WorldWideScience

Sample records for gene carriers optimization

  1. Personality traits in Huntington's disease: An exploratory study of gene expansion carriers and non-carriers.

    Larsen, Ida Unmack; Mortensen, Erik Lykke; Vinther-Jensen, Tua; Nielsen, Jørgen Erik; Knudsen, Gitte Moos; Vogel, Asmus

    2016-12-01

    Huntington's disease (HD) is associated with risk for developing psychiatric symptoms. Vulnerability or resilience to psychiatric symptoms may be associated with personality traits. This exploratory study, aimed to investigate personality traits in a large cohort of HD carriers and at risk gene-expansion negative individuals (HD non-carriers), exploring whether carrying the HD gene or growing up in an HD family influences personality traits. Forty-seven HD carriers, Thirty-nine HD non-carriers, and 121 healthy controls answered the Danish version of the revised NEO personality inventory. Comparisons between HD carriers and HD non-carriers were mostly non-significant but the combined group of HD carriers and non-carriers showed significantly higher scores on the facets: "hostility," "assertiveness," and "activity" and on the trait "Conscientiousness" relative to controls, "Conscientiousness" have been associated with resilience to psychiatric symptoms. Twelve HD carriers and non-carriers were classified as depressed and showed significantly lower scores on "Extraversion" and "Conscientiousness" and significantly higher scores on "Neuroticism," which are associated with vulnerability to psychiatric symptoms. Our findings suggest that, there is no direct effect of the HD gene on personality traits, but that personality assessment may be relevant to use when identifying individuals from HD families who are vulnerable to develop psychiatric symptoms. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  2. High Dynamic Optimized Carrier Loop Improvement for Tracking Doppler Rates

    Amirhossein Fereidountabar

    2015-01-01

    Full Text Available Mathematical analysis and optimization of a carrier tracking loop are presented. Due to fast changing of the carrier frequency in some satellite systems, such as Low Earth Orbit (LEO or Global Positioning System (GPS, or some planes like Unmanned Aerial Vehicles (UAVs, high dynamic tracking loops play a very important role. In this paper an optimized tracking loop consisting of a third-order Phase Locked Loop (PLL assisted by a second-order Frequency Locked Loop (FLL for UAVs is proposed and discussed. Based on this structure an optimal loop has been designed. The main advantages of this approach are the reduction of the computation complexity and smaller phase error. The paper shows the simulation results, comparing them with a previous work.

  3. Characterization of chicken riboflavin carrier protein gene structure ...

    The chicken riboflavin carrier protein (RCP) is an estrogen induced egg yolk and white protein. Eggs from hens which have a splice mutation in RCP gene fail to hatch, indicating an absolute requirement of RCP for the transport of riboflavin to the oocyte. In order to understand the mechanism of regulation of this gene by ...

  4. Optimization of territory control of the mail carrier by using Hungarian methods

    Supian, S.; Wahyuni, S.; Nahar, J.; Subiyanto

    2018-03-01

    In this paper, the territory control of the mail carrier from the central post office Bandung in delivering the package to the destination location was optimized by using Hungarian method. Sensitivity analysis against data changes that may occur was also conducted. The sampled data in this study are the territory control of 10 mail carriers who will be assigned to deliver mail package to 10 post office delivery centers in Bandung. The result of this research is the combination of territory control optimal from 10 mail carriers as follows: mail carrier 1 to Cikutra, mail carrier 2 to Ujung Berung, mail carrier 3 to Dayeuh Kolot, mail carrier 4 to Padalarang, mail carrier 5 to Situ Saeur, mail carrier 6 to Cipedes, mail carrier 7 to Cimahi, mail carrier 8 to Soreang, mail carrier 9 to Asia-Afrika, mail carrier 10 to Cikeruh. Based on this result, manager of the central post office Bandung can make optimal decisions to assign tasks to their mail carriers.

  5. Glucosylated polyethylenimine as a tumor-targeting gene carrier.

    Park, In-Kyu; Cook, Seung-Eun; Kim, You-Kyoung; Kim, Hyun-Woo; Cho, Myung-Haing; Jeong, Hwan-Jeong; Kim, Eun-Mi; Nah, Jae-Woon; Bom, Hee-Seung; Cho, Chong-Su

    2005-11-01

    Glucosylated polyethylenimine (GPEI) was synthesized as a tumor-targeting gene carrier through facilitative glucose metabolism by tumor glucose transporter. Particle sizes of GPEI/DNA complex increased in proportion to glucose content of GPEI, whereas surface charge of the complex was not dependent on glucosylation, partially due to inefficient shielding of the short hydrophilic group introduced. GPEI with higher glucosylation (36 mol-%) had no cytotoxic effect on cells even at polymer concentrations higher than 200 microg/mL. Compared to unglucosylated PEI, glucosylation induced less than one-order decrease of transfection efficiency. Transfection of GPEI/DNA complex into tumor cells possibly occurred through specific interaction between glucose-related cell receptors and glucose moiety of GPEI. Gamma imaging technique revealed GPEI/DNA complex was distributed in liver, spleen, and tumors.

  6. PWM pulse pattern optimization method using carrier frequency modulation. Carrier shuhasu hencho ni yoru PWM pulse pattern saitekikaho

    Iwaji, Y.; Fukuda, S. (Hokkaido University, Sapporo (Japan))

    1991-07-15

    Sinusoidal inverters are getting more widely used keeping pace with the development of semiconductor switching elements. This paper discusses optimizing a PWM pulse pattern at an inverter output to drive an induction motor, proposes methods for improving distortion and torque ripples using a carrier frequency modulation (CFM), and describes a method for realizing the improvement through use of a single-chip microcomputer. The method defines evaluation parameters corresponding to the distortion and torque ripples, and optimizes the CFM depth to the parameters. The PWM pulse pattern has its voltage vector and time width so selected that the time integrated space vector of a three-phase voltage approaches a circular locus. Furthermore, the carrier frequency, that is the sampling frequency of the inverter, is also adjusted so that the above evaluation parameters are minimized. The addition of a new variable called the frequency modulation provides freedom in selecting an output characteristic as called for by the purpose. 12 refs., 18 figs.

  7. Optimization of nanostructured lipid carriers for topical delivery of nimesulide using Box-Behnken design approach.

    Moghddam, Seyedeh Marziyeh Mahdavi; Ahad, Abdul; Aqil, Mohd; Imam, Syed Sarim; Sultana, Yasmin

    2017-05-01

    The aim of the present study was to develop and optimize topically applied nimesulide-loaded nanostructured lipid carriers. Box-Behnken experimental design was applied for optimization of nanostructured lipid carriers. The independent variables were ratio of stearic acid: oleic acid (X 1 ), poloxamer 188 concentration (X 2 ) and lecithin concentration (X 3 ) while particle size (Y 1 ) and entrapment efficiency (Y 2 ) were the chosen responses. Further, skin penetration study, in vitro release, confocal laser scanning microscopy and stability study were also performed. The optimized nanostructured lipid carriers of nimesulide provide reasonable particle size, flux, and entrapment efficiency. Optimized formulation (F9) with mean particle size of 214.4 ± 11 nm showed 89.4 ± 3.40% entrapment efficiency and achieved mean flux 2.66 ± 0.09 μg/cm 2 /h. In vitro release study showed prolonged drug release from the optimized formulation following Higuchi release kinetics with R 2 value of 0.984. Confocal laser scanning microscopy revealed an enhanced penetration of Rhodamine B-loaded nanostructured lipid carriers to the deeper layers of the skin. The stability study confirmed that the optimized formulation was considerably stable at refrigerator temperature as compared to room temperature. Our results concluded that nanostructured lipid carriers are an efficient carrier for topical delivery of nimesulide.

  8. AN APPLICATION OF MULTICRITERIA OPTIMIZATION TO THE TWO-CARRIER TWO-SPEED PLANETARY GEAR TRAINS

    Jelena Stefanović-Marinović

    2017-04-01

    Full Text Available The objective of this study is the application of multi-criteria optimization to the two-carrier two-speed planetary gear trains. In order to determine mathematical model of multi-criteria optimization, variables, objective functions and conditions should be determined. The subject of the paper is two-carrier two-speed planetary gears with brakes on single shafts. Apart from the determination of the set of the Pareto optimal solutions, the weighted coefficient method for choosing an optimal solution from this set is also included in the mathematical model.

  9. Poly(Amido Amine)s Containing Agmatine and Butanol Side Chains as Efficient Gene Carriers.

    Won, Young-Wook; Ankoné, Marc; Engbersen, Johan F J; Feijen, Jan; Kim, Sung Wan

    2016-04-01

    A new type of bioreducible poly(amido amine) copolymer is synthesized by the Michael addition polymerization of cystamine bisacrylamide (CBA) with 4-aminobutylguanidine (agmatine, AGM) and 4-aminobutanol (ABOL). Since the positively charged guanidinium groups of AGM and the hydroxybutyl groups of ABOL in the side chains have shown to improve the overall transfection efficiency of poly(amido amine)s, it is hypothesized that poly(CBA-ABOL/AGM) synthesized at the optimal ratio of both components would result in high transfection efficiency and minimal toxicity. In this study, a series of the poly(CBA-ABOL/AGM) copolymers is synthesized as gene carriers. The polymers are characterized and luciferase transfection efficiencies of the polymers in various cell lines are investigated to select the ideal ratio between AGM and ABOL. The poly(CBA-ABOL/AGM) containing 80% AGM and 20% ABOL has shown the best transfection efficiency with the lowest cytotoxicity, indicating that this polymer is very promising as a potent and nontoxic gene carrier. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Lipid Oxidation in Carriers of Lecithin: Cholesterol Acyltransferase Gene Mutations

    Holleboom, Adriaan G.; Daniil, Georgios; Fu, Xiaoming; Zhang, Renliang; Hovingh, G. Kees; Schimmel, Alinda W.; Kastelein, John J. P.; Stroes, Erik S. G.; Witztum, Joseph L.; Hutten, Barbara A.; Tsimikas, Sotirios; Hazen, Stanley L.; Chroni, Angeliki; Kuivenhoven, Jan Albert

    2012-01-01

    Objective-Lecithin:cholesterol acyltransferase (LCAT) has been shown to play a role in the depletion of lipid oxidation products, but this has so far not been studied in humans. In this study, we investigated processes and parameters relevant to lipid oxidation in carriers of functional LCAT

  11. Lipid Oxidation in Carriers of Lecithin : Cholesterol Acyltransferase Gene Mutations

    Holleboom, Adriaan G.; Daniil, Georgios; Fu, Xiaoming; Zhang, Renliang; Hovingh, G. Kees; Schimmel, Alinda W.; Kastelein, John J. P.; Stroes, Erik S. G.; Witztum, Joseph L.; Hutten, Barbara A.; Tsimikas, Sotirios; Hazen, Stanley L.; Chroni, Angeliki; Kuivenhoven, Jan Albert

    2012-01-01

    OBJECTIVE: Lecithin:cholesterol acyltransferase (LCAT) has been shown to play a role in the depletion of lipid oxidation products, but this has so far not been studied in humans. In this study, we investigated processes and parameters relevant to lipid oxidation in carriers of functional LCAT

  12. Development of Liposomal Bubbles with Perfluoropropane Gas as Gene Delivery Carriers

    Maruyama, Kazuo; Suzuki, Ryo; Sawamura, Kaori; Takizawa, Tomoko; Utoguchi, Naoki; Negishi, Yoichi

    2007-05-01

    Liposomes have some advantages as drug, antigen and gene delivery carriers. Their size can be easily controlled and they can be modified to add a targeting function. Based on liposome technology, we developed novel liposomal bubbles (Bubble liposomes) containing the ultrasound imaging gas, perfluoropropane. We assessed the feasibility of Bubble liposomes as carriers for gene delivery after cavitation induced by ultrasound. At first, we investigated their ability to deliver genes with Bubble liposomes and ultrasound to various types of cells such as mouse sarcoma cells, mouse melanoma cells, human T cell line and human umbilical vein endothelial cells. The results showed that the Bubble liposomes could deliver plasmid DNA to many cell types without cytotoxicity. In addition, we found that Bubble liposomes could effectively deliver plasmid DNA into mouse femoral artery in vivo. The gene transduction with Bubble liposomes was more effectively than conventional lipofection. We conclude that Bubble liposomes are unique and efficient gene delivery carriers in vitro and in vivo.

  13. Symptomatic lipid storage in carriers for the PNPLA2 gene.

    Janssen, Mirian C H; van Engelen, Baziel; Kapusta, Livia; Lammens, Martin; van Dijk, Martin; Fischer, Judith; van der Graaf, Marinette; Wevers, Ron A; Fahrleitner, Manuela; Zimmermann, Robert; Morava, Eva

    2013-08-01

    Neutral lipid storage disease comprises a heterogeneous group of inherited disorders characterized by severe accumulation of cytoplasmic triglyceride droplets in several tissues and neutrophils. A novel type of autosomal recessive lipid myopathy due to PNPLA2 mutations was recently described with associated cardiac disease, myopathy and frequent infections, but without ichthyosis. Here we describe the clinical and biochemical characteristics of a long surviving patient and report on four carrier family members with diverse clinical involvement. Interestingly, heterozygous patients show neutral lipid storage in muscle and in the keratocytes of the skin, Jordans' bodies, mild myopathy and frequent infections. Biochemical analysis of fibroblasts obtained from patients revealed increased triglyceride storage and reduced lipid droplet-associated triglyceride hydrolase activity. Together, our data implicate that the wild-type allele cannot fully compensate for the mutated dysfunctional allele of PNPLA2 leading to triglyceride accumulation in muscle and mild myopathy in PNPLA2 mutation carriers. The presence of neutral lipid droplets in the skin in PNPLA2 mutation carriers strengthens the link between NLSD and other neutral lipid storage diseases with ichthyosis.

  14. Lipid Phases Eye View to Lipofection. Cationic Phosphatidylcholine Derivatives as Efficient DNA Carriers for Gene Delivery

    Rumiana Koynova

    2008-01-01

    Efficient delivery of genetic material to cells is needed for tasks of utmost importance in laboratory and clinic, such as gene transfection and gene silencing. Synthetic cationic lipids can be used as delivery vehicles for nucleic acids and are now considered the most promising non-viral gene carriers. They form complexes (lipoplexes) with the polyanionic nucleic acids. A critical obstacle for clinical application of the lipid-mediated DNA delivery (lipofection) is its unsatisfactory efficie...

  15. Optimal Scheduling of Biogas-Solar-Wind Renewable Portfolio for Multi-Carrier Energy Supplies

    Zhou, Bin; Xu, Da; Li, Canbing

    2018-01-01

    the mitigation of renewable intermittency and the efficient utilization of batteries, and a multi-carrier generation scheduling scheme is further presented to dynamically optimize dispatch factors in the coupling matrix for energy-efficient con-version and storage, while different energy demands of end......This paper proposes a multi-source multi-product framework for coupled multi-carrier energy supplies with a biogas-solar-wind hybrid renewable system. In this framework, the biogas-solar-wind complementarities are fully exploited based on digesting thermodynamic effects for the synergetic...... interactions of electricity, gas and heating energy flows, and a coupling matrix is formulated for the modeling of production, conversion, storage, and consumption of different energy carriers. The multi-energy complementarity of biogas-solar-wind renewable portfolio can be utilized to facilitate...

  16. Optimal Scheduling of a Multi-Carrier Energy Hub Supplemented By Battery Energy Storage Systems

    Javadi, Mohammad Sadegh; Anvari-Moghaddam, Amjad; Guerrero, Josep M.

    2017-01-01

    This paper introduces a management model for optimal scheduling of a multi-carrier energy hub. In the proposed hub, three types of assets are considered: dispersed generating systems (DGs) such as micro-combined heat and power (mCHP) units, storage devices such as battery-based electrical storage...... systems (ESSs), and heating/cooling devices such as electrical heater, heat-pumps and absorption chillers. The optimal scheduling and management of the examined energy hub assets in line with electrical transactions with distribution network is modeled as a mixed-integer non-linear optimization problem....... In this regard, optimal operating points of DG units as well as ESSs are calculated based on a cost-effective strategy. Degradation cost of ESSs is also taken into consideration for short-term scheduling. Simulation results demonstrate that including well-planned energy storage options together with optimal...

  17. Establishment of mitochondrial pyruvate carrier 1 (MPC1) gene knockout mice with preliminary gene function analyses

    Li, Xiaoli; Li, Yaqing; Han, Gaoyang; Li, Xiaoran; Ji, Yasai; Fan, Zhirui; Zhong, Yali; Cao, Jing; Zhao, Jing; Mariusz, Goscinski; Zhang, Mingzhi; Wen, Jianguo; Nesland, Jahn M.; Suo, Zhenhe

    2016-01-01

    Pyruvate plays a critical role in the mitochondrial tricarboxylic acid (TCA) cycle, and it is the center product for the synthesis of amino acids, carbohydrates and fatty acids. Pyruvate transported across the inner mitochondrial membrane appears to be essential in anabolic and catabolic intermediary metabolism. The mitochondrial pyruvate carrier (MPC) mounted in the inner membrane of mitochondria serves as the channel to facilitate pyruvate permeating. In mammals, the MPC is formed by two paralogous subunits, MPC1 and MPC2. It is known that complete ablation of MPC2 in mice causes death on the 11th or 12th day of the embryonic period. However, MPC1 deletion and the knowledge of gene function in vivo are lacking. Using the new technology of gene manipulation known as Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9 (CRISPR/Cas9) systems, we gained stable MPC1 gene heterozygous mutation mice models, and the heterozygous mutations could be stably maintained in their offsprings. Only one line with homozygous 27 bases deletion in the first exon was established, but no offsprings could be obtained after four months of mating experiments, indicating infertility of the mice with such homozygous deletion. The other line of MPC1 knockout (KO) mice was only heterozygous, which mutated in the first exon with a terminator shortly afterwards. These two lines of MPC1 KO mice showed lower fertility and significantly higher bodyweight in the females. We concluded that heterozygous MPC1 KO weakens fertility and influences the metabolism of glucose and fatty acid and bodyweight in mice. PMID:27835892

  18. Optimization of LDL targeted nanostructured lipid carriers of 5-FU by a full factorial design

    Sare Andalib

    2012-01-01

    Full Text Available Background: Nanostructured lipid carriers (NLC are a mixture of solid and liquid lipids or oils as colloidal carrier systems that lead to an imperfect matrix structure with high ability for loading water soluble drugs. The aim of this study was to find the best proportion of liquid and solid lipids of different types for optimization of the production of LDL targeted NLCs used in carrying 5-Fu by the emulsification-solvent evaporation method. Materials and Methods: The influence of the lipid type, cholesterol or cholesteryl stearate for targeting LDL receptors, oil type (oleic acid or octanol, lipid and oil% on particle size, surface charge, drug loading efficiency, and drug released percent from the NLCs were studied by a full factorial design. Results: The NLCs prepared by 54.5% cholesterol and 25% of oleic acid, showed optimum results with particle size of 105.8 nm, relatively high zeta potential of −25 mV, drug loading efficiency of 38% and release efficiency of about 40%. Scanning electron microscopy of nanoparticles confirmed the results of dynamic light scattering method used in measuring the particle size of NLCs. Conclusions: The optimization method by a full factorial statistical design is a useful optimization method for production of nanostructured lipid carriers.

  19. Optimization of LDL targeted nanostructured lipid carriers of 5-FU by a full factorial design.

    Andalib, Sare; Varshosaz, Jaleh; Hassanzadeh, Farshid; Sadeghi, Hojjat

    2012-01-01

    Nanostructured lipid carriers (NLC) are a mixture of solid and liquid lipids or oils as colloidal carrier systems that lead to an imperfect matrix structure with high ability for loading water soluble drugs. The aim of this study was to find the best proportion of liquid and solid lipids of different types for optimization of the production of LDL targeted NLCs used in carrying 5-Fu by the emulsification-solvent evaporation method. The influence of the lipid type, cholesterol or cholesteryl stearate for targeting LDL receptors, oil type (oleic acid or octanol), lipid and oil% on particle size, surface charge, drug loading efficiency, and drug released percent from the NLCs were studied by a full factorial design. The NLCs prepared by 54.5% cholesterol and 25% of oleic acid, showed optimum results with particle size of 105.8 nm, relatively high zeta potential of -25 mV, drug loading efficiency of 38% and release efficiency of about 40%. Scanning electron microscopy of nanoparticles confirmed the results of dynamic light scattering method used in measuring the particle size of NLCs. The optimization method by a full factorial statistical design is a useful optimization method for production of nanostructured lipid carriers.

  20. Novel Handover Optimization with a Coordinated Contiguous Carrier Aggregation Deployment Scenario in LTE-Advanced Systems

    Ibraheem Shayea

    2016-01-01

    Full Text Available The carrier aggregation (CA technique and Handover Parameters Optimization (HPO function have been introduced in LTE-Advanced systems to enhance system performance in terms of throughput, coverage area, and connection stability and to reduce management complexity. Although LTE-Advanced has benefited from the CA technique, the low spectral efficiency and high ping-pong effect with high outage probabilities in conventional Carrier Aggregation Deployment Scenarios (CADSs have become major challenges for cell edge User Equipment (UE. Also, the existing HPO algorithms are not optimal for selecting the appropriate handover control parameters (HCPs. This paper proposes two solutions by deploying a Coordinated Contiguous-CADS (CC-CADS and a Novel Handover Parameters Optimization algorithm that is based on the Weight Performance Function (NHPO-WPF. The CC-CADS uses two contiguous component carriers (CCs that have two different beam directions. The NHPO-WPF automatically adjusts the HCPs based on the Weight Performance Function (WPF, which is evaluated as a function of the Signal-to-Interference Noise Ratio (SINR, cell load, and UE’s velocity. Simulation results show that the CC-CADS and the NHPO-WPF algorithm provide significant enhancements in system performance over that of conventional CADSs and HPO algorithms from the literature, respectively. The integration of both solutions achieves even better performance than scenarios in which each solution is considered independently.

  1. [Enterotoxin genes occurance among S. aureus strains isolated from inpatients and carriers].

    Lawrynowicz-Paciorek, Maja; Kochman, Maria; Piekarska, Katarzyna; Wyrebiak, Agata; Potracka, Ewa; Leniak-Chmiel, Urszula; Magdziak, Agnieszka

    2006-01-01

    We examined 44 inpatients and 66 carriers Staphylococcus aureus strains, isolated in years 2002-2005, for the presence of 18 enterotoxin genes (se/sel) (by PCR), the ability for A-D enterotoxin production (by SET-RPLA) and antibiotic resistance distribution (by disc diffusion method). se/sel genes were detected in 90,9% of all strains, sea (70,5%) and selk and selq (52,3%) - among inpatients strains and egc (65,2%) - among carriers strains were the most frequently se/sel genes found. Positive results of SET-RPLA were consistent with PCR results. There was no correlation observed between antibiotic resistance and se/sel genes distribution among tested S. aureus strains.

  2. Differences in gene transcriptomic pattern of Plasmodium falciparum in children with cerebral malaria and asymptomatic carriers

    Almelli, Talleh; Nuel, Grégory; Bischoff, Emmanuel

    2014-01-01

    . In this study, we analyzed the transcriptomes of isolates obtained from asymptomatic carriers and patients with uncomplicated or cerebral malaria. We also investigated the transcriptomes of 3D7 clone and 3D7-Lib that expresses severe malaria associated-variant surface antigen. Our findings revealed a specific...... up-regulation of genes involved in pathogenesis, adhesion to host cell, and erythrocyte aggregation in parasites from patients with cerebral malaria and 3D7-Lib, compared to parasites from asymptomatic carriers and 3D7, respectively. However, we did not find any significant difference between...... and their neighboring rif genes in 3D7-lib. Therefore, more investigations are needed to analyze the effective role of these genes during malaria infection to provide with new knowledge on malaria pathology. In addition, concomitant regulation of genes within the chromosomal neighborhood suggests a common mechanism...

  3. Genaesthics : Breast Surgery in BRCA1/2 Gene Mutation Carriers

    V.M.T. van Verschuer (Victorien)

    2017-01-01

    markdownabstractThe present thesis focuses on breast surgery in BRCA1/2 gene mutation carriers. The topics that are studied vary broadly, representing the multiple disciplines that are involved in the diagnostic work-up and treatment of BRCA1/2-associated breast cancer. The first part contains

  4. Breast cancer in female carriers of ATM gene alterations: outcome of adjuvant radiotherapy

    Meyer, Andreas; John, Esther; Doerk, Thilo; Sohn, Christof; Karstens, Johann H.; Bremer, Michael

    2004-01-01

    Background and purpose: We analyzed the clinical outcome of breast cancer patients carrying sequence variants in the ATM gene who received postoperative radiotherapy after breast conservative surgery to test whether an increased cellular radiosensitivity may translate into enhanced tumor cell killing and thereby result in an improvement of the therapeutic ratio. Patients and methods: We investigated a cohort of 138 breast cancer patients who received adjuvant radiotherapy following breast conservative surgery for T1 and T2 tumors. Genomic DNA samples of these patients had previously been scanned for mutations in the ATM gene. Follow-up data were available in 135 patients, with a median follow-up of 87 months. Local relapse-free, metastasis-free and overall survival were compared between carriers and non-carriers of a sequence variant in the ATM gene. Results: Twenty patients were found to carry a sequence variant in the ATM gene (truncating, 7; missense, 13). The actuarial 7-year local relapse-free survival of carriers vs. non-carriers were 88 vs. 94% (P=0.34). Actuarial metastasis-free and overall survival after 7 years were 63 vs. 85% (P=0.01) and 73 vs. 89% (P=0.055), respectively. However, the presence of a variant in the ATM gene did not remain a significant discriminator for metastasis-free survival in a multivariate Cox regression analysis (P=0.068). Conclusions: Our results do not support the hypothesis that breast cancer patients carrying a sequence variant in the ATM gene differentially benefit from postoperative radiotherapy. These findings have to be verified using larger number of cases to clarify the clinical consequences of sequence variants in the ATM gene

  5. Multiobjective Optimization Methodology A Jumping Gene Approach

    Tang, KS

    2012-01-01

    Complex design problems are often governed by a number of performance merits. These markers gauge how good the design is going to be, but can conflict with the performance requirements that must be met. The challenge is reconciling these two requirements. This book introduces a newly developed jumping gene algorithm, designed to address the multi-functional objectives problem and supplies a viably adequate solution in speed. The text presents various multi-objective optimization techniques and provides the technical know-how for obtaining trade-off solutions between solution spread and converg

  6. Optimization of Sour Cherry Juice Spray Drying as
Affected by Carrier Material and Temperature

    Zorić, Zoran; Pedisić, Sandra; Dragović-Uzelac, Verica

    2016-01-01

    Summary Response surface methodology was applied for optimization of the sour cherry Marasca juice spray drying process with 20, 30 and 40% of carriers maltodextrin with dextrose equivalent (DE) value of 4–7 and 13–17 and gum arabic, at three drying temperatures: 150, 175 and 200 °C. Increase in carrier mass per volume ratio resulted in lower moisture content and powder hygroscopicity, higher bulk density, solubility and product yield. Higher temperatures decreased the moisture content and bulk density of powders. Temperature of 200 °C and 27% of maltodextrin with 4–7 DE were found to be the most suitable for production of sour cherry Marasca powder. PMID:28115901

  7. Optimal design of tilt carrier frequency computer-generated holograms to measure aspherics.

    Peng, Jiantao; Chen, Zhe; Zhang, Xingxiang; Fu, Tianjiao; Ren, Jianyue

    2015-08-20

    Computer-generated holograms (CGHs) provide an approach to high-precision metrology of aspherics. A CGH is designed under the trade-off among size, mapping distortion, and line spacing. This paper describes an optimal design method based on the parametric model for tilt carrier frequency CGHs placed outside the interferometer focus points. Under the condition of retaining an admissible size and a tolerable mapping distortion, the optimal design method has two advantages: (1) separating the parasitic diffraction orders to improve the contrast of the interferograms and (2) achieving the largest line spacing to minimize sensitivity to fabrication errors. This optimal design method is applicable to common concave aspherical surfaces and illustrated with CGH design examples.

  8. Risk of metachronous colon cancer following surgery for rectal cancer in mismatch repair gene mutation carriers.

    Win, Aung Ko; Parry, Susan; Parry, Bryan; Kalady, Matthew F; Macrae, Finlay A; Ahnen, Dennis J; Young, Graeme P; Lipton, Lara; Winship, Ingrid; Boussioutas, Alex; Young, Joanne P; Buchanan, Daniel D; Arnold, Julie; Le Marchand, Loïc; Newcomb, Polly A; Haile, Robert W; Lindor, Noralane M; Gallinger, Steven; Hopper, John L; Jenkins, Mark A

    2013-06-01

    Despite regular surveillance colonoscopy, the metachronous colorectal cancer risk for mismatch repair (MMR) gene mutation carriers after segmental resection for colon cancer is high and total or subtotal colectomy is the preferred option. However, if the index cancer is in the rectum, management decisions are complicated by considerations of impaired bowel function. We aimed to estimate the risk of metachronous colon cancer for MMR gene mutation carriers who underwent a proctectomy for index rectal cancer. This retrospective cohort study comprised 79 carriers of germline mutation in a MMR gene (18 MLH1, 55 MSH2, 4 MSH6, and 2 PMS2) from the Colon Cancer Family Registry who had had a proctectomy for index rectal cancer. Cumulative risks of metachronous colon cancer were calculated using the Kaplan-Meier method. During median 9 years (range 1-32 years) of observation since the first diagnosis of rectal cancer, 21 carriers (27 %) were diagnosed with metachronous colon cancer (incidence 24.25, 95 % confidence interval [CI] 15.81-37.19 per 1,000 person-years). Cumulative risk of metachronous colon cancer was 19 % (95 % CI 9-31 %) at 10 years, 47 (95 % CI 31-68 %) at 20 years, and 69 % (95 % CI 45-89 %) at 30 years after surgical resection. The frequency of surveillance colonoscopy was 1 colonoscopy per 1.16 years (95 % CI 1.01-1.31 years). The AJCC stages of the metachronous cancers, where available, were 72 % stage I, 22 % stage II, and 6 % stage III. Given the high metachronous colon cancer risk for MMR gene mutation carriers diagnosed with an index rectal cancer, proctocolectomy may need to be considered.

  9. Probabilistic Optimal Power Dispatch in Multi-Carrier Networked Microgrids under Uncertainties

    Vahid Amir

    2017-11-01

    Full Text Available A microgrid (MG is a small-scale version of the power system which makes possible the integration of renewable resources as well as achieving maximum demand side management (DSM utilization. The future power system will be faced with severe uncertainties owing to penetration of renewable resources. Consequently, the uncertainty assessment of system performance is essential. The conventional energy scheduling in an MG may not be suitable for active distribution networks. Hence, this study focuses on the probabilistic analysis of optimal power dispatch considering economic aspects in a multi-carrier networked microgrid. The aim is to study the impact of uncertain behavior of loads, renewable resources, and electricity market on the optimal management of a multi-carrier networked microgrid. Furthermore, a novel time-based demand side management is proposed in order to reshape the load curve, as well as preventing the excessive use of energy in peak hours. The optimization model is formulated as a mixed integer nonlinear program (MINLP and is solved using MATLAB and GAMS software. Results show that the energy sharing capability between MCMGs and MCMGs and the main grids as well as utilization of demand side management can decrease operating costs for smart distribution grids.

  10. Preparation and characterization of oligochitosan-tragacanth nanoparticles as a novel gene carrier.

    Fattahi, Ali; Sadrjavadi, Komail; Golozar, Mohammad Ali; Varshosaz, Jaleh; Fathi, Mohammad-Hossein; Mirmohammad-Sadeghi, Hamid

    2013-09-12

    The nanoparticles of oligochitosan-water soluble tragacanth (OCH-WST) as novel gene carriers have been prepared and their transfection efficiency has been investigated on Hela and HepG2 cell lines. Different OCH:WST weight ratios were prepared to obtain particles with low size distribution and high surface charge, and also in range of below 200 nm. Nanoparticles with 132.5 ± 6.77 nm size, polydispersity index 1.92 ± 0.061, surface charge 30.45 ± 1.84 and spherical morphology, have been chosen as gene carrier. Nanoparticle-DNA complexes (nanoplexes) showed better transfection efficiency in both Hela and HepG2 cells than chitosan polyplexes, with 1.26 × 10(6) versus 9.05 × 10(5) and 7.76 × 10(5) versus 2.16 × 10(5), respectively. Higher transfection efficiency of nanoplexes could be attributed to their weaker complexation. Decreasing of transfection in presence of galactose in HepG2 cells, indicated receptor mediated endocytosis of nanoplexes. These properties all together, make OCH-WST nanoparticles as potential gene carrier for active gene delivery into cells containing sugar receptors. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Methylation state of the EDA gene promoter in Chinese X-linked hypohidrotic ectodermal dysplasia carriers.

    Wei Yin

    Full Text Available Hypodontia, hypohidrosis, sparse hair and characteristic faces are the main characters of X-linked hypohidrotic ectodermal dysplasia (XLHED which is caused by genetic ectodysplasin A (EDA deficiency. Heterozygous female carriers tend to have mild to moderate XLHED phenotype, even though 30% of them present no obvious symptom.A large Chinese XLHED family was reported and the entire coding region and exon-intron boundaries of EDA gene were sequenced. To elucidate the mechanism for carriers' tempered phenotype, we analyzed the methylation level on four sites of the promoter of EDA by the pyrosequencing system.A known frameshift mutation (c.573-574 insT was found in this pedigree. Combined with the pedigrees we reported before, 120 samples comprised of 23 carrier females from 11 families and 97 healthy females were analyzed for the methylation state of EDA promoter. Within 95% confidence interval (CI, 18 (78.26% carriers were hypermethylated at these 4 sites.Chinese XLHED carriers often have a hypermethylated EDA promoter.

  12. Low cytotoxicity fluorescent PAMAM dendrimer as gene carriers for monitoring the delivery of siRNA

    Guan, Lingmei [Sichuan University, State Key Laboratory of Bio-resources and Eco-environment, The Ministry of Education, College of Life Sciences (China); Huang, Saipeng [Chinese Academy of Sciences, State Key Laboratory for Structural Chemistry of Unstable and Stable Species, Center for Molecular Sciences, Institute of Chemistry (China); Chen, Zhao [Xi’an Jiaotong University, School of Science (China); Li, Yanchao [Chinese Academy of Sciences, State Key Laboratory for Structural Chemistry of Unstable and Stable Species, Center for Molecular Sciences, Institute of Chemistry (China); Liu, Ke [Sichuan University, State Key Laboratory of Bio-resources and Eco-environment, The Ministry of Education, College of Life Sciences (China); Liu, Yang, E-mail: yliu@iccas.ac.cn; Du, Libo, E-mail: dulibo@iccas.ac.cn [Chinese Academy of Sciences, State Key Laboratory for Structural Chemistry of Unstable and Stable Species, Center for Molecular Sciences, Institute of Chemistry (China)

    2015-09-15

    Visual detection of gene vectors has attracted a great deal of attention due to the application of these vectors in monitoring and evaluating the effect of gene carriers in living cells. A non-viral vector, the fluorescent PAMAM dendrimer (F-PAMAM), was synthesized through conjugation of PAMAM dendrimers and fluorescein. In vitro and ex vivo experiments show that F-PAMAM exhibits superphotostability, low cytotoxicity and facilitates endocytosis by A549 cells. The vector has a high siRNA binding affinity and it increases the efficiency of cy5-siRNA delivery in A549 cells, in comparison with a cy5-siRNA monomer. Our results provide a new method for simultaneously monitoring the delivery of siRNA and its non-viral carriers in living cells.

  13. Genaesthics : Breast Surgery in BRCA1/2 Gene Mutation Carriers

    Verschuer, Victorien

    2017-01-01

    markdownabstractThe present thesis focuses on breast surgery in BRCA1/2 gene mutation carriers. The topics that are studied vary broadly, representing the multiple disciplines that are involved in the diagnostic work-up and treatment of BRCA1/2-associated breast cancer. The first part contains studies on molecular and prognostic tumor characteristics in breast cancer. The thesis continues with an anatomical study on safety of prophylactic mastectomy, and finishes with studies on aesthetics an...

  14. Motor Decline in Clinically Presymptomatic Spinocerebellar Ataxia Type 2 Gene Carriers

    Velázquez-Perez, Luis; Díaz, Rosalinda; Pérez-González, Ruth; Canales, Nalia; Rodríguez-Labrada, Roberto; Medrano, Jacquelín; Sánchez, Gilberto; Almaguer-Mederos, Luis; Torres, Cira; Fernandez-Ruiz, Juan

    2009-01-01

    Background Motor deficits are a critical component of the clinical characteristics of patients with spinocerebellar ataxia type 2. However, there is no current information on the preclinical manifestation of those motor deficits in presymptomatic gene carriers. To further understand and characterize the onset of the clinical manifestation in this disease, we tested presymptomatic spinocerebellar ataxia type 2 gene carriers, and volunteers, in a task that evaluates their motor performance and their motor learning capabilities. Methods and Findings 28 presymptomatic spinocerebellar ataxia type 2 gene carriers and an equal number of control volunteers matched for age and gender participated in the study. Both groups were tested in a prism adaptation task known to be sensible to both motor performance and visuomotor learning deficits. Our results clearly show that although motor learning capabilities are intact, motor performance deficits are present even years before the clinical manifestation of the disease start. Conclusions The results show a clear deficit in motor performance that can be detected years before the clinical onset of the disease. This motor performance deficit appears before any motor learning or clinical manifestations of the disease. These observations identify the performance coefficient as an objective and quantitative physiological biomarker that could be useful to assess the efficiency of different therapeutic agents. PMID:19401771

  15. Enhanced transfection by antioxidative polymeric gene carrier that reduces polyplex-mediated cellular oxidative stress.

    Lee, Min Sang; Kim, Nak Won; Lee, Kyuri; Kim, Hongtae; Jeong, Ji Hoon

    2013-06-01

    To test the hypothesis in which polyplex-induced oxidative stress may affect overall transfection efficiency, an antioxidative transfection system minimizing cellular oxidative stress was designed for enhanced transfection. An amphiphilic copolymer (PEI-PLGA) was synthesized and used as a micelle-type gene carrier containing hydrophobic antioxidant, α-tocopherol. Cellular oxidative stress and the change of mitochondrial membrane potential after transfection was measured by using a fluorescent probe (H₂DCFDA) and lipophilic cationic probe (JC-1), respectively. Transfection efficiency was determined by measuring a reporter gene (luciferase) expression level. The initial transfection study with conventional PEI/plasmid DNA polyplex showed significant generation of reactive oxygen species (ROS). The PEI-PLGA copolymer successfully carried out the simultaneous delivery of α-tocopherol and plasmid DNA (PEI-PLGA/Toco/pDNA polyplex) into cells, resulting in a significant reduction in cellular ROS generation after transfection and helped to maintain the mitochondrial membrane potential (ΔΨ). In addition, the transfection efficiency was dramatically increased using the antioxidative transfection system. This work showed that oxidative stress would be one of the important factors that should be considered in designing non-viral gene carriers and suggested a possible way to reduce the carrier-mediated oxidative stress, which consequently leads to enhanced transfection.

  16. A logical approach to optimize the nanostructured lipid carrier system of irinotecan: efficient hybrid design methodology

    Negi, Lalit Mohan; Talegaonkar, Sushama; Jaggi, Manu

    2013-01-01

    Development of an effective formulation involves careful optimization of a number of excipient and process variables. Sometimes the number of variables is so large that even the most efficient optimization designs require a very large number of trials which put stress on costs as well as time. A creative combination of a number of design methods leads to a smaller number of trials. This study was aimed at the development of nanostructured lipid carriers (NLCs) by using a combination of different optimization methods. A total of 11 variables were first screened using the Plackett–Burman design for their effects on formulation characteristics like size and entrapment efficiency. Four out of 11 variables were found to have insignificant effects on the formulation parameters and hence were screened out. Out of the remaining seven variables, four (concentration of tween-80, lecithin, sodium taurocholate, and total lipid) were found to have significant effects on the size of the particles while the other three (phase ratio, drug to lipid ratio, and sonication time) had a higher influence on the entrapment efficiency. The first four variables were optimized for their effect on size using the Taguchi L9 orthogonal array. The optimized values of the surfactants and lipids were kept constant for the next stage, where the sonication time, phase ratio, and drug:lipid ratio were varied using the Box–Behnken design response surface method to optimize the entrapment efficiency. Finally, by performing only 38 trials, we have optimized 11 variables for the development of NLCs with a size of 143.52 ± 1.2 nm, zeta potential of −32.6 ± 0.54 mV, and 98.22 ± 2.06% entrapment efficiency. (paper)

  17. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  18. Biomimetics: From Bioinformatics to Rational Design of Dendrimers as Gene Carriers

    Araya-Durán, Ingrid; Varas-Concha, Ignacio; Almonacid, Daniel Eduardo; González-Nilo, Fernando Danilo

    2015-01-01

    Biomimetics, or the use of principles of Nature for developing new materials, is a paradigm that could help Nanomedicine tremendously. One of the current challenges in Nanomedicine is the rational design of new efficient and safer gene carriers. Poly(amidoamine) (PAMAM) dendrimers are a well-known class of nanoparticles, extensively used as non-viral nucleic acid carriers, due to their positively charged end-groups. Yet, there are still several aspects that can be improved for their successful application in in vitro and in vivo systems, including their affinity for nucleic acids as well as lowering their cytotoxicity. In the search of new functional groups that could be used as new dendrimer-reactive groups, we followed a biomimetic approach to determine the amino acids with highest prevalence in protein-DNA interactions. Then we introduced them individually as terminal groups of dendrimers, generating a new class of nanoparticles. Molecular dynamics studies of two systems: PAMAM-Arg and PAMAM-Lys were also performed in order to describe the formation of complexes with DNA. Results confirmed that the introduction of amino acids as terminal groups in a dendrimer increases their affinity for DNA and the interactions in the complexes were characterized at atomic level. We end up by briefly discussing additional modifications that can be made to PAMAM dendrimers to turned them into promising new gene carriers. PMID:26382062

  19. Heteroduplex analysis of the dystrophin gene: Application to point mutation and carrier detection

    Prior, T.W.; Papp, A.C.; Snyder, P.J.; Sedra, M.S.; Western, L.M.; Bartolo, C.; Mendell, J.R. [Ohio State Univ., Columbus, OH (United States); Moxley, R.T. [Univ. of Rochester Medical Center, NY (United States)

    1994-03-01

    Approximately one-third of Duchenne muscular dystrophy patients have undefined mutations in the dystrophin gene. For carrier and prenatal studies in families without detectable mutations, the indirect restriction fragment length polymorphism linkage approach is used. Using a multiplex amplification and heteroduplex analysis of dystrophin exons, the authors identified nonsense mutations in two DMD patients. Although the nonsense mutations are predicted to severely truncate the dystrophin protein, both patients presented with mild clinical courses of the disease. As a result of identifying the mutation in the affected boys, direct carrier studies by heteroduplex analysis were extended to other relatives. The authors conclude that the technique is not only ideal for mutation detection but is also useful for diagnostic testing. 29 refs., 4 figs.

  20. Bow hull-form optimization in waves of a 66,000 DWT bulk carrier

    Jin-Won Yu

    2017-09-01

    Full Text Available This paper uses optimization techniques to obtain bow hull form of a 66,000 DWT bulk carrier in calm water and in waves. Parametric modification functions of SAC and section shape of DLWL are used for hull form variation. Multi-objective functions are applied to minimize the wave-making resistance in calm water and added resistance in regular head wave of λ/L = 0.5. WAVIS version 1.3 is used to obtain wave-making resistance. The modified Fujii and Takahashi's formula is applied to obtain the added resistance in short wave. The PSO algorithm is employed for the optimization technique. The resistance and motion characteristics in calm water and regular and irregular head waves of the three hull forms are compared. It has been shown that the optimal brings 13.2% reduction in the wave-making resistance and 13.8% reduction in the added resistance at λ/L = 0.5; and the mean added resistance reduces by 9.5% at sea state 5.

  1. Aldehyded Dextran and ε-Poly(L-lysine Hydrogel as Nonviral Gene Carrier

    Yumiko Togo

    2013-01-01

    Full Text Available Background. The expression term of the gene transfected in cells needs to belong enough inorder to make a gene therapy clinically effective. The controlled release of the transfected gene can be utilized. The new biodegradable hydrogel material created by 20 w/w% aldehyded dextran and 10 w/w% ε-poly(L-lysine (ald-dex/PLL was developed. We examined whether it could be as a nonviral carrier of the gene transfer. Methods. A plasmid (Lac-Z was mixed with ald-dex/PLL. An in vitro study was performed to assess the expression of Lac-Z with X-gal stain after gene transfer into the cultured 293 cells and bone marrow cells. As a control group, PLL was used as a cationic polymer. Results. We confirmed that the transfection efficiency of the ald-dex/PLL had a higher transfection efficiency than PLL in 293 cells (plasmid of 2 μg: ald-dex/PLL 1.1%, PLL 0.23%, plasmid of 16 μg: ald-dex/PLL 1.23%, PLL 0.48%. In bone marrow cells, we confirmed the expression of Lac-Z by changing the quantity of aldehyded dextran. In the groups using ald-dextran of the quantity of 1/4 and 1/12 of PLL, their transfection efficiency was 0.43% and 0.41%, respectively. Conclusions. This study suggested a potential of using ald-dex/PLL as a non-carrier for gene transfer.

  2. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  3. Nano-sized calcium phosphate (CaP) carriers for non-viral gene deilvery

    Lee, Donghyun, E-mail: dhlee@cau.ac.kr [Department of Biomedical Engineering, Division of Integrative Engineering, Chung-Ang University, 221 Heukseok-Dong, Dongjak-Gu, Seoul 156-756 (Korea, Republic of); Upadhye, Kalpesh [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Kumta, Prashant N., E-mail: pkumta@pitt.edu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Department of Mechanical Engineering and Materials Sceince, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Department of Chemical and Petroleum Engineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Center for Complex Engineered Multifunctional Materials, University of Pittsburgh, Pittsburgh, PA 15261 (United States)

    2012-02-25

    Highlights: Black-Right-Pointing-Pointer Nanostructured calcium phosphates (NanoCaPs): comprehensive review. Black-Right-Pointing-Pointer Non viral gene delivery mechanisms: detailed mechanisms are outlined. Black-Right-Pointing-Pointer Barriers to non-viral gene delivery: detailed barriers are discussed. - Abstract: Gene therapy has garnered much interest due to the potential for curing multiple inherited and/or increases in the acquired diseases. As a result, there has been intense activity from multiple research groups for developing effective delivery methods and carriers, which is a critical step in advancing gene delivery technologies. In order for the carriers to effectively deliver the genetic payloads, multiple extracellular and intracellular barriers need to be overcome. Although overcoming these challenges to improve the effectiveness is critical, the development of safe gene delivery agents is even more vital to assure its use in clinical applications. The development of safe and effective strategies has therefore been a major challenge impeding gene therapy progress. In this regard, calcium phosphate (CaP) based nano-particles has been considered as one of the candidate non-viral gene delivery vehicles, but has been plagued by inconsistent and low transfection efficiencies limiting its progress. There has been major research effort to improve the consistency and effectiveness of CaP based vectors. Currently, it is therefore thought that by controlling the various synthesis factors such as Ca/P ratio, mode of mixing, and type of calcium phosphate phase, such variability and inefficiency could be modulated. This review attempts to provide a comprehensive analysis of the current research activity in the development of CaP based ceramic and polymer-ceramic hybrid systems for non-viral gene delivery. Preliminary transfection results of hydroxyapatite (HA or NanoCaPs), amorphous calcium phosphate (ACP) and brushite phases are also compared to assess the

  4. Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.

    Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong

    2016-04-01

    Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Detection of mismatch repair gene germline mutation carrier among Chinese population with colorectal cancer

    Jin, Hei-Ying; Zhao, Ronghua; Liu, Xiufang; Li, Vicky Ka Ming; Ding, Yijiang; Yang, Bolin; Geng, Jianxiang; Lai, Rensheng; Ding, Shuqing; Ni, Min

    2008-01-01

    Hereditary nonpolyposis colorectal cancer (HNPCC) is an autosomal dominant syndrome. The National Cancer Institute (NCI) has recommended the Revised Bethesda guidelines for screening HNPCC. There has been a great deal of research on the value of these tests in other countries. However, literature about the Chinese population is scarce. Our objective is to detect and study microsatellite instability (MSI) and mismatch repair (MMR) gene germline mutation carriers among a Chinese population with colorectal cancer. In 146 prospectively recruited consecutive patients with clinically proven colorectal cancer, MSI carriers were identified by analysis of tumor tissue using multiplex fluorescence polymerase chain reaction (PCR) using the NCI recommended panel and classified into microsatellite instability-low (MSI-L), microsatellite instability-high (MSI-H) and microsatellite stable (MSS) groups. Immunohistochemical staining for MSH2, MSH6 and MLH1 on tissue microarrays (TMAs) was performed, and methylation of the MLH1 promoter was analyzed by quantitative methylation specific PCR (MSP). Germline mutation analysis of blood samples was performed for MSH2, MSH6 and MLH1 genes. Thirty-four out of the 146 colorectal cancers (CRCs, 23.2%) were MSI, including 19 MSI-H CRCs and 15 MSI-L CRCS. Negative staining for MSH2 was found in 8 CRCs, negative staining for MSH6 was found in 6 CRCs. One MSI-H CRC was negative for both MSH6 and MSH2. Seventeen CRCs stained negatively for MLH1. MLH1 promoter methylation was determined in 34 MSI CRCs. Hypermethylation of the MLH1 promoter occurred in 14 (73.7%) out of 19 MSI-H CRCs and 5 (33.3%) out of 15 MSI-L CRCs. Among the 34 MSI carriers and one MSS CRC with MLH1 negative staining, 8 had a MMR gene germline mutation, which accounted for 23.5% of all MSI colorectal cancers and 5.5% of all the colorectal cancers. Five patients harbored MSH2 germline mutations, and three patients harbored MSH6 germline mutations. None of the patients had an MLH

  6. Alcohol Consumption and the Risk of Colorectal Cancer for Mismatch Repair Gene Mutation Carriers.

    Dashti, S Ghazaleh; Buchanan, Daniel D; Jayasekara, Harindra; Ait Ouakrim, Driss; Clendenning, Mark; Rosty, Christophe; Winship, Ingrid M; Macrae, Finlay A; Giles, Graham G; Parry, Susan; Casey, Graham; Haile, Robert W; Gallinger, Steven; Le Marchand, Loïc; Thibodeau, Stephen N; Lindor, Noralane M; Newcomb, Polly A; Potter, John D; Baron, John A; Hopper, John L; Jenkins, Mark A; Win, Aung Ko

    2017-03-01

    Background: People with germline mutation in one of the DNA mismatch repair (MMR) genes have increased colorectal cancer risk. For these high-risk people, study findings of the relationship between alcohol consumption and colorectal cancer risk have been inconclusive. Methods: 1,925 MMR gene mutations carriers recruited into the Colon Cancer Family Registry who had completed a questionnaire on lifestyle factors were included. Weighted Cox proportional hazard regression models were used to estimate hazard ratios (HR) and 95% confidence intervals (CI) for the association between alcohol consumption and colorectal cancer. Results: Colorectal cancer was diagnosed in 769 carriers (40%) at a mean (SD) age of 42.6 (10.3) years. Compared with abstention, ethanol consumption from any alcoholic beverage up to 14 g/day and >28 g/day was associated with increased colorectal cancer risk (HR, 1.50; 95% CI, 1.09-2.07 and 1.69; 95% CI, 1.07-2.65, respectively; P trend = 0.05), and colon cancer risk (HR, 1.78; 95% CI, 1.27-2.49 and 1.94; 95% CI, 1.19-3.18, respectively; P trend = 0.02). However, there was no clear evidence for an association with rectal cancer risk. Also, there was no evidence for associations between consumption of individual alcoholic beverage types (beer, wine, spirits) and colorectal, colon, or rectal cancer risk. Conclusions: Our data suggest that alcohol consumption, particularly more than 28 g/day of ethanol (∼2 standard drinks of alcohol in the United States), is associated with increased colorectal cancer risk for MMR gene mutation carriers. Impact: Although these data suggested that alcohol consumption in MMR carriers was associated with increased colorectal cancer risk, there was no evidence of a dose-response, and not all types of alcohol consumption were associated with increased risk. Cancer Epidemiol Biomarkers Prev; 26(3); 366-75. ©2016 AACR . ©2016 American Association for Cancer Research.

  7. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928

  8. Design optimization of ORC systems for waste heat recovery on board a LNG carrier

    Soffiato, Marco; Frangopoulos, Christos A.; Manente, Giovanni; Rech, Sergio; Lazzaretto, Andrea

    2015-01-01

    Highlights: • ORC systems are one of the most promising options to recover low temperature heat. • Design of ORC systems on board a LNG carrier is optimized using the Heatsep method. • Simple, regenerative and two-stage, subcritical and supercritical ORCs are considered. • Three engine cooling systems layouts are found to supply heat to the ORCs. • The highest net power output is achieved by the two-stage ORC configuration. - Abstract: Organic Rankine Cycle (ORC) technology may represent an interesting way to exploit the low grade waste heat rejected by the ship power generation plant. This option is investigated here to recover the heat available from three of the four engines of a real electrically driven Liquefied Natural Gas (LNG) carrier. A detailed analysis of the engines operation is first performed to evaluate all thermal streams released by the engines. Heat associated with the jacket water, lubricating oil and charge air cooling of the engines is found to be available for the ORC, while the heat from the exhaust gases is already used to generate low pressure steam for ship internal use. Simple, regenerative and two-stage ORC configurations are compared using six different organic fluids that are selected as the most suitable for this application. The thermal matching that maximizes the net power output of the total system composed by engine cooling circuits and ORC cycle is then found by searching for the optimum heat transfer between thermal streams independently of the structure/number of the heat exchangers. Three layouts of the engine cooling systems are compared. Results show that the maximum net power output (820 kW) achieved by the two-stage ORC configuration almost doubles the simple cycle and regenerative ones (430–580 kW), but structure complexity and reliability issues may give different indications in terms of economic feasibility

  9. Visual gene developer: a fully programmable bioinformatics software for synthetic gene optimization

    McDonald Karen

    2011-08-01

    Full Text Available Abstract Background Direct gene synthesis is becoming more popular owing to decreases in gene synthesis pricing. Compared with using natural genes, gene synthesis provides a good opportunity to optimize gene sequence for specific applications. In order to facilitate gene optimization, we have developed a stand-alone software called Visual Gene Developer. Results The software not only provides general functions for gene analysis and optimization along with an interactive user-friendly interface, but also includes unique features such as programming capability, dedicated mRNA secondary structure prediction, artificial neural network modeling, network & multi-threaded computing, and user-accessible programming modules. The software allows a user to analyze and optimize a sequence using main menu functions or specialized module windows. Alternatively, gene optimization can be initiated by designing a gene construct and configuring an optimization strategy. A user can choose several predefined or user-defined algorithms to design a complicated strategy. The software provides expandable functionality as platform software supporting module development using popular script languages such as VBScript and JScript in the software programming environment. Conclusion Visual Gene Developer is useful for both researchers who want to quickly analyze and optimize genes, and those who are interested in developing and testing new algorithms in bioinformatics. The software is available for free download at http://www.visualgenedeveloper.net.

  10. Development of a reduction-sensitive diselenide-conjugated oligoethylenimine nanoparticulate system as a gene carrier

    Cheng G

    2012-07-01

    Full Text Available Gang Cheng,1,2 Yiyan He,1 Li Xie,1 Yu Nie,1 Bin He,1 Zhirong Zhang,2 Zhongwei Gu11National Engineering Research Center for Biomaterials, 2Key Laboratory of Drug Targeting and Drug Delivery Systems, West China School of Pharmacy, Sichuan University, Chengdu, Sichuan, People's Republic of ChinaBackground: The reduction-sensitive cationic polymer is a promising nonviral carrier for gene delivery. Until now, disulfide bonds have been the only golden standard for its design. The aim of this research was to develop a novel reduction-responsive cationic polymer as a gene carrier.Methods: Polycationic carriers were synthesized by addition of branched oligoethylenimine 800 Da (OEI800 via an active ester containing diselenide bonds. Disulfide bonds cross-linked with OEI800-SSx and monoselenide bonds linked with OEI800-Sex were synthesized and compared. Their molecular weights and degradation properties were determined using gel permeation chromatography. Changes in particle size, morphology, and DNA binding were investigated by dynamic light scattering, transmission electron microscopy, and electrophoresis assay in a reduction environment. Cytotoxicity and transfection in vitro were evaluated in a murine melanoma cell line (B16F10 and a human cervical epithelial carcinoma cell line (HeLa, while intracellular degradation and dissociation with DNA were studied by confocal laser scanning microscopy with FITC-labeled OEI800 derivatives and Cy5-labeled DNA.Results: Diselenide-conjugated OEI800 (OEI800-Se Sex polymer carriers of high molecular weight were successfully synthesized. After compacting with DNA, the OEI800-SeSex polymers formed nanoparticles with an average size of 140 nm at an adequate C/P ratio. OEI800-Se Sex showed reduction-responsive degradation properties similar to those of the OEI800-SSx via gel permeation chromatography, dynamic light scattering, and transmission electron microscopy. OEI800-SeSex showed much lower cytotoxicity than PEI25k

  11. Correlation of ophthalmic examination with carrier status in females potentially harboring a severe Norrie disease gene mutation.

    Khan, Arif O; Aldahmesh, Mohammed A; Meyer, Brian

    2008-04-01

    To correlate ophthalmic findings with carrier status for a severe Norrie disease (ND) gene mutation (C95F). Prospective interventional case series. Six potential carriers and 1 obligate carrier from a family harboring the mutation. An ophthalmologist blind to the pedigree performed a full ophthalmic examination for the 7 asymptomatic family members. A peripheral blood sample was collected from each for ND gene sequencing. Ophthalmic examination findings (with attention to the presence or absence of retinal findings) and results of ND gene sequencing. Three carriers were identified by molecular genetics, and all 3 of them had peripheral retinal abnormality. However, 3 of the 4 genetically identified noncarriers also exhibited peripheral retinal abnormality. Two of these noncarriers with retinal findings were the offspring of a confirmed noncarrier. The genetically identified noncarrier with a normal peripheral retinal examination was the daughter of an obligate carrier. The presence of peripheral retinal changes was not useful for carrier prediction in a family harboring ND. There are likely additional loci responsible for phenotypic expression.

  12. Carrier Distortion in Hysteretic Self-Oscillating Class-D Audio Power:Amplifiers: Analysis and Optimization

    Høyerby, Mikkel Christian Kofod; Andersen, Michael A. E.

    2009-01-01

    An important distortion mechanism in hysteretic self-oscillating (SO) class-D (switch mode) power amplifiers-–carrier distortion-–is analyzed and an optimization method is proposed. This mechanism is an issue in any power amplifier application where a high degree of proportionality between input and output is required, such as in audio power amplifiers or xDSL drivers. From an average-mode point of view, carrier distortion is shown to be caused by nonlinear variation of the hysteretic compara...

  13. Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes.

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2016-02-01

    Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

  14. A new pathway for developing in vitro nanostructured non-viral gene carriers

    Chu, Benjamin [Chemistry Department, Stony Brook University, Stony Brook, NY 11794-3400 (United States); Liang Dehai [Chemistry Department, Stony Brook University, Stony Brook, NY 11794-3400 (United States); Hadjiargyrou, Michael [Biomedical Engineering Department, Stony Brook University, Stony Brook, NY 11794-3400 (United States); Hsiao, Benjamin S [Chemistry Department, Stony Brook University, Stony Brook, NY 11794-3400 (United States)

    2006-09-13

    Extracellular and intracellular barriers typically prevent the efficient transfection of non-viral gene vectors. The formulation of a gene delivery carrier that can overcome the barriers would be a key for successful gene therapy. We have developed a novel pathway for the preparation of core-shelled DNA nanoparticles by invoking solvent-induced condensation of plasmid DNA ({beta}-galactosidase) in a poor solvent mixture and subsequent encapsulation of the condensed DNA globule in a tri-block copolymer (e.g. polylactide-poly(ethylene glycol)-polylactide, L{sub 8}E{sub 78}L{sub 8}). The polylactide shell can protect the encapsulated DNA from degradation during electrospinning of a mixture of encapsulated DNA nanoparticles and biodegradable PLGA (a random copolymer of lactide and glycolide) to form a non-woven nanofibrous DNA-containing scaffold. The bioactive plasmid DNA can then be released in an intact form and in sufficient quantity from the scaffold with a controlled release rate and to transfect cells in vitro. Further consideration of the stability of the DNA in extracellular and intracellular environments is proposed. In particular, the use of block copolymers with a positively charged block and a hydrophilic block, as well as tri-arm block copolymers with an additional hydrophobic, biodegradable block to stabilize the DNA chain of interest, is discussed.

  15. A novel five-level optimized carrier multilevel PWM quad-inverter six-phase AC drive

    Sanjeevikumar, P.; Blaabjerg, F.; Wheeler, Pat

    2016-01-01

    A novel single carrier pulse-width modulation (PWM) for a new quad-inverter configuration for multilevel six-phase asymmetrical open-winding ac converter is proposed in this article. Modularity of the circuit consist of four standard two-level voltage source inverters (VSIs) with slight modificat......A novel single carrier pulse-width modulation (PWM) for a new quad-inverter configuration for multilevel six-phase asymmetrical open-winding ac converter is proposed in this article. Modularity of the circuit consist of four standard two-level voltage source inverters (VSIs) with slight...... modifications, i.e. one additional bi-direction switch (MOSFET/IGBT) in each phase and a link to neutral with two capacitors to generate increased output levels. Furthermore, original optimal single carrier zero-shifted five-level modulation (SCZSFM) algorithm is developed for each VSI to behave as equivalent...

  16. Exploring the Optimal Strategy to Predict Essential Genes in Microbes

    Yao Lu

    2011-12-01

    Full Text Available Accurately predicting essential genes is important in many aspects of biology, medicine and bioengineering. In previous research, we have developed a machine learning based integrative algorithm to predict essential genes in bacterial species. This algorithm lends itself to two approaches for predicting essential genes: learning the traits from known essential genes in the target organism, or transferring essential gene annotations from a closely related model organism. However, for an understudied microbe, each approach has its potential limitations. The first is constricted by the often small number of known essential genes. The second is limited by the availability of model organisms and by evolutionary distance. In this study, we aim to determine the optimal strategy for predicting essential genes by examining four microbes with well-characterized essential genes. Our results suggest that, unless the known essential genes are few, learning from the known essential genes in the target organism usually outperforms transferring essential gene annotations from a related model organism. In fact, the required number of known essential genes is surprisingly small to make accurate predictions. In prokaryotes, when the number of known essential genes is greater than 2% of total genes, this approach already comes close to its optimal performance. In eukaryotes, achieving the same best performance requires over 4% of total genes, reflecting the increased complexity of eukaryotic organisms. Combining the two approaches resulted in an increased performance when the known essential genes are few. Our investigation thus provides key information on accurately predicting essential genes and will greatly facilitate annotations of microbial genomes.

  17. Population carrier rates of pathogenic ARSA gene mutations: is metachromatic leukodystrophy underdiagnosed?

    Agnieszka Ługowska

    Full Text Available BACKGROUND: Metachromatic leukodystrophy (MLD is a severe neurometabolic disease caused mainly by deficiency of arylsulfatase A encoded by the ARSA gene. Based on epidemiological surveys the incidence of MLD per 100,000 live births varied from 0.6 to 2.5. Our purpose was to estimate the birth prevalence of MLD in Poland by determining population frequency of the common pathogenic ARSA gene mutations and to compare this estimate with epidemiological data. METHODOLOGY: We studied two independently ascertained cohorts from the Polish background population (N∼3000 each and determined carrier rates of common ARSA gene mutations: c.459+1G>A, p.P426L, p.I179S (cohort 1 and c.459+1G>A, p.I179S (cohort 2. PRINCIPAL FINDINGS: Taking into account ARSA gene mutation distribution among 60 Polish patients, the expected MLD birth prevalence in the general population (assuming no selection against homozygous fetuses was estimated as 4.0/100,000 and 4.1/100,000, respectively for the 1(st and the 2(nd cohort with a pooled estimate of 4.1/100,000 (CI: 1.8-9.4 which was higher than the estimate of 0.38 per 100,000 live births based on diagnosed cases. The p.I179S mutation was relatively more prevalent among controls than patients (OR = 3.6, P = 0.0082, for a comparison of p.I179S frequency relative to c.459+1G>A between controls vs. patients. CONCLUSIONS/SIGNIFICANCE: The observed discrepancy between the measured incidence of metachromatic leukodystrophy and the predicted carriage rates suggests that MLD is substantially underdiagnosed in the Polish population. The underdiagnosis rate may be particularly high among patients with p.I179S mutation whose disease is characterized mainly by psychotic symptoms.

  18. Determine the optimal carrier selection for a logistics network based on multi-commodity reliability criterion

    Lin, Yi-Kuei; Yeh, Cheng-Ta

    2013-05-01

    From the perspective of supply chain management, the selected carrier plays an important role in freight delivery. This article proposes a new criterion of multi-commodity reliability and optimises the carrier selection based on such a criterion for logistics networks with routes and nodes, over which multiple commodities are delivered. Carrier selection concerns the selection of exactly one carrier to deliver freight on each route. The capacity of each carrier has several available values associated with a probability distribution, since some of a carrier's capacity may be reserved for various orders. Therefore, the logistics network, given any carrier selection, is a multi-commodity multi-state logistics network. Multi-commodity reliability is defined as a probability that the logistics network can satisfy a customer's demand for various commodities, and is a performance indicator for freight delivery. To solve this problem, this study proposes an optimisation algorithm that integrates genetic algorithm, minimal paths and Recursive Sum of Disjoint Products. A practical example in which multi-sized LCD monitors are delivered from China to Germany is considered to illustrate the solution procedure.

  19. Preparation of Salicylic Acid Loaded Nanostructured Lipid Carriers Using Box-Behnken Design: Optimization, Characterization and Physicochemical Stability.

    Pantub, Ketrawee; Wongtrakul, Paveena; Janwitayanuchit, Wicharn

    2017-01-01

    Nanostructured lipid carriers loaded salicylic acid (NLCs-SA) were developed and optimized by using the design of experiment (DOE). Box-Behnken experimental design of 3-factor, 3-level was applied for optimization of nanostructured lipid carriers prepared by emulsification method. The independent variables were total lipid concentration (X 1 ), stearic acid to Lexol ® GT-865 ratio (X 2 ) and Tween ® 80 concentration (X 3 ) while the particle size was a dependent variable (Y). Box-Behnken design could create 15 runs by setting response optimizer as minimum particle size. The optimized formulation consists of 10% of total lipid, a mixture of stearic acid and capric/caprylic triglyceride at a 4:1 ratio, and 25% of Tween ® 80 which the formulation was applied in order to prepare in both loaded and unloaded salicylic acid. After preparation for 24 hours, the particle size of loaded and unloaded salicylic acid was 189.62±1.82 nm and 369.00±3.37 nm, respectively. Response surface analysis revealed that the amount of total lipid is a main factor which could affect the particle size of lipid carriers. In addition, the stability studies showed a significant change in particle size by time. Compared to unloaded nanoparticles, the addition of salicylic acid into the particles resulted in physically stable dispersion. After 30 days, sedimentation of unloaded lipid carriers was clearly observed. Absolute values of zeta potential of both systems were in the range of 3 to 18 mV since non-ionic surfactant, Tween ® 80, providing steric barrier was used. Differential thermograms indicated a shift of endothermic peak from 55°C for α-crystal form in freshly prepared samples to 60°C for β´-crystal form in storage samples. It was found that the presence of capric/caprylic triglyceride oil could enhance encapsulation efficiency up to 80% and facilitate stability of the particles.

  20. A versatile family of degradable non-viral gene carriers based on hyperbranched poly(ester amine)s

    Zhong, Zhiyuan; Song, Y.; Engbersen, Johannes F.J.; Lok, Martin C.; Hennink, Wim E.; Feijen, Jan

    2005-01-01

    A variety of degradable hyperbranched poly(ester amine)s containing primary, secondary and tertiary amino groups, were synthesized and evaluated as non-viral gene carriers. The polymers were obtained in high yields through a Michael-type conjugate addition of diacrylate monomers with trifunctional

  1. Optimal Scheduling and Operating Target (OPTAR) Cost Model for Aircraft Carriers in the Fleet Response Plan

    York, Michael A

    2008-01-01

    .... This capability is developed through the Fleet Readiness Training Plan (FRTP) where the Navy's carriers are scheduled in staggered 32-month cycles consisting of four phases of progressive readiness levels...

  2. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2015-01-01

    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  3. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  4. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  5. Modeling and optimization of gelatin-chitosan micro-carriers preparation for soft tissue engineering: Using Response Surface Methodology

    Radaei, Payam [Department of Chemical and Petroleum Engineering, Sharif University of Technology, Tehran 11365-8639 (Iran, Islamic Republic of); Mashayekhan, Shohreh, E-mail: mashayekhan@sharif.edu [Department of Chemical and Petroleum Engineering, Sharif University of Technology, Tehran 11365-8639 (Iran, Islamic Republic of); Vakilian, Saeid [Department of Chemical and Petroleum Engineering, Sharif University of Technology, Tehran 11365-8639 (Iran, Islamic Republic of); Stem Cell Technology Research Center, Tehran 1997775555 (Iran, Islamic Republic of)

    2017-06-01

    Electrospray ionization is a wide spread technique for producing polymeric microcarriers (MCs) by applying electrostatic force and ionic cross-linker, simultaneously. In this study, fabrication process of gelatin-chitosan MCs and its optimization using the Response Surface Methodology (RSM) is reported. Gelatin/chitosan (G/C) blend ratio, applied voltage and feeding flow rate, their individual and interaction effects on the diameter and mechanical strength of the MCs were investigated. The obtained models for diameter and mechanical strength of MCs have a quadratic relationship with G/C blend ratio, applied voltage and feeding flow rate. Using the desirability curve, optimized G/C blend ratios that are introduced, include the desirable quantities for MCs diameter and mechanical strength. MCs of the same desirable diameter (350 μm) and different G/C blend ratio (1, 2, and 3) were fabricated and their elasticity was investigated via Atomic Force Microscopy (AFM). The biocompatibility of the MCs was evaluated using MTT assay. The results showed that human Umbilical Cord Mesenchymal Stem Cells (hUCMSCs) could attach and proliferate on fabricated MCs during 7 days of culturing especially on those prepared with G/C blend ratios of 1 and 2. Such gelatin-chitosan MCs may be considered as a promising candidate for injectable tissue engineering scaffolds, supporting attachment and proliferation of hUCMSCs. - Highlights: • Gelatin-chitosan Micro-carriers fabricated by electrospray ionization method. • The effects of blend ratio, the syringe feeding rate, and voltage on micro-carrier optimization were investigated via RSM. • Both diameter and mechanical strength of Micro-carriers have a quadratic relationship with selected parameters. • The optimum conditions with fixed diameter of 350μm and maximized strength in different blend ratios were achieved. • The elasticity and biocompatibility of desirable fabricated micro-carriers characterized.

