WorldWideScience

Sample records for gene based pcr

  1. PCR-based detection of gene transfer vectors: application to gene doping surveillance.

    Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

    2013-12-01

    Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

  2. Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.

    Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto

    2018-08-01

    Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

    Panca J. Santoso

    2013-07-01

    Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

  4. Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

    Gaya Prasad

    2013-06-01

    Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

  5. Cloning of the koi herpesvirus (KHV gene encoding thymidine kinase and its use for a highly sensitive PCR based diagnosis

    Gilad Oren

    2005-03-01

    Full Text Available Abstract Background Outbreaks with mass mortality among common carp Cyprinus carpio carpio and koi Cyprinus carpio koi have occurred worldwide since 1998. The herpes-like virus isolated from diseased fish is different from Herpesvirus cyprini and channel catfish virus and was accordingly designated koi herpesvirus (KHV. Diagnosis of KHV infection based on viral isolation and current PCR assays has a limited sensitivity and therefore new tools for the diagnosis of KHV infections are necessary. Results A robust and sensitive PCR assay based on a defined gene sequence of KHV was developed to improve the diagnosis of KHV infection. From a KHV genomic library, a hypothetical thymidine kinase gene (TK was identified, subcloned and expressed as a recombinant protein. Preliminary characterization of the recombinant TK showed that it has a kinase activity using dTTP but not dCTP as a substrate. A PCR assay based on primers selected from the defined DNA sequence of the TK gene was developed and resulted in a 409 bp amplified fragment. The TK based PCR assay did not amplify the DNAs of other fish herpesviruses such as Herpesvirus cyprini (CHV and the channel catfish virus (CCV. The TK based PCR assay was specific for the detection of KHV and was able to detect as little as 10 fentograms of KHV DNA corresponding to 30 virions. The TK based PCR was compared to previously described PCR assays and to viral culture in diseased fish and was shown to be the most sensitive method of diagnosis of KHV infection. Conclusion The TK based PCR assay developed in this work was shown to be specific for the detection of KHV. The TK based PCR assay was more sensitive for the detection of KHV than previously described PCR assays; it was as sensitive as virus isolation which is the golden standard method for KHV diagnosis and was able to detect as little as 10 fentograms of KHV DNA corresponding to 30 virions.

  6. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  7. Species Authentication of Common Meat Based on PCR Analysis of the Mitochondrial COI Gene.

    Dai, Zhenyu; Qiao, Jiao; Yang, Siran; Hu, Shen; Zuo, Jingjing; Zhu, Weifeng; Huang, Chunhong

    2015-07-01

    Adulteration of meat products and costly animal-derived commodities with their inferior/cheaper counterparts is a grievous global problem. Species authentication is still technical challenging, especially to those deep processed products. The present study described the design of seven sets of species-specific primer based on a high heterozygous region of mitochondrial cytochrome c oxidase subunit I (COI) gene. These primers were proven to have high species specificity and no cross-reactions and unexpected products to different DNA source. Multiplex PCR assay was achieved for rapid and economical identification of four commonly consumed meats (pork, beef, chicken, and mutton). The conventional PCR assay was sensitive down to 0.001 ng of DNA template in the reactant. The developed method was also powerful in detecting as low as 0.1-mg adulterated pork (0.05 % in wt/wt) in an artificial counterfeited mutton. Validation test showed that the assay is specific, reproducible, and robust in commercial deep processed meats, leatherware, and feather commodities. This proposed method will be greatly beneficial to the consumers, food industry, leather, and feather commodity manufacture.

  8. Nested PCR and RFLP analysis based on the 16S rRNA gene

    Current phytoplasma detection and identification method is primarily based on nested PCR followed by restriction fragment length polymorphism analysis and gel electrophoresis. This method can potentially detect and differentiate all phytoplasmas including those previously not described. The present ...

  9. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  10. Heterologous Reconstitution of the Intact Geodin Gene Cluster in Aspergillus nidulans through a Simple and Versatile PCR Based Approach

    Nielsen, Morten Thrane; Nielsen, Jakob Blæsbjerg; Anyaogu, Dianna Chinyere

    2013-01-01

    was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to ransformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were...... of solid methodology for genetic manipulation of most species severely hampers pathway haracterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus...... successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC) encodes a polyketide synthase, ATEG_08453 (gedR) encodes a transcription factor...

  11. 18S rRNA is a reliable normalisation gene for real time PCR based on influenza virus infected cells

    Kuchipudi Suresh V

    2012-10-01

    Full Text Available Abstract Background One requisite of quantitative reverse transcription PCR (qRT-PCR is to normalise the data with an internal reference gene that is invariant regardless of treatment, such as virus infection. Several studies have found variability in the expression of commonly used housekeeping genes, such as beta-actin (ACTB and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, under different experimental settings. However, ACTB and GAPDH remain widely used in the studies of host gene response to virus infections, including influenza viruses. To date no detailed study has been described that compares the suitability of commonly used housekeeping genes in influenza virus infections. The present study evaluated several commonly used housekeeping genes [ACTB, GAPDH, 18S ribosomal RNA (18S rRNA, ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9 (ATP5G1] to identify the most stably expressed gene in human, pig, chicken and duck cells infected with a range of influenza A virus subtypes. Results The relative expression stability of commonly used housekeeping genes were determined in primary human bronchial epithelial cells (HBECs, pig tracheal epithelial cells (PTECs, and chicken and duck primary lung-derived cells infected with five influenza A virus subtypes. Analysis of qRT-PCR data from virus and mock infected cells using NormFinder and BestKeeper software programmes found that 18S rRNA was the most stable gene in HBECs, PTECs and avian lung cells. Conclusions Based on the presented data from cell culture models (HBECs, PTECs, chicken and duck lung cells infected with a range of influenza viruses, we found that 18S rRNA is the most stable reference gene for normalising qRT-PCR data. Expression levels of the other housekeeping genes evaluated in this study (including ACTB and GPADH were highly affected by influenza virus infection and

  12. Heterologous reconstitution of the intact geodin gene cluster in Aspergillus nidulans through a simple and versatile PCR based approach.

    Morten Thrane Nielsen

    Full Text Available Fungal natural products are a rich resource for bioactive molecules. To fully exploit this potential it is necessary to link genes to metabolites. Genetic information for numerous putative biosynthetic pathways has become available in recent years through genome sequencing. However, the lack of solid methodology for genetic manipulation of most species severely hampers pathway characterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to transformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC encodes a polyketide synthase, ATEG_08453 (gedR encodes a transcription factor responsible for activation of the geodin gene cluster and ATEG_08460 (gedL encodes a halogenase that catalyzes conversion of sulochrin to dihydrogeodin. We expect that our approach for transferring intact biosynthetic pathways to a fungus with a well developed genetic toolbox will be instrumental in characterizing the many exciting pathways for secondary metabolite production that are currently being uncovered by the fungal genome sequencing projects.

  13. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  14. Genotyping of Pasteurella multocida ovine and bovine isolates from Iran based on PCR-RFLP of ompH gene

    A. Ghanizadeh

    2015-10-01

    Full Text Available Pasteurella multocida (P. multocida, A Gram-negative facultative anaerobic bacterium, is a causative animal pathogen in porcine atrophic rhinitis and avian fowl cholera. The outer membrane of Gram-negative bacteria contains of many different protein in very high copy numbers. One of the major outer membrane, the H proteins have functional as high immunogenicity and antigenicity. In this study to increase information about epidemiology of ovine and bovine P. multocida, the 24 isolates from sheep and nine isolates from cattle were investigated by PCR-RFLP analysis of the ompH gene. In all 33 isolates, digestion of the amplified fragment of ompH gene by using EcoRI, cfoI and HindIII produced 3, 5 and 3 different restriction patterns respectively. Sixteen RFLP patterns were found among 33 investigated P.multocida isolates. This study showed that, the PCR RFLP based on ompH gene is potentially a useful method for typing of P. multocida isolates from sheep and cattle. The RFLP patterns of this gene exhibited extensive restriction site heterogeneity, which may be particularly suitable for fingerprinting of P. multocida isolates.Considering ompH protein as a protective immunogenic moiety of P.ultocida, the results of this study showed a heterogenic bacteria and this means the possibility to produce a multivalent vaccine to be protective against diseases caused by this organism in sheep and cattle in Iran.

  15. Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

    Wang, R F; Cao, W W; Cerniglia, C E

    1996-01-01

    In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

  16. Synthesis of the human VEGF165 gene based on overlap PCR and ...

    Yomi

    2012-01-16

    Jan 16, 2012 ... recombinant human VEGF165 (rhVEGF165) protein in CHO cells. ... The PCR program consisted of a denaturation step at 95°C for 3 min, then 25 cycles at ... PCR product for template and two oligos introduced at one end for.

  17. PCR-based detection of resistance genes in anaerobic bacteria isolated from intra-abdominal infections.

    Tran, Chau Minh; Tanaka, Kaori; Watanabe, Kunitomo

    2013-04-01

    Little information is available on the distribution of antimicrobial resistance genes in anaerobes in Japan. To understand the background of antimicrobial resistance in anaerobes involved in intra-abdominal infections, we investigated the distribution of eight antimicrobial resistance genes (cepA, cfiA, cfxA, ermF, ermB, mefA, tetQ, and nim) and a mutation in the gyrA gene in a total of 152 organisms (Bacteroides spp., Prevotella spp., Fusobacterium spp., Porphyromonas spp., Bilophila wadsworthia, Desulfovibrio desulfuricans, Veillonella spp., gram-positive cocci, and non-spore-forming gram-positive bacilli) isolated between 2003 and 2004 in Japan. The cepA gene was distributed primarily in Bacteroides fragilis. Gene cfxA was detected in about 9 % of the Bacteroides isolates and 75 % of the Prevotella spp. isolates and did not appear to contribute to cephamycin resistance. Two strains of B. fragilis contained the metallo-β-lactamase gene cfiA, but they did not produce the protein product. Gene tetQ was detected in about 81, 44, and 63 % of B. fragilis isolates, other Bacteroides spp., and Prevotella spp. isolates, respectively. The ermF gene was detected in 25, 13, 56, 64, and 16 % of Bacteroides spp., Prevotella spp., Fusobacterium spp., B. wadsworthia, and anaerobic cocci, respectively. Gene mefA was found in only 10 % of the B. fragilis strains and 3 % of the non-B. fragilis strains. Genes nim and ermB were not detected in any isolate. Substitution at position 82 (Ser to Phe) in gyrA was detected in B. fragilis isolates that were less susceptible or resistant to moxifloxacin. This study is the first report on the distribution of resistance genes in anaerobes isolated from intra-abdominal infections in Japan. We expect that the results might help in understanding the resistance mechanisms of specific anaerobes.

  18. A seminested PCR assay for detection and typing of human papillomavirus based on E1 gene sequences.

    Cavalcante, Gustavo Henrique O; de Araújo, Josélio M G; Fernandes, José Veríssimo; Lanza, Daniel C F

    2018-05-01

    HPV infection is considered one of the leading causes of cervical cancer in the world. To date, more than 180 types of HPV have been described and viral typing is critical for defining the prognosis of cancer. In this work, a seminested PCR which allow fast and inexpensively detection and typing of HPV is presented. The system is based on the amplification of a variable length region within the viral gene E1, using three primers that potentially anneal in all HPV genomes. The amplicons produced in the first step can be identified by high resolution electrophoresis or direct sequencing. The seminested step includes nine specific primers which can be used in multiplex or individual reactions to discriminate the main types of HPV by amplicon size differentiation using agarose electrophoresis, reducing the time spent and cost per analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. PCR-based clonality analysis of B-cell lymphomas in paraffin-embedded tissues: diagnostic value of immunoglobulin kappa and lambda light chain gene rearrangement investigation.

    Amara, Khaled; Trimeche, Mounir; Ziadi, Sonia; Sriha, Badreddine; Mokni, Moncef; Korbi, Sadok

    2006-01-01

    Polymerase chain reaction (PCR)-based analysis, employed for detecting immunoglobulin heavy chain (IgH) gene rearrangements, has become a diagnostic tool widely used in the investigation of B-cell lymphomas, but the overall sensitivity of these methods does not exceed 80%, notably in germinal center (GC) and post-GC B-cell origin lymphomas. Many PCR strategies devised for detecting immunoglobulin light chain (IgL) gene rearrangements have been developed to enhance the clonality detection rates. However, the feasibility of these methods in routine clinical diagnosis using paraffin-embedded tissues has not yet been investigated sufficiently. We studied a large series of 108 cases of B-cell lymphomas, as well as 20 reactive lymphoid tissues using degenerate primers to amplify immunoglobulin kappa (Igkappa) and lambda (Iglambda) light chain genes. B-cell clonality was further investigated using semi-nested PCR for IgH gene rearrangements. B-cell clonality was detected in 74%, 56.5%, and 43.5% of cases using IgH, Igkappa, and Iglambda PCR, respectively. By combining these methods, the clonality detection rate increased to 93.5%. Only polyclonal patterns were noted in reactive lymphoid samples. We concluded that in addition to the established methods for IgH analysis, a PCR-based approach for IgL gene rearrangements analysis improves the clonality detection rate in over 90% of B-cell lymphoma cases using routine histological specimens with poor preservation of the genomic DNA.

  20. PCR-based isolation and identification of full-length low-molecular-weight glutenin subunit genes in bread wheat (Triticum aestivum L.).

    Zhang, Xiaofei; Liu, Dongcheng; Jiang, Wei; Guo, Xiaoli; Yang, Wenlong; Sun, Jiazhu; Ling, Hongqing; Zhang, Aimin

    2011-12-01

    Low-molecular-weight glutenin subunits (LMW-GSs) are encoded by a multi-gene family and are essential for determining the quality of wheat flour products, such as bread and noodles. However, the exact role or contribution of individual LMW-GS genes to wheat quality remains unclear. This is, at least in part, due to the difficulty in characterizing complete sequences of all LMW-GS gene family members in bread wheat. To identify full-length LMW-GS genes, a polymerase chain reaction (PCR)-based method was established, consisting of newly designed conserved primers and the previously developed LMW-GS gene molecular marker system. Using the PCR-based method, 17 LMW-GS genes were identified and characterized in Xiaoyan 54, of which 12 contained full-length sequences. Sequence alignments showed that 13 LMW-GS genes were identical to those found in Xiaoyan 54 using the genomic DNA library screening, and the other four full-length LMW-GS genes were first isolated from Xiaoyan 54. In Chinese Spring, 16 unique LMW-GS genes were isolated, and 13 of them contained full-length coding sequences. Additionally, 16 and 17 LMW-GS genes in Dongnong 101 and Lvhan 328 (chosen from the micro-core collections of Chinese germplasm), respectively, were also identified. Sequence alignments revealed that at least 15 LMW-GS genes were common in the four wheat varieties, and allelic variants of each gene shared high sequence identities (>95%) but exhibited length polymorphism in repetitive regions. This study provides a PCR-based method for efficiently identifying LMW-GS genes in bread wheat, which will improve the characterization of complex members of the LMW-GS gene family and facilitate the understanding of their contributions to wheat quality.

  1. Analysis of conditional gene deletion using probe based Real-Time PCR

    Lyko Frank

    2010-12-01

    Full Text Available Abstract Following publication of this article 1 the authors noticed that an incorrect probe reference was cited on page 3, 4, 5 and 6 ("UP #69, Roche Applied Science". The correct probe that was used for the 1lox/2lox allele ratio analysis in the paper is as follows Probe for 1lox/2lox allele quantification: 5'-6-FAM-atAaCtTCgtatagCATaCattatac-BHQ-1 -3' (uppercase letters = LNA bases Manufacturer: EUROGENTEC, Seraing, Belgium All other information and reaction conditions in the paper are correct as stated.

  2. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  3. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  4. Evidence based selection of commonly used RT-qPCR reference genes for the analysis of mouse skeletal muscle.

    Kristen C Thomas

    Full Text Available The ability to obtain accurate and reproducible data using quantitative real-time Polymerase Chain Reaction (RT-qPCR is limited by the process of data normalization. The use of 'housekeeping' or 'reference' genes is the most common technique used to normalize RT-qPCR data. However, commonly used reference genes are often poorly validated and may change as a result of genetic background, environment and experimental intervention. Here we present an analysis of 10 reference genes in mouse skeletal muscle (Actb, Aldoa, Gapdh, Hprt1, Ppia, Rer1, Rn18s, Rpl27, Rpl41 and Rpl7L1, which were identified as stable either by microarray or in the literature. Using the MIQE guidelines we compared wild-type (WT mice across three genetic backgrounds (R129, C57BL/6j and C57BL/10 as well as analyzing the α-actinin-3 knockout (Actn3 KO mouse, which is a model of the common null polymorphism (R577X in human ACTN3. Comparing WT mice across three genetic backgrounds, we found that different genes were more tightly regulated in each strain. We have developed a ranked profile of the top performing reference genes in skeletal muscle across these common mouse strains. Interestingly the commonly used reference genes; Gapdh, Rn18s, Hprt1 and Actb were not the most stable. Analysis of our experimental variant (Actn3 KO also resulted in an altered ranking of reference gene suitability. Furthermore we demonstrate that a poor reference gene results in increased variability in the normalized expression of a gene of interest, and can result in loss of significance. Our data demonstrate that reference genes need to be validated prior to use. For the most accurate normalization, it is important to test several genes and use the geometric mean of at least three of the most stably expressed genes. In the analysis of mouse skeletal muscle, strain and intervention played an important role in selecting the most stable reference genes.

  5. Real-time PCR based on SYBR-Green I fluorescence: An alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions

    Puisieux Alain

    2003-10-01

    Full Text Available Abstract Background Real-time PCR is increasingly being adopted for RNA quantification and genetic analysis. At present the most popular real-time PCR assay is based on the hybridisation of a dual-labelled probe to the PCR product, and the development of a signal by loss of fluorescence quenching as PCR degrades the probe. Though this so-called 'TaqMan' approach has proved easy to optimise in practice, the dual-labelled probes are relatively expensive. Results We have designed a new assay based on SYBR-Green I binding that is quick, reliable, easily optimised and compares well with the published assay. Here we demonstrate its general applicability by measuring copy number in three different genetic contexts; the quantification of a gene rearrangement (T-cell receptor excision circles (TREC in peripheral blood mononuclear cells; the detection and quantification of GLI, MYC-C and MYC-N gene amplification in cell lines and cancer biopsies; and detection of deletions in the OPA1 gene in dominant optic atrophy. Conclusion Our assay has important clinical applications, providing accurate diagnostic results in less time, from less biopsy material and at less cost than assays currently employed such as FISH or Southern blotting.

  6. Evaluation of a real-time PCR assay based on the single-copy SAG1 gene for the detection of Toxoplasma gondii.

    Yu, Haijie; Huang, Bin; Zhuo, Xunhui; Chen, Xueqiu; Du, Aifang

    2013-11-08

    Real-time PCR-based detection of Toxoplasma gondii is very sensitive and convenient for diagnosing toxoplasmosis. However, the performance of the PCR assays could be influenced by the target gene chosen. Here we evaluate a real-time PCR assay using double-stranded DNA dyes (SYBR(®) Green I assay) with a new set of primers targeting the SAG1 gene for the fast and specific detection of T. gondii. The assay showed higher sensitivity than conventional PCR protocols using T. gondii DNA as template. The detection limit of the developed real-time PCR assay was in the order of 1 tachyzoite. The assay was also assessed by experimentally infected mice and showed positive results for blood (25%), spleen (50%) and lung (50%) as early as 1 dpi. The specificity of the assay was confirmed by using DNA from Neospora caninum, Escherichia coli, Babesia bovis, Trypanosoma brucei, Cryptosporidium parvum, and Toxocara canis. Assay applicability was successfully tested in blood samples collected from slaughtered pigs. These results indicate that, based on SYBR(®) green I, the quantitative SAG1 assay may also be useful in the study of the pathogenicity, immunoprophylaxis, and treatment of T. gondii. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. A locked nucleic acid (LNA-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture.

    Lingxiang Zhu

    Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

  8. Duplex detection of the Mycobacterium tuberculosis complex and medically important non-tuberculosis mycobacteria by real-time PCR based on the rnpB gene.

    Abdeldaim, Guma; Svensson, Erik; Blomberg, Jonas; Herrmann, Björn

    2016-11-01

    A duplex real-time PCR based on the rnpB gene was developed for Mycobacterium spp. The assay was specific for the Mycobacterium tuberculosis complex (MTB) and also detected all 19 tested species of non-tuberculous mycobacteria (NTM). The assay was evaluated on 404 clinical samples: 290 respiratory samples and 114 from tissue and other non-respiratory body sites. M. tuberculosis was detected by culture in 40 samples and in 30 samples by the assay. The MTB assay showed a sensitivity similar to Roche Cobas Amplicor MTB-PCR (Roche Molecular Systems, Pleasanton, CA, USA). There were only nine samples with non-tuberculous mycobacteria detected by culture. Six of them were detected by the PCR assay. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  9. PCR based diagnostic assay targeting the beta tubulin gene for the detection of Trichomonas vaginalis infection in vaginal swab samples of symptomatic and asymptomatic women in India

    Surya Prakash Dwivedi

    2012-10-01

    Full Text Available Objective: To develop an in-house PCR based diagnostic assay for identification of strains isolated from symptomatic and asymptomatic subjects of India, targeting the 毬 -tubulin gene using specific primers. Methods: In the present study a primer set is designed to target a well-conserved region in the beta-tubulin gene of Trichomonas vaginalis (T. vaginalis. All strains of T. vaginalis were tested and successfully detected by PCR yielding a single predicted product of 198 bp in gel electrophoresis, while there was negative response with DNA from Giardia lamblia, Toxoplasma gondii, Leishmania donovani and Entamoeba histolytica. The sensitivity and specificity for a single T. vaginalis cell per PCR was achieved. Axenic Culture, performed with long term axenized T. vaginalis culture system, was routinely examined to identify T. vaginalis. Results: The PCR based investigations with 498 vaginal swab samples from women attending OPD clinics of Halberg Hospital Moradabad and Queen Mary ’s Hospital, Lucknow, India and 17 long term axenic cultures maintained at PGIMER, Chandigarh, India using primer set BTUB 1 & BTUB 2 showed sensitivity and specificity response of 98% and 100%, respectively, while wet preparation in clinically isolated samples responded up to 62.5%. The PCR product sequencing result of symptomatic strains (SS1 of T. vaginalis (744 bp long was submitted to NCBI (Accession No: JF513200. It shows maximum identity 98 % with XM_001284521 Trichomonas vaginalis G-3 beta-tubulin (btub putative partial mRNA. Conclusions: The data gathered in the present study entail that the diagnosis of T. vaginalis infection by PCR may be established as a sensitive and specific protocol, to be incorporated into a joint strategy for the screening of multiple STDs by employing molecular amplification technique. The merits and precautions of the protocol have been discussed.

  10. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.

    Smith, Cindy J; Osborn, A Mark

    2009-01-01

    Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.

  11. Using PCR to Target Misconceptions about Gene Expression

    Leslie K. Wright

    2013-02-01

    Full Text Available We present a PCR-based laboratory exercise that can be used with first- or second-year biology students to help overcome common misconceptions about gene expression. Biology students typically do not have a clear understanding of the difference between genes (DNA and gene expression (mRNA/protein and often believe that genes exist in an organism or cell only when they are expressed. This laboratory exercise allows students to carry out a PCR-based experiment designed to challenge their misunderstanding of the difference between genes and gene expression. Students first transform E. coli with an inducible GFP gene containing plasmid and observe induced and un-induced colonies. The following exercise creates cognitive dissonance when actual PCR results contradict their initial (incorrect predictions of the presence of the GFP gene in transformed cells. Field testing of this laboratory exercise resulted in learning gains on both knowledge and application questions on concepts related to genes and gene expression.

  12. Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

    Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

    2013-01-01

    The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

  13. A probe-based qRT-PCR method to profile immunological gene expression in blood of captive beluga whales (Delphinapterus leucas

    Ming-An Tsai

    2017-09-01

    Full Text Available Cytokines are fundamental for a functioning immune system, and thus potentially serve as important indicators of animal health. Quantitation of mRNA using quantitative reverse transcription polymerase chain reaction (qRT-PCR is an established immunological technique. It is particularly suitable for detecting the expression of proteins against which monoclonal antibodies are not available. In this study, we developed a probe-based quantitative gene expression assay for immunological assessment of captive beluga whales (Delphinapterus leucas that is one of the most common cetacean species on display in aquariums worldwide. Six immunologically relevant genes (IL-2Rα, -4, -10, -12, TNFα, and IFNγ were selected for analysis, and two validated housekeeping genes (PGK1 and RPL4 with stable expression were used as reference genes. Sixteen blood samples were obtained from four animals with different health conditions and stored in RNAlater™ solution. These samples were used for RNA extraction followed by qRT-PCR analysis. Analysis of gene transcripts was performed by relative quantitation using the comparative Cq method with the integration of amplification efficiency and two reference genes. The expression levels of each gene in the samples from clinically healthy animals were normally distributed. Transcript outliers for IL-2Rα, IL-4, IL-12, TNFα, and IFNγ were noticed in four samples collected from two clinically unhealthy animals. This assay has the potential to identify immune system deviation from normal state, which is caused by health problems. Furthermore, knowing the immune status of captive cetaceans could help both trainers and veterinarians in implementing preventive approaches prior to disease onset.

  14. PCR-Based Analysis of ColE1 Plasmids in Clinical Isolates and Metagenomic Samples Reveals Their Importance as Gene Capture Platforms

    Manuel Ares-Arroyo

    2018-03-01

    Full Text Available ColE1 plasmids are important vehicles for the spread of antibiotic resistance in the Enterobacteriaceae and Pasteurellaceae families of bacteria. Their monitoring is essential, as they harbor important resistant determinants in humans, animals and the environment. In this work, we have analyzed ColE1 replicons using bioinformatic and experimental approaches. First, we carried out a computational study examining the structure of different ColE1 plasmids deposited in databases. Bioinformatic analysis of these ColE1 replicons revealed a mosaic genetic structure consisting of a host-adapted conserved region responsible for the housekeeping functions of the plasmid, and a variable region encoding a wide variety of genes, including multiple antibiotic resistance determinants. From this exhaustive computational analysis we developed a new PCR-based technique, targeting a specific sequence in the conserved region, for the screening, capture and sequencing of these small plasmids, either specific for Enterobacteriaceae or specific for Pasteurellaceae. To validate this PCR-based system, we tested various collections of isolates from both bacterial families, finding that ColE1 replicons were not only highly prevalent in antibiotic-resistant isolates, but also present in susceptible bacteria. In Pasteurellaceae, ColE1 plasmids carried almost exclusively antibiotic resistance genes. In Enterobacteriaceae, these plasmids encoded a large range of traits, including not only antibiotic resistance determinants, but also a wide variety of genes, showing the huge genetic plasticity of these small replicons. Finally, we also used a metagenomic approach in order to validate this technique, performing this PCR system using total DNA extractions from fecal samples from poultry, turkeys, pigs and humans. Using Illumina sequencing of the PCR products we identified a great diversity of genes encoded by ColE1 replicons, including different antibiotic resistance

  15. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil.

    de Oliveira, Valéria Maia; Manfio, Gilson Paulo; da Costa Coutinho, Heitor Luiz; Keijzer-Wolters, Anneke Christina; van Elsas, Jan Dirk

    2006-03-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was followed by specific amplification of (1) sequences affiliated with Rhizobium leguminosarum "sensu lato" and (2) R. tropici. Using analysis of the amplified sequences in clone libraries obtained on the basis of soil DNA, this two-sided method was shown to be very specific for rhizobial subpopulations in soil. It was then further validated as a direct fingerprinting tool of the target rhizobia based on denaturing gradient gel electrophoresis (DGGE). The PCR-DGGE approach was applied to soils from fields in Brazil cultivated with common bean (Phaseolus vulgaris) under conventional or no-tillage practices. The community fingerprints obtained allowed the direct analysis of the respective rhizobial community structures in soil samples from the two contrasting agricultural practices. Data obtained with both primer sets revealed clustering of the community structures of the target rhizobial types along treatment. Moreover, the DGGE profiles obtained with the R. tropici primer set indicated that the abundance and diversity of these organisms were favoured under NT practices. These results suggest that the R. leguminosarum-as well as R. tropici-targeted IGS-based nested PCR and DGGE are useful tools for monitoring the effect of agricultural practices on these and related rhizobial subpopulations in soils.

