands)

    Xie, Yanbo; Versluis, Michel; Van Den Berg, Albert; Eijkel, Jan C.T.

    2016-01-01

    The growing demand of renewable energy stimulates the exploration of new materials and methods for clean energy. We recently demonstrated a high efficiency and power density energy conversion mechanism by using jetted charged microdroplets, termed as ballistic energy conversion. Hereby, we model and

  16. Bilingualism and Conversational Understanding in Young Children

    Science.gov (United States)

    Siegal, Michael; Iozzi, Laura; Surian, Luca

    2009-01-01

    The purpose of the two experiments reported here was to investigate whether bilingualism confers an advantage on children's conversational understanding. A total of 163 children aged 3-6 years were given a Conversational Violations Test to determine their ability to identify responses to questions as violations of Gricean maxims of conversation…

  17. Critical Exchange: Religion and Schooling in Conversation

    Science.gov (United States)

    Stern, Julian

    2017-01-01

    Given the complex and messy contexts of schooling, conversations between religion and schooling can be "admitted" as examples of the sort of situated conversation that goes beyond the "false necessity" of universal state-controlled school-based education. There are distinct claims to be made about religion and schooling in…

  18. Jensen's operator inequality and its converses

    DEFF Research Database (Denmark)

    Hansen, Frank; Pecaric, Josip; Peric, Ivan

    2007-01-01

    We give a general formulation of Jensen's operator inequality for unital fields of positive linear mappings, and we consider different types of converse inequalities......We give a general formulation of Jensen's operator inequality for unital fields of positive linear mappings, and we consider different types of converse inequalities...

  19. Improving Teamwork through Awareness of Conversational Styles

    Science.gov (United States)

    Rehling, Louise

    2004-01-01

    Conversational styles can sometimes cause conflicts on problem-solving writing teams. In self-defense, students often resort to blaming and shaming around conversational styles, which can just worsen unproductive group behaviors, limiting idea exchanges and deflecting attention from substantive issues and onto what is often labeled "personality…

  20. Conversion Disorder in Stroke: A Case Report

    Directory of Open Access Journals (Sweden)

    Hsien-Yeh Chou

    2006-11-01

    Full Text Available Conversion disorder is caused by previous severe stress, emotional conflict, or an associated psychiatric disorder, and usually presents with one or more neurologic symptoms. Clinically, it is challenging to diagnose diseases such as transient ischemia attack, stroke, brain tumor, spinal cord injury, and neuropathy. In this case report, we present a male stroke patient who had a typical conversion disorder.