  6. Low cytotoxicity effect of dendrosome as an efficient carrier for rotavirus VP2 gene transferring into a human lung cell line : dendrosome, as a novel intranasally gene porter.

    Pourasgari, Farzaneh; Ahmadian, Shahin; Salmanian, Ali Hatef; Sarbolouki, Mohammad Nabi; Massumi, Mohammad

    2009-01-01

    The efficiency of dendrosome (a gene porter) was assessed in transferring recombinant human rotavirus VP2 cDNA into A549, a human lung cell line. After gene transferring, transmission electron microscopy showed core-like particles (CLPs) formation in the transfected cells both with dendrosome and lipofectamine porters. In addition, western blotting analysis showed that the expression of VP2 gene was almost equal in the dendrosome and lipofectamine-transfected cells. Also, the cytotoxicity studies revealed that dendrosome had a lower cytotoxicity than lipofectamine. Therefore, our study may introduce dendrosome as a possible carrier for gene transferring into the human lung cell line, especially, for intranasally administration of DNA vaccines.

  7. Synthesis and evaluation of a glutamic acid-modified hPAMAM complex as a promising versatile gene carrier.

    Hemmati, Mohammad; Kazemi, Bahram; Najafi, Farhood; Zarebkohan, Amir; Shirkoohi, Reza

    2016-01-01

    Hyperbranched poly(amidoamine) (HPAMAM), structurally analogous to polyamidoamine dendrimer (PAMAM) dendrimers, has been suggested to be an effective carrier for gene delivery. In the present study, glutamic acid-modified hPAMAM was developed as a novel non-viral gene carrier for the first time. The hPAMAM was synthesized by using a modified one-pot method. DNA was found to be bound to hPAMAM at different weight ratios (WhPAMAM/WDNA). The resulting HPAMAM-Glu20 was able to efficiently protect the encapsulated-DNA against degradation for over 2 h. In addition to low cytotoxicity, the transfection efficiency of hPAMAM-Glu20 represented much higher (p glutamic amino acid (Glu)-based gene delivery is an economical, effective and biocompatible method.

  8. Peripheral retinopathy in offspring of carriers of Norrie disease gene mutations. Possible transplacental effect of abnormal Norrin.

    Mintz-Hittner, H A; Ferrell, R E; Sims, K B; Fernandez, K M; Gemmell, B S; Satriano, D R; Caster, J; Kretzer, F L

    1996-12-01

    The Norrie disease (ND) gene (Xp11.3) (McKusick 310600) consists of one untranslated exon and two exons partially translated as the Norrie disease protein (Norrin). Norrin has sequence homology and computer-predicted tertiary structure of a growth factor containing a cystine knot motif, which affects endothelial cell migration and proliferation. Norrie disease (congenital retinal detachment), X-linked primary retinal dysplasia (congenital retinal fold), and X-linked exudative vitreoretinopathy (congenital macular ectopia) are allelic disorders. Blood was drawn for genetic studies from members of two families to test for ND gene mutations. Sixteen unaffected family members were examined ophthalmologically. If any retinal abnormality were identified, fundus photography and fluorescein angiography was performed. Family A had ND (R109stp), and family B had X-linked exudative vitreoretinopathy (R121L). The retinas of 11 offspring of carrier females were examined: three of seven carrier females, three of three otherwise healthy females, and one of one otherwise healthy male had peripheral inner retinal vascular abnormalities. The retinas of five offspring of affected males were examined: none of three carrier females and none of two otherwise healthy males had this peripheral retinal finding. Peripheral inner retinal vascular abnormalities similar to regressed retinopathy of prematurity were identified in seven offspring of carriers of ND gene mutations in two families. These ophthalmologic findings, especially in four genetically healthy offspring, strongly support the hypothesis that abnormal Norrin may have an adverse transplacental (environmental) effect on normal inner retinal vasculogenesis.

  9. Recycling Gene Carrier with High Efficiency and Low Toxicity Mediated by L-Cystine-Bridged Bis(β-cyclodextrin)s

    Zhang, Yu-Hui; Chen, Yong; Zhang, Ying-Ming; Yang, Yang; Chen, Jia-Tong; Liu, Yu

    2014-12-01

    Constructing safe and effective gene delivery carriers is becoming highly desirable for gene therapy. Herein, a series of supramolecular crosslinking system were prepared through host-guest binding of adamantyl-modified low molecular weight of polyethyleneimine with L-cystine-bridged bis(β-cyclodextrin)s and characterized by 1H NMR titration, electron microscopy, zeta potential, dynamic light-scattering, gel electrophoresis, flow cytometry and confocal fluorescence microscopy. The results showed that these nanometersized supramolecular crosslinking systems exhibited higher DNA transfection efficiencies and lower cytotoxicity than the commercial DNA carrier gold standard (25 kDa bPEI) for both normal cells and cancer cells, giving a very high DNA transfection efficiency up to 54% for 293T cells. Significantly, this type of supramolecular crosslinking system possesses a number of enzyme-responsive disulfide bonds, which can be cleaved by reductive enzyme to promote the DNA release but recovered by oxidative enzyme to make the carrier renewable. These results demonstrate that these supramolecular crosslinking systems can be used as promising gene carriers.

  10. Cancer risk and survival in path_MMR carriers by gene and gender up to 75 years of age

    Møller, Pål; Seppälä, Toni; Bernstein, Inge

    2017-01-01

    BACKGROUND: Most patients with path_MMR gene variants (Lynch syndrome (LS)) now survive both their first and subsequent cancers, resulting in a growing number of older patients with LS for whom limited information exists with respect to cancer risk and survival. OBJECTIVE AND DESIGN......%, duodenum 67%, stomach 61%, bile duct 29%, brain 22% and pancreas 0%. Path_PMS2 carriers had lower risk for cancer. CONCLUSION: Carriers of different path_MMR variants exhibit distinct patterns of cancer risk and survival as they age. Risk estimates for counselling and planning of surveillance and treatment...

  11. Optimizing inspection intervals—Reliability and availability in terms of a cost model: A case study on railway carriers

    Wolde, Mike ten; Ghobbar, Adel A.

    2013-01-01

    This paper states the problem that railway carriers have with inspections and maintenance in its most cost optimal way. Often there is external pressure to improve reliability and availability and to reduce costs significantly. To overcome this problem this paper suggests a model that tries to find the optimal inspection interval. Not all maintenance companies have their inspection intervals that match with the actual reliability of a system anymore and the inspection intervals are not necessarily at a cost optimum. This research retrieves the actual failure and repair data and combines this together with the availability of a system to find the optimum inspection interval in terms of costs. The application of the optimization approach to a railway carrier maintenance company in the Netherlands is also presented. -- Highlights: ► New optimization technique for reliability and availability by minimizing costs. ► Adaptable to multiple types of repairs. ► Usable as a practical model. ► Applicable to the FMECA, RCM and ISO31000 risk management methods

  12. Incidence and Carrier Frequency of CFTR Gene Mutations in Pregnancies With Echogenic Bowel in Nova Scotia and Prince Edward Island.

    Miller, Michelle E; Allen, Victoria M; Brock, Jo-Ann K

    2018-03-01

    Fetal echogenic bowel (echogenic bowel) is associated with cystic fibrosis (CF), with a reported incidence ranging from 1% to 13%. Prenatal testing for CF in the setting of echogenic bowel can be done by screening parental or fetal samples for pathogenic CFTR variants. If only one pathogenic variant is identified, sequencing of the CFTR gene can be undertaken, to identify a second pathogenic variant not covered in the standard screening panel. Full gene sequencing, however, also introduces the potential to identify variants of uncertain significance (VUSs) that can create counselling challenges and cause parental anxiety. To provide accurate counselling for families in the study population, the incidence of CF associated with echogenic bowel and the carrier frequency of CFTR variants were investigated. All pregnancies for which CF testing was undertaken for the indication of echogenic bowel (from Nova Scotia and Prince Edward Island) were identified (January 2007-July 2017). The CFTR screening and sequencing results were reviewed, and fetal outcomes related to CF were assessed. A total of 463 pregnancies with echogenic bowel were tested. Four were confirmed to be affected with CF, giving an incidence of 0.9% in this cohort. The carrier frequency of CF among all parents in the cohort was 5.0% (1 in 20); however, when excluding parents of affected fetuses, the carrier frequency for the population was estimated at 4.1% (1 in 25). CFTR gene sequencing identified an additional VUS in two samples. The incidence of CF in pregnancies with echogenic bowel in Nova Scotia and Prince Edward Island is 0.9%, with an estimated population carrier frequency of 4.1%. These results provide the basis for improved counselling to assess the risk of CF in the pregnancy, after parental carrier screening, using Bayesian probability. Counselling regarding VUSs should be undertaken before gene sequencing. Copyright © 2017 Society of Obstetricians and Gynaecologists of Canada. Published by

  13. Optimization of carrier multiplication for more effcient solar cells: the case of Sn quantum dots.

    Allan, Guy; Delerue, Christophe

    2011-09-27

    We present calculations of impact ionization rates, carrier multiplication yields, and solar-power conversion efficiencies in solar cells based on quantum dots (QDs) of a semimetal, α-Sn. Using these results and previous ones on PbSe and PbS QDs, we discuss a strategy to select QDs with the highest carrier multiplication rate for more efficient solar cells. We suggest using QDs of materials with a close to zero band gap and a high multiplicity of the bands in order to favor the relaxation of photoexcited carriers by impact ionization. Even in that case, the improvement of the maximum solar-power conversion efficiency appears to be a challenging task. © 2011 American Chemical Society

  14. Operational freight carrier planning basic concepts, optimization models and advanced memetic algorithms

    Schönberger, Jörn

    2005-01-01

    The modern freight carrier business requires a sophisticated automatic decision support in order to ensure the efficiency and reliability and therefore the survival of transport service providers. This book addresses these challenges and provides generic decision models for the short-term operations planning as well as advanced metaheuristics to obtain efficient operation plans. After a thorough analysis of the operations planning in the freight carrier business, decision models are derived. Their suitability is proven within a large number of numerical experiments, in which a new class of hybrid genetic search approaches demonstrate their appropriateness.

  15. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  16. The significance of circumscribed malignant mammographic masses in the surveillance of BRCA 1/2 gene mutation carriers

    Kaas, R.; Kroger, R.; Besnard, A.P.E.; Koops, W.; Pameijer, F.A.; Prevoo, W.; Loo, C.E.; Muller, S.H.; Hendriks, J.H.C.L.

    2004-01-01

    Breast cancers in gene mutation carriers may escape mammographic detection because of rapid growth and tumor expansion. Therefore, they may mimic benign lesions on the mammogram. Twenty-nine BRCA 1/2 mutation carriers under surveillance developed 31 breast cancers between 1994 and 2001 at a mean age of 44.2 years. Controls were 63 women with 67 breast cancers in the same period at a mean age of 53.8 years, also under surveillance because of a life time risk of at least 15%. In 26% of the carriers vs. 48% of the controls, mammography was the method that first suspected a malignancy. Seven radiologists performed a retrospective review of the original mammograms to establish technical assessment, with special attention for circumscribed lesions and estimated probability of malignancy. In the mutation carriers seven (23%) circumscribed non-calcified mammographic masses were found and three in the controls (4.5%) P=0.01. These masses were proven to be malignant. In both groups around 70% of these fast-growing circumscribed lesions were detected by the patients. The masses were situated in breasts with a good interpretable breast pattern. BRCA 1/2 mutation carriers had a significantly higher percentage of circumscribed non-calcified mammographic masses that proved to be malignant. These mammographic lesions in women at high risk should be described as at least Birads 0 and worked-up with ultrasound and needle biopsy. (orig.)

  17. Conformation and activity alteration of horseradish peroxidase induced by the interaction with gene carrier polyethyleneimines

    Huang, Aimin; Wei, Bangzhi; Mo, Junyong; Wang, Yajing; Ma, Lin

    2018-01-01

    Polyethyleneimine (PEI) has long been considered as "golden standard" for polymeric gene delivery carriers. However the molecular basis of the cytotoxicity of PEI is poorly understood. Little is known about the effects of PEI on the structure and functions of biomacromolecules. In this work, fluorescence, UV-vis absorption, circular dichroism spectroscopy were conducted to investigate the influence of PEI of average molecular weight 25, 10 and 1.8 kDa (denoted as PEI25k, PEI10k and PEI1.8k) on the conformation of horseradish peroxidase (HRP) and its catalytic efficiency. Zeta-potential measurement and isothermal titration calorimetry were used to reveal the mechanism of the interaction between PEIs and HRP. PEIs were found to bind onto the surface of HRP predominantly via hydrophobic interaction and hydrogen bond or van der Waals interaction. The complex formation between HRP and PEI induced a more compact conformation of the enzyme and an increased hydrophobicity of the microenvironment surrounding heme pocket. The conformational change of HRP had little impact on the affinity towards H2O2 and phenol. However, the increase in the non-planarity of porphyrin ring in the heme group led to an increase in the exposure degree of the active center and thus an enhancement of catalytic efficiency of HRP in the presence of high molecular weight PEIs (PEI25k and PEI10k). The polymer size played an important role in PEI-HRP interaction. PEI of low molecular weight (PEI1.8k) was less efficient to alter the conformation and catalytic activity of HRP in aqueous solutions.

  18. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

    Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

    2016-01-01

    Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

  19. Lactose carrier protein of Escherichia coli. Structure and expression of plasmids carrying the Y gene of the lac operon.

    Teather, R M; Bramhall, J; Riede, I; Wright, J K; Fürst, M; Aichele, G; Wilhelm, U; Overath, P

    1980-01-01

    The previously described hybrid plasmid pC7 which carries lacI+O+delta(Z)Y+A+ on a 12.3 X 10(6)-Mr DNA fragment [Teather et al. (1978) Mol. Gen. Genet. 159, 239-248] was partially digested with the restriction endonuclease EcoRI under conditions reducing the recognition sequence to d(A-A-T-T) and ligated to the vector pB322. lac Y-carrying inserts of various sized (Mr 1.5-4.7 X 10(6)) were obtained. Hybrid plasmid pTE18 (2300-base-pair insert) carries part of the I (repressor) gene, the promotor-operator region, part of the Z (beta-galactosidase) gene, the Y (lactose carrier) gene and part of the A (transacetylase) gene. Upon induction of pTE18-harbouring strains the Y-gene product is expressed at a nearly constant rate for several generations and accumulates to a level of 12-16% of the total cytoplasmic membrane protein. Integration into the membrane leads to active carrier as judged by binding and transport measurements.

  20. A metaheuristic optimization framework for informative gene selection

    Kaberi Das

    Full Text Available This paper presents a metaheuristic framework using Harmony Search (HS with Genetic Algorithm (GA for gene selection. The internal architecture of the proposed model broadly works in two phases, in the first phase, the model allows the hybridization of HS with GA to compute and evaluate the fitness of the randomly selected solutions of binary strings and then HS ranks the solutions in descending order of their fitness. In the second phase, the offsprings are generated using crossover and mutation operations of GA and finally, those offsprings were selected for the next generation whose fitness value is more than their parents evaluated by SVM classifier. The accuracy of the final gene subsets obtained from this model has been evaluated using SVM classifiers. The merit of this approach is analyzed by experimental results on five benchmark datasets and the results showed an impressive accuracy over existing feature selection approaches. The occurrence of gene subsets selected from this model have also been computed and the most often selected gene subsets with the probability of [0.1–0.9] have been chosen as optimal sets of informative genes. Finally, the performance of those selected informative gene subsets have been measured and established through probabilistic measures. Keywords: Gene Selection, Metaheuristic, Harmony Search Algorithm, Genetic Algorithm, SVM

  1. Transethosomal gels as carriers for the transdermal delivery of colchicine: statistical optimization, characterization, and ex vivo evaluation.

    Abdulbaqi, Ibrahim M; Darwis, Yusrida; Assi, Reem Abou; Khan, Nurzalina Abdul Karim

    2018-01-01

    Colchicine is used for the treatment of gout, pseudo-gout, familial Mediterranean fever, and many other illnesses. Its oral administration is associated with poor bioavailability and severe gastrointestinal side effects. The drug is also known to have a low therapeutic index. Thus to overcome these drawbacks, the transdermal delivery of colchicine was investigated using transethosomal gels as potential carriers. Colchicine-loaded transethosomes (TEs) were prepared by the cold method and statistically optimized using three sets of 24 factorial design experiments. The optimized formulations were incorporated into Carbopol 940 ® gel base. The prepared colchicine-loaded transethosomal gels were further characterized for vesicular size, dispersity, zeta potential, drug content, pH, viscosity, yield, rheological behavior, and ex vivo skin permeation through Sprague Dawley rats' back skin. The results showed that the colchicine-loaded TEs had aspherical irregular shape, nanometric size range, and high entrapment efficiency. All the formulated gels exhibited non-Newtonian plastic flow without thixotropy. Colchicine-loaded transethosomal gels were able to significantly enhance the skin permeation parameters of the drug in comparison to the non-ethosomal gel. These findings suggested that the transethosomal gels are promising carriers for the transdermal delivery of colchicine, providing an alternative route for drug administration.

  2. Transethosomal gels as carriers for the transdermal delivery of colchicine: statistical optimization, characterization, and ex vivo evaluation

    Abdulbaqi IM

    2018-04-01

    Full Text Available Ibrahim M Abdulbaqi, Yusrida Darwis, Reem Abou Assi, Nurzalina Abdul Karim Khan School of Pharmaceutical Sciences, Universiti Sains Malaysia, Minden, Penang, Malaysia Introduction: Colchicine is used for the treatment of gout, pseudo-gout, familial Mediterranean fever, and many other illnesses. Its oral administration is associated with poor bioavailability and severe gastrointestinal side effects. The drug is also known to have a low therapeutic index. Thus to overcome these drawbacks, the transdermal delivery of colchicine was investigated using transethosomal gels as potential carriers.Methods: Colchicine-loaded transethosomes (TEs were prepared by the cold method and statistically optimized using three sets of 24 factorial design experiments. The optimized formulations were incorporated into Carbopol 940® gel base. The prepared colchicine-loaded transethosomal gels were further characterized for vesicular size, dispersity, zeta potential, drug content, pH, viscosity, yield, rheological behavior, and ex vivo skin permeation through Sprague Dawley rats’ back skin.Results: The results showed that the colchicine-loaded TEs had aspherical irregular shape, nanometric size range, and high entrapment efficiency. All the formulated gels exhibited non-Newtonian plastic flow without thixotropy. Colchicine-loaded transethosomal gels were able to significantly enhance the skin permeation parameters of the drug in comparison to the non-ethosomal gel.Conclusion: These findings suggested that the transethosomal gels are promising carriers for the transdermal delivery of colchicine, providing an alternative route for drug administration. Keywords: transethosomes, ethosomal nanocarriers, colchicine, factorial design, skin permeation, rheology

  3. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia); Slamka, Tomas; Martinicky, David; Ilencikova, Denisa [National Cancer Institute, Department of Oncologic Genetics, Klenova 1, 833 01 Bratislava (Slovakia); Bartosova, Zdena [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia)

    2009-11-20

    Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or

  4. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    Ilencikova Denisa

    2009-11-01

    Full Text Available Abstract Background Depending on the population studied, large genomic rearrangements (LGRs of the mismatch repair (MMR genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC. It has been reported that loss of heterozygosity (LOH at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. Methods The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. Results We found six rearrangements in the MSH2 gene (five deletions and dup5-6, and one aberration in the MLH1 gene (del5-6. The MSH2 deletions were of three types (del1, del1-3, del1-7. We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. Conclusion LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1

  5. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova; Slamka, Tomas; Martinicky, David; Ilencikova, Denisa; Bartosova, Zdena

    2009-01-01

    Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or

  6. Exposure to diagnostic radiation and risk of breast cancer among carriers of BRCA1/2 mutations: retrospective cohort study (GENE-RAD-RISK)

    Pijpe, Anouk; Andrieu, Nadine; Easton, Douglas F.; Kesminiene, Ausrele; Cardis, Elisabeth; Noguès, Catherine; Gauthier-Villars, Marion; Lasset, Christine; Fricker, Jean-Pierre; Peock, Susan; Frost, Debra; Evans, D. Gareth; Eeles, Rosalind A.; Paterson, Joan; Manders, Peggy; van Asperen, Christi J.; Ausems, Margreet G. E. M.; Meijers-Heijboer, Hanne; Thierry-Chef, Isabelle; Hauptmann, Michael; Goldgar, David; Rookus, Matti A.; van Leeuwen, Flora E.; Fourme, Emmanuelle; Lidereau, Rosette; Stevens, Denise; Stoppa-Lyonnet, Dominique; Chompret, Agnès; Berthet, Pascaline; Luporsi, Elisabeth; Bonadona, Valérie; Gauducheau, René; de Sienne, Catherine; Lortholary, Alain; Frénay, Marc; Faivre, Laurence; Sobol, Hagay; Huiart, Laetitia; Longy, Michel; Nguyen, Tan Dat; Gladieff, Laurence; Guimbaud, Rosine; Gesta, Paul; Vennin, Philippe; Adenis, Claude; Chevrier, Annie; Rossi, Annick; Perrin, Jean; Bignon, Yves-Jean; Limacher, Jean-Marc; Dugast, Catherine; Courlancy, Polyclinique; Demange, Liliane; Zattara-Cannoni, Hélène; Dreyfus, Hélène; Noruzinia, Mehrdad; Venat-Bouvet, Laurence; Cook, Margaret; Oliver, Clare; Gregory, Helen; Cole, Trevor; Burgess, Lucy; Rogers, Mark; Hughes, Lisa; Brewer, Carole; Davidson, Rosemarie; Bradshaw, Nicola; Izatt, Louise; Pichert, Gabriella; Langman, Caroline; Chu, Carol; Miller, Julie; Evans, Gareth; Lalloo, Fiona; Shenton, Andrew; Side, Lucy; Bancroft, Elizabeth; Page, Elizabeth; Castro, Elena; Houlston, Richard; Rahman, Nazneen; Shanley, Susan; Cook, Jackie; Baxter, Lauren; Hodgson, Shirley; Goff, Sheila; Eccles, Diana; Verhoef, Senno; Brohet, Richard; Hogervorst, Frans; van 't Veer, Laura; van Leeuwen, Flora; Rookus, Matti; Collée, Margriet; van den Ouweland, Ans; Kriege, Mieke; Schutte, Mieke; Hooning, Maartje; Seynaeve, Caroline; Tollenaar, Rob; van Asperen, Christi; Wijnen, Juul; Devilee, Peter; Ligtenberg, Marjolijn; Ausems, Margreet; van der Luijt, Rob; Aalfs, Cora; van Os, Theo; Gille, Hans; Gomez-Garcia, Encarna; Blok, Rien; Oosterwijk, Jan; van der Hout, Annemiek; Vasen, Hans; van Leeuwen, Inge

    2012-01-01

    To estimate the risk of breast cancer associated with diagnostic radiation in carriers of BRCA1/2 mutations. Retrospective cohort study (GENE-RAD-RISK). Three nationwide studies (GENEPSO, EMBRACE, HEBON) in France, United Kingdom, and the Netherlands, 1993 female carriers of BRCA1/2 mutations

  7. Medium optimization for nuclease P1 production by Penicillium citrinum in solid-state fermentation using polyurethane foam as inert carrier

    Zhu, Y.; Knol, W.; Smits, J.P.; Bol, J.

    1996-01-01

    A solid-state fermentation system, using polyurethane foam as an inert carrier, was used for the production of nuclease P1 by Penicillium citrinum. Optimization of nuclease P1 production was carried out using a synthetic liquid medium. After a two-step medium optimization using a fractional

  8. General method for simultaneous optimization of light trapping and carrier collection in an ultra-thin film organic photovoltaic cell

    Tsai, Cheng-Chia, E-mail: ct2443@columbia.edu; Grote, Richard R.; Beck, Jonathan H.; Kymissis, Ioannis [Department of Electrical Engineering, Columbia University, New York, New York 10027 (United States); Osgood, Richard M. [Department of Electrical Engineering, Columbia University, New York, New York 10027 (United States); Department of Applied Physics and Applied Mathematics, Columbia University, New York, New York 10027 (United States); Englund, Dirk [Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

    2014-07-14

    We describe a general method for maximizing the short-circuit current in thin planar organic photovoltaic (OPV) heterojunction cells by simultaneous optimization of light absorption and carrier collection. Based on the experimentally obtained complex refractive indices of the OPV materials and the thickness-dependence of the internal quantum efficiency of the OPV active layer, we analyze the potential benefits of light trapping strategies for maximizing the overall power conversion efficiency of the cell. This approach provides a general strategy for optimizing the power conversion efficiency of a wide range of OPV structures. In particular, as an experimental trial system, the approach is applied here to a ultra-thin film solar cell with a SubPc/C{sub 60} photovoltaic structure. Using a patterned indium tin oxide (ITO) top contact, the numerically optimized designs achieve short-circuit currents of 0.790 and 0.980 mA/cm{sup 2} for 30 nm and 45 nm SubPc/C{sub 60} heterojunction layer thicknesses, respectively. These values correspond to a power conversion efficiency enhancement of 78% for the 30 nm thick cell, but only of 32% for a 45 nm thick cell, for which the overall photocurrent is actually higher. Applied to other material systems, the general optimization method can elucidate if light trapping strategies can improve a given cell architecture.

  9. Liposome-based DNA carriers may induce cellular stress response and change gene expression pattern in transfected cells

    2011-01-01

    Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1) gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA), Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i) some cationic liposomes may not be suitable for functional studies on hsp promoters, ii) lipofection may cause unintended changes in global gene expression in the transfected cells. PMID:21663599

  10. Liposome-based DNA carriers may induce cellular stress response and change gene expression pattern in transfected cells

    Lisowska Katarzyna Marta

    2011-06-01

    Full Text Available Abstract Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1 gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA, Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i some cationic liposomes may not be suitable for functional studies on hsp promoters, ii lipofection may cause unintended changes in global gene expression in the transfected cells.

  11. DOE Optimization of Nano-based Carrier of Pregabalin as Hydrogel: New Therapeutic & Chemometric Approaches for Controlled Drug Delivery Systems

    Arafa, Mona G.; Ayoub, Bassam M.

    2017-01-01

    Niosomes entrapping pregabalin (PG) were prepared using span 60 and cholesterol in different molar ratios by hydration method, the remaining PG from the hydrating solution was separated from vesicles by freeze centrifugation. Optimization of nano-based carrier of pregabalin (PG) was achieved. Quality by Design strategy was successfully employed to obtain PG-loaded niosomes with the desired properties. The optimal particle size, drug release and entrapment efficiency were attained by Minitab® program using design of experiment (DOE) that predicted the best parameters by investigating the combined effect of different factors simultaneously. Pareto chart was used in the screening step to exclude the insignificant variables while response surface methodology (RSM) was used in the optimization step to study the significant factors. Best formula was selected to prepare topical hydrogels loaded with niosomal PG using HPMC and Carbopol 934. It was verified, by means of mechanical and rheological tests, that addition of the vesicles to the gel matrix affected significantly gel network. In vitro release and ex vivo permeation experiments were carried out. Delivery of PG molecules followed a Higuchi, non Fickian diffusion. The present work will be of interest for pharmaceutical industry as a controlled transdermal alternative to the conventional oral route.

  12. GPAW optimized for Blue Gene/P using hybrid programming

    Kristensen, Mads Ruben Burgdorff; Happe, Hans Henrik; Vinter, Brian

    2009-01-01

    In this work we present optimizations of a Grid-based projector-augmented wave method software, GPAW for the Blue Gene/P architecture. The improvements are achieved by exploring the advantage of shared and distributed memory programming also known as hybrid programming. The work focuses on optimi......In this work we present optimizations of a Grid-based projector-augmented wave method software, GPAW for the Blue Gene/P architecture. The improvements are achieved by exploring the advantage of shared and distributed memory programming also known as hybrid programming. The work focuses...... on optimizing a very time consuming operation in GPAW, the finite-different stencil operation, and different hybrid programming approaches are evaluated. The work succeeds in demonstrating a hybrid programming model which is clearly beneficial compared to the original flat programming model. In total...... an improvement of 1.94 compared to the original implementation is obtained. The results we demonstrate here are reasonably general and may be applied to other finite difference codes....

  13. The arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier

    Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.

    1998-01-01

    Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.

  14. Optimization of white organic light emitting diodes based on emitting layer charge carrier conduction properties

    Baek, H I; Lee, C H

    2008-01-01

    We have fabricated white organic light emitting diodes (OLEDs) with multi-emitting layer (EML) structures in which 4,4'-N,N'-dicarbazole-biphenyl (CBP) layers doped with the phosphorescent dopants fac-tris(2-phenylpyridine) iridium (Ir(ppy) 3 ) and bis(2-(2'-benzo[4,5-a]thienyl)pyridinato-N,C3')iridium(acetylacetonate) (btp 2 Ir(acac)) and the fluorescent dopant 4,4'-bis[2-{4-(N,N-diphenylamino) phenyl}vinyl]biphenyl (DPAVBi) were used as green (G), red (R) and blue (B) EMLs, respectively. A higher efficiency was expected with the R/G/B EML sequence from the hole transport layer interface than with the G/R/B sequence because of the differences in the charge carrier conduction properties of the EMLs doped with phosphorescent dopants and the luminance balance between the phosphorescent and fluorescent emissions. A high efficiency of 18.3 cd A -1 (an external quantum efficiency of 8.5%) at 100 cd m -2 and good colour stability were achieved with the R/G/B EML sequence as expected, with an additional non-doped CBP interlayer used between the G and B EMLs. In addition, the OLED with this sequence was found to have the longest lifetime of the white devices we tested

  15. Optimization of white organic light emitting diodes based on emitting layer charge carrier conduction properties

    Baek, H I; Lee, C H [School of Electrical Engineering and Computer Science and Inter-University Semiconductor Research Center, Seoul National University, Seoul 151-744 (Korea, Republic of)], E-mail: hibaek75@snu.ac.kr

    2008-05-21

    We have fabricated white organic light emitting diodes (OLEDs) with multi-emitting layer (EML) structures in which 4,4'-N,N'-dicarbazole-biphenyl (CBP) layers doped with the phosphorescent dopants fac-tris(2-phenylpyridine) iridium (Ir(ppy){sub 3}) and bis(2-(2'-benzo[4,5-a]thienyl)pyridinato-N,C3')iridium(acetylacetonate) (btp{sub 2}Ir(acac)) and the fluorescent dopant 4,4'-bis[2-{l_brace}4-(N,N-diphenylamino) phenyl{r_brace}vinyl]biphenyl (DPAVBi) were used as green (G), red (R) and blue (B) EMLs, respectively. A higher efficiency was expected with the R/G/B EML sequence from the hole transport layer interface than with the G/R/B sequence because of the differences in the charge carrier conduction properties of the EMLs doped with phosphorescent dopants and the luminance balance between the phosphorescent and fluorescent emissions. A high efficiency of 18.3 cd A{sup -1} (an external quantum efficiency of 8.5%) at 100 cd m{sup -2} and good colour stability were achieved with the R/G/B EML sequence as expected, with an additional non-doped CBP interlayer used between the G and B EMLs. In addition, the OLED with this sequence was found to have the longest lifetime of the white devices we tested.

  16. Cancer spectrum in DNA mismatch repair gene mutation carriers: results from a hospital based Lynch syndrome registry.

    Pande, Mala; Wei, Chongjuan; Chen, Jinyun; Amos, Christopher I; Lynch, Patrick M; Lu, Karen H; Lucio, Laura A; Boyd-Rogers, Stephanie G; Bannon, Sarah A; Mork, Maureen E; Frazier, Marsha L

    2012-09-01

    The spectrum of cancers seen in a hospital based Lynch syndrome registry of mismatch repair gene mutation carriers was examined to determine the distribution of cancers and examine excess cancer risk. Overall there were 504 cancers recorded in 368 mutation carriers from 176 families. These included 236 (46.8 %) colorectal and 268 (53.2 %) extracolonic cancers. MLH1 mutation carriers had a higher frequency of colorectal cancers whereas MSH2, MSH6 and PMS2 mutation carriers had more extracolonic cancers although these differences were not statistically significant. Men had fewer extracolonic cancers than colorectal (45.3 vs. 54.7 %), whereas women had more extracolonic than colorectal cancers (59.0 vs. 41.0 %). The mean age at diagnosis overall for extracolonic cancers was older than for colorectal, 49.1 versus 44.8 years (P ≤ 0.001). As expected, the index cancer was colorectal in 58.1 % of patients and among the extracolonic index cancers, endometrial was the most common (13.8 %). A significant number of non-Lynch syndrome index cancers were recorded including breast (n = 5) prostate (n = 3), thyroid (n = 3), cervix (n = 3), melanoma (n = 3), and 1 case each of thymoma, sinus cavity, and adenocarcinoma of the lung. However, standardized incidence ratios calculated to assess excess cancer risk showed that only those cancers known to be associated with Lynch syndrome were significant in our sample. We found that Lynch syndrome patients can often present with cancers that are not considered part of Lynch syndrome. This has clinical relevance both for diagnosis of Lynch syndrome and surveillance for cancers of different sites during follow-up of these patients.

  17. Cold water for tyre production. Carrier: Intelligent solutions for optimal energy use; Kaltes Wasser fuer heisse Reifen. Carrier: Intelligente Loesungen zur optimalen Energienutzung

    Anon.

    2009-01-15

    Especially when it comes to special solutions for specific applications, this will show how well man and machine are working together. In a production plant of Michelin Reifenwerke at Bad Kreuznach, Carrier installed two absorption refrigerators, in cooperation with further specialist partners. Instead of electric power, the machines utilize waste heat of the production process. (orig.)

  18. Studies on guanidinated N-3-aminopropyl methacrylamide-N-2-hydroxypropyl methacrylamide co-polymers as gene delivery carrier.

    Qin, Zhu; Liu, Wei; Guo, Liang; Li, Xinsong

    2012-01-01

    Guanidinated N-3-aminopropyl methacrylamide (APMA)-N-2-hydroxypropyl methacrylamide (HPMA) co-polymers were prepared and evaluated to develop novel non-viral gene transfection carriers. The co-polymers were synthesized via radical co-polymerization of APMA and HPMA followed by total guanidination of amino groups, which employed guanidinated APMA (GPMA) for increasing cell-penetrating and HPMA as the positive shielding content. The molecular weight of guanidinated APMA-HPMA co-polymers (GPMA-HPMA) was determined by static light scattering. Furthermore, cytotoxicity and transfection experiments of GPMA-HPMA/pDNA complexes were conducted. A significant decrease of their parent cytotoxicity and an efficient transfection at relative low charge ratios were observed. The cellular distribution of most GPMA-HPMA/pDNA complexes was partially localized in the nucleus, as indicated by confocal laser scanning microscopy. The guanidination strategy employed may lead to non-viral gene delivery carriers that combine satisfactory transfection efficiency and cytotoxicity, which contribute to their cell-penetrating ability.

  19. Development and optimization of transferrin-conjugated nanostructured lipid carriers for brain delivery of paclitaxel using Box-Behnken design.

    Emami, Jaber; Rezazadeh, Mahboubeh; Sadeghi, Hojjat; Khadivar, Khashayar

    2017-05-01

    The treatment of brain cancer remains one of the most difficult challenges in oncology. The purpose of this study was to develop transferrin-conjugated nanostructured lipid carriers (Tf-NLCs) for brain delivery of paclitaxel (PTX). PTX-loaded NLCs (PTX-NLCs) were prepared using solvent evaporation method and the impact of various formulation variables were assessed using Box-Behnken design. Optimized PTX-NLC was coupled with transferrin as targeting ligand and in vitro cytotoxicity of it was investigated against U-87 brain cancer cell line. As a result, 14.1 mg of cholesterol, 18.5 mg of triolein, and 0.5% poloxamer were used to prepare the optimal formulation. Mean particle size (PS), zeta potential (ZP), entrapment efficiency (EE), drug loading (DL), mean release time (MRT) of adopted formulation were confirmed to be 205.4 ± 11 nm, 25.7 ± 6.22 mV, 91.8 ± 0.5%, 5.38 ± 0.03% and 29.3 h, respectively. Following conjugation of optimized PTX-NLCs with transferrin, coupling efficiency was 21.3 mg transferrin per mmol of stearylamine; PS and MRT were increased while ZP, EE and DL decreased non-significantly. Tf-PTX-NLCs showed higher cytotoxic activity compared to non-targeted NLCs and free drug. These results indicated that the Tf-PTX-NLCs could potentially be exploited as a delivery system in brain cancer cells.

  20. Cationic niosomes an effective gene carrier composed of novel spermine-derivative cationic lipids: effect of central core structures.

    Opanasopit, Praneet; Leksantikul, Lalita; Niyomtham, Nattisa; Rojanarata, Theerasak; Ngawhirunpat, Tanasait; Yingyongnarongkul, Boon-Ek

    2017-05-01

    Cationic niosomes formulated from Span 20, cholesterol (Chol) and novel spermine-based cationic lipids of multiple central core structures (di(oxyethyl)amino, di(oxyethyl)amino carboxy, 3-amino-1,2-dioxypropyl and 2-amino-1,3-dioxypropyl) were successfully prepared for improving transfection efficiency in vitro. The niosomes composed of spermine cationic lipid with central core structure of di(oxyethyl)amino revealed the highest gene transfection efficiency. To investigate the factors affecting gene transfection and cell viability including differences in the central core structures of cationic lipids, the composition of vesicles, molar ratio of cationic lipids in formulations and the weight ratio of niosomes to DNA. Cationic niosomes composed of nonionic surfactants (Span20), cholesterol and spermine-based cationic lipids of multiple central core structures were formulated. Gene transfection and cell viability were evaluated on a human cervical carcinoma cell line (HeLa cells) using pDNA encoding green fluorescent protein (pEGFP-C2). The morphology, size and charge were also characterized. High transfection efficiency was obtained from cationic niosomes composed of Span20:Chol:cationic lipid at the molar ratio of 2.5:2.5:0.5 mM. Cationic lipids with di(oxyethyl)amino as a central core structure exhibited highest transfection efficiency. In addition, there was also no serum effect on transfection efficiency. These novel cationic niosomes may constitute a good alternative carrier for gene transfection.

  1. Optimizing NTS-polyplex as a tool for gene transfer to cultured dopamine neurons.

    Daniel Hernandez-Baltazar

    Full Text Available The study of signal transduction in dopamine (DA-containing neurons as well as the development of new therapeutic approaches for Parkinson's disease requires the selective expression of transgenes in such neurons. Here we describe optimization of the use of the NTS-polyplex, a gene carrier system taking advantage of neurotensin receptor internalization, to transfect mouse DA neurons in primary culture. The plasmids DsRed2 (4.7 kbp and VGLUT2-Venus (11 kbp were used to compare the ability of this carrier system to transfect plasmids of different sizes. We examined the impact of age of the neurons (1, 3, 5 and 8 days after seeding, of culture media used during the transfection (Neurobasal with B27 vs. conditioned medium and of three molar ratios of plasmid DNA to carrier. While the NTS-polyplex successfully transfected both plasmids in a control N1E-115 cell line, only the pDsRed2 plasmid could be transfected in primary cultured DA neurons. We achieved 20% transfection efficiency of pDsRed2 in DA neurons, with 80% cell viability. The transfection was demonstrated pharmacologically to be dependent on activation of neurotensin receptors and to be selective for DA neurons. The presence of conditioned medium for transfection was found to be required to insure cell viability. Highest transfection efficiency was achieved in the most mature neurons. In contrast, transfection with the VGLUT2-Venus plasmid produced cell damage, most likely due to the high molar ratios required, as evidenced by a 15% cell viability of DA neurons at the three molar ratios tested (1:36, 1:39 and 1:42. We conclude that, when used at molar ratios lower than 1:33, the NTS-polyplex can selectively transfect mature cultured DA neurons with only low levels of toxicity. Our results provide evidence that the NTS-polyplex has good potential for targeted gene delivery in cultured DA neurons, an in vitro system of great use for the screening of new therapeutic approaches for Parkinson

  2. Optimal control of gene mutation in DNA replication.

    Yu, Juanyi; Li, Jr-Shin; Tarn, Tzyh-Jong

    2012-01-01

    We propose a molecular-level control system view of the gene mutations in DNA replication from the finite field concept. By treating DNA sequences as state variables, chemical mutagens and radiation as control inputs, one cell cycle as a step increment, and the measurements of the resulting DNA sequence as outputs, we derive system equations for both deterministic and stochastic discrete-time, finite-state systems of different scales. Defining the cost function as a summation of the costs of applying mutagens and the off-trajectory penalty, we solve the deterministic and stochastic optimal control problems by dynamic programming algorithm. In addition, given that the system is completely controllable, we find that the global optimum of both base-to-base and codon-to-codon deterministic mutations can always be achieved within a finite number of steps.

  3. Optimization of conditions for gene delivery system based on PEI

    Roya Cheraghi

    2017-01-01

    Full Text Available Objective(s: PEI based nanoparticle (NP due to dual capabilities of proton sponge and DNA binding is known as powerful tool for nucleic acid delivery to cells. However, serious cytotoxicity and complicated conditions, which govern NPs properties and its interactions with cells practically, hindered achievement to high transfection efficiency. Here, we have tried to optimize the properties of PEI/ firefly luciferase plasmid complexes and cellular condition to improve transfection efficiency. Materials and Methods: For this purpose, firefly luciferase, as a robust gene reporter, was complexed with PEI to prepare NPs with different size and charge. The physicochemical properties of nanoparticles were evaluated using agarose gel retardation and dynamic light scattering.  MCF7 and BT474 cells at different confluency were also transfected with prepared nanoparticles at various concentrations for short and long times. Results: The branched PEI can instantaneously bind to DNA and form cationic NPs. The results demonstrated the production of nanoparticles with size about 100-500 nm dependent on N/P ratio. Moreover, increase of nanoparticles concentration on the cell surface drastically improved the transfection rate, so at a concentration of 30 ng/ìl, the highest transfection efficiency was achieved. On the other side, at confluency between 40-60%, the maximum efficiency was obtained. The result demonstrated that N/P ratio of 12 could establish an optimized ratio between transfection efficiency and cytotoxicity of PEI/plasmid nanoparticles. The increase of NPs N/P ratio led to significant cytotoxicity. Conclusion: Obtained results verified the optimum conditions for PEI based gene delivery in different cell lines.

  4. Pressure-Induced Bandgap Optimization in Lead-Based Perovskites with Prolonged Carrier Lifetime and Ambient Retainability

    Liu, Gang [Center for High Pressure Science and Technology Advanced Research, Shanghai 201203 China; Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Kong, Lingping [Center for High Pressure Science and Technology Advanced Research, Shanghai 201203 China; Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Gong, Jue [Department of Chemistry and Biochemistry, Northern Illinois University, DeKalb IL 60115 USA; Yang, Wenge [Center for High Pressure Science and Technology Advanced Research, Shanghai 201203 China; Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Mao, Ho-kwang [Center for High Pressure Science and Technology Advanced Research, Shanghai 201203 China; Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Hu, Qingyang [Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Liu, Zhenxian [Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Schaller, Richard D. [Center for Nanoscale Materials, Argonne National Laboratory, Argonne IL 60439 USA; Zhang, Dongzhou [Hawai' i Institute of Geophysics and Planetology, School of Ocean and Earth Science and Technology, University of Hawai' i at Manoa, Honolulu HI 96822 USA; Xu, Tao [Department of Chemistry and Biochemistry, Northern Illinois University, DeKalb IL 60115 USA

    2016-12-05

    Bond length and bond angle exhibited by valence electrons is essential to the core of chemistry. Using lead-based organic–inorganic perovskite compounds as an exploratory platform, it is demonstrated that the modulation of valence electrons by compression can lead to discovery of new properties of known compounds. Yet, despite its unprecedented progress, further efficiency boost of lead-based organic–inorganic perovskite solar cells is hampered by their wider bandgap than the optimum value according to the Shockley–Queisser limit. By modulating the valence electron wavefunction with modest hydraulic pressure up to 2.1 GPa, the optimized bandgap for single-junction solar cells in lead-based perovskites, for the first time, is achieved by narrowing the bandgap of formamidinium lead triiodide (HC(NH2)2PbI3) from 1.489 to 1.337 eV. Strikingly, such bandgap narrowing is partially retained after the release of pressure to ambient, and the bandgap narrowing is also accompanied with double-prolonged carrier lifetime. With First-principles simulation, this work opens a new dimension in basic chemical understanding of structural photonics and electronics and paves an alternative pathway toward better photovoltaic materials-by-design.

  5. Pressure-Induced Bandgap Optimization in Lead-Based Perovskites with Prolonged Carrier Lifetime and Ambient Retainability

    Liu, Gang [Center for High Pressure Science and Technology Advanced Research, Shanghai 201203 China; Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Kong, Lingping [Center for High Pressure Science and Technology Advanced Research, Shanghai 201203 China; Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Gong, Jue [Department of Chemistry and Biochemistry, Northern Illinois University, DeKalb IL 60115 USA; Yang, Wenge [Center for High Pressure Science and Technology Advanced Research, Shanghai 201203 China; Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Mao, Ho-kwang [Center for High Pressure Science and Technology Advanced Research, Shanghai 201203 China; Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Hu, Qingyang [Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Liu, Zhenxian [Geophysical Laboratory, Carnegie Institution of Washington, Washington DC 20015 USA; Schaller, Richard D. [Center for Nanoscale Materials, Argonne National Laboratory, Argonne IL 60439 USA; Zhang, Dongzhou [Hawai' i Institute of Geophysics and Planetology, School of Ocean and Earth Science and Technology, University of Hawai' i at Manoa, Honolulu HI 96822 USA; Xu, Tao [Department of Chemistry and Biochemistry, Northern Illinois University, DeKalb IL 60115 USA

    2016-12-05

    Bond length and bond angle exhibited by valence electrons is essential to the core of chemistry. Using lead-based organic–inorganic perovskite compounds as an exploratory platform, it is demonstrated that the modulation of valence electrons by compression can lead to discovery of new properties of known compounds. Yet, despite its unprecedented progress, further efficiency boost of lead-based organic–inorganic perovskite solar cells is hampered by their wider bandgap than the optimum value according to the Shockley–Queisser limit. By modulating the valence electron wavefunction with modest hydraulic pressure up to 2.1 GPa, the optimized bandgap for single-junction solar cells in lead-based perovskites, for the first time, is achieved by narrowing the bandgap of formamidinium lead triiodide (HC(NH2)2PbI3) from 1.489 to 1.337 eV. Strikingly, such bandgap narrowing is partially retained after the release of pressure to ambient, and the bandgap narrowing is also accompanied with double-prolonged carrier lifetime. With First-principles simulation, this work opens a new dimension in basic chemical understanding of structural photonics and electronics and paves an alternative pathway toward better photovoltaic materials-by-design.

  6. Optimizing autologous cell grafts to improve stem cell gene therapy.

    Psatha, Nikoletta; Karponi, Garyfalia; Yannaki, Evangelia

    2016-07-01

    Over the past decade, stem cell gene therapy has achieved unprecedented curative outcomes for several genetic disorders. Despite the unequivocal success, clinical gene therapy still faces challenges. Genetically engineered hematopoietic stem cells are particularly vulnerable to attenuation of their repopulating capacity once exposed to culture conditions, ultimately leading to low engraftment levels posttransplant. This becomes of particular importance when transduction rates are low or/and competitive transplant conditions are generated by reduced-intensity conditioning in the absence of a selective advantage of the transduced over the unmodified cells. These limitations could partially be overcome by introducing megadoses of genetically modified CD34(+) cells into conditioned patients or by transplanting hematopoietic stem cells hematopoietic stem cells with high engrafting and repopulating potential. On the basis of the lessons gained from cord blood transplantation, we summarize the most promising approaches to date of increasing either the numbers of hematopoietic stem cells for transplantation or/and their engraftability, as a platform toward the optimization of engineered stem cell grafts. Copyright © 2016 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

  7. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Jiangyu Wu

    2013-01-01

    Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.

  8. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Huang, Weizhe; He, Ziying

    2013-01-01

    RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

  9. Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L.

    Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2017-07-01

    The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

  10. Application of GP IIIa gene Taq I polymorphism to determination of carrier status in Glanzmann's thrombasthenia families of Chinese origin

    Ruan Changgeng; Gu Jianmin; Wang Xiaodong; Chu Xiaohong; Pan Junliang; Wu Qingyu

    1992-08-01

    Glanzmann's thrombasthenia is a bleeding disorder caused by qualitative and/or quantitative defects of platelet membrane glycoprotein (GP) Ii b /III a complex. The disease is inherited in an autosomal recessive manner. The use of cDNA probes to study restriction fragment length polymorphisms (RFLPs) in GPIII a gene is reported. A Taq I polymorphism was identified and this RFLP consisted of variant bands of 6.5 kb/4.0 and 2.5 kb with a frequency of 0.46/0.54 in Chinese population. The Taq I polymorphism was further localized by polymerase chain reaction (PCR) method to exon VIII of the GPIII a gene. In two Glanzmann's thrombasthenia families, the Taq I RFLP studied with both Southern blotting and PCR methods identified defective GPIII a gene inherited by patients, and determined the genotype of asymptomatic subjects. Analysis of this Taq I polymorphism by PCR method should be potentially useful in future for the carrier detection and prenatal diagnosis in Glanzmann's thrombasthenia families

  11. Hepatitis B surface gene 145 mutant as a minor population in hepatitis B virus carriers

    Komatsu Haruki

    2012-01-01

    Full Text Available Abstract Background Hepatitis B virus (HBV can have mutations that include the a determinant, which causes breakthrough infection. In particular, a single mutation at amino acid 145 of the surface protein (G145 is frequently reported in the failure of prophylactic treatment. The aim of this study was to evaluate the frequency of the a determinant mutants, especially the G145 variant, in Japan, where universal vaccination has not been adopted. Methods The present study was a retrospective study. The study cohorts were defined as follows: group 1, children with failure to prevent mother-to-child transmission despite immunoprophylaxis (n = 18, male/female = 8/10, age 1-14 years; median 6 years; group 2, HBV carriers who had not received vaccination or hepatitis B immunoglobulin (n = 107, male/female = 107, age 1-52 years; median 16 years. To detect the G145R and G145A mutants in patients, we designed 3 probes for real-time PCR. We also performed direct sequencing and cloning of PCR products. Results By mutant-specific real-time PCR, one subject (5.6% was positive for the G145R mutant in group 1, while the G145 mutant was undetectable in group 2. The a determinant mutants were detected in one (5.6% of the group 1 subjects and 10 (9.3% of the group 2 subjects using direct sequencing, but direct sequencing did not reveal the G145 mutant as a predominant strain in the two groups. However, the subject who was positive according to the mutant-specific real-time PCR in group 1 had overlapped peaks at nt 587 in the electropherogram. In group 2, 11 patients had overlapped peaks at nt 587 in the electropherogram. Cloning of PCR products allowed detection of the G145R mutant as a minor strain in 7 (group 1: 1 subject, group 2: 6 subjects of 12 subjects who had overlapped peaks at nt 587 in the electropherogram. Conclusions The frequency of the a determinant mutants was not high in Japan. However, the G145R mutant was often present as a minor population in

  12. Breast tumor characteristics of BRCA1 and BRCA2 gene mutation carriers on MRI

    Veltman, J.; Mann, R.; Blickman, J.G.; Boetes, C.; Kok, T.; Obdeijn, I.M.; Hoogerbrugge, N.

    2008-01-01

    The appearance of malignant lesions in BRCA1 and BRCA2 mutation carriers (BRCA-MCs) on mammography and magnetic resonance imaging (MRI) was evaluated. Thus, 29 BRCA-MCs with breast cancer were retrospectively evaluated and the results compared with an age, tumor size and tumor type matched control group of 29 sporadic breast cancer cases. Detection rates on both modalities were evaluated. Tumors were analyzed on morphology, density (mammography), enhancement pattern and kinetics (MRI). Overall detection was significantly better with MRI than with mammography (55/58 vs 44/57, P = 0.021). On mammography, lesions in the BRCA-MC group were significantly more described as rounded (12//19 vs 3/13, P = 0.036) and with sharp margins (9/19 vs 1/13, P 0.024). On MRI lesions in the BRCA-MC group were significantly more described as rounded (16/27 vs 7/28, P = 0.010), with sharp margins (20/27 vs 7/28, P < 0.001) and with rim enhancement (7/27 vs 1/28, P = 0.025). No significant difference was found for enhancement kinetics (P = 0.667). Malignant lesions in BRCA-MC frequently have morphological characteristics commonly seen in benign lesions, like a rounded shape or sharp margins. This applies for both mammography and MRI. However the possibility of MRI to evaluate the enhancement pattern and kinetics enables the detection of characteristics suggestive for a malignancy. (orig.)

  13. Characterization of a stearoyl-acyl carrier protein desaturase gene family from chocolate tree, Theobroma cacao L

    Zhang, Yufan; Maximova, Siela N.; Guiltinan, Mark J.

    2015-01-01

    In plants, the conversion of stearoyl-ACP to oleoyol-ACP is catalyzed by a plastid-localized soluble stearoyl-acyl carrier protein (ACP) desaturase (SAD). The activity of SAD significantly impacts the ratio of saturated and unsaturated fatty acids, and is thus a major determinant of fatty acid composition. The cacao genome contains eight putative SAD isoforms with high amino acid sequence similarities and functional domain conservation with SAD genes from other species. Sequence variation in known functional domains between different SAD family members suggested that these eight SAD isoforms might have distinct functions in plant development, a hypothesis supported by their diverse expression patterns in various cacao tissues. Notably, TcSAD1 is universally expressed across all the tissues, and its expression pattern in seeds is highly correlated with the dramatic change in fatty acid composition during seed maturation. Interestingly, TcSAD3 and TcSAD4 appear to be exclusively and highly expressed in flowers, functions of which remain unknown. To test the function of TcSAD1 in vivo, transgenic complementation of the Arabidopsis ssi2 mutant was performed, demonstrating that TcSAD1 successfully rescued all AtSSI2 related phenotypes further supporting the functional orthology between these two genes. The identification of the major SAD gene responsible for cocoa butter biosynthesis provides new strategies for screening for novel genotypes with desirable fatty acid compositions, and for use in breeding programs to help pyramid genes for quality and other traits such as disease resistance. PMID:25926841

  14. Characterization of a stearoyl-acyl carrier protein desaturase gene family from chocolate tree, Theobroma cacao L.

    Zhang, Yufan; Maximova, Siela N; Guiltinan, Mark J

    2015-01-01

    In plants, the conversion of stearoyl-ACP to oleoyol-ACP is catalyzed by a plastid-localized soluble stearoyl-acyl carrier protein (ACP) desaturase (SAD). The activity of SAD significantly impacts the ratio of saturated and unsaturated fatty acids, and is thus a major determinant of fatty acid composition. The cacao genome contains eight putative SAD isoforms with high amino acid sequence similarities and functional domain conservation with SAD genes from other species. Sequence variation in known functional domains between different SAD family members suggested that these eight SAD isoforms might have distinct functions in plant development, a hypothesis supported by their diverse expression patterns in various cacao tissues. Notably, TcSAD1 is universally expressed across all the tissues, and its expression pattern in seeds is highly correlated with the dramatic change in fatty acid composition during seed maturation. Interestingly, TcSAD3 and TcSAD4 appear to be exclusively and highly expressed in flowers, functions of which remain unknown. To test the function of TcSAD1 in vivo, transgenic complementation of the Arabidopsis ssi2 mutant was performed, demonstrating that TcSAD1 successfully rescued all AtSSI2 related phenotypes further supporting the functional orthology between these two genes. The identification of the major SAD gene responsible for cocoa butter biosynthesis provides new strategies for screening for novel genotypes with desirable fatty acid compositions, and for use in breeding programs to help pyramid genes for quality and other traits such as disease resistance.

  15. Frequency in Japan of carriers of the rare recessive gene causing actalasemia

    Hamilton, H B; Neel, J V; Kobara, T Y; Ozaki, Kyoko

    1961-05-17

    A rapid and simple method to detect the hypocatalasemic heterozygotes for the gene responsible for acatalasemia is described. A total of 13,647 blood specimens from individuals residing in Hiroshima and Nagasaki have been examined in this manner, and the frequency of hypocatalasemia found to be 0.09%. Surveys in other parts of Japan have revealed frequencies of the order of 1.4%. This unevenness in the distribution of a rare recessive gene, taken in conjunction with the known variation from locality to locality in the frequency of inbreeding, has important implications for the interpretation of data on inbreeding effects. Some of these implications are discussed. 17 references, 1 figure, 6 tables.

  16. Endocrine metabolic disorders in patients with breast cancer, carriers of BRCA1 gene mutations.

    Berstein, L M; Boyarkina, M P; Vasilyev, D A; Poroshina, T E; Kovalenko, I G; Imyanitov, E N; Semiglazov, V F

    2012-03-01

    Two groups of breast cancer patients (53±2 years) in clinical remission receiving no specific therapy were examined: group 1, with BRCA1 gene mutations (N=11) and group 2, without mutations of this kind (N=11). The two groups did not differ by insulinemia and glycemia, insulin resistance index, blood levels of thyrotropic hormone, sex hormone-binding globulin, insulin-like growth factor-1, triglycerides, or lipoproteins. In group 1, blood estradiol level was higher. Intensive glucose-induced generation of reactive oxygen species in these patients was associated with a decrease of cholesterolemia, of the C-peptide/insulin proportion, and a trend to higher urinary excretion of 4-hydroxyestrone, one of the most genotoxic catecholestrogens. BRCA1 gene mutations in breast cancer patients were associated with signs of estrogenization and a pro-genotoxic shift in the estrogen and glucose system, which could modulate the disease course and requires correction.

  17. Chondroitin sulfate-polyethylenimine copolymer-coated superparamagnetic iron oxide nanoparticles as an efficient magneto-gene carrier for microRNA-encoding plasmid DNA delivery

    Lo, Yu-Lun; Chou, Han-Lin; Liao, Zi-Xian; Huang, Shih-Jer; Ke, Jyun-Han; Liu, Yu-Sheng; Chiu, Chien-Chih; Wang, Li-Fang

    2015-04-01

    MicroRNA-128 (miR-128) is an attractive therapeutic molecule with powerful glioblastoma regulation properties. However, miR-128 lacks biological stability and leads to poor delivery efficacy in clinical applications. In our previous study, we demonstrated two effective transgene carriers, including polyethylenimine (PEI)-decorated superparamagnetic iron oxide nanoparticles (SPIONs) as well as chemically-conjugated chondroitin sulfate-PEI copolymers (CPs). In this contribution, we report optimized conditions for coating CPs onto the surfaces of SPIONs, forming CPIOs, for magneto-gene delivery systems. The optimized weight ratio of the CPs and SPIONs is 2 : 1, which resulted in the formation of a stable particle as a good transgene carrier. The hydrodynamic diameter of the CPIOs is ~136 nm. The gel electrophoresis results demonstrate that the weight ratio of CPIO/DNA required to completely encapsulate pDNA is >=3. The in vitro tests of CPIO/DNA were done in 293 T, CRL5802, and U87-MG cells in the presence and absence of an external magnetic field. The magnetofection efficiency of CPIO/DNA was measured in the three cell lines with or without fetal bovine serum (FBS). CPIO/DNA exhibited remarkably improved gene expression in the presence of the magnetic field and 10% FBS as compared with a gold non-viral standard, PEI/DNA, and a commercial magnetofection reagent, PolyMag/DNA. In addition, CPIO/DNA showed less cytotoxicity than PEI/DNA and PolyMag/DNA against the three cell lines. The transfection efficiency of the magnetoplex improved significantly with an assisted magnetic field. In miR-128 delivery, a microRNA plate array and fluorescence in situ hybridization were used to demonstrate that CPIO/pMIRNA-128 indeed expresses more miR-128 with the assisted magnetic field than without. In a biodistribution test, CPIO/Cy5-DNA showed higher accumulation at the tumor site where an external magnet is placed nearby.MicroRNA-128 (miR-128) is an attractive therapeutic molecule

  18. Optimization and design of ibuprofen-loaded nanostructured lipid carriers using a hybrid-design approach for ocular drug delivery

    Rathod, Vishal

    The objective of the present project was to develop the Ibuprofen-loaded Nanostructured Lipid Carrier (IBU-NLCs) for topical ocular delivery based on substantial pre-formulation screening of the components and understanding the interplay between the formulation and process variables. The BCS Class II drug: Ibuprofen was selected as the model drug for the current study. IBU-NLCs were prepared by melt emulsification and ultrasonication technique. Extensive pre-formulation studies were performed to screen the lipid components (solid and liquid) based on drug's solubility and affinity as well as components compatibility. The results from DSC & XRD assisted in selecting the most suitable ratio to be utilized for future studies. DynasanRTM 114 was selected as the solid lipid & MiglyolRTM 840 was selected as the liquid lipid based on preliminary lipid screening. The ratio of 6:4 was predicted to be the best based on its crystallinity index and the thermal events. As there are many variables involved for further optimization of the formulation, a single design approach is not always adequate. A hybrid-design approach was applied by employing the Plackett Burman design (PBD) for preliminary screening of 7 critical variables, followed by Box-Behnken design (BBD), a sub-type of response surface methodology (RSM) design using 2 relatively significant variables from the former design and incorporating Surfactant/Co-surfactant ratio as the third variable. Comparatively, KolliphorRTM HS15 demonstrated lower Mean Particle Size (PS) & Polydispersity Index (PDI) and KolliphorRTM P188 resulted in Zeta Potential (ZP) ibuprofen thereafter over several hours. These values also confirm that the production method, and all other selected variables, effectively promoted the incorporation of ibuprofen in NLC. Quality by Design (QbD) approach was successfully implemented in developing a robust ophthalmic formulation with superior physicochemical and morphometric properties. NLCs as the

  19. LAMMPS strong scaling performance optimization on Blue Gene/Q

    Coffman, Paul; Jiang, Wei; Romero, Nichols A.

    2014-11-12

    LAMMPS "Large-scale Atomic/Molecular Massively Parallel Simulator" is an open-source molecular dynamics package from Sandia National Laboratories. Significant performance improvements in strong-scaling and time-to-solution for this application on IBM's Blue Gene/Q have been achieved through computational optimizations of the OpenMP versions of the short-range Lennard-Jones term of the CHARMM force field and the long-range Coulombic interaction implemented with the PPPM (particle-particle-particle mesh) algorithm, enhanced by runtime parameter settings controlling thread utilization. Additionally, MPI communication performance improvements were made to the PPPM calculation by re-engineering the parallel 3D FFT to use MPICH collectives instead of point-to-point. Performance testing was done using an 8.4-million atom simulation scaling up to 16 racks on the Mira system at Argonne Leadership Computing Facility (ALCF). Speedups resulting from this effort were in some cases over 2x.

  20. Differential regulation of mitochondrial pyruvate carrier genes modulates respiratory capacity and stress tolerance in yeast.

    Alba Timón-Gómez

    Full Text Available Mpc proteins are highly conserved from yeast to humans and are necessary for the uptake of pyruvate at the inner mitochondrial membrane, which is used for leucine and valine biosynthesis and as a fuel for respiration. Our analysis of the yeast MPC gene family suggests that amino acid biosynthesis, respiration rate and oxidative stress tolerance are regulated by changes in the Mpc protein composition of the mitochondria. Mpc2 and Mpc3 are highly similar but functionally different: Mpc2 is most abundant under fermentative non stress conditions and important for amino acid biosynthesis, while Mpc3 is the most abundant family member upon salt stress or when high respiration rates are required. Accordingly, expression of the MPC3 gene is highly activated upon NaCl stress or during the transition from fermentation to respiration, both types of regulation depend on the Hog1 MAP kinase. Overexpression experiments show that gain of Mpc2 function leads to a severe respiration defect and ROS accumulation, while Mpc3 stimulates respiration and enhances tolerance to oxidative stress. Our results identify the regulated mitochondrial pyruvate uptake as an important determinant of respiration rate and stress resistance.

  1. Differential regulation of mitochondrial pyruvate carrier genes modulates respiratory capacity and stress tolerance in yeast.

    Timón-Gómez, Alba; Proft, Markus; Pascual-Ahuir, Amparo

    2013-01-01

    Mpc proteins are highly conserved from yeast to humans and are necessary for the uptake of pyruvate at the inner mitochondrial membrane, which is used for leucine and valine biosynthesis and as a fuel for respiration. Our analysis of the yeast MPC gene family suggests that amino acid biosynthesis, respiration rate and oxidative stress tolerance are regulated by changes in the Mpc protein composition of the mitochondria. Mpc2 and Mpc3 are highly similar but functionally different: Mpc2 is most abundant under fermentative non stress conditions and important for amino acid biosynthesis, while Mpc3 is the most abundant family member upon salt stress or when high respiration rates are required. Accordingly, expression of the MPC3 gene is highly activated upon NaCl stress or during the transition from fermentation to respiration, both types of regulation depend on the Hog1 MAP kinase. Overexpression experiments show that gain of Mpc2 function leads to a severe respiration defect and ROS accumulation, while Mpc3 stimulates respiration and enhances tolerance to oxidative stress. Our results identify the regulated mitochondrial pyruvate uptake as an important determinant of respiration rate and stress resistance.

  2. Gene introduction into the mitochondria of Arabidopsis thaliana via peptide-based carriers

    Chuah, Jo-Ann; Yoshizumi, Takeshi; Kodama, Yutaka; Numata, Keiji

    2015-01-01

    Available methods in plant genetic transformation are nuclear and plastid transformations because similar procedures have not yet been established for the mitochondria. The double membrane and small size of the organelle, in addition to its large population in cells, are major obstacles in mitochondrial transfection. Here we report the intracellular delivery of exogenous DNA localized to the mitochondria of Arabidopsis thaliana using a combination of mitochondria-targeting peptide and cell-penetrating peptide. Low concentrations of peptides were sufficient to deliver DNA into the mitochondria and expression of imported DNA reached detectable levels within a short incubation period (12 h). We found that electrostatic interaction with the cell membrane is not a critical factor for complex internalization, instead, improved intracellular penetration of mitochondria-targeted complexes significantly enhanced gene transfer efficiency. Our results delineate a simple and effective peptide-based method, as a starting point for the development of more sophisticated plant mitochondrial transfection strategies.

  3. Estrogen regulation of chicken riboflavin carrier protein gene is mediated by ERE half sites without direct binding of estrogen receptor.

    Bahadur, Urvashi; Ganjam, Goutham K; Vasudevan, Nandini; Kondaiah, Paturu

    2005-02-28

    Estrogen is an important steroid hormone that mediates most of its effects on regulation of gene expression by binding to intracellular receptors. The consensus estrogen response element (ERE) is a 13bp palindromic inverted repeat with a three nucleotide spacer. However, several reports suggest that many estrogen target genes are regulated by diverse elements, such as imperfect EREs and ERE half sites (ERE 1/2), which are either the proximal or the distal half of the palindrome. To gain more insight into ERE half site-mediated gene regulation, we used a region from the estrogen-regulated chicken riboflavin carrier protein (RCP) gene promoter that contains ERE half sites. Using moxestrol, an analogue of estrogen and transient transfection of deletion and mutation containing RCP promoter/reporter constructs in chicken hepatoma (LMH2A) cells, we identified an estrogen response unit (ERU) composed of two consensus ERE 1/2 sites and one non-consensus ERE 1/2 site. Mutation of any of these sites within this ERU abolishes moxestrol response. Further, the ERU is able to confer moxestrol responsiveness to a heterologous promoter. Interestingly, RCP promoter is regulated by moxestrol in estrogen responsive human MCF-7 cells, but not in other cell lines such as NIH3T3 and HepG2 despite estrogen receptor-alpha (ER-alpha) co transfection. Electrophoretic mobility shift assays (EMSAs) with promoter regions encompassing the half sites and nuclear extracts from LMH2A cells show the presence of a moxestrol-induced complex that is abolished by a polyclonal anti-ERalpha antibody. Surprisingly, estrogen receptor cannot bind to these promoter elements in isolation. Thus, there appears to be a definite requirement for some other factor(s) in addition to estrogen receptor, for the generation of a suitable response of this promoter to estrogen. Our studies therefore suggest a novel mechanism of gene regulation by estrogen, involving ERE half sites without direct binding of ER to the

  4. Identification of citrullinaemia carrier and detection of a new silent mutation at 240bp position in ASS1 gene of normal Holstein cattle

    Kotikalapudi Rosaiah

    2014-01-01

    Full Text Available The autosomal recessive genetic disorders are regularly investigated especially in Indian Holstein and Holstein Crossbred bulls before they entered in semen collection so that a defective gene should not be transmitted to future generations. Bovine citrullinaemia first reported in Australia is a metabolic disorder as one of the enzymes, Argininosuccinate synthetase (ASS involved in urea cycle is impaired in function. The mutation responsible for citrullinemia has been characterized as a single-base substitution at 256bp (C>T in coding exon 3 of argininosuccinate synthetase 1 (ASS1 gene, which converts the CGA (arginine at 86 codon to TGA (stop codon. A Holstein bull during routine molecular screening was found to be carrier for Citrullinaemia that was confirmed by sequencing. This is a fresh case of Citrullinaemia carrier in addition to three cases reported earlier in India. Partial sequencing of coding exon 3 of a normal Holstein revealed a new silent polymorphism at 240bp position that does not change amino acid (Sarine AGC>AGT at 80 codon within exon 3 of ASS1 gene. The sequence of exon 3 of ASS1 gene in a normal Holstein exhibiting a new polymorphism was submitted to NCBI with accession No. KF933365. The presence of citrullinaemia carriers in Indian Holstein, though in very low frequency, emphasizing to continue the investigation of mutant gene in cattle population.

  5. Association of the solute carrier family 11 member 1 gene polymorphisms with susceptibility to leprosy in a Brazilian sample

    Maria José Franco Brochado

    2016-02-01

    Full Text Available Natural resistance-associated macrophage protein 1/solute carrier family 11 member 1 gene (Nramp1/Slc11a1 is a gene that controls the susceptibility of inbred mice to intracellular pathogens. Polymorphisms in the human Slc11a1/Nramp1 gene have been associated with host susceptibility to leprosy. This study has evaluated nine polymorphisms of the Slc11a1/Nramp1 gene [(GTn, 274C/T, 469+14G/C, 577-18G/A, 823C/T, 1029 C/T, 1465-85G/A, 1703G/A, and 1729+55del4] in 86 leprosy patients (67 and 19 patients had the multibacillary and the paucibacillary clinical forms of the disease, respectively, and 239 healthy controls matched by age, gender, and ethnicity. The frequency of allele 2 of the (GTn polymorphism was higher in leprosy patients [p = 0.04, odds ratio (OR = 1.49], whereas the frequency of allele 3 was higher in the control group (p = 0.03; OR = 0.66. Patients carrying the 274T allele (p = 0.04; OR = 1.49 and TT homozygosis (p = 0.02; OR = 2.46, such as the 469+14C allele (p = 0.03; OR = 1.53 of the 274C/T and 469+14G/C polymorphisms, respectively, were more frequent in the leprosy group. The leprosy and control groups had similar frequency of the 577-18G/A, 823C/T, 1029C/T, 1465-85G/A, 1703G/A, and 1729+55del4 polymorphisms. The 274C/T polymorphism in exon 3 and the 469+14G/C polymorphism in intron 4 were associated with susceptibility to leprosy, while the allele 2 and 3 of the (GTn polymorphism in the promoter region were associated with susceptibility and protection to leprosy, respectively.