  16. Comparison of in-house and commercial real time-PCR based carbapenemase gene detection methods in Enterobacteriaceae and non-fermenting gram-negative bacterial isolates.

    Smiljanic, M; Kaase, M; Ahmad-Nejad, P; Ghebremedhin, B

    2017-07-10

    Carbapenemase-producing gram-negative bacteria are increasing globally and have been associated with outbreaks in hospital settings. Thus, the accurate detection of these bacteria in infections is mandatory for administering the adequate therapy and infection control measures. This study aimed to establish and evaluate a multiplex real-time PCR assay for the simultaneous detection of carbapenemase gene variants in gram-negative rods and to compare the performance with a commercial RT-PCR assay (Check-Direct CPE). 116 carbapenem-resistant Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii isolates were genotyped for carbapenemase genes by PCR and sequencing. The defined isolates were used for the validation of the in-house RT-PCR by use of designed primer pairs and probes. Among the carbapenem-resistant isolates the genes bla KPC , bla VIM , bla NDM or bla OXA were detected. Both RT-PCR assays detected all bla KPC , bla VIM and bla NDM in the isolates. The in-house RT-PCR detected 53 of 67 (79.0%) whereas the commercial assay detected only 29 (43.3%) of the OXA genes. The in-house sufficiently distinguished the most prevalent OXA types (23-like and 48-like) in the melting curve analysis and direct detection of the genes from positive blood culture vials. The Check-Direct CPE and the in-house RT-PCR assay detected the carbapenem resistance from solid culture isolates. Moreover, the in-house assay enabled the identification of carbapenemase genes directly from positive blood-culture vials. However, we observed insufficient detection of various OXA genes in both assays. Nevertheless, the in-house RT-PCR detected the majority of the OXA type genes in Enterobacteriaceae and A. baumannii.

  17. Development of a new comprehensive and reliable endometrial receptivity map (ER Map/ER Grade) based on RT-qPCR gene expression analysis.

    Enciso, M; Carrascosa, J P; Sarasa, J; Martínez-Ortiz, P A; Munné, S; Horcajadas, J A; Aizpurua, J

    2018-02-01

    Is it possible to determine the receptivity status of an endometrium by combined quantitative reverse transcription PCR (RT-qPCR) expression analysis of genes involved in endometrial proliferation and immunity? The new ER Map®/ER Grade® test can predict endometrial receptivity status by RT-qPCR using a new panel of genes involved in endometrial proliferation and the maternal immune response associated to embryonic implantation. The human endometrium reaches a receptive status adequate for embryonic implantation around Days 19-21 of the menstrual cycle. During this period, known as the window of implantation (WOI), the endometrium shows a specific gene expression profile suitable for endometrial function evaluation. The number of molecular diagnostic tools currently available to characterize this process is very limited. In this study, a new system for human endometrial receptivity evaluation was optimized and presented for the first time. ER Map®/ER Grade® validation was achieved on 312 endometrial samples including fertile women and patients undergoing fertility treatment between July 2014 and March 2016. Expression analyses of 184 genes involved in endometrial receptivity and immune response were performed. Samples were additionally tested with an independent endometrial receptivity test. A total of 96 fertile women and 120 assisted reproduction treatment (ART) patients participated in the study. Endometrial biopsy samples were obtained at LH + 2 and LH + 7 days in fertile subjects in a natural cycle and at the window of implantation (WOI) in patients in a hormone-replacement therapy (HRT) cycle. Total RNA was purified, quality-checked and reverse-transcribed. Gene expression was quantified by high-throughput RT-qPCR and statistically analyzed. Informative genes were selected and used to classify samples into four different groups of endometrial receptivity status. Significantly different gene expression levels were found in 85 out of 184 selected genes when

  18. Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene

    Jiashun Wang

    Full Text Available Abstract Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1 mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 101 and 104 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18 CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10 h, which is a promising rapid method to detect Salmonella in emergency.

  19. Evaluation of a novel real-time PCR test based on the ssrA gene for the identification of group B streptococci in vaginal swabs.

    Wernecke, Martina

    2009-01-01

    BACKGROUND: Despite the implementation of prevention guidelines, early-onset group B streptococci (GBS) disease remains a cause of neonatal morbidity and mortality worldwide. Strategies to identify women who are at risk of transmitting GBS to their infant and the administration of intrapartum antibiotics have greatly reduced the incidence of neonatal GBS disease. However, there is a requirement for a rapid diagnostic test for GBS that can be carried out in a labour ward setting especially for women whose GBS colonisation status is unknown at the time of delivery. We report the design and evaluation of a real-time PCR test (RiboSEQ GBS test) for the identification of GBS in vaginal swabs from pregnant women. METHODS: The qualitative real-time PCR RiboSEQ GBS test was designed based on the bacterial ssrA gene and incorporates a competitive internal standard control. The analytical sensitivity of the test was established using crude lysate extracted from serial dilutions of overnight GBS culture using the IDI Lysis kit. Specificity studies were performed using DNA prepared from a panel of GBS strains, related streptococci and other species found in the genital tract environment. The RiboSEQ GBS test was evaluated on 159 vaginal swabs from pregnant women and compared with the GeneOhm StrepB Assay and culture for the identification of GBS. RESULTS: The RiboSEQ GBS test is specific and has an analytical sensitivity of 1-10 cell equivalents. The RiboSEQ GBS test was 96.4% sensitive and 95.8% specific compared to "gold standard" culture for the identification of GBS in vaginal swabs from pregnant women. In this study, the RiboSEQ GBS test performed slightly better than the commercial BD GeneOhm StrepB Assay which gave a sensitivity of 94.6% and a specificity of 89.6% compared to culture. CONCLUSION: The RiboSEQ GBS test is a valuable method for the rapid, sensitive and specific detection of GBS in pregnant women. This study also validates the ssrA gene as a suitable and

  20. Rapid and Specific Detection of Acidovorax avenae subsp. citrulli Using SYBR Green-Based Real-Time PCR Amplification of the YD-Repeat Protein Gene.

    Cho, Min Seok; Park, Duck Hwan; Ahn, Tae-Young; Park, Dong Suk

    2015-09-01

    The aim of this study was to develop a SYBR Green-based real-time PCR assay for the rapid, specific, and sensitive detection of Acidovorax avenae subsp. citrulli, which causes bacterial fruit blotch (BFB), a serious disease of cucurbit plants. The molecular and serological methods currently available for the detection of this pathogen are insufficiently sensitive and specific. Thus, a novel SYBR Green-based real-time PCR assay targeting the YD-repeat protein gene of A. avenae subsp. citrulli was developed. The specificity of the primer set was evaluated using DNA purified from 6 isolates of A. avenae subsp. citrulli, 7 other Acidovorax species, and 22 of non-targeted strains, including pathogens and non-pathogens. The AC158F/R primer set amplified a single band of the expected size from genomic DNA obtained from the A. avenae subsp. citrulli strains but not from the genomic DNA of other Acidovorax species, including that of other bacterial genera. Using this assay, it was possible to detect at least one genomeequivalents of the cloned amplified target DNA using 5 × 10(0) fg/μl of purified genomic DNA per reaction or using a calibrated cell suspension, with 6.5 colony-forming units per reaction being employed. In addition, this assay is a highly sensitive and reliable method for identifying and quantifying the target pathogen in infected samples that does not require DNA extraction. Therefore, we suggest that this approach is suitable for the rapid and efficient diagnosis of A. avenae subsp. citrulli contaminations of seed lots and plants.

  1. Detection of pork adulteration in processed meat by species-specific PCR-QIAxcel procedure based on D-loop and cytb genes.

    Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A

    2014-12-01

    Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.

  2. PCR Assay Based on the gyrB Gene for Rapid Identification of Acinetobacter baumannii-calcoaceticus Complex at Specie Level.

    Teixeira, Aline B; Barin, Juliana; Hermes, Djuli M; Barth, Afonso L; Martins, Andreza F

    2017-05-01

    The genus Acinetobacter sp. comprises more than 50 species, and four are closely related and difficult to be distinguished by either phenotypic or genotypic methods: the Acinetobacter calcoaceticus-baumannii complex (ABC). The correct identification at species level is necessary mainly due to the epidemiological aspects. We evaluated a multiplex PCR for gyrB gene to identify the species of the ABC using the sequencing of the ITS 16S-23S fragment as a gold standard. Isolates identified as Acinetobacter calcoaceticus-baumannii from three hospitals at southern Brazil in 2011 were included in this study. A total of 117 isolates were obtained and 106 (90.6%) were confirmed as A. baumannii, 6 (5.1%) as A. nosocomialis and 4 (3.4%) as A. pittii by PCR for gyrB gene. Only one isolate did not present a product of the PCR for the gyrB gene; this isolate was identified as Acinetobacter genospecie 10 by sequencing of ITS. We also noted that the non-A. baumannii isolates were recovered from respiratory tract (8/72.7%), blood (2/18.2%) and urine (1/9.1%), suggesting that these species can cause serious infection. These findings evidenced that the multiplex PCR of the gyrB is a feasible and simple method to identify isolates of the ABC at the species level. © 2016 Wiley Periodicals, Inc.

  3. Identification of Actinobacillus pleuropneumoniae serotypes 1, 7, and 12 by multiplex PCR based on genes involved in encapsulation

    Angen, Øystein; Jessing, Stine Graakjær; Ahrens, Peter

    2005-01-01

    . However, a number of isolates show cross-reaction between serotypes and this has urged the development of quick, serotype specific DNA-based methods necessary. Serotype specific tests have until now been described for the serotypes 2, 5, and 6 (Jessing et al, 2003) and serotypes 1, 2 and 8 (Schuchert et...

  4. SYBR green-based real-time reverse transcription-PCR for typing and subtyping of all hemagglutinin and neuraminidase genes of avian influenza viruses and comparison to standard serological subtyping tests

    Tsukamoto, K.; Javier, P.C.; Shishido, M.; Noguchi, D.; Pearce, J.; Kang, H.-M.; Jeong, O.M.; Lee, Y.-J.; Nakanishi, K.; Ashizawa, T.

    2012-01-01

    Continuing outbreaks of H5N1 highly pathogenic (HP) avian influenza virus (AIV) infections of wild birds and poultry worldwide emphasize the need for global surveillance of wild birds. To support the future surveillance activities, we developed a SYBR green-based, real-time reverse transcriptase PCR (rRT-PCR) for detecting nucleoprotein (NP) genes and subtyping 16 hemagglutinin (HA) and 9 neuraminidase (NA) genes simultaneously. Primers were improved by focusing on Eurasian or North American lineage genes; the number of mixed-base positions per primer was set to five or fewer, and the concentration of each primer set was optimized empirically. Also, 30 cycles of amplification of 1:10 dilutions of cDNAs from cultured viruses effectively reduced minor cross- or nonspecific reactions. Under these conditions, 346 HA and 345 NA genes of 349 AIVs were detected, with average sensitivities of NP, HA, and NA genes of 10 1.5, 10 2.3, and 10 3.1 50% egg infective doses, respectively. Utility of rRT-PCR for subtyping AIVs was compared with that of current standard serological tests by using 104 recent migratory duck virus isolates. As a result, all HA genes and 99% of the NA genes were genetically subtyped, while only 45% of HA genes and 74% of NA genes were serologically subtyped. Additionally, direct subtyping of AIVs in fecal samples was possible by 40 cycles of amplification: approximately 70% of HA and NA genes of NP gene-positive samples were successfully subtyped. This validation study indicates that rRT-PCR with optimized primers and reaction conditions is a powerful tool for subtyping varied AIVs in clinical and cultured samples. Copyright ?? 2012, American Society for Microbiology. All Rights Reserved.

  5. An Actinobacillus pleuropneumoniae PCR typing system based on the apx and omlA genes - evaluation of isolates from lungs and tonsils of pigs

    Gram, T.; Ahrens, Peter; Andreasen, Morten

    2000-01-01

    . The PCR typing system was tested on 102 field strains of A. pleuropneumoniae isolated from lungs of diseased pigs. The serotyping results of the investigated field strains were in agreement with the apr and omlA gene patterns found in the reference strains of the bacteria, with the exception of the oml...... gene patterns and in 89% of the isolates using the omlA gene. The same serotype specific apx/omlA gene pattern was thus found in the majority of the tonsil isolates and in isolates from diseased lungs. Most of the differences in the omlA gene were found in 18 tonsil isolates of serotype 12. The oml...

  6. Real-time PCR gene expression profiling

    Kubista, Mikael; Sjögreen, B.; Forootan, A.; Šindelka, Radek; Jonák, Jiří; Andrade, J.M.

    2007-01-01

    Roč. 1, - (2007), s. 56-60 ISSN 1360-8606 R&D Projects: GA AV ČR KJB500520601 Institutional research plan: CEZ:AV0Z50520514 Keywords : real - time PCR, * expression profiling * statistical analysis Subject RIV: EB - Genetics ; Molecular Biology

  7. A specific PCR-assay for resistance to Biotypes 1 and 2 of the rosy leaf curling aphid in apple based on an RFLP marker closely linked to the Sd1 gene

    Roche, P.; Arkel, van G.; Heusden, van A.W.

    1997-01-01

    This report describes the conversion of a restriction fragment length polymorphism (RFLP) marker (the 2B12a locus), linked to the Sd1 aphid resistance gene, to a polymerase chain reaction (PCR) based marker. A section of the 2B12 probe was sequenced and two primers were designed to amplify this

  8. Molecular typing of methicillin-resistant Staphylococcus aureus: Comparison of PCR-based open reading frame typing, multilocus sequence typing, and Staphylococcus protein A gene typing.

    Ogihara, Shinji; Saito, Ryoichi; Sawabe, Etsuko; Kozakai, Takahiro; Shima, Mari; Aiso, Yoshibumi; Fujie, Toshihide; Nukui, Yoko; Koike, Ryuji; Hagihara, Michio; Tohda, Shuji

    2018-04-01

    The recently developed PCR-based open reading frame typing (POT) method is a useful molecular typing tool. Here, we evaluated the performance of POT for molecular typing of methicillin-resistant Staphylococcus aureus (MRSA) isolates and compared its performance to those of multilocus sequence typing (MLST) and Staphylococcus protein A gene typing (spa typing). Thirty-seven MRSA isolates were collected between July 2012 and May 2015. MLST, spa typing, and POT were performed, and their discriminatory powers were evaluated using Simpson's index analysis. The MRSA isolates were classified into 11, 18, and 33 types by MLST, spa typing, and POT, respectively. The predominant strains identified by MLST, spa typing, and POT were ST8 and ST764, t002, and 93-191-127, respectively. The discriminatory power of MLST, spa typing, and POT was 0.853, 0.875, and 0.992, respectively, indicating that POT had the highest discriminatory power. Moreover, the results of MLST and spa were available after 2 days, whereas that of POT was available in 5 h. Furthermore, POT is rapid and easy to perform and interpret. Therefore, POT is a superior molecular typing tool for monitoring nosocomial transmission of MRSA. Copyright © 2017 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  9. Genetic Diversity and Phylogenetic Analysis of the Iranian Leishmania Parasites Based on HSP70 Gene PCR-RFLP and Sequence Analysis.

    Nemati, Sara; Fazaeli, Asghar; Hajjaran, Homa; Khamesipour, Ali; Anbaran, Mohsen Falahati; Bozorgomid, Arezoo; Zarei, Fatah

    2017-08-01

    Despite the broad distribution of leishmaniasis among Iranians and animals across the country, little is known about the genetic characteristics of the causative agents. Applying both HSP70 PCR-RFLP and sequence analyses, this study aimed to evaluate the genetic diversity and phylogenetic relationships among Leishmania spp. isolated from Iranian endemic foci and available reference strains. A total of 36 Leishmania isolates from almost all districts across the country were genetically analyzed for the HSP70 gene using both PCR-RFLP and sequence analysis. The original HSP70 gene sequences were aligned along with homologous Leishmania sequences retrieved from NCBI, and subjected to the phylogenetic analysis. Basic parameters of genetic diversity were also estimated. The HSP70 PCR-RFLP presented 3 different electrophoretic patterns, with no further intraspecific variation, corresponding to 3 Leishmania species available in the country, L. tropica, L. major, and L. infantum. Phylogenetic analyses presented 5 major clades, corresponding to 5 species complexes. Iranian lineages, including L. major, L. tropica, and L. infantum, were distributed among 3 complexes L. major, L. tropica, and L. donovani. However, within the L. major and L. donovani species complexes, the HSP70 phylogeny was not able to distinguish clearly between the L. major and L. turanica isolates, and between the L. infantum, L. donovani, and L. chagasi isolates, respectively. Our results indicated that both HSP70 PCR-RFLP and sequence analyses are medically applicable tools for identification of Leishmania species in Iranian patients. However, the reduced genetic diversity of the target gene makes it inevitable that its phylogeny only resolves the major groups, namely, the species complexes.

  10. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  11. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets.

    Liu, Xin; Guan, Huirui; Song, Min; Fu, Yanping; Han, Xiaomin; Lei, Meng; Ren, Jingyu; Guo, Bin; He, Wei; Wei, Yahui

    2018-01-01

    Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR) is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs) as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. In this study, 10 candidate RGs namely, 18S , 60S , CYP , GAPCP1 , GAPDH2 , EF1B , MDH , SAND , TUA1 , and TUA6 , were singled out from the transcriptome database of S. chamaejasme , and their expression stability under three abiotic stresses (drought, cold, and salt) and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH) were estimated with the programs geNorm, NormFinder, and BestKeeper. Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND , TUA1 and CYP , GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes ( P5CS2 and GI ) further verified that the RGs that we selected were suitable for gene expression normalization. This work is the first attempt to

  12. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets

    Xin Liu

    2018-04-01

    Full Text Available Background Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. Method In this study, 10 candidate RGs namely, 18S, 60S, CYP, GAPCP1, GAPDH2, EF1B, MDH, SAND, TUA1, and TUA6, were singled out from the transcriptome database of S. chamaejasme, and their expression stability under three abiotic stresses (drought, cold, and salt and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH were estimated with the programs geNorm, NormFinder, and BestKeeper. Result Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND, TUA1 and CYP, GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes (P5CS2 and GI further verified that the RGs that we selected were suitable for gene expression normalization. Discussion

  13. Reação em Cadeia da Polimerase (PCR baseada no gene cpx para detecção de Actinobacillus pleuropneumoniae em suínos natural e experimentalmente infectados Polymerase Chain Reaction (PCR based on the cpx gene for detection of Actinobacillus pleuropneumoniae in natural and experimentally infected pigs

    Karina Koerich de Souza

    2008-10-01

    Full Text Available A pleuropneumonia suína é uma das mais importantes doenças respiratórias dos suínos, estando presente em todos os países produtores. Para o controle e o monitoramento da pleuropneumonia, é necessário o desenvolvimento de métodos rápidos e acurados de diagnóstico. Com o objetivo de validar a técnica da PCR, baseada no gene cpx de Actinobacillus pleuropneumoniae, em suínos sabidamente positivos, primeiramente foi realizada inoculação experimental com amostras de A. pleuropneumoniae sorotipo 5B e coletadas amostras por meio de suabe de tonsila, biópsia de tonsila e sangue para realização da técnica de PCR, isolamento bacteriológico e teste de ELISA, respectivamente. Posteriormente, estas técnicas foram aplicadas em suínos naturalmente infectados, em três rebanhos com diferentes situações sanitárias quanto à apresentação clínica da doença. De cada rebanho, foram analisados cinco grupos de suínos com idades diferentes, sendo coletado de cada animal biópsia de tonsila para isolamento bacteriológico e PCR e sangue para determinação do perfil sorológico. Os resultados obtidos na inoculação experimental confirmaram que, mesmo com o estabelecimento da infecção comprovada pelo isolamento bacteriológico, após o período de 45 dias, não foi possível detectar o agente pela técnica de PCR. Em animais naturalmente infectados, a técnica de PCR apresentou maior sensibilidade quando comparado com o isolamento. A associação entre PCR e ELISA demonstrou ser uma boa alternativa para definir a situação sanitária do rebanho quanto à infecção por A. pleuropneumoniae.Swine pleuropneumonia is one of the most important pig respiratory diseases and has been found in all producer countries. For control and monitoring of pleuropneumonia, it is necessary the development of fast and specific methods of diagnosis. To validate PCR based on the cpx gene of Actinobacillus pleuropneumoniae in positive pigs, an experimental

  14. Molecular Recognition of Human Papilloma Virus (HPV Using Proprietary PCR Method Based on L1 Gene and the Evaluation of its Frequency in Tissue Samples from Patients with Cervical Cancer

    Roohollah Dorostkar

    2015-06-01

    Full Text Available Abstract Background: In 1970, human papillomavirus (HPV was introduced as the main etiologic factor of cervical carcinoma. Since there is no possibility of detecting the virus and its subtypes using serological methods and cell culture, the molecular methods such as PCR have particular importance in accurate, early and definite diagnosis of the virus. So, in this research, our goal is to use a proprietary PCR assay based on L1 gene of human papillomavirus for molecular recognition of HPV and to evaluate its prevalence in patient samples. Materials and Methods: In this experimental study, after collecting of samples from malignant cervical lesions, the viral DNA was extracted from paraffin blocks of 50 clinical samples and PCR was done by specific primers for L1 gene of human papillomavirus in all samples. After the analysis of PCR products by 2% agarose gel electrophoresis, sensitivity and specificity of the test were also evaluated. Results: Among 50 patient samples, 33 cases were confirmed to be positive for HPV infection and 17 cases were negative, showing high frequency of HPV in this patient population (about 66%. The results of specificity assay were positive for papilloma samples and sensitivity of the assay was 20 copies of recombinant construct containing L1 per reaction. Conclusion: This study showed that PCR by specific primers for L1 gene of human papilloma virus is a proper and accurate method for detection of this virus and the results confirm the previous reports of correlation between HPV and cervical carcinoma.

  15. MPN- and Real-Time-Based PCR Methods for the Quantification of Alkane Monooxygenase Homologous Genes (alkB) in Environmental Samples

    Pérez-de-Mora, Alfredo; Schulz, Stephan; Schloter, Michael

    Hydrocarbons are major contaminants of soil ecosystems as a result of uncontrolled oil spills and wastes disposal into the environment. Ecological risk assessment and remediation of affected sites is often constrained due to lack of suitable prognostic and diagnostic tools that provide information of abiotic-biotic interactions occurring between contaminants and biological targets. Therefore, the identification and quantification of genes involved in the degradation of hydrocarbons may play a crucial role for evaluating the natural attenuation potential of contaminated sites and the development of successful bioremediation strategies. Besides other gene clusters, the alk operon has been identified as a major player for alkane degradation in different soils. An oxygenase gene (alkB) codes for the initial step of the degradation of aliphatic alkanes under aerobic conditions. In this work, we present an MPN- and a real-time PCR method for the quantification of the bacterial gene alkB (coding for rubredoxin-dependent alkane monooxygenase) in environmental samples. Both approaches enable a rapid culture-independent screening of the alkB gene in the environment, which can be used to assess the intrinsic natural attenuation potential of a site or to follow up the on-going progress of bioremediation assays.

  16. Detection and characterization of Newcastle disease virus in clinical samples using real time RT-PCR and melting curve analysis based on matrix and fusion genes amplification

    Saad Sharawi

    2013-10-01

    Full Text Available Aim: Newcastle disease is still one of the major threats for poultry industry allover the world. Therefore, attempt was made in this study to use the SYBR Green I real-time PCR with melting curves analysis as for detection and differentiation of NDV strains in suspected infected birds. Materials and Methods: Two sets of primers were used to amplify matrix and fusion genes in samples collected from suspectly infected birds (chickens and pigeons. Melting curve analysis in conjunction with real time PCR was conducted for identifying different pathotypes of the isolated NDVs. Clinical samples were propagated on specific pathogen free ECE and tested for MDT and ICIP. Results: The velogenic NDVs isolated from chickens and pigeons were distinguished with mean T 85.03±0.341 and m 83.78±0.237 respectively for M-gene amplification and for F-gene amplification the mean T were 84.04±0.037 and m 84.53±0.223. On the other hand the lentogenic NDV isolates including the vaccinal strains (HB1 and LaSota have a higher mean T (86.99±0.021 for M-gene amplification and 86.50±0.063 for F-gene amplification. The test showed no reaction with m unrelated RNA samples. In addition, the results were in good agreement with both virus isolation and biological pathotyping (MDT and ICIP. The assay offers an attractive alternative method for the diagnosis of NDV that can be easily applied in laboratory diagnosis as a screening test for the detection and differentiation of NDV infections. Conclusion: As was shown by the successful rapid detection and pathotyping of 15 NDV strains in clinical samples representing velogenic and lentogenic NDV strains, and the agreement with the results of virus isolation , biological pathotyping and pathogenicity indices. The results of this report suggests that the described SybrGreen I real-time RT-PCR assay in conjunction with Melting curve analysis used as a rapid, specific and simple diagnostic tools for detection and pathotyping of

  17. A quantitative and direct PCR assay for the subspecies-specific detection of Clavibacter michiganensis subsp. michiganensis based on a ferredoxin reductase gene.

    Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk

    2012-06-01

    The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.

  18. Identification of stable reference genes for quantitative PCR in cells derived from chicken lymphoid organs.

    Borowska, D; Rothwell, L; Bailey, R A; Watson, K; Kaiser, P

    2016-02-01

    Quantitative polymerase chain reaction (qPCR) is a powerful technique for quantification of gene expression, especially genes involved in immune responses. Although qPCR is a very efficient and sensitive tool, variations in the enzymatic efficiency, quality of RNA and the presence of inhibitors can lead to errors. Therefore, qPCR needs to be normalised to obtain reliable results and allow comparison. The most common approach is to use reference genes as internal controls in qPCR analyses. In this study, expression of seven genes, including β-actin (ACTB), β-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-glucuronidase (GUSB), TATA box binding protein (TBP), α-tubulin (TUBAT) and 28S ribosomal RNA (r28S), was determined in cells isolated from chicken lymphoid tissues and stimulated with three different mitogens. The stability of the genes was measured using geNorm, NormFinder and BestKeeper software. The results from both geNorm and NormFinder were that the three most stably expressed genes in this panel were TBP, GAPDH and r28S. BestKeeper did not generate clear answers because of the highly heterogeneous sample set. Based on these data we will include TBP in future qPCR normalisation. The study shows the importance of appropriate reference gene normalisation in other tissues before qPCR analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

    Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

    2008-01-01

    A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

  20. Development and validation of a real time PCR for the detection of myxoma virus based on the diploid gene M000.5L/R.

    Duarte, Margarida Dias; Barros, Sílvia Carla; Henriques, Ana Margarida; Fagulha, Maria Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel

    2014-02-01

    The myxoma virus (MYXV) causes severe infections in European rabbits that may reach mortality rates up to 100% depending on the viral strain. The typical symptoms and lesions induced by the virus are usually enough to permit the correct clinical diagnosis. However, in peracute forms the infection may be accompanied by unspecific symptoms. Sudden death may also occur without evident clinical signs of myxomatosis. Likewise, a clinical diagnosis of atypical forms of myxomatosis (amyxomatous) is often complicated and delayed due to the scarceness of skin lesions. As the disease control often depends on an early and unequivocal diagnosis of MYXV, laboratorial methods play a relevant role in the confirmation of MYXV infection. This study describes the development and validation of a novel, high accurate real time polymerase chain reaction assay (rtPCR) for the detection of MYXV. Primers were designed to amplify a 125-bp within the gene M000.5L/R, which is duplicated in the termini of the genome and is unique among Leporipoxvirus. The assay was negative for SFV and other poxviruses and was able to detect 2.6 copies of MYXV DNA proving the effectiveness, specificity and sensitivity of this diagnosis tool. The rtPCR has been applied successfully in INIAV laboratory for routine diagnosis of myxomatosis since 2005. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. SCREENING OF COMMON FLAX FAD GENES BY PCR

    Veronika Štefúnová

    2013-02-01

    Full Text Available Currently, flax (Linum usitatissimum L. is an important crop from commercial and economical aspects. In the spotlight is the linseed oil as a source of α-linolenic acid. The aim of presented study was to analyse fatty acid desaturase (FAD genes in flax. Several genotypes of flax (Hohenheim, La Plata 1938, Redwing USA and Escalina were used. The primers described by Vrinten et al. (2005 were used for PCR amplification reactions. Two FAD3 genes, LuFAD3A and LuFAD3B, were identified in a genome of flax. Subsequently the nucleotide sequences between origins and genotypes of flax FAD genes were compared. Primarily were used the nucleotide sequences of FAD2 and FAD3C genes available in NCBI database. Differences were found using BLAST program in nucleotide sequences of FAD genes and the specific primers were designed to amplify a specific target sequences in a genome of flax. These primers were used in PCR amplification reactions to identification of FAD2 and FAD3C genes. The PCR products were separated by electrophoresis on agarose gel.

  2. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  3. Metagenomic of Actinomycetes Based on 16S rRNA and nifH Genes in Soil and Roots of Four Indonesian Rice Cultivars Using PCR-DGGE

    Mahyarudin

    2015-07-01

    Full Text Available The research was conducted to study the metagenomic of actinomycetes based on 16S ribosomal RNA (rRNA and bacterial nifH genes in soil and roots of four rice cultivars. The denaturing gradient gel electrophoresis profile based on 16S rRNA gene showed that the diversity of actinomycetes in roots was higher than soil samples. The profile also showed that the diversity of actinomycetes was similar in four varieties of rice plant and three types of agroecosystem. The profile was partially sequenced and compared to GenBank database indicating their identity with closely related microbes. The blast results showed that 17 bands were closely related ranging from 93% to 100% of maximum identity with five genera of actinomycetes, which is Geodermatophilus, Actinokineospora, Actinoplanes, Streptomyces and Kocuria. Our study found that Streptomyces species in soil and roots of rice plants were more varied than other genera, with a dominance of Streptomyces alboniger and Streptomyces acidiscabies in almost all the samples. Bacterial community analyses based on nifH gene denaturing gradient gel electrophoresis showed that diversity of bacteria in soils which have nifH gene was higher than that in rice plant roots. The profile also showed that the diversity of those bacteria was similar in four varieties of rice plant and three types of agroecosystem. Five bands were closely related with nifH gene from uncultured bacterium clone J50, uncultured bacterium clone clod-38, and uncultured bacterium clone BG2.37 with maximum identity 99%, 98%, and 92%, respectively. The diversity analysis based on 16S rRNA gene differed from nifH gene and may not correlate with each other. The findings indicated the diversity of actinomycetes and several bacterial genomes analyzed here have an ability to fix nitrogen in soil and roots of rice plant.

  4. Development of a PCR-based marker utilizing a deletion mutation in the dihydroflavonol 4-reductase (DFR) gene responsible for the lack of anthocyanin production in yellow onions (Allium cepa).

    Kim, Sunggil; Yoo, Kil Sun; Pike, Leonard M

    2005-02-01

    Bulb color in onions (Allium cepa) is an important trait, but the mechanism of color inheritance is poorly understood at the molecular level. A previous study showed that inactivation of the dihydroflavonol 4-reductase (DFR) gene at the transcriptional level resulted in a lack of anthocyanin production in yellow onions. The objectives of the present study were the identification of the critical mutations in the DFR gene (DFR-A) and the development of a PCR-based marker for allelic selection. We report the isolation of two additional DFR homologs (DFR-B and DFR-C). No unique sequences were identified in either DFR homolog, even in the untranslated region (UTR). Both genes shared more than 95% nucleotide sequence identity with the DFR-A gene. To obtain a unique sequence from each gene, we isolated the promoter regions. Sequences of the DFR-A and DFR-B promoters differed completely from one another, except for an approximately 100-bp sequence adjacent to the 5'UTR. It was possible to specifically amplify only the DFR-A gene using primers designed to anneal to the unique promoter region. The sequences of yellow and red DFR-A alleles were the same except for a single base-pair change in the promoter and an approximately 800-bp deletion within the 3' region of the yellow DFR-A allele. This deletion was used to develop a co-dominant PCR-based marker that segregated perfectly with color phenotypes in the F2 population. These results indicate that a deletion mutation in the yellow DFR-A gene results in the lack of anthocyanin production in yellow onions.

  5. Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing

    Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan

    2004-01-01

    an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... in the single-intron experiment. Spliced sequences were amplified in 46 cases (34%). We conclude that this procedure for elucidating gene structures with native cDNA sequences is cost-effective and will become even more so as it is further optimized.......The publication of a draft sequence of a third mammalian genome--that of the rat--suggests a need to rethink genome annotation. New mammalian sequences will not receive the kind of labor-intensive annotation efforts that are currently being devoted to human. In this paper, we demonstrate...

  6. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian

    2016-01-01

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results......, and Progressive Supranuclear Palsy patients. Using RefFinder, a web-based tool for evaluating RG stability, we identified the most stable RGs to be UBE2D2, CYC1, and RPL13 which we recommend for future RT-qPCR studies on human brain tissue from these patients. None of the investigated genes were affected...... by experimental variables such as RIN, PMI, or age. Findings were further validated by expression analyses of a target gene GSK3B, known to be affected by AD and PD. We obtained high variations in GSK3B levels when contrasting the results using different sets of common RG underlining the importance of a priori...

  7. Exploring Valid Reference Genes for Quantitative Real-time PCR Analysis in Plutella xylostella (Lepidoptera: Plutellidae)

    Fu, Wei; Xie, Wen; Zhang, Zhuo; Wang, Shaoli; Wu, Qingjun; Liu, Yong; Zhou, Xiaomao; Zhou, Xuguo; Zhang, Youjun

    2013-01-01

    Abstract: Quantitative real-time PCR (qRT-PCR), a primary tool in gene expression analysis, requires an appropriate normalization strategy to control for variation among samples. The best option is to compare the mRNA level of a target gene with that of reference gene(s) whose expression level is stable across various experimental conditions. In this study, expression profiles of eight candidate reference genes from the diamondback moth, Plutella xylostella, were evaluated under diverse experimental conditions. RefFinder, a web-based analysis tool, integrates four major computational programs including geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to comprehensively rank the tested candidate genes. Elongation factor 1 (EF1) was the most suited reference gene for the biotic factors (development stage, tissue, and strain). In contrast, although appropriate reference gene(s) do exist for several abiotic factors (temperature, photoperiod, insecticide, and mechanical injury), we were not able to identify a single universal reference gene. Nevertheless, a suite of candidate reference genes were specifically recommended for selected experimental conditions. Our finding is the first step toward establishing a standardized qRT-PCR analysis of this agriculturally important insect pest. PMID:23983612

  8. Characteristics of PCR-SSCP and RAPD-HPCE methods for identifying authentication of Penis et testis cervi in Traditional Chinese Medicine based on cytochrome b gene.

    Li, Mingcheng; Gao, Lijun; Qu, Li; Sun, Jingyu; Yuan, Guangxin; Xia, Wei; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

    2016-07-01

    The use of Penis et testis cervi, as a kind of precious Traditional Chinese Medicine (TCM), which is derived from dry deer's testis and penis, has been recorded for many years in China. There are abundant species of deer in China, the Penis et testis from species of Cervus Nippon and Cervus elaphusL were authentic, others species were defined as adulterant (different subspecies of deer) or counterfeits (different species). Identification of their origins or authenticity becomes a key in controlling the herbal products. A modified column chromatography was used to extract mitochondrial DNA of dried deer's testis and penis from sika deer (C. Nippon) and red deer (C. elaphusL) in addition to adulterants and counterfeits. Column chromatography requires for a short time to extract mitochondrial DNA of high purity with little damage of DNA molecules, which provides the primary structure of guarantee for the specific PCR; PCR-SSCP method showed a clear intra-specific difference among patterns of single-chain fragments, and completely differentiate Penis et testis origins from C. Nippon and C. elaphusL. RAPD-HPCE was based on the standard electropherograms to compute a control spectrum curve as similarity reference (R) among different samples. The similarity analysis indicated that there were significant inter-species differences among Penis et testis' adulterant or counterfeits. Both techniques provide a fast, simple, and accurate way to directly identify among inter-species or intra-species of Penis et testis.

  9. PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

    Janczarek, Monika; Palusińska-Szysz, Marta

    2016-05-01

    Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.

  10. UPLC/Q-TOF MS-based metabolomics and qRT-PCR in enzyme gene screening with key role in triterpenoid saponin biosynthesis of Polygala tenuifolia.

    Zhang, Fusheng; Li, Xiaowei; Li, Zhenyu; Xu, Xiaoshuang; Peng, Bing; Qin, Xuemei; Du, Guanhua

    2014-01-01

    The dried root of Polygala tenuifolia, named Radix Polygalae, is a well-known traditional Chinese medicine. Triterpenoid saponins are some of the most important components of Radix Polygalae extracts and are widely studied because of their valuable pharmacological properties. However, the relationship between gene expression and triterpenoid saponin biosynthesis in P. tenuifolia is unclear. In this study, ultra-performance liquid chromatography (UPLC) coupled with quadrupole time-of-flight mass spectrometry (Q-TOF MS)-based metabolomic analysis was performed to identify and quantify the different chemical constituents of the roots, stems, leaves, and seeds of P. tenuifolia. A total of 22 marker compounds (VIP>1) were explored, and significant differences in all 7 triterpenoid saponins among the different tissues were found. We also observed an efficient reference gene GAPDH for different tissues in this plant and determined the expression level of some genes in the triterpenoid saponin biosynthetic pathway. Results showed that MVA pathway has more important functions in the triterpenoid saponin biosynthesis of P. tenuifolia. The expression levels of squalene synthase (SQS), squalene monooxygenase (SQE), and beta-amyrin synthase (β-AS) were highly correlated with the peak area intensity of triterpenoid saponins compared with data from UPLC/Q-TOF MS-based metabolomic analysis. This finding suggested that a combination of UPLC/Q-TOF MS-based metabolomics and gene expression analysis can effectively elucidate the mechanism of triterpenoid saponin biosynthesis and can provide useful information on gene discovery. These findings can serve as a reference for using the overexpression of genes encoding for SQS, SQE, and/or β-AS to increase the triterpenoid saponin production of P. tenuifolia.

  11. UPLC/Q-TOF MS-based metabolomics and qRT-PCR in enzyme gene screening with key role in triterpenoid saponin biosynthesis of Polygala tenuifolia.

    Fusheng Zhang

    Full Text Available The dried root of Polygala tenuifolia, named Radix Polygalae, is a well-known traditional Chinese medicine. Triterpenoid saponins are some of the most important components of Radix Polygalae extracts and are widely studied because of their valuable pharmacological properties. However, the relationship between gene expression and triterpenoid saponin biosynthesis in P. tenuifolia is unclear.In this study, ultra-performance liquid chromatography (UPLC coupled with quadrupole time-of-flight mass spectrometry (Q-TOF MS-based metabolomic analysis was performed to identify and quantify the different chemical constituents of the roots, stems, leaves, and seeds of P. tenuifolia. A total of 22 marker compounds (VIP>1 were explored, and significant differences in all 7 triterpenoid saponins among the different tissues were found. We also observed an efficient reference gene GAPDH for different tissues in this plant and determined the expression level of some genes in the triterpenoid saponin biosynthetic pathway. Results showed that MVA pathway has more important functions in the triterpenoid saponin biosynthesis of P. tenuifolia. The expression levels of squalene synthase (SQS, squalene monooxygenase (SQE, and beta-amyrin synthase (β-AS were highly correlated with the peak area intensity of triterpenoid saponins compared with data from UPLC/Q-TOF MS-based metabolomic analysis.This finding suggested that a combination of UPLC/Q-TOF MS-based metabolomics and gene expression analysis can effectively elucidate the mechanism of triterpenoid saponin biosynthesis and can provide useful information on gene discovery. These findings can serve as a reference for using the overexpression of genes encoding for SQS, SQE, and/or β-AS to increase the triterpenoid saponin production of P. tenuifolia.

  12. Effective identification of Lactobacillus casei group species: genome-based selection of the gene mutL as the target of a novel multiplex PCR assay.

    Bottari, Benedetta; Felis, Giovanna E; Salvetti, Elisa; Castioni, Anna; Campedelli, Ilenia; Torriani, Sandra; Bernini, Valentina; Gatti, Monica

    2017-07-01

    Lactobacillus casei,Lactobacillus paracasei and Lactobacillusrhamnosus form a closely related taxonomic group (the L. casei group) within the facultatively heterofermentative lactobacilli. Strains of these species have been used for a long time as probiotics in a wide range of products, and they represent the dominant species of nonstarter lactic acid bacteria in ripened cheeses, where they contribute to flavour development. The close genetic relationship among those species, as well as the similarity of biochemical properties of the strains, hinders the development of an adequate selective method to identify these bacteria. Despite this being a hot topic, as demonstrated by the large amount of literature about it, the results of different proposed identification methods are often ambiguous and unsatisfactory. The aim of this study was to develop a more robust species-specific identification assay for differentiating the species of the L. casei group. A taxonomy-driven comparative genomic analysis was carried out to select the potential target genes whose similarity could better reflect genome-wide diversity. The gene mutL appeared to be the most promising one and, therefore, a novel species-specific multiplex PCR assay was developed to rapidly and effectively distinguish L. casei, L. paracasei and L. rhamnosus strains. The analysis of a collection of 76 wild dairy isolates, previously identified as members of the L. casei group combining the results of multiple approaches, revealed that the novel designed primers, especially in combination with already existing ones, were able to improve the discrimination power at the species level and reveal previously undiscovered intraspecific biodiversity.

  13. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  14. Selection of reference genes for qPCR in hairy root cultures of peanut

    Medrano Giuliana

    2011-10-01

    Full Text Available Abstract Background Hairy root cultures produced via Agrobacterium rhizogenes-mediated transformation have emerged as practical biological models to elucidate the biosynthesis of specialized metabolites. To effectively understand the expression patterns of the genes involved in the metabolic pathways of these compounds, reference genes need to be systematically validated under specific experimental conditions as established by the MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments guidelines. In the present report we describe the first validation of reference genes for RT-qPCR in hairy root cultures of peanut which produce stilbenoids upon elicitor treatments. Results A total of 21 candidate reference genes were evaluated. Nineteen genes were selected based on previous qPCR studies in plants and two were from the T-DNAs transferred from A. rhizogenes. Nucleotide sequences of peanut candidate genes were obtained using their homologous sequences in Arabidopsis. To identify the suitable primers, calibration curves were obtained for each candidate reference gene. After data analysis, 12 candidate genes meeting standard efficiency criteria were selected. The expression stability of these genes was analyzed using geNorm and NormFinder algorithms and a ranking was established based on expression stability of the genes. Candidate reference gene expression was shown to have less variation in methyl jasmonate (MeJA treated root cultures than those treated with sodium acetate (NaOAc. Conclusions This work constitutes the first effort to validate reference genes for RT-qPCR in hairy roots. While these genes were selected under conditions of NaOAc and MeJA treatment, we anticipate these genes to provide good targets for reference genes for hairy roots under a variety of stress conditions. The lead reference genes were a gene encoding for a TATA box binding protein (TBP2 and a gene encoding a ribosomal protein (RPL8C. A

  15. Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

    Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

    2012-10-01

    To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

  16. Selecting and validating reference genes for quantitative real-time PCR in Plutella xylostella (L.).

    You, Yanchun; Xie, Miao; Vasseur, Liette; You, Minsheng

    2018-05-01

    Gene expression analysis provides important clues regarding gene functions, and quantitative real-time PCR (qRT-PCR) is a widely used method in gene expression studies. Reference genes are essential for normalizing and accurately assessing gene expression. In the present study, 16 candidate reference genes (ACTB, CyPA, EF1-α, GAPDH, HSP90, NDPk, RPL13a, RPL18, RPL19, RPL32, RPL4, RPL8, RPS13, RPS4, α-TUB, and β-TUB) from Plutella xylostella were selected to evaluate gene expression stability across different experimental conditions using five statistical algorithms (geNorm, NormFinder, Delta Ct, BestKeeper, and RefFinder). The results suggest that different reference genes or combinations of reference genes are suitable for normalization in gene expression studies of P. xylostella according to the different developmental stages, strains, tissues, and insecticide treatments. Based on the given experimental sets, the most stable reference genes were RPS4 across different developmental stages, RPL8 across different strains and tissues, and EF1-α across different insecticide treatments. A comprehensive and systematic assessment of potential reference genes for gene expression normalization is essential for post-genomic functional research in P. xylostella, a notorious pest with worldwide distribution and a high capacity to adapt and develop resistance to insecticides.

  17. PCR

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  18. Detection of a putative virulence cadF gene of Campylobacter jejuni obtained from different sources using a microfabricated PCR chip

    Poulsen, Claus Riber; El-Ali, Jamil; Perch-Nielsen, Ivan R.

    2005-01-01

    A microfabricated polymerase chain reaction (PCR) chip made of epoxy-based photoresist (SU-8) was recently designed and developed. In this study, we tested whether the PCR chip could be used for rapid detection of a potential virulence determinant, the cadF gene of Campylobacter jejuni. PCR...... was performed using published PCR conditions and primers for the C. jejuni cadF gene. DNA isolated from a C. jejuni reference strain CCUG 11284, C. jejuni isolates obtained from different sources (chicken and human), and Campylobacter whole cells were used as templates in the PCR tests. Conventional PCR in tube...... was used as the control. After optimization of the PCR chip, PCR positives on the chip were obtained from 91.0% (10/11) of the tested chips. A fast transition time was achieved with the PCR chip, and therefore a faster cycling time and a shorter PCR program were obtained. Using the PCR chip, the cadF gene...

  19. Significantly improved PCR-based clonality testing in B-cell malignancies by use of multiple immunoglobulin gene targets. Report of the BIOMED-2 Concerted Action BHM4-CT98-3936.

    Evans, P.A.; Pott, C.; Groenen, P.J.T.A.; Salles, G.; Davi, F.; Berger, F.; Garcia, J.F.; Krieken, J.H.J.M. van; Pals, S.; Kluin, P.; Schuuring, E.; Spaargaren, M.; Boone, E.; Gonzalez, D.; Martinez, B.; Villuendas, R.; Gameiro, P.; Diss, T.C.; Mills, K.; Morgan, G.J.; Carter, G.I.; Milner, B.J.; Pearson, D.; Hummel, M.; Jung, W.; Ott, M.; Canioni, D.; Beldjord, K.; Bastard, C.; Delfau-Larue, M.H.; Dongen, J.J.M. van; Molina, T.J.; Cabecadas, J.

    2007-01-01

    Polymerase chain reaction (PCR) assessment of clonal immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements is an important diagnostic tool in mature B-cell neoplasms. However, lack of standardized PCR protocols resulting in a high level of false negativity has hampered comparability of

  20. No control genes required: Bayesian analysis of qRT-PCR data.

    Mikhail V Matz

    Full Text Available Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process.In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts. Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests.Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  1. No control genes required: Bayesian analysis of qRT-PCR data.

    Matz, Mikhail V; Wright, Rachel M; Scott, James G

    2013-01-01

    Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR) is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process. In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC) algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts). Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization) but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests. Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  2. Gene expression studies of reference genes for quantitative real-time PCR: an overview in insects.

    Shakeel, Muhammad; Rodriguez, Alicia; Tahir, Urfa Bin; Jin, Fengliang

    2018-02-01

    Whenever gene expression is being examined, it is essential that a normalization process is carried out to eliminate non-biological variations. The use of reference genes, such as glyceraldehyde-3-phosphate dehydrogenase, actin, and ribosomal protein genes, is the usual method of choice for normalizing gene expression. Although reference genes are used to normalize target gene expression, a major problem is that the stability of these genes differs among tissues, developmental stages, species, and responses to abiotic factors. Therefore, the use and validation of multiple reference genes are required. This review discusses the reasons that why RT-qPCR has become the preferred method for validating results of gene expression profiles, the use of specific and non-specific dyes and the importance of use of primers and probes for qPCR as well as to discuss several statistical algorithms developed to help the validation of potential reference genes. The conflicts arising in the use of classical reference genes in gene normalization and their replacement with novel references are also discussed by citing the high stability and low stability of classical and novel reference genes under various biotic and abiotic experimental conditions by employing various methods applied for the reference genes amplification.

  3. Selection of suitable reference genes for RT-qPCR analyses in cyanobacteria.

    Filipe Pinto

    Full Text Available Cyanobacteria are a group of photosynthetic prokaryotes that have a diverse morphology, minimal nutritional requirements and metabolic plasticity that has made them attractive organisms to use in biotechnological applications. The use of these organisms as cell factories requires the knowledge of their physiology and metabolism at a systems level. For the quantification of gene transcripts real-time quantitative polymerase chain reaction (RT-qPCR is the standard technique. However, to obtain reliable RT-qPCR results the use and validation of reference genes is mandatory. Towards this goal we have selected and analyzed twelve candidate reference genes from three morphologically distinct cyanobacteria grown under routinely used laboratory conditions. The six genes exhibiting less variation in each organism were evaluated in terms of their expression stability using geNorm, NormFinder and BestKeeper. In addition, the minimum number of reference genes required for normalization was determined. Based on the three algorithms, we provide a list of genes for cyanobacterial RT-qPCR data normalization. To our knowledge, this is the first work on the validation of reference genes for cyanobacteria constituting a valuable starting point for future works.

  4. A proline racemase based PCR for identification of Trypanosoma vivax in cattle blood.

    Regassa Fikru

    Full Text Available A study was conducted to develop a Trypanosoma vivax (T. vivax specific PCR based on the T. vivax proline racemase (TvPRAC gene. Forward and reverse primers were designed that bind at 764-783 bp and 983-1002 bp of the gene. To assess its specificity, TvPRAC PCR was conducted on DNA extracted from different haemotropic pathogens: T. vivax from Nigeria, Ethiopia and Venezuela, T. congolense Savannah type, T. brucei brucei, T. evansi, T. equiperdum, T. theileri, Theileria parva, Anaplasma marginale, Babesia bovis and Babesia bigemina and from bovine, goat, mouse, camel and human blood. The analytical sensitivity of the TvPRAC PCR was compared with that of the ITS-1 PCR and the 18S PCR-RFLP on a dilution series of T. vivax DNA in water. The diagnostic performance of the three PCRs was compared on 411 Ethiopian bovine blood specimens collected in a former study. TvPRAC PCR proved to be fully specific for T. vivax, irrespective of its geographical origin. Its analytical sensitivity was lower than that of ITS-1 PCR. On these bovine specimens, TvPRAC PCR detected 8.3% T. vivax infections while ITS-1 PCR and 18S PCR-RFLP detected respectively 22.6 and 6.1% T. vivax infections. The study demonstrates that a proline racemase based PCR could be used, preferably in combination with ITS-1 PCR, as a species-specific diagnostic test for T. vivax infections worldwide.

  5. Capillary-based integrated digital PCR in picoliter droplets.

    Chen, Jinyu; Luo, Zhaofeng; Li, Lin; He, Jinlong; Li, Luoquan; Zhu, Jianwei; Wu, Ping; He, Liqun

    2018-01-30

    The droplet digital polymerase chain reaction (ddPCR) is becoming more and more popular in diagnostic applications in academia and industry. In commercially available ddPCR systems, after they have been made by a generator, the droplets have to be transferred manually to modules for amplification and detection. In practice, some of the droplets (∼10%) are lost during manual transfer, leading to underestimation of the targets. In addition, the droplets are also at risk of cross-contamination during transfer. By contrast, in labs, some chip-based ddPCRs have been demonstrated where droplets always run in channels. However, the droplets easily coalesce to large ones in chips due to wall wetting as well as thermal oscillation. The loss of droplets becomes serious when such ddPCRs are applied to absolutely quantify rare mutations, such as in early diagnostics in clinical research or when measuring biological diversity at the cell level. Here, we propose a capillary-based integrated ddPCR system that is used for the first time to realize absolute quantification in this way. In this system, a HPLC T-junction is used to generate droplets and a long HPLC capillary connects the generator with both a capillary-based thermocycler and a capillary-based cytometer. The performance of the system is validated by absolute quantification of a gene specific to lung cancer (LunX). The results show that this system has very good linearity (0.9988) at concentrations ranging from NTC to 2.4 × 10 -4 copies per μL. As compared to qPCR, the all-in-one scheme is superior both in terms of the detection limit and the smaller fold changes measurement. The system of ddPCR might provide a powerful approach for clinical or academic applications where rare events are mostly considered.

  6. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases.

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian; Aznar, Susana; Pakkenberg, Bente; Brudek, Tomasz

    2016-11-17

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results. This is especially important in relation to neurodegenerative diseases where disease-related structural changes may affect the most commonly used RGs. We analysed 15 candidate RGs in 98 brain samples from two brain regions from Alzheimer's disease (AD), Parkinson's disease (PD), Multiple System Atrophy, and Progressive Supranuclear Palsy patients. Using RefFinder, a web-based tool for evaluating RG stability, we identified the most stable RGs to be UBE2D2, CYC1, and RPL13 which we recommend for future RT-qPCR studies on human brain tissue from these patients. None of the investigated genes were affected by experimental variables such as RIN, PMI, or age. Findings were further validated by expression analyses of a target gene GSK3B, known to be affected by AD and PD. We obtained high variations in GSK3B levels when contrasting the results using different sets of common RG underlining the importance of a priori validation of RGs for RT-qPCR studies.

  7. Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

    Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

    1999-01-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...

  8. Identification of Optimal Reference Genes for Normalization of qPCR Analysis during Pepper Fruit Development

    Yuan Cheng

    2017-06-01

    Full Text Available Due to its high sensitivity and reproducibility, quantitative real-time PCR (qPCR is practiced as a useful research tool for targeted gene expression analysis. For qPCR operations, the normalization with suitable reference genes (RGs is a crucial step that eventually determines the reliability of the obtained results. Although pepper is considered an ideal model plant for the study of non-climacteric fruit development, at present no specific RG have been developed or validated for the qPCR analyses of pepper fruit. Therefore, this study aimed to identify stably expressed genes for their potential use as RGs in pepper fruit studies. Initially, a total of 35 putative RGs were selected by mining the pepper transcriptome data sets derived from the PGP (Pepper Genome Platform and PGD (Pepper Genome Database. Their expression stabilities were further measured in a set of pepper (Capsicum annuum L. var. 007e fruit samples, which represented four different fruit developmental stages (IM: Immature; MG: Mature green; B: Break; MR: Mature red using the qPCR analysis. Then, based on the qPCR results, three different statistical algorithms, namely geNorm, Normfinder, and boxplot, were chosen to evaluate the expression stabilities of these putative RGs. It should be noted that nine genes were proven to be qualified as RGs during pepper fruit development, namely CaREV05 (CA00g79660; CaREV08 (CA06g02180; CaREV09 (CA06g05650; CaREV16 (Capana12g002666; CaREV21 (Capana10g001439; CaREV23 (Capana05g000680; CaREV26 (Capana01g002973; CaREV27 (Capana11g000123; CaREV31 (Capana04g002411; and CaREV33 (Capana08g001826. Further analysis based on geNorm suggested that the application of the two most stably expressed genes (CaREV05 and CaREV08 would provide optimal transcript normalization in the qPCR experiments. Therefore, a new and comprehensive strategy for the identification of optimal RGs was developed. This strategy allowed for the effective normalization of the qPCR

  9. Scarless and sequential gene modification in Pseudomonas using PCR product flanked by short homology regions

    Liang Rubing

    2010-08-01

    Full Text Available Abstract Background The lambda Red recombination system has been used to inactivate chromosomal genes in various bacteria and fungi. The procedure consists of electroporating a polymerase chain reaction (PCR fragment containing antibiotic cassette flanked by homology regions to the target locus into a strain that can express the lambda Red proteins (Gam, Bet, Exo. Results Here a scarless gene modification strategy based on the Red recombination system has been developed to modify Pseudomonas genome DNA via sequential deletion of multiple targets. This process was mediated by plasmid pRKaraRed encoding the Red proteins regulated by PBAD promoter, which was functional in P. aeruginosa as well as in other bacteria. First the target gene was substituted for the sacB-bla cassette flanked by short homology regions (50 bp, and then this marker gene cassette could be replaced by the PCR fragment flanking itself, generating target-deleted genome without any remnants and no change happened to the surrounding region. Twenty genes involved in the synthesis and regulation pathways of the phenazine derivate, pyocyanin, were modified, including one single-point mutation and deletion of two large operons. The recombination efficiencies ranged from 88% to 98%. Multiple-gene modification was also achieved, generating a triple-gene deletion strain PCA (PAO1, ΔphzHΔphzMΔphzS, which could produce another phenazine derivate, phenazine-1-carboxylic acid (PCA, efficiently and exclusively. Conclusions This lambda Red-based technique can be used to generate scarless and sequential gene modification mutants of P. aeruginosa efficiently, using one-step PCR product flanked by short homology regions. Single-point mutation, scarless deletion of genes can be achieved easily in less than three days. This method may give a new way to construct genetically modified P. aeruginosa strains more efficiently and advance the regulatory network study of this organism.