  6. A functional polymorphism in the reduced folate carrier gene and DNA hypomethylation in mothers of children with autism.

    James, S Jill; Melnyk, Stepan; Jernigan, Stefanie; Pavliv, Oleksandra; Trusty, Timothy; Lehman, Sara; Seidel, Lisa; Gaylor, David W; Cleves, Mario A

    2010-09-01

    The biologic basis of autism is complex and is thought to involve multiple and variable gene-environment interactions. While the logical focus has been on the affected child, the impact of maternal genetics on intrauterine microenvironment during pivotal developmental windows could be substantial. Folate-dependent one carbon metabolism is a highly polymorphic pathway that regulates the distribution of one-carbon derivatives between DNA synthesis (proliferation) and DNA methylation (cell-specific gene expression and differentiation). These pathways are essential to support the programmed shifts between proliferation and differentiation during embryogenesis and organogenesis. Maternal genetic variants that compromise intrauterine availability of folate derivatives could alter fetal cell trajectories and disrupt normal neurodevelopment. In this investigation, the frequency of common functional polymorphisms in the folate pathway was investigated in a large population-based sample of autism case-parent triads. In case-control analysis, a significant increase in the reduced folate carrier (RFC1) G allele frequency was found among case mothers, but not among fathers or affected children. Subsequent log linear analysis of the RFC1 A80G genotype within family trios revealed that the maternal G allele was associated with a significant increase in risk of autism whereas the inherited genotype of the child was not. Further, maternal DNA from the autism mothers was found to be significantly hypomethylated relative to reference control DNA. Metabolic profiling indicated that plasma homocysteine, adenosine, and S-adenosylhomocyteine were significantly elevated among autism mothers consistent with reduced methylation capacity and DNA hypomethylation. Together, these results suggest that the maternal genetics/epigenetics may influence fetal predisposition to autism. (c) 2010 Wiley-Liss, Inc.

  7. [Cloning, expression and transcriptional analysis of biotin carboxyl carrier protein gene (accA) from Amycolatopsis mediterranei U32 ].

    Lu, Jie; Yao, Yufeng; Jiang, Weihong; Jiao, Ruishen

    2003-02-01

    Acetyl CoA carboxylase (EC 6.4.1.2, ACC) catalyzes the ATP-dependent carboxylation of acetyl CoA to yield malonyl CoA, which is the first committed step in fatty acid synthesis. A pair of degenerate PCR primers were designed according to the conserved amino acid sequence of AccA from M. tuberculosis and S. coelicolor. The product of the PCR amplification, a DNA fragment of 250bp was used as a probe for screening the U32 genomic cosmid library and its gene, accA, coding the biotinylated protein subunit of acetyl CoA carboxylase, was successfully cloned from U32. The accA ORF encodes a 598-amino-acid protein with the calculated molecular mass of 63.7kD, with 70.1% of G + C content. A typical Streptomyces RBS sequence, AGGAGG, was found at the - 6 position upstream of the start codon GTG. Analysis of the deduced amino acid sequence showed the presence of biotin-binding site and putative ATP-bicarbonate interaction region, which suggested the U32 AccA may act as a biotin carboxylase as well as a biotin carrier protein. Gene accA was then cloned into the pET28 (b) vector and expressed solubly in E. coli BL21 (DE3) by 0.1 mmol/L IPTG induction. Western blot confirmed the covalent binding of biotin with AccA. Northern blot analyzed transcriptional regulation of accA by 5 different nitrogen sources.

  8. Regional brain metabolite abnormalities in inherited prion disease and asymptomatic gene carriers demonstrated in vivo by quantitative proton magnetic resonance spectroscopy

    Waldman, A.D.; Cordery, R.J.; Godbolt, A.; Rossor, M.N. [University College London, Dementia Research Group, Department of Neurodegenerative Disease, Institute of Neurology, London (United Kingdom); Imperial College of Science, Technology and Medicine, Division of Neuroscience and Psychological Medicine, Faculty of Medicine, London (United Kingdom); MacManus, D.G. [University College London, NMR Research Unit, Department of Clinical Neurology, Institute of Neurology, London (United Kingdom); Collinge, J. [University College London, MRC Prion Unit, Department of Neurodegenerative Disease, Institute of Neurology, London (United Kingdom)

    2006-06-15

    Inherited prion diseases are caused by mutations in the gene which codes for prion protein (PrP), leading to proliferation of abnormal PrP isomers in the brain and neurodegeneration; they include Gerstmann-Straeussler-Scheinker disease (GSS), fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD). We studied two patients with symptomatic inherited prion disease (P102L) and two pre-symptomatic P102L gene carriers using quantitative magnetic resonance spectroscopy (MRS). Short echo time spectra were acquired from the thalamus, caudate region and frontal white matter, metabolite levels and ratios were measured and z-scores calculated for individual patients relative to age-matched normal controls. MRS data were compared with structural magnetic resonance imaging. One fCJD case had generalised atrophy and showed increased levels of myo-inositol (MI) in the thalamus (z=3.7). The other had decreased levels of N-acetylaspartate (z=4) and diffuse signal abnormality in the frontal white matter. Both asymptomatic gene carriers had normal imaging, but increased frontal white matter MI (z=4.3, 4.1), and one also had increased MI in the caudate (z=5.3). Isolated MI abnormalities in asymptomatic gene carriers are a novel finding and may reflect early glial proliferation, prior to significant neuronal damage. MRS provides potential non-invasive surrogate markers of early disease and progression in inherited prion disease. (orig.)

  9. Regional brain metabolite abnormalities in inherited prion disease and asymptomatic gene carriers demonstrated in vivo by quantitative proton magnetic resonance spectroscopy

    Waldman, A.D.; Cordery, R.J.; Godbolt, A.; Rossor, M.N.; MacManus, D.G.; Collinge, J.

    2006-01-01

    Inherited prion diseases are caused by mutations in the gene which codes for prion protein (PrP), leading to proliferation of abnormal PrP isomers in the brain and neurodegeneration; they include Gerstmann-Straeussler-Scheinker disease (GSS), fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD). We studied two patients with symptomatic inherited prion disease (P102L) and two pre-symptomatic P102L gene carriers using quantitative magnetic resonance spectroscopy (MRS). Short echo time spectra were acquired from the thalamus, caudate region and frontal white matter, metabolite levels and ratios were measured and z-scores calculated for individual patients relative to age-matched normal controls. MRS data were compared with structural magnetic resonance imaging. One fCJD case had generalised atrophy and showed increased levels of myo-inositol (MI) in the thalamus (z=3.7). The other had decreased levels of N-acetylaspartate (z=4) and diffuse signal abnormality in the frontal white matter. Both asymptomatic gene carriers had normal imaging, but increased frontal white matter MI (z=4.3, 4.1), and one also had increased MI in the caudate (z=5.3). Isolated MI abnormalities in asymptomatic gene carriers are a novel finding and may reflect early glial proliferation, prior to significant neuronal damage. MRS provides potential non-invasive surrogate markers of early disease and progression in inherited prion disease. (orig.)

  10. Gravistimulation changes expression of genes encoding putative carrier proteins of auxin polar transport in etiolated pea epicotyls

    Hoshino, T.; Hitotsubashi, R.; Miyamoto, K.; Tanimoto, E.; Ueda, J.

    STS-95 space experiment has showed that auxin polar transport in etiolated epicotyls of pea (Pisum sativum L. cv. Alaska) seedlings is controlled by gravistimulation. In Arabidopsis thaliana auxin polar transport has considered to be regulated by efflux and influx carrier proteins in plasma membranes, AtPIN1 and AtAUX1, respectively. In order to know how gravistimuli control auxin polar transport in etiolated pea epicotyls at molecular levels, strenuous efforts have been made, resulting in successful isolation of full-length cDNAs of a putative auxin efflux and influx carriers, PsPIN2 and PsAUX1, respectively. Significantly high levels in homology were found on nucleotide and deduced amino acid sequences among PsPIN2, PsPIN1 (accession no. AY222857, Chawla and DeMason, 2003) and AtPINs, and also among PsAUX1, AtAUX1 and their related genes. Phylogenetic analyses based on the deduced amino acid sequences revealed that PsPIN2 belonged to a subclade including AtPIN3, AtPIN4 relating to lateral transport of auxin, while PsPIN1 belonged to the same clade as AtPIN1 relating to auxin polar transport. In the present study, we examined the effects of gravistimuli on the expression of PsPINs and PsAUX1 in etiolated pea seedlings by northern blot analysis. Expression of PsPIN1, PsPIN2 and PsAUX1 in hook region of 3.5-d-old etiolated pea seedlings grown under simulated microgravity conditions on a 3-D clinostat increased as compared with that of the seedlings grown under 1 g conditions. On the other hand, that of PsPIN1 and PsAUX1 in the 1st internode region under simulated microgravity conditions on a 3-D clinostat also increased, while that of PsPIN2 was affected little. These results suggest that expression of PsPIN1, PsPIN2 and PsAUX1 regulating polar/lateral transport of auxin is substantially under the control of gravity. A possible role of PsPINs and PsAUX1 of auxin polar transport in etiolated pea seedlings will also be discussed.

  11. Optimization of charge-carrier generation in amorphous-silicon thin-film tandem solar cell backed by two-dimensional metallic surface-relief grating

    Civiletti, Benjamin J.; Anderson, Tom H.; Ahmad, Faiz; Monk, Peter B.; Lakhtakia, Akhlesh

    2017-08-01

    The rigorous coupled-wave approach was implemented in a three-dimensional setting to calculate the chargecarrier-generation rate in a thin-film solar cell with multiple amorphous-silicon p-i-n junctions. The solar cell comprised a front antireflection window; three electrically isolated p-i-n junctions in tandem; and a periodically corrugated silver back-reflector with hillock-shaped corrugations arranged on a hexagonal lattice. The differential evolution algorithm (DEA) was used to maximize the charge-carrier-generation rate over a set of selected optical and electrical parameters. This optimization exercise minimized the bandgap of the topmost i-layer but all other parameters turned out to be uninfluential. More importantly, the exercise led to a configuration that would very likely render the solar cell inefficient. Therefore, another optimization exercise was conducted to maximize power density. The resulting configuration was optimal over all parameters.

  12. Optimized Carrier Based Multilevel Generated Modified Dual Three-Phase Open-Winding Inverter for Medium Power Applications

    Padmanaban, Sanjeevi Kumar; Blaabjerg, Frede; Wheeler, Patrick

    2016-01-01

    This paper presents a novel carrier based multilevel modulation for modified dual three-phase open-winding inverter applicable for low-voltage/high-current applications. A standard three-phase voltage source inverter (VSI) is connected across the open-winding of both ends of the motor. Each VSI i...

  13. Double-Bottom Chaotic Map Particle Swarm Optimization Based on Chi-Square Test to Determine Gene-Gene Interactions

    Yang, Cheng-Hong; Chang, Hsueh-Wei

    2014-01-01

    Gene-gene interaction studies focus on the investigation of the association between the single nucleotide polymorphisms (SNPs) of genes for disease susceptibility. Statistical methods are widely used to search for a good model of gene-gene interaction for disease analysis, and the previously determined models have successfully explained the effects between SNPs and diseases. However, the huge numbers of potential combinations of SNP genotypes limit the use of statistical methods for analysing high-order interaction, and finding an available high-order model of gene-gene interaction remains a challenge. In this study, an improved particle swarm optimization with double-bottom chaotic maps (DBM-PSO) was applied to assist statistical methods in the analysis of associated variations to disease susceptibility. A big data set was simulated using the published genotype frequencies of 26 SNPs amongst eight genes for breast cancer. Results showed that the proposed DBM-PSO successfully determined two- to six-order models of gene-gene interaction for the risk association with breast cancer (odds ratio > 1.0; P value <0.05). Analysis results supported that the proposed DBM-PSO can identify good models and provide higher chi-square values than conventional PSO. This study indicates that DBM-PSO is a robust and precise algorithm for determination of gene-gene interaction models for breast cancer. PMID:24895547

  14. Suicidal ideation and suicidal behavior according to the C-SSRS in a European cohort of Huntington's disease gene expansion carriers.

    van Duijn, Erik; Vrijmoeth, Eslie M; Giltay, Erik J; Bernhard Landwehrmeyer, G

    2018-03-01

    Huntington's disease (HD) gene expansion carriers are at an increased risk of suicide, but so far, no studies have investigated the full spectrum of suicidality, including suicidal ideation, suicidal behavior and self-injurious behavior. We included 1451 HD gene expansion carriers (age 48.4 years (SD 14.0), 54.8% female) of the REGISTRY study of the European Huntington's Disease Network. Lifetime suicidal ideation and suicidal behavior were assessed with the Columbia-Suicidal Severity Rating Scale. Motor symptoms and disease stage were assessed using subscales of the Unified Huntington's Disease Rating Scale, and depressed mood and irritability were assessed by the Problem Behaviors Assessment. Lifetime passive suicidal ideation was reported by 21.2%. Participants in stage II showed the highest prevalence rate of suicidal ideation, while participants in stage IV/V showed the highest prevalence of suicidal behavior. A lifetime suicide attempt was reported by 6.5% of the HD gene expansion carriers. In multivariate regression analyses, both suicidal ideation and suicidal behavior were associated with a depressed mood, and to a lesser extend to irritability. Results may have been affected by denial or recall bias and no conclusions can be made about the temporal and causal relationships with depressed mood and irritability because of the cross-sectional analyses. Given the high prevalence of suicidal ideation and suicidal behavior in all stages of HD, it is important to screen HD gene expansion carriers for suicidal ideation and suicidal behavior on a regular basis in clinical practice. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Multiobjective optimization in Gene Expression Programming for Dew Point

    Shroff, Siddharth; Dabhi, Vipul

    2013-01-01

    The processes occurring in climatic change evolution and their variations play a major role in environmental engineering. Different techniques are used to model the relationship between temperatures, dew point and relative humidity. Gene expression programming is capable of modelling complex realities with great accuracy, allowing, at the same time, the extraction of knowledge from the evolved models compared to other learning algorithms. This research aims to use Gene Expression Programming ...

  16. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  17. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Design, formulation and optimization of novel soft nano-carriers for transdermal olmesartan medoxomil delivery: In vitro characterization and in vivo pharmacokinetic assessment.

    Kamran, Mohd; Ahad, Abdul; Aqil, Mohd; Imam, Syed Sarim; Sultana, Yasmin; Ali, Asgar

    2016-05-30

    Olmesartan is a hydrophobic antihypertensive drug with a short biological half-life, and low bioavailability, presents a challenge with respect to its oral administration. The objective of the work was to formulate, optimize and evaluate the transdermal potential of novel vesicular nano-invasomes, containing above anti-hypertensive agent. To achieve the above purpose, soft carriers (viz. nano-invasomes) of olmesartan with β-citronellene as potential permeation enhancer were developed and optimized using Box-Behnken design. The physicochemical characteristics e.g., vesicle size, shape, entrapment efficiency and skin permeability of the nano-invasomes formulations were evaluated. The optimized formulation was further evaluated for in vitro drug release, confocal microscopy and in vivo pharmacokinetic study. The optimum nano-invasomes formulation showed vesicles size of 83.35±3.25nm, entrapment efficiency of 65.21±2.25% and transdermal flux of 32.78±0.703 (μg/cm(2)/h) which were found in agreement with the predicted value generated by Box-Behnken design. Confocal laser microscopy of rat skin showed that optimized formulation was eventually distributed and permeated deep into the skin. The pharmacokinetic study presented that transdermal nano-invasomes formulation showed 1.15 times improvement in bioavailability of olmesartan with respect to the control formulation in Wistar rats. It was concluded that the response surfaces estimated by Design Expert(®) illustrated obvious relationship between formulation factors and response variables and nano-invasomes were found to be a proficient carrier system for transdermal delivery of olmesartan. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Process optimization and photostability of silymarin nanostructured lipid carriers: effect on UV-irradiated rat skin and SK-MEL 2 cell line.

    Singh, Pooja; Singh, Mahendra; Kanoujia, Jovita; Arya, Malti; Saraf, Shailendra K; Saraf, Shubhini A

    2016-10-01

    The objective of the present work was to formulate a novel stable delivery system which would not only overcome the solubility issue of silymarin, but also help to increase the therapeutic value by better permeation, anticancer action and reduced toxicity. This was envisaged through the recent developments in nanotechnology, combined with the activity of the phytoconstituent silymarin. A 2(3) full factorial design based on three independent variables was used for process optimization of nanostructured lipid carriers (NLC). Developed formulations were evaluated on the basis of particle size, morphology, in vitro drug release, photostability and cell line studies. Optimized silymarin-NLC was incorporated into carbopol gel and further assessed for rheological parameters. Stable behaviour in presence of light was proven by photostability testing of formulation. Permeability parameters were significantly higher in NLC as compared to marketed phytosome formulation. The NLC based gel described in this study showed faster onset, and prolonged activity up to 24 h and better action against edema as compared to marketed formulation. In case of anticancer activity of silymarin-NLC against SK-MEL 2 cell lines, silymarin-NLC proved to possess anticancer activity in a dose-dependent manner (10-80 μM) and induced apoptosis at 80 μM in SK-MEL 2 cancer cells. This work documents for the first time that silymarin can be formulated into nanostructured lipoidal carrier system for enhanced permeation, greater stability as well as anticancer activity for skin.

  20. Association of TMEM106B gene polymorphism with age at onset in granulin mutation carriers and plasma granulin protein levels.

    Cruchaga, Carlos; Graff, Caroline; Chiang, Huei-Hsin; Wang, Jun; Hinrichs, Anthony L; Spiegel, Noah; Bertelsen, Sarah; Mayo, Kevin; Norton, Joanne B; Morris, John C; Goate, Alison

    2011-05-01

    To test whether rs1990622 (TMEM106B) is associated with age at onset (AAO) in granulin (GRN) mutation carriers and with plasma GRN levels in mutation carriers and healthy, elderly individuals. Rs1990622 (TMEM106B) was identified as a risk factor for frontotemporal lobar degeneration with TAR DNA-binding protein inclusions (FTLD-TDP) in a recent genome-wide association. Rs1990622 was genotyped in GRN mutation carriers and tested for association with AAO using the Kaplan-Meier method and a Cox proportional hazards model. Alzheimer's Disease Research Center. Subjects  We analyzed 50 affected and unaffected GRN mutation carriers from 4 previously reported FTLD-TDP families (HDDD1, FD1, HDDD2, and the Karolinska family). The GRN plasma levels were also measured in 73 healthy, elderly individuals. Age at onset and GRN plasma levels. The risk allele of rs1990622 was associated with a mean decrease of the AAO of 13 years (P = 9.9 × 10(-7)) and with lower plasma GRN levels in both healthy older adults (P = 4 × 10(-4)) and GRN mutation carriers (P = .0027). Analysis of the HapMap database identified a nonsynonymous single-nucleotide polymorphism rs3173615 (T185S) in perfect linkage disequilibrium with rs1990622. The association of rs1990622 with AAO explains, in part, the wide range in the AAO of disease among GRN mutation carriers. We hypothesize that rs1990622 or another variant in linkage disequilibrium could act in a manner similar to APOE in Alzheimer disease, increasing risk for disease in the general population and modifying AAO in mutation carriers. Our results also suggest that genetic variation in TMEM106B may influence risk for FTLD-TDP by modulating secreted levels of GRN.

  1. TMEM106B gene polymorphism is associated with age at onset in granulin mutation carriers and plasma granulin protein levels

    Cruchaga, Carlos; Graff, Caroline; Chiang, Huei-Hsin; Wang, Jun; Hinrichs, Anthony L.; Spiegel, Noah; Bertelsen, Sarah; Mayo, Kevin; Norton, Joanne B.; Morris, John C.; Goate, Alison

    2011-01-01

    Objective A recent genome-wide association study for frontotemporal lobar degeneration with TAR DNA-binding protein inclusions (FTLD-TDP), identified rs1990622 (TMEM106B) as a risk factor for FTLD-TDP. In this study we tested whether rs1990622 is associated with age at onset (AAO) in granulin (GRN) mutation carriers and with plasma GRN levels in mutation carriers and healthy elderly individuals. Design Rs1990622 was genotyped in GRN mutation carriers and tested for association with AAO using the Kaplan-Meier and a Cox proportional hazards model. Subjects We analyzed 50 affected and unaffected GRN mutation carriers from four previously reported FTLD-TDP families (HDDD1, FD1, HDDD2 and the Karolinska family). GRN plasma levels were also measured in 73 healthy, elderly individuals. Results The risk allele of rs1990622 is associated with a mean decrease of the age at onset of thirteen years (p=9.9×10−7), with lower plasma granulin levels in both healthy older adults (p = 4×10−4) and GRN mutation carriers (p=0.0027). Analysis of the HAPMAP database identified a non-synonymous single nucleotide polymorphism, rs3173615 (T185S) in perfect linkage disequilibrium with rs1990622. Conclusions The association of rs1990622 with AAO explains, in part, the wide range in the age at onset of disease among GRN mutation carriers. We hypothesize that rs1990622 or another variant in linkage disequilibrium could act in a manner similar to APOE in Alzheimer’s disease, increasing risk for disease in the general population and modifying AAO in mutation carriers. Our results also suggest that genetic variation in TMEM106B may influence risk for FTLD-TDP by modulating secreted levels of GRN. PMID:21220649

  2. Development of a codon optimization strategy using the efor RED reporter gene as a test case

    Yip, Chee-Hoo; Yarkoni, Orr; Ajioka, James; Wan, Kiew-Lian; Nathan, Sheila

    2018-04-01

    Synthetic biology is a platform that enables high-level synthesis of useful products such as pharmaceutically related drugs, bioplastics and green fuels from synthetic DNA constructs. Large-scale expression of these products can be achieved in an industrial compliant host such as Escherichia coli. To maximise the production of recombinant proteins in a heterologous host, the genes of interest are usually codon optimized based on the codon usage of the host. However, the bioinformatics freeware available for standard codon optimization might not be ideal in determining the best sequence for the synthesis of synthetic DNA. Synthesis of incorrect sequences can prove to be a costly error and to avoid this, a codon optimization strategy was developed based on the E. coli codon usage using the efor RED reporter gene as a test case. This strategy replaces codons encoding for serine, leucine, proline and threonine with the most frequently used codons in E. coli. Furthermore, codons encoding for valine and glycine are substituted with the second highly used codons in E. coli. Both the optimized and original efor RED genes were ligated to the pJS209 plasmid backbone using Gibson Assembly and the recombinant DNAs were transformed into E. coli E. cloni 10G strain. The fluorescence intensity per cell density of the optimized sequence was improved by 20% compared to the original sequence. Hence, the developed codon optimization strategy is proposed when designing an optimal sequence for heterologous protein production in E. coli.

  3. Methodology optimizing SAGE library tag-to-gene mapping: application to Leishmania

    Smandi Sondos

    2012-01-01

    Full Text Available Abstract Background Leishmaniasis are widespread parasitic-diseases with an urgent need for more active and less toxic drugs and for effective vaccines. Understanding the biology of the parasite especially in the context of host parasite interaction is a crucial step towards such improvements in therapy and control. Several experimental approaches including SAGE (Serial analysis of gene expression have been developed in order to investigate the parasite transcriptome organisation and plasticity. Usual SAGE tag-to-gene mapping techniques are inadequate because almost all tags are normally located in the 3'-UTR outside the CDS, whereas most information available for Leishmania transcripts is restricted to the CDS predictions. The aim of this work is to optimize a SAGE libraries tag-to-gene mapping technique and to show how this development improves the understanding of Leishmania transcriptome. Findings The in silico method implemented herein was based on mapping the tags to Leishmania genome using BLAST then mapping the tags to their gene using a data-driven probability distribution. This optimized tag-to-gene mappings improved the knowledge of Leishmania genome structure and transcription. It allowed analyzing the expression of a maximal number of Leishmania genes, the delimitation of the 3' UTR of 478 genes and the identification of biological processes that are differentially modulated during the promastigote to amastigote differentiation. Conclusion The developed method optimizes the assignment of SAGE tags in trypanosomatidae genomes as well as in any genome having polycistronic transcription and small intergenic regions.

  4. Identification of clonally rearranged T-cell receptor beta chain genes in HTLV-I carriers as a potential instrument for early detection of neoplasia

    M.M. Sales

    2005-05-01

    Full Text Available We analyzed the genetic recombination pattern of the T-cell receptor beta-chain gene (TCR-beta in order to identify clonal expansion of T-lymphocytes in 17 human T-lymphotropic virus type I (HTLV-I-positive healthy carriers, 7 of them with abnormal features in the peripheral blood lymphocytes. Monoclonal or oligoclonal expansion of T-cells was detected in 5 of 7 HTLV-I-positive patients with abnormal lymphocytes and unconfirmed diagnosis by using PCR amplification of segments of TCR-beta gene, in a set of reactions that target 102 different variable (V segments, covering all members of the 24 V families available in the gene bank, including the more recently identified segments of the Vbeta-5 and Vbeta-8 family and the two diversity beta segments. Southern blots, the gold standard method to detect T-lymphocyte clonality, were negative for all of these 7 patients, what highlights the low sensitivity of this method that requires a large amount of very high quality DNA. To evaluate the performance of PCR in the detection of clonality we also analyzed 18 leukemia patients, all of whom tested positive. Clonal expansion was not detected in any of the negative controls or healthy carriers without abnormal lymphocytes. In conclusion, PCR amplification of segments of rearranged TCR-beta is reliable and highly suitable for the detection of small populations of clonal T-cells in asymptomatic HTLV-I carriers who present abnormal peripheral blood lymphocytes providing an additional instrument for following up these patients with potentially higher risk of leukemia.

  5. Triplicate genes for mitochondrial ADP/ATP carriers in the aerobic yeast Yarrowia lipolytica are regulated differentially in the absence of oxygen

    Mentel, M.; Piskur, Jure; Neuveglise, C.

    2005-01-01

    Yarrowia lipolytica is a strictly aerobic fungus, which differs from the extensively studied model yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe with respect to its physiology, genetics and dimorphic growth habit. We isolated and sequenced cDNA and genomic clones (YlAAC1) from Y....... lipolytica that encode a mitochondrial ADP/ATP carrier. The YlAAC1 gene can complement the S. cerevisiae Delta aac2 deletion mutant. Southern hybridization, analysis of Yarrowia clones obtained in the course of the Genolevures project, and further sequencing revealed the existence of two paralogs of the Yl...

  6. Prophage Rs551 and Its Repressor Gene orf14 Reduce Virulence and Increase Competitive Fitness of Its Ralstonia solanacearum Carrier Strain UW551.

    Ahmad, Abdelmonim Ali; Stulberg, Michael J; Huang, Qi

    2017-01-01

    We previously characterized a filamentous lysogenic bacteriophage, ϕRs551, isolated directly from the race 3 biovar 2 phylotype IIB sequevar 1 strain UW551 of Ralstonia solanacearum grown under normal culture conditions. The genome of ϕRs551 was identified with 100% identity in the deposited genomes of 11 race 3 biovar 2 phylotype IIB sequevar 1 strains of R. solanacearum , indicating evolutionary and biological importance, and ORF14 of ϕRs551 was annotated as a putative type-2 repressor. In this study, we determined the effect of the prophage and its ORF14 on the virulence and competitive fitness of its carrier strain UW551 by deleting the orf14 gene only (the UW551 orf14 mutant), and nine of the prophage's 14 genes including orf14 and six out of seven structural genes (the UW551 prophage mutant), respectively, from the genome of UW551. The two mutants were increased in extracellular polysaccharide production, twitching motility, expression of targeted virulence and virulence regulatory genes ( pilT, egl, pehC, hrPB, and phcA ), and virulence, suggesting that the virulence of UW551 was negatively regulated by ϕRs551, at least partially through ORF14. Interestingly, we found that the wt ϕRs551-carrying strain UW551 of R. solanacearum significantly outcompeted the wt strain RUN302 which lacks the prophage in tomato plants co-inoculated with the two strains. When each of the two mutant strains was co-inoculated with RUN302, however, the mutants were significantly out-competed by RUN302 for the same colonization site. Our results suggest that ecologically, ϕRs551 may play an important role by regulating the virulence of and offering a competitive fitness advantage to its carrier bacterial strain for persistence of the bacterium in the environment, which in turn prolongs the symbiotic relationship between the phage ϕRs551 and the R. solanacearum strain UW551. Our study is the first toward a better understanding of the co-existence between a lysogenic phage and

  7. Prophage Rs551 and Its Repressor Gene orf14 Reduce Virulence and Increase Competitive Fitness of Its Ralstonia solanacearum Carrier Strain UW551

    Abdelmonim Ali Ahmad

    2017-12-01

    Full Text Available We previously characterized a filamentous lysogenic bacteriophage, ϕRs551, isolated directly from the race 3 biovar 2 phylotype IIB sequevar 1 strain UW551 of Ralstonia solanacearum grown under normal culture conditions. The genome of ϕRs551 was identified with 100% identity in the deposited genomes of 11 race 3 biovar 2 phylotype IIB sequevar 1 strains of R. solanacearum, indicating evolutionary and biological importance, and ORF14 of ϕRs551 was annotated as a putative type-2 repressor. In this study, we determined the effect of the prophage and its ORF14 on the virulence and competitive fitness of its carrier strain UW551 by deleting the orf14 gene only (the UW551 orf14 mutant, and nine of the prophage’s 14 genes including orf14 and six out of seven structural genes (the UW551 prophage mutant, respectively, from the genome of UW551. The two mutants were increased in extracellular polysaccharide production, twitching motility, expression of targeted virulence and virulence regulatory genes (pilT, egl, pehC, hrPB, and phcA, and virulence, suggesting that the virulence of UW551 was negatively regulated by ϕRs551, at least partially through ORF14. Interestingly, we found that the wt ϕRs551-carrying strain UW551 of R. solanacearum significantly outcompeted the wt strain RUN302 which lacks the prophage in tomato plants co-inoculated with the two strains. When each of the two mutant strains was co-inoculated with RUN302, however, the mutants were significantly out-competed by RUN302 for the same colonization site. Our results suggest that ecologically, ϕRs551 may play an important role by regulating the virulence of and offering a competitive fitness advantage to its carrier bacterial strain for persistence of the bacterium in the environment, which in turn prolongs the symbiotic relationship between the phage ϕRs551 and the R. solanacearum strain UW551. Our study is the first toward a better understanding of the co-existence between a

  8. Prophage Rs551 and Its Repressor Gene orf14 Reduce Virulence and Increase Competitive Fitness of Its Ralstonia solanacearum Carrier Strain UW551

    Ahmad, Abdelmonim Ali; Stulberg, Michael J.; Huang, Qi

    2017-01-01

    We previously characterized a filamentous lysogenic bacteriophage, ϕRs551, isolated directly from the race 3 biovar 2 phylotype IIB sequevar 1 strain UW551 of Ralstonia solanacearum grown under normal culture conditions. The genome of ϕRs551 was identified with 100% identity in the deposited genomes of 11 race 3 biovar 2 phylotype IIB sequevar 1 strains of R. solanacearum, indicating evolutionary and biological importance, and ORF14 of ϕRs551 was annotated as a putative type-2 repressor. In this study, we determined the effect of the prophage and its ORF14 on the virulence and competitive fitness of its carrier strain UW551 by deleting the orf14 gene only (the UW551 orf14 mutant), and nine of the prophage’s 14 genes including orf14 and six out of seven structural genes (the UW551 prophage mutant), respectively, from the genome of UW551. The two mutants were increased in extracellular polysaccharide production, twitching motility, expression of targeted virulence and virulence regulatory genes (pilT, egl, pehC, hrPB, and phcA), and virulence, suggesting that the virulence of UW551 was negatively regulated by ϕRs551, at least partially through ORF14. Interestingly, we found that the wt ϕRs551-carrying strain UW551 of R. solanacearum significantly outcompeted the wt strain RUN302 which lacks the prophage in tomato plants co-inoculated with the two strains. When each of the two mutant strains was co-inoculated with RUN302, however, the mutants were significantly out-competed by RUN302 for the same colonization site. Our results suggest that ecologically, ϕRs551 may play an important role by regulating the virulence of and offering a competitive fitness advantage to its carrier bacterial strain for persistence of the bacterium in the environment, which in turn prolongs the symbiotic relationship between the phage ϕRs551 and the R. solanacearum strain UW551. Our study is the first toward a better understanding of the co-existence between a lysogenic phage and

  9. Natural gum as mucoadhesive controlled release carriers: evaluation of cefpodoxime proxetil by D-optimal design technique.

    Patil, Satish H; Talele, Gokul S

    2014-03-01

    The present study deals with the development of mucoadhesive controlled release tablets of Cefpodoxime Proxetil to increase the gastric residence time and thus prolong drug release, reduce dosing frequency and improve oral bioavailability. Tablets were prepared using sodium alginate and karaya gum, a natural polymer, with a synthetic polymer hydroxypropylmethylcellulose (K100LV) and Karaya gum with HPMC K100LV in various ratios to optimize the drug release profile using D-Optimal technique. Pre- and post-compression parameters of tablets prepared with various formulations (S1-S9, C1-C9) were evaluated. The FTIR and DSC studies revealed that no physiochemical interaction between excipients and drug. The formulation S7 showed prolonged drug release, and the mechanism of drug release from the optimized formulation was confirmed using the Korsmeyer-Peppas model to be non-Fickian release transport and n value was found 0.605 indicating both diffusion and erosion mechanism from these natural gums. The optimized formulation showed mucoadhesive strength >35 g. An in vivo study was performed on rabbits using an X-ray imaging technique. The radiological evidence suggests that the tablets adheres (more than 10 hours) to a rabbit's stomach. No significant changes were found in the physical appearance, drug content, mucoadhesive study and in vitro dissolution pattern after storage at 40 °C/75% relative humidity for 3 months.

  10. Non-Viral Transfection Methods Optimized for Gene Delivery to a Lung Cancer Cell Line

    Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

    2013-01-01

    Background Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. Methods In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize deliver...

  11. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7

    Bi YZ

    2016-11-01

    Full Text Available Yanzhao Bi, Yifan Zhang, Chunying Cui, Lulu Ren, Xueyun Jiang School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing, People’s Republic of China Abstract: Nanodiamond (ND is a renowned material in nonviral small interfering RNA (siRNA carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH22NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR assay, enzyme-linked immunosorbent assay (ELISA, flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH22NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V–fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH22NH-VDGR/survivin-siRNA nanoparticle with 60–110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH22NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH22NH-VDGR was suggested

  12. Formulation Development, Optimization, and In vitro - In vivo Characterization of Natamycin Loaded PEGylated Nano-lipid Carriers for Ocular Applications.

    Patil, Akash; Lakhani, Prit; Taskar, Pranjal; Wu, Kai-Wei; Sweeney, Corinne; Avula, Bharathi; Wang, Yan-Hong; Khan, Ikhlas A; Majumdar, Soumyajit

    2018-04-23

    Current study aimed at formulating and optimizing natamycin (NT) loaded PEGylated NLCs (NT-PEG-NLCs) using Box-Behnken Design and investigating their potential in ocular applications. Response surface methodology (RSM) computations and plots for optimization were performed using Design Expert ® software, to obtain optimum values for response variables based on the criteria of desirability. Optimized NT-PEG-NLCs had predicted values for the dependent variables not significantly different from the experimental values. NT-PEG-NLCs were characterized for their physicochemical parameters; NT's rate of permeation and flux across rabbit cornea was evaluated, in vitro; ocular tissue distribution was assessed in rabbits, in vivo. NT-PEG-NLCs were found to have optimum particle size (< 300 nm) narrow PDI, high NT entrapment and NT content. In vitro transcorneal permeability and flux of NT from NT-PEG-NLCs was significantly higher than Natacyn ® . NT-PEG-NLC (0.3%) showed improved delivery of NT across the intact cornea and provided concentrations statistically similar to the marketed suspension (5%) in inner ocular tissues, in vivo, indicating that it could be a potential alternative to the conventional suspension during the course of fungal keratitis therapy. Copyright © 2018. Published by Elsevier Inc.

  13. Optimization of the charge-carrier injection in organic light-emitting diodes; Optimierung der Ladungstraegerinjektion in organische Leuchtdioden

    Krause, Ralf

    2009-07-01

    Nowadays based on resource shortage and climate warming there is a big interest in the use of power-saving lighting sources. Therefore the research on white organic light emitting devices (OLEDs) has gained importance during the last years. To obtain high power efficiencies in OLEDs it is necessary to provide low driving voltages. That can be realised by the use of doped transport layers, in which donors and acceptors are coevaporated with organic transport materials. In this thesis I discuss novel p-type and n-type doping materials for small organic molecules which decrease the ohmic loss in organic transport layers used in OLEDs. This reduction of the resistance is caused by an increase of the intrinsic charge carrier density and therefore an increase of the conductivity. First single layer devices are used to analyse the properties of potential doping materials by varying the doping concentration. The tested p-doping materials are commercially available metal oxides (MoO{sub 3} and Re{sub 2}O{sub 7}) and metal-organic complexes. Both metal oxides show a strong conductivity improvement of up to 7 orders of magnitude. The investigated n-doping materials are alkali salts, metal-organic and organic complexes. Among the alkali salts Cs{sub 2}CO{sub 3} is the best material in test with a conductivity enhancement of up to 7 orders of magnitude. For this material class I focused on the question whether the metal cation or the organic anion causes the doping effect. Using similar Caesium salts differently strong doping effects were obtained. Therefore I came to the conclusion that beside the metal cation also the anion plays a role for the doping effect. Secondly I performed a series of multilayer devices for two doping materials (Re{sub 2}O{sub 7} as acceptor and Cs{sub 2}CO{sub 3} as donor) to separate the transport and injection enhancement. The results show that a doped transport layer improves the hole or electron injection into an undoped material by several orders

  14. Evaluation and optimization of pH-responsive niosomes as a carrier for efficient treatment of breast cancer.

    Salem, Heba F; Kharshoum, Rasha M; Abo El-Ela, Fatma I; F, Amr Gamal; Abdellatif, Khaled R A

    2018-02-27

    Tamoxifen citrate (TXC) is commonly indicated to prevent cell multiplication and development of breast cancer. However, it is usually associated with limited activity and development of toxicity and resistance. This study aimed to describe an in situ pH-responsive niosomes as a carrier for localized and sustained delivery of TXC. The thin film hydration method was utilized to produce TXC niosomes using sorbitan monostearate and cholesterol of 1:1 Molar ratio. The produced formula displayed nano-spherical shape with entrapment efficiency (EE) of 88.90 ± 0.72% and drug release of 49.2 ± 1.51% within 8 h. This formula was incorporated into chitosan/glyceryl monooleate (CH/GMO) as a localized in situ pH-responsive hydrogel delivery system. Different formulae were produced by Design-Expert software based on user-defined response surface design utilizing different chitosan concentration (A) and GMO concentration (B) characterized for mean viscosity (R 2 ) and in vitro release studies (R 1 ). The results displayed that R 1 was significantly antagonistic with both of A and B while R 2 was significantly synergistic with both of them. The optimum formula was selected and capped with gold as an ideal candidate for computed tomography (CT) to evaluate the efficacy and tissue distribution of TXC utilizing Ehrlich carcinoma mice model. The optimum formula showed localized TXC in a tumour and consequently a significant anti-tumour efficacy compared with free TXC. Based on these outcomes, the novel in situ pH-responsive TXC-loaded noisome could be a promising formula for the efficient treatment of breast cancer.

  15. Evaluation of the XRCC1 gene as a phenotypic modifier in BRCA1/2 mutation carriers. Results from the consortium of investigators of modifiers of BRCA1/BRCA2

    Osorio, A.; Milne, R. L.; Alonso, R.; Pita, G.; Peterlongo, P.; Teulé, A.; Nathanson, K. L.; Domchek, S. M.; Rebbeck, T.; Lasa, A.; Konstantopoulou, I.; Hogervorst, F. B.; Verhoef, S.; van Dooren, M. F.; Jager, A.; Ausems, M. G. E. M.; Aalfs, C. M.; van Asperen, C. J.; Vreeswijk, M.; Waisfisz, Q.; van Roozendaal, C. E.; Ligtenberg, M. J.; Easton, D. F.; Peock, S.; Cook, M.; Oliver, C. T.; Frost, D.; Curzon, B.; Evans, D. G.; Lalloo, F.; Eeles, R.; Izatt, L.; Davidson, R.; Adlard, J.; Eccles, D.; Ong, K.-r; Douglas, F.; Downing, S.; Brewer, C.; Walker, L.; Nevanlinna, H.; Aittomäki, K.; Couch, F. J.; Fredericksen, Z.; Lindor, N. M.; Godwin, A.; Isaacs, C.; Caligo, M. A.; Loman, N.; Jernström, H.; Barbany-Bustinza, G.; Liljegren, A.; Ehrencrona, H.; Stenmark-Askmalm, M.; Feliubadaló, L.; Manoukian, S.; Peissel, B.; Zaffaroni, D.; Bonanni, B.; Fortuzzi, S.; Johannsson, O. T.; Chenevix-Trench, G.; Chen, X.-C.; Beesley, J.; Spurdle, A. B.; Sinilnikova, O. M.; Healey, S.; McGuffog, L.; Antoniou, A. C.; Brunet, J.; Radice, P.; Benítez, J.; Hogervorst, F. B. L.; Verheus, M.; van 't Veer, L. J.; van Leeuwen, F. E.; Rookus, M. A.; Collée, M.; van den Ouweland, A. M. W.; Hooning, M. J.; Tilanus-Linthorst, M. M. A.; Seynaeve, C.; Wijnen, J. T.; Vreeswijk, M. P.; Tollenaar, R. A.; Devilee, P.; Hoogerbrugge, N.; Ausems, M. G.; van der Luijt, R. B.; van Os, T. A.; Gille, J. J. P.; Meijers-Heijboer, H. E. J.; Gomez-Garcia, E. B.; Blok, Marinus J.; Caanen, B.; Oosterwijk, J. C.; van der Hout, A. H.; Mourits, M. J.; Vasen, H. F.; Peock, Susan; Cook, Margaret; Oliver, Clare; Frost, Debra; Miedzybrodzka, Zosia; Gregory, Helen; Morrison, Patrick; Jeffers, Lisa; Cole, Trevor; McKeown, Carole; Ong, Kai-Ren; Hoffman, Jonathan; Donaldson, Alan; Paterson, Joan; Downing, Sarah; Taylor, Amy; Murray, Alexandra; Rogers, Mark T.; McCann, Emma; Kennedy, M. John; Barton, David; East, South; Porteous, Mary; Drummond, Sarah; Brewer, Carole; Kivuva, Emma; Searle, Anne; Goodman, Selina; Hill, Kathryn; Davidson, Rosemarie; Bradshaw, Nicola; Snadden, Lesley; Longmuir, Mark; Watt, Catherine; Gibson, Sarah; Izatt, Louise; Jacobs, Chris; Langman, Caroline; Whaite, Anna; Dorkins, Huw; Barwell, Julian; Adlard, Julian; Chu, Carol; Miller, Julie; Ellis, Ian; Evans, D. Gareth; Lalloo, Fiona; Taylor, Jane; Side, Lucy; Male, Alison; Berlin, Cheryl; Eason, Jacqueline; Collier, Rebecca; Douglas, Fiona; Claber, Oonagh; Walker, Lisa; McLeod, Diane; Halliday, Dorothy; Durell, Sarah; Stayner, Barbara; Eeles, Ros; Shanley, Susan; Rahman, Nazneen; Houlston, Richard; Bancroft, Elizabeth; D'Mello, Lucia; Page, Elizabeth; Ardern-Jones, Audrey; Kohut, Kelly; Wiggins, Jennifer; Castro, Elena; Mitra, Anitra; Robertson, Lisa; Cook, Jackie; Quarrell, Oliver; Bardsley, Cathryn; Hodgson, Shirley; Goff, Sheila; Brice, Glen; Winchester, Lizzie; Eddy, Charlotte; Tripathi, Vishakha; Attard, Virginia; Eccles, Diana; Lucassen, Anneke; Crawford, Gillian; McBride, Donna; Smalley, Sarah; Godwin, A. K.; Karlsson, Per; Nordling, Margareta; Bergman, Annika; Einbeigi, Zakaria; Stenmark- Askmalm, Marie; Liedgren, Sigrun; Borg, Ake; Loman, Niklas; Olsson, Håkan; Kristoffersson, Ulf; Jernström, Helena; Harbst, Katja; Henriksson, Karin; Lindblom, Annika; Arver, Brita; Wachenfeldt, Anna von; Liljegren, Annelie; Barbany-Bustinza, Gisela; Rantala, Johanna; Melin, Beatrice; Grönberg, Henrik; Stattin, Eva-Lena; Emanuelsson, Monica; Ehrencrona, Hans; Rosenquist Brandell, Richard; Dahl, Niklas

    2011-01-01

    Single-nucleotide polymorphisms (SNPs) in genes involved in DNA repair are good candidates to be tested as phenotypic modifiers for carriers of mutations in the high-risk susceptibility genes BRCA1 and BRCA2. The base excision repair (BER) pathway could be particularly interesting given the relation

  16. Enhancing Wind Power Integration through Optimal Use of Flexibility in Multi-Carrier Energy Systems from the Danish Perspective

    Zong, Yi; Awadelrahman, M. A. Ahmed; Wang, Jiawei

    2017-01-01

    Denmark’ goal of being independent of fossil energy sources in 2050 puts forward great demands on all energy subsystems (electricity, heat, gas and transport, etc.) to be operated in a holistic manner. The Danish experience and challenges of wind power integration and the development of district...... heating systems are summarized in this paper. How to optimally use the cross-sectoral flexibility by intelligent control (model predictive control-based) of the key coupling components in an integrated heat and power system including electrical heat pumps in the demand side, and thermal storage...

  17. Modeling and optimization of gelatin-chitosan micro-carriers preparation for soft tissue engineering: Using Response Surface Methodology.

    Radaei, Payam; Mashayekhan, Shohreh; Vakilian, Saeid

    2017-06-01

    Electrospray ionization is a wide spread technique for producing polymeric microcarriers (MCs) by applying electrostatic force and ionic cross-linker, simultaneously. In this study, fabrication process of gelatin-chitosan MCs and its optimization using the Response Surface Methodology (RSM) is reported. Gelatin/chitosan (G/C) blend ratio, applied voltage and feeding flow rate, their individual and interaction effects on the diameter and mechanical strength of the MCs were investigated. The obtained models for diameter and mechanical strength of MCs have a quadratic relationship with G/C blend ratio, applied voltage and feeding flow rate. Using the desirability curve, optimized G/C blend ratios that are introduced, include the desirable quantities for MCs diameter and mechanical strength. MCs of the same desirable diameter (350μm) and different G/C blend ratio (1, 2, and 3) were fabricated and their elasticity was investigated via Atomic Force Microscopy (AFM). The biocompatibility of the MCs was evaluated using MTT assay. The results showed that human Umbilical Cord Mesenchymal Stem Cells (hUCMSCs) could attach and proliferate on fabricated MCs during 7days of culturing especially on those prepared with G/C blend ratios of 1 and 2. Such gelatin-chitosan MCs may be considered as a promising candidate for injectable tissue engineering scaffolds, supporting attachment and proliferation of hUCMSCs. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. The impact of quantitative optimization of hybridization conditions on gene expression analysis

    Auburn Richard P

    2011-03-01

    Full Text Available Abstract Background With the growing availability of entire genome sequences, an increasing number of scientists can exploit oligonucleotide microarrays for genome-scale expression studies. While probe-design is a major research area, relatively little work has been reported on the optimization of microarray protocols. Results As shown in this study, suboptimal conditions can have considerable impact on biologically relevant observations. For example, deviation from the optimal temperature by one degree Celsius lead to a loss of up to 44% of differentially expressed genes identified. While genes from thousands of Gene Ontology categories were affected, transcription factors and other low-copy-number regulators were disproportionately lost. Calibrated protocols are thus required in order to take full advantage of the large dynamic range of microarrays. For an objective optimization of protocols we introduce an approach that maximizes the amount of information obtained per experiment. A comparison of two typical samples is sufficient for this calibration. We can ensure, however, that optimization results are independent of the samples and the specific measures used for calibration. Both simulations and spike-in experiments confirmed an unbiased determination of generally optimal experimental conditions. Conclusions Well calibrated hybridization conditions are thus easily achieved and necessary for the efficient detection of differential expression. They are essential for the sensitive pro filing of low-copy-number molecules. This is particularly critical for studies of transcription factor expression, or the inference and study of regulatory networks.

  19. A Theoretical and Empirical Integrated Method to Select the Optimal Combined Signals for Geometry-Free and Geometry-Based Three-Carrier Ambiguity Resolution.

    Zhao, Dongsheng; Roberts, Gethin Wyn; Lau, Lawrence; Hancock, Craig M; Bai, Ruibin

    2016-11-16

    Twelve GPS Block IIF satellites, out of the current constellation, can transmit on three-frequency signals (L1, L2, L5). Taking advantages of these signals, Three-Carrier Ambiguity Resolution (TCAR) is expected to bring much benefit for ambiguity resolution. One of the research areas is to find the optimal combined signals for a better ambiguity resolution in geometry-free (GF) and geometry-based (GB) mode. However, the existing researches select the signals through either pure theoretical analysis or testing with simulated data, which might be biased as the real observation condition could be different from theoretical prediction or simulation. In this paper, we propose a theoretical and empirical integrated method, which first selects the possible optimal combined signals in theory and then refines these signals with real triple-frequency GPS data, observed at eleven baselines of different lengths. An interpolation technique is also adopted in order to show changes of the AR performance with the increase in baseline length. The results show that the AR success rate can be improved by 3% in GF mode and 8% in GB mode at certain intervals of the baseline length. Therefore, the TCAR can perform better by adopting the combined signals proposed in this paper when the baseline meets the length condition.

  20. Pareto evolution of gene networks: an algorithm to optimize multiple fitness objectives

    Warmflash, Aryeh; Siggia, Eric D; Francois, Paul

    2012-01-01

    The computational evolution of gene networks functions like a forward genetic screen to generate, without preconceptions, all networks that can be assembled from a defined list of parts to implement a given function. Frequently networks are subject to multiple design criteria that cannot all be optimized simultaneously. To explore how these tradeoffs interact with evolution, we implement Pareto optimization in the context of gene network evolution. In response to a temporal pulse of a signal, we evolve networks whose output turns on slowly after the pulse begins, and shuts down rapidly when the pulse terminates. The best performing networks under our conditions do not fall into categories such as feed forward and negative feedback that also encode the input–output relation we used for selection. Pareto evolution can more efficiently search the space of networks than optimization based on a single ad hoc combination of the design criteria. (paper)

  1. Pareto evolution of gene networks: an algorithm to optimize multiple fitness objectives.

    Warmflash, Aryeh; Francois, Paul; Siggia, Eric D

    2012-10-01

    The computational evolution of gene networks functions like a forward genetic screen to generate, without preconceptions, all networks that can be assembled from a defined list of parts to implement a given function. Frequently networks are subject to multiple design criteria that cannot all be optimized simultaneously. To explore how these tradeoffs interact with evolution, we implement Pareto optimization in the context of gene network evolution. In response to a temporal pulse of a signal, we evolve networks whose output turns on slowly after the pulse begins, and shuts down rapidly when the pulse terminates. The best performing networks under our conditions do not fall into categories such as feed forward and negative feedback that also encode the input-output relation we used for selection. Pareto evolution can more efficiently search the space of networks than optimization based on a single ad hoc combination of the design criteria.

  2. Cloning, Codon Optimization, and Expression of Yersinia intermedia Phytase Gene in E. coli.

    Mirzaei, Maryam; Saffar, Behnaz; Shareghi, Behzad

    2016-06-01

    Phytate is an anti-nutritional factor in plants, which catches the most phosphorus contents and some vital minerals. Therefore, Phytase is added mainly as an additive to the monogastric animals' foods to hydrolyze phytate and increase absorption of phosphorus. Y. intermedia phytase is a new phytase with special characteristics such as high specific activity, pH stability, and thermostability. Our aim was to clone, express, and characterizea codon optimized Y. intermedia phytase gene in E. coli . The Y. intermedia phytase gene was optimized according to the codon usage in E. coli . The sequence was synthesized and sub-cloned in pET-22b (+) vector and transformed into E. coli Bl21 (DE3). The protein was expressed in the presence of IPTG at a final concentration of 1 mM at 30°C. The purification of recombinant protein was performed by Ni 2+ affinity chromatography. Phytase activity and stability were determined in various pH and temperatures. The codon optimized Y. intermedia phytase gene was sub-cloned successfully.The expression was confirmed by SDS-PAGE and Western blot analysis. The recombinant enzyme (approximately 45 kDa) was purified. Specific activity of enzyme was 3849 (U.mg -1 ) with optimal pH 5 and optimal temperature of 55°C. Thermostability (80°C for 15 min) and pH stability (3-6) of the enzyme were 56 and more than 80%, respectively. The results of the expression and enzyme characterization revealed that the optimized Y. intermedia phytase gene has a good potential to be produced commercially andto be applied in animals' foodsindustry.

  3. Molecular cloning and characterization of the genes encoding an auxin efflux carrier and the auxin influx carriers associated with the adventitious root formation in mango (Mangifera indica L.) cotyledon segments.

    Li, Yun-He; Zou, Ming-Hong; Feng, Bi-Hong; Huang, Xia; Zhang, Zhi; Sun, Guang-Ming

    2012-06-01

    Polar auxin transport (PAT) plays an important role in the adventitious root formation of mango cotyledon segments, but the molecular mechanism remains unclear. In this study, we cloned a gene encoding an auxin efflux carrier (designated as MiPIN1), and we cloned four genes encoding auxin influx carriers (designated as MiAUX1, MiAUX2, MiAUX3 and MiAUX4). The results of a phylogenetic tree analysis indicated that MiPIN1 and the MiAUXs belong to plant PIN and AUXs/LAXs groups. Quantitative real-time PCR indicated that the expression of MiPIN1 and the MiAUXs was lowest at 0 days but sharply increased on and after day 4. During the root formation in the mango cotyledon segments, the MiPIN1 expression in the distal cut surface (DCS) was always higher than the expression in the proximal cut surface (PCS) whereas the expression of the MiAUXs in the PCS was usually higher than in the DCS. This expression pattern might be result in the PAT from the DCS to the PCS, which is essential for the adventitious root formation in the PCS. Our previous study indicated that a pre-treatment of embryos with indole-3-butyric acid (IBA) significantly promoted adventitious rooting in PCS whereas a pre-treatment with 2,3,5-triiodobenzoic acid (TIBA) completely inhibited this rooting. In this study, however, IBA and TIBA pre-treatments slightly changed the expression of MiPIN1. In contrast, while the MiAUX3 and MiAUX4 expression levels were significantly up-regulated by the IBA pre-treatment, the expression levels were down-regulated by the TIBA pre-treatment. These findings imply that MiAUX3 and MiAUX4 are more sensitive to the IBA and TIBA treatments and that they might play important roles during adventitious root formation in mango cotyledon segments. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  4. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7.

    Bi, Yanzhao; Zhang, Yifan; Cui, Chunying; Ren, Lulu; Jiang, Xueyun

    Nanodiamond (ND) is a renowned material in nonviral small interfering RNA (siRNA) carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH 2 ) 2 NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR) assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V-fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA nanoparticle with 60-110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH 2 ) 2 NH-VDGR was suggested to be used in siRNA delivery system and in cancer treatments.

  5. [Effect of gene optimization on the expression and purification of HDV small antigen produced by genetic engineering].

    Ding, Jun-Ying; Meng, Qing-Ling; Guo, Min-Zhuo; Yi, Yao; Su, Qiu-Dong; Lu, Xue-Xin; Qiu, Feng; Bi, Sheng-Li

    2012-10-01

    To study the effect of gene optimization on the expression and purification of HDV small antigen produced by genetic engineering. Based on the colon preference of E. coli, the HDV small antigen original gene from GenBank was optimized. Both the original gene and the optimized gene expressed in prokaryotic cells, SDS-PAGE was made to analyze the protein expression yield and to decide which protein expression style was more proportion than the other. Furthermore, two antigens were purified by chromatography in order to compare the purity by SDS-PAGE and Image Lab software. SDS-PAGE indicated that the molecular weight of target proteins from two groups were the same as we expected. Gene optimization resulted in the higher yield and it could make the product more soluble. After chromatography, the purity of target protein from optimized gene was up to 96.3%, obviously purer than that from original gene. Gene optimization could increase the protein expression yield and solubility of genetic engineering HDV small antigen. In addition, the product from the optimized gene group was easier to be purified for diagnosis usage.

  6. submitter Metabolomic Profile of Low–Copy Number Carriers at the Salivary α-Amylase Gene Suggests a Metabolic Shift Toward Lipid-Based Energy Production

    Arredouani, Abdelilah; Culeddu, Nicola; Moustafa, Julia El-Sayed; Tichet, Jean; Balkau, Beverley; Brousseau, Thierry; Manca, Marco; Falchi, Mario

    2016-01-01

    Low serum salivary amylase levels have been associated with a range of metabolic abnormalities, including obesity and insulin resistance. We recently suggested that a low copy number at the AMY1 gene, associated with lower enzyme levels, also increases susceptibility to obesity. To advance our understanding of the effect of AMY1 copy number variation on metabolism, we compared the metabolomic signatures of high– and low–copy number carriers. We analyzed, using mass spectrometry and nuclear magnetic resonance (NMR), the sera of healthy normal-weight women carrying either low–AMY1 copies (LAs: four or fewer copies; n = 50) or high–AMY1 copies (HAs: eight or more copies; n = 50). Best-fitting multivariate models (empirical P < 1 × $10^{−3})$ of mass spectrometry and NMR data were concordant in showing differences in lipid metabolism between the two groups. In particular, LA carriers showed lower levels of long- and medium-chain fatty acids, and higher levels of dicarboxylic fatty acids and 2-hydrox...

  7. Genes adopt non-optimal codon usage to generate cell cycle-dependent oscillations in protein levels

    Frenkel-Morgenstern, Milana; Danon, Tamar; Christian, Thomas

    2012-01-01

    The cell cycle is a temporal program that regulates DNA synthesis and cell division. When we compared the codon usage of cell cycle-regulated genes with that of other genes, we discovered that there is a significant preference for non-optimal codons. Moreover, genes encoding proteins that cycle a...

  8. Identification of three novel OA1 gene mutations identified in three families misdiagnosed with congenital nystagmus and carrier status determination by real-time quantitative PCR assay

    Hamel Christian

    2003-01-01

    Full Text Available Abstract Background X-linked ocular albinism type 1 (OA1 is caused by mutations in OA1 gene, which encodes a membrane glycoprotein localised to melanosomes. OA1 mainly affects pigment production in the eye, resulting in optic changes associated with albinism including hypopigmentation of the retina, nystagmus, strabismus, foveal hypoplasia, abnormal crossing of the optic fibers and reduced visual acuity. Affected Caucasian males usually appear to have normal skin and hair pigment. Results We identified three previously undescribed mutations consisting of two intragenic deletions (one encompassing exon 6, the other encompassing exons 7–8, and a point mutation (310delG in exon 2. We report the development of a new method for diagnosis of heterozygous deletions in OA1 gene based on measurement of gene copy number using real-time quantitative PCR from genomic DNA. Conclusion The identification of OA1 mutations in families earlier reported as families with hereditary nystagmus indicate that ocular albinism type 1 is probably underdiagnosed. Our method of real-time quantitative PCR of OA1 exons with DMD exon as external standard performed on the LightCycler™ allows quick and accurate carrier-status assessment for at-risk females.

  9. Linkage disequilibria among (CA){sub n} polymorphisms in the human dystrophin gene and their implications in carrier detection and prenatal diagnosis in Duchenne and Becker musclar dystrophies

    Chakraborty, R.; Zhong, Y.; Andrade, M. de [Univ. of Texas Graduate School of Biomedical Sciences, Houston, TX (United States)] [and others

    1994-06-01

    Four short tandem repeat loci, characterized by length polymorphisms of (CA){sub n} repeats, have been detected within introns 44, 45, 49, and 50 of the human dystrophin gene. The predicted heterozygosites for these loci range from 72 to 93%, and observed allele numbers range from 6 to 19 in 57 normal chromosomes, revealing their high degree of polymorphism. Evidence for significant disequilibria between the loci within introns 49 and 50 is found. These data appear to be consistent with observations of recombination frequencies between these markers and the length of the intron 44 in relation to the entire region. In addition, these four loci are collectively found to be 100% informative in carrier detection/prenatal diagnosis of Becker and Duchenne muscular dystrophies (B/DMD), whereas scoring the (CA){sub n} markers within introns 45 and 49 alone gives a 99.6% success rate. 13 refs., 4 tabs.

  10. Functionalized silica nanoparticles as a carrier for Betamethasone Sodium Phosphate: Drug release study and statistical optimization of drug loading by response surface method.

    Ghasemnejad, M; Ahmadi, E; Mohamadnia, Z; Doustgani, A; Hashemikia, S

    2015-11-01

    Mesoporous silica nanoparticles with a hexagonal structure (SBA-15) were synthesized and modified with (3-aminopropyl) triethoxysilane (APTES), and their performance as a carrier for drug delivery system was studied. Chemical structure and morphology of the synthesized and modified SBA-15 were characterized by SEM, BET, TEM, FT-IR and CHN technique. Betamethasone Sodium Phosphate (BSP) as a water soluble drug was loaded on the mesoporous silica particle for the first time. The response surface method was employed to obtain the optimum conditions for the drug/silica nanoparticle preparation, by using Design-Expert software. The effect of time, pH of preparative media, and drug/silica ratio on the drug loading efficiency was investigated by the software. The maximum loading (33.69%) was achieved under optimized condition (pH: 1.8, time: 3.54 (h) and drug/silica ratio: 1.7). The in vitro release behavior of drug loaded particles under various pH values was evaluated. Finally, the release kinetic of the drug was investigated using the Higuchi and Korsmeyer-Peppas models. Cell culture and cytotoxicity assays revealed the synthesized product doesn't have any cytotoxicity against human bladder cell line 5637. Accordingly, the produced drug-loaded nanostructures can be applied via different routes, such as implantation and topical or oral administration. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. X-ray structural analysis of Plasmodium falciparum enoyl acyl carrier protein reductase as a pathway toward the optimization of triclosan antimalarial efficacy.

    Freundlich, Joel S; Wang, Feng; Tsai, Han-Chun; Kuo, Mack; Shieh, Hong-Ming; Anderson, John W; Nkrumah, Louis J; Valderramos, Juan-Carlos; Yu, Min; Kumar, T R Santha; Valderramos, Stephanie G; Jacobs, William R; Schiehser, Guy A; Jacobus, David P; Fidock, David A; Sacchettini, James C

    2007-08-31

    The x-ray crystal structures of five triclosan analogs, in addition to that of the isoniazid-NAD adduct, are described in relation to their integral role in the design of potent inhibitors of the malarial enzyme Plasmodium falciparum enoyl acyl carrier protein reductase (PfENR). Many of the novel 5-substituted analogs exhibit low micromolar potency against in vitro cultures of drug-resistant and drug-sensitive strains of the P. falciparum parasite and inhibit purified PfENR enzyme with IC50 values of <200 nM. This study has significantly expanded the knowledge base with regard to the structure-activity relationship of triclosan while affording gains against cultured parasites and purified PfENR enzyme. In contrast to a recent report in the literature, these results demonstrate the ability to improve the in vitro potency of triclosan significantly by replacing the suboptimal 5-chloro group with larger hydrophobic moieties. The biological and x-ray crystallographic data thus demonstrate the flexibility of the active site and point to future rounds of optimization to improve compound potency against purified enzyme and intracellular Plasmodium parasites.

  12. Radionuclide carrier

    Hartman, F.A.; Kretschmar, H.C.; Tofe, A.J.

    1978-01-01

    A physiologically acceptable particulate radionuclide carrier is described. It comprises a modified anionic starch derivative with 0.1% to 1.5% by weight of a reducing agent and 1 to 20% by weight of anionic substituents

  13. Carrier Screening

    ... How accurate is carrier screening? No test is perfect. In a small number of cases, test results ... in which an egg is removed from a woman’s ovary, fertilized in a laboratory with the man’s ...

  14. Optimization of reload of nuclear power plants using ACO together with the GENES reactor physics code

    Lima, Alan M.M. de; Freire, Fernando S.; Nicolau, Andressa S.; Schirru, Roberto, E-mail: alan@lmp.ufrj.br, E-mail: andressa@lmp.ufrj.br, E-mail: schirru@lmp.ufrj.br, E-mail: ffreire@eletronuclear.gov.br [Coordenacao de Pos-Graduacao e Pesquisa de Engenharia (PEN/COPPE/UFRJ), Rio de Janeiro, RJ (Brazil); Eletrobras Termonuclear S.A. (ELETRONUCLEAR), Rio de Janeiro, RJ (Brazil)

    2017-11-01

    The Nuclear reload of a Pressurized Water Reactor (PWR) occurs whenever the burning of the fuel elements can no longer maintain the criticality of the reactor, that is, it cannot maintain the Nuclear power plant operates within its nominal power. Nuclear reactor reload optimization problem consists of finding a loading pattern of fuel assemblies in the reactor core in order to minimize the cost/benefit ratio, trying to obtain maximum power generation with a minimum of cost, since in all reloads an average of one third of the new fuel elements are purchased. This loading pattern must also satisfy constraints of symmetry and security. In practice, it consists of the placing 121 fuel elements in 121 core positions, in the case of the Angra 1 Brazilian Nuclear Power Plant (NPP), making this new arrangement provide the best cost/benefit ratio. It is an extremely complex problem, since it has around 1% of great places. A core of 121 fuel elements has approximately 10{sup 13} combinations and 10{sup 11} great locations. With this number of possible combinations it is impossible to test all, in order to choose the best. In this work a system called ACO-GENES is proposed in order to optimization the Nuclear Reactor Reload Problem. ACO is successfully used in combination problems, and it is expected that ACO-GENES will show a robust optimization system, since in addition to optimizing ACO, it allows important prior knowledge such as K infinite, burn, etc. After optimization by ACO-GENES, the best results will be validated by a licensed reactor physics code and will be compared with the actual results of the cycle. (author)

  15. Optimization of reload of nuclear power plants using ACO together with the GENES reactor physics code

    Lima, Alan M.M. de; Freire, Fernando S.; Nicolau, Andressa S.; Schirru, Roberto

    2017-01-01

    The Nuclear reload of a Pressurized Water Reactor (PWR) occurs whenever the burning of the fuel elements can no longer maintain the criticality of the reactor, that is, it cannot maintain the Nuclear power plant operates within its nominal power. Nuclear reactor reload optimization problem consists of finding a loading pattern of fuel assemblies in the reactor core in order to minimize the cost/benefit ratio, trying to obtain maximum power generation with a minimum of cost, since in all reloads an average of one third of the new fuel elements are purchased. This loading pattern must also satisfy constraints of symmetry and security. In practice, it consists of the placing 121 fuel elements in 121 core positions, in the case of the Angra 1 Brazilian Nuclear Power Plant (NPP), making this new arrangement provide the best cost/benefit ratio. It is an extremely complex problem, since it has around 1% of great places. A core of 121 fuel elements has approximately 10"1"3 combinations and 10"1"1 great locations. With this number of possible combinations it is impossible to test all, in order to choose the best. In this work a system called ACO-GENES is proposed in order to optimization the Nuclear Reactor Reload Problem. ACO is successfully used in combination problems, and it is expected that ACO-GENES will show a robust optimization system, since in addition to optimizing ACO, it allows important prior knowledge such as K infinite, burn, etc. After optimization by ACO-GENES, the best results will be validated by a licensed reactor physics code and will be compared with the actual results of the cycle. (author)

  16. Non-Viral Transfection Methods Optimized for Gene Delivery to a Lung Cancer Cell Line

    Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

    2013-01-01

    Background Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. Methods In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize delivery of a plasmid construct that expressed Green Fluorescent Protein (GFP). Transgene expression was detected by fluorescent microscopy and flowcytometry. Toxicities of the methods were estimated by trypan blue staining. In order to evaluate the density of the transfected gene, we used a plasmid construct that expressed the Stromal cell-Derived Factor-1 (SDF-1) gene and measured its expression by real-time PCR. Results Mean levels of GFP-expressing cells 48 hr after transfection were 8.4% (CaP), 8.2% (DEAE-dextran), 4.9% (superfect), 34.1% (electroporation), and 40.1% (lipofection). Lipofection had the highest intense SDF-1 expression of the analyzed methods. Conclusion This study has shown that the lipofection and electroporation methods were more efficient at gene delivery to Mehr-80 cells. The quantity of DNA per transfection, reagent concentration, and incubation time were identified as essential factors for successful transfection in all of the studied methods. PMID:23799175

  17. Non-viral transfection methods optimized for gene delivery to a lung cancer cell line.

    Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

    2013-04-01

    Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize delivery of a plasmid construct that expressed Green Fluorescent Protein (GFP). Transgene expression was detected by fluorescent microscopy and flowcytometry. Toxicities of the methods were estimated by trypan blue staining. In order to evaluate the density of the transfected gene, we used a plasmid construct that expressed the Stromal cell-Derived Factor-1 (SDF-1) gene and measured its expression by real-time PCR. Mean levels of GFP-expressing cells 48 hr after transfection were 8.4% (CaP), 8.2% (DEAE-dextran), 4.9% (superfect), 34.1% (electroporation), and 40.1% (lipofection). Lipofection had the highest intense SDF-1 expression of the analyzed methods. This study has shown that the lipofection and electroporation methods were more efficient at gene delivery to Mehr-80 cells. The quantity of DNA per transfection, reagent concentration, and incubation time were identified as essential factors for successful transfection in all of the studied methods.

  18. Profile of Mutations in the Reverse Transcriptase and Overlapping Surface Genes of Hepatitis B Virus (HBV) in Treatment-Naïve Indonesian HBV Carriers.

    Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake

    2017-11-22

    Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.

  19. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  20. The Aspergillus nidulans acuL gene encodes a mitochondrial carrier required for the utilization of carbon sources that are metabolized via the TCA cycle.