  10. A rapid and direct real time PCR-based method for identification of Salmonella spp

    Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.

    2003-01-01

    The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated ...

  11. PCR-Based EST Mapping in Wheat (Triticum aestivum L.

    J. PERRY GUSTAFSON

    2009-04-01

    Full Text Available Mapping expressed sequence tags (ESTs to hexaploid wheat is aimed to reveal the structure and function of the hexaploid wheat genome. Sixty eight ESTs representing 26 genes were mapped into all seven homologous chromosome groups of wheat (Triticum aestivum L using a polymerase chain reaction technique. The majority of the ESTs were mapped to homologous chromosome group 2, and the least were mapped to homologous chromosome group 6. Comparative analysis between the EST map from this study and the EST map based on RFLPs showed 14 genes that have been mapped by both approaches were mapped to the same arm of the same homologous chromosome, which indicated that using PCR-based ESTs was a reliable approach in mapping ESTs in hexaploid wheat.

  12. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    McMillan, Mary; Pereg, Lily

    2014-01-01

    Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA) in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA) is sufficient for effective normalisation of qRT-PCR data.

  13. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Mary McMillan

    Full Text Available Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA is sufficient for effective normalisation of qRT-PCR data.

  14. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events

    Tigst Demeke

    2018-05-01

    Full Text Available Droplet digital PCR (ddPCR has been used for absolute quantification of genetically engineered (GE events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences (HMG-I/Y, FatA(A, CruA and Ccf for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A, reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes. Keywords: Canola, Digital PCR, DNA extraction, GMO, Reference genes

  15. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat

    Porceddu Enrico

    2009-02-01

    Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability

  16. Development of the Multiple Gene Knockout System with One-Step PCR in Thermoacidophilic Crenarchaeon Sulfolobus acidocaldarius

    Shoji Suzuki

    2017-01-01

    Full Text Available Multiple gene knockout systems developed in the thermoacidophilic crenarchaeon Sulfolobus acidocaldarius are powerful genetic tools. However, plasmid construction typically requires several steps. Alternatively, PCR tailing for high-throughput gene disruption was also developed in S. acidocaldarius, but repeated gene knockout based on PCR tailing has been limited due to lack of a genetic marker system. In this study, we demonstrated efficient homologous recombination frequency (2.8 × 104 ± 6.9 × 103 colonies/μg DNA by optimizing the transformation conditions. This optimized protocol allowed to develop reliable gene knockout via double crossover using short homologous arms and to establish the multiple gene knockout system with one-step PCR (MONSTER. In the MONSTER, a multiple gene knockout cassette was simply and rapidly constructed by one-step PCR without plasmid construction, and the PCR product can be immediately used for target gene deletion. As an example of the applications of this strategy, we successfully made a DNA photolyase- (phr- and arginine decarboxylase- (argD- deficient strain of S. acidocaldarius. In addition, an agmatine selection system consisting of an agmatine-auxotrophic strain and argD marker was also established. The MONSTER provides an alternative strategy that enables the very simple construction of multiple gene knockout cassettes for genetic studies in S. acidocaldarius.

  17. A standard curve based method for relative real time PCR data processing

    Krause Andreas

    2005-03-01

    Full Text Available Abstract Background Currently real time PCR is the most precise method by which to measure gene expression. The method generates a large amount of raw numerical data and processing may notably influence final results. The data processing is based either on standard curves or on PCR efficiency assessment. At the moment, the PCR efficiency approach is preferred in relative PCR whilst the standard curve is often used for absolute PCR. However, there are no barriers to employ standard curves for relative PCR. This article provides an implementation of the standard curve method and discusses its advantages and limitations in relative real time PCR. Results We designed a procedure for data processing in relative real time PCR. The procedure completely avoids PCR efficiency assessment, minimizes operator involvement and provides a statistical assessment of intra-assay variation. The procedure includes the following steps. (I Noise is filtered from raw fluorescence readings by smoothing, baseline subtraction and amplitude normalization. (II The optimal threshold is selected automatically from regression parameters of the standard curve. (III Crossing points (CPs are derived directly from coordinates of points where the threshold line crosses fluorescence plots obtained after the noise filtering. (IV The means and their variances are calculated for CPs in PCR replicas. (V The final results are derived from the CPs' means. The CPs' variances are traced to results by the law of error propagation. A detailed description and analysis of this data processing is provided. The limitations associated with the use of parametric statistical methods and amplitude normalization are specifically analyzed and found fit to the routine laboratory practice. Different options are discussed for aggregation of data obtained from multiple reference genes. Conclusion A standard curve based procedure for PCR data processing has been compiled and validated. It illustrates that

  18. Screening Reliable Reference Genes for RT-qPCR Analysis of Gene Expression in Moringa oleifera.

    Deng, Li-Ting; Wu, Yu-Ling; Li, Jun-Cheng; OuYang, Kun-Xi; Ding, Mei-Mei; Zhang, Jun-Jie; Li, Shu-Qi; Lin, Meng-Fei; Chen, Han-Bin; Hu, Xin-Sheng; Chen, Xiao-Yang

    2016-01-01

    Moringa oleifera is a promising plant species for oil and forage, but its genetic improvement is limited. Our current breeding program in this species focuses on exploiting the functional genes associated with important agronomical traits. Here, we screened reliable reference genes for accurately quantifying the expression of target genes using the technique of real-time quantitative polymerase chain reaction (RT-qPCR) in M. oleifera. Eighteen candidate reference genes were selected from a transcriptome database, and their expression stabilities were examined in 90 samples collected from the pods in different developmental stages, various tissues, and the roots and leaves under different conditions (low or high temperature, sodium chloride (NaCl)- or polyethyleneglycol (PEG)- simulated water stress). Analyses with geNorm, NormFinder and BestKeeper algorithms revealed that the reliable reference genes differed across sample designs and that ribosomal protein L1 (RPL1) and acyl carrier protein 2 (ACP2) were the most suitable reference genes in all tested samples. The experiment results demonstrated the significance of using the properly validated reference genes and suggested the use of more than one reference gene to achieve reliable expression profiles. In addition, we applied three isotypes of the superoxide dismutase (SOD) gene that are associated with plant adaptation to abiotic stress to confirm the efficacy of the validated reference genes under NaCl and PEG water stresses. Our results provide a valuable reference for future studies on identifying important functional genes from their transcriptional expressions via RT-qPCR technique in M. oleifera.

  19. Real-time PCR quantification of human complement C4A and C4B genes

    Fust George

    2006-01-01

    Full Text Available Abstract Background The fourth component of human complement (C4, an essential factor of the innate immunity, is represented as two isoforms (C4A and C4B in the genome. Although these genes differ only in 5 nucleotides, the encoded C4A and C4B proteins are functionally different. Based on phenotypic determination, unbalanced production of C4A and C4B is associated with several diseases, such as systemic lupus erythematosus, type 1 diabetes, several autoimmune diseases, moreover with higher morbidity and mortality of myocardial infarction and increased susceptibility for bacterial infections. Despite of this major clinical relevance, only low throughput, time and labor intensive methods have been used so far for the quantification of C4A and C4B genes. Results A novel quantitative real-time PCR (qPCR technique was developed for rapid and accurate quantification of the C4A and C4B genes applying a duplex, TaqMan based methodology. The reliable, single-step analysis provides the determination of the copy number of the C4A and C4B genes applying a wide range of DNA template concentration (0.3–300 ng genomic DNA. The developed qPCR was applied to determine C4A and C4B gene dosages in a healthy Hungarian population (N = 118. The obtained data were compared to the results of an earlier study of the same population. Moreover a set of 33 samples were analyzed by two independent methods. No significant difference was observed between the gene dosages determined by the employed techniques demonstrating the reliability of the novel qPCR methodology. A Microsoft Excel worksheet and a DOS executable are also provided for simple and automated evaluation of the measured data. Conclusion This report describes a novel real-time PCR method for single-step quantification of C4A and C4B genes. The developed technique could facilitate studies investigating disease association of different C4 isotypes.

  20. Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

    Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

    2016-10-19

    Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

  1. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events.

    Demeke, Tigst; Eng, Monika

    2018-05-01

    Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.

  2. Recommended Reference Genes for Quantitative PCR Analysis in Soybean Have Variable Stabilities during Diverse Biotic Stresses.

    Raman Bansal

    Full Text Available For real-time reverse transcription-PCR (qRT-PCR in soybean, reference genes in different tissues, developmental stages, various cultivars, and under stress conditions have been suggested but their usefulness for research on soybean under various biotic stresses occurring in North-Central U.S. is not known. Here, we investigated the expression stabilities of ten previously recommended reference genes (ABCT, CYP, EF1A, FBOX, GPDH, RPL30, TUA4, TUB4, TUA5, and UNK2 in soybean under biotic stress from Bean pod mottle virus (BPMV, powdery mildew (PMD, soybean aphid (SBA, and two-spotted spider mite (TSSM. BPMV, PMD, SBA, and TSSM are amongst the most common pest problems on soybean in North-Central U.S. and other regions. Reference gene stability was determined using three software algorithms (geNorm, NormFinder, BestKeeper and a web-based tool (RefFinder. Reference genes showed variability in their expression as well as stability across various stressors and the best reference genes were stress-dependent. ABCT and FBOX were found to be the most stable in soybean under both BPMV and SBA stress but these genes had only minimal to moderate stability during PMD and TSSM stress. Expression of TUA4 and CYP was found to be most stable during PMD stress; TUB4 and TUA4 were stable under TSSM stress. Under various biotic stresses on soybean analyzed, GPDH expression was found to be consistently unstable. For all biotic stressors on soybean, we obtained pairwise variation (V2/3 values less than 0.15 which suggested that combined use of the two most stable reference genes would be sufficient for normalization. Further, we demonstrated the utility of normalizing the qRT-PCR data for target genes using the most stable reference genes validated in current study. Following of the recommendations from our current study will enable an accurate and reliable normalization of qRT-PCR data in soybean under biotic stress.

  3. Identification and validation of reference genes for quantitative real-time PCR in Drosophila suzukii (Diptera: Drosophilidae.

    Yifan Zhai

    Full Text Available To accurately evaluate gene expression levels and obtain more accurate quantitative real-time RT-PCR (qRT-PCR data, normalization relative to reliable reference gene(s is required. Drosophila suzukii, is an invasive fruit pest native to East Asia, and recently invaded Europe and North America, the stability of its reference genes have not been previously investigated. In this study, ten candidate reference genes (RPL18, RPS3, AK, EF-1β, TBP, NADH, HSP22, GAPDH, Actin, α-Tubulin, were evaluated for their suitability as normalization genes under different biotic (developmental stage, tissue and population, and abiotic (photoperiod, temperature conditions. The three statistical approaches (geNorm, NormFinder and BestKeeper and one web-based comprehensive tool (RefFinder were used to normalize analysis of the ten candidate reference genes identified α-Tubulin, TBP and AK as the most stable candidates, while HSP22 and Actin showed the lowest expression stability. We used three most stable genes (α-Tubulin, TBP and AK and one unstably expressed gene to analyze the expression of P-glycoprotein in abamectin-resistant and sensitive strains, and the results were similar to reference genes α-Tubulin, TBP and AK, which show good stability, while the result of HSP22 has a certain bias. The three validated reference genes can be widely used for quantification of target gene expression with qRT-PCR technology in D.suzukii.

  4. The utility of optical detection system (qPCR) and bioinformatics methods in reference gene expression analysis

    Skarzyńska, Agnieszka; Pawełkowicz, Magdalena; PlÄ der, Wojciech; Przybecki, Zbigniew

    2016-09-01

    Real-time quantitative polymerase chain reaction is consider as the most reliable method for gene expression studies. However, the expression of target gene could be misinterpreted due to improper normalization. Therefore, the crucial step for analysing of qPCR data is selection of suitable reference genes, which should be validated experimentally. In order to choice the gene with stable expression in the designed experiment, we performed reference gene expression analysis. In this study genes described in the literature and novel genes predicted as control genes, based on the in silico analysis of transcriptome data were used. Analysis with geNorm and NormFinder algorithms allow to create the ranking of candidate genes and indicate the best reference for flower morphogenesis study. According to the results, genes CACS and CYCL were characterised the most stable expression, but the least suitable genes were TUA and EF.

  5. Simulation and experimental validation of a SU-8 based PCR thermocycler chip with integrated heaters and temperature sensor

    El-Ali, Jamil; Perch-Nielsen, Ivan R.; Poulsen, Claus Riber

    2004-01-01

    We present a SU-8 based polymerase chain reaction (PCR) chip with integrated platinum thin film heaters and temperature sensor. The device is fabricated in SU-8 on a glass substrate. The use of SU-8 provides a simple microfabrication process for the PCR chamber, controllable surface properties......C/s, respectively, the performance of the chip is comparable with the best silicon micromachined PCR chips presented in the literature. The SU-8 chamber surface was found to be PCR compatible by amplification of yeast gene ribosomal protein S3 and Campylobacter gene cadF. The PCR compatibility of the chamber...

  6. Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

    Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

    1996-11-01

    A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

  7. PCR-RFLP Analysis of a fliC Gene Fragment in Avian Salmonella Isolates

    Zohreh Ebrahimvandi

    2014-07-01

    Full Text Available Background: Salmonella are a genus of zoonotic bacteria of worldwide economic and health importance. Members of Salmonella enterica subspecies enterica are mainly associated with warm-blooded vertebrates and are usually transmitted by ingestion of food or watercontaminated by infected feces. Objectives: The aim of this study was to apply a PCR-RFLP method based on the fliC gene to identify the serotypes of Salmonella isolates from Karaj, Iran. Materials and Methods: A total of 30 Salmonella isolates were serotyped by specific antisera. For the PCR-RFLP method based on the fliC gene, extracted DNA was used as the template for amplifying the fliC gene (1500 bp using specific primers. PCR products were subjected to digestion using HhaI restriction endonuclease. Results: This study determined 30 serotypes as Salmonella durban (56.6%, Salmonella uno (23.3%, Salmonella enteritidis (3.3%, Salmonella tinda (3.3%, Salmonella mjimweme (3.3%, Salmonella Thompson (3.3%, Salmonella sIIO8 (3.3 % and Salmonella sIIO7 (3.3%. Observations indicated that HhaI is able to discriminate Salmonella tinda and Salmonella thompson, yet Salmonella enteritidis, Salmonella durban and Salmonella mjimweme had the same pattern with this enzyme. Also Salmonella sIIO8, Salmonella sIIO7 and Salmonella uno showed the same pattern. Thus, regarding the size and the number of resulting fragments from this enzyme, four patterns were obtained for HhaI. Conclusion: A large number of Salmonella serotypes need to be analyzed by the PCR-RFLP method and different enzymes must be used to give reliable results.

  8. Development of a PCR-RFLP method based on the transcription elongation factor 1-α gene to differentiate Fusarium graminearum from other species within the Fusarium graminearum species complex.

    Garmendia, Gabriela; Umpierrez-Failache, Mariana; Ward, Todd J; Vero, Silvana

    2018-04-01

    Fusarium head blight (FHB) is a destructive disease of cereals crops worldwide and a major food safety concern due to grain contamination with trichothecenes and other mycotoxins. Fusarium graminearum, a member of the Fusarium graminearum species complex (FGSC) is the dominant FHB pathogen in many parts of the world. However, a number of other Fusarium species, including other members of the FGSC, may also be present for example in Argentina, New Zealand, Ethiopia, Nepal, Unites States in cereals such as wheat and barley. Proper species identification is critical to research aimed at improving disease and mycotoxin control programs. Identification of Fusarium species is are often unreliable by traditional, as many species are morphologically cryptic. DNA sequence-based methods offer a reliable means of species identification, but can be expensive when applied to the analyses of population samples. To facilitate identification of the major causative agent of FHB, this work describes an easy and inexpensive method to differentiate F. graminearum from the remaining species within the FGSC and from the other common Fusarium species causing FHB in cereals. The developed method is based on a PCR-RFLP of the transcription elongation factor (TEF 1-α) gene using the restriction enzyme BsaHI. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Droplet digital PCR analysis of NOTCH1 gene mutations in chronic lymphocytic leukemia.

    Minervini, Angela; Francesco Minervini, Crescenzio; Anelli, Luisa; Zagaria, Antonella; Casieri, Paola; Coccaro, Nicoletta; Cumbo, Cosimo; Tota, Giuseppina; Impera, Luciana; Orsini, Paola; Brunetti, Claudia; Giordano, Annamaria; Specchia, Giorgina; Albano, Francesco

    2016-12-27

    In chronic lymphocytic leukemia (CLL), NOTCH1 gene mutations (NOTCH1mut) have been associated with adverse prognostic features but the independence of these as a prognostic factor is still controversial. In our study we validated a c.7541-7542delCT NOTCH1 mutation assay based on droplet digital PCR (ddPCR); we also analyzed the NOTCH1mut allelic burden, expressed as fractional abundance (FA), in 88 CLL patients at diagnosis to assess its prognostic role and made a longitudinal ddPCR analysis in 10 cases harboring NOTCH1mut to verify the FA variation over time. Our data revealed that with the ddPCR approach the incidence of NOTCH1mut in CLL was much higher (53.4%) than expected. However, longitudinal ddPCR analysis of CLL cases showed a statistically significant reduction of the NOTCH1mut FA detected at diagnosis after treatment (median FA 11.67 % vs 0.09 %, respectively, p = 0.01); the same difference, in terms of NOTCH1mut FA, was observed in the relapsed cases compared to the NOTCH1mut allelic fraction observed in patients in complete or partial remission (median FA 4.75% vs 0.43%, respectively, p = 0.007). Our study demonstrated a much higher incidence of NOTCH1mut in CLL than has previously been reported, and showed that the NOTCH1mut allelic burden evaluation by ddPCR might identify patients in need of a closer clinical follow-up during the "watch and wait" interval and after standard chemotherapy.

  10. Quantitative analysis of the dystrophin gene by real-time PCR

    Maksimovic Nela

    2012-01-01

    Full Text Available Duchenne and Becker muscular dystrophy (DMD/BMD are severe X-linked neuromuscular disorders caused by mutations in the dystrophin gene. Our aim was to optimize a quantitative real-time PCR method based on SYBR® Green I chemistry for routine diagnostics of DMD/BMD deletion carriers. Twenty female relatives of DMD/BMD patients with previously detected partial gene deletions were studied. The relative quantity of the target exons was calculated by a comparative threshold cycle method (ΔΔCt. The carrier status of all subjects was successfully determined. The gene dosage ratio for non-carriers was 1.07±0.20, and for carriers 0.56±0.11. This assay proved to be simple, rapid, reliable and cost-effective.

  11. [Sensitivity and specificity of nested PCR pyrosequencing in hepatitis B virus drug resistance gene testing].

    Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian

    2012-05-01

    To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, PNested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, Pnested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.

  12. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum using quantitative real-time RT-PCR.

    Jacinta Gimeno

    Full Text Available Switchgrass (Panicum virgatum has received a lot of attention as a forage and bioenergy crop during the past few years. Gene expression studies are in progress to improve new traits and develop new cultivars. Quantitative real time PCR (qRT-PCR has emerged as an important technique to study gene expression analysis. For accurate and reliable results, normalization of data with reference genes is essential. In this work, we evaluate the stability of expression of genes to use as reference for qRT-PCR in the grass P. virgatum. Eleven candidate reference genes, including eEF-1α, UBQ6, ACT12, TUB6, eIF-4a, GAPDH, SAMDC, TUA6, CYP5, U2AF, and FTSH4, were validated for qRT-PCR normalization in different plant tissues and under different stress conditions. The expression stability of these genes was verified by the use of two distinct algorithms, geNorm and NormFinder. Differences were observed after comparison of the ranking of the candidate reference genes identified by both programs but eEF-1α, eIF-4a, CYP5 and U2AF are ranked as the most stable genes in the samples sets under study. Both programs discard the use of SAMDC and TUA6 for normalization. Validation of the reference genes proposed by geNorm and NormFinder were performed by normalization of transcript abundance of a group of target genes in different samples. Results show similar expression patterns when the best reference genes selected by both programs were used but differences were detected in the transcript abundance of the target genes. Based on the above research, we recommend the use of different statistical algorithms to identify the best reference genes for expression data normalization. The best genes selected in this study will help to improve the quality of gene expression data in a wide variety of samples in switchgrass.

  13. Identification and comprehensive evaluation of reference genes for RT-qPCR analysis of host gene-expression in Brassica juncea-aphid interaction using microarray data.

    Ram, Chet; Koramutla, Murali Krishna; Bhattacharya, Ramcharan

    2017-07-01

    Brassica juncea is a chief oil yielding crop in many parts of the world including India. With advancement of molecular techniques, RT-qPCR based study of gene-expression has become an integral part of experimentations in crop breeding. In RT-qPCR, use of appropriate reference gene(s) is pivotal. The virtue of the reference genes, being constant in expression throughout the experimental treatments, needs to be validated case by case. Appropriate reference gene(s) for normalization of gene-expression data in B. juncea during the biotic stress of aphid infestation is not known. In the present investigation, 11 reference genes identified from microarray database of Arabidopsis-aphid interaction at a cut off FDR ≤0.1, along with two known reference genes of B. juncea, were analyzed for their expression stability upon aphid infestation. These included 6 frequently used and 5 newly identified reference genes. Ranking orders of the reference genes in terms of expression stability were calculated using advanced statistical approaches such as geNorm, NormFinder, delta Ct and BestKeeper. The analysis suggested CAC, TUA and DUF179 as the most suitable reference genes. Further, normalization of the gene-expression data of STP4 and PR1 by the most and the least stable reference gene, respectively has demonstrated importance and applicability of the recommended reference genes in aphid infested samples of B. juncea. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. Exploring Valid Reference Genes for Quantitative Real-Time PCR Analysis in Sesamia inferens (Lepidoptera: Noctuidae)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study...

  15. Polymorphism of calpastatin gene in Arabic sheep using PCR- RFLP

    Calpastatin has been known as candidate gene in muscle growth efficiency and meat quality. This gene has been located to chromosome 5 of sheep. In order to evaluate the calpastatin gene polymorphism, random blood sample were collected from 111 Arabic ram sheep from different regions. The DNA extraction was ...

  16. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-01-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from

  17. Development of PCR-based detection methods for the quarantine phytopathogen Synchytrium endobioticum, causal agent of wart disease

    Boogert, van den P.H.J.F.; Gent-Pelzer, van M.P.E.; Bonants, P.J.M.; Boer, de S.H.; Wander, J.G.N.; Lévesque, C.A.; Leeuwen, van G.C.M.; Baayen, R.P.

    2005-01-01

    Abstract PCR-based methods were developed for the detection and quantification of the potato pathogen Synchytrium endobioticum in soil extracts and in planta. PCR primers, based on the internal transcribed spacer region of the multi-copy gene rDNA were tested for specificity, sensitivity and

  18. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR.

    Kannika, K; Pisuttharachai, D; Srisapoome, P; Wongtavatchai, J; Kondo, H; Hirono, I; Unajak, S; Areechon, N

    2017-06-01

    This study aimed to biotype Streptococcus agalactiae isolated from tilapia farms in Thailand based on molecular biotyping methods and to determine the correlation between the serotype and virulence of bacteria. In addition to a biotyping (serotyping) technique based on multiplex PCR of cps genes, in this study, we developed multiplex PCR typing of Group B streptococcus (GBS) virulence genes to examine three clusters of virulence genes and their correlation with the pathogenicity of S. agalactiae. The epidemiology of S. agalactiae in Thailand was analysed to provide bacterial genetic information towards a future rational vaccine strategy for tilapia culture systems. Streptococcus agalactiae were isolated from diseased tilapia from different areas of Thailand. A total of 124 S. agalactiae isolates were identified by phenotypic analysis and confirmed by 16S rRNA PCR. Bacterial genotyping was conducted based on (i) molecular serotyping of the capsular polysaccharide (cps) gene cluster and (ii) virulence gene profiling using multiplex PCR analysis of 14 virulence genes (lmb, scpB, pavA, cspA, spb1, cyl, bca, rib, fbsA, fbsB, cfb, hylB, bac and pbp1A/ponA). Only serotypes Ia and III were found in this study; serotype Ia lacks the lmb, scpB and spb1 genes, whereas serotype III lacks only the bac gene. Virulence tests in juvenile Nile tilapia demonstrated a correlation between the pathogenicity of the bacteria and their virulence gene profile, with serotype III showing higher virulence than serotype Ia. Epidemiological analysis showed an almost equal distribution in all regions of Thailand, except serotype III was found predominantly in the southern areas. Only two serotypes of S. agalactiae were isolated from diseased tilapia in Thailand. Serotype Ia showed fewer virulence genes and lower virulence than serotype III. Both serotypes showed a similar distribution throughout Thailand. We identified two major serotypes of S. agalactiae isolates associated with the outbreak in

  19. Selection and evaluation of potential reference genes for gene expression analysis in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae using reverse-transcription quantitative PCR.

    Miao Yuan

    Full Text Available The brown planthopper (BPH, Nilaparvata lugens (Hemiptera, Delphacidae, is one of the most important rice pests. Abundant genetic studies on BPH have been conducted using reverse-transcription quantitative real-time PCR (qRT-PCR. Using qRT-PCR, the expression levels of target genes are calculated on the basis of endogenous controls. These genes need to be appropriately selected by experimentally assessing whether they are stably expressed under different conditions. However, such studies on potential reference genes in N. lugens are lacking. In this paper, we presented a systematic exploration of eight candidate reference genes in N. lugens, namely, actin 1 (ACT, muscle actin (MACT, ribosomal protein S11 (RPS11, ribosomal protein S15e (RPS15, alpha 2-tubulin (TUB, elongation factor 1 delta (EF, 18S ribosomal RNA (18S, and arginine kinase (AK and used four alternative methods (BestKeeper, geNorm, NormFinder, and the delta Ct method to evaluate the suitability of these genes as endogenous controls. We examined their expression levels among different experimental factors (developmental stage, body part, geographic population, temperature variation, pesticide exposure, diet change, and starvation following the MIQE (Minimum Information for publication of Quantitative real time PCR Experiments guidelines. Based on the results of RefFinder, which integrates four currently available major software programs to compare and rank the tested candidate reference genes, RPS15, RPS11, and TUB were found to be the most suitable reference genes in different developmental stages, body parts, and geographic populations, respectively. RPS15 was the most suitable gene under different temperature and diet conditions, while RPS11 was the most suitable gene under different pesticide exposure and starvation conditions. This work sheds light on establishing a standardized qRT-PCR procedure in N. lugens, and serves as a starting point for screening for reference genes for

  20. Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ.

    Mank, Nils N; Berghoff, Bork A; Hermanns, Yannick N; Klug, Gabriele

    2012-10-02

    The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA.

  1. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian; Aznar, Susana; Pakkenberg, Bente; Brudek, Tomasz

    2016-01-01

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results. This is especially important in relation to neurodegenerative diseases where disease-related structural changes may affect the most commonly used RGs. We analysed 15 candidate RGs in 98 brain sampl...

  2. Identification of endogenous control genes for normalisation of real-time quantitative PCR data in colorectal cancer.

    Kheirelseid, Elrasheid A H

    2010-01-01

    BACKGROUND: Gene expression analysis has many applications in cancer diagnosis, prognosis and therapeutic care. Relative quantification is the most widely adopted approach whereby quantification of gene expression is normalised relative to an endogenously expressed control (EC) gene. Central to the reliable determination of gene expression is the choice of control gene. The purpose of this study was to evaluate a panel of candidate EC genes from which to identify the most stably expressed gene(s) to normalise RQ-PCR data derived from primary colorectal cancer tissue. RESULTS: The expression of thirteen candidate EC genes: B2M, HPRT, GAPDH, ACTB, PPIA, HCRT, SLC25A23, DTX3, APOC4, RTDR1, KRTAP12-3, CHRNB4 and MRPL19 were analysed in a cohort of 64 colorectal tumours and tumour associated normal specimens. CXCL12, FABP1, MUC2 and PDCD4 genes were chosen as target genes against which a comparison of the effect of each EC gene on gene expression could be determined. Data analysis using descriptive statistics, geNorm, NormFinder and qBasePlus indicated significant difference in variances between candidate EC genes. We determined that two genes were required for optimal normalisation and identified B2M and PPIA as the most stably expressed and reliable EC genes. CONCLUSION: This study identified that the combination of two EC genes (B2M and PPIA) more accurately normalised RQ-PCR data in colorectal tissue. Although these control genes might not be optimal for use in other cancer studies, the approach described herein could serve as a template for the identification of valid ECs in other cancer types.

  3. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

  4. Shape based kinetic outlier detection in real-time PCR

    D'Atri Mario

    2010-04-01

    Full Text Available Abstract Background Real-time PCR has recently become the technique of choice for absolute and relative nucleic acid quantification. The gold standard quantification method in real-time PCR assumes that the compared samples have similar PCR efficiency. However, many factors present in biological samples affect PCR kinetic, confounding quantification analysis. In this work we propose a new strategy to detect outlier samples, called SOD. Results Richards function was fitted on fluorescence readings to parameterize the amplification curves. There was not a significant correlation between calculated amplification parameters (plateau, slope and y-coordinate of the inflection point and the Log of input DNA demonstrating that this approach can be used to achieve a "fingerprint" for each amplification curve. To identify the outlier runs, the calculated parameters of each unknown sample were compared to those of the standard samples. When a significant underestimation of starting DNA molecules was found, due to the presence of biological inhibitors such as tannic acid, IgG or quercitin, SOD efficiently marked these amplification profiles as outliers. SOD was subsequently compared with KOD, the current approach based on PCR efficiency estimation. The data obtained showed that SOD was more sensitive than KOD, whereas SOD and KOD were equally specific. Conclusion Our results demonstrated, for the first time, that outlier detection can be based on amplification shape instead of PCR efficiency. SOD represents an improvement in real-time PCR analysis because it decreases the variance of data thus increasing the reliability of quantification.

  5. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

    Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

    1999-01-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

  7. Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

    Torriani, S; Zapparoli, G; Dellaglio, F

    1999-10-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

  8. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.

    Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha

    2010-05-21

    Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  9. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    Afendy Arian

    2010-05-01

    Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  10. PCR Expression Analysis Of the Estrogeninducible Gene Bcei in Gastrointestinal and Other Human Tumors

    Iris Wundrack

    1994-01-01

    Full Text Available A polymerase chain reaction (PCR assay was developed to test for tumor cell specific expression of the BCEI gene. This new marker gene, reported at first for human breast cancer, was found specifically active in various gastrointestinal carcinomas by previously applying immunohistochemistry and RNA (Northern blot analysis. Presently, by using reverse transcription -PCR analysis, a series of primary tumor tissues and established tumor cell lines were testcd for BCEI transcription. This approach was compared to immunostaining achieved by an antibody directed against the BCEI gene’s product. The result demonstrate the superior sensitivity of PCR by indicating the gene’ s expression in cases where immunohistochemical testing remained negative.

  11. PCR-Internal Transcribed Spacer (ITS) genes sequencing and ...

    Methods: DNA extraction, purification, amplification and sequencing of Internal Transcribed Spacer (ITS) genes were per- formed using ... Keywords: Internal transcribed spacer genes, phylogenetic, genetic relationship, clinical and environmental fungi, HIV-TB. ... Nigeria. An Ethical clearance was obtained from the Eth-.

  12. Identification of valid reference genes for the normalization of RT qPCR gene expression data in human brain tissue

    Ravid Rivka

    2008-05-01

    Full Text Available Abstract Background Studies of gene expression in post mortem human brain can contribute to understanding of the pathophysiology of neurodegenerative diseases, including Alzheimer's disease (AD, Parkinson's disease (PD and dementia with Lewy bodies (DLB. Quantitative real-time PCR (RT qPCR is often used to analyse gene expression. The validity of results obtained using RT qPCR is reliant on accurate data normalization. Reference genes are generally used to normalize RT qPCR data. Given that expression of some commonly used reference genes is altered in certain conditions, this study aimed to establish which reference genes were stably expressed in post mortem brain tissue from individuals with AD, PD or DLB. Results The present study investigated the expression stability of 8 candidate reference genes, (ubiquitin C [UBC], tyrosine-3-monooxygenase [YWHAZ], RNA polymerase II polypeptide [RP II], hydroxymethylbilane synthase [HMBS], TATA box binding protein [TBP], β-2-microglobulin [B2M], glyceraldehyde-3-phosphate dehydrogenase [GAPDH], and succinate dehydrogenase complex-subunit A, [SDHA] in cerebellum and medial temporal gyrus of 6 AD, 6 PD, 6 DLB subjects, along with 5 matched controls using RT qPCR (TaqMan® Gene Expression Assays. Gene expression stability was analysed using geNorm to rank the candidate genes in order of decreasing stability in each disease group. The optimal number of genes recommended for accurate data normalization in each disease state was determined by pairwise variation analysis. Conclusion This study identified validated sets of mRNAs which would be appropriate for the normalization of RT qPCR data when studying gene expression in brain tissue of AD, PD, DLB and control subjects.

  13. Validation of putative reference genes for normalization of Q-RT-PCR data from paraffin-embedded lymphoid tissue

    Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe

    2009-01-01

    Normalization of quantitative reverse transcription-PCR (Q-RT-PCR) data to appropriate tissue-specific reference genes is an essential part of interpreting the results. This study aimed to determine the most appropriate reference genes for normalizing gene expressions in lymphatic tissue...... was 0.93 (Pnormalization with the appropriate reference genes. Thus, we show that formalin-fixed, paraffin-embedded lymphoid samples are suitable for Q-RT-PCR when using thoroughly validated reference genes....

  14. Genome-Wide Identification and Evaluation of Reference Genes for Quantitative RT-PCR Analysis during Tomato Fruit Development.

    Cheng, Yuan; Bian, Wuying; Pang, Xin; Yu, Jiahong; Ahammed, Golam J; Zhou, Guozhi; Wang, Rongqing; Ruan, Meiying; Li, Zhimiao; Ye, Qingjing; Yao, Zhuping; Yang, Yuejian; Wan, Hongjian

    2017-01-01

    Gene expression analysis in tomato fruit has drawn increasing attention nowadays. Quantitative real-time PCR (qPCR) is a routine technique for gene expression analysis. In qPCR operation, reliability of results largely depends on the choice of appropriate reference genes (RGs). Although tomato is a model for fruit biology study, few RGs for qPCR analysis in tomato fruit had yet been developed. In this study, we initially identified 38 most stably expressed genes based on tomato transcriptome data set, and their expression stabilities were further determined in a set of tomato fruit samples of four different fruit developmental stages (Immature, mature green, breaker, mature red) using qPCR analysis. Two statistical algorithms, geNorm and Normfinder, concordantly determined the superiority of these identified putative RGs. Notably, SlFRG05 (Solyc01g104170), SlFRG12 (Solyc04g009770), SlFRG16 (Solyc10g081190), SlFRG27 (Solyc06g007510), and SlFRG37 (Solyc11g005330) were proved to be suitable RGs for tomato fruit development study. Further analysis using geNorm indicate that the combined use of SlFRG03 (Solyc02g063070) and SlFRG27 would provide more reliable normalization results in qPCR experiments. The identified RGs in this study will be beneficial for future qPCR analysis of tomato fruit developmental study, as well as for the potential identification of optimal normalization controls in other plant species.

  15. Genome-Wide Identification and Evaluation of Reference Genes for Quantitative RT-PCR Analysis during Tomato Fruit Development

    Yuan Cheng

    2017-08-01

    Full Text Available Gene expression analysis in tomato fruit has drawn increasing attention nowadays. Quantitative real-time PCR (qPCR is a routine technique for gene expression analysis. In qPCR operation, reliability of results largely depends on the choice of appropriate reference genes (RGs. Although tomato is a model for fruit biology study, few RGs for qPCR analysis in tomato fruit had yet been developed. In this study, we initially identified 38 most stably expressed genes based on tomato transcriptome data set, and their expression stabilities were further determined in a set of tomato fruit samples of four different fruit developmental stages (Immature, mature green, breaker, mature red using qPCR analysis. Two statistical algorithms, geNorm and Normfinder, concordantly determined the superiority of these identified putative RGs. Notably, SlFRG05 (Solyc01g104170, SlFRG12 (Solyc04g009770, SlFRG16 (Solyc10g081190, SlFRG27 (Solyc06g007510, and SlFRG37 (Solyc11g005330 were proved to be suitable RGs for tomato fruit development study. Further analysis using geNorm indicate that the combined use of SlFRG03 (Solyc02g063070 and SlFRG27 would provide more reliable normalization results in qPCR experiments. The identified RGs in this study will be beneficial for future qPCR analysis of tomato fruit developmental study, as well as for the potential identification of optimal normalization controls in other plant species.

  16. Identification of Tunisian Leishmania spp. by PCR amplification of cysteine proteinase B (cpb) genes and phylogenetic analysis.

    Chaouch, Melek; Fathallah-Mili, Akila; Driss, Mehdi; Lahmadi, Ramzi; Ayari, Chiraz; Guizani, Ikram; Ben Said, Moncef; Benabderrazak, Souha

    2013-03-01

    Discrimination of the Old World Leishmania parasites is important for diagnosis and epidemiological studies of leishmaniasis. We have developed PCR assays that allow the discrimination between Leishmania major, Leishmania tropica and Leishmania infantum Tunisian species. The identification was performed by a simple PCR targeting cysteine protease B (cpb) gene copies. These PCR can be a routine molecular biology tools for discrimination of Leishmania spp. from different geographical origins and different clinical forms. Our assays can be an informative source for cpb gene studying concerning drug, diagnostics and vaccine research. The PCR products of the cpb gene and the N-acetylglucosamine-1-phosphate transferase (nagt) Leishmania gene were sequenced and aligned. Phylogenetic trees of Leishmania based cpb and nagt sequences are close in topology and present the classic distribution of Leishmania in the Old World. The phylogenetic analysis has enabled the characterization and identification of different strains, using both multicopy (cpb) and single copy (nagt) genes. Indeed, the cpb phylogenetic analysis allowed us to identify the Tunisian Leishmania killicki species, and a group which gathers the least evolved isolates of the Leishmania donovani complex, that was originated from East Africa. This clustering confirms the African origin for the visceralizing species of the L. donovani complex. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Real-time PCR detection of aldoxime dehydratase genes in nitrile-degrading microorganisms.

    Dooley-Cullinane, Tríona Marie; O'Reilly, Catherine; Coffey, Lee

    2017-02-01

    Aldoxime dehydratase catalyses the conversion of aldoximes to their corresponding nitriles. Utilization of the aldoxime-nitrile metabolising enzyme pathway can facilitate the move towards a greener chemistry. In this work, a real-time PCR assay was developed for the detection of aldoxime dehydratase genes in aldoxime/nitrile metabolising microorganisms which have been purified from environmental sources. A conventional PCR assay was also designed allowing gene confirmation via sequencing. Aldoxime dehydratase genes were identified in 30 microorganisms across 11 genera including some not previously shown to harbour the gene. The assay displayed a limit of detection of 1 pg/μL DNA or 7 CFU/reaction. This real-time PCR assay should prove valuable in the high-throughput screening of micro-organisms for novel aldoxime dehydratase genes towards pharmaceutical and industrial applications.

  18. Validation of reference genes for RT-qPCR analysis in Herbaspirillum seropedicae.

    Pessoa, Daniella Duarte Villarinho; Vidal, Marcia Soares; Baldani, José Ivo; Simoes-Araujo, Jean Luiz

    2016-08-01

    The RT-qPCR technique needs a validated set of reference genes for ensuring the consistency of the results from the gene expression. Expression stabilities for 9 genes from Herbaspirillum seropedicae, strain HRC54, grown with different carbon sources were calculated using geNorm and NormFinder, and the gene rpoA showed the best stability values. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. ICG: a wiki-driven knowledgebase of internal control genes for RT-qPCR normalization.

    Sang, Jian; Wang, Zhennan; Li, Man; Cao, Jiabao; Niu, Guangyi; Xia, Lin; Zou, Dong; Wang, Fan; Xu, Xingjian; Han, Xiaojiao; Fan, Jinqi; Yang, Ye; Zuo, Wanzhu; Zhang, Yang; Zhao, Wenming; Bao, Yiming; Xiao, Jingfa; Hu, Songnian; Hao, Lili; Zhang, Zhang

    2018-01-04

    Real-time quantitative PCR (RT-qPCR) has become a widely used method for accurate expression profiling of targeted mRNA and ncRNA. Selection of appropriate internal control genes for RT-qPCR normalization is an elementary prerequisite for reliable expression measurement. Here, we present ICG (http://icg.big.ac.cn), a wiki-driven knowledgebase for community curation of experimentally validated internal control genes as well as their associated experimental conditions. Unlike extant related databases that focus on qPCR primers in model organisms (mainly human and mouse), ICG features harnessing collective intelligence in community integration of internal control genes for a variety of species. Specifically, it integrates a comprehensive collection of more than 750 internal control genes for 73 animals, 115 plants, 12 fungi and 9 bacteria, and incorporates detailed information on recommended application scenarios corresponding to specific experimental conditions, which, collectively, are of great help for researchers to adopt appropriate internal control genes for their own experiments. Taken together, ICG serves as a publicly editable and open-content encyclopaedia of internal control genes and accordingly bears broad utility for reliable RT-qPCR normalization and gene expression characterization in both model and non-model organisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Complementary techniques: validation of gene expression data by quantitative real time PCR.

    Provenzano, Maurizio; Mocellin, Simone

    2007-01-01

    Microarray technology can be considered the most powerful tool for screening gene expression profiles of biological samples. After data mining, results need to be validated with highly reliable biotechniques allowing for precise quantitation of transcriptional abundance of identified genes. Quantitative real time PCR (qrt-PCR) technology has recently reached a level of sensitivity, accuracy and practical ease that support its use as a routine bioinstrumentation for gene level measurement. Currently, qrt-PCR is considered by most experts the most appropriate method to confirm or confute microarray-generated data. The knowledge of the biochemical principles underlying qrt-PCR as well as some related technical issues must be beard in mind when using this biotechnology.

  1. Rapid direct identification of Cryptococcus neoformans from pigeon droppings by nested PCR using CNLAC1 gene.

    Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S

    2012-08-01

    Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.

  2. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

  3. Identification of Reference Genes for Normalizing Quantitative Real-Time PCR in Urechis unicinctus

    Bai, Yajiao; Zhou, Di; Wei, Maokai; Xie, Yueyang; Gao, Beibei; Qin, Zhenkui; Zhang, Zhifeng

    2018-06-01

    The reverse transcription quantitative real-time PCR (RT-qPCR) has become one of the most important techniques of studying gene expression. A set of valid reference genes are essential for the accurate normalization of data. In this study, five candidate genes were analyzed with geNorm, NormFinder, BestKeeper and ΔCt methods to identify the genes stably expressed in echiuran Urechis unicinctus, an important commercial marine benthic worm, under abiotic (sulfide stress) and normal (adult tissues, embryos and larvae at different development stages) conditions. The comprehensive results indicated that the expression of TBP was the most stable at sulfide stress and in developmental process, while the expression of EF- 1- α was the most stable at sulfide stress and in various tissues. TBP and EF- 1- α were recommended as a suitable reference gene combination to accurately normalize the expression of target genes at sulfide stress; and EF- 1- α, TBP and TUB were considered as a potential reference gene combination for normalizing the expression of target genes in different tissues. No suitable gene combination was obtained among these five candidate genes for normalizing the expression of target genes for developmental process of U. unicinctus. Our results provided a valuable support for quantifying gene expression using RT-qPCR in U. unicinctus.

  4. Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR

    2014-01-01

    Background Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. Results A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. Conclusions The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level

  5. Polymorphism of calpastatin gene in Arabic sheep using PCR- RFLP

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... Calpastatin has been known as candidate gene in muscle growth efficiency and ... population, AA, AB, BB genotype have been identified with the 70.27, .... of cimaterol on rabbit growth and myofibrillar protein degradation.

  6. A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

    Redman Julia C

    2008-07-01

    Full Text Available Abstract Background Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs, which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants. Results We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes. Conclusion High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.

  7. A PCR-based method for identification of bifidobacteria from the human alimentary tract at the species level

    Venema, K.; Maathuis, A.J.H.

    2003-01-01

    A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12

  8. In search of suitable reference genes for gene expression studies of human renal cell carcinoma by real-time PCR

    Kristiansen Glen

    2007-06-01

    Full Text Available Abstract Background Housekeeping genes are commonly used as endogenous reference genes for the relative quantification of target genes in gene expression studies. No conclusive systematic study comparing the suitability of different candidate reference genes in clear cell renal cell carcinoma has been published to date. To remedy this situation, 10 housekeeping genes for normalizing purposes of RT-PCR measurements already recommended in various studies were examined with regard to their usefulness as reference genes. Results The expression of the potential reference genes was examined in matched malignant and non-malignant tissue specimens from 25 patients with clear cell renal cell carcinoma. Quality assessment of isolated RNA performed with a 2100 Agilent Bioanalyzer showed a mean RNA integrity number of 8.7 for all samples. The between-run variations related to the crossing points of PCR reactions of a control material ranged from 0.17% to 0.38%. The expression of all genes did not depend on age, sex, and tumour stage. Except the genes TATA box binding protein (TBP and peptidylprolyl isomerase A (PPIA, all genes showed significant differences in expression between malignant and non-malignant pairs. The expression stability of the candidate reference genes was additionally controlled using the software programs geNorm and NormFinder. TBP and PPIA were validated as suitable reference genes by normalizing the target gene ADAM9 using these two most stably expressed genes in comparison with up- and down-regulated housekeeping genes of the panel. Conclusion Our study demonstrated the suitability of the two housekeeping genes PPIA and TBP as endogenous reference genes when comparing malignant tissue samples with adjacent normal tissue samples from clear cell renal cell carcinoma. Both genes are recommended as reference genes for relative gene quantification in gene profiling studies either as single gene or preferably in combination.

  9. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

    Kwang-Pyo Kim

    2015-09-01

    Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.

  10. Utility of the cytochrome c oxidase subunit I gene for the diagnosis of toxoplasmosis using PCR.

    Feng, Xue; Norose, Kazumi; Li, Kexin; Hikosaka, Kenji

    2017-10-01

    Toxoplasmosis is caused by the protozoan parasite Toxoplasma gondii, which belongs to the phylum Apicomplexa. Since this parasite causes severe clinical symptoms in immunocompromised patients, early diagnosis of toxoplasmosis is essential. PCR is currently used for early diagnosis, but there is no consensus regarding the most effective method for amplifying Toxoplasma DNA. In this study, we considered the utility of the cytochrome c subunit I (cox1) gene, which is encoded in the mitochondrial DNA of this parasite, as a novel target of PCR for the diagnosis of toxoplasmosis. To do this, we compared its copy number per haploid nuclear genome and the detection sensitivity of cox1-PCR with the previously reported target genes B1 and 18S rRNA and the AF146527 repeat element. We found that the copy number of cox1 was high and that the PCR using cox1 primers was more efficient at amplifying Toxoplasma DNA than the other PCR targets examined. In addition, PCR using clinical samples indicated that the cox1 gene would be useful for the diagnosis of toxoplasmosis. These findings suggest that use of cox1-PCR would facilitate the diagnosis of toxoplasmosis in clinical laboratories. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR

    Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)

    1994-09-01

    Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.

  12. DNA microarray-based PCR ribotyping of Clostridium difficile.

    Schneeberg, Alexander; Ehricht, Ralf; Slickers, Peter; Baier, Vico; Neubauer, Heinrich; Zimmermann, Stefan; Rabold, Denise; Lübke-Becker, Antina; Seyboldt, Christian

    2015-02-01

    This study presents a DNA microarray-based assay for fast and simple PCR ribotyping of Clostridium difficile strains. Hybridization probes were designed to query the modularly structured intergenic spacer region (ISR), which is also the template for conventional and PCR ribotyping with subsequent capillary gel electrophoresis (seq-PCR) ribotyping. The probes were derived from sequences available in GenBank as well as from theoretical ISR module combinations. A database of reference hybridization patterns was set up from a collection of 142 well-characterized C. difficile isolates representing 48 seq-PCR ribotypes. The reference hybridization patterns calculated by the arithmetic mean were compared using a similarity matrix analysis. The 48 investigated seq-PCR ribotypes revealed 27 array profiles that were clearly distinguishable. The most frequent human-pathogenic ribotypes 001, 014/020, 027, and 078/126 were discriminated by the microarray. C. difficile strains related to 078/126 (033, 045/FLI01, 078, 126, 126/FLI01, 413, 413/FLI01, 598, 620, 652, and 660) and 014/020 (014, 020, and 449) showed similar hybridization patterns, confirming their genetic relatedness, which was previously reported. A panel of 50 C. difficile field isolates was tested by seq-PCR ribotyping and the DNA microarray-based assay in parallel. Taking into account that the current version of the microarray does not discriminate some closely related seq-PCR ribotypes, all isolates were typed correctly. Moreover, seq-PCR ribotypes without reference profiles available in the database (ribotype 009 and 5 new types) were correctly recognized as new ribotypes, confirming the performance and expansion potential of the microarray. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Development and application of a universal Hemoplasma screening assay based on the SYBR green PCR principle.

    Willi, Barbara; Meli, Marina L; Lüthy, Ruedi; Honegger, Hanspeter; Wengi, Nicole; Hoelzle, Ludwig E; Reusch, Claudia E; Lutz, Hans; Hofmann-Lehmann, Regina

    2009-12-01

    Hemotropic mycoplasmas (hemoplasmas) are the causative agents of infectious anemia in several mammalian species. Their zoonotic potential has recently been substantiated by the identification of a feline hemoplasma isolate in an immunocompromised human patient. Although species-specific diagnostic molecular methods have been developed, their application as screening tools is limited due to the species diversity of hemoplasmas. The goals of this study were to develop a universal hemoplasma screening assay with broad specificity based on the SYBR green PCR principle, to compare the assay with hemoplasma-specific TaqMan PCR, and to analyze potential tick vectors and human blood samples to address the zoonotic potential. The newly developed PCR assay based on the 16S rRNA gene amplified feline, canine, bovine, porcine, camelid, and murine hemoplasmas, as well as Mycoplasma penetrans and Mycoplasma pneumoniae. The lower detection limit for feline and canine hemoplasmas was 1 to 10 copies/PCR. The assay exhibited 98.2% diagnostic sensitivity and 92.1% diagnostic specificity for feline hemoplasmas. All 1,950 Ixodes ticks were PCR negative, suggesting that Ixodes ticks are not relevant vectors for the above-mentioned hemoplasma species in Switzerland. None of the 414 blood samples derived from anemic or immunocompromised human patients revealed a clear positive result. The SYBR green PCR assay described here is a suitable tool to screen for known and so-far-undiscovered hemoplasma species. Positive results should be confirmed by specific TaqMan PCR or sequencing.

  14. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

    Lee Yeon-Su

    2010-05-01

    Full Text Available Abstract Background Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. Methods We assessed the suitability of six possible reference genes, beta-actin (ACTB, glyceraldehydes-3-phosphate dehydrogenase (GAPDH, hypoxanthine phosphoribosyl transferase 1 (HPRT1, beta-2-microglobulin (B2M, ribosomal subunit L29 (RPL29 and 18S ribosomal RNA (18S rRNA in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. Results This RT-qPCR study showed that there are statistically significant (p Conclusion This study validated RPL29 and RPL29-B2M as the best single reference genes and combination, for RT-qPCR analysis of 'all stomach tissues', and B2M and B2M-GAPDH as the best single reference gene and combination, for 'stomach cancer cell lines'. Use of these validated reference genes should provide more exact interpretation of differential gene expressions at transcription level in stomach cancer.

  15. Identification of genes for normalization of real-time RT-PCR data in breast carcinomas

    Lyng, Maria B; Laenkholm, Anne-Vibeke; Pallisgaard, Niels

    2008-01-01

    BACKGROUND: Quantitative real-time RT-PCR (RT-qPCR) has become a valuable molecular technique in basic and translational biomedical research, and is emerging as an equally valuable clinical tool. Correlation of inter-sample values requires data normalization, which can be accomplished by various...... means, the most common of which is normalization to internal, stably expressed, reference genes. Recently, such traditionally utilized reference genes as GAPDH and B2M have been found to be regulated in various circumstances in different tissues, emphasizing the need to identify genes independent...... of factors influencing the tissue, and that are stably expressed within the experimental milieu. In this study, we identified genes for normalization of RT-qPCR data for invasive breast cancer (IBC), with special emphasis on estrogen receptor positive (ER+) IBC, but also examined their applicability to ER...

  16. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  17. Review: Diagnostic accuracy of PCR-based detection tests for Helicobacter Pylori in stool samples.

    Khadangi, Fatemeh; Yassi, Maryam; Kerachian, Mohammad Amin

    2017-12-01

    Although different methods have been established to detect Helicobacter pylori (H. pylori) infection, identifying infected patients is an ongoing challenge. The aim of this meta-analysis was to provide pooled diagnostic accuracy measures for stool PCR test in the diagnosis of H. pylori infection. In this study, a systematic review and meta-analysis were carried out on various sources, including MEDLINE, Web of Sciences, and the Cochrane Library from April 1, 1999, to May 1, 2016. This meta-analysis adheres to the guidelines provided by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses report (PRISMA Statement). The clinical value of DNA stool PCR test was based on the pooled false positive, false negative, true positive, and true negative of different genes. Twenty-six of 328 studies identified met the eligibility criteria. Stool PCR test had a performance of 71% (95% CI: 68-73) sensitivity, 96% (95% CI: 94-97) specificity, and 65.6 (95% CI: 30.2-142.5) diagnostic odds ratio (DOR) in diagnosis of H. pylori. The DOR of genes which showed the highest performance of stool PCR tests was as follows: 23S rRNA 152.5 (95% CI: 55.5-418.9), 16S rRNA 67.9 (95%CI: 6.4-714.3), and glmM 68.1 (95%CI: 20.1-231.7). The sensitivity and specificity of stool PCR test are relatively in the same spectrum of other diagnostic methods for the detection of H. pylori infection. In descending order of significance, the most diagnostic candidate genes using PCR detection were 23S rRNA, 16S rRNA, and glmM. PCR for 23S rRNA gene which has the highest performance could be applicable to detect H. pylori infection. © 2017 John Wiley & Sons Ltd.