    Flipphi, Michel; Oestreicher, Nathalie; Nicolas, Valérie; Guitton, Audrey; Vélot, Christian

    2014-07-01

    In Aspergillus nidulans, the utilization of acetate as sole carbon source requires several genes (acu). Most of them are also required for the utilization of fatty acids. This is the case for acuD and acuE, which encode the two glyoxylate cycle-specific enzymes, isocitrate lyase and malate synthase, respectively, but also for acuL that we have identified as AN7287, and characterized in this study. Deletion of acuL resulted in the same phenotype as the original acuL217 mutant. acuL encodes a 322-amino acid protein which displays all the structural features of a mitochondrial membrane carrier, and shares 60% identity with the Saccharomyces cerevisiae succinate/fumarate mitochondrial antiporter Sfc1p (also named Acr1p). Consistently, the AcuL protein was shown to localize in mitochondria, and partial cross-complementation was observed between the S. cerevisiae and A. nidulans homologues. Extensive phenotypic characterization suggested that the acuL gene is involved in the utilization of carbon sources that are catabolized via the TCA cycle, and therefore require gluconeogenesis. In addition, acuL proves to be co-regulated with acuD and acuE. Overall, our data suggest that AcuL could link the glyoxylate cycle to gluconeogenesis by exchanging cytoplasmic succinate for mitochondrial fumarate. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Variable expression of cerebral cavernous malformations in carriers of a premature termination codon in exon 17 of the Krit1 gene

    Gamero Miguel A

    2003-07-01

    Full Text Available Abstract Background Cerebral cavernous malformations (CCM present as either sporadic or autosomal dominant conditions with incomplete penetrance of symptoms. Differences in genetic and environmental factors might be minimized among first-degree relatives. We therefore studied clinical expression in a family with several affected members. Methods We studied a three-generation family with the onset of CCM as a cerebral haemorrhage in the younger (four-year-old sibling. Identification and enumeration of CCMs were performed in T2-weighted or gradient-echo MRIs of the whole brains. Genetic analysis comprised SCCP, sequencing and restriction polymorphism of the Krit1 gene in the proband and at risk relatives. Results The phenotypes of cerebral cavernous malformations (CCMs in carriers of Krit1 mutations were very variable. We identified a novel frameshift mutation caused by a 1902A insertion in exon 17 of the Krit1 gene, which leads to a premature TAA triplet and predicts the truncating phenotype Y634X. A very striking finding was the absence of both clinical symptoms and CCMs in the eldest sibling harbouring the 1902insA. Conclusions Patients in this family, harbouring the same mutation, illustrate the very variable clinical and radiological expression of a Krit1 mutation. The early and critical onset in the proband contrasts with minor clinical findings in affected relatives. This consideration is important in genetic counselling.

  2. Amphiphilic star block copolymers as gene carrier Part I: Synthesis via ATRP using calix[4]resorcinarene-based initiators and characterization

    Zheng, Anna; Xue, Yan; Wei, Dafu [Shanghai Key Laboratory of Advanced Polymeric Materials, Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China); Guan, Yong, E-mail: yguan@ecust.edu.cn [Shanghai Key Laboratory of Advanced Polymeric Materials, Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China); Xiao, Huining [Department of Chemical Engineering, University of New Brunswick, Fredericton, New Brunswick, Canada E3B 5A3 (Canada)

    2013-01-01

    In this work, a cationic star polymer [poly(2-dimethylamino)ethyl methacrylate (PDMAEMA)] was prepared via atom transfer radical polymerization (ATRP), using brominated calix[4]resorcinarene as an initiator. Hydrophobic moieties, methyl methacrylate (MMA) and butyl acrylate (BA), were further incorporated via 'one-pot' method. Well-defined eight-armed star block copolymers bearing hydrophilic blocks inside and hydrophobic blocks outside were synthesized. The molecular weight, particle size, electrophoretic mobility and apparent charge density were determined by gel permeation chromatography (GPC), dynamic light scattering (DLS), phase analysis light scattering (PALS) and colloidal titration, respectively. The zeta potentials and apparent charge densities of the products exhibited the characteristics of polyelectrolyte. The incorporation of hydrophobic moieties generated electrostatic screening effect. The as-synthesized amphiphilic star copolymer is promising as a thermo-sensitive gene carrier for gene therapy. Highlights: Black-Right-Pointing-Pointer Amphiphilic cationic star block copolymers with well-controlled structures were prepared via ATRP. Black-Right-Pointing-Pointer The molecular structures and properties of the initiator and copolymers were systematically characterized. Black-Right-Pointing-Pointer The products exhibited the positive charged character, and hydrophobic moieties generated electrostatic screening effect.

  3. Estimated carrier frequency of creatine transporter deficiency in females in the general population using functional characterization of novel missense variants in the SLC6A8 gene.

    DesRoches, Caro-Lyne; Patel, Jaina; Wang, Peixiang; Minassian, Berge; Salomons, Gajja S; Marshall, Christian R; Mercimek-Mahmutoglu, Saadet

    2015-07-10

    Creatine transporter deficiency (CRTR-D) is an X-linked inherited disorder of creatine transport. All males and about 50% of females have intellectual disability or cognitive dysfunction. Creatine deficiency on brain proton magnetic resonance spectroscopy and elevated urinary creatine to creatinine ratio are important biomarkers. Mutations in the SLC6A8 gene occur de novo in 30% of males. Despite reports of high prevalence of CRTR-D in males with intellectual disability, there are no true prevalence studies in the general population. To determine carrier frequency of CRTR-D in the general population we studied the variants in the SLC6A8 gene reported in the Exome Variant Server database and performed functional characterization of missense variants. We also analyzed synonymous and intronic variants for their predicted pathogenicity using in silico analysis tools. Nine missense variants were functionally analyzed using transient transfection by site-directed mutagenesis with In-Fusion HD Cloning in HeLa cells. Creatine uptake was measured by liquid chromatography tandem mass spectrometry for creatine measurement. The c.1654G>T (p.Val552Leu) variant showed low residual creatine uptake activity of 35% of wild type transfected HeLa cells and was classified as pathogenic. Three variants (c.808G>A; p.Val270Met, c.942C>G; p.Phe314Leu and c.952G>A; p.Ala318Thr) were predicted to be pathogenic based on in silico analysis, but proved to be non-pathogenic by our functional analysis. The estimated carrier frequency of CRTR-D was 0.024% in females in the general population. We recommend functional studies for all novel missense variants by transient transfection followed by creatine uptake measurement by liquid chromatography tandem mass spectrometry as fast and cost effective method for the functional analysis of missense variants in the SLC6A8 gene. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

  4. Toward a suitable structural analysis of gene delivery carrier based on polycationic carbohydrates by electron transfer dissociation tandem mass spectrometry

    Przybylski, Cédric; Benito, Juan M.; Bonnet, Véronique; Mellet, Carmen Ortiz; García Fernández, José M.

    2016-01-01

    Polycationic carbohydrates represent an attractive class of biomolecules for several applications and particularly as non viral gene delivery vectors. In this case, the establishment of structure-biological activity relationship requires sensitive and accurate characterization tools to both control and achieve fine structural deciphering. Electrospray-tandem mass spectrometry (ESI-MS/MS) appears as a suitable approach to address these questions. In the study herein, we have investigated the usefulness of electron transfer dissociation (ETD) to get structural data about five polycationic carbohydrates demonstrated as promising gene delivery agents. A particular attention was paid to determine the influence of charge states as well as both fluoranthene reaction time and supplementary activation (SA) on production of charge reduced species, fragmentation yield, varying from 2 to 62%, as well as to obtain the most higher both diversity and intensity of fragments, according to charge states and targeted compounds. ETD fragmentation appeared to be mainly directed toward pending group rather than carbohydrate cyclic scaffold leading to a partial sequencing for building blocks when amino groups are close to carbohydrate core, but allowing to complete structural deciphering of some of them, such as those including dithioureidocysteaminyl group which was not possible with CID only. Such findings clearly highlight the potential to help the rational choice of the suitable analytical conditions, according to the nature of the gene delivery molecules exhibiting polycationic features. Moreover, our ETD-MS/MS approach open the way to a fine sequencing/identification of grafted groups carried on various sets of oligo-/polysaccharides in various fields such as glycobiology or nanomaterials, even with unknown or questionable extraction, synthesis or modification steps. - Highlights: • The first ETD-MS/MS characterization of polycationic carbohydrate based non-viral gene delivery

  5. Toward a suitable structural analysis of gene delivery carrier based on polycationic carbohydrates by electron transfer dissociation tandem mass spectrometry

    Przybylski, Cédric, E-mail: cedric.przybylski@upmc.fr [Université d’Evry-Val-d’Essonne, Laboratoire Analyse et Modélisation pour la Biologie et l’Environnement, CNRS UMR 8587, Bâtiment Maupertuis, Bld F. Mitterrand, F-91025 Evry (France); Benito, Juan M. [Instituto de Investigaciones Químicas (IIQ), CSIC−Universidad de Sevilla, Américo Vespucio 49, Isla de la Cartuja, E-41092 Sevilla (Spain); Bonnet, Véronique [Université de Picardie Jules Verne, Laboratoire de Glycochimie, des Antimicrobiens et des Agroressources, CNRS UMR 7378, 80039 Amiens (France); Mellet, Carmen Ortiz [Departamento de Química Orgánica, Facultad de Química, Universidad de Sevilla, E-41012 Sevilla (Spain); García Fernández, José M. [Instituto de Investigaciones Químicas (IIQ), CSIC−Universidad de Sevilla, Américo Vespucio 49, Isla de la Cartuja, E-41092 Sevilla (Spain)

    2016-12-15

    Polycationic carbohydrates represent an attractive class of biomolecules for several applications and particularly as non viral gene delivery vectors. In this case, the establishment of structure-biological activity relationship requires sensitive and accurate characterization tools to both control and achieve fine structural deciphering. Electrospray-tandem mass spectrometry (ESI-MS/MS) appears as a suitable approach to address these questions. In the study herein, we have investigated the usefulness of electron transfer dissociation (ETD) to get structural data about five polycationic carbohydrates demonstrated as promising gene delivery agents. A particular attention was paid to determine the influence of charge states as well as both fluoranthene reaction time and supplementary activation (SA) on production of charge reduced species, fragmentation yield, varying from 2 to 62%, as well as to obtain the most higher both diversity and intensity of fragments, according to charge states and targeted compounds. ETD fragmentation appeared to be mainly directed toward pending group rather than carbohydrate cyclic scaffold leading to a partial sequencing for building blocks when amino groups are close to carbohydrate core, but allowing to complete structural deciphering of some of them, such as those including dithioureidocysteaminyl group which was not possible with CID only. Such findings clearly highlight the potential to help the rational choice of the suitable analytical conditions, according to the nature of the gene delivery molecules exhibiting polycationic features. Moreover, our ETD-MS/MS approach open the way to a fine sequencing/identification of grafted groups carried on various sets of oligo-/polysaccharides in various fields such as glycobiology or nanomaterials, even with unknown or questionable extraction, synthesis or modification steps. - Highlights: • The first ETD-MS/MS characterization of polycationic carbohydrate based non-viral gene delivery

  6. Optimization of Saanen sperm genes amplification: evaluation of standardized protocols in genetically uncharacterized rural goats reared under a subtropical environment.

    Barbour, Elie K; Saade, Maya F; Sleiman, Fawwak T; Hamadeh, Shady K; Mouneimne, Youssef; Kassaifi, Zeina; Kayali, Ghazi; Harakeh, Steve; Jaber, Lina S; Shaib, Houssam A

    2012-10-01

    The purpose of this research is to optimize quantitatively the amplification of specific sperm genes in reference genomically characterized Saanen goat and to evaluate the standardized protocols applicability on sperms of uncharacterized genome of rural goats reared under subtropical environment for inclusion in future selection programs. The optimization of the protocols in Saanen sperms included three production genes (growth hormone (GH) exons 2, 3, and 4, αS1-casein (CSN1S1), and α-lactalbumin) and two health genes (MHC class II DRB and prion (PrP)). The optimization was based on varying the primers concentrations and the inclusion of a PCR cosolvent (Triton X). The impact of the studied variables on statistically significant increase in the yield of amplicons was noticed in four out of five (80%) optimized protocols, namely in those related to GH, CSN1S1, α-lactalbumin, and PrP genes (P 0.05). The applicability of the optimized protocols of Saanen sperm genes on amplification of uncharacterized rural goat sperms revealed a 100% success in tested individuals for amplification of GH, CSN1S1, α-lactalbumin, and MHC class II DRB genes and a 75% success for the PrP gene. The significant success in applicability of the Saanen quantitatively optimized protocols to other uncharacterized genome of rural goats allows for their inclusion in future selection, targeting the sustainability of this farming system in a subtropical environment and the improvement of the farmers livelihood.

  7. Partial rescue of in vivo insulin signalling in skeletal muscle by impaired insulin clearance in heterozygous carriers of a mutation in the insulin receptor gene

    Højlund, K.; Wojtaszewski, Jørgen; Birk, Jesper Bratz

    2006-01-01

    AIMS/HYPOTHESIS: Recently we reported the coexistence of postprandial hypoglycaemia and moderate insulin resistance in heterozygous carriers of the Arg1174Gln mutation in the insulin receptor gene (INSR). Controlled studies of in vivo insulin signalling in humans with mutant INSR are unavailable,...

  8. TIMP-2 gene transfer by positively charged PEG-lated monosized polycationic carrier to smooth muscle cells

    Lacin, Nelisa, E-mail: melisalacin@yahoo.com [Mersin University, Advanced Technology Education, Research and Application Center (Turkey); Utkan, Gueldem [TUBITAK MAM, Enzyme and Fermentation Technology Laboratory, Genetic Engineering and Biotechnology Institute (Turkey); Kutsal, Tuelin [Hacettepe University, Chemical Engineering Department and Bioengineering Division (Turkey); Dedeoglu, Bala Guer; Yulug, Is Latin-Small-Letter-Dotless-I k G. [Bilkent University, Department of Molecular Biology and Genetics, Faculty of Science (Turkey); Piskin, Erhan [Hacettepe University, Chemical Engineering Department and Bioengineering Division and Center for Bioengineering-Biyomedtek (Turkey)

    2012-02-15

    Remodeling of the extracellular matrix resulting from increased secretion of metalloproteinase enzymes is implicated in restenosis following balloon angioplasty. Matrix metalloproteinases (MMPs) and the tissue inhibitors of metalloproteinases play an essential role in both normal and pathological extracellular matrix degradation. Tissue inhibitor of matrix metalloproteinase-2 is the most extensively studied tissue inhibitor of metalloproteinases in myocardial tissue in animal models and clinical examples of cardiac disease; therefore it is selected for this study. Gene transfer of tissue inhibitor of matrix metalloproteinase-2 may have a therapeutic potential by inhibition of matrix metalloproteinase activity. We have used PEG-lated nanoparticles poly(St/PEG-EEM/DMAPM) which were synthesized previously in our laboratory. The nanoparticles, with an average size of 77.6 {+-} 2.05 nm with a zeta potential of +64. 4 {+-} 1.14 mV and 201.9 {+-} 1.83 nm with +54.2 {+-} 0.77 mV were used in the transfection studies. Zeta Potential values and size of polyplex were appropriate for an effective transfection. TIMP-2 expression was detected by western blotting. Increased protein level in smooth muscle cells according to non-transfected smooth muscle cells confirms the successful delivery and expression of the tissue inhibitor of matrix metalloproteinase-2 gene with the non-viral vector transfection approach.

  9. Transcription regulation of AAC3 gene encoding hypoxic isoform of ADP/ATP carrier in Saccharomyces cerevisiae

    Sokolikova, B.

    2001-01-01

    Two repressoric regions are present in the AAC3 promoter, termed URS1 and URS2. URS1 region is responsible for a carbon source-dependent regulation and plays a role under both, aerobic and anaerobic conditions. By deletion analysis URS1 was localized into the -322/-244 region and was found that the regulation is likely exerted by the repression by non-fermentable or non-repressing fermentable carbon sources than by the activation by repressing carbon source. By computer analysis cis sequences for two potential transcription factors, Rap1 and ERA, were identified within URS1. Rap1 binding into its consensus sequence was proved, effort to find the protein binding to the ERA cis regulatory sequences has failed. By the means of mutational analysis we revealed that the regulation pathway mediating the carbon source-dependent regulation via URS1 differs according to the presence or absence of oxygen in the growth medium. Under aerobic conditions the carbon source-dependent repression is mediated by the ERA factor and the role of Rap1 is only marginal. On the contrary, under anaerobic conditions, the repression is mediated solely by Rap1. AAC1 gene product might be involved in the regulation of the AAC3 gene, the regulation pathway has not been characterized yet. (author)

  10. Beginning to understand the role of sugar carriers in Colletotrichum lindemuthianum: the function of the gene mfs1.

    Pereira, Monalessa Fábia; de Araújo Dos Santos, Carolina Maria; de Araújo, Elza Fernandes; de Queiroz, Marisa Vieira; Bazzolli, Denise Mara Soares

    2013-02-01

    Fungi of the Colletotrichum genus are among the most prominent phytopathogens that cause diseases with a considerable economic impact, such as anthracnose. The hemibiotrophic fungus Colletotrichum lindemuthianum (teleomorph Glomerella cingulata f. sp. phaseoli) is the causal agent of the anthracnose of the common bean; and similarly to other phytopathogens, it uses multiple strategies to gain access to different carbon sources from its host. In this study, we examine mfs1, a newly identified C. lindemuthianum hexose transporter. The mfs1 gene is expressed only during the necrotrophic phase of the fungus' interaction within the plant and allows it to utilize the available sugars during this phase. The deletion of mfs1 gene resulted in differential growth of the fungus in a medium that contained glucose, mannose or fructose as the only carbon source. This study is the first to describe a hexose transporter in the hemibiotrophic pathogen C. lindemuthianum and to demonstrate the central role of this protein in capturing carbon sources during the necrotrophic development of the plant/pathogen interaction.

  11. TIMP-2 gene transfer by positively charged PEG-lated monosized polycationic carrier to smooth muscle cells

    Laçin, Nelisa; Utkan, Güldem; Kutsal, Tülin; Dedeoğlu, Bala Gür; Yuluğ, Işık G.; Pişkin, Erhan

    2012-02-01

    Remodeling of the extracellular matrix resulting from increased secretion of metalloproteinase enzymes is implicated in restenosis following balloon angioplasty. Matrix metalloproteinases (MMPs) and the tissue inhibitors of metalloproteinases play an essential role in both normal and pathological extracellular matrix degradation. Tissue inhibitor of matrix metalloproteinase-2 is the most extensively studied tissue inhibitor of metalloproteinases in myocardial tissue in animal models and clinical examples of cardiac disease; therefore it is selected for this study. Gene transfer of tissue inhibitor of matrix metalloproteinase-2 may have a therapeutic potential by inhibition of matrix metalloproteinase activity. We have used PEG-lated nanoparticles poly(St/PEG-EEM/DMAPM) which were synthesized previously in our laboratory. The nanoparticles, with an average size of 77.6 ± 2.05 nm with a zeta potential of +64. 4 ± 1.14 mV and 201.9 ± 1.83 nm with +54.2 ± 0.77 mV were used in the transfection studies. Zeta Potential values and size of polyplex were appropriate for an effective transfection. TIMP-2 expression was detected by western blotting. Increased protein level in smooth muscle cells according to non-transfected smooth muscle cells confirms the successful delivery and expression of the tissue inhibitor of matrix metalloproteinase-2 gene with the non-viral vector transfection approach.

  12. Model checking optimal finite-horizon control for probabilistic gene regulatory networks.

    Wei, Ou; Guo, Zonghao; Niu, Yun; Liao, Wenyuan

    2017-12-14

    Probabilistic Boolean networks (PBNs) have been proposed for analyzing external control in gene regulatory networks with incorporation of uncertainty. A context-sensitive PBN with perturbation (CS-PBNp), extending a PBN with context-sensitivity to reflect the inherent biological stability and random perturbations to express the impact of external stimuli, is considered to be more suitable for modeling small biological systems intervened by conditions from the outside. In this paper, we apply probabilistic model checking, a formal verification technique, to optimal control for a CS-PBNp that minimizes the expected cost over a finite control horizon. We first describe a procedure of modeling a CS-PBNp using the language provided by a widely used probabilistic model checker PRISM. We then analyze the reward-based temporal properties and the computation in probabilistic model checking; based on the analysis, we provide a method to formulate the optimal control problem as minimum reachability reward properties. Furthermore, we incorporate control and state cost information into the PRISM code of a CS-PBNp such that automated model checking a minimum reachability reward property on the code gives the solution to the optimal control problem. We conduct experiments on two examples, an apoptosis network and a WNT5A network. Preliminary experiment results show the feasibility and effectiveness of our approach. The approach based on probabilistic model checking for optimal control avoids explicit computation of large-size state transition relations associated with PBNs. It enables a natural depiction of the dynamics of gene regulatory networks, and provides a canonical form to formulate optimal control problems using temporal properties that can be automated solved by leveraging the analysis power of underlying model checking engines. This work will be helpful for further utilization of the advances in formal verification techniques in system biology.

  13. Identification and optimization of classifier genes from multi-class earthworm microarray dataset.

    Ying Li

    Full Text Available Monitoring, assessment and prediction of environmental risks that chemicals pose demand rapid and accurate diagnostic assays. A variety of toxicological effects have been associated with explosive compounds TNT and RDX. One important goal of microarray experiments is to discover novel biomarkers for toxicity evaluation. We have developed an earthworm microarray containing 15,208 unique oligo probes and have used it to profile gene expression in 248 earthworms exposed to TNT, RDX or neither. We assembled a new machine learning pipeline consisting of several well-established feature filtering/selection and classification techniques to analyze the 248-array dataset in order to construct classifier models that can separate earthworm samples into three groups: control, TNT-treated, and RDX-treated. First, a total of 869 genes differentially expressed in response to TNT or RDX exposure were identified using a univariate statistical algorithm of class comparison. Then, decision tree-based algorithms were applied to select a subset of 354 classifier genes, which were ranked by their overall weight of significance. A multiclass support vector machine (MC-SVM method and an unsupervised K-mean clustering method were applied to independently refine the classifier, producing a smaller subset of 39 and 30 classifier genes, separately, with 11 common genes being potential biomarkers. The combined 58 genes were considered the refined subset and used to build MC-SVM and clustering models with classification accuracy of 83.5% and 56.9%, respectively. This study demonstrates that the machine learning approach can be used to identify and optimize a small subset of classifier/biomarker genes from high dimensional datasets and generate classification models of acceptable precision for multiple classes.

  14. Optimal structural inference of signaling pathways from unordered and overlapping gene sets.

    Acharya, Lipi R; Judeh, Thair; Wang, Guangdi; Zhu, Dongxiao

    2012-02-15

    A plethora of bioinformatics analysis has led to the discovery of numerous gene sets, which can be interpreted as discrete measurements emitted from latent signaling pathways. Their potential to infer signaling pathway structures, however, has not been sufficiently exploited. Existing methods accommodating discrete data do not explicitly consider signal cascading mechanisms that characterize a signaling pathway. Novel computational methods are thus needed to fully utilize gene sets and broaden the scope from focusing only on pairwise interactions to the more general cascading events in the inference of signaling pathway structures. We propose a gene set based simulated annealing (SA) algorithm for the reconstruction of signaling pathway structures. A signaling pathway structure is a directed graph containing up to a few hundred nodes and many overlapping signal cascades, where each cascade represents a chain of molecular interactions from the cell surface to the nucleus. Gene sets in our context refer to discrete sets of genes participating in signal cascades, the basic building blocks of a signaling pathway, with no prior information about gene orderings in the cascades. From a compendium of gene sets related to a pathway, SA aims to search for signal cascades that characterize the optimal signaling pathway structure. In the search process, the extent of overlap among signal cascades is used to measure the optimality of a structure. Throughout, we treat gene sets as random samples from a first-order Markov chain model. We evaluated the performance of SA in three case studies. In the first study conducted on 83 KEGG pathways, SA demonstrated a significantly better performance than Bayesian network methods. Since both SA and Bayesian network methods accommodate discrete data, use a 'search and score' network learning strategy and output a directed network, they can be compared in terms of performance and computational time. In the second study, we compared SA and

  15. A prospective investigation of predictive and modifiable risk factors for breast cancer in unaffected BRCA1 and BRCA2 gene carriers

    Guinan, Emer M; Hussey, Juliette; McGarrigle, Sarah A; Healy, Laura A; O’Sullivan, Jacintha N; Bennett, Kathleen; Connolly, Elizabeth M

    2013-01-01

    Breast cancer is the most common female cancer worldwide. The lifetime risk of a woman being diagnosed with breast cancer is approximately 12.5%. For women who carry the deleterious mutation in either of the BRCA genes, BRCA1 or BRCA2, the risk of developing breast or ovarian cancer is significantly increased. In recent years there has been increased penetrance of BRCA1 and BRCA2 associated breast cancer, prompting investigation into the role of modifiable risk factors in this group. Previous investigations into this topic have relied on participants recalling lifetime weight changes and subjective methods of recording physical activity. The influence of obesity-related biomarkers, which may explain the link between obesity, physical activity and breast cancer risk, has not been investigated prospectively in this group. This paper describes the design of a prospective cohort study investigating the role of predictive and modifiable risk factors for breast cancer in unaffected BRCA1 and BRCA2 gene mutation carriers. Participants will be recruited from breast cancer family risk clinics and genetics clinics. Lifestyle risk factors that will be investigated will include body composition, metabolic syndrome and its components, physical activity and dietary intake. PBMC telomere length will be measured as a potential predictor of breast cancer occurrence. Measurements will be completed on entry to the study and repeated at two years and five years. Participants will also be followed annually by questionnaire to track changes in risk factor status and to record cancer occurrence. Data will be analysed using multiple regression models. The study has an accrual target of 352 participants. The results from this study will provide valuable information regarding the role of modifiable lifestyle risk factors for breast cancer in women with a deleterious mutation in the BRCA gene. Additionally, the study will attempt to identify potential blood biomarkers which may be predictive

  16. Optimization of laser capture microdissection and RNA amplification for gene expression profiling of prostate cancer

    Vasmatzis George

    2007-03-01

    Full Text Available Abstract Background To discover prostate cancer biomarkers, we profiled gene expression in benign and malignant cells laser capture microdissected (LCM from prostate tissues and metastatic prostatic adenocarcinomas. Here we present methods developed, optimized, and validated to obtain high quality gene expression data. Results RNase inhibitor was included in solutions used to stain frozen tissue sections for LCM, which improved RNA quality significantly. Quantitative PCR assays, requiring minimal amounts of LCM RNA, were developed to determine RNA quality and concentration. SuperScript II™ reverse transcriptase was replaced with SuperScript III™, and SpeedVac concentration was eliminated to optimize linear amplification. The GeneChip® IVT labeling kit was used rather than the Enzo BioArray™ HighYield™ RNA transcript labeling kit since side-by-side comparisons indicated high-end signal saturation with the latter. We obtained 72 μg of labeled complementary RNA on average after linear amplification of about 2 ng of total RNA. Conclusion Unsupervised clustering placed 5/5 normal and 2/2 benign prostatic hyperplasia cases in one group, 5/7 Gleason pattern 3 cases in another group, and the remaining 2/7 pattern 3 cases in a third group with 8/8 Gleason pattern 5 cases and 3/3 metastatic prostatic adenocarcinomas. Differential expression of alpha-methylacyl coenzyme A racemase (AMACR and hepsin was confirmed using quantitative PCR.

  17. Gene selection using hybrid binary black hole algorithm and modified binary particle swarm optimization.

    Pashaei, Elnaz; Pashaei, Elham; Aydin, Nizamettin

    2018-04-14

    In cancer classification, gene selection is an important data preprocessing technique, but it is a difficult task due to the large search space. Accordingly, the objective of this study is to develop a hybrid meta-heuristic Binary Black Hole Algorithm (BBHA) and Binary Particle Swarm Optimization (BPSO) (4-2) model that emphasizes gene selection. In this model, the BBHA is embedded in the BPSO (4-2) algorithm to make the BPSO (4-2) more effective and to facilitate the exploration and exploitation of the BPSO (4-2) algorithm to further improve the performance. This model has been associated with Random Forest Recursive Feature Elimination (RF-RFE) pre-filtering technique. The classifiers which are evaluated in the proposed framework are Sparse Partial Least Squares Discriminant Analysis (SPLSDA); k-nearest neighbor and Naive Bayes. The performance of the proposed method was evaluated on two benchmark and three clinical microarrays. The experimental results and statistical analysis confirm the better performance of the BPSO (4-2)-BBHA compared with the BBHA, the BPSO (4-2) and several state-of-the-art methods in terms of avoiding local minima, convergence rate, accuracy and number of selected genes. The results also show that the BPSO (4-2)-BBHA model can successfully identify known biologically and statistically significant genes from the clinical datasets. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Identification of Optimal Reference Genes for Normalization of qPCR Analysis during Pepper Fruit Development

    Yuan Cheng

    2017-06-01

    Full Text Available Due to its high sensitivity and reproducibility, quantitative real-time PCR (qPCR is practiced as a useful research tool for targeted gene expression analysis. For qPCR operations, the normalization with suitable reference genes (RGs is a crucial step that eventually determines the reliability of the obtained results. Although pepper is considered an ideal model plant for the study of non-climacteric fruit development, at present no specific RG have been developed or validated for the qPCR analyses of pepper fruit. Therefore, this study aimed to identify stably expressed genes for their potential use as RGs in pepper fruit studies. Initially, a total of 35 putative RGs were selected by mining the pepper transcriptome data sets derived from the PGP (Pepper Genome Platform and PGD (Pepper Genome Database. Their expression stabilities were further measured in a set of pepper (Capsicum annuum L. var. 007e fruit samples, which represented four different fruit developmental stages (IM: Immature; MG: Mature green; B: Break; MR: Mature red using the qPCR analysis. Then, based on the qPCR results, three different statistical algorithms, namely geNorm, Normfinder, and boxplot, were chosen to evaluate the expression stabilities of these putative RGs. It should be noted that nine genes were proven to be qualified as RGs during pepper fruit development, namely CaREV05 (CA00g79660; CaREV08 (CA06g02180; CaREV09 (CA06g05650; CaREV16 (Capana12g002666; CaREV21 (Capana10g001439; CaREV23 (Capana05g000680; CaREV26 (Capana01g002973; CaREV27 (Capana11g000123; CaREV31 (Capana04g002411; and CaREV33 (Capana08g001826. Further analysis based on geNorm suggested that the application of the two most stably expressed genes (CaREV05 and CaREV08 would provide optimal transcript normalization in the qPCR experiments. Therefore, a new and comprehensive strategy for the identification of optimal RGs was developed. This strategy allowed for the effective normalization of the q

  19. Single-gene testing combined with single nucleotide polymorphism microarray preimplantation genetic diagnosis for aneuploidy: a novel approach in optimizing pregnancy outcome.

    Brezina, Paul R; Benner, Andrew; Rechitsky, Svetlana; Kuliev, Anver; Pomerantseva, Ekaterina; Pauling, Dana; Kearns, William G

    2011-04-01

    To describe a method of amplifying DNA from blastocyst trophectoderm cells (two or three cells) and simultaneously performing 23-chromosome single nucleotide polymorphism microarrays and single-gene preimplantation genetic diagnosis. Case report. IVF clinic and preimplantation genetic diagnostic centers. A 36-year-old woman, gravida 2, para 1011, and her husband who both were carriers of GM(1) gangliosidosis. The couple wished to proceed with microarray analysis for aneuploidy detection coupled with DNA sequencing for GM(1) gangliosidosis. An IVF cycle was performed. Ten blastocyst-stage embryos underwent trophectoderm biopsy. Twenty-three-chromosome microarray analysis for aneuploidy and specific DNA sequencing for GM(1) gangliosidosis mutations were performed. Viable pregnancy. After testing, elective single embryo transfer was performed followed by an intrauterine pregnancy with documented fetal cardiac activity by ultrasound. Twenty-three-chromosome microarray analysis for aneuploidy detection and single-gene evaluation via specific DNA sequencing and linkage analysis are used for preimplantation diagnosis for single-gene disorders and aneuploidy. Because of the minimal amount of genetic material obtained from the day 3 to 5 embryos (up to 6 pg), these modalities have been used in isolation of each other. The use of preimplantation genetic diagnosis for aneuploidy coupled with testing for single-gene disorders via trophectoderm biopsy is a novel approach to maximize pregnancy outcomes. Although further investigation is warranted, preimplantation genetic diagnosis for aneuploidy and single-gene testing seem destined to be used increasingly to optimize ultimate pregnancy success. Copyright © 2011 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  20. An Optimized Protocol to Increase Virus-Induced Gene Silencing Efficiency and Minimize Viral Symptoms in Petunia

    Broderick, Shaun R.; Jones, Michelle L.

    2013-01-01

    Virus-induced gene silencing (VIGS) is used to down-regulate endogenous plant genes. VIGS efficiency depends on viral proliferation and systemic movement throughout the plant. Although tobacco rattle virus (TRV)-based VIGS has been successfully used in petunia (Petunia × hybrida), the protocol has not been thoroughly optimized for efficient and uniform gene down-regulation in this species. Therefore, we evaluated six parameters that improved VIGS in petunia. Inoculation of mechanically wounde...

  1. Low-weight polyethylenimine cross-linked 2-hydroxypopyl-ß-cyclodextrin and folic acid as an efficient and nontoxic siRNA carrier for gene silencing and tumor inhibition by VEGF siRNA

    Li JM

    2013-06-01

    Full Text Available Jin-Ming Li, Yuan-Yuan Wang, Wei Zhang, Hua Su, Liang-Nian Ji, Zong-Wan Mao MOE Key Laboratory of Bioinorganic and Synthetic Chemistry, School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou, People's Republic of China Background: Targeted delivery of small interfering RNA (siRNA has been regarded as one of the most important technologies for the development of siRNA therapeutics. However, the need for safe and efficient delivery systems is a barrier to further development of RNA interference therapeutics. In this work, a nontoxic and efficient siRNA carrier delivery system of low molecular weight polyethyleneimine (PEI-600 Da cross-linked with 2-hydroxypopyl-β-cyclodextrin (HP-β-CD and folic acid (FA was synthesized for biomedical application. Methods: The siRNA carrier was prepared using a simple method and characterized by nuclear magnetic resonance and Fourier transform infrared spectroscopy. The siRNA carrier nanoparticles were characterized in terms of morphology, size and zeta potential, stability, efficiency of delivery, and gene silencing efficiency in vitro and in vivo. Results: The siRNA carrier was synthesized successfully. It showed good siRNA binding capacity and ability to protect siRNA. Further, the toxicity of the carrier measured in vitro and in vivo appeared to be negligible, probably because of degradation of the low molecular weight PEI and HP-β-CD in the cytosol. Flow cytometry and confocal microscopy confirmed that the FA receptor-mediated endocytosis of the FA-HP-β-CD-PEI/siRNA complexes was greater than that of the HP-β-CD-PEI/siRNA complexes in FA receptor-enriched HeLa cells. The FA-HP-β-CD-PEI/siRNA complexes also demonstrated excellent gene silencing efficiency in vitro (in the range of 90%, and reduced vascular endothelial growth factor (VEGF protein expression in the presence of 20% serum. FA-HP-β-CD-PEI/siRNA complexes administered via tail vein injection resulted in marked

  2. Construction and characterization of Gal-chitosan graft methoxy poly (ethylene glycol) (Gal-CS-mPEG) nanoparticles as efficient gene carrier

    Jin, Jiting; Fu, Wandong; Liao, Miaofei; Han, Baoqin; Chang, Jing; Yang, Yan

    2017-10-01

    In the present study, galactosylated chitosan (Gal-CS) was conjugated with methoxy poly(ethylene glycol) (mPEG) as a hydrophilic group. The structure of Gal-CS-mPEG polymer was characterized and the nanoparticles (NPs) were prepared using ironic gelation method. The study was designed to investigate the characteristics and functions of Gal-CS-mPEG NPs. The morphology of Gal-CS-mPEG NPs was observed by SEM and it was a compact and spherical shape. The size of the NPs was approximately 200 nm in diameter under the ideal process parameters. The interaction between Gal-CS-mPEG NPs and pDNA, and the protection of pDNA against DNase I and serum degradation by Gal-CS-mPEG NPs were evaluated. Agarose gel electrophoresis results showed that Gal-CS-mPEG NPs had strong interaction with pDNA at the weight ratio of 12:1, 4:1 and 2:1 and could protect pDNA from DNase I and serum degradation. Gal-CS-mPEG NPs exhibited high loading efficiency and sustainable in vitro release. The blood compatibility studies demonstrated that Gal-CS-mPEG NPs had superior compatibility with erythrocytes in terms of aggregation degree and hemolysis level. Gal-CS-mPEG NPs showed no cytotoxicity on L929 cells, which is a normal mouse connective tissue fibroblast, but showed inhibitory effects on the proliferation of Bel-7402 cells, which is a liver cancer cell line. In conclusion, Gal-CS-mPEG NP is a bio-safe and efficient gene carrier with potential application in gene delivery.

  3. Cholesterol-Containing Nuclease-Resistant siRNA Accumulates in Tumors in a Carrier-free Mode and Silences MDR1 Gene

    Ivan V. Chernikov

    2017-03-01

    Full Text Available Chemical modifications are an effective way to improve the therapeutic properties of small interfering RNAs (siRNAs, making them more resistant to degradation in serum and ensuring their delivery to target cells and tissues. Here, we studied the carrier-free biodistribution and biological activity of a nuclease-resistant anti-MDR1 cholesterol-siRNA conjugate in healthy and tumor-bearing severe combined immune deficiency (SCID mice. The attachment of cholesterol to siRNA provided its efficient accumulation in the liver and in tumors, and reduced its retention in the kidneys after intravenous and intraperitoneal injection. The major part of cholesterol-siRNA after intramuscular and subcutaneous injections remained in the injection place. Confocal microscopy data demonstrated that cholesterol-siRNA spread deep in the tissue and was present in the cytoplasm of almost all the liver and tumor cells. The reduction of P-glycoprotein level in human KB-8-5 xenograft overexpressing the MDR1 gene by 60% was observed at days 5–6 after injection. Then, its initial level recovered by the eighth day. The data showed that, regardless of the mode of administration (intravenous, intraperitoneal, or peritumoral, cholesterol-siMDR efficiently reduced the P-glycoprotein level in tumors. The designed anti-MDR1 conjugate has potential as an adjuvant therapeutic for the reversal of multiple drug resistance of cancer cells.

  4. Carrier frequency of GJB2 gene mutations c.35delG, c.235delC and c.167delT among the populations of Eurasia.

    Dzhemileva, Lilya U; Barashkov, Nikolay A; Posukh, Olga L; Khusainova, Rita I; Akhmetova, Vita L; Kutuev, Ildus A; Gilyazova, Irina R; Tadinova, Vera N; Fedorova, Sardana A; Khidiyatova, Irina M; Lobov, Simeon L; Khusnutdinova, Elza K

    2010-11-01

    Hearing impairment is one of the most common disorders of sensorineural function and the incidence of profound prelingual deafness is about 1 per 1000 at birth. GJB2 gene mutations make the largest contribution to hereditary hearing impairment. The spectrum and prevalence of some GJB2 mutations are known to be dependent on the ethnic origin of the population. This study presents data on the carrier frequencies of major GJB2 mutations, c.35delG, c.167delT and c.235delC, among 2308 healthy persons from 18 various populations of Eurasia: Russians, Bashkirs, Tatars, Chuvashes, Udmurts, Komi-Permyaks and Mordvins (Volga-Ural region of Russia); Belarusians and Ukrainians (East Europe); Abkhazians, Avars, Cherkessians and Ingushes (Caucasus); Kazakhs, Uighurs and Uzbeks (Central Asia); and Yakuts and Altaians (Siberia). The data on c.35delG and c.235delC mutation prevalence in the studied ethnic groups can be used to investigate the prospective founder effect in the origin and prevalence of these mutations in Eurasia and consequently in populations around the world.

  5. Enhancing freezing tolerance of Brassica napus L. by overexpression of a stearoyl-acyl carrier protein desaturase gene (SAD) from Sapium sebiferum (L.) Roxb.

    Peng, Dan; Zhou, Bo; Jiang, Yueqiao; Tan, XiaoFeng; Yuan, DeYi; Zhang, Lin

    2018-07-01

    Sapium sebiferum (L.) Roxb. is an important woody oil tree and traditional herbal medicine in China. Stearoyl-acyl carrier protein desaturase (SAD) is a dehydrogenase enzyme that plays a key role in the transformation of saturated fatty acids into unsaturated fatty acids in oil; these fatty acids greatly influence the freezing tolerance of plants. However, it remains unclear whether freezing tolerance can be regulated by the expression level of SsSAD in S. sebiferum L. Our research indicated that SsSAD expression in S. sebiferum L. increased under freezing stress. To further confirm this result, we constructed a pEGAD-SsSAD vector and transformed it into B. napus L. W10 by Agrobacterium tumefaciens-mediated transformation. Transgenic plants that overexpressed the SsSAD gene exhibited significantly higher linoleic (18:2) and linolenic acid (18:3) content and advanced freezing tolerance. These results suggest that SsSAD overexpression in B. napus L. can increase the content of polyunsaturated fatty acids (PUFAs) such as linoleic (18:2) and linolenic acid (18:3), which are likely pivotal in improving freezing tolerance in B. napus L. plants. Thus, SsSAD overexpression could be useful in the production of freeze-tolerant varieties of B. napus L. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Automatic identification of optimal marker genes for phenotypic and taxonomic groups of microorganisms.

    Elad Segev

    Full Text Available Finding optimal markers for microorganisms important in the medical, agricultural, environmental or ecological fields is of great importance. Thousands of complete microbial genomes now available allow us, for the first time, to exhaustively identify marker proteins for groups of microbial organisms. In this work, we model the biological task as the well-known mathematical "hitting set" problem, solving it based on both greedy and randomized approximation algorithms. We identify unique markers for 17 phenotypic and taxonomic microbial groups, including proteins related to the nitrite reductase enzyme as markers for the non-anammox nitrifying bacteria group, and two transcription regulation proteins, nusG and yhiF, as markers for the Archaea and Escherichia/Shigella taxonomic groups, respectively. Additionally, we identify marker proteins for three subtypes of pathogenic E. coli, which previously had no known optimal markers. Practically, depending on the completeness of the database this algorithm can be used for identification of marker genes for any microbial group, these marker genes may be prime candidates for the understanding of the genetic basis of the group's phenotype or to help discover novel functions which are uniquely shared among a group of microbes. We show that our method is both theoretically and practically efficient, while establishing an upper bound on its time complexity and approximation ratio; thus, it promises to remain efficient and permit the identification of marker proteins that are specific to phenotypic or taxonomic groups, even as more and more bacterial genomes are being sequenced.

  7. Bacterial host and reporter gene optimization for genetically encoded whole cell biosensors.

    Brutesco, Catherine; Prévéral, Sandra; Escoffier, Camille; Descamps, Elodie C T; Prudent, Elsa; Cayron, Julien; Dumas, Louis; Ricquebourg, Manon; Adryanczyk-Perrier, Géraldine; de Groot, Arjan; Garcia, Daniel; Rodrigue, Agnès; Pignol, David; Ginet, Nicolas

    2017-01-01

    Whole-cell biosensors based on reporter genes allow detection of toxic metals in water with high selectivity and sensitivity under laboratory conditions; nevertheless, their transfer to a commercial inline water analyzer requires specific adaptation and optimization to field conditions as well as economical considerations. We focused here on both the influence of the bacterial host and the choice of the reporter gene by following the responses of global toxicity biosensors based on constitutive bacterial promoters as well as arsenite biosensors based on the arsenite-inducible P ars promoter. We observed important variations of the bioluminescence emission levels in five different Escherichia coli strains harboring two different lux-based biosensors, suggesting that the best host strain has to be empirically selected for each new biosensor under construction. We also investigated the bioluminescence reporter gene system transferred into Deinococcus deserti, an environmental, desiccation- and radiation-tolerant bacterium that would reduce the manufacturing costs of bacterial biosensors for commercial water analyzers and open the field of biodetection in radioactive environments. We thus successfully obtained a cell survival biosensor and a metal biosensor able to detect a concentration as low as 100 nM of arsenite in D. deserti. We demonstrated that the arsenite biosensor resisted desiccation and remained functional after 7 days stored in air-dried D. deserti cells. We also report here the use of a new near-infrared (NIR) fluorescent reporter candidate, a bacteriophytochrome from the magnetotactic bacterium Magnetospirillum magneticum AMB-1, which showed a NIR fluorescent signal that remained optimal despite increasing sample turbidity, while in similar conditions, a drastic loss of the lux-based biosensors signal was observed.

  8. Smart and Controllable rAAV Gene Delivery Carriers in Progenitor Cells for Human Musculoskeletal Regenerative Medicine with a Focus on the Articular Cartilage.

    Rey-Rico, Ana; Cucchiarini, Magali

    2017-01-01

    Cell therapy using mesenchymal stem cells (MSCs) is a powerful tool for the treatment of various diseases and injuries. Still, important limitations including the large amounts of cells required for application in vivo and the age-related decline in lifespan, proliferation, and potency may hinder the use of MSCs in patients. In this regard, gene therapy may offer strong approaches to optimize the use of MSCs for regenerative medicine. Diverse nonviral and viral gene vehicles have been manipulated to genetically modify MSCs, among which the highly effective and relatively safe recombinant adeno-associated viral (rAAV) vectors that emerged as the preferred gene delivery system to treat human disorders. Yet, clinical adaptation of such gene vehicles may be limited by several hurdles, including the possibility of dissemination to nontarget sites and the presence of immune and toxic responses in the host organism that may impair their therapeutic actions. The use of smart biomaterials acting as interfaces to enhance the temporal and spatial presentation of therapeutic agents in the target place and/or acting as scaffolding for MSC growth is an innovative, valuable approach to overcome these shortcomings that else restrain the efficacy of such potent cell populations. Here, we provide an overview on the most recent tissue engineering approaches based on the use of biomaterials acting as vehicles for rAAV vectors to target MSCs directly in the recipient (in vivo strategy) or as supportive matrices for rAAV-modified MSCs for indirect cell reimplantation (ex vivo strategy) as means to activate the reparative processes in tissues of the musculoskeletal system. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  9. Aircraft Carriers

    Nødskov, Kim; Kværnø, Ole

    as their purchases of aircraft carrier systems, makes it more than likely that the country is preparing such an acquisition. China has territorial disputes in the South China Sea over the Spratly Islands and is also worried about the security of its sea lines of communications, by which China transports the majority......, submarines, aircraft and helicopters, is not likely to be fully operational and war-capable until 2020, given the fact that China is starting from a clean sheet of paper. The United States of America (USA), the United Kingdom (UK), Russia and India are currently building or have made decisions to build new...

  10. Differential Analysis of the Nasal Microbiome of Pig Carriers or Non-Carriers of Staphylococcus aureus

    Espinosa-Gongora, Carmen; Larsen, Niels; Schonning, Kristian

    2016-01-01

    pathogen in animal carriers. The aim of this study was to determine whether the nasal microbiome of pig S. aureus carriers differs from that of non-carriers. The V3-V5 region of the 16S rRNA gene was sequenced from nasal swabs of 44 S. aureus carriers and 56 non-carriers using the 454 GS FLX titanium...... microbiome of pigs that are not colonized with S. aureus harbours several species/taxa that are significantly less abundant in pig carriers, suggesting that the nasal microbiota may play a role in the individual predisposition to S. aureus nasal carriage in pigs. Further research is warranted to isolate...

  11. Screening for the genes involved in bombykol biosynthesis: Identification and functional characterization of Bombyx mori acyl carrier protein (BmACP

    Atsushi eOhnishi

    2011-12-01

    Full Text Available Species-specific sex pheromones released by female moths to attract conspecific male moths are synthesized de novo in the pheromone gland (PG via fatty acid synthesis (FAS. Biosynthesis of moth sex pheromones is usually regulated by a neurohormone termed pheromone biosynthesis activating neuropeptide (PBAN, a 33-aa peptide that originates in the subesophageal ganglion. In the silkmoth, Bombyx mori, cytoplasmic lipid droplets (LDs, which store the sex pheromone (bombykol precursor fatty acid, accumulate in PG cells prior to eclosion. PBAN activation of the PBAN receptor stimulates lipolysis of the stored LD triacylglycerols (TAGs resulting in release of the bombykol precursor for final modification. While we have previously characterized a number of molecules involved in bombykol biosynthesis, little is known about the mechanisms of PBAN signaling that regulate the TAG lipolysis in PG cells. In the current study, we sought to further identify genes involved in bombykol biosynthesis as well as PBAN signaling, by using a subset of 312 expressed sequence tag (EST clones that are in either our B. mori PG cDNA library or the public B. mori EST databases, SilkBase and CYBERGATE, and which are preferentially expressed in the PG. Using RT-PCR expression analysis and an RNAi screening approach, we have identified another 8 EST clones involved in bombykol biosynthesis. Furthermore, we have determined the functional role of a clone designated BmACP that encodes B. mori acyl carrier protein (ACP. Our results indicate that BmACP plays an essential role in the biosynthesis of the bombykol precursor fatty acid via the canonical FAS pathway during pheromonogenesis.

  12. Construction Of An Optimized Lentiviral Vector Containing Pdx-1 Gene For Transduction Of Stem Cells Towards Gene Therapy Diabetes Type 1

    S Rahmati

    2013-02-01

    Full Text Available Abstract Background & aim: Nowadays, most of gene therapy protocols are performed by lentiviral vectors. One of the most important factors which is involved in pancreas development and transcription of insulin gene is pancreatic & duodenal homeobox 1 (PDX-1 transcription factor. The goal of this study was to optimize a lentiviral construct, containing pdx-1 gene, to transfect stem cells towards gene therapy of type-1 diabetes. Methods: In this experimental study, first, the pdx-1 gene was multiplied by PCR from pcDNA3.1-pdx-1 and cloned into pTG19-T vector. Then, pdx-1 was subcloned on upstream of IRES-EGFP gene into IRES2-EGFP vector. At the next step, the cloned parts of IRES-EGFP and pdx-1 were isolated and cloned into the lentiviral expression vector pSINTREM in upstream of TRE-CMV gene. After sequencing, final construct was transfected into HEK 293 cells and gene expression of pdx-1 was evaluated using flow cytometry analysis and reverse fluorescent microscopy. Results: Flow cytometry results and inverted fluorescent microscopy observing showed that pdx-1 and GFP genes are expressed in cells transfected with final recombinant construct. Conclusion: Regarding the design of this construct, to ensure long time expression with higher in vivo and in vitro expression efficiency for stem cells and also use of Tet on induced optimized system, it seems that the current construct can be among the best ones to transfect stem cells. Key words: Gene therapy, Diabetes, Stem cells

  13. Optimizing the molecular diagnosis of CDKL5 gene-related epileptic encephalopathy in boys.

    Mei, Davide; Darra, Francesca; Barba, Carmen; Marini, Carla; Fontana, Elena; Chiti, Laura; Parrini, Elena; Dalla Bernardina, Bernardo; Guerrini, Renzo

    2014-11-01

    Mutations involving the cyclin-dependent kinase-like 5 (CDKL5) gene cause an early onset epileptic encephalopathy (EE) with severe neurologic impairment and a skewed 12:1 female-to-male ratio. To date, 18 mutations have been described in boys. We analyzed our cohort of boys with early onset EE to assess the diagnostic yield of our molecular approach. We studied 74 boys who presented early onset severe seizures, including infantile spasms and developmental delay, in the setting of EE, using Sanger sequencing, next-generation sequencing (NGS) and multiplex ligation-dependent probe amplification (MLPA). We identified alterations involving CDKL5 in four boys (5.4%) using NGS in one and MLPA in three. Three of four mutations were indicative of somatic mosaicism. CDKL5 gene mutations accounted for 5.4% of boys with early onset EE. Somatic mosaic mutations might be even more represented than germline mutations, probably because their less deleterious effect enhances viability of the male embryo. The molecular approach used for CDKL5 screening remarkably influences the diagnostic yield in boys. Diagnosis is optimized by Sanger sequencing combined with array-based methods or MLPA; alternatively, NGS targeted resequencing designed to also detect copy number alterations, may be performed. Wiley Periodicals, Inc. © 2014 International League Against Epilepsy.

  14. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  15. Interval-value Based Particle Swarm Optimization algorithm for cancer-type specific gene selection and sample classification

    D. Ramyachitra

    2015-09-01

    Full Text Available Microarray technology allows simultaneous measurement of the expression levels of thousands of genes within a biological tissue sample. The fundamental power of microarrays lies within the ability to conduct parallel surveys of gene expression using microarray data. The classification of tissue samples based on gene expression data is an important problem in medical diagnosis of diseases such as cancer. In gene expression data, the number of genes is usually very high compared to the number of data samples. Thus the difficulty that lies with data are of high dimensionality and the sample size is small. This research work addresses the problem by classifying resultant dataset using the existing algorithms such as Support Vector Machine (SVM, K-nearest neighbor (KNN, Interval Valued Classification (IVC and the improvised Interval Value based Particle Swarm Optimization (IVPSO algorithm. Thus the results show that the IVPSO algorithm outperformed compared with other algorithms under several performance evaluation functions.

  16. Interval-value Based Particle Swarm Optimization algorithm for cancer-type specific gene selection and sample classification.

    Ramyachitra, D; Sofia, M; Manikandan, P

    2015-09-01

    Microarray technology allows simultaneous measurement of the expression levels of thousands of genes within a biological tissue sample. The fundamental power of microarrays lies within the ability to conduct parallel surveys of gene expression using microarray data. The classification of tissue samples based on gene expression data is an important problem in medical diagnosis of diseases such as cancer. In gene expression data, the number of genes is usually very high compared to the number of data samples. Thus the difficulty that lies with data are of high dimensionality and the sample size is small. This research work addresses the problem by classifying resultant dataset using the existing algorithms such as Support Vector Machine (SVM), K-nearest neighbor (KNN), Interval Valued Classification (IVC) and the improvised Interval Value based Particle Swarm Optimization (IVPSO) algorithm. Thus the results show that the IVPSO algorithm outperformed compared with other algorithms under several performance evaluation functions.

  17. Optimizing cationic and neutral lipids for efficient gene delivery at high serum content.

    Chan, Chia-Ling; Ewert, Kai K; Majzoub, Ramsey N; Hwu, Yeu-Kuang; Liang, Keng S; Leal, Cecília; Safinya, Cyrus R

    2014-01-01

    Cationic liposome (CL)-DNA complexes are promising gene delivery vectors with potential application in gene therapy. A key challenge in creating CL-DNA complexes for application is that their transfection efficiency (TE) is adversely affected by serum. In particular, little is known about the effects of a high serum content on TE, even though this may provide design guidelines for application in vivo. We prepared CL-DNA complexes in which we varied the neutral lipid [1,2-dioleoyl-sn-glycerophosphatidylcholine, glycerol-monooleate (GMO), cholesterol], the headgroup charge and chemical structure of the cationic lipid, and the ratio of neutral to cationic lipid; we then measured the TE of these complexes as a function of serum content and assessed their cytotoxicity. We tested selected formulations in two human cancer cell lines (M21/melanoma and PC-3/prostate cancer). In the absence of serum, all CL-DNA complexes of custom-synthesized multivalent lipids show high TE. Certain combinations of multivalent lipids and neutral lipids, such as MVL5(5+)/GMO-DNA complexes or complexes based on the dendritic-headgroup lipid TMVLG3(8+) exhibited high TE both in the absence and presence of serum. Although their TE still dropped to a small extent in the presence of serum, it reached or surpassed that of benchmark commercial transfection reagents, particularly at a high serum content. Two-component vectors (one multivalent cationic lipid and one neutral lipid) can rival or surpass benchmark reagents at low and high serum contents (up to 50%, v/v). We propose guidelines for optimizing the serum resistance of CL-DNA complexes based on a given cationic lipid. Copyright © 2014 John Wiley & Sons, Ltd.

  18. Development, optimization and evaluation of surfactant-based pulmonary nanolipid carrier system of paclitaxel for the management of drug resistance lung cancer using Box-Behnken design.

    Kaur, Prabhjot; Garg, Tarun; Rath, Goutam; Murthy, R S Rayasa; Goyal, Amit K

    2016-07-01

    In the present study, nanostructured lipid carriers (NLCs) along with various surfactants loaded with paclitaxel (PTX) were prepared by an emulsification technique using a Box-Behnken design. The Box-Behnken design indicated that the most effective factors on the size and PDI were at high surfactant concentration (1.5%), low lipids ratio (6:4) and medium homogenization speed (6000 rpm). Among all the formulations, Tween 20-loaded NLCs show least particle size compared to Tween 80 and Tween 60. Entrapment efficiency of Tween 20, Tween 80 and Tween 60-loaded formulations were 82.40, 85.60 and 79.78%, respectively. Drug release of Tween 80, Tween 20 and Tween 60-loaded NLCs is 64.9, 62.3 and 59.7%, respectively (within 72 h). Maximum cellular uptake was observed with Tween 20 formulation on Caco-2 cell lines. Furthermore, spray drying of resultant NLCs was showed good flow properties and was selected for drug delivery to deeper airways. In-vivo studies demonstrated the better localization of drug within the lungs using different surfactant-based pulmonary delivery systems. From this study, we have concluded that delivering drugs through pulmonary route is advantageous for local action in lungs as maximum amount of drug concentration was observed in lungs. The surfactants could prove to be beneficial in treating drug resistance lung cancer by inhibiting P-gp efflux in the form of nano lipidic carriers.

  19. Optimization to the Culture Conditions for Phellinus Production with Regression Analysis and Gene-Set Based Genetic Algorithm

    Li, Zhongwei; Xin, Yuezhen; Wang, Xun; Sun, Beibei; Xia, Shengyu; Li, Hui

    2016-01-01

    Phellinus is a kind of fungus and is known as one of the elemental components in drugs to avoid cancers. With the purpose of finding optimized culture conditions for Phellinus production in the laboratory, plenty of experiments focusing on single factor were operated and large scale of experimental data were generated. In this work, we use the data collected from experiments for regression analysis, and then a mathematical model of predicting Phellinus production is achieved. Subsequently, a gene-set based genetic algorithm is developed to optimize the values of parameters involved in culture conditions, including inoculum size, PH value, initial liquid volume, temperature, seed age, fermentation time, and rotation speed. These optimized values of the parameters have accordance with biological experimental results, which indicate that our method has a good predictability for culture conditions optimization. PMID:27610365

  20. Development and optimization of sulforaphane-loaded nanostructured lipid carriers by the Box-Behnken design for improved oral efficacy against cancer: in vitro, ex vivo and in vivo assessments.

    Soni, Kriti; Rizwanullah, Md; Kohli, Kanchan

    2017-11-28

    In the present study, sulforaphane (SFN)-loaded nanostructured lipid carriers (NLC) were developed and optimized for improved oral efficacy against cancer. The SFN-loaded NLC formulation was developed by melt emulsification ultrasonication technique and optimized by Box-Behnken statistical design. The optimized SFN-loaded NLC formulation composed of precirol ® ATO 5 (solid lipid) and vitamin E (liquid lipid) as lipid phase (3% w/v), poloxamer 188 (1%) and Tween 80 (1%) as surfactant. The mean particle size, polydispersity index, zeta potential, entrapment efficiency (%) and drug loading (%) of optimized SFN-loaded NLC formulation was observed to be 145.38 ± 4.46 nm, 0.181 ± 0.023, -25.12 ± 2.36 mV, 84.94 ± 3.82% and 14.82 ± 3.46%, respectively. In vitro drug release studies showed that the release of SFN from optimized NLC formulation was significantly higher (86.52 ± 5.48%) compared to SFN suspension (38.47 ± 5.52%) up to 24 h. Ex vivo gut permeation studies revealed a very good enhancement in permeation of drug present in the NLC compared to plain SFN solution and were further confirmed by CLSM. MTT assay in different cancer cell lines showed that the optimized SFN-loaded NLC formulation exhibited significantly improved (p < .05) cytotoxicity compared to free SFN solution. SFN-loaded NLC formulation showed significantly improved antioxidant activity compared to free SFN solution. Furthermore, pharmacokinetic study on albino Wistar rats showed 5.04-fold increase in relative oral bioavailability with NLC (p < .05) compared to SFN suspension. Therefore, NLC represents a great potential for improved efficacy of SFN after oral administration.

  1. Prevalence of carriers of premutation-size alleles of the FMR1 gene-and implications for the population genetics of the fragile X syndrome

    Rousseau, F.; Rouillard, P.; Morel, M.L. [Universite Laval, Quebec City (Canada)] [and others

    1995-11-01

    The fragile X syndrome is the second leading cause of mental retardation after Down syndrome. Fragile X premutations are not associated with any clinical phenotype but are at high risk of expanding to full mutations causing the disease when they are transmitted by a carrier woman. There is no reliable estimate of the prevalence of women who are carriers of fragile X premutations. We have screened 10,624 unselected women by Southern blot for the presence of FMR1 premutation alleles and have confirmed their size by PCR analysis. We found 41 carriers of alleles with 55-101 CGG repeats, a prevalence of 1/259 women (95% confidence interval 1/373-1/198). Thirty percent of these alleles carry an inferred haplotype that corresponds to the most frequent haplotype found in fragile X males and may indeed constitute premutations associated with a significant risk of expansion on transmission by carrier women. We identified another inferred haplotype that is rare in both normal and fragile X chromosomes but that is present on 13 (57%) of 23 chromosomes carrying FMR1 alleles with 53-64 CGG repeats. This suggests either (1) that this haplotype may be stable or (2) that the associated premutation-size alleles have not yet reached equilibrium in this population and that the incidence of fragile X syndrome may increase in the future. 42 refs., 3 figs., 4 tabs.

  2. Codon Optimization Significantly Improves the Expression Level of α-Amylase Gene from Bacillus licheniformis in Pichia pastoris

    Jian-Rong Wang

    2015-01-01

    Full Text Available α-Amylase as an important industrial enzyme has been widely used in starch processing, detergent, and paper industries. To improve expression efficiency of recombinant α-amylase from Bacillus licheniformis (B. licheniformis, the α-amylase gene from B. licheniformis was optimized according to the codon usage of Pichia pastoris (P. pastoris and expressed in P. pastoris. Totally, the codons encoding 305 amino acids were optimized in which a total of 328 nucleotides were changed and the G+C content was increased from 47.6 to 49.2%. The recombinants were cultured in 96-deep-well microplates and screened by a new plate assay method. Compared with the wild-type gene, the optimized gene is expressed at a significantly higher level in P. pastoris after methanol induction for 168 h in 5- and 50-L bioreactor with the maximum activity of 8100 and 11000 U/mL, which was 2.31- and 2.62-fold higher than that by wild-type gene. The improved expression level makes the enzyme a good candidate for α-amylase production in industrial use.

  3. Efficacy of DNA double-strand breaks repair in breast cancer is decreased in carriers of the variant allele of the UBC9 gene c.73G>A polymorphism

    Synowiec, Ewelina [Department of Molecular Genetics, University of Lodz, Lodz (Poland); Krupa, Renata [Laboratory of DNA Repair, Department of Molecular Genetics, University of Lodz, Banacha 12/16, Lodz (Poland); Morawiec, Zbigniew; Wasylecka, Maja [Department of Surgical Oncology, N. Copernicus Hospital, Lodz (Poland); Dziki, Lukasz; Morawiec, Jan [Department of General and Colorectal Surgery, Medical University of Lodz, Lodz (Poland); Blasiak, Janusz [Department of Molecular Genetics, University of Lodz, Lodz (Poland); Wozniak, Katarzyna, E-mail: wozniak@biol.uni.lodz.pl [Laboratory of DNA Repair, Department of Molecular Genetics, University of Lodz, Banacha 12/16, Lodz (Poland)

    2010-12-10

    UBC9 (E2) SUMO conjugating enzyme plays an important role in the maintenance of genome stability and integrity. In the present work we examined the association between the c.73G>A (Val25Met) polymorphism of the UBC9 gene (rs11553473) and efficacy of DNA double-strand breaks (DSBs) repair (DRE) in breast cancer patients. We determined the level of endogenous (basal) and exogenous (induced by {gamma}-irradiation) DSBs and efficacy of their repair in peripheral blood lymphocytes of 57 breast cancer patients and 70 healthy individuals. DNA damage and repair were studied by neutral comet assay. Genotypes were determined in DNA from peripheral blood lymphocytes by allele-specific PCR (ASO-PCR). We also correlated genotypes with the clinical characteristics of breast cancer patients. We observed a strong association between breast cancer occurrence and the variant allele carried genotypes in patients with elevated level of basal as well as induced DNA damage (OR 6.74, 95% CI 2.27-20.0 and OR 5.33, 95% CI 1.81-15.7, respectively). We also found statistically significant (p < 0.05) difference in DRE related to the c.73G>A polymorphism of the UBC9 gene in breast cancer patients. Carriers of variant allele have decreased DNA DRE as compared to wild type genotype carriers. We did not find any association with the UBC9 gene polymorphism and estrogen and progesterone receptor status. The variant allele of the UBC9 gene polymorphism was strongly inversely related to HER negative breast cancer patients (OR 0.03, 95% CI 0.00-0.23). Our results suggest that the c.73G>A polymorphism of the UBC9 gene may affect DNA DSBs repair efficacy in breast cancer patients.

  4. Efficacy of DNA double-strand breaks repair in breast cancer is decreased in carriers of the variant allele of the UBC9 gene c.73G>A polymorphism

    Synowiec, Ewelina; Krupa, Renata; Morawiec, Zbigniew; Wasylecka, Maja; Dziki, Lukasz; Morawiec, Jan; Blasiak, Janusz; Wozniak, Katarzyna

    2010-01-01

    UBC9 (E2) SUMO conjugating enzyme plays an important role in the maintenance of genome stability and integrity. In the present work we examined the association between the c.73G>A (Val25Met) polymorphism of the UBC9 gene (rs11553473) and efficacy of DNA double-strand breaks (DSBs) repair (DRE) in breast cancer patients. We determined the level of endogenous (basal) and exogenous (induced by γ-irradiation) DSBs and efficacy of their repair in peripheral blood lymphocytes of 57 breast cancer patients and 70 healthy individuals. DNA damage and repair were studied by neutral comet assay. Genotypes were determined in DNA from peripheral blood lymphocytes by allele-specific PCR (ASO-PCR). We also correlated genotypes with the clinical characteristics of breast cancer patients. We observed a strong association between breast cancer occurrence and the variant allele carried genotypes in patients with elevated level of basal as well as induced DNA damage (OR 6.74, 95% CI 2.27-20.0 and OR 5.33, 95% CI 1.81-15.7, respectively). We also found statistically significant (p A polymorphism of the UBC9 gene in breast cancer patients. Carriers of variant allele have decreased DNA DRE as compared to wild type genotype carriers. We did not find any association with the UBC9 gene polymorphism and estrogen and progesterone receptor status. The variant allele of the UBC9 gene polymorphism was strongly inversely related to HER negative breast cancer patients (OR 0.03, 95% CI 0.00-0.23). Our results suggest that the c.73G>A polymorphism of the UBC9 gene may affect DNA DSBs repair efficacy in breast cancer patients.

  5. Breast Cancer Gene Therapy: Development of Novel Non-Invasive Magnetic Resonance Assay to Optimize Efficacy

    Mason, Ralph P

    2007-01-01

    Gene therapy holds great promise for treatment of breast cancer. In particular clinical trials are underway to apply therapeutic genes related to pro-drug activation or to modulate the activity of oncogenes by blocking promoter sites...

  6. Optimizations of siRNA design for the activation of gene transcription by targeting the TATA-box motif.

    Miaomiao Fan

    Full Text Available Small interfering RNAs (siRNAs are widely used to repress gene expression by targeting mRNAs. Some reports reveal that siRNAs can also activate or inhibit gene expression through targeting the gene promoters. Our group has found that microRNAs (miRNAs could activate gene transcription via interaction with the TATA-box motif in gene promoters. To investigate whether siRNA targeting the same region could upregulate the promoter activity, we test the activating efficiency of siRNAs targeting the TATA-box motif of 16 genes and perform a systematic analysis to identify the common features of the functional siRNAs for effective activation of gene promoters. Further, we try various modifications to improve the activating efficiency of siRNAs and find that it is quite useful to design the promoter-targeting activating siRNA by following several rules such as (a complementary to the TATA-box-centered region; (b UA usage at the first two bases of the antisense strand; (c twenty-three nucleotides (nts in length; (d 2'-O-Methyl (2'-OMe modification at the 3' terminus of the antisense strand; (e avoiding mismatches at the 3' end of the antisense strand. The optimized activating siRNAs potently enhance the expression of interleukin-2 (IL-2 gene in human and mouse primary CD4+ T cells with a long-time effect. Taken together, our study provides a guideline for rational design the promoter-targeting siRNA to sequence-specifically enhance gene expression.

  7. The relationship between PMI (manA) gene expression and optimal selection pressure in Indica rice transformation.

    Gui, Huaping; Li, Xia; Liu, Yubo; Han, Kai; Li, Xianggan

    2014-07-01

    An efficient mannose selection system was established for transformation of Indica cultivar IR58025B . Different selection pressures were required to achieve optimum transformation frequency for different PMI selectable marker cassettes. This study was conducted to establish an efficient transformation system for Indica rice, cultivar IR58025B. Four combinations of two promoters, rice Actin 1 and maize Ubiquitin 1, and two manA genes, native gene from E. coli (PMI-01) and synthetic maize codon-optimized gene (PMI-09) were compared under various concentrations of mannose. Different selection pressures were required for different gene cassettes to achieve corresponding optimum transformation frequency (TF). Higher TFs as 54 and 53% were obtained when 5 g/L mannose was used for selection of prActin-PMI-01 cassette and 7.5 g/L mannose used for selection of prActin-PMI-09, respectively. TFs as 67 and 56% were obtained when 7.5 and 15 g/L mannose were used for selection of prUbi-PMI-01 and prUbi-PMI-09, respectively. We conclude that higher TFs can be achieved for different gene cassettes when an optimum selection pressure is applied. By investigating the PMI expression level in transgenic calli and leaves, we found there was a significant positive correlation between the protein expression level and the optimal selection pressure. Higher optimal selection pressure is required for those constructs which confer higher expression of PMI protein. The single copy rate of those transgenic events for prActin-PMI-01 cassette is lower than that for other three cassettes. We speculate some of low copy events with low protein expression levels might not have been able to survive in the mannose selection.

  8. A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina.

    Bidard, Frédérique; Imbeaud, Sandrine; Reymond, Nancie; Lespinet, Olivier; Silar, Philippe; Clavé, Corinne; Delacroix, Hervé; Berteaux-Lecellier, Véronique; Debuchy, Robert

    2010-06-18

    The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis.

  9. A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina

    Bidard Frédérique

    2010-06-01

    Full Text Available Abstract Background The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. Findings We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS, we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. Conclusions A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis.

  10. PEO-PPO-PEO/Poly(DL-lactide-co-caprolactone) Nanoparticles as Carriers for SN-38: Design, Optimization and Nano-Bio Interface Interactions.

    Koliqi, Rozafa; Dimchevska, Simona; Geskovski, Nikola; Petruševski, Gjorgji; Chacorovska, Marina; Pejova, Biljana; Hristov, Delyan R; Ugarkovic, Sonja; Goracinova, Katerina

    2016-01-01

    Encapsulation of extremely hydrophobic substances such as SN-38 into nanoparticles, is a promising approach to solve the solubility issue and enable drug administration. Moreover, nanocarriers' tumor homing behavior, targeted and controlled release at the site of action will optimize therapeutic potency and decrease toxicity of the incorporated drug substance. However, the enormous drug hydrophobicity might limit the capacity for encapsulation as the premature drug precipitation will contribute to fast free drug crystal growth, low drug incorporation and huge waste of the active material. In this article we defined the optimal region for manufacturing of SN-38 loaded PEO-PPO-PEO/P(DL)LCL nanoparticles (NPs) with high efficacy of encapsulation, suitable particle size and different surface properties, using D-optimal design and nanoprecipitation as production method. Further we made an approach to investigate the interactions with macromolecules at the nano-bio interface which are predetermined by the physico-chemical and surface properties of the NPs, and are important determinants for the biological identity of the nanoparticles, the potential for evasion of the physiological barriers and the efficacy of localization at the site of action. Here we present in depth analysis of the behavior of two types of nanoparticles with different surface properties through structured protein interaction and bioreactivity experiments in order to presuppose NP performance and toxicological profile in biological environment.