  18. Selection and validation of endogenous reference genes for qRT-PCR analysis in leafy spurge (Euphorbia esula.

    Wun S Chao

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR is the most important tool in measuring levels of gene expression due to its accuracy, specificity, and sensitivity. However, the accuracy of qRT-PCR analysis strongly depends on transcript normalization using stably expressed reference genes. The aim of this study was to find internal reference genes for qRT-PCR analysis in various experimental conditions for seed, adventitious underground bud, and other organs of leafy spurge. Eleven candidate reference genes (BAM4, PU1, TRP-like, FRO1, ORE9, BAM1, SEU, ARF2, KAPP, ZTL, and MPK4 were selected from among 171 genes based on expression stabilities during seed germination and bud growth. The other ten candidate reference genes were selected from three different sources: (1 3 stably expressed leafy spurge genes (60S, bZIP21, and MD-100 identified from the analyses of leafy spurge microarray data; (2 3 orthologs of Arabidopsis "general purpose" traditional reference genes (GAPDH_1, GAPDH_2, and UBC; and (3 4 orthologs of Arabidopsis stably expressed genes (UBC9, SAND, PTB, and F-box identified from Affymetrix ATH1 whole-genome GeneChip studies. The expression stabilities of these 21 genes were ranked based on the C(T values of 72 samples using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ΔC(T method. Our analyses revealed SAND, PTB, ORE9, and ARF2 to be the most appropriate reference genes for accurate normalization of gene expression data. Since SAND and PTB were obtained from 4 orthologs of Arabidopsis, while ORE9 and ARF2 were selected from 171 leafy spurge genes, it was more efficient to identify good reference genes from the orthologs of other plant species that were known to be stably expressed than that of randomly testing endogenous genes. Nevertheless, the two newly identified leafy spurge genes, ORE9 and ARF2, can serve as orthologous candidates in the search for reference genes

  19. PCR-RFLP analyses for studying the diversity of GH and Pit-1 genes in Slovak Simmental cattle

    Anna Trakovická

    2013-10-01

    Full Text Available The aim of this study was evaluation of growth hormone (GH and specific pituitary transcription factor (Pit-1 genes diversity in population of 353 Slovak Simmental cows. The analyses were based on single nucleotide polymorphisms GH/AluI and Pit-1/HinfI detections. A polymorphic site of GH gene (AluI has been linked to differences in circulating metabolites, metabolic hormones and milk yield. Bovine Pit-1 is responsible for pituitary development and hormone secreting gene expression, including GH gene. The Pit-1/HinfI locus was associated with growth, milk production and reproduction performance in cattle. Samples of genomic DNA were analyzed by PCR-RFLP method. Digestion of GH gene PCR products with restriction enzyme AluI revealed allele L and V with frequency 0.695 and 0.305, respectively. The digested Pit-1 gene PCR products with enzyme HinfI revealed alleles A (0.249 and B (0.751. Dominant genotypes were for GH gene heterozygous LV (0.47 and for Pit-1 gene homozygous BB (0.56 animals. The observed heterozygosity, effective allele numbers and polymorphism information content of GH/AluI and Pit-1/HinfI bovine loci population were 0.42/0.37, 1.73/1.59 and 0.33/0.30, respectively. The median polymorphic information content of loci was also transferred to the higher observed homozygosity in population (0.58/0.63. Keywords: cattle, growth hormone, leptin, PCR, Pit-1, polymorphism.

  20. Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella

    Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar

    2013-01-01

    We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)

  1. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  2. Validation of reference genes for quantitative real-time PCR in Périgord black truffle (Tuber melanosporum) developmental stages.

    Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni

    2015-08-01

    The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable

  3. Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

    Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

    2014-09-01

    PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR

    Kawaguchi Makoto

    2010-01-01

    Full Text Available Abstract Background Lung cancers are the most common type of human malignancy and are intractable. Lung cancers are generally classified into four histopathological subtypes: adenocarcinoma (AD, squamous cell carcinoma (SQ, large cell carcinoma (LC, and small cell carcinoma (SC. Molecular biological characterization of these subtypes has been performed mainly using DNA microarrays. In this study, we compared the gene expression profiles of these four subtypes using twelve human lung cancer cell lines and the more reliable quantitative real-time PCR (qPCR. Results We selected 100 genes from public DNA microarray data and examined them by DNA microarray analysis in eight test cell lines (A549, ABC-1, EBC-1, LK-2, LU65, LU99, STC 1, RERF-LC-MA and a normal control lung cell line (MRC-9. From this, we extracted 19 candidate genes. We quantified the expression of the 19 genes and a housekeeping gene, GAPDH, with qPCR, using the same eight cell lines plus four additional validation lung cancer cell lines (RERF-LC-MS, LC-1/sq, 86-2, and MS-1-L. Finally, we characterized the four subtypes of lung cancer cell lines using principal component analysis (PCA of gene expression profiling for 12 of the 19 genes (AMY2A, CDH1, FOXG1, IGSF3, ISL1, MALL, PLAU, RAB25, S100P, SLCO4A1, STMN1, and TGM2. The combined PCA and gene pathway analyses suggested that these genes were related to cell adhesion, growth, and invasion. S100P in AD cells and CDH1 in AD and SQ cells were identified as candidate markers of these lung cancer subtypes based on their upregulation and the results of PCA analysis. Immunohistochemistry for S100P and RAB25 was closely correlated to gene expression. Conclusions These results show that the four subtypes, represented by 12 lung cancer cell lines, were well characterized using qPCR and PCA for the 12 genes examined. Certain genes, in particular S100P and CDH1, may be especially important for distinguishing the different subtypes. Our results

  5. Real-time PCR analysis of genes encoding tumor antigens in esophageal tumors and a cancer vaccine

    Weinert, Brian T; Krishnadath, Kausilia K; Milano, Francesca

    2009-01-01

    Tumor antigens are the primary target of therapeutic cancer vaccines. We set out to define and compare the expression pattern of tumor antigen genes in esophagus carcinoma biopsies and in an allogeneic tumor lysate-based cancer vaccine, MelCancerVac. Cells used for vaccine production were treated...... in the production of the vaccine. Quantitative PCR was used to assay 74 tumor antigen genes in patients with squamous cell carcinoma of the esophagus. 81% (13/16) of tumors expressed more than five cancer/testis (CT) antigens. A total of 96 genes were assayed in the tumor cell clone (DDM1.7) used to make tumor cell...

  6. Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

    Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...

  7. Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses

    Chen, Hongjun; Ye, Jianqiang; Xu, Kemin; Angel, Matthew; Shao, Hongxia; Ferrero, Andrea; Sutton, Troy; Perez, Daniel R.

    2012-01-01

    Since 1999, plasmid-based reverse genetics (RG) systems have revolutionized the way influenza viruses are studied. However, it is not unusual to encounter cloning difficulties for one or more influenza genes while attempting to recover virus de novo. To overcome some of these shortcomings we sought to develop partial or full plasmid-free RG systems. The influenza gene of choice is assembled into a RG competent unit by virtue of overlapping PCR reactions containing a cDNA copy of the viral gene segment under the control of RNA polymerase I promoter (pol1) and termination (t1) signals – herein referred to as Flu PCR amplicons. Transfection of tissue culture cells with either HA or NA Flu PCR amplicons and 7 plasmids encoding the remaining influenza RG units, resulted in efficient virus rescue. Likewise, transfections including both HA and NA Flu PCR amplicons and 6 RG plasmids also resulted in efficient virus rescue. In addition, influenza viruses were recovered from a full set of Flu PCR amplicons without the use of plasmids. PMID:23029501

  8. Single base pair mutation analysis by PNA directed PCR clamping

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  9. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design.

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-11-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from 29.9% to 37.8%. Copyright © 2014. Published by Elsevier B.V.

  10. Monitoring Methanotrophic Bacteria in Hybrid Anaerobic-Aerobic Reactors with PCR and a Catabolic Gene Probe

    Miguez, Carlos B.; Shen, Chun F.; Bourque, Denis; Guiot, Serge R.; Groleau, Denis

    1999-01-01

    We attempted to mimic in small upflow anaerobic sludge bed (UASB) bioreactors the metabolic association found in nature between methanogens and methanotrophs. UASB bioreactors were inoculated with pure cultures of methanotrophs, and the bioreactors were operated by using continuous low-level oxygenation in order to favor growth and/or survival of methanotrophs. Unlike the reactors in other similar studies, the hybrid anaerobic-aerobic bioreactors which we used were operated synchronously, not sequentially. Here, emphasis was placed on monitoring various methanotrophic populations by using classical methods and also a PCR amplification assay based on the mmoX gene fragment of the soluble methane monooxygenase (sMMO). The following results were obtained: (i) under the conditions used, Methylosinus sporium appeared to survive better than Methylosinus trichosporium; (ii) the PCR method which we used could detect as few as about 2,000 sMMO gene-containing methanotrophs per g (wet weight) of granular sludge; (iii) inoculation of the bioreactors with pure cultures of methanotrophs contributed greatly to increases in the sMMO-containing population (although the sMMO-containing population decreased gradually with time, at the end of an experiment it was always at least 2 logs larger than the initial population before inoculation); (iv) in general, there was a good correlation between populations with the sMMO gene and populations that exhibited sMMO activity; and (v) inoculation with sMMO-positive cultures helped increase significantly the proportion of sMMO-positive methanotrophs in reactors, even after several weeks of operation under various regimes. At some point, anaerobic-aerobic bioreactors like those described here might be used for biodegradation of various chlorinated pollutants. PMID:9925557

  11. Evaluation of Housekeeping Genes for Quantitative Real-Time PCR Analysis of Bradysia odoriphaga (Diptera: Sciaridae

    Caihua Shi

    2016-07-01

    Full Text Available The soil insect Bradysia odoriphaga (Diptera: Sciaridae causes substantial damage to Chinese chive. Suitable reference genes in B. odoriphaga (Bradysia odoriphaga have yet to be identified for normalizing target gene expression among samples by quantitative real-time PCR (qRT-PCR. This study was focused on identifying the expression stability of 12 candidate housekeeping genes in B. odoriphaga under various experiment conditions. The final stability ranking of 12 housekeeping genes was obtained with RefFinder, and the most suitable number of reference genes was analyzed by GeNorm. The results revealed that the most appropriate sets of internal controls were RPS15, RPL18, and RPS18 across developmental phases; RPS15, RPL28, and GAPDH across temperatures; RPS15 and RPL18 across pesticide treatments; RSP5, RPS18, and SDHA across photoperiods; ACTb, RPS18, and RPS15 across diets; RPS13 and RPL28 across populations; and RPS15, ACTb, and RPS18 across all samples. The use of the most suitable reference genes versus an arbitrarily selected reference gene resulted in significant differences in the analysis of a target gene expression. HSP23 in B. odoriphaga was found to be up-regulated under low temperatures. These results will contribute to the standardization of qRT-PCR and will also be valuable for further research on gene function in B. odoriphaga.

  12. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  13. Cloning and evaluation of reference genes for quantitative real-time PCR analysis in Amorphophallus

    Kai Wang

    2017-04-01

    Full Text Available Quantitative real-time reverse transcription PCR (RT-qPCR has been widely used in the detection and quantification of gene expression levels because of its high accuracy, sensitivity, and reproducibility as well as its large dynamic range. However, the reliability and accuracy of RT-qPCR depends on accurate transcript normalization using stably expressed reference genes. Amorphophallus is a perennial plant with a high content of konjac glucomannan (KGM in its corm. This crop has been used as a food source and as a traditional medicine for thousands of years. Without adequate knowledge of gene expression profiles, there has been no report of validated reference genes in Amorphophallus. In this study, nine genes that are usually used as reference genes in other crops were selected as candidate reference genes. These putative sequences of these genes Amorphophallus were cloned by the use of degenerate primers. The expression stability of each gene was assessed in different tissues and under two abiotic stresses (heat and waterlogging in A. albus and A. konjac. Three distinct algorithms were used to evaluate the expression stability of the candidate reference genes. The results demonstrated that EF1-a, EIF4A, H3 and UBQ were the best reference genes under heat stress in Amorphophallus. Furthermore, EF1-a, EIF4A, TUB, and RP were the best reference genes in waterlogged conditions. By comparing different tissues from all samples, we determined that EF1-α, EIF4A, and CYP were stable in these sets. In addition, the suitability of these reference genes was confirmed by validating the expression of a gene encoding the small heat shock protein SHSP, which is related to heat stress in Amorphophallus. In sum, EF1-α and EIF4A were the two best reference genes for normalizing mRNA levels in different tissues and under various stress treatments, and we suggest using one of these genes in combination with 1 or 2 reference genes associated with different

  14. Nilai Diagnostik Metode “Real Time” PCR GeneXpert pada TB Paru BTA Negatif

    Eka Kurniawan

    2016-09-01

    Full Text Available  AbstrakTuberkulosis (TB paru adalah penyakit menular yang disebabkan oleh kuman Mycobacterium tuberkulosis. TB masih tetap menjadi masalah kesehatan dunia karena lebih kurang 1/3 penduduk dunia terinfeksi oleh kuman ini dan sumber penularannya berasal dari Basil Tahan Asam (BTA positif maupun negatif. TB paru BTA negatif didiagnosis berdasarkan gambaran klinis dan rontgen torak yang sesuai TB serta pertimbangan dokter sehingga hal ini dapat menimbulkan under atau over diagnosis TB. GeneXpert merupakan pemeriksaan molekuler dengan metode “real time“ PCR dan merupakan penemuan terobosan untuk mendiagnosis TB secara cepat. Tujuan penelitiian ini adalah melakukan penilaian validitas GeneXpert pada TB paru BTA negatif dibandingkan dengan kultur Loweinstein Jensen. Desain penelitian uji diagnostik ini adalah cross sectional study. Penelitian dilakukan terhadap 40 orang pasien TB paru BTA negatif di Puskesmas sekitar kota Padang dan pasien yang dirawat di Bagian Penyakit Dalam RS dr. M. Djamil Padang. Dilakukan pemeriksaan sputum dengan GeneXpert dan dibandingkan dengan kultur Loweinstein Jensen. Hasil uji diagnostik dengan GeneXpert untuk mendiagnosis TB paru BTA negatif didapatkan sensitivitas 83.33%, spesifisitas 95.46%, nilai prediksi positif 93.75%, nilai prediksi negatif 87.5% dan akurasi 90% serta hasil uji kappa didapatkan 0.796. Disimpulkan GeneXpert memiliki sensitivitas, spesifisitas, nilai prediksi positif, nilai prediksi negatif dan akurasi yang tinggi pada TB paru BTA negatif.Kata kunci: nilai diagnostik, TB paru BTA negatif, GeneXpert AbstractPulmonary tuberculosis is an infectious disease caused by Mycobacterium tuberculosis. TB is still a global health problem. Approximately one third of the world population is infected by Mycobacterium tuberculosis and the source of infection came from smear positive and negative patient. Smear negative pulmonary TB can be considered based on clinical symptom and chest x-ray as well as

  15. Novel reference genes for quantifying transcriptional responses of Escherichia coli to protein overexpression by quantitative PCR

    Zou Ruiyang

    2011-04-01

    Full Text Available Abstract Background Accurate interpretation of quantitative PCR (qPCR data requires normalization using constitutively expressed reference genes. Ribosomal RNA is often used as a reference gene for transcriptional studies in E. coli. However, the choice of reliable reference genes has not been systematically validated. The objective of this study is to identify a set of reliable reference genes for transcription analysis in recombinant protein over-expression studies in E. coli. Results In this study, the meta-analysis of 240 sets of single-channel Affymetrix microarray data representing over-expressions of 63 distinct recombinant proteins in various E. coli strains identified twenty candidate reference genes that were stably expressed across all conditions. The expression of these twenty genes and two commonly used reference genes, rrsA encoding ribosomal RNA 16S and ihfB, was quantified by qPCR in E. coli cells over-expressing four genes of the 1-Deoxy-D-Xylulose 5-Phosphate pathway. From these results, two independent statistical algorithms identified three novel reference genes cysG, hcaT, and idnT but not rrsA and ihfB as highly invariant in two E. coli strains, across different growth temperatures and induction conditions. Transcriptomic data normalized by the geometric average of these three genes demonstrated that genes of the lycopene synthetic pathway maintained steady expression upon enzyme overexpression. In contrast, the use of rrsA or ihfB as reference genes led to the mis-interpretation that lycopene pathway genes were regulated during enzyme over-expression. Conclusion This study identified cysG/hcaT/idnT to be reliable novel reference genes for transcription analysis in recombinant protein producing E. coli.

  16. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

    Rho, Hyun-Wook; Lee, Byoung-Chan; Choi, Eun-Seok; Choi, Il-Ju; Lee, Yeon-Su; Goh, Sung-Ho

    2010-01-01

    Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. We assessed the suitability of six possible reference genes, beta-actin (ACTB), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyl transferase 1 (HPRT1), beta-2-microglobulin (B2M), ribosomal subunit L29 (RPL29) and 18S ribosomal RNA (18S rRNA) in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. This RT-qPCR study showed that there are statistically significant (p < 0.05) differences in the expression levels of HPRT1 and 18S rRNA in 'normal-' versus 'tumor stomach tissues'. The stability analyses by geNorm suggest B2M-GAPDH, as best reference gene combination for 'stomach cancer cell lines'; RPL29-HPRT1, for 'all stomach tissues'; and ACTB-18S rRNA, for 'all stomach cell lines and tissues'. NormFinder also identified B2M as the best reference gene for 'stomach cancer cell lines', RPL29-B2M for 'all stomach tissues', and 18S rRNA-ACTB for 'all stomach cell lines and tissues'. The comparisons of normalized expression of the target gene, GPNMB, showed different interpretation of target gene expression depend on best single reference gene or combination. This study validated RPL29 and RPL29-B2M as the best single reference

  17. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Alok Arun

    Full Text Available Real-time quantitative reverse transcription PCR (qRT-PCR is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae, two developmental stages (pupal and adult and two sexes (male and female, all of which were subjected to two food treatments (food stress and control feeding ad libitum. The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the

  18. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression

  19. Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.

    2004-01-01

    The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV

  20. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  1. Identification of pork contamination in meatball using genetic marker mitochondrial DNA cytochrome b gene by duplex-PCR

    Novianty, E.; Kartikasari, L. R.; Lee, J. H.; Cahyadi, M.

    2017-04-01

    Meat based food products have a big opportunity to mix and adulterated with other meats. Muslim communities are prohibited to consume pork-containing product or other pig derivatives in food. Therefore, the high sensitivity, fast, cheap and accurate approach is needed to detect pig contamination in raw meat and meat-processed product such as meatball. The aim of this study was to identify pork contamination in meatball using genetic marker of mitochondrial DNA cytochrome b gene by duplex-PCR. Samples were prepared and designed by following the proportions 0, 1, 5, 10, 25% of pork in meatballs, respectively. The DNA genome was extracted from meatballs and polymerase chain reaction (PCR) was performed using species specific primer to isolate mt-DNA cytochrome b gene. The results showed that the DNA genome was successfully isolated from pork, beef, and contaminated meatballs. Furthermore, 2% agarose gels was able to visualize of duplex-PCR to identify pork contamination in meatballs up to very small proportion (1%). It can be concluded that duplex-PCR of mt-DNA cytochrome b gene was very sensitive to identify pork contamination in meatball with the presence of specific 398 bp DNA band.

  2. Selection of Suitable Reference Genes for Quantitative Real-time PCR in Sapium sebiferum

    Xue Chen

    2017-05-01

    Full Text Available Chinese tallow (Sapium sebiferum L. is a promising landscape and bioenergy plant. Measuring gene expression by quantitative real-time polymerase chain reaction (qRT-PCR can provide valuable information on gene function. Stably expressed reference genes for normalization are a prerequisite for ensuring the accuracy of the target gene expression level among different samples. However, the reference genes in Chinese tallow have not been systematically validated. In this study, 12 candidate reference genes (18S, GAPDH, UBQ, RPS15, SAND, TIP41, 60S, ACT7, PDF2, APT, TBP, and TUB were investigated with qRT-PCR in 18 samples, including those from different tissues, from plants treated with sucrose and cold stresses. The data were calculated with four common algorithms, geNorm, BestKeeper, NormFinder, and the delta cycle threshold (ΔCt. TIP41 and GAPDH were the most stable for the tissue-specific experiment, GAPDH and 60S for cold treatment, and GAPDH and UBQ for sucrose stresses, while the least stable genes were 60S, TIP41, and 18S respectively. The comprehensive results showed APT, GAPDH, and UBQ to be the top-ranked stable genes across all the samples. The stability of 60S was the lowest during all experiments. These selected reference genes were further validated by comparing the expression profiles of the chalcone synthase gene in Chinese tallow in different samples. The results will help to improve the accuracy of gene expression studies in Chinese tallow.

  3. Evaluation of candidate reference genes for gene expression normalization in Brassica juncea using real time quantitative RT-PCR.

    Ruby Chandna

    Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.

  4. Comprehensive evaluation of candidate reference genes for gene expression studies in Lysiphlebia japonica (Hymenoptera: Aphidiidae) using RT-qPCR.

    Gao, Xue-Ke; Zhang, Shuai; Luo, Jun-Yu; Wang, Chun-Yi; Lü, Li-Min; Zhang, Li-Juan; Zhu, Xiang-Zhen; Wang, Li; Lu, Hui; Cui, Jin-Jie

    2017-12-30

    Lysiphlebia japonica (Ashmead) is a predominant parasitoid of cotton-melon aphids in the fields of northern China with a proven ability to effectively control cotton aphid populations in early summer. For accurate normalization of gene expression in L. japonica using quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR), reference genes with stable gene expression patterns are essential. However, no appropriate reference genes is L. japonica have been investigated to date. In the present study, 12 selected housekeeping genes from L. japonica were cloned. We evaluated the stability of these genes under various experimental treatments by RT-qPCR using four independent (geNorm, NormFinder, BestKeeper and Delta Ct) and one comparative (RefFinder) algorithm. We identified genes showing the most stable levels of expression: DIMT, 18S rRNA, and RPL13 during different stages; AK, RPL13, and TBP among sexes; EF1A, PPI, and RPL27 in different tissues, and EF1A, RPL13, and PPI in adults fed on different diets. Moreover, the expression profile of a target gene (odorant receptor 1, OR1) studied during the developmental stages confirms the reliability of the chosen selected reference genes. This study provides for the first time a comprehensive list of suitable reference genes for gene expression studies in L. japonica and will benefit subsequent genomics and functional genomics research on this natural enemy. Copyright © 2017. Published by Elsevier B.V.

  5. Selection of reference genes for quantitative RT-PCR (RT-qPCR) analysis of rat tissues under physiological and toxicological conditions

    Svingen, Terje; Letting, Heidi; Hadrup, Niels

    2015-01-01

    In biological research the analysis of gene expression levels in cells and tissues can be a powerful tool to gain insights into biological processes. For this, quantitative RT-PCR (RT-qPCR) is a popular method that often involve the use of constitutively expressed endogenous reference (or...... ‘housekeeping’) gene for normalization of data. Thus, it is essential to use reference genes that have been verified to be stably expressed within the specific experimental setting. Here, we have analysed the expression stability of 12 commonly used reference genes (Actb, B2m, Gapdh, Hprt, Pgk1, Rn18s, Rpl13a...

  6. Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

    Hackett James R

    2007-08-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

  7. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

    2016-08-01

    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Selection of internal control genes for real-time quantitative PCR in ovary and uterus of sows across pregnancy.

    María Martínez-Giner

    Full Text Available BACKGROUND: Reproductive traits play a key role in pig production in order to reduce costs and increase economic returns. Among others, gene expression analyses represent a useful approach to study genetic mechanisms underlying reproductive traits in pigs. The application of reverse-transcription quantitative PCR requires the selection of appropriate reference genes, whose expression levels should not be affected by the experimental conditions, especially when comparing gene expression across different physiological stages. RESULTS: The gene expression stability of ten potential reference genes was studied by three different methods (geNorm, NormFinder and BestKeeper in ovary and uterus collected at five different physiological time points (heat, and 15, 30, 45 and 60 days of pregnancy. Although final ranking differed, the three algorithms gave very similar results. Thus, the most stable genes across time were TBP and UBC in uterus and TBP and HPRT1 in ovary, while HMBS and ACTB showed the less stable expression in uterus and ovary, respectively. When studied as a systematic effect, the reproductive stage did not significantly affect the expression of the candidate reference genes except at 30d and 60d of pregnancy, when a general drop in expression was observed in ovary. CONCLUSIONS: Based in our results, we propose the use of TBP, UBC and SDHA in uterus and TBP, GNB2L1 and HPRT1 in ovary for normalization of longitudinal expression studies using quantitative PCR in sows.

  9. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  10. Genomic GC-content affects the accuracy of 16S rRNA gene sequencing bsed microbial profiling due to PCR bias

    Laursen, Martin F.; Dalgaard, Marlene Danner; Bahl, Martin Iain

    2017-01-01

    Profiling of microbial community composition is frequently performed by partial 16S rRNA gene sequencing on benchtop platforms following PCR amplification of specific hypervariable regions within this gene. Accuracy and reproducibility of this strategy are two key parameters to consider, which may...... be influenced during all processes from sample collection and storage, through DNA extraction and PCR based library preparation to the final sequencing. In order to evaluate both the reproducibility and accuracy of 16S rRNA gene based microbial profiling using the Ion Torrent PGM platform, we prepared libraries...... be explained partly by premature read truncation, but to larger degree their genomic GC-content, which correlated negatively with the observed relative abundances, suggesting a PCR bias against GC-rich species during library preparation. Increasing the initial denaturation time during the PCR amplification...

  11. Identification of suitable reference genes for gene expression normalization in qRT-PCR analysis in watermelon.

    Qiusheng Kong

    Full Text Available Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT-PCR is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT-PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT-PCR analyses involving watermelon.

  12. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    Enan, M. R.; Bashandy, S.A.

    2006-01-01

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  13. PCR-RFLP on β-tubulin gene for rapid identification of the most clinically important species of Aspergillus.

    Nasri, Tuba; Hedayati, Mohammad Taghi; Abastabar, Mahdi; Pasqualotto, Alessandro C; Armaki, Mojtaba Taghizadeh; Hoseinnejad, Akbar; Nabili, Mojtaba

    2015-10-01

    Aspergillus species are important agents of life-threatening infections in immunosuppressed patients. Proper speciation in the Aspergilli has been justified based on varied fungal virulence, clinical presentations, and antifungal resistance. Accurate identification of Aspergillus species usually relies on fungal DNA sequencing but this requires expensive equipment that is not available in most clinical laboratories. We developed and validated a discriminative low-cost PCR-based test to discriminate Aspergillus isolates at the species level. The Beta tubulin gene of various reference strains of Aspergillus species was amplified using the universal fungal primers Bt2a and Bt2b. The PCR products were subjected to digestion with a single restriction enzyme AlwI. All Aspergillus isolates were subjected to DNA sequencing for final species characterization. The PCR-RFLP test generated unique patterns for six clinically important Aspergillus species, including Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus terreus, Aspergillus clavatus and Aspergillus nidulans. The one-enzyme PCR-RFLP on Beta tubulin gene designed in this study is a low-cost tool for the reliable and rapid differentiation of the clinically important Aspergillus species. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae.

    Meng Sun

    Full Text Available The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA, elongation factor 1 (EF1, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, ribosomal protein S13 (RPS13, ribosomal protein S20 (RPS20, tubulin (TUB, and β-actin (ACTB were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1 were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands. 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults. 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C. To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83 was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  15. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae).

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  16. [Evaluation of cytomegalovirus quantification in blood by the R-gene real-time PCR test].

    Marque-Juillet, S; Touzard, A; Monnier, S; Fernand-Laurent, C; Therby, A; Rigaudeau, S; Harzic, M

    2010-04-01

    Diagnosing the presence of cytomegalovirus (CMV) in the blood of immunodepressed patients is often done by quantitative polymerase chain reaction (Q-PCR) even though the reference method remains the antigenemia pp65 (Ag-pp65) test. To define the predictive value of the Q-PCR in the diagnosis of CMV disease and assess treatment efficacy using the CMV R-gene test. To compare the Q-PCR results and feasibility with those of the Ag-pp65 test. The Q-PCR was performed in 34 whole blood samples (frozen at -80 degrees C until use) from five patients diagnosed with CMV disease, defined as the presence of clinical signs and Ag-pp65 in the nuclei of more than two cells. After extraction, viral DNA was quantified in each sample using the Q-PCR CMV R-gene kit according to the manufacturer's instructions. Immediately after blood was drawn, the Ag-pp65 test had been performed in 32 samples using CINAkit (Argene). The 16 samples positive by the Ag-pp65 test were also positive by PCR; six samples negative by the Ag-pp65 test were positive by PCR; and the remaining 10 samples were negative by both techniques. During treatment, the two markers' kinetics were similar. The CMV R-gene test has a predictive value as good as that of the Ag-pp65 test but is fast and easier to use. A prospective study with a greater number of patients is needed to define the prediction threshold for CMV disease. Copyright 2009 Elsevier Masson SAS. All rights reserved.