  11. A hybrid gene selection approach for microarray data classification using cellular learning automata and ant colony optimization.

    Vafaee Sharbaf, Fatemeh; Mosafer, Sara; Moattar, Mohammad Hossein

    2016-06-01

    This paper proposes an approach for gene selection in microarray data. The proposed approach consists of a primary filter approach using Fisher criterion which reduces the initial genes and hence the search space and time complexity. Then, a wrapper approach which is based on cellular learning automata (CLA) optimized with ant colony method (ACO) is used to find the set of features which improve the classification accuracy. CLA is applied due to its capability to learn and model complicated relationships. The selected features from the last phase are evaluated using ROC curve and the most effective while smallest feature subset is determined. The classifiers which are evaluated in the proposed framework are K-nearest neighbor; support vector machine and naïve Bayes. The proposed approach is evaluated on 4 microarray datasets. The evaluations confirm that the proposed approach can find the smallest subset of genes while approaching the maximum accuracy. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Transient B cell depletion or improved transgene expression by codon optimization promote tolerance to factor VIII in gene therapy.

    Brandon K Sack

    Full Text Available The major complication in the treatment of hemophilia A is the development of neutralizing antibodies (inhibitors against factor VIII (FVIII. The current method for eradicating inhibitors, termed immune tolerance induction (ITI, is costly and protracted. Clinical protocols that prevent rather than treat inhibitors are not yet established. Liver-directed gene therapy hopes to achieve long-term correction of the disease while also inducing immune tolerance. We sought to investigate the use of adeno-associated viral (serotype 8 gene transfer to induce tolerance to human B domain deleted FVIII in hemophilia A mice. We administered an AAV8 vector with either human B domain deleted FVIII or a codon-optimized transgene, both under a liver-specific promoter to two strains of hemophilia A mice. Protein therapy or gene therapy was given either alone or in conjunction with anti-CD20 antibody-mediated B cell depletion. Gene therapy with a low-expressing vector resulted in sustained near-therapeutic expression. However, supplementary protein therapy revealed that gene transfer had sensitized mice to hFVIII in a high-responder strain but not in mice of a low-responding strain. This heightened response was ameliorated when gene therapy was delivered with anti-murine CD20 treatment. Transient B cell depletion prevented inhibitor formation in protein therapy, but failed to achieve a sustained hypo-responsiveness. Importantly, use of a codon-optimized hFVIII transgene resulted in sustained therapeutic expression and tolerance without a need for B cell depletion. Therefore, anti-CD20 may be beneficial in preventing vector-induced immune priming to FVIII, but higher levels of liver-restricted expression are preferred for tolerance.

  13. Removal of antibiotics and antibiotic resistance genes from domestic sewage by constructed wetlands: Optimization of wetland substrates and hydraulic loading.

    Chen, Jun; Wei, Xiao-Dong; Liu, You-Sheng; Ying, Guang-Guo; Liu, Shuang-Shuang; He, Liang-Ying; Su, Hao-Chang; Hu, Li-Xin; Chen, Fan-Rong; Yang, Yong-Qiang

    2016-09-15

    This study aimed to assess removal potential of antibiotics and antibiotic resistance genes (ARGs) in raw domestic wastewater by various mesocosm-scale horizontal subsurface-flow constructed wetlands (CWs) planted Cyperus alternifolius L. with different design parameters. Twelve CWs with three hydraulic loading rates (HLR 10, 20 and 30cm/day) and four substrates (oyster shell, zeolite, medical stone and ceramic) were set up in order to select the best optimized wetland. The result showed that 7 target antibiotics compounds including erythromycin-H2O, lincomycin, monensin, ofloxacin, sulfamerazine, sulfamethazine and novobiocin were detected, and all selected 18 genes (three sulfonamide resistance genes (sul1, sul2 and sul3), four tetracycline resistance genes (tetG, tetM, tetO and tetX), two macrolide resistance genes (ermB and ermC), three quinolone resistance genes (qnrB, qnrD and qnrS) and four chloramphenicol resistance genes (cmlA, fexA, fexB and floR)) and two integrase genes (int1 and int2) were positively detected in the domestic wastewaters. The aqueous removal rates of the total antibiotics ranged from17.9 to 98.5%, while those for the total ARGs varied between 50.0 and 85.8% by the mesocosm-scale CWs. After considering their aqueous removal rates in combination with their mass removals, the CW with zeolite as the substrate and HLR of 20cm/day was selected as the best choice. Combined chemical and biological analyses indicate that both microbial degradation and physical sorption processes were responsible for the fate of antibiotics and ARGs in the wetlands. The findings from this study suggest constructed wetlands could be a promising technology for the removal of emerging contaminants such as antibiotics and ARGs in domestic wastewater. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. The nitrate-reduction gene cluster components exert lineage-dependent contributions to optimization of Sinorhizobium symbiosis with soybeans.

    Liu, Li Xue; Li, Qin Qin; Zhang, Yun Zeng; Hu, Yue; Jiao, Jian; Guo, Hui Juan; Zhang, Xing Xing; Zhang, Biliang; Chen, Wen Xin; Tian, Chang Fu

    2017-12-01

    Receiving nodulation and nitrogen fixation genes does not guarantee rhizobia an effective symbiosis with legumes. Here, variations in gene content were determined for three Sinorhizobium species showing contrasting symbiotic efficiency on soybeans. A nitrate-reduction gene cluster absent in S. sojae was found to be essential for symbiotic adaptations of S. fredii and S. sp. III. In S. fredii, the deletion mutation of the nap (nitrate reductase), instead of nir (nitrite reductase) and nor (nitric oxide reductase), led to defects in nitrogen-fixation (Fix - ). By contrast, none of these core nitrate-reduction genes were required for the symbiosis of S. sp. III. However, within the same gene cluster, the deletion of hemN1 (encoding oxygen-independent coproporphyrinogen III oxidase) in both S. fredii and S. sp. III led to the formation of nitrogen-fixing (Fix + ) but ineffective (Eff - ) nodules. These Fix + /Eff - nodules were characterized by significantly lower enzyme activity of glutamine synthetase indicating rhizobial modulation of nitrogen-assimilation by plants. A distant homologue of HemN1 from S. sojae can complement this defect in S. fredii and S. sp. III, but exhibited a more pleotropic role in symbiosis establishment. These findings highlighted the lineage-dependent optimization of symbiotic functions in different rhizobial species associated with the same host. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  15. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  16. FocusHeuristics - expression-data-driven network optimization and disease gene prediction.

    Ernst, Mathias; Du, Yang; Warsow, Gregor; Hamed, Mohamed; Endlich, Nicole; Endlich, Karlhans; Murua Escobar, Hugo; Sklarz, Lisa-Madeleine; Sender, Sina; Junghanß, Christian; Möller, Steffen; Fuellen, Georg; Struckmann, Stephan

    2017-02-16

    To identify genes contributing to disease phenotypes remains a challenge for bioinformatics. Static knowledge on biological networks is often combined with the dynamics observed in gene expression levels over disease development, to find markers for diagnostics and therapy, and also putative disease-modulatory drug targets and drugs. The basis of current methods ranges from a focus on expression-levels (Limma) to concentrating on network characteristics (PageRank, HITS/Authority Score), and both (DeMAND, Local Radiality). We present an integrative approach (the FocusHeuristics) that is thoroughly evaluated based on public expression data and molecular disease characteristics provided by DisGeNet. The FocusHeuristics combines three scores, i.e. the log fold change and another two, based on the sum and difference of log fold changes of genes/proteins linked in a network. A gene is kept when one of the scores to which it contributes is above a threshold. Our FocusHeuristics is both, a predictor for gene-disease-association and a bioinformatics method to reduce biological networks to their disease-relevant parts, by highlighting the dynamics observed in expression data. The FocusHeuristics is slightly, but significantly better than other methods by its more successful identification of disease-associated genes measured by AUC, and it delivers mechanistic explanations for its choice of genes.

  17. Optimization of cationic lipid mediated gene transfer: structure-function, physico-chemical, and cellular studies.

    Carrière, Marie; Tranchant, Isabelle; Niore, Pierre-Antoine; Byk, Gerardo; Mignet, Nathalie; Escriou, Virginie; Scherman, Daniel; Herscovici, Jean

    2002-01-01

    The rationale design aimed at the enhancement of cationic lipid mediated gene transfer is discussed. These improvements are based on the straight evaluation of the structure-activity relationship and on the introduction of new structures. Much attention have been given to the supramolecular structures of the lipid/DNA complexes, to the effect of serum on gene transfer and to the intracellular trafficking of the lipoplexes. Finally new avenue using reducible cationic lipids has been discussed.

  18. High risk of cerebral-vein thrombosis in carriers of a prothrombin-gene mutation and in users of oral contraceptives.

    Martinelli, I; Sacchi, E; Landi, G; Taioli, E; Duca, F; Mannucci, P M

    1998-06-18

    Idiopathic cerebral-vein thrombosis can cause serious neurologic disability. We evaluated risk factors for this disorder, including genetic risk factors (mutations in the genes encoding factor V and prothrombin) and nongenetic risk factors (such as the use of oral contraceptive agents). We compared the prevalence of these risk factors in 40 patients with cerebral-vein thrombosis, 80 patients with deep-vein thrombosis of the lower extremities, and 120 healthy controls. The G1691A mutation in the factor V gene and the G20210A prothrombin-gene mutation, which are established genetic risk factors for venous thrombosis, were studied. We also assessed the use of oral contraceptives and other risk factors for thrombosis. The prevalence of the prothrombin-gene mutation was higher in patients with cerebral-vein thrombosis (20 percent) than in healthy controls (3 percent; odds ratio, 10.2; 95 percent confidence interval, 2.3 to 31.0) and was similar to that in patients with deep-vein thrombosis (18 percent). Similar results were obtained for the mutation in the factor V gene. The use of oral contraceptives was more frequent among women with cerebral-vein thrombosis (96 percent) than among controls (32 percent; odds ratio, 22.1; 95 percent confidence interval, 5.9 to 84.2) and among those with deep-vein thrombosis (61 percent; odds ratio, 4.4; 95 percent confidence interval, 1.1 to 17.8). For women who were taking oral contraceptives and who also had the prothrombin-gene mutation (seven patients with cerebral-vein thrombosis but only one control), the odds ratio for cerebral-vein thrombosis rose to 149.3 (95 percent confidence interval, 31.0 to 711.0). Mutations in the prothrombin gene and the factor V gene are associated with cerebral-vein thrombosis. The use of oral contraceptives is also strongly and independently associated with the disorder. The presence of both the prothrombin-gene mutation and oral-contraceptive use raises the risk of cerebral-vein thrombosis further.

  19. Optimization of RT-PCR reactions in studies with genes of lignin biosynthetic route in Saccharum spontaneum

    JUAN P.P. LLERENA

    Full Text Available ABSTRACT Saccharum spontaneum has been used for the development of energy cane a crop aimed to be used for the production of second-generation ethanol, or lignocellulosic ethanol. Lignin is a main challenge in the conversion of cell wall sugars into ethanol. In our studies to isolate the genes the lignin biosynthesis in S. spontaneum we have had great difficulty in RT-PCR reactions. Thus, we evaluated the effectiveness of different additives in the amplification of these genes. While COMT and CCoAOMT genes did not need any additives for other genes there was no amplification (HCT, F5H, 4CL and CCR or the yield was very low (CAD and C4H. The application of supplementary cDNA was enough to overcome the non-specificity and low yield for C4H and C3H, while the addition of 0.04% BSA + 2% formamide was effective to amplify 4CL, CCR, F5H and CCR. HCT was amplified only by addition of 0.04% BSA + 2% formamide + 0.1 M trehalose and amplification of PAL was possible with addition of 2% of DMSO. Besides optimization of expression assays, the results show that additives can act independently or synergistically.

  20. Optimization of Critical Hairpin Features Allows miRNA-based Gene Knockdown Upon Single-copy Transduction

    Renier Myburgh

    2014-01-01

    Full Text Available Gene knockdown using micro RNA (miRNA-based vector constructs is likely to become a prominent gene therapy approach. It was the aim of this study to improve the efficiency of gene knockdown through optimizing the structure of miRNA mimics. Knockdown of two target genes was analyzed: CCR5 and green fluorescent protein. We describe here a novel and optimized miRNA mimic design called mirGE comprising a lower stem length of 13 base pairs (bp, positioning of the targeting strand on the 5′ side of the miRNA, together with nucleotide mismatches in upper stem positions 1 and 12 placed on the passenger strand. Our mirGE proved superior to miR-30 in four aspects: yield of targeting strand incorporation into RNA-induced silencing complex (RISC; incorporation into RISC of correct targeting strand; precision of cleavage by Drosha; and ratio of targeting strand over passenger strand. A triple mirGE hairpin cassette targeting CCR5 was constructed. It allowed CCR5 knockdown with an efficiency of over 90% upon single-copy transduction. Importantly, single-copy expression of this construct rendered transduced target cells, including primary human macrophages, resistant to infection with a CCR5-tropic strain of HIV. Our results provide new insights for a better knockdown efficiency of constructs containing miRNA. Our results also provide the proof-of-principle that cells can be rendered HIV resistant through single-copy vector transduction, rendering this approach more compatible with clinical applications.

  1. An integer optimization algorithm for robust identification of non-linear gene regulatory networks

    Chemmangattuvalappil Nishanth

    2012-09-01

    Full Text Available Abstract Background Reverse engineering gene networks and identifying regulatory interactions are integral to understanding cellular decision making processes. Advancement in high throughput experimental techniques has initiated innovative data driven analysis of gene regulatory networks. However, inherent noise associated with biological systems requires numerous experimental replicates for reliable conclusions. Furthermore, evidence of robust algorithms directly exploiting basic biological traits are few. Such algorithms are expected to be efficient in their performance and robust in their prediction. Results We have developed a network identification algorithm to accurately infer both the topology and strength of regulatory interactions from time series gene expression data in the presence of significant experimental noise and non-linear behavior. In this novel formulism, we have addressed data variability in biological systems by integrating network identification with the bootstrap resampling technique, hence predicting robust interactions from limited experimental replicates subjected to noise. Furthermore, we have incorporated non-linearity in gene dynamics using the S-system formulation. The basic network identification formulation exploits the trait of sparsity of biological interactions. Towards that, the identification algorithm is formulated as an integer-programming problem by introducing binary variables for each network component. The objective function is targeted to minimize the network connections subjected to the constraint of maximal agreement between the experimental and predicted gene dynamics. The developed algorithm is validated using both in silico and experimental data-sets. These studies show that the algorithm can accurately predict the topology and connection strength of the in silico networks, as quantified by high precision and recall, and small discrepancy between the actual and predicted kinetic parameters

  2. Optimization of Intracellular Transportation of Gene Therapeutic DNA in Small Cell Lung Cancer (Ph.d.)

    Cramer, Frederik

    2013-01-01

    Small cell lung cancer (SCLC) is a highly malignant disease characterized as being very aggressive and metastasizing at a rapid pace. The malevolent pace of SCLC cell migration results in almost three out of four SCLC patients having disseminated SCLC at the time of diagnosis. Unfortunately...... has to be able to repeated systemic delivery of gene therapy to cancer cells in a both safe and efficient way. Non-viral delivery vectors fulfill many of these requirements except the latter. It is currently very difficult to systemically transport sufficient amounts of therapeutic DNA, by a non......-viral delivery system, to the nuclei of the SCLC cells. As a result, the gene therapy expression obtained is too low to have any clinical relevance. We have at the Department of Radiation Biology developed a transcriptionally targeting suicide gene therapy system which is built on a double stranded DNA plasmid...

  3. Optimization of Agrobacterium-mediated transient expression of heterologous genes in spinach

    Cao, Dang Viet; Pamplona, Reniel S.; Kim, Jiwon

    2017-01-01

    The Agrobacterium-mediated transient assay is a relatively rapid technique and a promising approach for assessing the expression of a gene of interest. Despite the successful application of this transient expression system in several plant species, it is not well understood in spinach. In this st...

  4. Supramolecular nano-engineered lipidic carriers based on diflunisal-phospholipid complex for transdermal delivery: QbD based optimization, characterization and preclinical investigations for management of rheumatoid arthritis.

    Kaur, Amanpreet; Bhoop, Bhupinder Singh; Chhibber, Sanjay; Sharma, Gajanand; Gondil, Vijay Singh; Katare, Om Prakash

    2017-11-25

    Diflunisal (DIF) is used for treatment of rheumatoid arthritis, osteoarthritis etc. DIF-phospholipid complex (DIF-PL complex) was prepared by solvent-evaporation method and characterized by molecular docking studies, SEM, FTIR, DSC, PXRD studies. Further, the DIF-PL complex was incorporated into supramolecular nano-engineered lipidic carriers (SNLCs) for transdermal delivery. The optimization exercise was done using Face centered cubic design (FCCD) after screening of variables by L8 Taguchi orthogonal array design. The optimized SNLC formulation depicted average particle size (188.1nm), degree of entrapment (86.77±3.33%), permeation flux (5.47±0.48μg/cm 2 /h) and skin retention (17.72±0.68μg/cm 2 ). The dermatokinetic studies revealed the higher concentration of DIF in dermis. The Confocal laser scanning microscopy (CSLM) studies revealed penetration of SNLCs into the deeper layers of skin. The results of mice ear edema depicted significant inhibition of ear edema (76.37±12.52%; prheumatoid arthritis model, the inhibition of paw edema was significantly higher (73.85±14.5%). The levels of TNF-α were reduced in synovial fluid (146.74±1.69pg/mL) and serum (132.43±2.70pg/mL). Furthermore, the licking and biting time was reduced in formalin induced hyperalgesia model. Hence, it can be concluded that dual formulation strategy based SNLCs were promising in treatment of pain and inflammation associated with rheumatoid arthritis. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Efficient Coproduction of Mannanase and Cellulase by the Transformation of a Codon-Optimized Endomannanase Gene from Aspergillus niger into Trichoderma reesei.

    Sun, Xianhua; Xue, Xianli; Li, Mengzhu; Gao, Fei; Hao, Zhenzhen; Huang, Huoqing; Luo, Huiying; Qin, Lina; Yao, Bin; Su, Xiaoyun

    2017-12-20

    Cellulase and mannanase are both important enzyme additives in animal feeds. Expressing the two enzymes simultaneously within one microbial host could potentially lead to cost reductions in the feeding of animals. For this purpose, we codon-optimized the Aspergillus niger Man5A gene to the codon-usage bias of Trichoderma reesei. By comparing the free energies and the local structures of the nucleotide sequences, one optimized sequence was finally selected and transformed into the T. reesei pyridine-auxotrophic strain TU-6. The codon-optimized gene was expressed to a higher level than the original one. Further expressing the codon-optimized gene in a mutated T. reesei strain through fed-batch cultivation resulted in coproduction of cellulase and mannanase up to 1376 U·mL -1 and 1204 U·mL -1 , respectively.

  6. Determinism and randomness in the evolution of introns and sine inserts in mouse and human mitochondrial solute carrier and cytokine receptor genes.

    Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A

    2015-04-01

    In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Impact of gene patents and licensing practices on access to genetic testing and carrier screening for Tay-Sachs and Canavan disease.

    Colaianni, Alessandra; Chandrasekharan, Subhashini; Cook-Deegan, Robert

    2010-04-01

    Genetic testing for Tay-Sachs and Canavan disease is particularly important for Ashkenazi Jews, because both conditions are more frequent in that population. This comparative case study was possible because of different patenting and licensing practices. The role of DNA testing differs between Tay-Sachs and Canavan diseases. The first-line screening test for Tay-Sachs remains an enzyme activity test rather than genotyping. Genotyping is used for preimplantation diagnosis and confirmatory testing. In contrast, DNA-based testing is the basis for Canavan screening and diagnosis. The HEXA gene for Tay-Sachs was cloned at the National Institutes of Health, and the gene was patented but has not been licensed. The ASPA gene for Canavan disease was cloned and patented by Miami Children's Hospital. Miami Children's Hospital did not inform family members and patient groups that had contributed to the gene discovery that it was applying for a patent, and pursued restrictive licensing practices when a patent issued in 1997. This led to intense controversy, litigation, and a sealed, nonpublic 2003 settlement that apparently allowed for nonexclusive licensing. A survey of laboratories revealed a possible price premium for ASPA testing, with per-unit costs higher than for other genetic tests in the Secretary's Advisory Committee on Genetics, Health, and Society case studies. The main conclusion from comparing genetic testing for Tay-Sachs and Canavan diseases, however, is that patenting and licensing conducted without communication with patients and advocates cause mistrust and can lead to controversy and litigation, a negative model to contrast with the positive model of patenting and licensing for genetic testing of cystic fibrosis.

  8. Codon optimization of the HIV-1 vpu and vif genes stabilizes their mRNA and allows for highly efficient Rev-independent expression

    Nguyen, Kim-Lien; Llano, Manuel; Akari, Hirofumi; Miyagi, Eri; Poeschla, Eric M.; Strebel, Klaus; Bour, Stephan

    2004-01-01

    Two HIV-1 accessory proteins, Vpu and Vif, are notoriously difficult to express autonomously in the absence of the viral Tat and Rev proteins. We examined whether the codon bias observed in the vpu and vif genes relative to highly expressed human genes contributes to the Rev dependence and low expression level outside the context of the viral genome. The entire vpu gene as well as the 5' half of the vif gene were codon optimized and the resulting open reading frames (ORFs) (vphu and hvif, respectively) were cloned in autonomous expression vectors under the transcriptional control of the CMV promoter. Codon optimization efficiently removed the expression block observed in the native genes and allowed high levels of Rev- and Tat-independent expression of Vpu and Vif. Most of the higher protein levels detected are accounted for by enhanced steady-state levels of the mRNA encoding the optimized species. Nuclear run-on experiments show for the first time that codon optimization has no effect on the rate of transcriptional initiation or elongation of the vphu mRNA. Instead, optimization of the vpu gene was found to stabilize the vphu mRNA in the nucleus and enhance its export to the cytoplasm. This was achieved by allowing the optimized mRNA to use a new CRM1-independent nuclear export pathway. This work provides a better understanding of the molecular mechanisms underlying the process of codon optimization and introduces novel tools to study the biological functions of the Vpu and Vif proteins independently of other viral proteins

  9. Quantitative analysis of the dystrophin gene by real-time PCR

    Maksimovic Nela

    2012-01-01

    Full Text Available Duchenne and Becker muscular dystrophy (DMD/BMD are severe X-linked neuromuscular disorders caused by mutations in the dystrophin gene. Our aim was to optimize a quantitative real-time PCR method based on SYBR® Green I chemistry for routine diagnostics of DMD/BMD deletion carriers. Twenty female relatives of DMD/BMD patients with previously detected partial gene deletions were studied. The relative quantity of the target exons was calculated by a comparative threshold cycle method (ΔΔCt. The carrier status of all subjects was successfully determined. The gene dosage ratio for non-carriers was 1.07±0.20, and for carriers 0.56±0.11. This assay proved to be simple, rapid, reliable and cost-effective.

  10. Theoretical optimization of base doping concentration for radiation resistance of InGaP subcells of InGaP/GaAs/Ge based on minority-carrier lifetime

    Elfiky, Dalia; Yamaguchi, Masafumi; Sasaki, Takuo

    2010-01-01

    One of the fundamental objectives for research and development of space solar cells is to improve their radiation resistance. InGaP solar cells with low base carrier concentrations under low-energy proton irradiations have shown high radiation resistances. In this study, an analytical model for low-energy proton radiation damage to InGaP subcells based on a fundamental approach for radiative and nonradiative recombinations has been proposed. The radiation resistance of InGaP subcells as a function of base carrier concentration has been analyzed by using the radiative recombination lifetime and damage coefficient K for the minority-carrier lifetime of InGaP. Numerical analysis shows that an InGaP solar cell with a lower base carrier concentration is more radiation-resistant. Satisfactory agreements between analytical and experimental results have been obtained, and these results show the validity of the analytical procedure. The damage coefficients for minority-carrier diffusion length and carrier removal rate with low-energy proton irradiations have been observed to be dependent on carrier concentration through this study. As physical mechanisms behind the difference observed between the radiation-resistant properties of various base doping concentrations, two mechanisms, namely, the effect of a depletion layer as a carrier collection layer and generation of the impurity-related complex defects due to low-energy protons stopping within the active region, have been proposed. (author)

  11. Biocheese: A Food Probiotic Carrier

    Castro, J. M.; Tornadijo, M. E.; Fresno, J. M.; Sandoval, H.

    2015-01-01

    This review describes some aspects related to the technological barriers encountered in the development and stability of probiotic cheeses. Aspects concerning the viability of probiotic cultures in this matrix are discussed and the potential of cheese as a biofunctional food carrier is analyzed, outlying some points related to health and safety. In general, the manufacture of probiotic cheese should have little change when compared with the elaboration of cheese in the traditional way. The physicochemical and technological parameters influencing the quality of these products have also to be measured so as to obtain a process optimization. PMID:25802862

  12. Optimal consistency in microRNA expression analysis using reference-gene-based normalization.

    Wang, Xi; Gardiner, Erin J; Cairns, Murray J

    2015-05-01

    Normalization of high-throughput molecular expression profiles secures differential expression analysis between samples of different phenotypes or biological conditions, and facilitates comparison between experimental batches. While the same general principles apply to microRNA (miRNA) normalization, there is mounting evidence that global shifts in their expression patterns occur in specific circumstances, which pose a challenge for normalizing miRNA expression data. As an alternative to global normalization, which has the propensity to flatten large trends, normalization against constitutively expressed reference genes presents an advantage through their relative independence. Here we investigated the performance of reference-gene-based (RGB) normalization for differential miRNA expression analysis of microarray expression data, and compared the results with other normalization methods, including: quantile, variance stabilization, robust spline, simple scaling, rank invariant, and Loess regression. The comparative analyses were executed using miRNA expression in tissue samples derived from subjects with schizophrenia and non-psychiatric controls. We proposed a consistency criterion for evaluating methods by examining the overlapping of differentially expressed miRNAs detected using different partitions of the whole data. Based on this criterion, we found that RGB normalization generally outperformed global normalization methods. Thus we recommend the application of RGB normalization for miRNA expression data sets, and believe that this will yield a more consistent and useful readout of differentially expressed miRNAs, particularly in biological conditions characterized by large shifts in miRNA expression.

  13. Lysine-functionalized nanodiamonds as gene carriers: development of stable colloidal dispersion for in vitro cellular uptake studies and siRNA delivery application

    Alwani, Saniya; Kaur, Randeep; Michel, Deborah; Chitanda, Jackson M; Verrall, Ronald E; Karunakaran, Chithra; Badea, Ildiko

    2016-01-01

    Purpose Nanodiamonds (NDs) are emerging as an attractive tool for gene therapeutics. To reach their full potential for biological application, NDs should maintain their colloidal stability in biological milieu. This study describes the behavior of lysine-functionalized ND (lys-ND) in various dispersion media, with an aim to limit aggregation and improve the colloidal stability of ND-gene complexes called diamoplexes. Furthermore, cellular and macromolecular interactions of lys-NDs are also analyzed in vitro to establish the understanding of ND-mediated gene transfer in cells. Methods lys-NDs were synthesized earlier through covalent conjugation of lysine amino acid to carboxylated NDs surface generated through re-oxidation in strong oxidizing acids. In this study, dispersions of lys-NDs were prepared in various media, and the degree of sedimentation was monitored for 72 hours. Particle size distributions and zeta potential measurements were performed for a period of 25 days to characterize the physicochemical stability of lys-NDs in the medium. The interaction profile of lys-NDs with fetal bovine serum showed formation of a protein corona, which was evaluated by size and charge distribution measurements. Uptake of lys-NDs in cervical cancer cells was analyzed by scanning transmission X-ray microscopy, flow cytometry, and confocal microscopy. Cellular uptake of diamoplexes (complex of lys-NDs with small interfering RNA) was also analyzed using flow cytometry. Results Aqueous dispersion of lys-NDs showed minimum sedimentation and remained stable over a period of 25 days. Size distributions showed good stability, remaining under 100 nm throughout the testing period. A positive zeta potential of >+20 mV indicated a preservation of surface charges. Size distribution and zeta potential changed for lys-NDs after incubation with blood serum, suggesting an interaction with biomolecules, mainly proteins, and a possible formation of a protein corona. Cellular internalization

  14. Lysine-functionalized nanodiamonds as gene carriers: development of stable colloidal dispersion for in vitro cellular uptake studies and siRNA delivery application.

    Alwani, Saniya; Kaur, Randeep; Michel, Deborah; Chitanda, Jackson M; Verrall, Ronald E; Karunakaran, Chithra; Badea, Ildiko

    2016-01-01

    Nanodiamonds (NDs) are emerging as an attractive tool for gene therapeutics. To reach their full potential for biological application, NDs should maintain their colloidal stability in biological milieu. This study describes the behavior of lysine-functionalized ND (lys-ND) in various dispersion media, with an aim to limit aggregation and improve the colloidal stability of ND-gene complexes called diamoplexes. Furthermore, cellular and macromolecular interactions of lys-NDs are also analyzed in vitro to establish the understanding of ND-mediated gene transfer in cells. lys-NDs were synthesized earlier through covalent conjugation of lysine amino acid to carboxylated NDs surface generated through re-oxidation in strong oxidizing acids. In this study, dispersions of lys-NDs were prepared in various media, and the degree of sedimentation was monitored for 72 hours. Particle size distributions and zeta potential measurements were performed for a period of 25 days to characterize the physicochemical stability of lys-NDs in the medium. The interaction profile of lys-NDs with fetal bovine serum showed formation of a protein corona, which was evaluated by size and charge distribution measurements. Uptake of lys-NDs in cervical cancer cells was analyzed by scanning transmission X-ray microscopy, flow cytometry, and confocal microscopy. Cellular uptake of diamoplexes (complex of lys-NDs with small interfering RNA) was also analyzed using flow cytometry. Aqueous dispersion of lys-NDs showed minimum sedimentation and remained stable over a period of 25 days. Size distributions showed good stability, remaining under 100 nm throughout the testing period. A positive zeta potential of >+20 mV indicated a preservation of surface charges. Size distribution and zeta potential changed for lys-NDs after incubation with blood serum, suggesting an interaction with biomolecules, mainly proteins, and a possible formation of a protein corona. Cellular internalization of lys-NDs was confirmed

  15. Phenotypical features of two patients diagnosed with PHARC syndrome and carriers of a new homozygous mutation in the ABHD12 gene.

    Frasquet, Marina; Lupo, Vincenzo; Chumillas, María José; Vázquez-Costa, Juan Francisco; Espinós, Carmen; Sevilla, Teresa

    2018-04-15

    PHARC (Polyneuropathy, Hearing loss, Ataxia, Retinitis pigmentosa and Cataracts) (MIM# 612674) is an autosomal recessive neurodegenerative disease caused by mutations in the ABHD12 gene. We evaluated two Spanish siblings affected with pes cavus, sensorimotor neuropathy, hearing loss, retinitis pigmentosa and juvenile cataracts in whom the genetic test of ABHD12 revealed a novel homozygous frameshift mutation, c.211_223del (p.Arg71Tyrfs*26). The earliest clinical manifestation in these patients was a demyelinating neuropathy manifested with a Charcot-Marie-Tooth phenotype over three decades. Progressive hearing loss, cataracts and retinitis pigmentosa appeared after the age of 30. We herein describe the complete clinical picture of these two patients, and focus particularly on neuropathy characteristics. This study supports the fact that although PHARC is rare, its phenotype is very characteristic and we should include its study in patients affected with demyelinating polyneuropathy, hearing loss and retinopathy. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Peptide-Carrier Conjugation

    Hansen, Paul Robert

    2015-01-01

    To produce antibodies against synthetic peptides it is necessary to couple them to a protein carrier. This chapter provides a nonspecialist overview of peptide-carrier conjugation. Furthermore, a protocol for coupling cysteine-containing peptides to bovine serum albumin is outlined....

  17. Air Carrier Traffic Statistics.

    2013-11-01

    This report contains airline operating statistics for large certificated air carriers based on data reported to U.S. Department of Transportation (DOT) by carriers that hold a certificate issued under Section 401 of the Federal Aviation Act of 1958 a...

  18. Air Carrier Traffic Statistics.

    2012-07-01

    This report contains airline operating statistics for large certificated air carriers based on data reported to U.S. Department of Transportation (DOT) by carriers that hold a certificate issued under Section 401 of the Federal Aviation Act of 1958 a...

  19. Parallel approach on sorting of genes in search of optimal solution.

    Kumar, Pranav; Sahoo, G

    2018-05-01

    An important tool for comparing genome analysis is the rearrangement event that can transform one given genome into other. For finding minimum sequence of fission and fusion, we have proposed here an algorithm and have shown a transformation example for converting the source genome into the target genome. The proposed algorithm comprises of circular sequence i.e. "cycle graph" in place of mapping. The main concept of algorithm is based on optimal result of permutation. These sorting processes are performed in constant running time by showing permutation in the form of cycle. In biological instances it has been observed that transposition occurs half of the frequency as that of reversal. In this paper we are not dealing with reversal instead commencing with the rearrangement of fission, fusion as well as transposition. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Optimizing hyaluronidase dose and plasmid DNA delivery greatly improves gene electrotransfer efficiency in rat skeletal muscle

    Åkerström, Thorbjörn; Vedel, Kenneth; Needham Andersen, Josefine

    2015-01-01

    Transfection of rat skeletal muscle in vivo is a widely used research model. However, gene electrotransfer protocols have been developed for mice and yield variable results in rats. We investigated whether changes in hyaluronidase pre-treatment and plasmid DNA delivery can improve transfection...... with a homogenous distribution. We also show that transfection was stable over five weeks of regular exercise or inactivity. Our findings show that species-specific plasmid DNA delivery and hyaluronidase pre-treatment greatly improves transfection efficiency in rat skeletal muscle....... efficiency in rat skeletal muscle. We found that pre-treating the muscle with a hyaluronidase dose suitable for rats (0.56. U/g b.w.) prior to plasmid DNA injection increased transfection efficiency by >200% whereas timing of the pre-treatment did not affect efficiency. Uniformly distributing plasmid DNA...

  1. Tumor mismatch repair immunohistochemistry and DNA MLH1 methylation testing of patients with endometrial cancer diagnosed at age younger than 60 years optimizes triage for population-level germline mismatch repair gene mutation testing.

    Buchanan, Daniel D; Tan, Yen Y; Walsh, Michael D; Clendenning, Mark; Metcalf, Alexander M; Ferguson, Kaltin; Arnold, Sven T; Thompson, Bryony A; Lose, Felicity A; Parsons, Michael T; Walters, Rhiannon J; Pearson, Sally-Ann; Cummings, Margaret; Oehler, Martin K; Blomfield, Penelope B; Quinn, Michael A; Kirk, Judy A; Stewart, Colin J; Obermair, Andreas; Young, Joanne P; Webb, Penelope M; Spurdle, Amanda B

    2014-01-10

    Clinicopathologic data from a population-based endometrial cancer cohort, unselected for age or family history, were analyzed to determine the optimal scheme for identification of patients with germline mismatch repair (MMR) gene mutations. Endometrial cancers from 702 patients recruited into the Australian National Endometrial Cancer Study (ANECS) were tested for MMR protein expression using immunohistochemistry (IHC) and for MLH1 gene promoter methylation in MLH1-deficient cases. MMR mutation testing was performed on germline DNA of patients with MMR-protein deficient tumors. Prediction of germline mutation status was compared for combinations of tumor characteristics, age at diagnosis, and various clinical criteria (Amsterdam, Bethesda, Society of Gynecologic Oncology, ANECS). Tumor MMR-protein deficiency was detected in 170 (24%) of 702 cases. Germline testing of 158 MMR-deficient cases identified 22 truncating mutations (3% of all cases) and four unclassified variants. Tumor MLH1 methylation was detected in 99 (89%) of 111 cases demonstrating MLH1/PMS2 IHC loss; all were germline MLH1 mutation negative. A combination of MMR IHC plus MLH1 methylation testing in women younger than 60 years of age at diagnosis provided the highest positive predictive value for the identification of mutation carriers at 46% versus ≤ 41% for any other criteria considered. Population-level identification of patients with MMR mutation-positive endometrial cancer is optimized by stepwise testing for tumor MMR IHC loss in patients younger than 60 years, tumor MLH1 methylation in individuals with MLH1 IHC loss, and germline mutations in patients exhibiting loss of MSH6, MSH2, or PMS2 or loss of MLH1/PMS2 with absence of MLH1 methylation.

  2. Insight into carrier lifetime impact on band-modulation devices

    Parihar, Mukta Singh; Lee, Kyung Hwa; Park, Hyung Jin; Lacord, Joris; Martinie, Sébastien; Barbé, Jean-Charles; Xu, Yue; El Dirani, Hassan; Taur, Yuan; Cristoloveanu, Sorin; Bawedin, Maryline

    2018-05-01

    A systematic study to model and characterize the band-modulation Z2-FET device is developed bringing light to the relevance of the carrier lifetime influence. This work provides guidelines to optimize the Z2-FETs for sharp switching, ESD protection, and 1T-DRAM applications. Lower carrier lifetime in the Z2-FET helps in attaining the sharp switch. We provide new insights into the correlation between generation/recombination, diffusion, electrostatic barriers and carrier lifetime.

  3. Lysine-functionalized nanodiamonds as gene carriers: development of stable colloidal dispersion for in vitro cellular uptake studies and siRNA delivery application

    Alwani S

    2016-02-01

    Full Text Available Saniya Alwani,1 Randeep Kaur,1 Deborah Michel,1 Jackson M Chitanda,2 Ronald E Verrall,3 Chithra Karunakaran,4 Ildiko Badea1 1Drug Design and Discovery Research Group, College of Pharmacy and Nutrition, 2Department of Chemical & Biological Engineering, 3Department of Chemistry, University of Saskatchewan, 4Canadian Light Source, Saskatoon, SK, Canada Purpose: Nanodiamonds (NDs are emerging as an attractive tool for gene therapeutics. To reach their full potential for biological application, NDs should maintain their colloidal stability in biological milieu. This study describes the behavior of lysine-functionalized ND (lys-ND in various dispersion media, with an aim to limit aggregation and improve the colloidal stability of ND-gene complexes called diamoplexes. Furthermore, cellular and macromolecular interactions of lys-NDs are also analyzed in vitro to establish the understanding of ND-mediated gene transfer in cells. Methods: lys-NDs were synthesized earlier through covalent conjugation of lysine amino acid to carboxylated NDs surface generated through re-oxidation in strong oxidizing acids. In this study, dispersions of lys-NDs were prepared in various media, and the degree of sedimentation was monitored for 72 hours. Particle size distributions and zeta potential measurements were performed for a period of 25 days to characterize the physicochemical stability of lys-NDs in the medium. The interaction profile of lys-NDs with fetal bovine serum showed formation of a protein corona, which was evaluated by size and charge distribution measurements. Uptake of lys-NDs in cervical cancer cells was analyzed by scanning transmission X-ray microscopy, flow cytometry, and confocal microscopy. Cellular uptake of diamoplexes (complex of lys-NDs with small interfering RNA was also analyzed using flow cytometry. Results: Aqueous dispersion of lys-NDs showed minimum sedimentation and remained stable over a period of 25 days. Size distributions showed

  4. Optimizing the performance of streaming numerical kernels on the IBM Blue Gene/P PowerPC 450 processor

    Malas, Tareq Majed Yasin

    2012-05-21

    Several emerging petascale architectures use energy-efficient processors with vectorized computational units and in-order thread processing. On these architectures the sustained performance of streaming numerical kernels, ubiquitous in the solution of partial differential equations, represents a challenge despite the regularity of memory access. Sophisticated optimization techniques are required to fully utilize the CPU. We propose a new method for constructing streaming numerical kernels using a high-level assembly synthesis and optimization framework. We describe an implementation of this method in Python targeting the IBM® Blue Gene®/P supercomputer\\'s PowerPC® 450 core. This paper details the high-level design, construction, simulation, verification, and analysis of these kernels utilizing a subset of the CPU\\'s instruction set. We demonstrate the effectiveness of our approach by implementing several three-dimensional stencil kernels over a variety of cached memory scenarios and analyzing the mechanically scheduled variants, including a 27-point stencil achieving a 1.7× speedup over the best previously published results. © The Author(s) 2012.

  5. The novel albumin-chitosan core-shell nanoparticles for gene delivery: preparation, optimization and cell uptake investigation

    Karimi, Mahdi [Tarbiat Modares University, Department of Nanobiotechnology, Faculty of Biological Sciences (Iran, Islamic Republic of); Avci, Pinar [Massachusetts General Hospital, Wellman Center for Photomedicine (United States); Mobasseri, Rezvan [Tarbiat Modares University, Department of Nanobiotechnology, Faculty of Biological Sciences (Iran, Islamic Republic of); Hamblin, Michael R. [Massachusetts General Hospital, Wellman Center for Photomedicine (United States); Naderi-Manesh, Hossein, E-mail: naderman@modares.ac.ir [Tarbiat Modares University, Department of Nanobiotechnology, Faculty of Biological Sciences (Iran, Islamic Republic of)

    2013-05-15

    Natural polymers and proteins such as chitosan (CS) and albumin (Alb) have recently attracted much attention both in drug delivery and gene delivery. The underlying rationale is their unique properties such as biodegradability, biocompatibility and controlled release. This study aimed to prepare novel albumin-chitosan-DNA (Alb-CS-DNA) core-shell nanoparticles as a plasmid delivery system and find the best conditions for their preparation. Phase separation method and ionic interaction were used for preparation of Alb nanoparticles and Alb-CS-DNA core-shell nanoparticles, respectively. The effects of three important independent variables (1) CS/Alb mass ratio, (2) the ratios of moles of the amine groups of cationic polymers to those of the phosphate groups of DNA (N/P ratio), and (3) Alb concentration, on the nanoparticle size and loading efficiency of the plasmid were investigated and optimized through Box-Behnken design of response surface methodology (RSM). The optimum conditions were found to be CS/Alb mass ratio = 3, N/P ratio = 8.24 and Alb concentration = 0.1 mg/mL. The most critical factors for the size of nanoparticles and loading efficiency were Alb concentration and N/P ratio. The optimized nanoparticles had an average size of 176 {+-} 3.4 nm and loading efficiency of 80 {+-} 3.9 %. Cytotoxicity experiments demonstrated that the prepared nanoparticles were not toxic. The high cellular uptake of nanoparticles ({approx}85 %) was shown by flow cytometry and fluorescent microscopy.

  6. Synthesis and optimization of cholesterol-based diquaternary ammonium Gemini Surfactant (Chol-GS) as a new gene delivery vector.

    Kim, Bieong-Kil; Doh, Kyung-Oh; Bae, Yun-Ui; Seu, Young-Bae

    2011-01-01

    Amongst a number of potential nonviral vectors, cationic liposomes have been actively researched, with both gemini surfactants and bola amphiphiles reported as being in possession of good structures in terms of cell viability and in vitro transfection. In this study, a cholesterol-based diquaternary ammonium gemini surfactant (Chol-GS) was synthesized and assessed as a novel nonviral gene vector. Chol-GS was synthesized from cholesterol by way of four reaction steps. The optimal efficiency was found to be at a weight ratio of 1:4 of lipid:DOPE (1,2-dioleoyl-L-alpha- glycero-3-phosphatidylethanolamine), and at a ratio of between 10:1~15:1 of liposome:DNA. The transfection efficiency was compared with commercial liposomes and with Lipofectamine, 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE-C), and N-[1-(2,3-dioleoyloxy)propyl]- N,N,N-trimethylammonium chloride (DOTAP). The results indicate that the efficiency of Chol-GS is greater than that of all the tested commercial liposomes in COS7 and Huh7 cells, and higher than DOTAP and Lipofectamine in A549 cells. Confirmation of these findings was observed through the use of green fluorescent protein expression. Chol-GS exhibited a moderate level of cytotoxicity, at optimum concentrations for efficient transfection, indicating cell viability. Hence, the newly synthesized Chol-GS liposome has the potential of being an excellent nonviral vector for gene delivery.

  7. Optimization of a nonviral transfection system to evaluate Cox-2 controlled interleukin-4 expression for osteoarthritis gene therapy in vitro.

    Lang, Annemarie; Neuhaus, Johannes; Pfeiffenberger, Moritz; Schröder, Erik; Ponomarev, Igor; Weber, Yvonne; Gaber, Timo; Schmidt, Michael F G

    2014-01-01

    Gene therapy appears to have the potential for achieving a long-term remedy for osteoarthritis (OA). However, there is a risk of adverse reactions, especially when using cytomegalovirus-controlled expression. To provide a safe application, we focused on the expression of therapeutic cytokines [e.g. interleukin (IL)-4] in a disease-responsive manner by use of the previously cloned Cox-2 promoter as 'genetic switch'. In the present study, we report the functionality of a controlled gene therapeutic system in an equine osteoarthritic cell model. Different nonviral transfection reagents were tested for their efficiency on equine chondrocytes stimulated with equine IL-1β or lipopolysaccharide to create an inflammatory environment. To optimize the transfection, we successfully redesigned the vector by excluding the internal ribosomal entry site (IRES). The functionality of our Cox-2 promoter construct with respect to expressing IL-4 was proven at the mRNA and protein levels and the anti-inflammatory potential of IL-4 was confirmed by analyzing the expression of IL-1β, IL-6, IL-8, matrix metalloproteinase (MMP)-1, MMP-3 and tumor necrosis factor (TNF)-α using a quantitative polymerase chain reaction. Nonviral transfection reagents yielded transfection rates from 21% to 44% with control vectors with and without IRES, respectively. Stimulation of equine chondrocytes resulted in a 20-fold increase of mRNA expression of IL-1β. Such exogenous stimulation of chondrocytes transfected with pNCox2-IL4 led to an increase of IL-4 mRNA expression, whereas expression of inflammatory mediators decreased. The timely link between these events confirms the anti-inflammatory potential of synthesized IL-4. We consider that this approach has significant potential for translation into a useful anti-inflammation therapy. Molecular tools such as the described therapeutic plasmid pave the way for a local-controlled, self-limiting gene therapy. Copyright © 2014 John Wiley & Sons, Ltd.

  8. Drug transporter gene expression in human colorectal tissue and cell lines: modulation with antiretrovirals for microbicide optimization.

    Mukhopadhya, Indrani; Murray, Graeme I; Berry, Susan; Thomson, John; Frank, Bruce; Gwozdz, Garry; Ekeruche-Makinde, Julia; Shattock, Robin; Kelly, Charles; Iannelli, Francesco; Pozzi, Gianni; El-Omar, Emad M; Hold, Georgina L; Hijazi, Karolin

    2016-02-01

    The objectives of this study were to comprehensively assess mRNA expression of 84 drug transporters in human colorectal biopsies and six representative cell lines, and to investigate the alteration of drug transporter gene expression after exposure to three candidate microbicidal antiretroviral (ARV) drugs (tenofovir, darunavir and dapivirine) in the colorectal epithelium. The outcome of the objectives informs development of optimal ARV-based microbicidal formulations for prevention of HIV-1 infection. Drug transporter mRNA expression was quantified from colorectal biopsies and cell lines by quantitative real-time PCR. Relative mRNA expression was quantified in Caco-2 cells and colorectal explants after induction with ARVs. Data were analysed using Pearson's product moment correlation (r), hierarchical clustering and principal component analysis (PCA). Expression of 58 of the 84 transporters was documented in colorectal biopsies, with genes for CNT2, P-glycoprotein (P-gp) and MRP3 showing the highest expression. No difference was noted between individual subjects when analysed by age, gender or anatomical site (rectum or recto-sigmoid) (r = 0.95-0.99). High expression of P-gp and CNT2 proteins was confirmed by immunohistochemical staining. Similarity between colorectal tissue and cell-line drug transporter gene expression was variable (r = 0.64-0.84). PCA showed distinct clustering of human colorectal biopsy samples, with the Caco-2 cells defined as the best surrogate system. Induction of Caco-2 cell lines with ARV drugs suggests that darunavir-based microbicides incorporating tenofovir may result in drug-drug interactions likely to affect distribution of individual drugs to sub-epithelial target cells. These findings will help optimize complex formulations of rectal microbicides to realize their full potential as an effective approach for pre-exposure prophylaxis against HIV-1 infection. © The Author 2015. Published by Oxford University Press on behalf of the

  9. Enhancing potency of siRNA targeting fusion genes by optimization outside of target sequence.

    Gavrilov, Kseniya; Seo, Young-Eun; Tietjen, Gregory T; Cui, Jiajia; Cheng, Christopher J; Saltzman, W Mark

    2015-12-01

    Canonical siRNA design algorithms have become remarkably effective at predicting favorable binding regions within a target mRNA, but in some cases (e.g., a fusion junction site) region choice is restricted. In these instances, alternative approaches are necessary to obtain a highly potent silencing molecule. Here we focus on strategies for rational optimization of two siRNAs that target the junction sites of fusion oncogenes BCR-ABL and TMPRSS2-ERG. We demonstrate that modifying the termini of these siRNAs with a terminal G-U wobble pair or a carefully selected pair of terminal asymmetry-enhancing mismatches can result in an increase in potency at low doses. Importantly, we observed that improvements in silencing at the mRNA level do not necessarily translate to reductions in protein level and/or cell death. Decline in protein level is also heavily influenced by targeted protein half-life, and delivery vehicle toxicity can confound measures of cell death due to silencing. Therefore, for BCR-ABL, which has a long protein half-life that is difficult to overcome using siRNA, we also developed a nontoxic transfection vector: poly(lactic-coglycolic acid) nanoparticles that release siRNA over many days. We show that this system can achieve effective killing of leukemic cells. These findings provide insights into the implications of siRNA sequence for potency and suggest strategies for the design of more effective therapeutic siRNA molecules. Furthermore, this work points to the importance of integrating studies of siRNA design and delivery, while heeding and addressing potential limitations such as restricted targetable mRNA regions, long protein half-lives, and nonspecific toxicities.

  10. Gene

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  11. Poly[N-(2-aminoethyl)ethyleneimine] as a New Non-Viral Gene Delivery Carrier : The Effect of Two Protonatable Nitrogens in the Monomer Unit on Gene Delivery Efficiency

    Khazaie, Yahya; Novo, Luis; van Gaal, Ethlinn; Fassihi, Afshin; Mirahmadi-Zareh, Seyedeh Zohreh; Esfahani, Mohammad Hossein Nasr; van Nostrum, Cornelus F.; Hennink, Wim E.; Dorkoosh, Farid

    2014-01-01

    Purpose. The aim of this study was to investigate the in vitro gene delivery efficiency of poly[N-(2-aminoethyl)ethylene-imine](PAEEI), a polymer with a linear Polyethyleneimine (LPEI) backbone and with aminoethyl side groups that has two protonatable nitrogen atoms per monomer unit instead of one

  12. Have we found an optimal insertion site in a Newcastle disease virus vector to express a foreign gene for vaccine and gene therapy purposes?

    Using reverse genetics technology, many strains of Newcastle disease virus (NDV) have been developed as vectors to express foreign genes for vaccine and gene therapy purposes. The foreign gene is usually inserted into a non-coding region of the NDV genome as an independent transcription unit. Eval...

  13. Optimizing The Performance of Streaming Numerical Kernels On The IBM Blue Gene/P PowerPC 450

    Malas, Tareq

    2011-07-01

    Several emerging petascale architectures use energy-efficient processors with vectorized computational units and in-order thread processing. On these architectures the sustained performance of streaming numerical kernels, ubiquitous in the solution of partial differential equations, represents a formidable challenge despite the regularity of memory access. Sophisticated optimization techniques beyond the capabilities of modern compilers are required to fully utilize the Central Processing Unit (CPU). The aim of the work presented here is to improve the performance of streaming numerical kernels on high performance architectures by developing efficient algorithms to utilize the vectorized floating point units. The importance of the development time demands the creation of tools to enable simple yet direct development in assembly to utilize the power-efficient cores featuring in-order execution and multiple-issue units. We implement several stencil kernels for a variety of cached memory scenarios using our Python instruction simulation and generation tool. Our technique simplifies the development of efficient assembly code for the IBM Blue Gene/P supercomputer\\'s PowerPC 450. This enables us to perform high-level design, construction, verification, and simulation on a subset of the CPU\\'s instruction set. Our framework has the capability to implement streaming numerical kernels on current and future high performance architectures. Finally, we present several automatically generated implementations, including a 27-point stencil achieving a 1.7x speedup over the best previously published results.

  14. Identification of SNP barcode biomarkers for genes associated with facial emotion perception using particle swarm optimization algorithm.

    Chuang, Li-Yeh; Lane, Hsien-Yuan; Lin, Yu-Da; Lin, Ming-Teng; Yang, Cheng-Hong; Chang, Hsueh-Wei

    2014-01-01

    Facial emotion perception (FEP) can affect social function. We previously reported that parts of five tested single-nucleotide polymorphisms (SNPs) in the MET and AKT1 genes may individually affect FEP performance. However, the effects of SNP-SNP interactions on FEP performance remain unclear. This study compared patients with high and low FEP performances (n = 89 and 93, respectively). A particle swarm optimization (PSO) algorithm was used to identify the best SNP barcodes (i.e., the SNP combinations and genotypes that revealed the largest differences between the high and low FEP groups). The analyses of individual SNPs showed no significant differences between the high and low FEP groups. However, comparisons of multiple SNP-SNP interactions involving different combinations of two to five SNPs showed that the best PSO-generated SNP barcodes were significantly associated with high FEP score. The analyses of the joint effects of the best SNP barcodes for two to five interacting SNPs also showed that the best SNP barcodes had significantly higher odds ratios (2.119 to 3.138; P < 0.05) compared to other SNP barcodes. In conclusion, the proposed PSO algorithm effectively identifies the best SNP barcodes that have the strongest associations with FEP performance. This study also proposes a computational methodology for analyzing complex SNP-SNP interactions in social cognition domains such as recognition of facial emotion.

  15. Transcript profiling of common bean (Phaseolus vulgaris L. using the GeneChip® Soybean Genome Array: optimizing analysis by masking biased probes

    Gronwald John W

    2010-05-01

    Full Text Available Abstract Background Common bean (Phaseolus vulgaris L. and soybean (Glycine max both belong to the Phaseoleae tribe and share significant coding sequence homology. This suggests that the GeneChip® Soybean Genome Array (soybean GeneChip may be used for gene expression studies using common bean. Results To evaluate the utility of the soybean GeneChip for transcript profiling of common bean, we hybridized cRNAs purified from nodule, leaf, and root of common bean and soybean in triplicate to the soybean GeneChip. Initial data analysis showed a decreased sensitivity and accuracy of measuring differential gene expression in common bean cross-species hybridization (CSH GeneChip data compared to that of soybean. We employed a method that masked putative probes targeting inter-species variable (ISV regions between common bean and soybean. A masking signal intensity threshold was selected that optimized both sensitivity and accuracy of measuring differential gene expression. After masking for ISV regions, the number of differentially-expressed genes identified in common bean was increased by 2.8-fold reflecting increased sensitivity. Quantitative RT-PCR (qRT-PCR analysis of 20 randomly selected genes and purine-ureide pathway genes demonstrated an increased accuracy of measuring differential gene expression after masking for ISV regions. We also evaluated masked probe frequency per probe set to gain insight into the sequence divergence pattern between common bean and soybean. The sequence divergence pattern analysis suggested that the genes for basic cellular functions and metabolism were highly conserved between soybean and common bean. Additionally, our results show that some classes of genes, particularly those associated with environmental adaptation, are highly divergent. Conclusions The soybean GeneChip is a suitable cross-species platform for transcript profiling in common bean when used in combination with the masking protocol described. In

  16. Duchenne muscular dystrophy carriers

    Matsumura, K.; Nakano, I.

    1989-01-01

    By means of magnetic resonance imaging (MRI), the proton spin-lattice relaxation times (T1 values) of the skeletal muscles were measured in Duchenne muscular dystrophy (DMD) carriers and normal controls. The bound water fraction (BWF) was calculated from the T1 values obtained, according to the fast proton diffusion model. In the DMD carriers, T1 values of the gluteus maximus and quadriceps femoris muscles were significantly higher, and BWFs of these muscles were significantly lower than in normal control. Degenerative muscular changes accompanied by interstitial edema were presumed responsible for this abnormality. No correlation was observed between the muscle T1 and serum creatine kinase values. The present study showed that MRI could be a useful method for studying the dynamic state of water in both normal and pathological skeletal muscles. Its possible utility for DMD carrier detection was discussed briefly. (orig.)

  17. Gene delivery using calcium phosphate nanoparticles: Optimization of the transfection process and the effects of citrate and poly(l-lysine) as additives.

    Khan, Mohammed A; Wu, Victoria M; Ghosh, Shreya; Uskoković, Vuk

    2016-06-01

    Despite the long history of nanoparticulate calcium phosphate (CaP) as a non-viral transfection agent, there has been limited success in attempts to optimize its properties for transfection comparable in efficiency to that of viral vectors. Here we focus on the optimization of: (a) CaP nanoparticle precipitation conditions, predominantly supersaturation and Ca/P molar ratios; (b) transfection conditions, mainly the concentrations of the carrier and plasmid DNA; (c) the presence of surface additives, including citrate anion and cationic poly(l-lysine) (PLL). CaP nanoparticles significantly improved transfection with plasmid DNA encoding enhanced green fluorescent protein (eGFP) in pre-osteoblastic MC3T3-E1 cells compared to a commercial non-viral carrier. At the same time they elicited significantly lesser cytotoxicity than the commercial carrier. Plasmid DNA acted as a nucleation promoter, decreasing the nucleation lag time of metastable CaP solutions and leading to a higher rate of nucleation and a lower size of the precipitated particles. The degree of supersaturation (DS) of 15 was found to be more optimal for transfection than that of 12.5 or 17.5 and higher. Because CaP particles precipitated at DS 15 were spherical, while DS 17.5 and 21 yielded acicular particles, it was concluded that spherical particle morphologies were more conducive to transfection than the anisotropic ones. Even though the yield at DS 15 was 10 and 100 times lower than that at DS 17.5 and 21, respectively, transfection rates were higher using CaP nanoparticle colloids prepared at DS 15 than using those made at higher or lower DS, indicating that the right particle morphology can outweigh the difference in the amount of the carrier, even when this difference is close to 100×. In contrast to the commercial carrier, the concentration of CaP-pDNA delivered to the cells was directly proportional to the transfection rate. Osteosarcoma K7M2 cells were four times more easily transfectable with

  18. Asymmetric Carrier Random PWM

    Mathe, Laszlo; Lungeanu, Florin; Rasmussen, Peter Omand

    2010-01-01

    index. The flat motor current spectrum generates an acoustical noise close to the white noise, which may improve the acoustical performance of the drive. The new carrier wave is easy to implement digitally, without employing any external circuits. The modulation method can be used in open, as well...

  19. Willis H Carrier

    Home; Journals; Resonance – Journal of Science Education; Volume 17; Issue 2. Willis H. Carrier - Father of Air Conditioning. R V Simha. General Article Volume 17 Issue 2 February 2012 pp 117-138. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/017/02/0117-0138 ...

  20. Otimização de metodologia para o estudo de genes KIR Methodology optimization for KIR genotyping

    Cristiane Conceição Chagas Rudnick

    2010-06-01

    Full Text Available Receptores killer cell immunoglobulin-like (KIRs são moléculas localizadas na superfície de células natural killer (NK e em subpopulações de linfócitos T codificadas por genes do cromossomo 19q13.4. A interação entre receptores KIR e moléculas antígeno leucocitário humano (HLA de classe I determina se células NK exercerão ou não sua função citotóxica e/ou secretora de citocinas ou se esta será inibida. Este trabalho teve por finalidade otimizar a metodologia para a genotipagem KIR, baseando-se nas condições descritas por Martin (2004. A técnica utilizada foi a reação em cadeia da polimerase com primers de sequência específica (PCR-SSP com iniciadores sintetizados pela Invitrogen® e visualização do produto amplificado em gel de agarose a 2% com brometo de etídio. Adaptações foram realizadas e a concentração de alguns reagentes foi alterada, como a do controle interno de 100 nM para 150 nM, iniciadores específicos senso e antissenso de KIR12.5/12.3, KIR13.5/13.3, KIR14.5/14.3, KIR22.5/22.3 e KIR36.5/36.3 de 500 nM para 750 nM e da solução de MgCl2 de 1,5 mM para 2 mM. As concentrações dos demais reagentes e temperaturas de amplificação foram mantidas. Nessas condições, o uso da Taq DNA polimerase recombinante (Invitrogen® foi satisfatório. Os resultados das genotipagens de 70 indivíduos foram confirmados por rSSO-Luminex® (One Lambda, Canoga Park, CA, EUA. A tipagem de genes KIR por essa técnica apresentou sensibilidade, especificidade, reprodutibilidade e baixo custo.The killer cell immunoglobulin-like receptors (KIRs are molecules expressed on natural killer (NK cells surface and in T-cell subsets encoded by genes located in chromosome 19q13.4. The interaction between KIR receptors and HLA class I molecules determines if the NK cells will fulfill their cytotoxic function and/or cytokine secretion or if this function will be inhibited. The objective of this work was to optimize KIR genotyping method

  1. Sealed substrate carrier for electroplating

    Ganti, Kalyana Bhargava [Fremont, CA

    2012-07-17

    One embodiment relates to a substrate carrier for use in electroplating a plurality of substrates. The substrate carrier includes a non-conductive carrier body on which the substrates are held, and conductive lines are embedded within the carrier body. A conductive bus bar is embedded into a top side of the carrier body and is conductively coupled to the conductive lines. A thermoplastic overmold covers a portion of the bus bar, and there is a plastic-to-plastic bond between the thermoplastic overmold and the non-conductive carrier body. Other embodiments, aspects and features are also disclosed.

  2. Expression stability and selection of optimal reference genes for gene expression normalization in early life stage rainbow trout exposed to cadmium and copper.

    Shekh, Kamran; Tang, Song; Niyogi, Som; Hecker, Markus

    2017-09-01

    Gene expression analysis represents a powerful approach to characterize the specific mechanisms by which contaminants interact with organisms. One of the key considerations when conducting gene expression analyses using quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is the selection of appropriate reference genes, which is often overlooked. Specifically, to reach meaningful conclusions when using relative quantification approaches, expression levels of reference genes must be highly stable and cannot vary as a function of experimental conditions. However, to date, information on the stability of commonly used reference genes across developmental stages, tissues and after exposure to contaminants such as metals is lacking for many vertebrate species including teleost fish. Therefore, in this study, we assessed the stability of expression of 8 reference gene candidates in the gills and skin of three different early life-stages of rainbow trout after acute exposure (24h) to two metals, cadmium (Cd) and copper (Cu) using qPCR. Candidate housekeeping genes were: beta actin (b-actin), DNA directed RNA polymerase II subunit I (DRP2), elongation factor-1 alpha (EF1a), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), glucose-6-phosphate dehydrogenase (G6PD), hypoxanthine phosphoribosyltransferase (HPRT), ribosomal protein L8 (RPL8), and 18S ribosomal RNA (18S). Four algorithms, geNorm, NormFinder, BestKeeper, and the comparative ΔCt method were employed to systematically evaluate the expression stability of these candidate genes under control and exposed conditions as well as across three different life-stages. Finally, stability of genes was ranked by taking geometric means of the ranks established by the different methods. Stability of reference genes was ranked in the following order (from lower to higher stability): HPRT

  3. Minimal doses of a sequence-optimized transgene mediate high-level and long-term EPO expression in vivo: challenging CpG-free gene design.

    Kosovac, D; Wild, J; Ludwig, C; Meissner, S; Bauer, A P; Wagner, R

    2011-02-01

    Advanced gene delivery techniques can be combined with rational gene design to further improve the efficiency of plasmid DNA (pDNA)-mediated transgene expression in vivo. Herein, we analyzed the influence of intragenic sequence modifications on transgene expression in vitro and in vivo using murine erythropoietin (mEPO) as a transgene model. A single electro-gene transfer of an RNA- and codon-optimized mEPOopt gene into skeletal muscle resulted in a 3- to 4-fold increase of mEPO production sustained for >1 year and triggered a significant increase in hematocrit and hemoglobin without causing adverse effects. mEPO expression and hematologic levels were significantly lower when using comparable amounts of the wild type (mEPOwt) gene and only marginal effects were induced by mEPOΔCpG lacking intragenic CpG dinucleotides, even at high pDNA amounts. Corresponding with these observations, in vitro analysis of transfected cells revealed a 2- to 3-fold increased (mEPOopt) and 50% decreased (mEPOΔCpG) erythropoietin expression compared with mEPOwt, respectively. RNA analyses demonstrated that the specific design of the transgene sequence influenced expression levels by modulating transcriptional activity and nuclear plus cytoplasmic RNA amounts rather than translation. In sum, whereas CpG depletion negatively interferes with efficient expression in postmitotic tissues, mEPOopt doses <0.5 μg were sufficient to trigger optimal long-term hematologic effects encouraging the use of sequence-optimized transgenes to further reduce effective pDNA amounts.

  4. Tay-Sachs Carrier Screening by Enzyme and Molecular Analyses in the New York City Minority Population.

    Mehta, Nikita; Lazarin, Gabriel A; Spiegel, Erica; Berentsen, Kathleen; Brennan, Kelly; Giordano, Jessica; Haque, Imran S; Wapner, Ronald

    2016-09-01

    Carrier screening for Tay-Sachs disease is performed by sequence analysis of the HEXA gene and/or hexosaminidase A enzymatic activity testing. Enzymatic analysis (EA) has been suggested as the optimal carrier screening method, especially in non-Ashkenazi Jewish (non-AJ) individuals, but its utilization and efficacy have not been fully evaluated in the general population. This study assesses the reliability of EA in comparison with HEXA sequence analysis in non-AJ populations. Five hundred eight Hispanic and African American patients (516 samples) had EA of their leukocytes performed and 12 of these patients who tested positive by EA ("carriers") had subsequent HEXA gene sequencing performed. Of the 508 patients, 25 (4.9%) were EA positive and 40 (7.9%) were inconclusive. Of the 12 patients who were sequenced, 11 did not carry a pathogenic variant and one carried a likely deleterious mutation (NM_000520.4(HEXA):c.1510C>T). High inconclusive rates and poor correlation between positive/inconclusive enzyme results and identification of pathogenic mutations suggest that ethnic-specific recalibration of reference ranges for EA may be necessary. Alternatively, HEXA gene sequencing could be performed.

  5. Motor carrier evaluation program

    Portsmouth, James

    1992-01-01

    The U.S. Department of Energy-Headquarters (DOE-HQ), Transportation Management Program (TMP) has the overall responsibility to provide a well-managed transportation program for the safe, efficient, and economical transportation of DOE-owned materials. The DOE-TMP has established an excellent safety record in the transportation of hazardous materials including radioactive materials and radioactive wastes. This safety record can be maintained only through continued diligence and sustained effort on the part of the DOE-TMP, its field offices, and the contractors' organizations. Key elements in the DOE'S effective hazardous and radioactive materials shipping program are (1) integrity of packages, (2) strict adherence to regulations and procedures, (3) trained personnel, (4) complete management support, and (5) use of the best commercial carriers. The DOE Motor Carrier Evaluation Program was developed to better define the criteria and methodology needed to identify motor carriers for use in the transportation of Highway Route Controlled Quantities (HRCQ), Truck Load (TL) quantities of radioactive materials, hazardous materials and waste. (author)

  6. Carrier transport uphill. I. General

    Rosenberg, T; Wilbrandt, W

    1963-01-01

    A quantitative treatment of a carrier pump operating with two carrier forms C and Z is presented. Asymmetric metabolic reactions are assumed to transform Z into C on one and C into Z on the other side of the membrane, establishing a carrier cycle. The kinetical consequences of this mechanism...

  7. Maintainable substrate carrier for electroplating

    Chen, Chen-An [Milpitas, CA; Abas, Emmanuel Chua [Laguna, PH; Divino, Edmundo Anida [Cavite, PH; Ermita, Jake Randal G [Laguna, PH; Capulong, Jose Francisco S [Laguna, PH; Castillo, Arnold Villamor [Batangas, PH; Ma,; Xiaobing, Diana [Saratoga, CA

    2012-07-17

    One embodiment relates to a substrate carrier for use in electroplating a plurality of substrates. The carrier includes a non-conductive carrier body on which the substrates are placed and conductive lines embedded within the carrier body. A plurality of conductive clip attachment parts are attached in a permanent manner to the conductive lines embedded within the carrier body. A plurality of contact clips are attached in a removable manner to the clip attachment parts. The contact clips hold the substrates in place and conductively connecting the substrates with the conductive lines. Other embodiments, aspects and features are also disclosed.

  8. No differences in brain microstructure between young KIBRA-C carriers and non-carriers.

    Hu, Li; Xu, Qunxing; Li, Jizhen; Wang, Feifei; Xu, Xinghua; Sun, Zhiyuan; Ma, Xiangxing; Liu, Yong; Wang, Qing; Wang, Dawei

    2018-01-02

    KIBRA rs17070145 polymorphism is associated with variations in memory function and the microstructure of related brain areas. Diffusion kurtosis imaging (DKI) as an extension of diffusion tensor imaging that can provide more information about changes in microstructure, based on the idea that water diffusion in biological tissues is heterogeneous due to structural hindrance and restriction. We used DKI to explore the relationship between KIBRA gene polymorphism and brain microstructure in young adults. We recruited 100 healthy young volunteers, including 53 TT carriers and 47 C allele carriers. No differences were detected between the TT homozygotes and C-allele carriers for any diffusion and kurtosis parameter. These results indicate KIBRA rs17070145 polymorphism likely has little or no effect on brain microstructure in young adults.

  9. Autonomous component carrier selection

    Garcia, Luis Guilherme Uzeda; Pedersen, Klaus; Mogensen, Preben

    2009-01-01

    management and efficient system operation. Due to the expected large number of user-deployed cells, centralized network planning becomes unpractical and new scalable alternatives must be sought. In this article, we propose a fully distributed and scalable solution to the interference management problem...... in local areas, basing our study case on LTE-Advanced. We present extensive network simulation results to demonstrate that a simple and robust interference management scheme, called autonomous component carrier selection allows each cell to select the most attractive frequency configuration; improving...... the experience of all users and not just the few best ones; while overall cell capacity is not compromised....

  10. Efficient carrier relaxation and fast carrier recombination of N-polar InGaN/GaN light emitting diodes

    Feng, Shih-Wei; Liao, Po-Hsun; Leung, Benjamin; Han, Jung; Yang, Fann-Wei; Wang, Hsiang-Chen

    2015-01-01

    Based on quantum efficiency and time-resolved electroluminescence measurements, the effects of carrier localization and quantum-confined Stark effect (QCSE) on carrier transport and recombination dynamics of Ga- and N-polar InGaN/GaN light-emitting diodes (LEDs) are reported. The N-polar LED exhibits shorter ns-scale response, rising, delay, and recombination times than the Ga-polar one does. Stronger carrier localization and the combined effects of suppressed QCSE and electric field and lower potential barrier acting upon the forward bias in an N-polar LED provide the advantages of more efficient carrier relaxation and faster carrier recombination. By optimizing growth conditions to enhance the radiative recombination, the advantages of more efficient carrier relaxation and faster carrier recombination in a competitive performance N-polar LED can be realized for applications of high-speed flash LEDs. The research results provide important information for carrier transport and recombination dynamics of an N-polar InGaN/GaN LED

  11. Efficient carrier relaxation and fast carrier recombination of N-polar InGaN/GaN light emitting diodes

    Feng, Shih-Wei, E-mail: swfeng@nuk.edu.tw; Liao, Po-Hsun [Department of Applied Physics, National University of Kaohsiung, No. 700, Kaohsiung University Rd., Nan Tzu Dist., 811 Kaohsiung, Taiwan (China); Leung, Benjamin; Han, Jung [Department of Electrical Engineering, Yale University, New Haven, Connecticut 06520 (United States); Yang, Fann-Wei [Department of Electronic Engineering, Southern Taiwan University of Science and Technology, Tainan, Taiwan (China); Wang, Hsiang-Chen [Graduate Institute of Opto-Mechatronics and Advanced Institute of Manufacturing with High-Tech Innovations (AIM-HI), National Chung Cheng University, Chia-Yi, Taiwan (China)

    2015-07-28

    Based on quantum efficiency and time-resolved electroluminescence measurements, the effects of carrier localization and quantum-confined Stark effect (QCSE) on carrier transport and recombination dynamics of Ga- and N-polar InGaN/GaN light-emitting diodes (LEDs) are reported. The N-polar LED exhibits shorter ns-scale response, rising, delay, and recombination times than the Ga-polar one does. Stronger carrier localization and the combined effects of suppressed QCSE and electric field and lower potential barrier acting upon the forward bias in an N-polar LED provide the advantages of more efficient carrier relaxation and faster carrier recombination. By optimizing growth conditions to enhance the radiative recombination, the advantages of more efficient carrier relaxation and faster carrier recombination in a competitive performance N-polar LED can be realized for applications of high-speed flash LEDs. The research results provide important information for carrier transport and recombination dynamics of an N-polar InGaN/GaN LED.

  12. A new optimized formulation of cationic solid lipid nanoparticles intended for gene delivery: development, characterization and DNA binding efficiency of TCERG1 expression plasmid.

    Fàbregas, Anna; Sánchez-Hernández, Noemí; Ticó, Josep Ramon; García-Montoya, Encarna; Pérez-Lozano, Pilar; Suñé-Negre, Josep M; Hernández-Munain, Cristina; Suñé, Carlos; Miñarro, Montserrat

    2014-10-01

    Solid lipid nanoparticles (SLNs) are being considered as a new approach for therapeutics for many known diseases. In addition to drug delivery, their use as non-viral vectors for gene delivery can be achieved by the inclusion of cationic lipids, which provide a positive surface potential that favours binding to the DNA backbone. This work is based on the idea that the optimization of the components is required as the first step in simplifying the qualitative and quantitative composition of SLNs as much as possible without affecting the essential properties that define SLNs as optimal non-viral vectors for gene delivery. We selected the best lipids and surfactants in terms of particle size and zeta potential and characterized the properties of the resulting nanoparticles using X-ray photoelectron spectroscopy (XPS) and atomic force microscopy (AFM). The SLNs had a particle size of approximately 120 nm and a positive surface charge of 42 mV. In addition, we analysed the main physicochemical characteristics of the bulk components of the nanoparticles using X-ray diffraction (XRD), differential scanning calorimetry (DSC) and mass spectrometry (MS). The suitability of the optimized SLNs for DNA binding was evaluated after the lyophilisation process using a carboxyl-terminal region of the TCERG1 gene, a human factor that has been implicated in several diseases. We show that the SLNs presented high efficiency in the binding of DNA, and importantly, they presented no toxicity when assayed in an in vivo system. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Gene transfer of Chlorella vulgaris n-3 fatty acid desaturase optimizes the fatty acid composition of human breast cancer cells

    Meilan Xue

    2012-12-01

    Full Text Available Chlorella vulgaris has the gene of n-3 fatty acid desaturase (CvFad3, which can synthesize the precursor of n-3 polyunsaturated fatty acids (PUFAs or convert n-6 to n-3 PUFAs. The objective of the present study was to examine whether the CvFad3 gene from C. vulgaris can be functionally and efficiently expressed in human breast cancer cells and whether its expression can exert a significant effect on cell fatty acid composition. We inserted the CvFad3 gene into the plasmid pEGFP-C3 to construct the eukaryotic expression vector pEGFP-C3-n-3 and to express the n-3 Fad gene in human breast cancer cells (MCF-7 cells. Transfection of MCF-7 cells with the recombinant vector resulted in a high expression of n-3 fatty acid desaturase. Lipid analysis indicated that the ratio of n-6/n-3 PUFAs was decreased from 6:1 in the control cells to about 1:1 in the cells expressing the n-3 fatty acid desaturase. Accordingly, the CvFad3 gene significantly decreased the ratio of n-6/n-3 PUFAs of the MCF-7 cell membrane. The expression of the CvFad3 gene can decrease cell proliferation and promote cell apoptosis. This study demonstrates that the CvFad3 gene can dramatically balance the ratio of n-6/n-3 PUFAs and may provide an effective approach to the modification of the fatty acid composition of mammalian cells, also providing a basis for potential applications of its transfer in experimental and clinical settings.

  14. Identifying optimal reference genes for the normalization of microRNA expression in cucumber under viral stress

    Liang, Chaoqiong; Hao, Jianjun; Meng, Yan; Luo, Laixin; Li, Jianqiang

    2018-01-01

    Cucumber green mottle mosaic virus (CGMMV) is an economically important pathogen and causes significant reduction of both yield and quality of cucumber (Cucumis sativus). Currently, there were no satisfied strategies for controlling the disease. A better understanding of microRNA (miRNA) expression related to the regulation of plant-virus interactions and virus resistance would be of great assistance when developing control strategies for CGMMV. However, accurate expression analysis is highly dependent on robust and reliable reference gene used as an internal control for normalization of miRNA expression. Most commonly used reference genes involved in CGMMV-infected cucumber are not universally expressed depending on tissue types and stages of plant development. It is therefore crucial to identify suitable reference genes in investigating the role of miRNA expression. In this study, seven reference genes, including Actin, Tubulin, EF-1α, 18S rRNA, Ubiquitin, GAPDH and Cyclophilin, were evaluated for the most accurate results in analyses using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Gene expression was assayed on cucumber leaves, stems and roots that were collected at different days post inoculation with CGMMV. The expression data were analyzed using algorithms including delta-Ct, geNorm, NormFinder, and BestKeeper as well as the comparative tool RefFinder. The reference genes were subsequently validated using miR159. The results showed that EF-1α and GAPDH were the most reliable reference genes for normalizing miRNA expression in leaf, root and stem samples, while Ubiquitin and EF-1α were the most suitable combination overall. PMID:29543906

  15. Gene transfer of Chlorella vulgaris n-3 fatty acid desaturase optimizes the fatty acid composition of human breast cancer cells

    Xue, Meilan; Ge, Yinlin; Zhang, Jinyu [Department of Biochemistry and Molecular Biology, Medical College, Qingdao University, Qingdao Shandong (China); Wang, Qing [Affiliated Hospital of Qingdao University, Qingdao Shandong (China); Hou, Lin [Department of Biochemistry and Molecular Biology, Medical College, Qingdao University, Qingdao Shandong (China)

    2012-09-14

    Chlorella vulgaris has the gene of n-3 fatty acid desaturase (CvFad3), which can synthesize the precursor of n-3 polyunsaturated fatty acids (PUFAs) or convert n-6 to n-3 PUFAs. The objective of the present study was to examine whether the CvFad3 gene from C. vulgaris can be functionally and efficiently expressed in human breast cancer cells and whether its expression can exert a significant effect on cell fatty acid composition. We inserted the CvFad3 gene into the plasmid pEGFP-C3 to construct the eukaryotic expression vector pEGFP-C3-n-3 and to express the n-3 Fad gene in human breast cancer cells (MCF-7 cells). Transfection of MCF-7 cells with the recombinant vector resulted in a high expression of n-3 fatty acid desaturase. Lipid analysis indicated that the ratio of n-6/n-3 PUFAs was decreased from 6:1 in the control cells to about 1:1 in the cells expressing the n-3 fatty acid desaturase. Accordingly, the CvFad3 gene significantly decreased the ratio of n-6/n-3 PUFAs of the MCF-7 cell membrane. The expression of the CvFad3 gene can decrease cell proliferation and promote cell apoptosis. This study demonstrates that the CvFad3 gene can dramatically balance the ratio of n-6/n-3 PUFAs and may provide an effective approach to the modification of the fatty acid composition of mammalian cells, also providing a basis for potential applications of its transfer in experimental and clinical settings.

  16. Gene transfer of Chlorella vulgaris n-3 fatty acid desaturase optimizes the fatty acid composition of human breast cancer cells

    Xue, Meilan; Ge, Yinlin; Zhang, Jinyu; Wang, Qing; Hou, Lin

    2012-01-01

    Chlorella vulgaris has the gene of n-3 fatty acid desaturase (CvFad3), which can synthesize the precursor of n-3 polyunsaturated fatty acids (PUFAs) or convert n-6 to n-3 PUFAs. The objective of the present study was to examine whether the CvFad3 gene from C. vulgaris can be functionally and efficiently expressed in human breast cancer cells and whether its expression can exert a significant effect on cell fatty acid composition. We inserted the CvFad3 gene into the plasmid pEGFP-C3 to construct the eukaryotic expression vector pEGFP-C3-n-3 and to express the n-3 Fad gene in human breast cancer cells (MCF-7 cells). Transfection of MCF-7 cells with the recombinant vector resulted in a high expression of n-3 fatty acid desaturase. Lipid analysis indicated that the ratio of n-6/n-3 PUFAs was decreased from 6:1 in the control cells to about 1:1 in the cells expressing the n-3 fatty acid desaturase. Accordingly, the CvFad3 gene significantly decreased the ratio of n-6/n-3 PUFAs of the MCF-7 cell membrane. The expression of the CvFad3 gene can decrease cell proliferation and promote cell apoptosis. This study demonstrates that the CvFad3 gene can dramatically balance the ratio of n-6/n-3 PUFAs and may provide an effective approach to the modification of the fatty acid composition of mammalian cells, also providing a basis for potential applications of its transfer in experimental and clinical settings

  17. Optimizing viral and non-viral gene transfer methods for genetic modification of porcine mesenchymal stem cells

    Stiehler, Maik; Duch, Mogens; Mygind, Tina

    2006-01-01

    INTRODUCTION: Mesenchymal stem cells (MSCs) provide an excellent source of pluripotent progenitor cells for tissue-engineering applications due to their proliferation capacity and differentiation potential. Genetic modification of MSCs with genes encoding tissue-specific growth factors...... viral and non-viral ex vivo gene delivery systems with respect to gene transfer efficiency, maintenance of transgene expression, and safety issues using primary porcine MSCs as target cells. MATERIALS AND METHODS: MSCs were purified from bone marrow aspirates from the proximal tibiae of four 3-month......-old Danish landrace pigs by Ficoll step gradient separation and polystyrene adherence technique. Vectors expressing enhanced green fluorescent protein (eGFP) and human bone morphogenetic protein-2 (BMP-2) were transferred to the cells by different non-viral methods and by use of recombinant adeno...

  18. Reversal of Blindness in Animal Models of Leber Congenital Amaurosis Using Optimized AAV2-mediated Gene Transfer

    Bennicelli, Jeannette; Wright, John Fraser; Komaromy, Andras; Jacobs, Jonathan B; Hauck, Bernd; Zelenaia, Olga; Mingozzi, Federico; Hui, Daniel; Chung, Daniel; Rex, Tonia S; Wei, Zhangyong; Qu, Guang; Zhou, Shangzhen; Zeiss, Caroline; Arruda, Valder R

    2008-01-01

    We evaluated the safety and efficacy of an optimized adeno-associated virus (AAV; AAV2.RPE65) in animal models of the RPE65 form of Leber congenital amaurosis (LCA). Protein expression was optimized by addition of a modified Kozak sequence at the translational start site of hRPE65. Modifications in AAV production and delivery included use of a long stuffer sequence to prevent reverse packaging from the AAV inverted-terminal repeats, and co-injection with a surfactant. The latter allows consis...

  19. Recovery of human metapneumovirus from cDNA: optimization of growth in vitro and expression of additional genes

    Biacchesi, Stephane; Skiadopoulos, Mario H.; Tran, Kim C.; Murphy, Brian R.; Collins, Peter L.; Buchholz, Ursula J.

    2004-01-01

    Human metapneumovirus (HMPV) is a recently recognized causative agent of respiratory tract disease in individuals of all ages and especially young infants. HMPV remains poorly characterized and has been reported to replicate inefficiently in vitro. Complete consensus sequences were recently determined for two isolates representing the two proposed HMPV genetic subgroups (Biacchesi et al., Virology 315 (1) (2003) 1). We have developed a reverse genetic system to produce one of these isolates, CAN97-83, entirely from cDNA. We also recovered a version, rHMPV-GFP, in which the enhanced green fluorescent protein (GFP) was expressed from a transcription cassette inserted as the first gene, leaving the 41-nt leader region and first 16 nt of the N gene undisturbed. The ability to monitor GFP expression in living cells greatly facilitated the initial recovery of this slow-growing virus. In addition, the ability to express a foreign gene from an engineered transcription cassette confirmed the identification of the HMPV transcription signals and identified the F gene-end signal as being highly efficient for transcription termination. The ability to recover virus containing a foreign insert in this position indicated that the viral promoter is contained within the 3'-terminal 57 nt of the genome. Recombinant HMPV replicated in vitro as efficiently as biologically derived HMPV, whereas the kinetics and final yield of rHMPV-GFP were reduced several-fold. Conditions for trypsin treatment were investigated, providing for improved virus yields. Another version of HMPV, rHMPV+G1F23, was recovered that contained a second copy of the G gene and two extra copies of F in promoter-proximal positions in the order G1-F2-F3. Thus, this recombinant genome would encode 11 mRNAs rather than eight and would be 17.3 kb long, 30% longer than that of the natural virus. Nonetheless, the rHMPV+G1F23 virus replicated in vitro with an efficiency that was only modestly reduced compared to rHMPV and was

  20. LIQUIFIED NATURAL GAS (LNG CARRIERS

    Daniel Posavec

    2010-12-01

    Full Text Available Modern liquefied natural gas carriers are double-bottom ships classified according to the type of LNG tank. The tanks are specially designed to store natural gas cooled to -161°C, the boiling point of methane. Since LNG is highly flammable, special care must be taken when designing and operating the ship. The development of LNG carriers has begun in the middle of the twentieth century. LNG carrier storage space has gradually grown to the current maximum of 260000 m3. There are more than 300 LNG carriers currently in operation (the paper is published in Croatian.

  1. Optimized outcome prediction in breast cancer by combining the 70-gene signature with clinical risk prediction algorithms

    Drukker, C.A.; Nijenhuis, M.V.; Bueno de Mesquita, J.M.; Retel, V.P.; Retel, Valesca; van Harten, Willem H.; van Tinteren, H.; Wesseling, J.; Schmidt, M.K.; van 't Veer, L.J.; Sonke, G.S.; Rutgers, E.J.T.; van de Vijver, M.J.; Linn, S.C.

    2014-01-01

    Clinical guidelines for breast cancer treatment differ in their selection of patients at a high risk of recurrence who are eligible to receive adjuvant systemic treatment (AST). The 70-gene signature is a molecular tool to better guide AST decisions. The aim of this study was to evaluate whether

  2. Optimization and physicochemical characterization of a cationic lipid-phosphatidylcholine mixed emulsion formulated as a highly efficient vehicle that facilitates adenoviral gene transfer

    Kim SY

    2017-10-01

    Full Text Available Soo-Yeon Kim,1,2 Sang-Jin Lee,2 Jin-Ki Kim,3 Han-Gon Choi,3 Soo-Jeong Lim1 1Department of Bioscience and Bioengineering, Sejong University, Seoul, Kwangjin-gu, Seoul, 2Immunotherapeutics Branch, Research Institute, National Cancer Center, Ilsandong-gu, Goyang-si, Gyeonggi-do, 3College of Pharmacy & Institute of Pharmaceutical Science and Technology, Hanyang University, Sangnok-gu, Ansan, Republic of Korea Abstract: Cationic lipid-based nanoparticles enhance viral gene transfer by forming electrostatic complexes with adenoviral vectors. We recently demonstrated the superior complexation capabilities of 1,2-dioleoyl-3-trimethylammonium propane (DOTAP emulsion compared with a liposomal counterpart but the cytotoxicity of DOTAP emulsions remained a challenge. The present study is aimed at formulating an emulsion capable of acting as a highly effective viral gene transfer vehicle with reduced cytotoxicity and to physicochemically characterize the structures of virus-emulsion complexes in comparison with virus–liposome complexes when the only difference between emulsions and liposomes was the presence or absence of inner oil core. The emulsion formulation was performed by 1 reducing the content of DOTAP while increasing the content of zwitterionic lipid 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC, and 2 optimizing the oil content. The complexation capability of formulated DOTAP:DMPC mixed emulsions was similar to those of emulsions containing DOTAP alone while displaying significantly lower cytotoxicity. The complexation capabilities of the DOTAP:DMPC mixed emulsion were serum-compatible and were monitored in a variety of cell types, whereas its liposomal counterpart was totally ineffective. Characterization by scanning electron microscopy, transmission electron microscopy, atomic force microscopy, and dynamic light scattering studies indicated that the optimized emulsions spontaneously surrounded the virus particles to generate emulsions that

  3. Sensitive detection of gene expression in mycobacteria under replicating and non-replicating conditions using optimized far-red reporters.

    Paul Carroll; Lise J Schreuder; Julian Muwanguzi-Karugaba; Siouxsie Wiles; Brian D Robertson; Jorge Ripoll; Theresa H Ward; Gregory J Bancroft; Ulrich E Schaible; Tanya Parish

    2010-01-01

    Fluorescent reporter proteins have proven useful for imaging techniques in many organisms. We constructed optimized expression systems for several fluorescent proteins from the far-red region of the spectrum and analyzed their utility in several mycobacterial species. Plasmids expressing variants of the Discosoma Red fluorescent protein (DsRed) from the Mycobacterium bovis hsp60 promoter were unstable; in contrast expression from the Mycobacterium smegmatis rpsA promoter was stable. In Mycoba...

  4. Optimization of coffee (Coffea arabica transformation parameters using uidA and hpt genes: effect of osmotic pre-treatment, helium pressure and target distance

    Andrés M Gatica

    2009-11-01

    Full Text Available The aim of this work was to optimize the biolistic delivery parameters that affect the DNA delivery and stable expression of marker genes into coffee tissues (Coffea arabica. L. cvs. Caturra and Catuaí. The effect of osmotic preculture length, osmotic concentration of medium, Helium pressure and target distance on transient expression of the uidA gene in coffee leaves and somatic embryos were tested. The highest transient uidA expression was obtained when Caturra (18.3±2.8 and Catuaí (6.8±2.0 leaves and Catuaí embryos (80.0±7.4 were cultured for 5h on Yasuda medium complemented with 0.5M Mannitol +0.5M Sorbitol. The combination of 1100psi and a target distance of 9cm resulted in the highest number of blue spots per Caturra leaf segment (23.6±3.9, whereas for the Catuaí variety the combination of 1100psi and a target distance of six (10.2±1.9 and nine (8.2±1.9 cm gave the highest number of blue spots per leaf segment. The optimized protocol was tested with pCAMBIA 1 301 (uidA gene and the hpt gene, pCAMBIA 1 305.2 (uidA version GUSPlus ™ and the hpt gene and pCAMBIA 1 301-BAR (uidA gene and the bar gene. The highest number of blue spots was obtained when Caturra (54.6±5.7 and Catuaí (28.9±4.3 leaves were bombarded with pCAMBIA 1 305.2. Selection of bombarded coffee tissues with 100mg/l hygromicyn caused the oxidation of tissues. Rev. Biol. Trop. 57 (Suppl. 1: 151-160. Epub 2009 November 30.La presente investigación tuvo como objetivo optimizar los parámetros que afectan la incorporación y expresión de genes marcadores mediante biobalística en segmentos de hoja y embriones somáticos de café (Coffea arabica. L. cvs. Caturra y Catuaí. La mayor expresión transitoria del gen uidA en segmentos de hoja de Caturra (18.3±2.8 y Catuaí (6.8±2.0 y embriones somáticos de Catuaí (80.0±7.4 se obtuvo al cultivar los explantes por cinco horas previo al bombardeo en el medio Yasuda complementado con 0.5M mannitol+0.5M sorbitol

  5. The energy carrier hydrogen

    Anon.

    1992-01-01

    The potential of hydrogen to be used as a clean fuel for the production of heat and power, as well as for the propulsion of aeroplanes and vehicles, is described, in particular for Germany. First, attention is paid to the application of hydrogen as a basic material for the (petro)chemical industry, as an indirect energy source for (petro)chemical processes, and as a direct energy source for several purposes. Than the importance of hydrogen as an energy carrier in a large-scale application of renewable energy sources is discussed. Next an overview is given of new and old hydrogen production techniques from fossil fuels, biomass, or the electrolysis of water. Energetic applications of hydrogen in the transportation sector and the production of electric power and heat are mentioned. Brief descriptions are given of techniques to store hydrogen safely. Finally attention is paid to hydrogen research in Germany. Two hydrogen projects, in which Germany participates, are briefly dealt with: the Euro-Quebec project (production of hydrogen by means of hydropower), and the HYSOLAR project (hydrogen production by means of solar energy). 18 figs., 1 tab., 7 refs

  6. Treatment Adherence as a New Choice Factor for Optimization of Oral Anticoagulation Therapy in Patients with Atrial Fibrillation and Hemostatic Gene Polymorphisms

    Yu. P. Skirdenko

    2016-01-01

    Full Text Available Aim. To evaluate treatment adherence and prevalence of CYP2C9 and VKORC1 gene mutations in patients with atrial fibrillation (AF and provide rationale of choice for oral anticoagulation therapy.Material and methods. Treatment adherence was evaluated in 137 AF patients (aged 35-85 years with quantitative estimation of drug therapy adherence along with compliance to medical support and lifestyle modifications. Among them 82 patients underwent polymerase chain reaction (PCR analysis of CYP2C9 and VKORC1 gene polymorphisms.Results. Patients receiving anticoagulation therapy are characterized by lower level of adherence compared to patients without anticoagulants (65.2±19.3% vs 68.5±19.1%; Wald-Wolfowitz; p<0.05. Considering all studied parameters men are less adherent than women (54.7±18.6% vs 60.6±16.7%; Kolmogorov-Smirnov; p<0.05. Patients receiving new oral anticoagulants (NOAC have better compliance compared with patients of warfarin group. Mutations in CYP2C9 gene were detected in 32.9%, VKORC1 – in 68.3%, and their combination – in 21.9% of study participants. Warfarin therapy may be potentially dangerous in such patients due to low adherence.Conclusion. Considering high prevalence of CYP2C9 and VKORC1 gene mutations treatment adherence should be estimated to optimize choice of anticoagulation therapy. NOAC treatment should be considered in patients with low adherence for prevention of thromboembolic complications.

  7. Assessment and Optimization of the GeneXpert Diagnostic Platform for Detection of Ebola Virus RNA in Seminal Fluid.

    Pettitt, James; Higgs, Elizabeth; Fallah, Mosoka; Nason, Martha; Stavale, Eric; Marchand, Jonathan; Reilly, Cavan; Jensen, Kenneth; Dighero-Kemp, Bonnie; Tuznik, Kaylie; Logue, James; Bolay, Fatorma; Hensley, Lisa

    2017-02-15

    Recent studies have suggested that Ebola virus (EBOV) ribonucleic acid (RNA) potentially present in the semen of a large number of survivors of Ebola virus disease (EVD) in Western Africa may contribute to sexual transmission of EVD and generate new clusters of cases in regions previously declared EVD-free. These findings drive the immediate need for a reliable, rapid, user-friendly assay for detection of EBOV RNA in semen that is deployable to multiple sites across Western Africa. In this study, we optimized the Xpert EBOV assay for semen samples by adding dithiothreitol. Compared to the assays currently in use in Liberia (including Ebola Zaire Target 1, major groove binder real-time-polymerase chain reaction assays, and original Xpert EBOV assay), the modified Xpert EBOV assay demonstrated greater sensitivity than the comparator assays. Thus, the modified Xpert EBOV assay is optimal for large-scale monitoring of EBOV RNA persistence in male survivors. Published by Oxford University Press for the Infectious Diseases Society of America 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  8. Reversal of blindness in animal models of leber congenital amaurosis using optimized AAV2-mediated gene transfer.

    Bennicelli, Jeannette; Wright, John Fraser; Komaromy, Andras; Jacobs, Jonathan B; Hauck, Bernd; Zelenaia, Olga; Mingozzi, Federico; Hui, Daniel; Chung, Daniel; Rex, Tonia S; Wei, Zhangyong; Qu, Guang; Zhou, Shangzhen; Zeiss, Caroline; Arruda, Valder R; Acland, Gregory M; Dell'Osso, Lou F; High, Katherine A; Maguire, Albert M; Bennett, Jean

    2008-03-01

    We evaluated the safety and efficacy of an optimized adeno-associated virus (AAV; AAV2.RPE65) in animal models of the RPE65 form of Leber congenital amaurosis (LCA). Protein expression was optimized by addition of a modified Kozak sequence at the translational start site of hRPE65. Modifications in AAV production and delivery included use of a long stuffer sequence to prevent reverse packaging from the AAV inverted-terminal repeats, and co-injection with a surfactant. The latter allows consistent and predictable delivery of a given dose of vector. We observed improved electroretinograms (ERGs) and visual acuity in Rpe65 mutant mice. This has not been reported previously using AAV2 vectors. Subretinal delivery of 8.25 x 10(10) vector genomes in affected dogs was well tolerated both locally and systemically, and treated animals showed improved visual behavior and pupillary responses, and reduced nystagmus within 2 weeks of injection. ERG responses confirmed the reversal of visual deficit. Immunohistochemistry confirmed transduction of retinal pigment epithelium cells and there was minimal toxicity to the retina as judged by histopathologic analysis. The data demonstrate that AAV2.RPE65 delivers the RPE65 transgene efficiently and quickly to the appropriate target cells in vivo in animal models. This vector holds great promise for treatment of LCA due to RPE65 mutations.

  9. LIQUIFIED NATURAL GAS (LNG) CARRIERS

    Daniel Posavec; Katarina Simon; Matija Malnar

    2010-01-01

    Modern liquefied natural gas carriers are double-bottom ships classified according to the type of LNG tank. The tanks are specially designed to store natural gas cooled to -161°C, the boiling point of methane. Since LNG is highly flammable, special care must be taken when designing and operating the ship. The development of LNG carriers has begun in the middle of the twentieth century. LNG carrier storage space has gradually grown to the current maximum of 260000 m3. There are more than 300 L...

  10. Impact of carriers in oral absorption

    Gram, Luise Kvisgaard; Rist, Gerda Marie; Lennernäs, Hans

    2009-01-01

    Carriers may mediate the permeation across enterocytes for drug substances being organic anions. Carrier mediated permeation for the organic anions estrone-3-sulfate (ES) and glipizide across Caco-2 cells were investigated kinetically, and interactions on involved carriers evaluated. Initial...

  11. 7 CFR 35.4 - Carrier.

    2010-01-01

    ... AND PLUMS Definitions § 35.4 Carrier. Carrier means any common or private carrier, including, but not being limited to, trucks, rail, airplanes, vessels, tramp or chartered steamers, whether carrying for...

  12. Basic Stand Alone Carrier Line Items PUF

    U.S. Department of Health & Human Services — This release contains the Basic Stand Alone (BSA) Carrier Line Items Public Use Files (PUF) with information from Medicare Carrier claims. The CMS BSA Carrier Line...

  13. Homozygous carriers of the G allele of rs4664447 of the glucagon gene (GCG) are characterised by decreased fasting and stimulated levels of insulin, glucagon and glucagon-like peptide (GLP)-1

    Torekov, S S; Ma, L; Grarup, N

    2011-01-01

    The glucagon gene (GCG) encodes several hormones important for energy metabolism: glucagon, oxyntomodulin and glucagon-like peptide (GLP)-1 and -2. Variants in GCG may associate with type 2 diabetes, obesity and/or related metabolic traits.......The glucagon gene (GCG) encodes several hormones important for energy metabolism: glucagon, oxyntomodulin and glucagon-like peptide (GLP)-1 and -2. Variants in GCG may associate with type 2 diabetes, obesity and/or related metabolic traits....

  14. The use of semantic similarity measures for optimally integrating heterogeneous Gene Ontology data from large scale annotation pipelines

    Gaston K Mazandu

    2014-08-01

    Full Text Available With the advancement of new high throughput sequencing technologies, there has been an increase in the number of genome sequencing projects worldwide, which has yielded complete genome sequences of human, animals and plants. Subsequently, several labs have focused on genome annotation, consisting of assigning functions to gene products, mostly using Gene Ontology (GO terms. As a consequence, there is an increased heterogeneity in annotations across genomes due to different approaches used by different pipelines to infer these annotations and also due to the nature of the GO structure itself. This makes a curator's task difficult, even if they adhere to the established guidelines for assessing these protein annotations. Here we develop a genome-scale approach for integrating GO annotations from different pipelines using semantic similarity measures. We used this approach to identify inconsistencies and similarities in functional annotations between orthologs of human and Drosophila melanogaster, to assess the quality of GO annotations derived from InterPro2GO mappings compared to manually annotated GO annotations for the Drosophila melanogaster proteome from a FlyBase dataset and human, and to filter GO annotation data for these proteomes. Results obtained indicate that an efficient integration of GO annotations eliminates redundancy up to 27.08 and 22.32% in the Drosophila melanogaster and human GO annotation datasets, respectively. Furthermore, we identified lack of and missing annotations for some orthologs, and annotation mismatches between InterPro2GO and manual pipelines in these two proteomes, thus requiring further curation. This simplifies and facilitates tasks of curators in assessing protein annotations, reduces redundancy and eliminates inconsistencies in large annotation datasets for ease of comparative functional genomics.

  15. Motor carrier evaluation program plan

    Portsmouth, J.H.; Maxwell, J.E.; Boness, G.O.; Rice, L.E.

    1991-04-01

    The US Department of Energy (DOE) Transportation Management Program (TMP) has established a program to assist the DOE field offices and their contractors in evaluating the motor carriers used to transport DOE-owned hazardous and radioactive materials. This program was initiated to provide the DOE field offices with the tools necessary to help ensure, during this period of motor carrier deregulation, that only highly qualified carriers transport radioactive and hazardous commodities for the DOE. This program will assist DOE in maintaining their excellent performance record in the safe transportation of hazardous commodities. The program was also developed in response to public concern surrounding the transportation of hazardous materials. Representatives of other federal agencies, states, and tribal governments, as well as the news media, have expressed concern about the selection and qualification of carriers engaged in the transportation of Highway Route-Controlled Quantities (HRCQ) and Truckload (TL) quantities of radioactive material for the DOE. 8 refs

  16. Solute carrier transporters: Pharmacogenomics research ...

    Aghogho

    2010-12-27

    Dec 27, 2010 ... This paper reviews the solute carrier transporters and highlights the fact that there is much to be learnt from .... transporters, drug targets, effect or proteins and meta- ... basolateral or apical plasma membrane of polarized cells,.

  17. Optimal Route for Human Umbilical Cord Blood-Derived Mesenchymal Stem Cell Transplantation to Protect Against Neonatal Hyperoxic Lung Injury: Gene Expression Profiles and Histopathology.

    Dong Kyung Sung

    Full Text Available The aim of this study was to determine the optimal route of mesenchymal stem cell (MSC transplantation. To this end, gene expression profiling was performed to compare the effects of intratracheal (i.t. versus intravenous (i.v. MSC administration. Furthermore, the therapeutic efficacy of each route to protect against neonatal hyperoxic lung injury was also determined. Newborn Sprague-Dawley rats were exposed to hyperoxia (90% oxygen from birth for 14 days. Human umbilical cord blood-derived MSCs labeling with PKH26 were transplanted through either the i.t. (5×10(5 or i.v. (2×10(6 route at postnatal day (P 5. At P14, lungs were harvested for histological, biochemical and microarray analyses. Hyperoxic conditions induced an increase in the mean linear intercept and mean alveolar volume (MAV, indicative of impaired alveolarization. The number of ED-1 positive cells was significantly decreased by both i.t. and i.v. transplantations. However, i.t. administration of MSCs resulted in a greater decrease in MAV and ED-1 positive cells compared to i.v. administration. Moreover, the number of TUNEL-positive cells was significantly decreased in the i.t. group, but not in the i.v. group. Although the i.t. group received only one fourth of the number of MSCs that the i.v. group did, a significantly higher number of donor cell-derived red PKH 26 positivity were recovered in the i.t. group. Hyperoxic conditions induced the up regulation of genes associated with the inflammatory response, such as macrophage inflammatory protein-1 α, tumor necrosis factor-α and inter leukin-6; genes associated with cell death, such as p53 and caspases; and genes associated with fibrosis, such as connective tissue growth factor. In contrast, hyperoxic conditions induced the dwon-regulation of vascular endothelial growth factor and hepatocyte growth factor. These hyperoxia-induced changes in gene expression were decreased in the i.t. group, but not in the i.v. group. Thus

  18. Enhanced Efficacy of a Codon-Optimized DNA Vaccine Encoding the Glycoprotein Precursor Gene of Lassa Virus in a Guinea Pig Disease Model When Delivered by Dermal Electroporation

    Niranjan Y. Sardesai

    2013-07-01

    Full Text Available Lassa virus (LASV causes a severe, often fatal, hemorrhagic fever endemic to West Africa. Presently, there are no FDA-licensed medical countermeasures for this disease. In a pilot study, we constructed a DNA vaccine (pLASV-GPC that expressed the LASV glycoprotein precursor gene (GPC. This plasmid was used to vaccinate guinea pigs (GPs using intramuscular electroporation as the delivery platform. Vaccinated GPs were protected from lethal infection (5/6 with LASV compared to the controls. However, vaccinated GPs experienced transient viremia after challenge, although lower than the mock-vaccinated controls. In a follow-on study, we developed a new device that allowed for both the vaccine and electroporation pulse to be delivered to the dermis. We also codon-optimized the GPC sequence of the vaccine to enhance expression in GPs. Together, these innovations resulted in enhanced efficacy of the vaccine. Unlike the pilot study where neutralizing titers were not detected until after virus challenge, modest neutralizing titers were detected in guinea pigs before challenge, with escalating titers detected after challenge. The vaccinated GPs were never ill and were not viremic at any timepoint. The combination of the codon-optimized vaccine and dermal electroporation delivery is a worthy candidate for further development.

  19. L-Asparaginase from Streptomyces griseus NIOT-VKMA29: optimization of process variables using factorial designs and molecular characterization of L-asparaginase gene

    Meena, Balakrishnan; Anburajan, Lawrance; Sathish, Thadikamala; Vijaya Raghavan, Rangamaran; Dharani, Gopal; Valsalan Vinithkumar, Nambali; Kirubagaran, Ramalingam

    2015-07-01

    Marine actinobacteria are known to be a rich source for novel metabolites with diverse biological activities. In this study, a potential extracellular L-asparaginase was characterised from the Streptomyces griseus NIOT-VKMA29. Box-Behnken based optimization was used to determine the culture medium components to enhance the L-asparaginase production. pH, starch, yeast extract and L-asparagine has a direct correlation for enzyme production with a maximum yield of 56.78 IU mL-1. A verification experiment was performed to validate the experiment and more than 99% validity was established. L-Asparaginase biosynthesis gene (ansA) from Streptomyces griseus NIOT-VKMA29 was heterologously expressed in Escherichia coli M15 and the enzyme production was increased threefold (123 IU mL-1) over the native strain. The ansA gene sequences reported in this study encloses several base substitutions with that of reported sequences in GenBank, resulting in altered amino acid sequences of the translated protein.

  20. Recombinant HAP Phytase of the Thermophilic Mold Sporotrichum thermophile: Expression of the Codon-Optimized Phytase Gene in Pichia pastoris and Applications.

    Ranjan, Bibhuti; Satyanarayana, T

    2016-02-01

    The codon-optimized phytase gene of the thermophilic mold Sporotrichum thermophile (St-Phy) was expressed in Pichia pastoris. The recombinant P. pastoris harboring the phytase gene (rSt-Phy) yielded a high titer of extracellular phytase (480 ± 23 U/mL) on induction with methanol. The recombinant phytase production was ~40-fold higher than that of the native fungal strain. The purified recombinant phytase (rSt-Phy) has the molecular mass of 70 kDa on SDS-PAGE, with K m and V max (calcium phytate), k cat and k cat/K m values of 0.147 mM and 183 nmol/mg s, 1.3 × 10(3)/s and 8.84 × 10(6)/M s, respectively. Mg(2+) and Ba(2+) display a slight stimulatory effect, while other cations tested exert inhibitory action on phytase. The enzyme is inhibited by chaotropic agents (guanidinium hydrochloride, potassium iodide, and urea), Woodward's reagent K and 2,3-bunatedione, but resistant to both pepsin and trypsin. The rSt-Phy is useful in the dephytinization of broiler feeds efficiently in simulated gut conditions of chick leading to the liberation of soluble inorganic phosphate with concomitant mitigation in antinutrient effects of phytates. The addition of vanadate makes it a potential candidate for generating haloperoxidase, which has several applications.

  1. Prognostic value of X-chromosome inactivation in symptomatic female carriers of dystrophinopathy

    Juan-Mateu Jonàs

    2012-10-01

    Full Text Available Abstract Background Between 8% and 22% of female carriers of DMD mutations exhibit clinical symptoms of variable severity. Development of symptoms in DMD mutation carriers without chromosomal rearrangements has been attributed to skewed X-chromosome inactivation (XCI favouring predominant expression of the DMD mutant allele. However the prognostic use of XCI analysis is controversial. We aimed to evaluate the correlation between X-chromosome inactivation and development of clinical symptoms in a series of symptomatic female carriers of dystrophinopathy. Methods We reviewed the clinical, pathological and genetic features of twenty-four symptomatic carriers covering a wide spectrum of clinical phenotypes. DMD gene analysis was performed using MLPA and whole gene sequencing in blood DNA and muscle cDNA. Blood and muscle DNA was used for X-chromosome inactivation (XCI analysis thought the AR methylation assay in symptomatic carriers and their female relatives, asymptomatic carriers as well as non-carrier females. Results Symptomatic carriers exhibited 49.2% more skewed XCI profiles than asymptomatic carriers. The extent of XCI skewing in blood tended to increase in line with the severity of muscle symptoms. Skewed XCI patterns were found in at least one first-degree female relative in 78.6% of symptomatic carrier families. No mutations altering XCI in the XIST gene promoter were found. Conclusions Skewed XCI is in many cases familial inherited. The extent of XCI skewing is related to phenotype severity. However, the assessment of XCI by means of the AR methylation assay has a poor prognostic value, probably because the methylation status of the AR gene in muscle may not reflect in all cases the methylation status of the DMD gene.

  2. Gettering improvements of minority-carrier lifetimesin solar grade silicon

    Osinniy, Viktor; Nylandsted Larsen, Arne; Dahl, Espen

    2012-01-01

    The minority-carrier lifetime in p-type solar-grade silicon (SoG-Si) produced by Elkem Solar was investigated after different types of heat treatment. Two groups of samples differing by the as-grown lifetimes were exposed to internal and phosphorus gettering using constant and variable temperature...... processes. Optimal heat-treatment parameters for each group of samples were then identified which improved the minority-carrier lifetimes to values higher than the minimum value needed for solar cells. Phosphorus gettering using a variable temperature process enhanced in particular the lifetime within each...

  3. Evaluation of carrier-mediated siRNA delivery

    Colombo, Stefano; Nielsen, Hanne Mørck; Foged, Camilla

    2013-01-01

    RNA delivery. An in vitro cell culture model system expressing enhanced green fluorescent protein (EGFP) was used to develop the assay, which was based on the intracellular quantification of a full-length double-stranded Dicer substrate siRNA by stem-loop RT qPCR. The result is a well-documented protocol......RNA delivered by use of carriers remains an analytical challenge. The purpose of the present study was to optimize and validate an analytical protocol based on stem-loop reverse transcription quantitative polymerase chain reaction (RT qPCR) to quantitatively monitor the carrier-mediated intracellular si...

  4. Implementation of quality by design principles in the development of microsponges as drug delivery carriers: Identification and optimization of critical factors using multivariate statistical analyses and design of experiments studies.

    Simonoska Crcarevska, Maja; Dimitrovska, Aneta; Sibinovska, Nadica; Mladenovska, Kristina; Slavevska Raicki, Renata; Glavas Dodov, Marija

    2015-07-15

    Microsponges drug delivery system (MDDC) was prepared by double emulsion-solvent-diffusion technique using rotor-stator homogenization. Quality by design (QbD) concept was implemented for the development of MDDC with potential to be incorporated into semisolid dosage form (gel). Quality target product profile (QTPP) and critical quality attributes (CQA) were defined and identified, accordingly. Critical material attributes (CMA) and Critical process parameters (CPP) were identified using quality risk management (QRM) tool, failure mode, effects and criticality analysis (FMECA). CMA and CPP were identified based on results obtained from principal component analysis (PCA-X&Y) and partial least squares (PLS) statistical analysis along with literature data, product and process knowledge and understanding. FMECA identified amount of ethylcellulose, chitosan, acetone, dichloromethane, span 80, tween 80 and water ratio in primary/multiple emulsions as CMA and rotation speed and stirrer type used for organic solvent removal as CPP. The relationship between identified CPP and particle size as CQA was described in the design space using design of experiments - one-factor response surface method. Obtained results from statistically designed experiments enabled establishment of mathematical models and equations that were used for detailed characterization of influence of identified CPP upon MDDC particle size and particle size distribution and their subsequent optimization. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Induced pluripotent stem cells (iPSCs) derived from a symptomatic carrier of a S305I mutation in the microtubule-associated protein tau (MAPT)-gene causing frontotemporal dementia

    Nimsanor, Natakarn; Jørring, Ida; Rasmussen, Mikkel A.

    2016-01-01

    Frontotemporal dementia with parkinsonism linked to chromosome 17q21.2 (FTDP-17) is an autosomal-dominant neurodegenerative disorder. Mutations in the gene coding the microtubule-associated protein tau (MAPT) can cause FTDP-17 but the underlying mechanisms of the disease are still unknown. Induced...

  6. Lack of neural compensatory mechanisms of BDNF val66met met carriers and APOE E4 carriers in healthy aging, mild cognitive impairment, and Alzheimer's disease.

    Gomar, Jesus J; Conejero-Goldberg, Concepcion; Huey, Edward D; Davies, Peter; Goldberg, Terry E

    2016-03-01

    Compromises in compensatory neurobiologic mechanisms due to aging and/or genetic factors (i.e., APOE gene) may influence brain-derived neurotrophic factor (BDNF) val66met polymorphism effects on temporal lobe morphometry and memory performance. We studied 2 cohorts from Alzheimer's Disease Neuroimaging Initiative: 175 healthy subjects and 222 with prodromal and established Alzheimer's disease. Yearly structural magnetic resonance imaging and cognitive performance assessments were carried out over 3 years of follow-up. Both cohorts had similar BDNF Val/Val and Met allele carriers' (including both Val/Met and Met/Met individuals) distribution. In healthy subjects, a significant trend for thinner posterior cingulate and precuneus cortices was detected in Met carriers compared to Val homozygotes in APOE E4 carriers, with large and medium effect sizes, respectively. The mild cognitive impairment/Alzheimer's disease cohort showed a longitudinal decline in entorhinal thickness in BDNF Met carriers compared to Val/Val in APOE E4 carriers, with effect sizes ranging from medium to large. In addition, an effect of BDNF genotype was found in APOE E4 carriers for episodic memory (logical memory and ADAS-Cog) and semantic fluency measures, with Met carriers performing worse in all cases. These findings suggest a lack of compensatory mechanisms in BDNF Met carriers and APOE E4 carriers in healthy and pathological aging. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Enhancement of charge carrier recombination efficiency by utilizing a hole-blocking interlayer in white OLEDs

    Wang Qi; Yu Junsheng; Zhao Juan; Li Ming; Lu Zhiyun

    2013-01-01

    Charge carrier balance and recombination are essential factors relating to the performance of white organic light-emitting devices (WOLEDs). In this study, we discussed the contribution of charge carrier balance in the interlayer-based WOLEDs. By varying the interlayer thickness, the mechanisms of electroluminescent spectral alteration, energy transfer, and especially, charge carrier transport and balance in the devices were investigated and revealed in detail. With a 5 nm thick interlayer tailoring charge carrier transport and recombination, WOLEDs yielded a high power efficiency, current efficiency and external quantum efficiency of 36.1 lm W −1 , 47.1 cd A −1 and 18.3%, respectively. Additionally, single-carrier devices and quantitative analysis were subsequently carried out, demonstrating that the enhancement of carrier recombination efficiency corresponds to the optimization of device performance. (paper)

  8. 29 CFR 1201.1 - Carrier.

    2010-07-01

    ... 29 Labor 4 2010-07-01 2010-07-01 false Carrier. 1201.1 Section 1201.1 Labor Regulations Relating to Labor (Continued) NATIONAL MEDIATION BOARD DEFINITIONS § 1201.1 Carrier. The term carrier includes any express company, sleeping car company, carrier by railroad, subject to the Interstate Commerce Act...

  9. Low-cost carriers fare competition effect

    Carmona Benitez, R.B.; Lodewijks, G.

    2010-01-01

    This paper examines the effects that low-cost carriers (LCC’s) produce when entering new routes operated only by full-service carriers (FSC’s) and routes operated by low-cost carriers in competition with full-service carriers. A mathematical model has been developed to determine what routes should

  10. Bacterial Carriers for Glioblastoma Therapy

    Nalini Mehta

    2017-03-01

    Full Text Available Treatment of aggressive glioblastoma brain tumors is challenging, largely due to diffusion barriers preventing efficient drug dosing to tumors. To overcome these barriers, bacterial carriers that are actively motile and programmed to migrate and localize to tumor zones were designed. These carriers can induce apoptosis via hypoxia-controlled expression of a tumor suppressor protein p53 and a pro-apoptotic drug, Azurin. In a xenograft model of human glioblastoma in rats, bacterial carrier therapy conferred a significant survival benefit with 19% overall long-term survival of >100 days in treated animals relative to a median survival of 26 days in control untreated animals. Histological and proteomic analyses were performed to elucidate the safety and efficacy of these carriers, showing an absence of systemic toxicity and a restored neural environment in treated responders. In the treated non-responders, proteomic analysis revealed competing mechanisms of pro-apoptotic and drug-resistant activity. This bacterial carrier opens a versatile avenue to overcome diffusion barriers in glioblastoma by virtue of its active motility in extracellular space and can lead to tailored therapies via tumor-specific expression of tumoricidal proteins.

  11. Sponge-associated actinobacterial diversity: validation of the methods of actinobacterial DNA extraction and optimization of 16S rRNA gene amplification.

    Yang, Qi; Franco, Christopher M M; Zhang, Wei

    2015-10-01

    Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.

  12. ASPIC: a novel method to predict the exon-intron structure of a gene that is optimally compatible to a set of transcript sequences

    Pesole Graziano

    2005-10-01

    Full Text Available Abstract Background: Currently available methods to predict splice sites are mainly based on the independent and progressive alignment of transcript data (mostly ESTs to the genomic sequence. Apart from often being computationally expensive, this approach is vulnerable to several problems – hence the need to develop novel strategies. Results: We propose a method, based on a novel multiple genome-EST alignment algorithm, for the detection of splice sites. To avoid limitations of splice sites prediction (mainly, over-predictions due to independent single EST alignments to the genomic sequence our approach performs a multiple alignment of transcript data to the genomic sequence based on the combined analysis of all available data. We recast the problem of predicting constitutive and alternative splicing as an optimization problem, where the optimal multiple transcript alignment minimizes the number of exons and hence of splice site observations. We have implemented a splice site predictor based on this algorithm in the software tool ASPIC (Alternative Splicing PredICtion. It is distinguished from other methods based on BLAST-like tools by the incorporation of entirely new ad hoc procedures for accurate and computationally efficient transcript alignment and adopts dynamic programming for the refinement of intron boundaries. ASPIC also provides the minimal set of non-mergeable transcript isoforms compatible with the detected splicing events. The ASPIC web resource is dynamically interconnected with the Ensembl and Unigene databases and also implements an upload facility. Conclusion: Extensive bench marking shows that ASPIC outperforms other existing methods in the detection of novel splicing isoforms and in the minimization of over-predictions. ASPIC also requires a lower computation time for processing a single gene and an EST cluster. The ASPIC web resource is available at http://aspic.algo.disco.unimib.it/aspic-devel/.

  13. 78 FR 66801 - Motor Carrier Safety Advisory Committee; Charter Renewal

    2013-11-06

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2006-26367] Motor Carrier Safety Advisory Committee; Charter Renewal AGENCY: Federal Motor Carrier Safety... and recommendations on motor carrier safety programs and motor carrier safety regulations through a...

  14. Plasmid AZOBR_p1-borne fabG gene for putative 3-oxoacyl-[acyl-carrier protein] reductase is essential for proper assembly and work of the dual flagellar system in the alphaproteobacterium Azospirillum brasilense Sp245.

    Filip'echeva, Yulia A; Shelud'ko, Andrei V; Prilipov, Alexei G; Burygin, Gennady L; Telesheva, Elizaveta M; Yevstigneyeva, Stella S; Chernyshova, Marina P; Petrova, Lilia P; Katsy, Elena I

    2018-02-01

    Azospirillum brasilense can swim and swarm owing to the activity of a constitutive polar flagellum (Fla) and inducible lateral flagella (Laf), respectively. Experimental data on the regulation of the Fla and Laf assembly in azospirilla are scarce. Here, the coding sequence (CDS) AZOBR_p1160043 (fabG1) for a putative 3-oxoacyl-[acyl-carrier protein (ACP)] reductase was found essential for the construction of both types of flagella. In an immotile leaky Fla - Laf - fabG1::Omegon-Km mutant, Sp245.1610, defects in flagellation and motility were fully complemented by expressing the CDS AZOBR_p1160043 from plasmid pRK415. When pRK415 with the cloned CDS AZOBR_p1160045 (fliC) for a putative 65.2 kDa Sp245 Fla flagellin was transferred into the Sp245.1610 cells, the bacteria also became able to assemble a motile single flagellum. Some cells, however, had unusual swimming behavior, probably because of the side location of the organelle. Although the assembly of Laf was not restored in Sp245.1610 (pRK415-p1160045), this strain was somewhat capable of swarming motility. We propose that the putative 3-oxoacyl-[ACP] reductase encoded by the CDS AZOBR_p1160043 plays a role in correct flagellar location in the cell envelope and (or) in flagellar modification(s), which are also required for the inducible construction of Laf and for proper swimming and swarming motility of A. brasilense Sp245.

  15. PMS2 monoallelic mutation carriers: the known unknown.

    Goodenberger, McKinsey L; Thomas, Brittany C; Riegert-Johnson, Douglas; Boland, C Richard; Plon, Sharon E; Clendenning, Mark; Win, Aung Ko; Senter, Leigha; Lipkin, Steven M; Stadler, Zsofia K; Macrae, Finlay A; Lynch, Henry T; Weitzel, Jeffrey N; de la Chapelle, Albert; Syngal, Sapna; Lynch, Patrick; Parry, Susan; Jenkins, Mark A; Gallinger, Steven; Holter, Spring; Aronson, Melyssa; Newcomb, Polly A; Burnett, Terrilea; Le Marchand, Loïc; Pichurin, Pavel; Hampel, Heather; Terdiman, Jonathan P; Lu, Karen H; Thibodeau, Stephen; Lindor, Noralane M

    2016-01-01

    Germ-line mutations in MLH1, MSH2, MSH6, and PMS2 have been shown to cause Lynch syndrome. The penetrance of the cancer and tumor spectrum has been repeatedly studied, and multiple professional societies have proposed clinical management guidelines for affected individuals. Several studies have demonstrated a reduced penetrance for monoallelic carriers of PMS2 mutations compared with the other mismatch repair (MMR) genes, but clinical management guidelines have largely proposed the same screening recommendations for all MMR gene carriers. The authors considered whether enough evidence existed to propose new screening guidelines specific to PMS2 mutation carriers with regard to age at onset and frequency of colonic screening. Published reports of PMS2 germ-line mutations were combined with unpublished cases from the authors' research registries and clinical practices, and a discussion of potential modification of cancer screening guidelines was pursued. A total of 234 monoallelic PMS2 mutation carriers from 170 families were included. Approximately 8% of those with colorectal cancer (CRC) were diagnosed before age 30, and each of these tumors presented on the left side of the colon. As it is currently unknown what causes the early onset of CRC in some families with monoallelic PMS2 germline mutations, the authors recommend against reducing cancer surveillance guidelines in families found having monoallelic PMS2 mutations in spite of the reduced penetrance.Genet Med 18 1, 13-19.

  16. Aromatase expression is increased in BRCA1 mutation carriers

    Chand, Ashwini L; KConFab; Simpson, Evan R; Clyne, Colin D

    2009-01-01

    Until recently, the molecular mechanisms explaining increased incidence of ovarian and breast cancers in carriers of BRCA1 gene mutations had not been clearly understood. Of significance is the finding that BRCA1 negatively regulates aromatase expression in vitro. Our objective was to characterise aromatase gene (CYP19A1) and its promoter expression in breast adipose and ovarian tissue in BRCA1 mutation carriers and unaffected controls. We measured aromatase transcripts, total and promoter-specific (PII, PI.3, PI.4) in prophylactic oophorectomy or mastectomy, therapeutic mastectomy, ovarian and breast tissue from unaffected women. We demonstrate that the lack of functional BRCA1 protein correlates to higher aromatase levels in 85% of BRCA1 mutation carriers. This increase is mediated by aberrant transcriptional regulation of aromatase; in breast adipose by increases in promoter II/I.3 and I.4-specific transcripts; and in the ovary with elevation in promoter I.3 and II-specific transcripts. Understanding the link between BRCA1 and aromatase is significant in terms of understanding why carcinogenesis is restricted to estrogen-producing tissues in BRCA1 mutation carriers

  17. Optimization of a multi-gene HIV-1 recombinant subtype CRF02AG DNA vaccine for expression of multiple immunogenic forms

    Ellenberger, Dennis; Li Bin; Smith, James; Yi Hong; Folks, Thomas; Robinson, Harriet; Butera, Salvatore

    2004-01-01

    We developed an AIDS vaccine for Western and West-Central Africa based on a DNA plasmid vector expressing HIV-1 recombinant subtype CRF02 A G gag, pol, and env genes. To optimize the production of noninfectious HIV-like particles (VLPs) and potentially improve the effectiveness of the vaccine, we generated four potential vaccine constructs: the parental (IC2) and three modifications (IC25, IC48, and IC90) containing mutations within the HIV protease. While the parental construct IC2 expressed aggregates of Gag proteins, the IC25 construct resulted in the production of immature VLPs (the core comprises unprocessed Pr 55Gag ). The remaining two constructs (IC48 and IC90) produced mature VLPs (the core comprises processed capsid p24) in addition to immature VLPs and aggregates of Gag proteins. VLPs incorporated significant levels of mature gp120 envelope glycoprotein. Importantly, the mature VLPs were fusion competent and entered coreceptor-specific target cells. The production of multiple antigenic forms, including fusion-competent VLPs, by candidate DNA vaccine constructs may provide immunologic advantages for induction of protective cellular and humoral responses against HIV-1 proteins

  18. Hot carrier degradation in semiconductor devices

    2015-01-01

    This book provides readers with a variety of tools to address the challenges posed by hot carrier degradation, one of today’s most complicated reliability issues in semiconductor devices.  Coverage includes an explanation of carrier transport within devices and book-keeping of how they acquire energy (“become hot”), interaction of an ensemble of colder and hotter carriers with defect precursors, which eventually leads to the creation of a defect, and a description of how these defects interact with the device, degrading its performance. • Describes the intricacies of hot carrier degradation in modern semiconductor technologies; • Covers the entire hot carrier degradation phenomenon, including topics such as characterization, carrier transport, carrier-defect interaction, technological impact, circuit impact, etc.; • Enables detailed understanding of carrier transport, interaction of the carrier ensemble with the defect precursors, and an accurate assessment of how the newly created defects imp...

  19. ISS qualified thermal carrier equipment

    Deuser, Mark S.; Vellinger, John C.; Jennings, Wm. M.

    2000-01-01

    Biotechnology is undergoing a period of rapid and sustained growth, a trend which is expected to continue as the general population ages and as new medical treatments and products are conceived. As pharmaceutical and biomedical companies continue to search for improved methods of production and, for answers to basic research questions, they will seek out new avenues of research. Space processing on the International Space Station (ISS) offers such an opportunity! Space is rapidly becoming an industrial laboratory for biotechnology research and processing. Space bioprocessing offers exciting possibilities for developing new pharmaceuticals and medical treatments, which can be used to benefit mankind on Earth. It also represents a new economic frontier for the private sector. For over eight years, the thermal carrier development team at SHOT has been working with government and commercial sector scientists who are conducting microgravity experiments that require thermal control. SHOT realized several years ago that the hardware currently being used for microgravity thermal control was becoming obsolete. It is likely that the government, academic, and industrial bioscience community members could utilize SHOT's hardware as a replacement to their current microgravity thermal carrier equipment. Moreover, SHOT is aware of several international scientists interested in utilizing our space qualified thermal carrier. SHOT's economic financing concept could be extremely beneficial to the international participant, while providing a source of geographic return for their particular region. Beginning in 2000, flight qualified thermal carriers are expected to be available to both the private and government sectors. .

  20. Construction of carrier state viruses with partial genomes of the segmented dsRNA bacteriophages

    Sun Yang; Qiao Xueying; Mindich, Leonard

    2004-01-01

    The cystoviridae are bacteriophages with genomes of three segments of dsRNA enclosed within a polyhedral capsid. Two members of this family, PHI6 and PHI8, have been shown to form carrier states in which the virus replicates as a stable episome in the host bacterium while expressing reporter genes such as kanamycin resistance or lacα. The carrier state does not require the activity of all the genes necessary for phage production. It is possible to generate carrier states by infecting cells with virus or by electroporating nonreplicating plasmids containing cDNA copies of the viral genomes into the host cells. We have found that carrier states in both PHI6 and PHI8 can be formed at high frequency with all three genomic segments or with only the large and small segments. The large genomic segment codes for the proteins that constitute the inner core of the virus, which is the structure responsible for the packaging and replication of the genome. In PHI6, a carrier state can be formed with the large and middle segment if mutations occur in the gene for the major structural protein of the inner core. In PHI8, carrier state formation requires the activity of genes 8 and 12 of segment S

  1. Intact working memory in non-manifesting LRRK2 carriers--an fMRI study

    Thaler, A.; Helmich, R.C.G.; Or-Borichev, A.; Nuenen, B.F. van; Shapira-Lichter, I.; Gurevich, T.; Orr-Urtreger, A.; Marder, K.; Bressman, S.; Bloem, B.R.; Giladi, N.; Hendler, T.; Mirelman, A.

    2016-01-01

    Cognitive impairments are prevalent in patients with Parkinson's disease. Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most common cause of genetic Parkinsonism. Non-manifesting carriers of the G2019S mutation in the LRRK2 gene were found to have lower executive functions as

  2. A cognitive fMRI study in non-manifesting LRRK2 and GBA carriers

    Bregman, N.; Thaler, A.; Mirelman, A.; Helmich, R.C.G.; Gurevich, T.; Orr-Urtreger, A.; Marder, K.; Bressman, S.; Bloem, B.R.; Giladi, N.

    2017-01-01

    Mutations in the GBA and LRRK2 genes account for one-third of the prevalence of Parkinson's disease (PD) in Ashkenazi Jews. Non-manifesting carriers (NMC) of these mutations represent a population at risk for future development of PD. PD patient who carry mutations in the GBA gene demonstrates more

  3. High Production of 2,3-Butanediol (2,3-BD by Raoultella ornithinolytica B6 via Optimizing Fermentation Conditions and Overexpressing 2,3-BD Synthesis Genes.

    Taeyeon Kim

    Full Text Available Biological production of 2,3-butandiol (2,3-BD has received great attention as an alternative to the petroleum-based 2,3-BD production. In this study, a high production of 2,3-BD in fed-batch fermentation was investigated with a newly isolated bacterium designated as Raoultella ornithinolytica B6. The isolate produced 2,3-BD as the main product using hexoses (glucose, galactose, and fructose, pentose (xylose and disaccharide (sucrose. The effects of temperature, pH-control schemes, and agitation speeds on 2,3-BD production were explored to optimize the fermentation conditions. Notably, cell growth and 2,3-BD production by R. ornithinolytica B6 were higher at 25°C than at 30°C. When three pH control schemes (no pH control, pH control at 7, and pH control at 5.5 after the pH was decreased to 5.5 during fermentation were tested, the best 2,3-BD titer and productivity along with reduced by-product formation were achieved with pH control at 5.5. Among different agitation speeds (300, 400, and 500 rpm, the optimum agitation speed was 400 rpm with 2,3-BD titer of 68.27 g/L, but acetic acid was accumulated up to 23.32 g/L. Further enhancement of the 2,3-BD titer (112.19 g/L, yield (0.38 g/g, and productivity (1.35 g/L/h as well as a significant reduction of acetic acid accumulation (9.71 g/L was achieved by the overexpression of homologous budABC genes, the 2,3-BD-synthesis genes involved in the conversion of pyruvate to 2,3-BD. This is the first report presenting a high 2,3-BD production by R.ornithinolytica which has attracted little attention with respect to 2,3-BD production, extending the microbial spectrum of 2,3-BD producers.

  4. Efficiency of some spectrochemical carriers

    Gomes, R.P.

    1978-01-01

    A comparative study of the efficiency of some spectrochemical carriers for the quantitative spectrographic analysis of Ag, Al, B, Bi, Cd, Cr, Cu, Fe, Mg, Mn, Mo, Ni, P, Pb, Si, Sn, V and Zn in uranium-base materials is presented. The volatility behavior of the eighteen elements is verified by means of the moving plate technique and each of the mentioned carriers. The best results are obtained with 4% In 2 O 3 , 6% AgCl and 5% NaF in a U 3 O 8 matrix. The sensitivities for some elements were extended to fractions of p.p.m. The precision, accuracy and acceptability of the method are calculated for all elements. The total error values as approximately in the range of 16-45% [pt

  5. Preventative maintenance of straddle carriers

    Si Li

    2015-04-01

    Objectives: The purpose of this industry-driven study is to model preventative maintenance (PM influences on the operational effectiveness of straddle carriers. Method: The study employs historical data consisting of 21 273 work orders covering a 27-month period. Two models are developed, both of which forecast influences of PM regimes for different types of carrier. Results: The findings of the study suggest that the reliability of the straddle fleet decreases with increased intervals of PM services. The study also finds that three factors – namely resources, number of new straddles, and the number of new lifting work centres – influence the performances of straddles. Conclusion: The authors argue that this collaborative research exercise makes a significant contribution to existing supply chain management literature, particularly in the area of operations efficiency. The study also serves as an avenue to enhance relevant management practice.

  6. Distribution of a pseudodeficiency allele among Tay-Sachs carriers

    Tomczak, J.; Grebner, E.E. (Thomas Jefferson Univ., Philadelphia, PA (United States)); Boogen, C. (Univ. of Essen Medical School (Germany))

    1993-08-01

    Recently Triggs-Raine et al. (1992) identified a new mutation in the gene coding for the [alpha]-subunit of [beta]-hexosaminidase A (hex A), the enzyme whose deficiency causes Tay-Sachs disease. This mutation, a C[sub 739]-to-T transition in exon 7, results in an altered enzyme that is active (albeit at reduced levels) in cells but that has essentially no activity in serum. This so-called pseudodeficient allele was first detected in compound heterozygotes who also carried a Tay-Sachs disease allele and therefore had no detectable hex A in their serum but who were in good health. Carriers of this apparently benign mutation are generally indistinguishable from carriers of a lethal mutation by means of routine enzyme-based screening tests, because the product of the pseudodeficient allele is not detectable in serum and has decreased activity in cells. This suggests that some individuals who have been classified as Tay-Sachs carriers are actually carriers of the pseudodeficient allele and are not at risk to have a child affected with Tay-Sachs disease. The pseudodeficient allele may also be responsible for some inconclusive diagnoses, where leukocyte values fall below the normal range but are still above the carrier range. The fact that there are now two mutant alleles (the psuedodeficient and the adult) that are indistinguishable from the lethal infantile mutations by means of enzyme assay yet that are phenotypically very different and that together may account for as much as 12% of enzyme-defined carriers on the basis of the data here suggests that DNA analysis should be part of a comprehensive screening program. It will be particularly useful to identify the mutations in couples at risk, before they undergo prenatal diagnosis. DNA analysis will also resolve some inconclusive diagnoses.

  7. Performance Analysis of Downlink Inter-band Carrier Aggregation in LTE-Advanced

    Wang, Hua; Rosa, Claudio; Pedersen, Klaus

    2011-01-01

    CC can be different. In this paper, we investigate the downlink resource allocation for inter-band CA, i.e., how to assign carrier(s) to different UEs. A simple yet effective G-factor based carrier selection algorithm, which takes both traffic load and radio channel characteristics......Carrier aggregation (CA) is one of the most distinct features for LTE-Advanced systems, which can support a much wider transmission bandwidth up to 100 MHz by aggregating two or more individual component carriers (CCs) belonging to the same (intra-band) or different (inter-band) frequency bands....... With CA, it is possible to schedule a user equipment (UE) on multiple CCs simultaneously. From radio resource management (RRM) perspective, CC selection plays an important role in optimizing the system performance, especially in the case of inter-band CA where the radio propagation characteristics of each...

  8. Protein carriers of conjugate vaccines

    Pichichero, Michael E

    2013-01-01

    The immunogenicity of polysaccharides as human vaccines was enhanced by coupling to protein carriers. Conjugation transformed the T cell-independent polysaccharide vaccines of the past to T cell-dependent antigenic vaccines that were much more immunogenic and launched a renaissance in vaccinology. This review discusses the conjugate vaccines for prevention of infections caused by Hemophilus influenzae type b, Streptococcus pneumoniae, and Neisseria meningitidis. Specifically, the characteristics of the proteins used in the construction of the vaccines including CRM, tetanus toxoid, diphtheria toxoid, Neisseria meningitidis outer membrane complex, and Hemophilus influenzae protein D are discussed. The studies that established differences among and key features of conjugate vaccines including immunologic memory induction, reduction of nasopharyngeal colonization and herd immunity, and antibody avidity and avidity maturation are presented. Studies of dose, schedule, response to boosters, of single protein carriers with single and multiple polysaccharides, of multiple protein carriers with multiple polysaccharides and conjugate vaccines administered concurrently with other vaccines are discussed along with undesirable consequences of conjugate vaccines. The clear benefits of conjugate vaccines in improving the protective responses of the immature immune systems of young infants and the senescent immune systems of the elderly have been made clear and opened the way to development of additional vaccines using this technology for future vaccine products. PMID:23955057

  9. 7 CFR 33.4 - Carrier.

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Carrier. 33.4 Section 33.4 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.4 Carrier. Carrier means any common or...

  10. 8 CFR 217.6 - Carrier agreements.

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Carrier agreements. 217.6 Section 217.6 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS VISA WAIVER PROGRAM § 217... may notify a carrier of the existence of a basis for termination of a carrier agreement under this...

  11. 14 CFR 271.4 - Carrier costs.

    2010-01-01

    ... Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS GUIDELINES FOR SUBSIDIZING AIR CARRIERS PROVIDING ESSENTIAL AIR TRANSPORTATION § 271.4 Carrier costs. (a) The reasonable costs projected for a carrier providing essential air service at an eligible...

  12. 14 CFR 271.5 - Carrier revenues.

    2010-01-01

    ... Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS GUIDELINES FOR SUBSIDIZING AIR CARRIERS PROVIDING ESSENTIAL AIR TRANSPORTATION § 271.5 Carrier revenues. (a) The projected passenger revenue for a carrier providing essential air service at an eligible...

  13. Carrier Distortion in Hysteretic Self-Oscillating Class-D Audio Power

    Høyerby, Mikkel Christian Kofod; Andersen, Michael A. E.

    2009-01-01

    An important distortion mechanism in hysteretic self-oscillating (SO) class-D (switch mode) power amplifiers-–carrier distortion-–is analyzed and an optimization method is proposed. This mechanism is an issue in any power amplifier application where a high degree of proportionality between input...... and output is required, such as in audio power amplifiers or xDSL drivers. From an average-mode point of view, carrier distortion is shown to be caused by nonlinear variation of the hysteretic comparator input average voltage with the output average voltage. This easily causes total harmonic distortion...... figures in excess of 0.1–0.2%, inadequate for high-quality audio applications. Carrier distortion is shown to be minimized when the feedback system is designed to provide a triangular carrier (sliding) signal at the input of a hysteretic comparator. The proposed optimization method is experimentally...

  14. 14 CFR 399.82 - Passing off of carrier identity by affiliation between carriers.

    2010-01-01

    ... forth in paragraph (c) of this section. In such cases the Board may determine in an adjudicatory... carrier shall not engage in joint public relations activities at points served by both carriers which tend... either carrier are performed in common with the other carrier or as part of a single system. In cases...

  15. Quaternized Polyamidoamine Dendrimers as Novel Gene Delivery System: Relationship between Degree of Quaternization and Their Influences

    Lee, Jung Hoon; Lim, Yong beom; Choi, Joon Sig; Choi, Myung Un; Yang, Chul Hak; Park, Jong Sang

    2003-01-01

    Quaternary ammonium groups were introduced to Starburst polyamidoamine (PAMAM) dendrimers for a gene carrier. These quaternary dendritic carriers exhibited reduced cytotoxicity on 293T cells compared to parent dendrimers examined and their transfection efficiency were similar with parent dendrimers. Quaternization could be a promising tool to improve properties of dendrimers as a gene delivery carrier

  16. Non-permeable substrate carrier for electroplating

    Abas, Emmanuel Chua; Chen, Chen-An; Ma, Diana Xiaobing; Ganti, Kalyana Bhargava

    2012-11-27

    One embodiment relates to a substrate carrier for use in electroplating a plurality of substrates. The substrate carrier comprises a non-conductive carrier body on which the substrates are to be held. Electrically-conductive lines are embedded within the carrier body, and a plurality of contact clips are coupled to the electrically-conductive lines embedded within the carrier body. The contact clips hold the substrates in place and electrically couple the substrates to the electrically-conductive lines. The non-conductive carrier body is continuous so as to be impermeable to flow of electroplating solution through the non-conductive carrier body. Other embodiments, aspects and features are also disclosed.