  17. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

    Borges-Pérez Andrés

    2008-12-01

    Full Text Available Abstract Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC, SGN-U321250 (TIP41, SGN-U346908 ("Expressed" and SGN-U316474 (SAND genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real

  18. RPE65 gene: multiplex PCR and mutation screening in patients from ...

    Unknown

    The RPE65 protein is believed to play an important role in the metabolism of vitamin A in the ... PCR and mutation screening in patients from India with retinal degenerative diseases. ..... Bennett J. 2001 Gene therapy restores vision in a canine.

  19. Detection of Legionella pneumophila by real-time PCR for the mip gene.

    Wilson, Deborah A; Yen-Lieberman, Belinda; Reischl, Udo; Gordon, Steve M; Procop, Gary W

    2003-07-01

    A real-time PCR assay for the mip gene of Legionella pneumophila was tested with 27 isolates of L. pneumophila, 20 isolates of 14 other Legionella species, and 103 non-Legionella bacteria. Eight culture-positive and 40 culture-negative clinical specimens were tested. This assay was 100% sensitive and 100% specific for L. pneumophila.

  20. Identification of Reference Genes for RT-qPCR Data Normalization in Cannabis sativa Stem Tissues

    Lauralie Mangeot-Peter

    2016-09-01

    Full Text Available Gene expression profiling via quantitative real-time PCR is a robust technique widely used in the life sciences to compare gene expression patterns in, e.g., different tissues, growth conditions, or after specific treatments. In the field of plant science, real-time PCR is the gold standard to study the dynamics of gene expression and is used to validate the results generated with high throughput techniques, e.g., RNA-Seq. An accurate relative quantification of gene expression relies on the identification of appropriate reference genes, that need to be determined for each experimental set-up used and plant tissue studied. Here, we identify suitable reference genes for expression profiling in stems of textile hemp (Cannabis sativa L., whose tissues (isolated bast fibres and core are characterized by remarkable differences in cell wall composition. We additionally validate the reference genes by analysing the expression of putative candidates involved in the non-oxidative phase of the pentose phosphate pathway and in the first step of the shikimate pathway. The goal is to describe the possible regulation pattern of some genes involved in the provision of the precursors needed for lignin biosynthesis in the different hemp stem tissues. The results here shown are useful to design future studies focused on gene expression analyses in hemp.

  1. Identification of Reference Genes for RT-qPCR Data Normalization in Cannabis sativa Stem Tissues.

    Mangeot-Peter, Lauralie; Legay, Sylvain; Hausman, Jean-Francois; Esposito, Sergio; Guerriero, Gea

    2016-09-15

    Gene expression profiling via quantitative real-time PCR is a robust technique widely used in the life sciences to compare gene expression patterns in, e.g., different tissues, growth conditions, or after specific treatments. In the field of plant science, real-time PCR is the gold standard to study the dynamics of gene expression and is used to validate the results generated with high throughput techniques, e.g., RNA-Seq. An accurate relative quantification of gene expression relies on the identification of appropriate reference genes, that need to be determined for each experimental set-up used and plant tissue studied. Here, we identify suitable reference genes for expression profiling in stems of textile hemp (Cannabis sativa L.), whose tissues (isolated bast fibres and core) are characterized by remarkable differences in cell wall composition. We additionally validate the reference genes by analysing the expression of putative candidates involved in the non-oxidative phase of the pentose phosphate pathway and in the first step of the shikimate pathway. The goal is to describe the possible regulation pattern of some genes involved in the provision of the precursors needed for lignin biosynthesis in the different hemp stem tissues. The results here shown are useful to design future studies focused on gene expression analyses in hemp.

  2. Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

    Javad Mohammadi

    2017-06-01

    Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

  3. Selection of reference genes for qRT-PCR analysis of gene expression in sea cucumber Apostichopus japonicus during aestivation

    Zhao, Ye; Chen, Muyan; Wang, Tianming; Sun, Lina; Xu, Dongxue; Yang, Hongsheng

    2014-11-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a technique that is widely used for gene expression analysis, and its accuracy depends on the expression stability of the internal reference genes used as normalization factors. However, many applications of qRT-PCR used housekeeping genes as internal controls without validation. In this study, the expression stability of eight candidate reference genes in three tissues (intestine, respiratory tree, and muscle) of the sea cucumber Apostichopus japonicus was assessed during normal growth and aestivation using the geNorm, NormFinder, delta CT, and RefFinder algorithms. The results indicate that the reference genes exhibited significantly different expression patterns among the three tissues during aestivation. In general, the β-tubulin (TUBB) gene was relatively stable in the intestine and respiratory tree tissues. The optimal reference gene combination for intestine was 40S ribosomal protein S18 (RPS18), TUBB, and NADH dehydrogenase (NADH); for respiratory tree, it was β-actin (ACTB), TUBB, and succinate dehydrogenase cytochrome B small subunit (SDHC); and for muscle it was α-tubulin (TUBA) and NADH dehydrogenase [ubiquinone] 1 α subcomplex subunit 13 (NDUFA13). These combinations of internal control genes should be considered for use in further studies of gene expression in A. japonicus during aestivation.

  4. A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic

    Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.

    2007-01-01

    Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.

  5. Reference gene identification for reliable normalisation of quantitative RT-PCR data in Setaria viridis.

    Nguyen, Duc Quan; Eamens, Andrew L; Grof, Christopher P L

    2018-01-01

    Quantitative real-time polymerase chain reaction (RT-qPCR) is the key platform for the quantitative analysis of gene expression in a wide range of experimental systems and conditions. However, the accuracy and reproducibility of gene expression quantification via RT-qPCR is entirely dependent on the identification of reliable reference genes for data normalisation. Green foxtail ( Setaria viridis ) has recently been proposed as a potential experimental model for the study of C 4 photosynthesis and is closely related to many economically important crop species of the Panicoideae subfamily of grasses, including Zea mays (maize), Sorghum bicolor (sorghum) and Sacchurum officinarum (sugarcane). Setaria viridis (Accession 10) possesses a number of key traits as an experimental model, namely; (i) a small sized, sequenced and well annotated genome; (ii) short stature and generation time; (iii) prolific seed production, and; (iv) is amendable to Agrobacterium tumefaciens -mediated transformation. There is currently however, a lack of reference gene expression information for Setaria viridis ( S. viridis ). We therefore aimed to identify a cohort of suitable S. viridis reference genes for accurate and reliable normalisation of S. viridis RT-qPCR expression data. Eleven putative candidate reference genes were identified and examined across thirteen different S. viridis tissues. Of these, the geNorm and NormFinder analysis software identified SERINE / THERONINE - PROTEIN PHOSPHATASE 2A ( PP2A ), 5 '- ADENYLYLSULFATE REDUCTASE 6 ( ASPR6 ) and DUAL SPECIFICITY PHOSPHATASE ( DUSP ) as the most suitable combination of reference genes for the accurate and reliable normalisation of S. viridis RT-qPCR expression data. To demonstrate the suitability of the three selected reference genes, PP2A , ASPR6 and DUSP , were used to normalise the expression of CINNAMYL ALCOHOL DEHYDROGENASE ( CAD ) genes across the same tissues. This approach readily demonstrated the suitably of the three

  6. A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi.

    Kanako Komaki-Yasuda

    Full Text Available A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.

  7. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... is comparable to typing of other H. pylori urease genes....

  8. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments.

    Ganger, Michael T; Dietz, Geoffrey D; Ewing, Sarah J

    2017-12-01

    qPCR has established itself as the technique of choice for the quantification of gene expression. Procedures for conducting qPCR have received significant attention; however, more rigorous approaches to the statistical analysis of qPCR data are needed. Here we develop a mathematical model, termed the Common Base Method, for analysis of qPCR data based on threshold cycle values (C q ) and efficiencies of reactions (E). The Common Base Method keeps all calculations in the logscale as long as possible by working with log 10 (E) ∙ C q , which we call the efficiency-weighted C q value; subsequent statistical analyses are then applied in the logscale. We show how efficiency-weighted C q values may be analyzed using a simple paired or unpaired experimental design and develop blocking methods to help reduce unexplained variation. The Common Base Method has several advantages. It allows for the incorporation of well-specific efficiencies and multiple reference genes. The method does not necessitate the pairing of samples that must be performed using traditional analysis methods in order to calculate relative expression ratios. Our method is also simple enough to be implemented in any spreadsheet or statistical software without additional scripts or proprietary components.

  9. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses.

    Dongli Wan

    Full Text Available Stipa grandis P. Smirn. is a dominant plant species in the typical steppe of the Xilingole Plateau of Inner Mongolia. Selection of suitable reference genes for the quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR is important for gene expression analysis and research into the molecular mechanisms underlying the stress responses of S. grandis. In the present study, 15 candidate reference genes (EF1 beta, ACT, GAPDH, SamDC, CUL4, CAP, SNF2, SKIP1, SKIP5, SKIP11, UBC2, UBC15, UBC17, UCH, and HERC2 were evaluated for their stability as potential reference genes for qRT-PCR under different stresses. Four algorithms were used: GeNorm, NormFinder, BestKeeper, and RefFinder. The results showed that the most stable reference genes were different under different stress conditions: EF1beta and UBC15 during drought and salt stresses; ACT and GAPDH under heat stress; SKIP5 and UBC17 under cold stress; UBC15 and HERC2 under high pH stress; UBC2 and UBC15 under wounding stress; EF1beta and UBC17 under jasmonic acid treatment; UBC15 and CUL4 under abscisic acid treatment; and HERC2 and UBC17 under salicylic acid treatment. EF1beta and HERC2 were the most suitable genes for the global analysis of all samples. Furthermore, six target genes, SgPOD, SgPAL, SgLEA, SgLOX, SgHSP90 and SgPR1, were selected to validate the most and least stable reference genes under different treatments. Our results provide guidelines for reference gene selection for more accurate qRT-PCR quantification and will promote studies of gene expression in S. grandis subjected to environmental stress.

  10. Characterizing bacterial gene expression in nitrogen cycle metabolism with RT-qPCR.

    Graham, James E; Wantland, Nicholas B; Campbell, Mark; Klotz, Martin G

    2011-01-01

    Recent advances in DNA sequencing have greatly accelerated our ability to obtain the raw information needed to recognize both known and potential novel modular microbial genomic capacity for nitrogen metabolism. With PCR-based approaches to quantifying microbial mRNA expression now mainstream in most laboratories, researchers can now more efficiently propose and test hypotheses on the contributions of individual microbes to the biological accessibility of nitrogen upon which all other life depends. We review known microbial roles in these key nitrogen transformations, and describe the necessary steps in carrying out relevant gene expression studies. An example experimental design is then provided characterizing Nitrosococcus oceani mRNA expression in cultures responding to ammonia. The approach described, that of assessing microbial genome inventory and testing putative modular gene expression by mRNA quantification, is likely to remain an important tool in understanding individual microbial contributions within microbial community activities that maintain the Earth's nitrogen balance. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

    Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

    2001-07-01

    Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

  12. Identification of potential internal control genes for real-time PCR analysis during stress response in Pyropia haitanensis

    Wang, Xia; Feng, Jianhua; Huang, Aiyou; He, Linwen; Niu, Jianfeng; Wang, Guangce

    2017-11-01

    Pyropia haitanensis has prominent stress-resistance characteristics and is endemic to China. Studies into the stress responses in these algae could provide valuable information on the stress-response mechanisms in the intertidal Rhodophyta. Here, the effects of salinity and light intensity on the quantum yield of photosystem II in Py. haitanensis were investigated using pulse-amplitude-modulation fluorometry. Total RNA and genomic DNA of the samples under different stress conditions were isolated. By normalizing to the genomic DNA quantity, the RNA content in each sample was evaluated. The cDNA was synthesized and the expression levels of seven potential internal control genes were evaluated using qRT-PCR method. Then, we used geNorm, a common statistical algorithm, to analyze the qRT-PCR data of seven reference genes. Potential genes that may constantly be expressed under different conditions were selected, and these genes showed stable expression levels in samples under a salinity treatment, while tubulin, glyceraldehyde-3-phosphate dehydrogenase and actin showed stability in samples stressed by strong light. Based on the results of the pulse amplitude-modulation fluorometry, an absolute quantification was performed to obtain gene copy numbers in certain stress-treated samples. The stably expressed genes as determined by the absolute quantification in certain samples conformed to the results of the geNorm screening. Based on the results of the software analysis and absolute quantification, we proposed that elongation factor 3 and 18S ribosomal RNA could be used as internal control genes when the Py. haitanensis blades were subjected to salinity stress, and that α-tubulin and 18S ribosomal RNA could be used as the internal control genes when the stress was from strong light. In general, our findings provide a convenient reference for the selection of internal control genes when designing experiments related to stress responses in Py. haitanensis.

  13. Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

    Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

    2013-01-01

    Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

  14. Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

    Huali Huang

    Full Text Available Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L. DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

  15. Evaluation of Four Endogenous Reference Genes and Their Real-Time PCR Assays for Common Wheat Quantification in GMOs Detection

    Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

    2013-01-01

    Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat. PMID:24098735

  16. PCR-based techniques for leprosy diagnosis: from the laboratory to the clinic.

    Alejandra Nóbrega Martinez

    2014-04-01

    Full Text Available In leprosy, classic diagnostic tools based on bacillary counts and histopathology have been facing hurdles, especially in distinguishing latent infection from active disease and diagnosing paucibacillary clinical forms. Serological tests and IFN-gamma releasing assays (IGRA that employ humoral and cellular immune parameters, respectively, are also being used, but recent results indicate that quantitative PCR (qPCR is a key technique due to its higher sensitivity and specificity. In fact, advances concerning the structure and function of the Mycobacterium leprae genome led to the development of specific PCR-based gene amplification assays for leprosy diagnosis and monitoring of household contacts. Also, based on the validation of point-of-care technologies for M. tuberculosis DNA detection, it is clear that the same advantages of rapid DNA detection could be observed in respect to leprosy. So far, PCR has proven useful in the determination of transmission routes, M. leprae viability, and drug resistance in leprosy. However, PCR has been ascertained to be especially valuable in diagnosing difficult cases like pure neural leprosy (PNL, paucibacillary (PB, and patients with atypical clinical presentation and histopathological features compatible with leprosy. Also, the detection of M. leprae DNA in different samples of the household contacts of leprosy patients is very promising. Although a positive PCR result is not sufficient to establish a causal relationship with disease outcome, quantitation provided by qPCR is clearly capable of indicating increased risk of developing the disease and could alert clinicians to follow these contacts more closely or even define rules for chemoprophylaxis.

  17. Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

    Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

    2017-11-01

    Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  18. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

    D'Souza, T M; Boominathan, K; Reddy, C A

    1996-01-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

  19. Early diagnosis of typhoid fever by nested PCR for flagellin gene of Salmonella enterica serotype Typhi.

    Khan, S; Harish, B N; Menezes, G A; Acharya, N S; Parija, S C

    2012-11-01

    Typhoid fever caused by Salmonella Typhi continues to be a major health problem in spite of the use of antibiotics and the development of newer antibacterial drugs. Inability to make an early laboratory diagnosis and resort to empirical therapy, often lead to increased morbidity and mortality in cases of typhoid fever. This study was aimed to optimize a nested PCR for early diagnosis of typhoid fever and using it as a diagnostic tool in culture negative cases of suspected typhoid fever. Eighty patients with clinical diagnosis of typhoid fever and 40 controls were included in the study. The blood samples collected were subjected to culture, Widal and nested PCR targeting the flagellin gene of S. Typhi. The sensitivity of PCR on blood was found to be 100 per cent whereas the specificity was 76.9 per cent. The positive predictive value (PPV) of PCR was calculated to be 76.9 per cent with an accuracy of 86 per cent. None of the 40 control samples gave a positive PCR. Due to its high sensitivity and specificity nested PCR can be used as a useful tool to diagnose clinically suspected, culture negative cases of typhoid fever.

  20. PCR and RFLP analyses based on the ribosomal protein operon

    Differentiation and classification of phytoplasmas have been primarily based on the highly conserved 16Sr RNA gene. RFLP analysis of 16Sr RNA gene sequences has identified 31 16Sr RNA (16Sr) groups and more than 100 16Sr subgroups. Classification of phytoplasma strains can however, become more refin...

  1. Cry-Bt identifier: a biological database for PCR detection of Cry genes present in transgenic plants.

    Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil

    2009-10-23

    We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.

  2. Evaluation of reference genes for RT-qPCR study in abalone Haliotis discus hannai during heavy metal overload stress

    Sang Yoon Lee

    2016-06-01

    Full Text Available Abstract Background The evaluation of suitable reference genes as normalization controls is a prerequisite requirement for launching quantitative reverse transcription-PCR (RT-qPCR-based expression study. In order to select the stable reference genes in abalone Haliotis discus hannai tissues (gill and hepatopancreas under heavy metal exposure conditions (Cu, Zn, and Cd, 12 potential candidate housekeeping genes were subjected to expression stability based on the comprehensive ranking while integrating four different statistical algorithms (geNorm, NormFinder, BestKeeper, and ΔCT method. Results Expression stability in the gill subset was determined as RPL7 > RPL8 > ACTB > RPL3 > PPIB > RPL7A > EF1A > RPL4 > GAPDH > RPL5 > UBE2 > B-TU. On the other hand, the ranking in the subset for hepatopancreas was RPL7 > RPL3 > RPL8 > ACTB > RPL4 > EF1A > RPL5 > RPL7A > B-TU > UBE2 > PPIB > GAPDH. The pairwise variation assessed by the geNorm program indicates that two reference genes could be sufficient for accurate normalization in both gill and hepatopancreas subsets. Overall, both gill and hepatopancreas subsets recommended ribosomal protein genes (particularly RPL7 as stable references, whereas traditional housekeepers such as β-tubulin (B-TU and glyceraldehyde-3-phosphate dehydrogenase (GAPDH genes were ranked as unstable genes. The validation of reference gene selection was confirmed with the quantitative assay of MT transcripts. Conclusions The present analysis showed the importance of validating reference genes with multiple algorithmic approaches to select genes that are truly stable. Our results indicate that expression stability of a given reference gene could not always have consensus across tissue types. The data from this study could be a good guide for the future design of RT-qPCR studies with respect to metal regulation/detoxification and other related

  3. Selection of reference genes for quantitative real-time PCR in bovine preimplantation embryos

    Van Zeveren Alex

    2005-12-01

    Full Text Available Abstract Background Real-time quantitative PCR is a sensitive and very efficient technique to examine gene transcription patterns in preimplantation embryos, in order to gain information about embryo development and to optimize assisted reproductive technologies. Critical to the succesful application of real-time PCR is careful assay design, reaction optimization and validation to maximize sensitivity and accuracy. In most of the studies published GAPD, ACTB or 18S rRNA have been used as a single reference gene without prior verification of their expression stability. Normalization of the data using unstable controls can result in erroneous conclusions, especially when only one reference gene is used. Results In this study the transcription levels of 8 commonly used reference genes (ACTB, GAPD, Histone H2A, TBP, HPRT1, SDHA, YWHAZ and 18S rRNA were determined at different preimplantation stages (2-cell, 8-cell, blastocyst and hatched blastocyst in order to select the most stable genes to normalize quantitative data within different preimplantation embryo stages. Conclusion Using the geNorm application YWHAZ, GAPD and SDHA were found to be the most stable genes across the examined embryonic stages, while the commonly used ACTB was shown to be highly regulated. We recommend the use of the geometric mean of those 3 reference genes as an accurate normalization factor, which allows small expression differences to be reliably measured.

  4. Expression Stabilities of Ten Candidate Reference Genes for RT-qPCR in Zanthoxylum bungeanum Maxim.

    Fei, Xitong; Shi, Qianqian; Yang, Tuxi; Fei, Zhaoxue; Wei, Anzhi

    2018-03-30

    Real-time reverse transcription quantitative PCR has become a common method for studying gene expression, however, the optimal selection of stable reference genes is a prerequisite for obtaining accurate quantification of transcript abundance. Suitable reference genes for RT-qPCR have not yet been identified for Chinese prickly ash ( Zanthoxylum bungeanum Maxim.). Chinese prickly ash is the source of an important food seasoning in China. In recent years, Chinese prickly ash has also been developed as a medicinal plant. The expression stabilities of ten genes ( 18S , 28S , EF , UBA , UBQ , TIF , NTB , TUA , RPS , and TIF5A ) were evaluated in roots, stems, leaves, flowers and fruits at five developmental stages and also under stress from cold, drought, and salt. To do this we used three different statistical algorithms: geNorm, NormFinder and BestKeeper. Among the genes investigated, UBA and UBQ were found to be most stable for the different cultivars and different tissues examined, UBQ and TIF for fruit developmental stage. Meanwhile, EF and TUA were most stable under cold treatment, EF and UBQ under drought treatment and NTB and RPS under salt treatment. UBA and UBQ for all samples evaluated were most stably expressed, but 18S , TUA and RPS were found to be generally unreliable as reference genes. Our results provide a basis for the future selection of reference genes for biological research with Chinese prickly ash, under a variety of conditions.

  5. Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.

    Yu, Guoqin; Fadrosh, Doug; Goedert, James J; Ravel, Jacques; Goldstein, Alisa M

    2015-01-01

    Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon's index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (Pnested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance 27% of total OTUs in stool). Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by nested PCR should be validated by other technologies.

  6. Differentiation between spore-forming and asporogenic bacteria using a PCR and southern hybridization based method

    Brill, J.A.; Wiegel, J. [Univ. of Georgia, Athens, GA (United States)

    1997-12-31

    A set of molecular probes was devised to develop a method for screening for the presence of sequences homologous to three representative genes exclusively involved in endosporulation. Based on known gene sequences, degenerate PCR primers were designed against spo0A and ssp. Experimental conditions were devised under which homologs of both genes were consistently detected in endospore-forming bacteria, but not in asporogenic bacteria. The PCR amplification products and dpaA/B from Bacillus subtilis were used as hybridization probes for Southern blots. Identical conditions were used with the genomic DNA from endospore-forming and asporogenic bacteria. We therefore concluded that the probes specifically detect the targeted sporulation genes and we obtained no indication that genes homologous to ssp, spo0A and dpaA/B are present in asporogenic bacteria. Thus, this assay can potentially be used to detect spore-forming bacteria in various kinds of samples and to distinguish between bacteria containing sporulation genes and those who do not regardless of whether sporulation is observed or not. 43 refs., 3 figs., 1 tab.

  7. Possible gene dosage effect of glutathione-S-transferases on atopic asthma: using real-time PCR for quantification of GSTM1 and GSTT1 gene copy numbers

    Brasch-Andersen, Charlotte; Christiansen, L; Tan, Q

    2004-01-01

    -S-transferase (GST) involved in the antioxidant defense were tested for association to asthma using 246 Danish atopic families in a family-based transmission disequilibrium test (TDT) design. A real-time PCR assay for relative quantification of gene copy number of GSTM1 and GSTT1 was developed. The assay made......Asthma is a complex genetic disorder characterized by chronic inflammation in the airways. As oxidative stress is a key component of inflammation, variations in genes involved in antioxidant defense could therefore be likely candidates for asthma. Three enzymes from the superfamily glutathione...

  8. Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.

    Jamjoom, Manal; Sultan, Amal H

    2009-04-01

    The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity

  9. Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

    Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

    2016-09-01

    Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Use of amplicon sequencing to improve sensitivity in PCR-based detection of microbial pathogen in environmental samples.

    Saingam, Prakit; Li, Bo; Yan, Tao

    2018-06-01

    DNA-based molecular detection of microbial pathogens in complex environments is still plagued by sensitivity, specificity and robustness issues. We propose to address these issues by viewing them as inadvertent consequences of requiring specific and adequate amplification (SAA) of target DNA molecules by current PCR methods. Using the invA gene of Salmonella as the model system, we investigated if next generation sequencing (NGS) can be used to directly detect target sequences in false-negative PCR reaction (PCR-NGS) in order to remove the SAA requirement from PCR. False-negative PCR and qPCR reactions were first created using serial dilutions of laboratory-prepared Salmonella genomic DNA and then analyzed directly by NGS. Target invA sequences were detected in all false-negative PCR and qPCR reactions, which lowered the method detection limits near the theoretical minimum of single gene copy detection. The capability of the PCR-NGS approach in correcting false negativity was further tested and confirmed under more environmentally relevant conditions using Salmonella-spiked stream water and sediment samples. Finally, the PCR-NGS approach was applied to ten urban stream water samples and detected invA sequences in eight samples that would be otherwise deemed Salmonella negative. Analysis of the non-target sequences in the false-negative reactions helped to identify primer dime-like short sequences as the main cause of the false negativity. Together, the results demonstrated that the PCR-NGS approach can significantly improve method sensitivity, correct false-negative detections, and enable sequence-based analysis for failure diagnostics in complex environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Identification of Acinetobacter baumannii of Human and Animal Origins by a Gene-Specific PCR.

    Hamouda, Ahmed

    2017-09-01

    Acinetobacter baumannii is a notorious nosocomial pathogen known for its ability to cause severe infections, especially in intensive care units. The identification of a conserved gene encoding a hypothetical protein in A. baumannii isolates but not in other Acinetobacter species during a comparative genomic analysis was reported. For the purpose of this study, we call this gene, A.b_hyp gene. The aim of this study was to report the results of screening for the presence of the A.b_hyp gene in a worldwide collection of well-characterized A. baumannii collected from clinical and animal specimens. A total of 83 clinical, animal, and type strains were used. These comprised 73 A. baumannii isolates of clinical (n = 60) and animal origin (n = 13), and ten type strains, including a positive control strain, A. baumannii ATCC 19606. All isolates were examined by PCR amplification of the A.b_hyp gene. The A.b_hyp gene was detected in 72 isolates (99%) of A. baumannii but one clinical isolate failed to produce an amplicon. The control strain, A. baumannii ATCC 19606, was also positive for this gene. No bands were detected in non-A. baumannii species and therefore the isolates are thought to be negative for the gene. No bands were detected in non-A. baumannii isolates and therefore they are thought to be negative for the gene. The PCR A.b_ hyp method provides evidence that detection of this gene can be used as a reliable, easy, and low-cost biomarker for A. baumannii identification.