  17. A pseudodeficiency allele common in non-Jewish Tay-Sachs carriers: Implications for carrier screening

    Triggs-Raine, B.L.; Akerman, B.R.; Gravel, R.A. (McGill Univ.-Montreal Children' s Hospital Research Institute, Montreal, Quebec (Canada)); Mules, E.H.; Thomas, G.H.; Dowling, C.E. (Johns Hopkins School of Medicine, Baltimore, MD (United States)); Kaback, M.M.; Lim-Steele, J.S.T. (Univ. of California, San Diego, CA (United States)); Natowicz, M.R. (Eunice Kennedy Shriver Center for Mental Retardation, Waltham, MA (United States)); Grebner, E.E. (Thomas Jefferson Univ., Philadelphia, PA (United States)); Navon, R.R. (Tel-Aviv Univ., Kfar-Sava (Israel)); Welch, J.P. (Dalhousie Univ., Halifax, Nova, Scotia (Canada)); Greenberg, C.R. (Univ. of Manitoba, Winnipeg (Canada))

    1992-10-01

    Deficiency of [beta]-hexosaminidase A (Hex A) activity typically results in Tay-Sachs disease. However, healthy subjects found to be deficient in Hex A activity (i.e., pseudodeficient) by means of in vitro biochemical tests have been described. The authors analyzed the HEXA gene of one pseudodeficient subject and identified both a C[sub 739]-to-T substitution that changes Arg[sub 247][yields]Trp on one allele and a previously identified Tay-Sachs disease mutation of the second allele. Six additional pseudodeficient subjects were found to have the C[sub 739]-to-T but for none of 36 Jewish enzyme-defined carries who did not have one of three known mutations common to this group. The C[sub 739]-to-T allele, together with a [open quotes]true[close quotes] Tay-Sachs disease allele, causes Hex A pseudodeficiency. Given both the large proportion of non-Jewish carriers with this allele and that standard biochemical screening cannot differentiate between heterozygotes for the C[sub 739]-to-T mutations and Tay-Sachs disease carriers, DNA testing for this mutation in at-risk couples is essential. This could prevent unnecessary or incorrect prenatal diagnoses. 40 refs., 3 figs., 4 tabs.

  18. Outcomes for Gestational Carriers Versus Traditional Surrogates in the United States.

    Fuchs, Erika L; Berenson, Abbey B

    2018-05-01

    Little is known about the obstetric and procedural outcomes of traditional surrogates and gestational carriers. Participants included 222 women living in the United States who completed a brief online survey between November 2015 and February 2016. Differences between gestational carriers (n = 204) and traditional surrogates (n = 18) in demographic characteristics, pregnancy outcomes, and procedural outcomes were examined using chi-squared tests, Fisher's exact tests, and t-tests. Out of 248 eligible respondents, 222 surveys were complete, for a response rate of 89.5%. Overall, obstetric outcomes were similar among gestational carriers and traditional surrogates. Traditional surrogates were more likely than gestational carriers to have a Center for Epidemiologic Studies Depression Scale Revised score of 16 or higher (37.5% vs. 4.0%). Gestational carriers reported higher mean compensation ($27,162.80 vs. $17,070.07) and were more likely to travel over 400 miles (46.0% vs. 0.0%) than traditional surrogates. Procedural differences, but not differences in obstetric outcomes, emerged between gestational carriers and traditional surrogates. To ensure that both traditional surrogates and gestational carriers receive optimal medical care, it may be necessary to extend practice guidelines to ensure that traditional surrogates are offered the same level of care offered to gestational carriers.

  19. 76 FR 32390 - Motor Carrier Safety Advisory Committee Public Meeting

    2011-06-06

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2006-26367] Motor Carrier Safety Advisory Committee Public Meeting AGENCY: Federal Motor Carrier Safety Administration (FMCSA), DOT. ACTION: Notice of Motor Carrier Safety Advisory Committee (MCSAC) Meeting. SUMMARY...

  20. 77 FR 46555 - Motor Carrier Safety Advisory Committee: Public Meeting

    2012-08-03

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2006-26367] Motor Carrier Safety Advisory Committee: Public Meeting AGENCY: Federal Motor Carrier Safety Administration (FMCSA), DOT. ACTION: Notice of meeting of Motor Carrier Safety Advisory Committee (MCSAC...

  1. 75 FR 2923 - Motor Carrier Safety Advisory Committee Public Meeting

    2010-01-19

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2006-26367] Motor Carrier Safety Advisory Committee Public Meeting AGENCY: Federal Motor Carrier Safety Administration (FMCSA), DOT. ACTION: Notice of Motor Carrier Safety Advisory Committee Meeting. SUMMARY: FMCSA...

  2. 75 FR 29384 - Motor Carrier Safety Advisory Committee Public Meeting

    2010-05-25

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2010-0143] Motor Carrier Safety Advisory Committee Public Meeting AGENCY: Federal Motor Carrier Safety Administration (FMCSA), DOT. ACTION: Notice of Motor Carrier Safety Advisory Committee meeting. SUMMARY: FMCSA...

  3. 75 FR 72863 - Motor Carrier Safety Advisory Committee Public Meeting

    2010-11-26

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2006-26367] Motor Carrier Safety Advisory Committee Public Meeting AGENCY: Federal Motor Carrier Safety Administration, DOT. ACTION: Notice of Motor Carrier Safety Advisory Committee Meeting. SUMMARY: FMCSA announces...

  4. 75 FR 50797 - Motor Carrier Safety Advisory Committee Public Meeting

    2010-08-17

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2010-0143] Motor Carrier Safety Advisory Committee Public Meeting AGENCY: Federal Motor Carrier Safety Administration (FMCSA), DOT. ACTION: Notice of Motor Carrier Safety Advisory Committee Meeting. SUMMARY: FMCSA...

  5. Improving accuracy of Tay Sachs carrier screening of the non-Jewish population: analysis of 34 carriers and six late-onset patients with HEXA enzyme and DNA sequence analysis.

    Park, Noh Jin; Morgan, Craig; Sharma, Rajesh; Li, Yuanyin; Lobo, Raynah M; Redman, Joy B; Salazar, Denise; Sun, Weimin; Neidich, Julie A; Strom, Charles M

    2010-02-01

    The purpose of this study was to determine whether combining different testing modalities namely beta-hexosaminidase A (HEXA) enzyme analysis, HEXA DNA common mutation assay, and HEXA gene sequencing could improve the sensitivity for carrier detection in non-Ashkenazi (AJ) individuals. We performed a HEXA gene sequencing assay, a HEXA DNA common mutation assay, and a HEXA enzyme assay on 34 self-reported Tay-Sachs disease (TSD) carriers, six late-onset patients with TSD, and one pseudodeficiency allele carrier. Sensitivity of TSD carrier detection was 91% for gene sequencing compared with 91% for the enzyme assay and 52% for the DNA mutation assay. Gene sequencing combined with enzyme testing had the highest sensitivity (100%) for carrier detection. Gene sequencing detected four novel mutations, three of which are predicted to be disease causing [118.delT, 965A-->T (D322V), and 775A-->G (T259A)]. Gene sequencing is useful in identifying rare mutations in patients with TSD and their families, in evaluating spouses of known carriers for TSD who have indeterminate enzyme analysis and negative for common mutation analysis, and in resolving ambiguous enzyme testing results.

  6. Wuestite - a solar energy carrier

    Weidenkaff, A; Nueesch, P; Wokaun, A [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Reller, A [Hamburg Univ., Hamburg (Germany)

    1997-06-01

    Hydrogen is produced when Wuestite (Fe{sub 1-y}O) is oxidised by water. This reaction is part of a two-step thermochemical metal oxide cycle for the storage of solar energy in the form of chemical energy carriers, characterised by a high chemical potential. The reaction was studied in a tubular furnace with on-line gas analysis and further characterised in detail by DTA und high-temperature X-ray powder diffraction. The influence of non-stoichiometry, morphology and temperature on the mechanism and kinetics of the water-splitting reaction was determined. (author) 3 figs., tabs., 3 refs.

  7. Gene profile analysis of osteoblast genes differentially regulated by histone deacetylase inhibitors

    Lamblin Anne-Francoise

    2007-10-01

    Full Text Available Abstract Background Osteoblast differentiation requires the coordinated stepwise expression of multiple genes. Histone deacetylase inhibitors (HDIs accelerate the osteoblast differentiation process by blocking the activity of histone deacetylases (HDACs, which alter gene expression by modifying chromatin structure. We previously demonstrated that HDIs and HDAC3 shRNAs accelerate matrix mineralization and the expression of osteoblast maturation genes (e.g. alkaline phosphatase, osteocalcin. Identifying other genes that are differentially regulated by HDIs might identify new pathways that contribute to osteoblast differentiation. Results To identify other osteoblast genes that are altered early by HDIs, we incubated MC3T3-E1 preosteoblasts with HDIs (trichostatin A, MS-275, or valproic acid for 18 hours in osteogenic conditions. The promotion of osteoblast differentiation by HDIs in this experiment was confirmed by osteogenic assays. Gene expression profiles relative to vehicle-treated cells were assessed by microarray analysis with Affymetrix GeneChip 430 2.0 arrays. The regulation of several genes by HDIs in MC3T3-E1 cells and primary osteoblasts was verified by quantitative real-time PCR. Nine genes were differentially regulated by at least two-fold after exposure to each of the three HDIs and six were verified by PCR in osteoblasts. Four of the verified genes (solute carrier family 9 isoform 3 regulator 1 (Slc9a3r1, sorbitol dehydrogenase 1, a kinase anchor protein, and glutathione S-transferase alpha 4 were induced. Two genes (proteasome subunit, beta type 10 and adaptor-related protein complex AP-4 sigma 1 were suppressed. We also identified eight growth factors and growth factor receptor genes that are significantly altered by each of the HDIs, including Frizzled related proteins 1 and 4, which modulate the Wnt signaling pathway. Conclusion This study identifies osteoblast genes that are regulated early by HDIs and indicates pathways that

  8. Optimization and Optimal Control

    Chinchuluun, Altannar; Enkhbat, Rentsen; Tseveendorj, Ider

    2010-01-01

    During the last four decades there has been a remarkable development in optimization and optimal control. Due to its wide variety of applications, many scientists and researchers have paid attention to fields of optimization and optimal control. A huge number of new theoretical, algorithmic, and computational results have been observed in the last few years. This book gives the latest advances, and due to the rapid development of these fields, there are no other recent publications on the same topics. Key features: Provides a collection of selected contributions giving a state-of-the-art accou

  9. Optimally Stopped Optimization

    Vinci, Walter; Lidar, Daniel

    We combine the fields of heuristic optimization and optimal stopping. We propose a strategy for benchmarking randomized optimization algorithms that minimizes the expected total cost for obtaining a good solution with an optimal number of calls to the solver. To do so, rather than letting the objective function alone define a cost to be minimized, we introduce a further cost-per-call of the algorithm. We show that this problem can be formulated using optimal stopping theory. The expected cost is a flexible figure of merit for benchmarking probabilistic solvers that can be computed when the optimal solution is not known, and that avoids the biases and arbitrariness that affect other measures. The optimal stopping formulation of benchmarking directly leads to a real-time, optimal-utilization strategy for probabilistic optimizers with practical impact. We apply our formulation to benchmark the performance of a D-Wave 2X quantum annealer and the HFS solver, a specialized classical heuristic algorithm designed for low tree-width graphs. On a set of frustrated-loop instances with planted solutions defined on up to N = 1098 variables, the D-Wave device is between one to two orders of magnitude faster than the HFS solver.

  10. Construction and Biological Evaluation of a Novel Integrin ανβ3-Specific Carrier for Targeted siRNA Delivery In Vitro

    Xueqi Chen

    2017-02-01

    Full Text Available (1 Background: The great potential of RNA interference (RNAi-based gene therapy is premised on the effective delivery of small interfering RNAs (siRNAs to target tissues and cells. Hence, we aimed at developing and examining a novel integrin αvβ3-specific delivery carrier for targeted transfection of siRNA to malignant tumor cells; (2 Methods: Arginine-glycine-aspartate motif (RGD was adopted as a tissue target for specific recognition of integrin αvβ3. To enable siRNA binding, a chimeric peptide was synthesized by adding nonamer arginine residues (9R at the carboxy terminus of cyclic-RGD dimer, designated as c(RGD2-9R. The efficiency of 9R peptide transferring siRNA was biologically evaluated in vitro by flow cytometry, confocal microscopy, and Western blot; (3 Results: An optimal 10:1 molar ratio of c(RGD2-9R to siRNA was confirmed by the electrophoresis on agarose gels. Both the flow cytometry and confocal microscopy results testified that transfection of c(RGD2-9R as an siRNA delivery carrier was obviously higher than the naked-siRNA group. The results of Western blot demonstrated that these 9R peptides were able to transduce siRNA to HepG2 cells in vitro, resulting in efficient gene silencing; and (4 Conclusion: The chimeric peptide of c(RGD2-9R can be developed as an effective siRNA delivery carrier and shows potential as a new strategy for RNAi-based gene therapy.

  11. Mode of transgene expression after fusion to early or late viral genes of a conditionally replicating adenovirus via an optimized internal ribosome entry site in vitro and in vivo

    Rivera, Angel A.; Wang Minghui; Suzuki, Kaori; Uil, Taco G.; Krasnykh, Victor; Curiel, David T.; Nettelbeck, Dirk M.

    2004-01-01

    The expression of therapeutic genes by oncolytic viruses is a promising strategy to improve viral oncolysis, to augment gene transfer compared with a nonreplicating adenoviral vector, or to combine virotherapy and gene therapy. Both the mode of transgene expression and the locale of transgene insertion into the virus genome critically determine the efficacy of this approach. We report here on the properties of oncolytic adenoviruses which contain the luciferase cDNA fused via an optimized internal ribosome entry site (IRES) to the immediate early adenoviral gene E1A (AdΔE1AIL), the early gene E2B (AdΔE2BIL), or the late fiber gene (AdΔfiberIL). These viruses showed distinct kinetics of transgene expression and luciferase activity. Early after infection, luciferase activities were lower for these viruses, especially for AdΔE2BIL, compared with nonreplicating AdTL, which contained the luciferase gene expressed from the strong CMV promoter. However, 6 days after infection, luciferase activities were approximately four (AdΔE1AIL) to six (AdΔfiberIL) orders of magnitude higher than for AdTL, reflecting virus replication and efficient transgene expression. Similar results were obtained in vivo after intratumoral injection of AdΔE2BIL, AdΔfiberIL, and AdTL. AdΔfiberIL and the parental virus, Ad5-Δ24, resulted in similar cytotoxicity, but AdΔE2BIL and AdΔE1AIL were slightly attenuated. Disruption of the expression of neighboring viral genes by insertion of the transgene was minimal for AdΔE2BIL and AdΔfiberIL, but substantial for AdΔE1AIL. Our observations suggest that insertion of IRES-transgene cassettes into viral transcription units is an attractive strategy for the development of armed oncolytic adenoviruses with defined kinetics and strength of transgene expression

  12. Graphene materials as 2D non-viral gene transfer vector platforms.

    Vincent, M; de Lázaro, I; Kostarelos, K

    2017-03-01

    Advances in genomics and gene therapy could offer solutions to many diseases that remain incurable today, however, one of the critical reasons halting clinical progress is due to the difficulty in designing efficient and safe delivery vectors for the appropriate genetic cargo. Safety and large-scale production concerns counter-balance the high gene transfer efficiency achieved with viral vectors, while non-viral strategies have yet to become sufficiently efficient. The extraordinary physicochemical, optical and photothermal properties of graphene-based materials (GBMs) could offer two-dimensional components for the design of nucleic acid carrier systems. We discuss here such properties and their implications for the optimization of gene delivery. While the design of such vectors is still in its infancy, we provide here an exhaustive and up-to-date analysis of the studies that have explored GBMs as gene transfer vectors, focusing on the functionalization strategies followed to improve vector performance and on the biological effects attained.

  13. Methane biofiltration using autoclaved aerated concrete as the carrier material.

    Ganendra, Giovanni; Mercado-Garcia, Daniel; Hernandez-Sanabria, Emma; Boeckx, Pascal; Ho, Adrian; Boon, Nico

    2015-09-01

    The methane removal capacity of mixed methane-oxidizing bacteria (MOB) culture in a biofilter setup using autoclaved aerated concrete (AAC) as a highly porous carrier material was tested. Batch experiment was performed to optimize MOB immobilization on AAC specimens where optimum methane removal was obtained when calcium chloride was not added during bacterial inoculation step and 10-mm-thick AAC specimens were used. The immobilized MOB could remove methane at low concentration (~1000 ppmv) in a biofilter setup for 127 days at average removal efficiency (RE) of 28.7 %. Unlike a plug flow reactor, increasing the total volume of the filter by adding a biofilter in series did not result in higher total RE. MOB also exhibited a higher abundance at the bottom of the filter, in proximity with the methane gas inlet where a high methane concentration was found. Overall, an efficient methane biofilter performance could be obtained using AAC as the carrier material.

  14. Silicon nanowire hot carrier electroluminescence

    Plessis, M. du, E-mail: monuko@up.ac.za; Joubert, T.-H.

    2016-08-31

    Avalanche electroluminescence from silicon pn junctions has been known for many years. However, the internal quantum efficiencies of these devices are quite low due to the indirect band gap nature of the semiconductor material. In this study we have used reach-through biasing and SOI (silicon-on-insulator) thin film structures to improve the internal power efficiency and the external light extraction efficiency. Both continuous silicon thin film pn junctions and parallel nanowire pn junctions were manufactured using a custom SOI technology. The pn junctions are operated in the reach-through mode of operation, thus increasing the average electric field within the fully depleted region. Experimental results of the emission spectrum indicate that the most dominant photon generating mechanism is due to intraband hot carrier relaxation processes. It was found that the SOI nanowire light source external power efficiency is at least an order of magnitude better than the comparable bulk CMOS (Complementary Metal Oxide Semiconductor) light source. - Highlights: • We investigate effect of electric field on silicon avalanche electroluminescence. • With reach-through pn junctions the current and carrier densities are kept constant. • Higher electric fields increase short wavelength radiation. • Higher electric fields decrease long wavelength radiation. • The effect of the electric field indicates intraband transitions as main mechanism.

  15. Phenobarbital use and neurological problems in FMR1 premutation carriers.

    Saldarriaga, Wilmar; Lein, Pamela; González Teshima, Laura Yuriko; Isaza, Carolina; Rosa, Lina; Polyak, Andrew; Hagerman, Randi; Girirajan, Santhosh; Silva, Marisol; Tassone, Flora

    2016-03-01

    Fragile X Syndrome (FXS) is a neurodevelopmental disorder caused by a CGG expansion in the FMR1 gene located at Xq27.3. Patients with the premutation in FMR1 present specific clinical problems associated with the number of CGG repeats (55-200 CGG repeats). Premutation carriers have elevated FMR1 mRNA expression levels, which have been associated with neurotoxicity potentially causing neurodevelopmental problems or neurological problems associated with aging. However, cognitive impairments or neurological problems may also be related to increased vulnerability of premutation carriers to neurotoxicants, including phenobarbital. Here we present a study of three sisters with the premutation who were exposed differentially to phenobarbital therapy throughout their lives, allowing us to compare the neurological effects of this drug in these patients. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Rapid and targeted introgression of genes into popular wheat cultivars using marker-assisted background selection.

    Harpinder S Randhawa

    Full Text Available A marker-assisted background selection (MABS-based gene introgression approach in wheat (Triticum aestivum L. was optimized, where 97% or more of a recurrent parent genome (RPG can be recovered in just two backcross (BC generations. A four-step MABS method was developed based on 'Plabsim' computer simulations and wheat genome structure information. During empirical optimization of this method, double recombinants around the target gene were selected in a step-wise fashion during the two BC cycles followed by selection for recurrent parent genotype on non-carrier chromosomes. The average spacing between carrier chromosome markers was <4 cM. For non-carrier chromosome markers that flanked each of the 48 wheat gene-rich regions, this distance was approximately 12 cM. Employed to introgress seedling stripe rust (Puccinia striiformis f. sp. tritici resistance gene Yr15 into the spring wheat cultivar 'Zak', marker analysis of 2,187 backcross-derived progeny resulted in the recovery of a BC(2F(2ratio3 plant with 97% of the recurrent parent genome. In contrast, only 82% of the recurrent parent genome was recovered in phenotypically selected BC(4F(7 plants developed without MABS. Field evaluation results from 17 locations indicated that the MABS-derived line was either equal or superior to the recurrent parent for the tested agronomic characteristics. Based on these results, MABS is recommended as a strategy for rapidly introgressing a targeted gene into a wheat genotype in just two backcross generations while recovering 97% or more of the recurrent parent genotype.

  17. Low-complexity Joint Sub-carrier Phase Noise Compensation for Digital Multi-carrier Systems

    Yankov, Metodi Plamenov; Barletta, Luca; Zibar, Darko

    2017-01-01

    Joint sub-carrier phase noise processing is proposed which recovers the SNR penalty related to decreased sub-carrier baudrate w.r.t. single carrier systems. The method enables digital sub-banding to be safely employed for nonlinear mitigation for modulation formats of up to 256-QAM.......Joint sub-carrier phase noise processing is proposed which recovers the SNR penalty related to decreased sub-carrier baudrate w.r.t. single carrier systems. The method enables digital sub-banding to be safely employed for nonlinear mitigation for modulation formats of up to 256-QAM....

  18. Inert carriers for column extraction chromatography

    Katykhin, G.S.

    1978-01-01

    Inert carriers used in column extraction chromatography are reviewed. Such carriers are devided into two large groups: hydrophilic carriers which possess high surface energy and are well wetted only with strongly polar liquids (kieselguhrs, silica gels, glasses, cellulose, Al 2 O 3 ) and water-repellent carriers which possess low surface energy and are well wetted with various organic solvents (polyethylene, polytetrafluorethylene polytrifluorochlorethylene). Properties of various carriers are presented: structure, chemical and radiation stability, adsorption properties, extracting agent capacity. The effect of structure and sizes of particles on the efficiency of chromatography columns is considered. Ways of immovable phase deposition on the carrier and the latter's regeneration. Peculiarities of column packing for preparative and continuous chromatography are discussed

  19. Skewed X-chromosome inactivation in female carriers of dyskeratosis congenita

    Devriendt, K.; Matthijs, G.; Legius, E. [Univ. Hospital Gasthuisberg, Leuven (Belgium)] [and others

    1997-03-01

    In this study, we report on a family with X-linked dyskeratosis congenita (DC). Linkage analysis with markers in the factor VIII gene at Xq28 yielded a LOD score of 2 at a recombination of 0. Clinical manifestations of DC, such as skin lesions following the Blaschko lines, were present in two obligate carrier females. Highly skewed X inactivation was observed in white blood cells, cultured skin fibroblasts, and buccal mucosa from female carriers of DC in this family. This suggests a critical role for the DC gene in bone marrow-cell and fibroblast-cell proliferation. 23 refs., 4 figs., 1 tab.

  20. Aerial Logistics Management for Carrier Onboard Delivery

    2016-09-01

    NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY by Samuel L. Chen September 2016...AND SUBTITLE AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY 5. FUNDING NUMBERS 6. AUTHOR(S) Samuel L. Chen 7. PERFORMING ORGANIZATION NAME(S...delivery (COD) is the use of aircraft to transport people and cargo from a forward logistics site (FLS) to a carrier strike group (CSG). The goal of

  1. Both Hemophilia Health Care Providers and Hemophilia A Carriers Report that Carriers have Excessive Bleeding

    Paroskie, Allison; Oso, Olatunde; DeBaun, Michael R.; Sidonio, Robert F

    2014-01-01

    Introduction Hemophilia A, the result of reduced factor VIII (FVIII) activity, is an X-linked recessive bleeding disorder. Previous reports of Hemophilia A carriers suggest an increased bleeding tendency. Our objective was to determine the attitudes and understanding of the Hemophilia A carrier bleeding phenotype, and opinions regarding timing of carrier testing from the perspective of both medical providers and affected patients. Data from this survey was used as preliminary data for an ongoing prospective study. Material and Methods An electronic survey was distributed to physicians and nurses employed at Hemophilia Treatment Centers (HTC), and Hemophilia A carriers who were members of Hemophilia Federation of America. Questions focused on the clinical understanding of bleeding symptoms and management of Hemophilia A carriers, and the timing and intensity of carrier testing. Results Our survey indicates that 51% (36/51) of providers compared to 78% (36/46) of carriers believe that Hemophilia A carriers with normal FVIII activity have an increased bleeding tendency (pHemophilia A carriers report a high frequency of bleeding symptoms. Regarding carrier testing, 72% (50/69) of medical providers recommend testing after 14 years of age, conversely 65% (29/45) of Hemophilia A carriers prefer testing to be done prior to this age (pHemophilia A carriers self-report a higher frequency of bleeding than previously acknowledged, and have a preference for earlier testing to confirm carrier status. PMID:24309601

  2. Symptomatic lipid storage in carriers for the PNPLA2 gene

    Janssen, M.C.H.; Engelen, B.G.M. van; Kapusta, L.; Lammens, M.M.; Dijk, M.; Fischer, J.; Graaf, M. van der; Wevers, R.A.; Fahrleitner, M.; Zimmermann, R.; Morava, E.

    2013-01-01

    Neutral lipid storage disease comprises a heterogeneous group of inherited disorders characterized by severe accumulation of cytoplasmic triglyceride droplets in several tissues and neutrophils. A novel type of autosomal recessive lipid myopathy due to PNPLA2 mutations was recently described with

  3. Cyclodextrins in drug carrier systems.

    Uekama, K; Otagiri, M

    1987-01-01

    One of the important characteristics of cyclodextrins is the formation of an inclusion complex with a variety of drug molecules in solution and in the solid state. As a consequence of intensive basic research, exhaustive toxic studies, and realization of industrial production during the past decade, there seem to be no more barriers for the practical application of natural cyclodextrins in the biomedical field. Recently, a number of cyclodextrin derivatives and cyclodextrin polymers have been prepared to obtain better inclusion abilities than parent cyclodextrins. The natural cyclodextrins and their synthetic derivatives have been successfully utilized to improve various drug properties, such as solubility, dissolution and release rates, stability, or bioavailability. In addition, the enhancement of drug activity, selective transfer, or the reduction of side effects has been achieved by means of inclusion complexation. The drug-cyclodextrin complex is generally formed outside of the body and, after administration, it dissociates, releasing the drug into the organism in a fast and nearly uniform manner. In the biomedical application of cyclodextrins, therefore, particular attention should be directed to the magnitude of the stability constant of the inclusion complex. In the case of parenteral application, a rather limited amount of work has been done because the cyclodextrins in the drug carrier systems have to be more effectively designed to compete with various biological components in the circulatory system. However, the works published thus far apparently indicate that the inclusion phenomena of cyclodextrin analogs may allow the rational design of drug formulation and that the combination of molecular encapsulation with other carrier systems will become a very effective and valuable method for the development of a new drug delivery system in the near future.

  4. Healthy versus Entorhinal Cortical Atrophy Identification in Asymptomatic APOE4 Carriers at Risk for Alzheimer's Disease.

    Konishi, Kyoko; Joober, Ridha; Poirier, Judes; MacDonald, Kathleen; Chakravarty, Mallar; Patel, Raihaan; Breitner, John; Bohbot, Véronique D

    2018-01-01

    Early detection of Alzheimer's disease (AD) has been challenging as current biomarkers are invasive and costly. Strong predictors of future AD diagnosis include lower volume of the hippocampus and entorhinal cortex, as well as the ɛ4 allele of the Apolipoprotein E gene (APOE) gene. Therefore, studying functions that are critically mediated by the hippocampus and entorhinal cortex, such as spatial memory, in APOE ɛ4 allele carriers, may be key to the identification of individuals at risk of AD, prior to the manifestation of cognitive impairments. Using a virtual navigation task developed in-house, specifically designed to assess spatial versus non-spatial strategies, the current study is the first to differentiate functional and structural differences within APOE ɛ4 allele carriers. APOE ɛ4 allele carriers that predominantly use non-spatial strategies have decreased fMRI activity in the hippocampus and increased atrophy in the hippocampus, entorhinal cortex, and fimbria compared to APOE ɛ4 allele carriers who use spatial strategies. In contrast, APOE ɛ4 allele carriers who use spatial strategies have grey matter levels comparable to non-APOE ɛ4 allele carriers. Furthermore, in a leave-one-out analysis, grey matter in the entorhinal cortex could predict navigational strategy with 92% accuracy.

  5. Genes and Gene Therapy

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  6. Carrier-carrier relaxation kinetics in quantum well semiconductor structures with nonparabolic energy bands

    Dery, H.; Tromborg, Bjarne; Eisenstein, G.

    2003-01-01

    We describe carrier-carrier scattering dynamics in an inverted quantum well structure including the nonparabolic nature of the valance band. A solution of the semiconductor Bloch equations yields strong evidence to a large change in the temporal evolution of the carrier distributions compared to ...

  7. Facilitated transport of hydrophilic salts by mixtures of anion and cation carriers and by ditopic carriers

    Chrisstoffels, L.A.J.; de Jong, Feike; Reinhoudt, David; Sivelli, Stefano; Gazzola, Licia; Casnati, Alessandro; Ungaro, Rocco

    1999-01-01

    Anion transfer to the membrane phase affects the extraction efficiency of salt transport by cation carriers 1 and 3. Addition of anion receptors 5 or 6 to cation carriers 1, 3, or 4 in the membrane phase enhances the transport of salts under conditions in which the cation carriers alone do not

  8. Driver citation/carrier data relationship project

    1996-09-01

    The Driver/Carrier Relationship Project was commissioned to address three issues. The first was to determine if drivers of commercial motor vehicles get tickets at a different rate, depending on the carrier that they are working for. The second issue...

  9. Method and apparatus for information carrier authentication

    2015-01-01

    The present invention relates to a method of enabling authentication of an information carrier, the information carrier comprising a writeable part and a physical token arranged to supply a response upon receiving a challenge, the method comprising the following steps; applying a first challenge to

  10. Immobilisation of Acinetobacter calcoaceticus using natural carriers

    2005-04-02

    Apr 2, 2005 ... and Cloete, 1995) or ceramic (Kariminiaae-Hamedaani et al.,. 2003) carriers. Besides the synthetic carriers, natural zeolite. (NZ) has been shown as a .... ing 9 mℓ of sterile distilled water, crushed with a sterile glass rod and dispersed by mixing (2 700 r/min for 10 min using the test tube shaker Kartell TK3S) ...

  11. High capacity carrier ethernet transport networks

    Rasmussen, Anders; Zhang, Jiang; Yu, Hao

    2009-01-01

    OAM functions, survivability and the increased bandwidth requirements of carrier class systems. This article provides an overview of PBB-TE and T-MPLS and demonstrates how IPTV services can be realized in the framework of Carrier Ethernet. In addition we provide a case study on performing bit error...

  12. Providing resilience for carrier ethernet multicast traffic

    Ruepp, Sarah Renée; Wessing, Henrik; Zhang, Jiang

    2009-01-01

    This paper presents an overview of the Carrier Ethernet technology with specific focus on resilience. In particular, we detail how multicast traffic, which is essential for e.g. IPTV can be protected. We present Carrier Ethernet resilience methods for linear and ring networks and show by simulation...

  13. Inert carrier drying and coating process

    1980-01-01

    An inert carrier process is described for drying radioactive (particularly low level) waste material and for incorporating the dry material into a binder matrix from which the dried material will not be leached. Experimental details, and examples of the carrier and binder materials, are given. (U.K.)

  14. Safety requirements for the Pu carriers

    Mishima, H.

    1993-01-01

    Ministry of Transport of Japan has now set about studying requirements for Pu carriers to ensure safety. It was first studied what the basic concept of safe carriage of Pu should be, and the basic ideas have been worked out. Next the requirements for the Pu carriers were studied based on the above. There are at present no international requirements of construction and equipment for the nuclear-material carriers, but MOT of Japan has so far required special construction and equipment for the nuclear-material carriers which carry a large amount of radioactive material, such as spent fuel or low level radioactive waste, corresponding to the level of the respective potential hazard. The requirements of construction and equipment of the Pu carriers have been established considering the difference in heat generation between Pu and spent fuel, physical protection, and so forth, in addition to the above basic concept. (J.P.N.)

  15. Direct Effect of Dielectric Surface Energy on Carrier Transport in Organic Field-Effect Transistors.

    Zhou, Shujun; Tang, Qingxin; Tian, Hongkun; Zhao, Xiaoli; Tong, Yanhong; Barlow, Stephen; Marder, Seth R; Liu, Yichun

    2018-05-09

    The understanding of the characteristics of gate dielectric that leads to optimized carrier transport remains controversial, and the conventional studies applied organic semiconductor thin films, which introduces the effect of dielectric on the growth of the deposited semiconductor thin films and hence only can explore the indirect effects. Here, we introduce pregrown organic single crystals to eliminate the indirect effect (semiconductor growth) in the conventional studies and to undertake an investigation of the direct effect of dielectric on carrier transport. It is shown that the matching of the polar and dispersive components of surface energy between semiconductor and dielectric is favorable for higher mobility. This new empirical finding may show the direct relationship between dielectric and carrier transport for the optimized mobility of organic field-effect transistors and hence show a promising potential for the development of next-generation high-performance organic electronic devices.

  16. Stigmatization of carrier status: social implications of heterozygote genetic screening programs.

    Kenen, R H; Schmidt, R M

    1978-01-01

    Possible latent psychological and social consequences ensuing from genetic screening programs need to be investigated during the planning phase of national genetic screening programs. The relatively few studies which have been performed to determine psychological, social, and economic consequences resulting from a genetic screening program are reviewed. Stigmatization of carrier-status, having major psychosocial implications in heterozygote genetic screening programs, is discussed and related to Erving Goffman's work in the area of stigmatization. Questions are raised regarding the relationship between such variables as religiosity and sex of the individual and acceptance of the status of newly identified carrier of a mutant gene. Severity of the deleterious gene and visibility of the carrier status are two important factors to consider in an estimation of potential stigma. Specific implications are discussed for four genetic diseases: Tay-Sachs, Sickle-Cell Anemia, Huntington's disease and Hemophilia. PMID:152585

  17. Mitochondrial glutamate carriers from Drosophila melanogaster: biochemical, evolutionary and modeling studies.

    Lunetti, Paola; Cappello, Anna Rita; Marsano, René Massimiliano; Pierri, Ciro Leonardo; Carrisi, Chiara; Martello, Emanuela; Caggese, Corrado; Dolce, Vincenza; Capobianco, Loredana

    2013-10-01

    The mitochondrial carriers are members of a family of transport proteins that mediate solute transport across the inner mitochondrial membrane. Two isoforms of the glutamate carriers, GC1 and GC2 (encoded by the SLC25A22 and SLC25A18 genes, respectively), have been identified in humans. Two independent mutations in SLC25A22 are associated with severe epileptic encephalopathy. In the present study we show that two genes (CG18347 and CG12201) phylogenetically related to the human GC encoding genes are present in the D. melanogaster genome. We have functionally characterized the proteins encoded by CG18347 and CG12201, designated as DmGC1p and DmGC2p respectively, by overexpression in Escherichia coli and reconstitution into liposomes. Their transport properties demonstrate that DmGC1p and DmGC2p both catalyze the transport of glutamate across the inner mitochondrial membrane. Computational approaches have been used in order to highlight residues of DmGC1p and DmGC2p involved in substrate binding. Furthermore, gene expression analysis during development and in various adult tissues reveals that CG18347 is ubiquitously expressed in all examined D. melanogaster tissues, while the expression of CG12201 is strongly testis-biased. Finally, we identified mitochondrial glutamate carrier orthologs in 49 eukaryotic species in order to attempt the reconstruction of the evolutionary history of the glutamate carrier function. Comparison of the exon/intron structure and other key features of the analyzed orthologs suggests that eukaryotic glutamate carrier genes descend from an intron-rich ancestral gene already present in the common ancestor of lineages that diverged as early as bilateria and radiata. © 2013.

  18. Reversible electron–hole separation in a hot carrier solar cell

    Limpert, S; Bremner, S; Linke, H

    2015-01-01

    Hot-carrier solar cells are envisioned to utilize energy filtering to extract power from photogenerated electron–hole pairs before they thermalize with the lattice, and thus potentially offer higher power conversion efficiency compared to conventional, single absorber solar cells. The efficiency of hot-carrier solar cells can be expected to strongly depend on the details of the energy filtering process, a relationship which to date has not been satisfactorily explored. Here, we establish the conditions under which electron–hole separation in hot-carrier solar cells can occur reversibly, that is, at maximum energy conversion efficiency. We thus focus our analysis on the internal operation of the hot-carrier solar cell itself, and in this work do not consider the photon-mediated coupling to the Sun. After deriving an expression for the voltage of a hot-carrier solar cell valid under conditions of both reversible and irreversible electrical operation, we identify separate contributions to the voltage from the thermoelectric effect and the photovoltaic effect. We find that, under specific conditions, the energy conversion efficiency of a hot-carrier solar cell can exceed the Carnot limit set by the intra-device temperature gradient alone, due to the additional contribution of the quasi-Fermi level splitting in the absorber. We also establish that the open-circuit voltage of a hot-carrier solar cell is not limited by the band gap of the absorber, due to the additional thermoelectric contribution to the voltage. Additionally, we find that a hot-carrier solar cell can be operated in reverse as a thermally driven solid-state light emitter. Our results help explore the fundamental limitations of hot-carrier solar cells, and provide a first step towards providing experimentalists with a guide to the optimal configuration of devices. (paper)

  19. Methanol as an energy carrier

    Biedermann, P.; Grube, T.; Hoehlein, B. (eds.)

    2006-07-01

    For the future, a strongly growing energy demand is expected in the transport sector worldwide. Economically efficient oil production will run through a maximum in the next decade. Higher fuel prices and an environmentally desirable reduction of emissions will increase the pressure for reducing fuel consumption and emissions in road traffic. These criteria show the urgent necessity of structural changes in the fuel market. Due to its advantages concerning industrial-scale production, storage and global availability, methanol has the short- to medium-term potential for gaining increased significance as a substitution product in the energy market. Methanol can be produced both from fossil energy sources and from biomass or waste materials through the process steps of synthesis gas generation with subsequent methanol synthesis. Methanol has the potential to be used in an environmentally friendly manner in gasoline/methanol mixtures for flexible fuel vehicles with internal combustion engines and in diesel engines with pure methanol. Furthermore, it can be used in fuel cell vehicles with on-board hydrogen production in direct methanol fuel cell drives, and in stationary systems for electricity and heat generation as well as for hydrogen production. Finally, in portable applications it serves as an energy carrier for electric power generation. In this book, the processes for the production and use of methanol are presented and evaluated, markets and future options are discussed and issues of safety and environmental impacts are addressed by a team of well-known authors. (orig.)

  20. First description of Cryptosporidium parvum in carrier pigeons (Columba livia).

    Oliveira, Bruno César Miranda; Ferrari, Elis Domingos; da Cruz Panegossi, Mariele Fernanda; Nakamura, Alex Akira; Corbucci, Flávio Sader; Nagata, Walter Bertequini; Dos Santos, Bianca Martins; Gomes, Jancarlo Ferreira; Meireles, Marcelo Vasconcelos; Widmer, Giovanni; Bresciani, Katia Denise Saraiva

    2017-08-30

    The carrier pigeon and the domestic pigeon are different breeds of the species Columba livia. Carrier pigeons are used for recreational activities such as bird contests and exhibitions. Due to the close contact with humans, these birds may potentially represent a public health risk, since they can host and disseminate zoonotic parasites, such as those belonging to the genus Cryptosporidium (phylum Apicomplexa). The purpose of this work was the detection by microscopic and molecular techniques of Cryptosporidium spp. oocysts in fecal samples of carrier pigeons, and subsequently to sequence the 18S ribosomal RNA marker of positive samples to identify the species. A total of 100 fecal samples were collected individually in two pigeon breeding facilities from Formiga and Araçatuba, cities located in Minas Gerais state and São Paulo state, Brazil, respectively. The age of the birds ranged from one to 12 years; 56 were females and 44 males. Fecal smears were stained with negative malachite green, whereas the molecular characterization was based on the sequence of a ∼800bp fragment of the 18S rRNA gene. Microscopic examination of fecal smears revealed 4% (4/100) oocyst positivity. On the other hand, 7% (7/100) of positivity were found using nested PCR. Three samples were 99% to 100% similar to Cryptosporidium parvum 18S rDNA type A (Genbank AH006572) and the other three samples had 99% to 100% similarity to C. parvum 18S rDNA type B (Genbank AF308600). To our knowledge, this is the first report of C. parvum oocysts in carrier pigeons. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Preparation of Calcium Phosphate/pDNA Nanoparticles for Exogenous Gene Delivery by Co-Precipitation Method: Optimization of Formulation Variables Using Box-Behnken Design.

    Li, Wenpan; Zhang, Xirui; Jing, Shasha; Xin, Xiu; Chen, Kang; Chen, Dawei; Hu, Haiyang

    2017-08-01

    This research focused on optimizing the preparations of pDNA-loaded calcium phosphate (CaP) nanoparticles by employing a 3-factor, 3-level Box-Behnken design. Results indicated that a Ca/P ratio of 189.56, pH of 7.82, and a stirring speed of 528.83 rpm were the optimum conditions for preparation of the nanoparticles. The size of the optimized CaP/pDNA nanoparticles was 61.3 ± 3.64 nm, with a polydispersity index of 0.341 and an encapsulation efficiency of up to 92.11%. The optimized CaP/pDNA nanoparticles had high transfection efficiency and demonstrated good biocompatibility in vitro. Therefore, the Box-Behnken design method was successful in providing desirable CaP nanoparticle pDNA delivery systems by optimizing the experimental factors. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  2. Methionine synthase A2756G and reduced folate carrier1 A80G ...

    Maha Moustafa

    2015-10-09

    Oct 9, 2015 ... folate carrier (RFC1) A80G gene polymorphisms on the maternal risk for DS. Patients: This ... Peer review under responsibility of Ain Shams University. ... Folate is the general term for a water-soluble B vitamin (vita- min B9) ...

  3. Pathology of ovarian cancers in BRCA1 and BRCA2 carriers

    Lakhani, Sunil R.; Manek, Sanjiv; Penault-Llorca, Frederique; Flanagan, Adrienne; Arnout, Laurent; Merrett, Samantha; McGuffog, Lesley; Steele, Dawn; Devilee, Peter; Klijn, Jan G. M.; Meijers-Heijboer, Hanne; Radice, Paolo; Pilotti, Silvana; Nevanlinna, Heli; Butzow, Ralf; Sobol, Hagay; Jacquemier, Jocylyne; Lyonet, Dominique Stoppa; Neuhausen, Susan L.; Weber, Barbara; Wagner, Teresa; Winqvist, Robert; Bignon, Yves-Jean; Monti, Franco; Schmitt, Fernando; Lenoir, Gilbert; Seitz, Susanne; Hamman, Ute; Pharoah, Paul; Lane, Geoff; Ponder, Bruce; Bishop, D. Timothy; Easton, Douglas F.

    2004-01-01

    Germline mutations in the BRCA1 and BRCA2 genes confer increased susceptibility to ovarian cancer. There is evidence that tumors in carriers may exhibit a distinct distribution of pathological features, but previous studies on the pathology of such tumors have been small. Our aim was to evaluate the

  4. Methionine synthase A2756G and reduced folate carrier1 A80G ...

    Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier (RFC1) A80G gene polymorphisms on the maternal risk for DS. Patients: This study was conducted in the Medical Genetics Center, Ain-Shams University hospitals, on a total of 170 mothers of children, diagnosed with ...

  5. The Biological Activity of alpha-Mangostin, a Larvicidal Botanic Mosquito Sterol Carrier Protein-2 Inhibitor

    2010-01-01

    it is known that esterase aids in the detoxiÞcation of or- ganophosphates ( Hemingway and Ransom 2000). In- terestingly, we found that -mangostin...Disruption of the sterol carrier protein 2 gene in mice impairs biliary lipid and hepatic cholesterol metabolism. J. Biol. Chem. 276: 48058Ð48065. Hemingway

  6. Methionine synthase A2756G and reduced folate carrier1 A80G ...

    Background: Polymorphisms of genes encoding enzymes involved in folate metabolism have long been hypothesized to be maternal risk factors for Down syndrome, however, results are conflicting and inconclusive. Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier ...

  7. Motor pathway excitability in ATP13A2 mutation carriers

    Zittel, S; Kroeger, J; van der Vegt, J P M

    2012-01-01

    OBJECTIVE: To describe excitability of motor pathways in Kufor-Rakeb syndrome (PARK9), an autosomal recessive nigro-striatal-pallidal-pyramidal neurodegeneration caused by a mutation in the ATP13A2 gene, using transcranial magnetic stimulation (TMS). METHODS: Five members of a Chilean family...... with an ATP13A2 mutation (one affected mutation carrier (MC) with a compound heterozygous mutation, 4 asymptomatic MC with a single heterozygous mutation) and 11 healthy subjects without mutations were studied. We measured motor evoked potentials (MEP), the contralateral silent period (cSP), short interval....... RESULTS: CSP duration was increased in the symptomatic ATP13A2 MC. The iSP measurements revealed increased interhemispheric inhibition in both the compound heterozygous and the heterozygous MC. CONCLUSION: A compound heterozygous mutation in the ATP13A2 gene is associated with increased intracortical...

  8. Xenopus reduced folate carrier regulates neural crest development epigenetically.

    Jiejing Li

    Full Text Available Folic acid deficiency during pregnancy causes birth neurocristopathic malformations resulting from aberrant development of neural crest cells. The Reduced folate carrier (RFC is a membrane-bound receptor for facilitating transfer of reduced folate into the cells. RFC knockout mice are embryonic lethal and develop multiple malformations, including neurocristopathies. Here we show that XRFC is specifically expressed in neural crest tissues in Xenopus embryos and knockdown of XRFC by specific morpholino results in severe neurocristopathies. Inhibition of RFC blocked the expression of a series of neural crest marker genes while overexpression of RFC or injection of 5-methyltetrahydrofolate expanded the neural crest territories. In animal cap assays, knockdown of RFC dramatically reduced the mono- and trimethyl-Histone3-K4 levels and co-injection of the lysine methyltransferase hMLL1 largely rescued the XRFC morpholino phenotype. Our data revealed that the RFC mediated folate metabolic pathway likely potentiates neural crest gene expression through epigenetic modifications.

  9. Deletion of A44L, A46R and C12L Vaccinia Virus Genes from the MVA Genome Improved the Vector Immunogenicity by Modifying the Innate Immune Response Generating Enhanced and Optimized Specific T-Cell Responses

    María Pía Holgado

    2016-05-01

    Full Text Available MVA is an attenuated vector that still retains immunomodulatory genes. We have previously reported its optimization after deleting the C12L gene, coding for the IL-18 binding-protein. Here, we analyzed the immunogenicity of MVA vectors harboring the simultaneous deletion of A44L, related to steroid synthesis and A46R, a TLR-signaling inhibitor (MVAΔA44L-A46R; or also including a deletion of C12L (MVAΔC12L/ΔA44L-A46R. The absence of biological activities of the deleted genes in the MVA vectors was demonstrated. Adaptive T-cell responses against VACV epitopes, evaluated in spleen and draining lymph-nodes of C57Bl/6 mice at acute/memory phases, were of higher magnitude in those animals that received deleted MVAs compared to MVAwt. MVAΔC12L/ΔA44L-A46R generated cellular specific memory responses of higher quality characterized by bifunctionality (CD107a/b+/IFN-γ+ and proliferation capacity. Deletion of selected genes from MVA generated innate immune responses with higher levels of determining cytokines related to T-cell response generation, such as IL-12, IFN-γ, as well as IL-1β and IFN-β. This study describes for the first time that simultaneous deletion of the A44L, A46R and C12L genes from MVA improved its immunogenicity by enhancing the host adaptive and innate immune responses, suggesting that this approach comprises an appropriate strategy to increase the MVA vaccine potential.

  10. Porous silica nanoparticles as carrier for curcumin delivery

    Hartono, Sandy Budi; Hadisoewignyo, Lannie; Irawaty, Wenny; Trisna, Luciana; Wijaya, Robby

    2018-04-01

    Mesoporous silica nanoparticles (MSN) with large surface areas and pore volumes show great potential as drug and gene carriers. However, there are still some challenging issues hinders their clinical application. Many types of research in the use of mesoporous silica material for drug and gene delivery involving complex and rigorous procedures. A facile and reproducible procedure to prepare combined drug carrier is required. We investigated the effect of physiochemical parameters of mesoporous silica, including structural symmetry (cubic and hexagonal), particles size (micro size: 1-2 µm and nano size: 100 -300 nm), on the solubility and release profile of curcumin. Transmission Electron Microscopy, X-Ray Powder Diffraction, and Nitrogen sorption were used to confirm the synthesis of the mesoporous silica materials. Mesoporous silica materials with different mesostructures and size have been synthesized successfully. Curcumin has anti-oxidant, anti-inflammation and anti-virus properties which are beneficial to fight various diseases such as diabetic, cancer, allergic, arthritis and Alzheimer. Curcumin has low solubility which minimizes its therapeutic effect. The use of nanoporous material to carry and release the loaded molecules is expected to enhance curcumin solubility. Mesoporous silica materials with a cubic mesostructure had a higher release profile and curcumin solubility, while mesoporous silica materials with a particle size in the range of nano meter (100-300) nm also show better release profile and solubility.

  11. Genome-wide assessment of the carriers involved in the cellular uptake of drugs: a model system in yeast.

    Lanthaler, Karin; Bilsland, Elizabeth; Dobson, Paul D; Moss, Harry J; Pir, Pınar; Kell, Douglas B; Oliver, Stephen G

    2011-10-24

    The uptake of drugs into cells has traditionally been considered to be predominantly via passive diffusion through the bilayer portion of the cell membrane. The recent recognition that drug uptake is mostly carrier-mediated raises the question of which drugs use which carriers. To answer this, we have constructed a chemical genomics platform built upon the yeast gene deletion collection, using competition experiments in batch fermenters and robotic automation of cytotoxicity screens, including protection by 'natural' substrates. Using these, we tested 26 different drugs and identified the carriers required for 18 of the drugs to gain entry into yeast cells. As well as providing a useful platform technology, these results further substantiate the notion that the cellular uptake of pharmaceutical drugs normally occurs via carrier-mediated transport and indicates that establishing the identity and tissue distribution of such carriers should be a major consideration in the design of safe and effective drugs.

  12. Carrier scattering in metals and semiconductors

    Gantmakher, VF

    1987-01-01

    The transport properties of solids, as well as the many optical phenomena in them are determined by the scattering of current carriers. ``Carrier Scattering in Metals and Semiconductors'' elucidates the state of the art in the research on the scattering mechanisms for current carriers in metals and semiconductors and describes experiments in which these mechanisms are most dramatically manifested.The selection and organization of the material is in a form to prepare the reader to reason independently and to deal just as independently with available theoretical results and experimental

  13. Biodegradable nanoparticles for gene therapy technology

    Hosseinkhani, Hossein; He, Wen-Jie; Chiang, Chiao-Hsi; Hong, Po-Da; Yu, Dah-Shyong; Domb, Abraham J.; Ou, Keng-Liang

    2013-01-01

    Rapid propagations in materials technology together with biology have initiated great hopes in the possibility of treating many diseases by gene therapy technology. Viral and non-viral gene carriers are currently applied for gene delivery. Non-viral technology is safe and effective for the delivery of genetic materials to cells and tissues. Non-viral systems are based on plasmid expression containing a gene encoding a therapeutic protein and synthetic biodegradable nanoparticles as a safe carrier of gene. Biodegradable nanoparticles have shown great interest in drug and gene delivery systems as they are easy to be synthesized and have no side effect in cells and tissues. This review provides a critical view of applications of biodegradable nanoparticles on gene therapy technology to enhance the localization of in vitro and in vivo and improve the function of administered genes

  14. Effects of porous carrier size on biofilm development, microbial distribution and nitrogen removal in microaerobic bioreactors

    Ahmad, Muhammad; Liu, Sitong; Mahmood, Nasir; Mahmood, Asif; Ali, Muhammad; Zheng, Maosheng; Ni, Jinren

    2017-01-01

    In this study, effects of porous carrier’s size (polyurethane-based) on microbial characteristics were systematically investigated in addition to nitrogen removal performance in six microaerobic bioreactors. Among different sized carriers (50, 30, 20, 15,10, 5 mm), 15 mm carrier showed highest nitrogen removal (98%) due to optimal micro-environments created for aerobic nitrifiers in outer layer (0∼7 mm), nitrifiers and denitrifiers in middle layer (7∼10 mm) and anaerobic denitrifiers in inner layer (10∼15 mm). Candidatus brocadia, a dominant anammox bacteria, was solely concentrated close to centroid (0∼70 μm) and strongly co-aggregated with other bacterial communities in the middle layer of the carrier. Contrarily, carriers with a smaller (<15 mm) or larger size (>15 mm) either destroy the effective zone for anaerobic denitrifiers or damage the microaerobic environments due to poor mass transfer. This study is of particular use for optimal design of carriers in enhancing simultaneous nitrification-denitrification in microaerobic wastewater treatment processes.

  15. Effects of porous carrier size on biofilm development, microbial distribution and nitrogen removal in microaerobic bioreactors

    Ahmad, Muhammad

    2017-03-15

    In this study, effects of porous carrier’s size (polyurethane-based) on microbial characteristics were systematically investigated in addition to nitrogen removal performance in six microaerobic bioreactors. Among different sized carriers (50, 30, 20, 15,10, 5 mm), 15 mm carrier showed highest nitrogen removal (98%) due to optimal micro-environments created for aerobic nitrifiers in outer layer (0∼7 mm), nitrifiers and denitrifiers in middle layer (7∼10 mm) and anaerobic denitrifiers in inner layer (10∼15 mm). Candidatus brocadia, a dominant anammox bacteria, was solely concentrated close to centroid (0∼70 μm) and strongly co-aggregated with other bacterial communities in the middle layer of the carrier. Contrarily, carriers with a smaller (<15 mm) or larger size (>15 mm) either destroy the effective zone for anaerobic denitrifiers or damage the microaerobic environments due to poor mass transfer. This study is of particular use for optimal design of carriers in enhancing simultaneous nitrification-denitrification in microaerobic wastewater treatment processes.

  16. Parameters influencing the introduction of plasmid DNA into cells by the use of synthetic amphiphiles as a carrier system

    van der Woude, Irene; Willy Visser, H.; ter Beest, Martin B.A.; Wagenaar, Anno; Ruiters, Marcel H.J.; Engberts, Jan B.F.N.; Hoekstra, Dick

    1995-01-01

    Parameters that affect cellular transfection as accomplished by introducing DNA via carriers composed of cationic synthetic amphiphiles, have been investigated with the aim to obtain insight into the mechanism of DNA translocation. Such insight may be exploited in optimizing carrier properties of synthetic amphiphiles for molecules other than nucleic acids. In the present work, the interaction of vesicles composed of the cationic amphiphile dioleyloxy-propyl-trimethylammonium chloride (DOTMA)...

  17. Syngas Generation from Methane Using a Chemical-Looping Concept: A Review of Oxygen Carriers

    Kongzhai Li

    2013-01-01

    Full Text Available Conversion of methane to syngas using a chemical-looping concept is a novel method for syngas generation. This process is based on the transfer of gaseous oxygen source to fuel (e.g., methane by means of a cycling process using solid oxides as oxygen carriers to avoid direct contact between fuel and gaseous oxygen. Syngas is produced through the gas-solid reaction between methane and solid oxides (oxygen carriers, and then the reduced oxygen carriers can be regenerated by a gaseous oxidant, such as air or water. The oxygen carrier is recycled between the two steps, and the syngas with a ratio of H2/CO = 2.0 can be obtained successively. Air is used instead of pure oxygen allowing considerable cost savings, and the separation of fuel from the gaseous oxidant avoids the risk of explosion and the dilution of product gas with nitrogen. The design and elaboration of suitable oxygen carriers is a key issue to optimize this method. As one of the most interesting oxygen storage materials, ceria-based and perovskite oxides were paid much attention for this process. This paper briefly introduced the recent research progresses on the oxygen carriers used in the chemical-looping selective oxidation of methane (CLSOM to syngas.

  18. Pressure dependence of excited-state charge-carrier dynamics in organolead tribromide perovskites

    Liu, X. C.; Han, J. H.; Zhao, H. F.; Yan, H. C.; Shi, Y.; Jin, M. X.; Liu, C. L.; Ding, D. J.

    2018-05-01

    Excited-state charge-carrier dynamics governs the performance of organometal trihalide perovskites (OTPs) and is strongly influenced by the crystal structure. Characterizing the excited-state charge-carrier dynamics in OTPs under high pressure is imperative for providing crucial insights into structure-property relations. Here, we conduct in situ high-pressure femtosecond transient absorption spectroscopy experiments to study the excited-state carrier dynamics of CH3NH3PbBr3 (MAPbBr3) under hydrostatic pressure. The results indicate that compression is an effective approach to modulate the carrier dynamics of MAPbBr3. Across each pressure-induced phase, carrier relaxation, phonon scattering, and Auger recombination present different pressure-dependent properties under compression. Responsiveness is attributed to the pressure-induced variation in the lattice structure, which also changes the electronic band structure. Specifically, simultaneous prolongation of carrier relaxation and Auger recombination is achieved in the ambient phase, which is very valuable for excess energy harvesting. Our discussion provides clues for optimizing the photovoltaic performance of OTPs.

  19. Delineation of the working memory profile in female FMR1 premutation carriers: the effect of cognitive load on ocular motor responses.

    Shelton, Annie L; Cornish, Kim M; Godler, David E; Clough, Meaghan; Kraan, Claudine; Bui, Minh; Fielding, Joanne

    2015-04-01

    Fragile X mental retardation 1 (FMR1) premutation carriers (PM-carriers) are characterised as having mid-sized expansions of between 55 and 200 CGG repeats in the 5' untranslated region of the FMR1 gene. While there is evidence of executive dysfunction in PM-carriers, few studies have explicitly explored working memory capabilities in female PM-carriers. 14 female PM-carriers and 13 age- and IQ-matched healthy controls completed an ocular motor n-back working memory paradigm. This task examined working memory ability and the effect of measured increases in cognitive load. Female PM-carriers were found to have attenuated working memory capabilities. Increasing the cognitive load did not elicit the expected reciprocal increase in the task errors for female PM-carriers, as it did in controls. However female PM-carriers took longer to respond than controls, regardless of the cognitive load. Further, FMR1 mRNA levels were found to significantly predict PM-carrier response time. Although preliminary, these findings provide further evidence of executive dysfunction, specifically disruption to working memory processes, which were found to be associated with increases in FMR1 mRNA expression in female PM-carriers. With future validation, ocular motor paradigms such as the n-back paradigm will be critical to the development of behavioural biomarkers for identification of PM-carrier cognitive-affective phenotypes. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Auto Carrier Transporter Loading and Unloading Improvement

    Miller, Brian

    2003-01-01

    .... Any reduction in time and energy will result in a significant savings of money. The intent of this research is to develop an algorithm to solve the Auto Carrier Transport Pickup and Delivery Problem...

  1. Aircraft Carrier Exposure Testing of Aircraft Materials

    Lee, Eui

    2004-01-01

    .... Test and control specimens were affixed on exposure racks and installed on aircraft carriers to compare adhesive bonding primers for aluminum and to determine the static property behavior of various...

  2. Commercial Air Carrier Vulnerabilities to Information Operations

    Shelburn, Bryan H

    2002-01-01

    .... Among those elements susceptible to these vulnerabilities are the operations of commercial air carriers that are essential to the military's ability to wage war and project power wherever needed in the world...

  3. Part B Carrier Summary Data File

    U.S. Department of Health & Human Services — Data sets are summarized at the carrier level by meaningful Healthcare Common Procedure Coding-Current Procedural Terminology, (HCPC-CPT), code ranges. The data set...

  4. Whole exome sequencing reveals concomitant mutations of multiple FA genes in individual Fanconi anemia patients.

    Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan

    2014-05-15

    Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.

  5. Evaluating multicast resilience in carrier ethernet

    Ruepp, Sarah Renée; Wessing, Henrik; Zhang, Jiang

    2010-01-01

    This paper gives an overview of the Carrier Ethernet technology with specific focus on resilience. In particular, we show how multicast traffic, which is essential for IPTV can be protected. We detail the ackground for resilience mechanisms and their control and e present Carrier Ethernet...... resilience methods for linear nd ring networks. By simulation we show that the vailability of a multicast connection can be significantly increased by applying protection methods....

  6. Synthetic Lipoproteins as Carriers for Drug Delivery.

    Huang, Gangliang; Liu, Yang; Huang, Hualiang

    2016-01-01

    Synthetic lipoprotein is an effective carrier of targeted delivery for drugs. It has the very small size, good biocompatibility, suitable half-life, and specific lipoprotein receptorbinding capacity. Compared with the traditional natural lipoprotein, synthetic lipoprotein not only retains the original biological characteristics and functions, but also exhibits the excellent characteristics in drug delivery. Herein, the advantages, development, applications, and prospect of synthetic lipoproteins as drug carriers were summarized.

  7. Ultrafast carrier dynamics in a p-type GaN wafer under different carrier distributions

    Fang, Yu; Yang, Junyi; Yang, Yong; Wu, Xingzhi; Xiao, Zhengguo; Zhou, Feng; Song, Yinglin

    2016-02-01

    The dependence of the carrier distribution on photoexcited carrier dynamics in a p-type Mg-doped GaN (GaN:Mg) wafer were systematically measured by femtosecond transient absorption (TA) spectroscopy. The homogeneity of the carrier distribution was modified by tuning the wavelength of the UV pulse excitation around the band gap of GaN:Mg. The TA kinetics appeared to be biexponential for all carrier distributions, and only the slower component decayed faster as the inhomogeneity of the carrier distribution increased. It was concluded that the faster component (50-70 ps) corresponded to the trap process of holes by the Mg acceptors, and the slower component (150-600 ps) corresponded to the combination of non-radiative surface recombination and intrinsic carrier recombination via dislocations. Moreover, the slower component increased gradually with the incident fluence due to the saturation of surface states.

  8. The Kinetics of Carrier Transport Inhibition

    Rosenberg, T.; Wilbrandt, Robert Walter

    1962-01-01

    The kinetical treatment of enzymatic carrier transports as given in previous communications has been extended to conditions of inhibition. Various possible types of inhibitors have been considered differing in the site of attack (enzyme or carrier), in the mode of action (competing with the subst......The kinetical treatment of enzymatic carrier transports as given in previous communications has been extended to conditions of inhibition. Various possible types of inhibitors have been considered differing in the site of attack (enzyme or carrier), in the mode of action (competing...... with the substrate for the enzyme or the carrier or for both, competing with the carrier for the enzyme, or non-competitive) and in the ability of penetrating the membrane. Experiments are reported on the inhibition of glucose and fructose transport across the human red cell membrane by phlorizine, phloretine...... and polyphloretinephosphate. The results of the analysis for these inhibitors indicate a substrate competitive mode of action. The effect of reversing the transport direction by interchanging the substrate concentration has been treated for the case of a non-penetrating substrate competitive inhibitor in the external medium...

  9. Determining the role of skewed X-chromosome inactivation in developing muscle symptoms in carriers of Duchenne muscular dystrophy.

    Viggiano, Emanuela; Ergoli, Manuela; Picillo, Esther; Politano, Luisa

    2016-07-01

    Duchenne and Becker dystrophinopathies (DMD and BMD) are X-linked recessive disorders caused by mutations in the dystrophin gene that lead to absent or reduced expression of dystrophin in both skeletal and heart muscles. DMD/BMD female carriers are usually asymptomatic, although about 8 % may exhibit muscle or cardiac symptoms. Several mechanisms leading to a reduced dystrophin have been hypothesized to explain the clinical manifestations and, in particular, the role of the skewed XCI is questioned. In this review, the mechanism of XCI and its involvement in the phenotype of BMD/DMD carriers with both a normal karyotype or with X;autosome translocations with breakpoints at Xp21 (locus of the DMD gene) will be analyzed. We have previously observed that DMD carriers with moderate/severe muscle involvement, exhibit a moderate or extremely skewed XCI, in particular if presenting with an early onset of symptoms, while DMD carriers with mild muscle involvement present a random XCI. Moreover, we found that among 87.1 % of the carriers with X;autosome translocations involving the locus Xp21 who developed signs and symptoms of dystrophinopathy such as proximal muscle weakness, difficulty to run, jump and climb stairs, 95.2 % had a skewed XCI pattern in lymphocytes. These data support the hypothesis that skewed XCI is involved in the onset of phenotype in DMD carriers, the X chromosome carrying the normal DMD gene being preferentially inactivated and leading to a moderate-severe muscle involvement.

  10. Optimizing Hybrid de Novo Transcriptome Assembly and Extending Genomic Resources for Giant Freshwater Prawns (Macrobrachium rosenbergii: The Identification of Genes and Markers Associated with Reproduction

    Hyungtaek Jung

    2016-05-01

    Full Text Available The giant freshwater prawn, Macrobrachium rosenbergii, a sexually dimorphic decapod crustacean is currently the world’s most economically important cultured freshwater crustacean species. Despite its economic importance, there is currently a lack of genomic resources available for this species, and this has limited exploration of the molecular mechanisms that control the M. rosenbergii sex-differentiation system more widely in freshwater prawns. Here, we present the first hybrid transcriptome from M. rosenbergii applying RNA-Seq technologies directed at identifying genes that have potential functional roles in reproductive-related traits. A total of 13,733,210 combined raw reads (1720 Mbp were obtained from Ion-Torrent PGM and 454 FLX. Bioinformatic analyses based on three state-of-the-art assemblers, the CLC Genomic Workbench, Trans-ABySS, and Trinity, that use single and multiple k-mer methods respectively, were used to analyse the data. The influence of multiple k-mers on assembly performance was assessed to gain insight into transcriptome assembly from short reads. After optimisation, de novo assembly resulted in 44,407 contigs with a mean length of 437 bp, and the assembled transcripts were further functionally annotated to detect single nucleotide polymorphisms and simple sequence repeat motifs. Gene expression analysis was also used to compare expression patterns from ovary and testis tissue libraries to identify genes with potential roles in reproduction and sex differentiation. The large transcript set assembled here represents the most comprehensive set of transcriptomic resources ever developed for reproduction traits in M. rosenbergii, and the large number of genetic markers predicted should constitute an invaluable resource for future genetic research studies on M. rosenbergii and can be applied more widely on other freshwater prawn species in the genus Macrobrachium.

  11. The Optimization of Molecular Detection of Clinical Isolates of Brucella in Blood Cultures by eryD Transcriptase Gene for Confirmation of Culture-Negative Samples.

    Tabibnejad, Mahsa; Alikhani, Mohammad Yousef; Arjomandzadegan, Mohammad; Hashemi, Seyed Hamid; Naseri, Zahra

    2016-04-01

    Brucellosis is a zoonosis disease which is widespread across the world. The aim of the present study is the evaluation of culture-negative blood samples. A total of 100 patients with suspected brucellosis were included in this experimental study and given positive serological tests. Diagnosis was performed on patients with clinical symptoms of the disease, followed by the detection of a titer that was equal to or more than 1:160 (in endemic areas) by the standard tube agglutination method. Blood samples were cultured by a BACTEC 9050 system, and subsequently by Brucella agar. At the same time, DNA from all blood samples was extracted by Qiagen Kit Company (Qia Amp Mini Kit). A molecular assay of blood samples was carried out by detection of eryD transcriptase and bcsp 31 genes in specific double PCR reactions. The specificity of the primers was evaluated by DNA from pure and approved Brucella colonies found in the blood samples, by DNA from other bacteria, and by ordinary PCR. DNA extraction from the pure colonies was carried out by both Qiagen Kit and Chelex 100 methods; the two were compared. 39 cases (39%) had positive results when tested by the BACTEC system, and 61 cases (61%) became negative. 23 culture-positive blood samples were randomly selected for PCR reactions; all showed 491 bp for the eryD gene and 223 bp for the bcsp 31 gene. Interestingly, out of 14 culture-negative blood samples, 13 cases showed positive bonds in PCR. The specificity of the PCR method was equal to 100%. DNA extraction from pure cultures was done by both Chelex 100 and Qiagen Kit; these showed the same results for all samples. The results prove that the presented double PCR method could be used to detect positive cases from culture-negative blood samples. The Chelex 100 method is simpler and safer than the use of Qiagen Kit for DNA extraction.

  12. Evaluation of current prediction models for Lynch syndrome: updating the PREMM5 model to identify PMS2 mutation carriers.

    Goverde, A; Spaander, M C W; Nieboer, D; van den Ouweland, A M W; Dinjens, W N M; Dubbink, H J; Tops, C J; Ten Broeke, S W; Bruno, M J; Hofstra, R M W; Steyerberg, E W; Wagner, A

    2018-07-01

    Until recently, no prediction models for Lynch syndrome (LS) had been validated for PMS2 mutation carriers. We aimed to evaluate MMRpredict and PREMM5 in a clinical cohort and for PMS2 mutation carriers specifically. In a retrospective, clinic-based cohort we calculated predictions for LS according to MMRpredict and PREMM5. The area under the operator receiving characteristic curve (AUC) was compared between MMRpredict and PREMM5 for LS patients in general and for different LS genes specifically. Of 734 index patients, 83 (11%) were diagnosed with LS; 23 MLH1, 17 MSH2, 31 MSH6 and 12 PMS2 mutation carriers. Both prediction models performed well for MLH1 and MSH2 (AUC 0.80 and 0.83 for PREMM5 and 0.79 for MMRpredict) and fair for MSH6 mutation carriers (0.69 for PREMM5 and 0.66 for MMRpredict). MMRpredict performed fair for PMS2 mutation carriers (AUC 0.72), while PREMM5 failed to discriminate PMS2 mutation carriers from non-mutation carriers (AUC 0.51). The only statistically significant difference between PMS2 mutation carriers and non-mutation carriers was proximal location of colorectal cancer (77 vs. 28%, p PMS2 mutation carriers (AUC 0.77) and overall (AUC 0.81 vs. 0.72). We validated these results in an external cohort of 376 colorectal cancer patients, including 158 LS patients. MMRpredict and PREMM5 cannot adequately identify PMS2 mutation carriers. Adding location of colorectal cancer to PREMM5 may improve the performance of this model, which should be validated in larger cohorts.

  13. Mitochondrial Carriers Link the Catabolism of Hydroxyaromatic Compounds to the Central Metabolism in Candida parapsilosis

    Igor Zeman

    2016-12-01

    Full Text Available The pathogenic yeast Candida parapsilosis metabolizes hydroxyderivatives of benzene and benzoic acid to compounds channeled into central metabolism, including the mitochondrially localized tricarboxylic acid cycle, via the 3-oxoadipate and gentisate pathways. The orchestration of both catabolic pathways with mitochondrial metabolism as well as their evolutionary origin is not fully understood. Our results show that the enzymes involved in these two pathways operate in the cytoplasm with the exception of the mitochondrially targeted 3-oxoadipate CoA-transferase (Osc1p and 3-oxoadipyl-CoA thiolase (Oct1p catalyzing the last two reactions of the 3-oxoadipate pathway. The cellular localization of the enzymes indicates that degradation of hydroxyaromatic compounds requires a shuttling of intermediates, cofactors, and products of the corresponding biochemical reactions between cytosol and mitochondria. Indeed, we found that yeast cells assimilating hydroxybenzoates increase the expression of genes SFC1, LEU5, YHM2, and MPC1 coding for succinate/fumarate carrier, coenzyme A carrier, oxoglutarate/citrate carrier, and the subunit of pyruvate carrier, respectively. A phylogenetic analysis uncovered distinct evolutionary trajectories for sparsely distributed gene clusters coding for enzymes of both pathways. Whereas the 3-oxoadipate pathway appears to have evolved by vertical descent combined with multiple losses, the gentisate pathway shows a striking pattern suggestive of horizontal gene transfer to the evolutionarily distant Mucorales.

  14. Optimizing the Targeting of Mouse Parvovirus 1 to Murine Melanoma Selects for Recombinant Genomes and Novel Mutations in the Viral Capsid Gene

    Matthew Marr

    2018-01-01

    Full Text Available Combining virus-enhanced immunogenicity with direct delivery of immunomodulatory molecules would represent a novel treatment modality for melanoma, and would require development of new viral vectors capable of targeting melanoma cells preferentially. Here we explore the use of rodent protoparvoviruses targeting cells of the murine melanoma model B16F10. An uncloned stock of mouse parvovirus 1 (MPV1 showed some efficacy, which was substantially enhanced following serial passage in the target cell. Molecular cloning of the genes of both starter and selected virus pools revealed considerable sequence diversity. Chimera analysis mapped the majority of the improved infectivity to the product of the major coat protein gene, VP2, in which linked blocks of amino acid changes and one or other of two apparently spontaneous mutations were selected. Intragenic chimeras showed that these represented separable components, both contributing to enhanced infection. Comparison of biochemical parameters of infection by clonal viruses indicated that the enhancement due to changes in VP2 operates after the virus has bound to the cell surface and penetrated into the cell. Construction of an in silico homology model for MPV1 allowed placement of these changes within the capsid shell, and revealed aspects of the capsid involved in infection initiation that had not been previously recognized.

  15. Ultrasound-mediated structural changes in cells revealed by FTIR spectroscopy: A contribution to the optimization of gene and drug delivery

    Grimaldi, Paola; Di Giambattista, Lucia; Giordani, Serena; Udroiu, Ion; Pozzi, Deleana; Gaudenzi, Silvia; Bedini, Angelico; Giliberti, Claudia; Palomba, Raffaele; Congiu Castellano, Agostina

    2011-12-01

    Ultrasound effects on biological samples are gaining a growing interest concerning in particular, the intracellular delivery of drugs and genes in a safe and in a efficient way. Future progress in this field will require a better understanding of how ultrasound and acoustic cavitation affect the biological system properties. The morphological changes of cells due to ultrasound (US) exposure have been extensively studied, while little attention has been given to the cells structural changes. We have exposed two different cell lines to 1 MHz frequency ultrasound currently used in therapy, Jurkat T-lymphocytes and NIH-3T3 fibroblasts, both employed as models respectively in the apoptosis and in the gene therapy studies. The Fourier Transform Infrared (FTIR) Spectroscopy was used as probe to reveal the structural changes in particular molecular groups belonging to the main biological systems. The genotoxic damage of cells exposed to ultrasound was ascertained by the Cytokinesis-Block Micronucleus (CBMN) assay. The FTIR spectroscopy results, combined with multivariate statistical analysis, regarding all cellular components (lipids, proteins, nucleic acids) of the two cell lines, show that Jurkat cells are more sensitive to therapeutic ultrasound in the lipid and protein regions, whereas the NIH-3T3 cells are more sensitive in the nucleic acids region; a meaningful genotoxic effect is present in both cell lines only for long sonication times while in the Jurkat cells also a significant cytotoxic effect is revealed for long times of exposure to ultrasound.

  16. Genetic relationships of Corynebacterium diphtheriae strains isolated from a diphtheria case and carriers by restriction fragment length polymorphism of rRNA genes Relação genética de cepas de Corynebacterium diphtheriae isoladas de caso e seus contatos por RLFP de rRNA gene

    Claudio Tavares Sacchi

    1995-08-01

    Full Text Available In the present study we report the results of an analysis, based on ribotyping of Corynebacterium diphtheriae intermedius strains isolated from a 9 years old child with clinical diphtheria and his 5 contacts. Quantitative analysis of RFLPs of rRNA was used to determine relatedness of these 7 C.diphtheriae strains providing support data in the diphtheria epidemiology. We have also tested those strains for toxigenicity in vitro by using the Elek's gel diffusion method and in vivo by using cell culture method on cultured monkey kidney cell (VERO cells. The hybridization results revealed that the 5 C.diphtheriae strains isolated from contacts and one isolated from the clinical case (nose case strain had identical RFLP patterns with all 4 restriction endonucleases used, ribotype B. The genetic distance from this ribotype and ribotype A (throat case strain, that we initially assumed to be responsible for the illness of the patient, was of 0.450 showing poor genetic correlation among these two ribotypes. We found no significant differences concerned to the toxin production by using the cell culture method. In conclusion, the use of RFLPs of rRNA gene was successful in detecting minor differences in closely related toxigenic C.diphtheriae intermedius strains and providing information about genetic relationships among them.No presente estudo, nós reportamos os resultados de uma análise, baseada na ribotipagem de cepas de C. diphtheriae intermedius isoladas de uma criança de 9 anos com difteria e seus 5 contatos. Análise quantitativa por RFLP de rRNA foi usada para determinar a relação destas 7 cepas de C. diphtheriae fornecendo dados de interesse epidemiológico. Nós também testamos estas cepas para toxicidade in vitro usando método de difusão de Elek e in vivo usando método de cultura celular com células VERO. Os resultados de hibridização revelaram que as 5 cepas de C. diphtheriae isoladas dos contatos e uma isolada do caso (cepa isolada

  17. Acoustic radiation force control: Pulsating spherical carriers.

    Rajabi, Majid; Mojahed, Alireza

    2018-02-01

    power supply for distinct cases of zero, negative and positive radiation force states along with the frequency dependent asymmetry index. In addition, considering the effect of phase difference between the incident wave field and the pulsating object, and its possible variation with respect to spatial position of object, some practical points about the spatial average of generated radiation force, the optimal state of operation, the stability of zero radiation force states and the possibly of precise motion control are discussed. This work would extend the novel concept of smart carriers to and may be helpful for robust single-beam acoustic handling techniques. Furthermore, the shown capability of precise motion control may be considered as a new way toward smart acoustic driven micro-mechanisms and micro-machines. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Optimization of intrinsic and extrinsic tendon healing through controllable water-soluble mitomycin-C release from electrospun fibers by mediating adhesion-related gene expression.

    Zhao, Xin; Jiang, Shichao; Liu, Shen; Chen, Shuai; Lin, Zhi Yuan William; Pan, Guoqing; He, Fan; Li, Fengfeng; Fan, Cunyi; Cui, Wenguo

    2015-08-01

    To balance intrinsic and extrinsic healing during tendon repair is challenging in tendon surgery. We hypothesized that by mediating apoptotic gene and collagen synthesis of exogenous fibroblasts, the adhesion formation induced by extrinsic healing could be inhibited. With the maintenance of intrinsic healing, the tendon could be healed with proper function with no adhesion. In this study, we loaded hydrophilic mitomycin-C (MMC) into hyaluronan (HA) hydrosols, which were then encapsulated in poly(L-lactic acid) (PLLA) fibers by micro-sol electrospinning. This strategy successfully provided a controlled release of MMC to inhibit adhesion formations with no detrimental effect on intrinsic healing. We found that micro-sol electrospinning was an effective and facile approach to incorporate and control hydrophilic drug release from hydrophobic polyester fibers. MMC exhibited an initially rapid, and gradually steadier release during 40 days, and the release rates could be tuned by its concentration. In vitro studies revealed that low concentrations of MMC could inhibit fibroblast adhesion and proliferation. When lacerate tendons were healed using the MMC-HA loaded PLLA fibers in vivo, they exhibited comparable mechanical strength to the naturally healed tendons but with no significant presence of adhesion formation. We further identified the up-regulation of apoptotic protein Bax expression and down-regulation of proteins Bcl2, collage I, collagen III and α-SMA during the healing process associated with minimum adhesion formations. This approach presented here leverages new advances in drug delivery and nanotechnology and offers a promising strategy to balance intrinsic and extrinsic tendon healing through modulating genes associated with fibroblast apoptosis and collagen synthesis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Performance of Uplink Carrier Aggregation in LTE-Advanced Systems

    Wang, Hua; Rosa, Claudio; Pedersen, Klaus

    2010-01-01

    Carrier aggregation (CA) has been proposed to aggregate two or more component carriers (CCs) to support a much wider transmission bandwidth for LTE-Advanced systems. With carrier aggregation, it is possible to schedule a user equipment (UE) on multiple component carriers simultaneously. In this p...

  20. Carrier screening for thalassemia and hemoglobinopathies in Canada.

    Langlois, Sylvie; Ford, Jason C; Chitayat, David

    2008-10-01

    investigation should include quantitation of HbA2 and HbF. In addition, if there is microcytosis(mean cellular volume thalassemia or an Hb variant, or of a combination of thalassemia and a hemoglobin variant, they should be referred for genetic counselling. Ideally,this should be prior to conception, or as early as possible in the pregnancy. Additional molecular studies may be required to clarify the carrier status of the parents and thus the risk to the fetus. (II-3A) 5. Prenatal diagnosis should be offered to the pregnant woman/couple at risk for having a fetus affected with a clinically significant thalassemia or hemoglobinopathy. Prenatal diagnosis should be performed with the patient's informed consent. If prenatal diagnosis is declined, testing of the child should be done to allow early diagnosis and referral to a pediatric hematology centre, if indicated. (II-3A) 6. Prenatal diagnosis by DNA analysis can be performed using cells obtained by chorionic villus sampling or amniocentesis. Alternatively for those who decline invasive testing and are at risk of hemoglobin Bart's hydrops fetalis (four-gene deletion alpha-thalassemia), serial detailed fetal ultrasound for assessment of the fetal cardiothoracic ratio (normal thalassemia should prompt immediate investigation of the pregnant patient and her partner to determine their carrier status for alpha-thalassemia. (III-A) VALIDATION: This guideline has been prepared by the Prenatal Diagnosis Committee of the Canadian College of Medical Geneticists (CCMG) and the Genetics Committee of the Society of Obstetricians and Gynaecologists of Canada (SOGC) and approved by the Board of Directors of the CCMG and the Executive and Council of the SOGC.

  1. Extracting hot carriers from photoexcited semiconductor nanocrystals

    Zhu, Xiaoyang

    2014-12-10

    This research program addresses a fundamental question related to the use of nanomaterials in solar energy -- namely, whether semiconductor nanocrystals (NCs) can help surpass the efficiency limits, the so-called “Shockley-Queisser” limit, in conventional solar cells. In these cells, absorption of photons with energies above the semiconductor bandgap generates “hot” charge carriers that quickly “cool” to the band edges before they can be utilized to do work; this sets the solar cell efficiency at a limit of ~31%. If instead, all of the energy of the hot carriers could be captured, solar-to-electric power conversion efficiencies could be increased, theoretically, to as high as 66%. A potential route to capture this energy is to utilize semiconductor nanocrystals. In these materials, the quasi-continuous conduction and valence bands of the bulk semiconductor become discretized due to confinement of the charge carriers. Consequently, the energy spacing between the electronic levels can be much larger than the highest phonon frequency of the lattice, creating a “phonon bottleneck” wherein hot-carrier relaxation is possible via slower multiphonon emission. For example, hot-electron lifetimes as long as ~1 ns have been observed in NCs grown by molecular beam epitaxy. In colloidal NCs, long lifetimes have been demonstrated through careful design of the nanocrystal interfaces. Due to their ability to slow electronic relaxation, semiconductor NCs can in principle enable extraction of hot carriers before they cool to the band edges, leading to more efficient solar cells.

  2. Carbon: Hydrogen carrier or disappearing skeleton?

    De Jong, K.P.; Van Wechem, H.M.H.

    1994-01-01

    The use of liquid hydrocarbons as energy carriers implies the use of carbon as a carrier for hydrogen to facilitate hydrogen transport and storage. The current trend for liquid energy carriers used in the transport sector is to maximize the load of hydrogen on the carbon carrier. The recently developed Shell Middle Distillate Hydrogenation process for the manufacture of high quality diesel from aromatic refinery streams fits this picture. In the future, the hydrogen required to raise the product H/C ratio will be increasingly produced via gasification of large amounts of heavy residues. In the light of the strong preference towards using liquid fuels in the transport sector, the Shell Middle Distillate Synthesis process to convert natural gas into diesel of very high quality is discussed. Finally, a few comments on the use of hydrogen without a carbon carrier are made. Long lead times and the likelihood of producing the 'first' hydrogen from fossil fuel are highlighted. 13 figs., 6 tabs., 5 refs

  3. Estimating Motor Carrier Management Information System Crash File Underreporting from Carrier Records.

    2017-08-01

    This FMCSA-sponsored research investigated the claim that motor carriers have a substantial number of crashes in their own records that are not contained in the Motor Carrier Management Information System (MCMIS) crash file. Based on the results of t...

  4. Estimating motor carrier management information system crash file underreporting from carrier records : research brief.

    2017-08-01

    This study estimated a significant amount of underreporting to the MCMIS crash file by the States, for the carriers who cooperated in the study. For the study carriers, it appears that the MCMIS file contained about 66 percent of their reportable cra...

  5. Charge-carrier mobilities in disordered semiconducting polymers: effects of carrier density and electric field [refereed

    Meisel, K.D.; Pasveer, W.F.; Cottaar, J.; Tanase, C.; Coehoorn, R.; Bobbert, P.A.; Blom, P.W.M.; Leeuw, de D.M.; Michels, M.A.J.

    2006-01-01

    We model charge transport in disordered semiconducting polymers by hopping of charge carriers on a square lattice of sites with Gaussian on-site energy disorder, using Fermi-Dirac statistics. From numerically exact solns. of the Master equation, we study the dependence of the charge-carrier mobility

  6. Charge-carrier mobilities in disordered semiconducting polymers : effects of carrier density and electric field

    Meisel, K.D.; Pasveer, W.F.; Cottaar, J.; Tanase, C.; Coehoorn, R.; Bobbert, P.A.; Blom, P.W.M.; Leeuw, D.M. de; Michels, M.A.J.

    2006-01-01

    We model charge transport in disordered semiconducting polymers by hopping of charge carriers on a square lattice of sites with Gaussian on-site energy disorder, using Fermi-Dirac statistics. From numerically exact solutions of the Master equation, we study the dependence of the charge-carrier

  7. Enhanced piezoelectric operation of NiO/GaN heterojunction generator by suppressed internal carrier screening

    Jeong, Dae Kyung; Kang, Jin-Ho; Ryu, Sang-Wan; Ha, Jun-Seok

    2017-01-01

    A NiO/GaN heterojunction piezoelectric generator was fabricated, and the improvement in device performance was analyzed. The electrical properties of NiO were varied by regulating the gas environment during sputtering. An optimized NiO layer was adopted for high piezoelectric voltage generation. Internal carrier screening was revealed to be the dominant mechanism degrading the piezoelectric performance, necessitating the suppression of carrier screening. The highly resistive NiO layer was advantageous in the suppression of carrier transport across the junction that screened the piezoelectric field. The maximum piezoelectric voltage and current density values obtained were 7.55 V and 1.14 µ A cm −2 , respectively. The power obtained was sufficient to operate a light-emitting diode combined with a charging circuit. (paper)

  8. Study of carrier concentration in single InP nanowires by luminescence and Hall measurements

    Lindgren, David; Hultin, Olof; Heurlin, Magnus; Storm, Kristian; Borgström, Magnus T; Samuelson, Lars; Gustafsson, Anders

    2015-01-01

    The free electron carrier concentrations in single InP core–shell nanowires are determined by micro-photoluminescence, cathodoluminescence (CL) and Hall effect measurements. The results from luminescence measurements were obtained by solving the Fermi–Dirac integral, as well as by analyzing the peak full width at half maximum (FWHM). Furthermore, the platform used for Hall effect measurements, combined with spot mode CL spectroscopy, is used to determine the carrier concentrations at specific positions along single nanowires. The results obtained via luminescence measurements provide an accurate and rapid feedback technique for the epitaxial development of doping incorporation in nanowires. The technique has been employed on several series of samples in which growth parameters, such as V/III-ratio, temperature and dopant flows, were investigated in an optimization procedure. The correlation between the Hall effect and luminescence measurements for extracting the carrier concentration of different samples were in excellent agreement. (paper)

  9. Carriers in mesenchymal stem cell osteoblast mineralization-State-of-the-art

    Dahl, Morten; Jørgensen, Niklas Rye; Hørberg, Mette

    2014-01-01

    PURPOSE: Tissue engineering is a new way to regenerate bone tissue, where osteogenic capable cells combine with an appropriate scaffolding material. Our aim was in a Medline Search to evaluate osteoblast mineralization in vitro and in vivo including gene expressing combining mesenchymal stem cells...... (MSCs) and five different carriers, titanium, collagen, calcium carbonate, calcium phosphate and polylactic acid-polyglycolic acid copolymer for purpose of a meta-or a descriptive analysis. MATERIALS AND METHODS: The search included the following MeSH words in different combinations-mesenchymal stem...... cells, alkaline phosphatase, bone regeneration, tissue engineering, drug carriers, tissue scaffolds, titanium, collagen, calcium carbonate, calcium phosphates and polylactic acid-polyglycolic acid copolymer. RESULTS: Two out of 80 articles included numerical values and as control, carriers and cells...

  10. Mitochondrial-targeted DNA delivery using a DF-MITO-Porter, an innovative nano carrier with cytoplasmic and mitochondrial fusogenic envelopes

    Yamada, Yuma; Kawamura, Eriko; Harashima, Hideyoshi

    2012-01-01

    Mitochondrial gene therapy has the potential for curing a variety of diseases that are associated with mitochondrial DNA mutations and/or defects. To achieve this, it will be necessary to deliver therapeutic agents into the mitochondria in diseased cells. A number of mitochondrial drug delivery systems have been reported to date. However, reports of mitochondrial-targeted DNA delivery are limited. To achieve this, the therapeutic agent must be taken up by the cell (1), after which, the multi-processes associated with intracellular trafficking must be sophisticatedly regulated so as to release the agent from the endosome and deliver it to the cytosol (2) and to pass through the mitochondrial membrane (3). We report herein on the mitochondrial delivery of oligo DNA as a model therapeutic using a Dual Function (DF)-MITO-Porter, an innovative nano carrier designed for mitochondrial delivery. The critical structural elements of the DF-MITO-Porter include mitochondria-fusogenic inner envelopes and endosome-fusogenic outer envelopes, modified with octaarginine which greatly assists in cellular uptake. Inside the cell, the carrier passes through the endosomal and mitochondrial membranes via step-wise membrane fusion. When the oligo DNA was packaged in the DF-MITO-Porter, cellular uptake efficiency was strongly enhanced. Intracellular observation using confocal laser scanning microscopy showed that the DF-MITO-Porter was effectively released from endosomes. Moreover, the findings confirmed that the mitochondrial targeting activity of the DF-MITO-Porter was significantly higher than that of a carrier without outer endosome-fusogenic envelopes. These results support the conclusion that mitochondrial-targeted DNA delivery using a DF-MITO-Porter can be achieved when intracellular trafficking is optimally regulated.

  11. Mitochondrial-targeted DNA delivery using a DF-MITO-Porter, an innovative nano carrier with cytoplasmic and mitochondrial fusogenic envelopes

    Yamada, Yuma; Kawamura, Eriko; Harashima, Hideyoshi, E-mail: harasima@pharm.hokudai.ac.jp [Hokkaido University, Laboratory for Molecular Design of Pharmaceutics, Faculty of Pharmaceutical Sciences (Japan)

    2012-08-15

    Mitochondrial gene therapy has the potential for curing a variety of diseases that are associated with mitochondrial DNA mutations and/or defects. To achieve this, it will be necessary to deliver therapeutic agents into the mitochondria in diseased cells. A number of mitochondrial drug delivery systems have been reported to date. However, reports of mitochondrial-targeted DNA delivery are limited. To achieve this, the therapeutic agent must be taken up by the cell (1), after which, the multi-processes associated with intracellular trafficking must be sophisticatedly regulated so as to release the agent from the endosome and deliver it to the cytosol (2) and to pass through the mitochondrial membrane (3). We report herein on the mitochondrial delivery of oligo DNA as a model therapeutic using a Dual Function (DF)-MITO-Porter, an innovative nano carrier designed for mitochondrial delivery. The critical structural elements of the DF-MITO-Porter include mitochondria-fusogenic inner envelopes and endosome-fusogenic outer envelopes, modified with octaarginine which greatly assists in cellular uptake. Inside the cell, the carrier passes through the endosomal and mitochondrial membranes via step-wise membrane fusion. When the oligo DNA was packaged in the DF-MITO-Porter, cellular uptake efficiency was strongly enhanced. Intracellular observation using confocal laser scanning microscopy showed that the DF-MITO-Porter was effectively released from endosomes. Moreover, the findings confirmed that the mitochondrial targeting activity of the DF-MITO-Porter was significantly higher than that of a carrier without outer endosome-fusogenic envelopes. These results support the conclusion that mitochondrial-targeted DNA delivery using a DF-MITO-Porter can be achieved when intracellular trafficking is optimally regulated.

  12. Choosing mineral carrier of nanoscale additives for asphalt concrete

    Inozemtsev Sergey Sergeevich

    2014-03-01

    Full Text Available At present time the operation life of the majority of roads is essentially shorter than required. The reason for it is the increase in traffic intensity and axle loads of automobile transport. The obvious reasons for early wear of roads are the low quality of the components used and low industrial standards while producing asphalt pavement. In this paper the mineral material was selected as a carrier of nanoscale additives for asphalt. The optimal modes for grinding mineral materials were identified, which provide correspondence of their structure parameters with the developed model. The influence of different mineral nanomodifier carriers on the structure formation processes was estimated. It is shown that among a number of mineral materials diatomite has high activity in relation to the bitumen, because it has a highly porous structure. It is also shown that as a result of lighter fractions of bitumen adsorption on the border of phase interface, diatomite and bitumen changes from the free state to the film, and solvate shell of bitumen is saturated with asphaltenes. With the help of IR spectroscopy the authors defined the nature of the diatomite and bitumen interaction and proved that in the process of their interaction there occurs physical adsorption with additional absorption of bitumen components into the pore space of diatomite grains.

  13. Fragile X premutation carriers: A systematic review of neuroimaging findings.

    Brown, Stephanie S G; Stanfield, Andrew C

    2015-05-15

    Expansion of the CGG repeat region of the FMR1 gene from less than 45 repeats to between 55 and 200 repeats is known as the fragile X premutation. Carriers of the fragile X premutation may develop a neurodegenerative disease called fragile X-associated tremor/ataxia syndrome (FXTAS). Recent evidence suggests that premutation carriers experience other psychiatric difficulties throughout their lifespan. Medline, EMBASE and PsychINFO were searched for all appropriate English language studies published between January 1990 and December 2013. 419 potentially relevant articles were identified and screened. 19 articles were included in the analysis. We discuss key structural magnetic resonance imaging (MRI) findings such as the MCP sign and white matter atrophy. Additionally, we discuss how functional MRI results have progressed our knowledge of how FXTAS may manifest, including reduced brain activation during social and memory tasks in multiple regions. This systematic review may have been limited by the search for articles on just 3 scientific databases. Differing techniques and methods of analyses between research groups and primary research articles may have caused differences in results between studies. Current MRI studies into the fragile X premutation have been important in the diagnosis of FXTAS and identifying potential pathophysiological mechanisms. Associations with blood based measures have also demonstrated that neurodevelopmental and neurodegenerative aspects of the fragile X premutation could be functionally and pathologically separate. Larger longitudinal studies will be required to investigate these conclusions. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Neurological and endocrine phenotypes of fragile X carrier women.

    Hall, D; Todorova-Koteva, K; Pandya, S; Bernard, B; Ouyang, B; Walsh, M; Pounardjian, T; Deburghraeve, C; Zhou, L; Losh, M; Leehey, M; Berry-Kravis, E

    2016-01-01

    Women who carry fragile X mental retardation 1 (FMR1)gene premutation expansions frequently report neurological or endocrine symptoms and prior studies have predominantly focused on questionnaire report of medical issues. Premutation carrier (PMC) women (n = 33) and non-carrier controls (n = 13) were recruited and evaluated by a neurologist, neuropsychologist, and endocrinologist. Blood and skin biopsies were collected for molecular measures. Scales for movement disorders, neuropathy, cognitive function, psychiatric symptoms, sleep, and quality of life were completed. The average age of the women was 51 years (n = 46) and average CGG repeat size was 91 ± 24.9 in the FMR1 PMC women. Seventy percent of the PMC women had an abnormal neurological examination. PMC women had significantly higher scores on the Fragile X-Associated Tremor Ataxia Syndrome (FXTAS) rating scale, more neuropathy, and difficulty with tandem gait compared to controls. Central sensitivity syndromes, a neuroticism profile on the NEO Personality Profile, and sleep disorders were also prevalent. Discrepancies between subject report and examination findings were also seen. This pilot study suggests that women with the FMR1 premutation may have a phenotype that overlaps with that seen in FXTAS. Additional research with larger sample sizes is warranted to better delineate the clinical features. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Protection switching for carrier ethernet multicast

    Ruepp, Sarah Renée; Wessing, Henrik; Berger, Michael Stübert

    2010-01-01

    This paper addresses network survivability for IPTV multicast transport in Carrier Ethernet networks. The impact of link failures is investigated and suggestions for intelligent multicast resilience schemes are proposed. In particular, functions of the multicast tree are integrated with the Carri...... recovery path length, recovery time, number of branch nodes and operational complexity. The integrated approach therefore shows significant potential to increase the QoE for IPTV users in case of network failures and recovery actions.......This paper addresses network survivability for IPTV multicast transport in Carrier Ethernet networks. The impact of link failures is investigated and suggestions for intelligent multicast resilience schemes are proposed. In particular, functions of the multicast tree are integrated with the Carrier...

  16. Natural carriers in bioremediation: A review

    Anna Dzionek

    2016-09-01

    Full Text Available Bioremediation of contaminated groundwater or soil is currently the cheapest and the least harmful method of removing xenobiotics from the environment. Immobilization of microorganisms capable of degrading specific contaminants significantly promotes bioremediation processes, reduces their costs, and also allows for the multiple use of biocatalysts. Among the developed methods of immobilization, adsorption on the surface is the most common method in bioremediation, due to the simplicity of the procedure and its non-toxicity. The choice of carrier is an essential element for successful bioremediation. It is also important to consider the type of process (in situ or ex situ, type of pollution, and properties of immobilized microorganisms. For these reasons, the article summarizes recent scientific reports about the use of natural carriers in bioremediation, including efficiency, the impact of the carrier on microorganisms and contamination, and the nature of the conducted research.

  17. Hiding secret data into a carrier image

    Ovidiu COSMA

    2012-06-01

    Full Text Available The object of steganography is embedding hidden information in an appropriate multimedia carrier, e.g., image, audio, or video. There are several known methods of solving this problem, which operate either in the space domain or in the frequency domain, and are distinguished by the following characteristics: payload, robustness and strength. The payload is the amount of secret data that can be embedded in the carrier without inducing suspicious artefacts, robustness indicates the degree in which the secret data is affected by the normal processing of the carrier e.g., compression, and the strength indicate how easy the presence of hidden data can be detected by steganalysis techniques. This paper presents a new method of hiding secret data into a digital image compressed by a technique based on the Discrete Wavelet Transform (DWT [2] and the Set Partitioning In Hierarchical Trees (SPIHT subband coding algorithm [6]. The proposed method admits huge payloads and has considerable strength.

  18. Optimization of IGCT for pulsed power

    Chen Fanglin; Tang Longgu; Chen Yongmin; Pan Xuejun

    2014-01-01

    In order to develop high-performance IGCT devices applied in pulse power, cathode finger layout is optimized, the finger structure is modified, minority carrier lifetime is properly controlled and gate triggering characteristics is improved. As a result of these measures, the IGCT turn -on di/dt is improved, current handling capability is enhanced and switching response speed is increased. The feasibility and validity of the optimization study on the IGCT is verified by simulation and experimental results. (authors)

  19. LTE-Advanced Radio and Network Optimization

    Velez, Fernando J.; Sousa, Sofia; Flores, Jessica Acevedo

    2015-01-01

    In cellular optimization, the UL and DL the values from carrier-to-noise-plus-interference ratio (CNIR) from/at the mobile station are very important parameters. From a detailed analysis of its variation with the coverage and reuse distances for different values of the Channel Quality Indicator (...

  20. Recent Findings Concerning PAMAM Dendrimer Conjugates with Cyclodextrins as Carriers of DNA and RNA

    Keiichi Motoyama

    2009-08-01

    Full Text Available We have evaluated the potential use of various polyamidoamine (PAMAM dendrimer [dendrimer, generation (G 2-4] conjugates with cyclodextrins (CyDs as novel DNA and RNA carriers. Among the various dendrimer conjugates with CyDs, the dendrimer (G3 conjugate with α-CyD having an average degree of substitution (DS of 2.4 [α-CDE (G3, DS2] displayed remarkable properties as DNA, shRNA and siRNA delivery carriers through the sensor function of α-CDEs toward nucleic acid drugs, cell surface and endosomal membranes. In an attempt to develop cell-specific gene transfer carriers, we prepared sugar-appended α-CDEs. Of the various sugar-appended α-CDEs prepared, galactose- or mannose-appended α-CDEs provided superior gene transfer activity to α-CDE in various cells, but not cell-specific gene delivery ability. However, lactose-appended α-CDE [Lac-α-CDE (G2] was found to possess asialoglycoprotein receptor (AgpR-mediated hepatocyte-selective gene transfer activity, both in vitro and in vivo. Most recently, we prepared folate-poly(ethylene glycol-appended α-CDE [Fol-PαC (G3] and revealed that Fol-PαC (G3 imparted folate receptor (FR-mediated cancer cell-selective gene transfer activity. Consequently, α-CDEs bearing integrated, multifunctional molecules may possess the potential to be novel carriers for DNA, shRNA and siRNA.

  1. Towards 100 gigabit carrier ethernet transport networks

    Rasmussen, Anders; Zhang, Jiang; Yu, Hao

    2010-01-01

    technology, making the use of Ethernet as a convergence layer for Next Generation Networks a distinct possibility. Triple Play services, in particular IPTV, are expected to be a main drivers for carrier Ethernet, however, a number of challenges must be addressed including QoS enabled control plane, enhanced......Ethernet as a transport technology has, up to now, lacked the features such as network layer architecture, customer separation and manageability that carriers require for wide-scale deployment. However, with the advent of PBB-TE and TMPLS, it is now possible to use Ethernet as a transport...

  2. Interface recombination influence on carrier transport

    Konin, A

    2013-01-01

    A theory of interface recombination in the semiconductor–semiconductor junction is developed. The interface recombination rate dependence on the nonequilibrium carrier densities is derived on the basis of a model in which the interface recombination occurs through the mechanism of trapping. The general relation between the interface recombination parameters at small carrier density deviation from the equilibrium ones is obtained. The validity of this relation is proved considering the generation of the Hall electric field in the extrinsic semiconductor sample. The anomalous Hall electromotive force in a weak magnetic field was investigated and interpreted by means of a new interface recombination model. The experimental data corroborate the developed theory. (paper)

  3. Hot-carrier effects in MOS devices

    Takeda, Eiji; Miura-Hamada, Akemi

    1995-01-01

    The exploding number of uses for ultrafast, ultrasmall integrated circuits has increased the importance of hot-carrier effects in manufacturing as well as for other technological applications. They are rapidly movingout of the research lab and into the real world.This book is derived from Dr. Takedas book in Japanese, Hot-Carrier Effects, (published in 1987 by Nikkei Business Publishers). However, the new book is much more than a translation. Takedas original work was a starting point for developing this much more complete and fundamental text on this increasingly important topic. The new work

  4. A FDG-PET Study of Metabolic Networks in Apolipoprotein E ε4 Allele Carriers.

    Zhijun Yao

    Full Text Available Recently, some studies have applied the graph theory in brain network analysis in Alzheimer's disease (AD and Mild Cognitive Impairment (MCI. However, relatively little research has specifically explored the properties of the metabolic network in apolipoprotein E (APOE ε4 allele carriers. In our study, all the subjects, including ADs, MCIs and NCs (normal controls were divided into 165 APOE ε4 carriers and 165 APOE ε4 noncarriers. To establish the metabolic network for all brain regions except the cerebellum, cerebral glucose metabolism data obtained from FDG-PET (18F-fluorodeoxyglucose positron emission tomography were segmented into 90 areas with automated anatomical labeling (AAL template. Then, the properties of the networks were computed to explore the between-group differences. Our results suggested that both APOE ε4 carriers and noncarriers showed the small-world properties. Besides, compared with APOE ε4 noncarriers, the carriers showed a lower clustering coefficient. In addition, significant changes in 6 hub brain regions were found in between-group nodal centrality. Namely, compared with APOE ε4 noncarriers, significant decreases of the nodal centrality were found in left insula, right insula, right anterior cingulate, right paracingulate gyri, left cuneus, as well as significant increases in left paracentral lobule and left heschl gyrus in APOE ε4 carriers. Increased local short distance interregional correlations and disrupted long distance interregional correlations were found, which may support the point that the APOE ε4 carriers were more similar with AD or MCI in FDG uptake. In summary, the organization of metabolic network in APOE ε4 carriers indicated a less optimal pattern and APOE ε4 might be a risk factor for AD.

  5. Archaeosomes: an excellent carrier for drug and cell delivery.

    Kaur, Gurmeet; Garg, Tarun; Rath, Goutam; Goyal, Amit K

    2016-09-01

    Archaeosomes as liposomes made with one or more ether lipids that are unique to the domain of Archaeobacteria, found in Archaea constitute a novel family of liposome. Achaean-type lipids consist of archaeol (diether) and/or caldarchaeol (tetraether) core structures. Archaeosomes can be produced using standard procedures (hydrated film submitted to sonication, extrusion and detergent dialysis) at any temperature in the physiological range or lower, therefore making it possible to encapsulate thermally stable compounds. Various physiological as well as environmental factors affect its stability. Archaeosomes are widely used as drug delivery systems for cancer vaccines, Chagas disease, proteins and peptides, gene delivery, antigen delivery and delivery of natural antioxidant compounds. In this review article, our major aim was to explore the applications of this new carrier system in pharmaceutical field.

  6. Structural and chemical aspects of HPMA copolymers as drug carriers.

    Ulbrich, Karel; Subr, Vladimír

    2010-02-17

    Synthetic strategies and chemical and structural aspects of the synthesis of HPMA copolymer conjugates with various drugs and other biologically active molecules are described and discussed in this chapter. The discussion is held from the viewpoint of design and structure of the polymer backbone and biodegradable spacer between a polymer and drug, structure and methods of attachment of the employed drugs to the carrier and structure and methods of conjugation with targeting moieties. Physicochemical properties of the water-soluble polymer-drug conjugates and polymer micelles including mechanisms of drug release are also discussed. Detailed description of biological behavior of the polymer-drug conjugates as well as application of the copolymers for surface modification and targeting of gene delivery vectors are not included, they are presented and discussed in separate chapters of this issue. Copyright 2009 Elsevier B.V. All rights reserved.

  7. Visualizing Carrier Transport in Metal Halide Perovskite Nanoplates via Electric Field Modulated Photoluminescence Imaging.

    Hu, Xuelu; Wang, Xiao; Fan, Peng; Li, Yunyun; Zhang, Xuehong; Liu, Qingbo; Zheng, Weihao; Xu, Gengzhao; Wang, Xiaoxia; Zhu, Xiaoli; Pan, Anlian

    2018-05-09

    Metal halide perovskite nanostructures have recently been the focus of intense research due to their exceptional optoelectronic properties and potential applications in integrated photonics devices. Charge transport in perovskite nanostructure is a crucial process that defines efficiency of optoelectronic devices but still requires a deep understanding. Herein, we report the study of the charge transport, particularly the drift of minority carrier in both all-inorganic CsPbBr 3 and organic-inorganic hybrid CH 3 NH 3 PbBr 3 perovskite nanoplates by electric field modulated photoluminescence (PL) imaging. Bias voltage dependent elongated PL emission patterns were observed due to the carrier drift at external electric fields. By fitting the drift length as a function of electric field, we obtained the carrier mobility of about 28 cm 2 V -1 S -1 in the CsPbBr 3 perovskite nanoplate. The result is consistent with the spatially resolved PL dynamics measurement, confirming the feasibility of the method. Furthermore, the electric field modulated PL imaging is successfully applied to the study of temperature-dependent carrier mobility in CsPbBr 3 nanoplates. This work not only offers insights for the mobile carrier in metal halide perovskite nanostructures, which is essential for optimizing device design and performance prediction, but also provides a novel and simple method to investigate charge transport in many other optoelectronic materials.

  8. Effects of chemical structure on the thermodynamic efficiency of radical chain carriers for organic synthesis.

    Lin, Ching Yeh; Peh, Jessie; Coote, Michelle L

    2011-03-18

    The chain carrier index (CCI), defined as the ratio of the bond dissociation free energies (BDFE) of corresponding chain carrier halides and hydrides, is proposed as a measure of the thermodynamic efficiency of chain carriers for radical dehalogenation. The larger this value is relative to the corresponding value of the organic substrate, the more thermodynamically efficient the process. The chloride and bromide CCIs were evaluated at the G3(MP2)-RAD(+) level of theory for 120 different R-groups, covering a broad range of carbon-centered and noncarbon-centered species; the effects of solvent and temperature have also been studied. The broad finding from this work is that successful chain carriers generally maximize the strength of their halide (versus hydride bonds) through charge-shift bonding. As a result, the thermodynamic efficiency of a chain carrier tends to increase down the periodic table, and also with the inclusion of stronger electron donating substituents. The CCIs of carbon-centered species fall into a relatively narrow range so that, even when the CCI is maximized through inclusion of lone pair donor OMe or NMe(2) groups, the thermodynamic driving force for dehalogenation of other organic substrates is modest at best, and the process is likely to be kinetically hampered. Among the noncarbon-centered species studied, bismuth- and borane-centered compounds have some of the highest CCI values and, although their kinetics requires further optimization, these classes of compounds would be worth further investigation as tin-free radical reducing agents.

  9. Pricing Scheme of Ocean Carrier for Inbound Container Storage for Assistance of Container Supply Chain Finance

    Mingzhu Yu

    2014-01-01

    Full Text Available The aim of this paper is to investigate the pricing scheme of ocean carrier for inbound container storage so as to assist container supply chain finance. In this paper, how an ocean carrier should set price of inbound container storage to the customer while facing the contract from the container terminal operator is first analyzed. Then, two different contract systems, the free-time contract system which is widely used in practice and the free-space contract system which is newly developed recently, are considered. In the two different contract systems, inbound container storage pricing models are constructed, and accordingly optimal solution approaches for the ocean carrier are provided. For comparison purpose, some numerical experiments for the two different contract systems are conducted to investigate the effects of the container terminal operator’s decision on the system outcomes. Numerical experiments show that (1 the carrier is more flexible in the free-space contract system and can receive more profit by using the free-storage-space as a pooling storage system and (2 the free-space contract system benefits both the carrier in profit and the busy terminal in traffic control.

  10. Gene therapy prospects--intranasal delivery of therapeutic genes.

    Podolska, Karolina; Stachurska, Anna; Hajdukiewicz, Karolina; Małecki, Maciej

    2012-01-01

    Gene therapy is recognized to be a novel method for the treatment of various disorders. Gene therapy strategies involve gene manipulation on broad biological processes responsible for the spreading of diseases. Cancer, monogenic diseases, vascular and infectious diseases are the main targets of gene therapy. In order to obtain valuable experimental and clinical results, sufficient gene transfer methods are required. Therapeutic genes can be administered into target tissues via gene carriers commonly defined as vectors. The retroviral, adenoviral and adeno-associated virus based vectors are most frequently used in the clinic. So far, gene preparations may be administered directly into target organs or by intravenous, intramuscular, intratumor or intranasal injections. It is common knowledge that the number of gene therapy clinical trials has rapidly increased. However, some limitations such as transfection efficiency and stable and long-term gene expression are still not resolved. Consequently, great effort is focused on the evaluation of new strategies of gene delivery. There are many expectations associated with intranasal delivery of gene preparations for the treatment of diseases. Intranasal delivery of therapeutic genes is regarded as one of the most promising forms of pulmonary gene therapy research. Gene therapy based on inhalation of gene preparations offers an alternative way for the treatment of patients suffering from such lung diseases as cystic fibrosis, alpha-1-antitrypsin defect, or cancer. Experimental and first clinical trials based on plasmid vectors or recombinant viruses have revealed that gene preparations can effectively deliver therapeutic or marker genes to the cells of the respiratory tract. The noninvasive intranasal delivery of gene preparations or conventional drugs seems to be very encouraging, although basic scientific research still has to continue.

  11. Charge Carrier Dynamics at Silver Nanocluster-Molecular Acceptor Interfaces

    Almansaf, Abdulkhaleq

    2017-07-01

    A fundamental understanding of interfacial charge transfer at donor-acceptor interfaces is very crucial as it is considered among the most important dynamical processes for optimizing performance in many light harvesting systems, including photovoltaics and photo-catalysis. In general, the photo-generated singlet excitons in photoactive materials exhibit very short lifetimes because of their dipole-allowed spin radiative decay and short diffusion lengths. In contrast, the radiative decay of triplet excitons is dipole forbidden; therefore, their lifetimes are considerably longer. The discussion in this thesis primarily focuses on the relevant parameters that are involved in charge separation (CS), charge transfer (CT), intersystem crossing (ISC) rate, triplet state lifetime, and carrier recombination (CR) at silver nanocluster (NCs) molecular-acceptors interfaces. A combination of steady-state and femto- and nanosecond broadband transient absorption spectroscopies were used to investigate the charge carrier dynamics in various donor-acceptor systems. Additionally, this thesis was prolonged to investigate some important factors that influence the charge carrier dynamics in Ag29 silver NCs donor-acceptor systems, such as the metal doping and chemical structure of the nanocluster and molecular acceptors. Interestingly, clear correlations between the steady-state measurements and timeresolved spectroscopy results are found. In the first study, we have investigated the interfacial charge transfer dynamics in positively charged meso units of 5, 10, 15, 20-tetra (1- methyl-4-pyridino)-porphyrin tetra (p-toluene sulfonate) (TMPyP) and neutral charged 5, 10, 15, 20-tetra (4-pyridyl)-porphyrin (TPyP), with negatively charged undoped and gold (Au)- doped silver Ag29 NCs. Moreover, this study showed the impact of Au doping on the charge carrier dynamics of the system. In the second study, we have investigated the interfacial charge transfer dynamics in [Pt2 Ag23 Cl7 (PPh3

  12. Healthy versus Entorhinal Cortical Atrophy Identification in Asymptomatic APOE4 Carriers at Risk for Alzheimer’s Disease

    Konishi, Kyoko; Joober, Ridha; Poirier, Judes; MacDonald, Kathleen; Chakravarty, Mallar; Patel, Raihaan; Breitner, John; Bohbot, Véronique D.

    2018-01-01

    Early detection of Alzheimer’s disease (AD) has been challenging as current biomarkers are invasive and costly. Strong predictors of future AD diagnosis include lower volume of the hippocampus and entorhinal cortex, as well as the ɛ4 allele of the Apolipoprotein E gene (APOE) gene. Therefore, studying functions that are critically mediated by the hippocampus and entorhinal cortex, such as spatial memory, in APOE ɛ4 allele carriers, may be key to the identification of individuals at risk of AD, prior to the manifestation of cognitive impairments. Using a virtual navigation task developed in-house, specifically designed to assess spatial versus non-spatial strategies, the current study is the first to differentiate functional and structural differences within APOE ɛ4 allele carriers. APOE ɛ4 allele carriers that predominantly use non-spatial strategies have decreased fMRI activity in the hippocampus and increased atrophy in the hippocampus, entorhinal cortex, and fimbria compared to APOE ɛ4 allele carriers who use spatial strategies. In contrast, APOE ɛ4 allele carriers who use spatial strategies have grey matter levels comparable to non-APOE ɛ4 allele carriers. Furthermore, in a leave-one-out analysis, grey matter in the entorhinal cortex could predict navigational strategy with 92% accuracy. PMID:29278888

  13. Abnormal trajectories in cerebellum and brainstem volumes in carriers of the fragile X premutation.

    Wang, Jun Yi; Hessl, David; Hagerman, Randi J; Simon, Tony J; Tassone, Flora; Ferrer, Emilio; Rivera, Susan M

    2017-07-01

    Fragile X-associated tremor/ataxia syndrome (FXTAS) is a late-onset neurodegenerative disorder typically affecting male premutation carriers with 55-200 CGG trinucleotide repeat expansions in the FMR1 gene after age 50. The aim of this study was to examine whether cerebellar and brainstem changes emerge during development or aging in late life. We retrospectively analyzed magnetic resonance imaging scans from 322 males (age 8-81 years). Volume changes in the cerebellum and brainstem were contrasted with those in the ventricles and whole brain. Compared to the controls, premutation carriers without FXTAS showed significantly accelerated volume decrease in the cerebellum and whole brain, flatter inverted U-shaped trajectory of the brainstem, and larger ventricles. Compared to both older controls and premutation carriers without FXTAS, carriers with FXTAS exhibited significant volume decrease in the cerebellum and whole brain and accelerated volume decrease in the brainstem. We therefore conclude that cerebellar and brainstem volumes were likely affected during both development and progression of neurodegeneration in premutation carriers, suggesting that interventions may need to start early in adulthood to be most effective. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Identification of mitochondrial carriers in Saccharomyces cerevisiae by transport assay of reconstituted recombinant proteins.

    Palmieri, Ferdinando; Agrimi, Gennaro; Blanco, Emanuela; Castegna, Alessandra; Di Noia, Maria A; Iacobazzi, Vito; Lasorsa, Francesco M; Marobbio, Carlo M T; Palmieri, Luigi; Scarcia, Pasquale; Todisco, Simona; Vozza, Angelo; Walker, John

    2006-01-01

    The inner membranes of mitochondria contain a family of carrier proteins that are responsible for the transport in and out of the mitochondrial matrix of substrates, products, co-factors and biosynthetic precursors that are essential for the function and activities of the organelle. This family of proteins is characterized by containing three tandem homologous sequence repeats of approximately 100 amino acids, each folded into two transmembrane alpha-helices linked by an extensive polar loop. Each repeat contains a characteristic conserved sequence. These features have been used to determine the extent of the family in genome sequences. The genome of Saccharomyces cerevisiae contains 34 members of the family. The identity of five of them was known before the determination of the genome sequence, but the functions of the remaining family members were not. This review describes how the functions of 15 of these previously unknown transport proteins have been determined by a strategy that consists of expressing the genes in Escherichia coli or Saccharomyces cerevisiae, reconstituting the gene products into liposomes and establishing their functions by transport assay. Genetic and biochemical evidence as well as phylogenetic considerations have guided the choice of substrates that were tested in the transport assays. The physiological roles of these carriers have been verified by genetic experiments. Various pieces of evidence point to the functions of six additional members of the family, but these proposals await confirmation by transport assay. The sequences of many of the newly identified yeast carriers have been used to characterize orthologs in other species, and in man five diseases are presently known to be caused by defects in specific mitochondrial carrier genes. The roles of eight yeast mitochondrial carriers remain to be established.

  15. Study of the effect of HFE gene mutations on iron overload in ...

    Background: HFE gene mutations have been shown to be responsible for hereditary hemochromatosis. Their effect on iron load in β-thalassemia patients and carriers remains controversial. Objectives: We aimed to determine the prevalence of HFE gene mutations (C282Y and H63D) in β-thalassemia patients and carriers ...

  16. Electrical and thermal transport properties of Y bxCo4Sb12 filled skutterudites with ultrahigh carrier concentrations

    Yulong Li

    2015-11-01

    Full Text Available For filled skutterudites, element Yb is one of the most common and important fillers. However, the optimal carrier concentration range in Y bxCo4Sb12 filled skutterudites has not been determined as a result of the low Yb filling fraction limit. In this study, a non-equilibrium fabrication process (MS-SPS process, consisting of a melt-spinning method and a spark plasma sintering technique, has been applied to prepare Y bxCo4Sb12 samples. The Yb filling fraction is successfully extended to 0.35, which provides the possibility to clarify the optimal carrier concentration range for Yb-filled skutterudites. High carrier concentrations, with a maximum of around 1 × 1021 cm−3, were achieved in the MS-SPS Y bxCo4Sb12 samples due to the significantly enhanced Yb filling fractions. The phase compositions, lattice parameters, electrical and thermal transport properties of the MS-SPS Y bxCo4Sb12 samples with high carrier concentrations were systematically investigated. An optimal carrier concentration range of around 5 ∼ 6 × 1020 cm−3, corresponding to the actual Yb filling fraction of around 0.21∼0.26, has been determined, which displays the highest thermoelectric performance in Y bxCo4Sb12 thermoelectric materials.

  17. Solid state cloaking for electrical charge carrier mobility control

    Zebarjadi, Mona; Liao, Bolin; Esfarjani, Keivan; Chen, Gang

    2015-07-07

    An electrical mobility-controlled material includes a solid state host material having a controllable Fermi energy level and electrical charge carriers with a charge carrier mobility. At least one Fermi level energy at which a peak in charge carrier mobility is to occur is prespecified for the host material. A plurality of particles are distributed in the host material, with at least one particle disposed with an effective mass and a radius that minimize scattering of the electrical charge carriers for the at least one prespecified Fermi level energy of peak charge carrier mobility. The minimized scattering of electrical charge carriers produces the peak charge carrier mobility only at the at least one prespecified Fermi level energy, set by the particle effective mass and radius, the charge carrier mobility being less than the peak charge carrier mobility at Fermi level energies other than the at least one prespecified Fermi level energy.

  18. Carrier portfolio management for shipping seasonal products

    Lu, T.; Fransoo, J.C.; Lee, C.-Y.

    2017-01-01

    Many seasonal products are transported via ocean carriers from origin to destination markets. The shipments arriving earlier in the market may sell at higher prices, but faster shipping services can be costly. In this paper, we study a newsvendor-type shipper who transports and sells seasonal

  19. OCP: Opportunistic Carrier Prediction for Wireless Networks

    2008-08-01

    Many protocols have been proposed for medium access control in wireless networks. MACA [13], MACAW [3], and FAMA [8] are the earlier proposals for...world performance of carrier sense. In Proceedings of ACM SIGCOMM E-WIND Workshop, 2005. [13] P. Karn. MACA : A new channel access method for packet radio

  20. A new lubricant carrier for metal forming

    Arentoft, Mogens; Bay, Niels; Tang, Peter Torben

    2009-01-01

    A lubricant carrier for metal forming processes is developed. Surfaces with pores of micrometer size for entrapping lubricant are generated by electrochemical deposition of an alloy, consisting of two immiscible metals, of which one metal subsequently is etched away leaving 5 mu m layers with a s...... extrusion at high reduction and excessive stroke comparing with conventionally lubrication using phosphate coating and soap....

  1. Probing ultrafast carrier dynamics, nonlinear absorption

    We investigate the relaxation dynamics of photogenerated carriers in silicon nanowires consisting of a crystalline core and a surrounding amorphous shell, using femtosecond time resolved differential reflectivity and transmission spectroscopy at 3.15 eV and 1.57 eV photon energies. The complex behaviour of the ...

  2. European regulatory framework for person carrier robots

    Fosch Villaronga, E.; Roig, A.

    The aim of this paper is to establish the grounds for a future regulatory framework for Person Carrier Robots, which includes legal and ethical aspects. Current industrial standards focus on physical human–robot interaction, i.e. on the prevention of harm. Current robot technology nonetheless

  3. On safety of radioactive waste carrier

    Kondo, Toshikazu

    1995-01-01

    The waste generated by reprocessing the spent fuel from Japanese nuclear power stations in France and U.K. is to be returned to Japan. The first return transport was carried out from February to April when the waste management facility in Rokkasho, Aomori Prefecture, was completed. Most of this return transport was the sea transport using the exclusively used carrier, Pacific Pintail, from Cherbourg, France, to Mutsu Ogawara, Japan. Ministry of Transport carried out the examination on the safety of this method of transport including the safety of the carrier based on the rule for the sea transport and storage of dangerous substances. The international rule on the sea transport of high level radioactive waste, the course of adopting the INF code and its outline, and the Japanese safety standard for the carriers exclusively used for high level radioactive waste are explained. The Pacific Pintail is the ship of 5087 GT, which was built in 1987 as the carrier exclusively used for radioactive substances, owned by Pacific Nuclear Transport Ltd. of U.K. The main features related to the safety of the Pacific Pintail are explained, and the sufficient countermeasures are taken. (K.I.)

  4. A Suboptimal Power-Saving Transmission Scheme in Multiple Component Carrier Networks

    Chung, Yao-Liang; Tsai, Zsehong

    Power consumption due to transmissions in base stations (BSs) has been a major contributor to communication-related CO2 emissions. A power optimization model is developed in this study with respect to radio resource allocation and activation in a multiple Component Carrier (CC) environment. We formulate and solve the power-minimization problem of the BS transceivers for multiple-CC networks with carrier aggregation, while maintaining the overall system and respective users' utilities above minimum levels. The optimized power consumption based on this model can be viewed as a lower bound of that of other algorithms employed in practice. A suboptimal scheme with low computation complexity is proposed. Numerical results show that the power consumption of our scheme is much better than that of the conventional one in which all CCs are always active, if both schemes maintain the same required utilities.

  5. Wiener's Loop Filter for PLL-Based Carrier Recovery of OQPSK and MSK-Type Modulations

    Arnaldo Spalvieri

    2008-01-01

    Full Text Available This letter considers carrier recovery for offset quadrature phase shift keying (OQPSK and minimum shift keying-type (MSK-type modulations based on phase-lock loop (PLL. The concern of the letter is the optimization of the loop filter of the PLL. The optimization is worked out in the light of Wiener's theory taking into account the phase noise affecting the incoming carrier, the additive white Gaussian noise that is present on the channel, and the self-noise produced by the phase detector. Delay in the loop, which may affect the numerical implementation of the PLL, is also considered. Closed-form expressions for the loop filter and for the mean-square error are given for the case where the phase noise is characterized as a first-order process.

  6. Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers

    Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B.; Rudolph, Anja; Schmutzler, Rita K.; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A.; Easton, Douglas F.; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A.; Schmidt, Marjanka K; van der Baan, Frederieke H.; Spurdle, Amanda B.; Walker, Logan C.; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B.; Olopade, Olufunmilayo I.; Nussbaum, Robert L.; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy R.; Arun, Banu K.; Karlan, Beth Y.; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K.; Miron, Alex; Southey, Melissa C.; Goldgar, David E.; Buys, Saundra S.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Ding, Yuan Chun; Neuhausen, Susan L.; Hansen, Thomas V. O.; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E.; Blazer, Kathleen R.; Weitzel, Jeffrey N.; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E.; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D. Gareth R.; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E.; Kennedy, M. John; Rogers, Mark T.; Porteous, Mary E.; Morrison, Patrick J.; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V.; Ellis, Steve; Cole, Trevor; Godwin, Andrew K.; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M.; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L.; Rodriguez, Gustavo C.; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A.M.; Meijers-Heijboer, Hanne E.J.; van der Hout, Annemarie H.; Vreeswijk, Maaike P.G.; Hoogerbrugge, Nicoline; Ausems, Margreet G.E.M.; van Doorn, Helena C.; Collée, J. Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R.; Olswold, Curtis; Couch, Fergus J.; Lindor, Noralane M.; Wang, Xianshu; Szabo, Csilla I.; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E.; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F.; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M.; Phelan, Catherine M.; Greene, Mark H.; Mai, Phuong L.; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L.; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B.; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D.P.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Friedman, Eitan

    2014-01-01

    Background BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and non-genetic modifying factors. In this study we evaluated the putative role of variants in many candidate modifier genes. Methods Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n=3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. Results The observed p-values of association ranged between 0.005-1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. Conclusion There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Impact Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. PMID:25336561

  7. Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers.

    Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B; Rudolph, Anja; Schmutzler, Rita K; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A; Easton, Douglas F; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A; Schmidt, Marjanka K; van der Baan, Frederieke H; Spurdle, Amanda B; Walker, Logan C; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B; Olopade, Olufunmilayo I; Nussbaum, Robert L; Nathanson, Katherine L; Domchek, Susan M; Rebbeck, Timothy R; Arun, Banu K; Karlan, Beth Y; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K; Miron, Alex; Southey, Melissa C; Goldgar, David E; Buys, Saundra S; Janavicius, Ramunas; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Ding, Yuan Chun; Neuhausen, Susan L; Hansen, Thomas V O; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E; Blazer, Kathleen R; Weitzel, Jeffrey N; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D Gareth R; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E; Kennedy, M John; Rogers, Mark T; Porteous, Mary E; Morrison, Patrick J; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V; Ellis, Steve; Cole, Trevor; Godwin, Andrew K; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L; Rodriguez, Gustavo C; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A M; Meijers-Heijboer, Hanne E J; van der Hout, Annemarie H; Vreeswijk, Maaike P G; Hoogerbrugge, Nicoline; Ausems, Margreet G E M; van Doorn, Helena C; Collée, J Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R; Olswold, Curtis; Couch, Fergus J; Lindor, Noralane M; Wang, Xianshu; Szabo, Csilla I; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M; Phelan, Catherine M; Greene, Mark H; Mai, Phuong L; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D P; Chenevix-Trench, Georgia; Antoniou, Antonis C; Friedman, Eitan

    2015-01-01

    BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and nongenetic modifying factors. In this study, we evaluated the putative role of variants in many candidate modifier genes. Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n = 3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. The observed P values of association ranged between 0.005 and 1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. ©2014 American Association for Cancer Research.

  8. Cosmogenic radionuclide carriers in the atmosphere

    Lujaniene, G.; Lujanas, V.

    1998-01-01

    The investigation of radionuclides ( 7 Be 32,33 P and 35 S) and stable sulfur and phosphorus forms was based on the Tessier sequential extraction method. The properties of radionuclide carriers can be transformed in the atmosphere in a very short time (days, hours), in contrast to soil and the hydrosphere. Oxidation processes proceeding in the atmosphere induce changes in the aerosol carrier properties. The aerosol can be characterized by low pH and high Eh values corresponding to high 7Be solubility. The unexpectedly high negative Eh values obtained in dry summer period indicate that the 7 Be 32,33 P aerosol is bound to insoluble carriers. 137 Cs solubility does not depend on changes in pH. This can be explained by the fact that in contrast to 7 Be, 137 Cs is associated with the exchangeable fraction. Cs ions can be replaced not only by H + but also by NH 4 + and other ions. 7 Be aerosols collected at the seaside of the Baltic sea (Preila) were found to be more soluble than those in Vilnius, their solubility was up to 50-90 % and clear dependence between 7 Be solubility, pH and Eh was not observed. It can be attributed to differences in the atmospheric aerosol composition (e.g. soluble chlorides) in Vilnius and Preila. A great variety of 7 Be carriers properties as well as their dependence on the season and the existence of admixtures in the atmosphere require great caution in applying this isotope in tracer investigations. Soluble carriers are removed faster from the atmosphere by precipitation. The significance of this fact is confirmed by the ratio of 7 Be/ 32 P in the air and precipitation. Both soluble and insoluble aerosols can be formed depending on the environmental conditions

  9. Limitations of high dose carrier based formulations.

    Yeung, Stewart; Traini, Daniela; Tweedie, Alan; Lewis, David; Church, Tanya; Young, Paul M

    2018-06-10

    This study was performed to investigate how increasing the active pharmaceutical ingredient (API) content within a formulation affects the dispersion of particles and the aerosol performance efficiency of a carrier based dry powder inhalable (DPI) formulation, using a custom dry powder inhaler (DPI) development rig. Five formulations with varying concentrations of API beclomethasone dipropionate (BDP) between 1% and 30% (w/w) were formulated as a multi-component carrier system containing coarse lactose and fine lactose with magnesium stearate. The morphology of the formulation and each component were investigated using scanning electron micrographs while the particle size was measured by laser diffraction. The aerosol performance, in terms of aerodynamic diameter, was assessed using the British pharmacopeia Apparatus E cascade impactor (Next generation impactor). Chemical analysis of the API was observed by high performance liquid chromatography (HPLC). Increasing the concentration of BDP in the blend resulted in increasing numbers and size of individual agglomerates and densely packed BDP multi-layers on the surface of the lactose carrier. BDP present within the multi-layer did not disperse as individual primary particles but as dense agglomerates, which led to a decrease in aerosol performance and increased percentage of BDP deposition within the Apparatus E induction port and pre-separator. As the BDP concentration in the blends increases, aerosol performance of the formulation decreases, in an inversely proportional manner. Concurrently, the percentage of API deposition in the induction port and pre-separator could also be linked to the amount of micronized particles (BDP and Micronized composite carrier) present in the formulation. The effect of such dose increase on the behaviour of aerosol dispersion was investigated to gain greater insight in the development and optimisation of higher dosed carrier-based formulations. Copyright © 2018 Elsevier B.V. All

  10. Carrier transport in THz quantum cascade lasers: Are Green's functions necessary?

    Matyas, A; Jirauschek, C; Kubis, T; Lugli, P

    2009-01-01

    We have applied two different simulation models for the stationary carrier transport and optical gain analysis in resonant phonon depopulation THz Quantum Cascade Lasers (QCLs), based on the semiclassical ensemble Monte Carlo (EMC) and fully quantum mechanical non-equilibrium Green's functions (NEGF) method, respectively. We find in the incoherent regime near and above the threshold current a qualitative and quantitative agreement of both methods. Therefore, we show that THz-QCLs can be successfully optimized utilizing the numerically efficient EMC method.

  11. Characterization of EIAV LTR variability and compartmentalization in various reservoir tissues of long-term inapparent carrier ponies

    Reis, Jenner K.P.; Craigo, Jodi K.; Cook, Sheila J.; Issel, Charles J.; Montelaro, Ronald C.

    2003-01-01

    Dynamic genomic variation resulting in changes in envelope antigenicity has been established as a fundamental mechanism of persistence by equine infectious anemia virus (EIAV), as observed with other lentiviruses, including HIV-1. In addition to the reported changes in envelope sequences, however, certain studies indicate the viral LTR as a second variable EIAV gene, with the enhancer region being designated as hypervariable. These observations have lead to the suggestion that LTR variation may alter viral replication properties to optimize to the microenvironment of particular tissue reservoirs. To test this hypothesis directly, we examined the population of LTR quasispecies contained in various tissues of two inapparent carrier ponies experimentally infected with a reference EIAV biological clone for 18 months. The results of these studies demonstrated that the EIAV LTR is in fact highly conserved with respect to the infecting LTR species after 1.5 years of persistent infection and regardless of the tissue reservoir. Thus, these comprehensive analyses demonstrate for the first time that the EIAV LTR is highly conserved during long-term persistent infection and that the observed variations in viral LTR are associated more with in vitro adaptation to replication in cultured cells rather than in vivo replication in natural target cells

  12. Association of breast cancer risk in BRCA1 and BRCA2 mutation carriers with genetic variants showing differential allelic expression

    Hamdi, Yosr; Soucy, Penny; Kuchenbaeker, Karoline B

    2017-01-01

    and ovarian cancer risks in 15,252 BRCA1 and 8211 BRCA2 mutation carriers ascertained from 54 studies participating in the Consortium of Investigators of Modifiers of BRCA1/2. RESULTS: We identified a region on 11q22.3 that is significantly associated with breast cancer risk in BRCA1 mutation carriers (most...... studies using estrogen receptor (ER)-negative or triple-negative (i.e., ER-, progesterone receptor-, and HER2-negative) cases could therefore be helpful to confirm the association of this locus with breast cancer risk.......1 and BRCA2 mutation carriers, a list of 175 genes was developed based of their involvement in cancer-related pathways. METHODS: Using data from a genome-wide map of SNPs associated with allelic expression, we assessed the association of ~320 SNPs located in the vicinity of these genes with breast...

  13. Carrier-interleaved orthogonal multi-electrode multi-carrier resistivity-measurement tool

    Cai, Yu; Sha, Shuang

    2016-01-01

    This paper proposes a new carrier-interleaved orthogonal multi-electrode multi-carrier resistivity-measurement tool used in a cylindrical borehole environment during oil-based mud drilling processes. The new tool is an orthogonal frequency division multiplexing access-based contactless multi-measurand detection tool. The tool can measure formation resistivity in different azimuthal angles and elevational depths. It can measure many more measurands simultaneously in a specified bandwidth than the legacy frequency division multiplexing multi-measurand tool without a channel-select filter while avoiding inter-carrier interference. The paper also shows that formation resistivity is not sensitive to frequency in certain frequency bands. The average resistivity collected from N subcarriers can increase the measurement of the signal-to-noise ratio (SNR) by N times given no amplitude clipping in the current-injection electrode. If the clipping limit is taken into account, with the phase rotation of each single carrier, the amplitude peak-to-average ratio can be reduced by 3 times, and the SNR can achieve a 9/ N times gain over the single-carrier system. The carrier-interleaving technique is also introduced to counter the carrier frequency offset (CFO) effect, where the CFO will cause inter-pad interference. A qualitative analysis and simulations demonstrate that block-interleaving performs better than tone-interleaving when coping with a large CFO. The theoretical analysis also suggests that increasing the subcarrier number can increase the measurement speed or enhance elevational resolution without sacrificing receiver performance. The complex orthogonal multi-pad multi-carrier resistivity logging tool, in which all subcarriers are complex signals, can provide a larger available subcarrier pool than other types of transceivers. (paper)

  14. Nonlinear optimization

    Ruszczynski, Andrzej

    2011-01-01

    Optimization is one of the most important areas of modern applied mathematics, with applications in fields from engineering and economics to finance, statistics, management science, and medicine. While many books have addressed its various aspects, Nonlinear Optimization is the first comprehensive treatment that will allow graduate students and researchers to understand its modern ideas, principles, and methods within a reasonable time, but without sacrificing mathematical precision. Andrzej Ruszczynski, a leading expert in the optimization of nonlinear stochastic systems, integrates the theory and the methods of nonlinear optimization in a unified, clear, and mathematically rigorous fashion, with detailed and easy-to-follow proofs illustrated by numerous examples and figures. The book covers convex analysis, the theory of optimality conditions, duality theory, and numerical methods for solving unconstrained and constrained optimization problems. It addresses not only classical material but also modern top...

  15. Rapid DNA haplotyping using a multiplex heteroduplex approach: Application to Duchenne muscula dystrophy carrier detection

    Prior, T.W.; Wenger, G.D.; Moore, J. [Ohio State Univ., Columbus, OH (United States)] [and others

    1994-09-01

    A new strategy has been developed for rapid haplotype analysis. It is based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. The method is simple, rapid, does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using 12 commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. As a result of expanding the number of detectable polymorphisms throughout the dystrophin gene, we show how the method can easily be combined with dinucleotide analysis to improve the accuracy of carrier detection in the nondeletion cases. The technique is also shown to be used as an effective screen for improving carrier detection in several families with deletions. The finding of heterozygosity within the deletion identifies the at-risk female as a noncarrier. Using this method, we have identified and incorporated 3 new dystrophin polymorphisms (one of which in exon 16 is unique to African Americans). The method may be used other genetic diseases when mutations are unknown, or there are few dinucleotide markers in the gene proximity, or for the identification of haplotype backgrounds of mutant alleles.

  16. Electrodeposition of carrier-free 57Co on rhodium as an approach to the preparation of Moessbauer sources

    Cieszykowska, Izabela; ZoLtowska, MaLgorzata; Mielcarski, MieczysLaw

    2011-01-01

    Electrodeposition of carrier-free 57 Co on a rhodium matrix as the first step of preparing Moessbauer sources was studied. To optimize the plating parameters, the influences of current density, volume and pH of the electrolyte solution, shape, thickness, and surface area of the rhodium cathode, mode of cathode pretreatment, concentration of 57 Co and duration of electrolysis were investigated.

  17. Development of a Practical Hydrogen Storage System Based on Liquid Organic Hydrogen Carriers and a Homogeneous Catalyst

    Jensen, Craig [Hawaii Hydrogen Carriers, LLC, Honolulu, HI (United States); Brayton, Daniel [Hawaii Hydrogen Carriers, LLC, Honolulu, HI (United States); Jorgensen, Scott W. [General Motors, LLC, Warren, MI (United States). Research and Development Center. Chemical and Material Systems Lab.; Hou, Peter [General Motors, LLC, Warren, MI (United States). Research and Development Center. Chemical and Material Systems Lab.

    2017-03-24

    The objectives of this project were: 1) optimize a hydrogen storage media based on LOC/homogeneous pincer catalyst (carried out at Hawaii Hydrogen Carriers, LLC) and 2) develop space, mass and energy efficient tank and reactor system to house and release hydrogen from the media (carried out at General Motor Research Center).

  18. Website Optimization

    King, Andrew

    2008-01-01

    Remember when an optimized website was one that merely didn't take all day to appear? Times have changed. Today, website optimization can spell the difference between enterprise success and failure, and it takes a lot more know-how to achieve success. This book is a comprehensive guide to the tips, techniques, secrets, standards, and methods of website optimization. From increasing site traffic to maximizing leads, from revving up responsiveness to increasing navigability, from prospect retention to closing more sales, the world of 21st century website optimization is explored, exemplified a

  19. Phenotype comparison of MLH1 and MSH2 mutation carriers in a cohort of 1,914 individuals undergoing clinical genetic testing in the United States

    F. Kastrinos (Fay); E.M. Stoffel (Elena); J. Balmana (Judith); E.W. Steyerberg (Ewout); R. Mercado (Rowena); S. Syngal (Sapna)

    2008-01-01

    textabstractBackground and Aims: Lynch syndrome is caused by germ-line mismatch repair gene mutations. We examined the phenotypic differences between MLH1 and MSH2 gene mutation carriers and whether mutation type (point versus large rearrangement) affected phenotypic expression. Methods: This is a

  20. DNA Glycosylases Involved in Base Excision Repair May Be Associated with Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    Osorio, Ana; Milne, Roger L; Kuchenbaecker, Karoline

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) in genes involved in the D