  12. Reference gene validation for qPCR in rat carotid body during postnatal development

    Carroll John L

    2011-10-01

    Full Text Available Abstract Background The carotid bodies are the main arterial oxygen chemoreceptors in mammals. Afferent neural output from the carotid bodies to brainstem respiratory and cardiovascular nuclei provides tonic input and mediates important protective responses to acute and chronic hypoxia. It is widely accepted that the selection of reference genes for mRNA normalization in quantitative real-time PCR must be validated for a given tissue and set of conditions. This is particularly important for studies in carotid body during early postnatal maturation as the arterial oxygen tension undergoes major changes from fetal to postnatal life, which may affect reference gene expression. In order to determine the most stable and suitable reference genes for the study of rat carotid body during development, six commonly used reference genes, β-actin, RPII (RNA polymerase II, PPIA (peptidyl-proyl-isomerase A, TBP (TATA-box binding protein, GAPDH, and 18s rRNA, were evaluated in two age groups (P0-1 and P14-16 under three environmental oxygen conditions (normoxia, chronic hypoxia and chronic hyperoxia using the three most commonly used software programs, geNorm, NormFinder and BestKeeper. Findings The three programs produced similar results but the reference gene rankings were not identical between programs or experimental conditions. Overall, 18s rRNA was the least stable reference gene for carotid body and, when hyperoxia and/or hypoxia conditions were included, actin was similarly unstable. Conclusions Reference or housekeeping gene expression for qPCR studies of carotid body during postnatal development may vary with developmental stage and environmental conditions. Selection of the best reference gene or combination of reference genes for carotid body development studies should take environmental conditions into account. Two commonly used reference genes, 18s rRNA and actin, may be unsuitable for studies of carotid body maturation, especially if the study

  13. Elasmobranch qPCR reference genes: a case study of hypoxia preconditioned epaulette sharks

    Ashton Kevin J

    2010-04-01

    Full Text Available Abstract Background Elasmobranch fishes are an ancient group of vertebrates which have high potential as model species for research into evolutionary physiology and genomics. However, no comparative studies have established suitable reference genes for quantitative PCR (qPCR in elasmobranchs for any physiological conditions. Oxygen availability has been a major force shaping the physiological evolution of vertebrates, especially fishes. Here we examined the suitability of 9 reference candidates from various functional categories after a single hypoxic insult or after hypoxia preconditioning in epaulette shark (Hemiscyllium ocellatum. Results Epaulette sharks were caught and exposed to hypoxia. Tissues were collected from 10 controls, 10 individuals with single hypoxic insult and 10 individuals with hypoxia preconditioning (8 hypoxic insults, 12 hours apart. We produced sequence information for reference gene candidates and monitored mRNA expression levels in four tissues: cerebellum, heart, gill and eye. The stability of the genes was examined with analysis of variance, geNorm and NormFinder. The best ranking genes in our study were eukaryotic translation elongation factor 1 beta (eef1b, ubiquitin (ubq and polymerase (RNA II (DNA directed polypeptide F (polr2f. The performance of the ribosomal protein L6 (rpl6 was tissue-dependent. Notably, in one tissue the analysis of variance indicated statistically significant differences between treatments for genes that were ranked as the most stable candidates by reference gene software. Conclusions Our results indicate that eef1b and ubq are generally the most suitable reference genes for the conditions and tissues in the present epaulette shark studies. These genes could also be potential reference gene candidates for other physiological studies examining stress in elasmobranchs. The results emphasise the importance of inter-group variation in reference gene evaluation.

  14. RT-qPCR normalization genes in the red alga Chondrus crispus.

    Nathalie Kowalczyk

    Full Text Available Chondrus crispus is a common red macroalga living on the rocky shores of the North Atlantic Ocean. It has a long research history, being a major source of carrageenan, a thickener widely used in the food industry, but also for physiological and ecological studies. To establish it as a model for red algae, its genome has been sequenced, allowing the development of molecular tools such as quantification of gene expression, including RNAseq and RT-qPCR. To determine appropriate genes for RT-qPCR normalization, the expression of 14 genes was monitored in 18 conditions using two sets of algal samples: samples from the sequenced strain, cultured and stressed in laboratory conditions and C. crispus collected on the shore and stressed in situ. The expression stability of the genes between the samples was evaluated by comparing the Ct range and using the programs geNorm and NormFinder. The candidate genes encoded translation related proteins (initiation factors IF4A-1 and IF4A-2, elongation factor EF1α and eRF3, an eukaryotic polypeptide chain release factor, cytoskeleton proteins (two β-tubulins, α-tubulin and actin, enzymes involved in the pentose phosphate pathway (glucose 6-phosphate deshydrogenase, protein recycling process (ubiquitin and ubiquitin-conjugating enzyme and glycolysis (isocitrate dehydrogenase. The two sets of samples showed different expression patterns. Most of the genes were stable in the algae cultivated in the laboratory, whereas environmental samples showed a more important variation in gene expression. When analyzing the two sets separately, the ranking of the most stables genes were different from one method to another. When considering all samples, the two statistical methods were concordant, revealing translation initiation factor 4A-2 and eukaryotic polypeptide chain release factor 3 as pertinent normalization genes. This study highlights thus the importance of testing reference genes according to the experiments as well

  15. Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

    Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

    1999-12-01

    A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

  16. A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.

    Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao

    2012-06-01

    Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Genotyping of the Holstein-Friesian crossbred cattle for CD18 gene using PCR-RFLP

    A. S. Khade

    2014-05-01

    Full Text Available Aim: The present study was undertaken in Holstein-Friesian (HF crossbred cattle with the objective to find out genotype of HF crossbred cattle for Bovine Leucocyte Adhesion Deficiency (BLAD by using PCR-RFLP. Materials and Methods: 50 blood samples were collected from HF crossbred cattle and subjected to PCR. The amplified PCR products were digested using Taq I restriction enzyme at 65 oC overnight. After restriction digestion, the final PCR products were electrophoresed on 2.5 % agarose gel. Results: All the 50 animals under present investigation were found to be normal as the amplified PCR product upon digestion with Taq I restriction enzyme, revealed two bands of 313 bp and 54 bp for normal animals. Conclusions: In the present investigation D128G carrier frequency was found to be 0 %. However, recent reports suggest that the mutant gene has already been observed in the HF crossbred cattle population of India, which makes it necessary to screen the animals to avoid the risk of spreading BLAD in the breeding cattle population.

  18. Genotyping of PCR-based polymorphisms and linkage-disequilibrium analysis at the NF1 locus

    Purandare, S.M.; Viskochil, D.H.; Cawthon, R. [Univ. of Utah, Salt Lake City, UT (United States)] [and others

    1996-07-01

    Six polymorphism across the NF1 gene have been adapted for genotyping through application of PCR-based assays. Three exon-based polymorphisms - at positions 702, 2034, and 10647 in the NF1 cDNA - were genotyped by mutagenically separated PCR (MS-PCR). A fourth polymorphism, DV1.9, is an L1 insertion element in intron 30, and the other two polymorphisms, GXAlu and EVI-20, are short tandem repeats in intron 27b. All the polymorphisms were evaluated in a cohort of 110 CEPH individuals who previously had been analyzed by use of eight RFLPs at the NF1 locus. Pairwise linkage-disequilibrium analyses with the six PCR-based polymorphisms and their flanking markers demonstrated disequilibrium between all tested loci. Genotypes of the four diallelic polymorphisms (702, 2034, 10647, and DV1.9) were also evaluated in cohorts from the CEPH, African, and Japanese populations. The CEPH and Japanese cohorts showed similar heterozygosities and linkage-disequilibrium coefficients. The African cohort showed a higher degree of heterozygosity and lower linkage-disequilibrium values, compared with the CEPH and Japanese cohorts. 36 refs., 2 figs., 3 tabs.

  19. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-01-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  20. Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

    Ki Young Yoo

    2010-03-01

    Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

  1. Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.

    Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong

    2017-10-15

    Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Detection of Histoplasma capsulatum from clinical specimens by cycling probe-based real-time PCR and nested real-time PCR.

    Muraosa, Yasunori; Toyotome, Takahito; Yahiro, Maki; Watanabe, Akira; Shikanai-Yasuda, Maria Aparecida; Kamei, Katsuhiko

    2016-05-01

    We developed new cycling probe-based real-time PCR and nested real-time PCR assays for the detection of Histoplasma capsulatum that were designed to detect the gene encoding N-acetylated α-linked acidic dipeptidase (NAALADase), which we previously identified as an H. capsulatum antigen reacting with sera from patients with histoplasmosis. Both assays specifically detected the DNAs of all H. capsulatum strains but not those of other fungi or human DNA. The limited of detection (LOD) of the real-time PCR assay was 10 DNA copies when using 10-fold serial dilutions of the standard plasmid DNA and 50 DNA copies when using human serum spiked with standard plasmid DNA. The nested real-time PCR improved the LOD to 5 DNA copies when using human serum spiked with standard plasmid DNA, which represents a 10-fold higher than that observed with the real-time PCR assay. To assess the ability of the two assays to diagnose histoplasmosis, we analyzed a small number of clinical specimens collected from five patients with histoplasmosis, such as sera (n = 4), formalin-fixed paraffin-embedded (FFPE) tissue (n = 4), and bronchoalveolar lavage fluid (BALF) (n = 1). Although clinical sensitivity of the real-time PCR assay was insufficiently sensitive (33%), the nested real-time PCR assay increased the clinical sensitivity (77%), suggesting it has a potential to be a useful method for detecting H. capsulatum DNA in clinical specimens. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P cancer group (P prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  4. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  5. Tissue-specific methylation of human insulin gene and PCR assay for monitoring beta cell death.

    Mohamed I Husseiny

    Full Text Available The onset of metabolic dysregulation in type 1 diabetes (T1D occurs after autoimmune destruction of the majority of pancreatic insulin-producing beta cells. We previously demonstrated that the DNA encoding the insulin gene is uniquely unmethylated in these cells and then developed a methylation-specific PCR (MSP assay to identify circulating beta cell DNA in streptozotocin-treated mice prior to the rise in blood glucose. The current study extends to autoimmune non-obese diabetic (NOD mice and humans, showing in NOD mice that beta cell death occurs six weeks before the rise in blood sugar and coincides with the onset of islet infiltration by immune cells, demonstrating the utility of MSP for monitoring T1D. We previously reported unique patterns of methylation of the human insulin gene, and now extend this to other human tissues. The methylation patterns of the human insulin promoter, intron 1, exon 2, and intron 2 were determined in several normal human tissues. Similar to our previous report, the human insulin promoter was unmethylated in beta cells, but methylated in all other tissues tested. In contrast, intron 1, exon 2 and intron 2 did not exhibit any tissue-specific DNA methylation pattern. Subsequently, a human MSP assay was developed based on the methylation pattern of the insulin promoter and human islet DNA was successfully detected in circulation of T1D patients after islet transplantation therapy. Signal levels of normal controls and pre-transplant samples were shown to be similar, but increased dramatically after islet transplantation. In plasma the signal declines with time but in whole blood remains elevated for at least two weeks, indicating that association of beta cell DNA with blood cells prolongs the signal. This assay provides an effective method to monitor beta cell destruction in early T1D and in islet transplantation therapy.

  6. Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.

    Thrush Anthony

    2010-01-01

    Full Text Available Abstract Background Perennial ryegrass (Lolium perenne L. is an important pasture and turf crop. Biotechniques such as gene expression studies are being employed to improve traits in this temperate grass. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is among the best methods available for determining changes in gene expression. Before analysis of target gene expression, it is essential to select an appropriate normalisation strategy to control for non-specific variation between samples. Reference genes that have stable expression at different biological and physiological states can be effectively used for normalisation; however, their expression stability must be validated before use. Results Existing Serial Analysis of Gene Expression data were queried to identify six moderately expressed genes that had relatively stable gene expression throughout the year. These six candidate reference genes (eukaryotic elongation factor 1 alpha, eEF1A; TAT-binding protein homolog 1, TBP-1; eukaryotic translation initiation factor 4 alpha, eIF4A; YT521-B-like protein family protein, YT521-B; histone 3, H3; ubiquitin-conjugating enzyme, E2 were validated for qRT-PCR normalisation in 442 diverse perennial ryegrass (Lolium perenne L. samples sourced from field- and laboratory-grown plants under a wide range of experimental conditions. Eukaryotic EF1A is encoded by members of a multigene family exhibiting differential expression and necessitated the expression analysis of different eEF1A encoding genes; a highly expressed eEF1A (h, a moderately, but stably expressed eEF1A (s, and combined expression of multigene eEF1A (m. NormFinder identified eEF1A (s and YT521-B as the best combination of two genes for normalisation of gene expression data in perennial ryegrass following different defoliation management in the field. Conclusions This study is unique in the magnitude of samples tested with the inclusion of numerous field-grown samples

  7. PCR-based detection of a rare linear DNA in cell culture

    Saveliev Sergei V.

    2002-01-01

    Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  8. PCR-based detection of a rare linear DNA in cell culture.

    Saveliev, Sergei V.

    2002-11-11

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  9. PCR-Based Seamless Genome Editing with High Efficiency and Fidelity in Escherichia coli

    Liu, Yilan; Yang, Maohua; Yan, Daojiang

    2016-01-01

    Efficiency and fidelity are the key obstacles for genome editing toolboxes. In the present study, a PCR-based tandem repeat assisted genome editing (TRAGE) method with high efficiency and fidelity was developed. The design of TRAGE is based on the mechanism of repair of spontaneous double...... for seamlessly deleting, substituting and inserting targeted genes using PCR products. The effects of different manipulations including sucrose addition time, subculture times in LB with sucrose and stages of inoculation on the efficiency were investigated. With our recommended procedure, seamless excision...... of cat-sacB cassette can be realized in 48 h efficiently. We believe that the developed method has great potential for seamless genome editing in E. coli....

  10. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  11. Detection of Shiga toxins genes by Multiplex PCR in clinical samples

    2013-09-01

    Full Text Available Background: Different methods have been used for detection of shiga toxins; such as,  cell culture, ELISA, and RFPLA. However, all of these methods suffer from high cost, time-consumption and relatively low sensitivity. In this study we used Multiplex PCR method for detection of genes encoding shiga toxins. Material and Methods: In this study, 63 clinical samples were obtained from positive cultures of Shigella and E. coli O157, from Bahman 1391 until Ordibehesht 1392 in Mazandaran province. Initial confirmation of shiga toxins producing bacteria was performed by biochemical and serological methods. After DNA extraction, detection of stx1 and stx2 genes was accomplished by multiplex PCR.  For confirmation of the PCR amplicon, DNA sequencing was used. Antibiotic sensitivity tests were performed by disk diffusion method. Results:  Among the positive strains, 13 strains contained stx2 genes, 4 strains contained Stx/Stx1 genes and 4 strains harbored both Stx/Stx1 and Stx2. The DNA extracted from other Gram-negative bacteria was not protected by the relevant parts of these toxins. Sequencing of the amplified fragments indicated the correct toxin sequences.  The sensitivity for identification of Stx/Stx1 gene was 1.56 pg/ µl and for Stx2 was 1.08 pg/µl. The toxin positive strains were all sensitive to Cefixime, Gentamicin, Amikacin, Ceftriaxone, and Nitrofurantoin. Conclusion: This method is fast and accurate for detection of bacteria producing shiga toxin and can be used to identify different types of shiga toxin.

  12. Expression analysis of fiber related genes in cotton (gossypium hirsutum l.) through real time pcr

    Iqbal, N.; Khatoon, A.; Asif, M.; Bashir, A.

    2016-01-01

    Cotton fibers are unicellular seed trichomes and the largest known plant cells. Fiber morphogenesis in cotton is a complex process involving a large number of genes expressed throughout fiber development process. The expression profiling of five gene families in various cotton tissues was carried out through real time PCR. Expression analysis revealed that transcripts of expansin, tubulin and E6 were elevated from 5 to 20 days post anthesis (DPA) fibers. Three Lipid transfer proteins (LTPs) including LTP1, LTP3, LTP7 exhibited highest expression in 10 - 20 DPA fibers. Transcripts of LTP3 were detected in fibers and non fiber tissues that of LTP7 were almost negligible in non fiber tissues. Sucrose phosphate synthase gene showed highest expression in 10 DPA fibers while sucrose synthse (susy) expressed at higher rate in 5-20 DPA fibers as well as roots. The results reveal that most of fiber related genes showed high expression in 5-20 DPA fibers. Comprehensive expression study may help to determine tissue and stage specificity of genes under study. The study may also help to explore complex process of fiber development and understand the role of these genes in fiber development process. Highly expressed genes in fibers may be transformed in cotton for improvement of fiber quality traits. Genes that were expressed specifically in fibers or other tissues could be used for isolation of upstream regulatory sequences. (author)

  13. Comparison of toxicity neutralization-, ELISA- and PCR tests for typing of Clostridium perfringens and detection of the enterotoxin gene by PCR

    Møller, Kristian; Ahrens, Peter

    1996-01-01

    A polymerase chain reaction (PCR) was developed for the specific amplification of a part of each of the five Clostridium perfringens toxin genes: alpha (alpha), beta (beta), epsilon (epsilon), iota (iota), and enterotoxin (CPE). While the toxicity neutralization test (TNT) only showed limited...

  14. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-01-01

    From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  15. Detection of chicken contamination in beef meatball using duplex-PCR Cyt b gene

    Sari, E. P.; Kartikasari, L. R.; Cahyadi, M.

    2017-04-01

    Beef is one of expensive animal protein sources compared to other meats, on the other hand, chicken is cheap animal protein source. Mixing of chicken into beef meatball is possibly performed to decrease production cost. The aim of this study was to detect chicken contamination in beef meatball using Cytochrome b (Cyt b) gene by duplex-PCR. Sample was designed and prepared as follows, 100% of chicken meatball, 100% of beef meatball and serial level of chicken contaminations in beef meatball (1, 5, 10 and 25%, respectively). Isolation of DNA genome from meatball was according to the guideline of gSYNCTM DNA Extraction Kit for animal tissue. The PCR reaction was carried out using KAPA2G Fast Multiplex Mix. This study found that the DNA genome was succesfully extracted. Moreover, chicken contamination in beef meatball was indicated by the presence of 227 bp DNA band on 2% of agarose gels. Current study revealed that duplex-PCR using Cyt b gene as a genetic marker was able to detect chicken contamination in beef meatball until 1% of chicken meat in the sample. It can be effectively used to identify contamination and also authenticate species origin in animal products to protect consumer from undesirable contents in the food.

  16. Molecular typing of the actin gene of Trichomonas vaginalis isolates by PCR-RFLP in Iran.

    Momeni, Zohreh; Sadraei, Javid; Kazemi, Bahram; Dalimi, Abdolhossein

    2015-12-01

    Trichomonas vaginalis is a human urogenital pathogen that causes trichomoniasis, the most common nonviral, parasitic sexually transmitted infection in the world. At present, little is known regarding the degree of strain variability of T. vaginalis. A classification method for T. vaginalis strains would be a useful tool in the study of the epidemiology, drug resistance, pathogenesis and transmission of T. vaginalis. Eight different types of actin genes have been identified by PCR-RFLP in T. vaginalis; the purpose of this study is to determine the genotypes of this parasite in Karaj city, Iran. Forty-five clinical T. vaginalis isolates from vaginal secretions and urine sediment were collected from Karaj city from 2012 through 2014. DNA was extracted and the actin gene was amplified by nested-PCR; all samples were positive. To determine the genetic differences, sequencing on seven samples was conducted. Then, all PCR products were digested with HindII, MseI, and RsaI restriction enzymes. Of 45 isolates, 23 samples (51.1%) were of actin genotype G, 11 samples (24.4%) of genotype E, six samples (13.3%) of genotype H, three samples (6.6%) of genotype I, and two samples (4.4%) were mixed genotypes of G and E. Genetic diversity of T. vaginalis isolates is notable. The actin genotype G may be the dominant genotype in Karaj city, Iran. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Detection of Balamuthia mandrillaris DNA by real-time PCR targeting the RNase P gene

    Lewin Astrid

    2008-12-01

    Full Text Available Abstract Background The free-living amoeba Balamuthia mandrillaris may cause fatal encephalitis both in immunocompromised and in – apparently – immunocompetent humans and other mammalian species. Rapid, specific, sensitive, and reliable detection requiring little pathogen-specific expertise is an absolute prerequisite for a successful therapy and a welcome tool for both experimental and epidemiological research. Results A real-time polymerase chain reaction assay using TaqMan® probes (real-time PCR was established specifically targeting the RNase P gene of B. mandrillaris amoebae. The assay detected at least 2 (down to 0.5 genomes of B. mandrillaris grown in axenic culture. It did not react with DNA from closely related Acanthamoeba (3 species, nor with DNA from Toxoplasma gondii, Leishmania major, Pneumocystis murina, Mycobacterium bovis (BCG, human brain, various mouse organs, or from human and murine cell lines. The assay efficiently detected B. mandrillaris DNA in spiked cell cultures, spiked murine organ homogenates, B. mandrillaris-infected mice, and CNS tissue-DNA preparations from 2 patients with proven cerebral balamuthiasis. This novel primer set was successfully combined with a published set that targets the B. mandrillaris 18S rRNA gene in a duplex real-time PCR assay to ensure maximum specificity and as a precaution against false negative results. Conclusion A real-time PCR assay for B. mandrillaris amoebae is presented, that is highly specific, sensitive, and reliable and thus suited both for diagnosis and for research.

  18. Detection of clonal B cells in microdissected reactive lymphoproliferations: possible diagnostic pitfalls in PCR analysis of immunoglobulin heavy chain gene rearrangement

    Zhou, X.G.; Sandvej, K.; Gregersen, Niels

    1999-01-01

    Aims-To evaluate the specificity of standard and fluorescence based (GENESCAN) polymerase chain reaction (PCR) immunoglobulin heavy chain (IgH) gene rearrangement analysis in complete and microdissected paraffin wax embedded sections from lymphoid proliferations. Methods-PCR IgH gene rearrangement...... because of preferential priming or detection of local B cell clones. Data from clonal analysis of small, microdissected or lymphocyte poor samples must be evaluated critically. It is recommended that analyses should be run in parallel on at least two tissue specimens. Only reproducible bands present...

  19. PCR Screening of Antibiotic Resistance Genes in Faecal Samples from Australian and Chinese Children.

    Ravensdale, Joshua T; Xian, Darren Ten Wei; Wei, Chooi Ming; Lv, Quanjun; Wen, Xiajian; Guo, Jing; Coorey, Ranil; LeSouëf, Peter; Lu, Fengmin; Zhang, Brad; Dykes, Gary A

    2018-03-31

    Recent public awareness campaigns on the risk of antibiotic resistance in pathogenic microbes has placed pressure on governments to enforce stricter antimicrobial stewardship policies on the hospital and agricultural industry. This study aimed to screen faecal samples from Australian and Chinese children for the presence of antibiotic resistance genes to identify demographics at risk of carriage of these genes and examine antimicrobial stewardship policies from the two countries which may influence carriage. Faecal samples from 46 Australian and 53 Chinese children were screened for the presence of six clinically relevant antibiotic resistance genes using PCR. Clinical and demographic data was also collected from each patient. Over 90% of faecal samples from Chinese children tested positive for β-lactam, macrolide, tetracycline, and aminoglycoside resistance genes, which was substantially higher than Australian samples. Besides country of origin, no clear trend could be seen to predict carriage of resistance genes. The exception to this was Chinese born children who immigrated to Australia having higher rates of carriage for bla TEM and tetM genes than children born and still living in Australia. These data indicated that Chinese children were more likely to carry certain antibiotic resistance genes than Australian children. The Chinese government has recently implemented strict policies to control the overuse of antibiotics in hospitals. However, many of these policies do not extend to the agricultural industry which could explain the differences seen in this study. Copyright © 2018. Published by Elsevier Ltd.

  20. PCR Based Microbial Monitor for Analysis of Recycled Water Aboard the ISSA: Issues and Prospects

    Cassell, Gail H.; Lefkowitz, Elliot J.; Glass, John I.

    1995-01-01

    added to a PCR assay; There are not likely to be contaminants in ISSA recycled water that would inhibit PCR resulting in false-negative results; The TaqMan PCR product detection system is the most promising method for developing a rapid, highly automated gene-based microbial monitoring system. The method is inherently quantitative. NASA and other government agencies have invested in other technologies that, although potentially could lead to revolutionary advances, are not likely to mature in the next 5 years into working systems; PCR-based methods cannot distinguish between DNA or RNA of a viable microorganism and that of a non-viable organism. This may or may not be an important issue with reclaimed water on the ISSA. The recycling system probably damages the capacity of the genetic material of any bacteria or viruses killed during processing to serve as a template in a PCR desinged to amplify a large segment of DNA (less than 650 base pairs). If necessary, vital dye staining could be used in addition to PCR, to enumerate the viable cells in a water sample; The quality control methods have been developed to insure that PCR's are working properly, and that reactions are not contaminated with PCR carryover products which could lead to the generation of false-positive results; and The sequences of the small rRNA subunit gene for a large number of microorganisms are known, and they consititue the best database for rational development of the oligonucleotide reagents that give PCR its great specificity. From those gene sequences, sets of oligonucleotide primers for PCR and Taqman detection that could be used in a NASA microbial monitor were constructed using computer based methods. In addition to space utilization, a microbial monitior will have tremendous terrestrial applications. Analysis of patient samples for microbial pathogens, testing industrial effluent for biofouling bacteria, and detection biological warfare agents on the battlefield are but a few of the diverse

  1. Identification of circulating miRNA biomarkers based on global quantitative real-time PCR profiling

    Kang Kang

    2012-02-01

    Full Text Available Abstract MicroRNAs (miRNAs are small noncoding RNAs (18-25 nucleotides that regulate gene expression at the post-transcriptional level. Recent studies have demonstrated the presence of miRNAs in the blood circulation. Deregulation of miRNAs in serum or plasma has been associated with many diseases including cancers and cardiovascular diseases, suggesting the possible use of miRNAs as diagnostic biomarkers. However, the detection of the small amount of miRNAs found in serum or plasma requires a method with high sensitivity and accuracy. Therefore, the current study describes polymerase chain reaction (PCR-based methods for measuring circulating miRNAs. Briefly, the procedure involves four major steps: (1 sample collection and preparation; (2 global miRNAs profiling using quantitative real-time PCR (qRT-PCR; (3 data normalization and analysis; and (4 selection and validation of miRNA biomarkers. In conclusion, qRT-PCR is a promising method for profiling of circulating miRNAs as biomarkers.

  2. Normalizing gene expression by quantitative PCR during somatic embryogenesis in two representative conifer species: Pinus pinaster and Picea abies.

    de Vega-Bartol, José J; Santos, Raquen Raissa; Simões, Marta; Miguel, Célia M

    2013-05-01

    Suitable internal control genes to normalize qPCR data from different stages of embryo development and germination were identified in two representative conifer species. Clonal propagation by somatic embryogenesis has a great application potentiality in conifers. Quantitative PCR (qPCR) is widely used for gene expression analysis during somatic embryogenesis and embryo germination. No single reference gene is universal, so a systematic characterization of endogenous genes for concrete conditions is fundamental for accuracy. We identified suitable internal control genes to normalize qPCR data obtained at different steps of somatic embryogenesis (embryonal mass proliferation, embryo maturation and germination) in two representative conifer species, Pinus pinaster and Picea abies. Candidate genes included endogenous genes commonly used in conifers, genes previously tested in model plants, and genes with a lower variation of the expression along embryo development according to genome-wide transcript profiling studies. Three different algorithms were used to evaluate expression stability. The geometric average of the expression values of elongation factor-1α, α-tubulin and histone 3 in P. pinaster, and elongation factor-1α, α-tubulin, adenosine kinase and CAC in P. abies were adequate for expression studies throughout somatic embryogenesis. However, improved accuracy was achieved when using other gene combinations in experiments with samples at a single developmental stage. The importance of studies selecting reference genes to use in different tissues or developmental stages within one or close species, and the instability of commonly used reference genes, is highlighted.

  3. Tetra primer ARMS-PCR relates folate/homocysteine pathway genes and ACE gene polymorphism with coronary artery disease.

    Masud, Rizwan; Qureshi, Irfan Zia

    2011-09-01

    Cardiovascular disorders and coronary artery disease (CAD) are significant contributors to morbidity and mortality in heart patients. As genes of the folate/homocysteine pathway have been linked with the vascular disease, we investigated association of these gene polymorphisms with CAD/myocardial infarction (MI) using the novel approach of tetraprimer ARMS-PCR. A total of 230 participants (129 MI cases, 101 normal subjects) were recruited. We genotyped rs1801133 and rs1801131 SNPs in 5'10' methylenetetrahydrofolate reductase (MTHFR), rs1805087 SNP in 5' methyltetrahydrofolate homocysteine methyltransferase (MTR), rs662 SNP in paroxanse1 (PON1), and rs5742905 polymorphism in cystathionine beta synthase (CBS). Angiotensin converting enzyme (ACE) insertion/deletion polymorphism was detected through conventional PCR. Covariates included blood pressure, fasting blood sugar, serum cholesterol, and creatinine concentrations. Our results showed allele frequencies at rs1801133, rs1801131, rs1805087 and the ACE insertion/deletion (I/D) polymorphism varied between cases and controls. Logistic regression, after adjusting for covariates, demonstrated significant associations of rs1801133 and rs1805087 with CAD in the additive, dominant, and genotype model. In contrast, ACE I/D polymorphism was significantly related with CAD where recessive model was applied. Gene-gene interaction against the disease status revealed two polymorphism groups: rs1801133, rs662, and rs1805087; and rs1801131, rs662, and ACE I/D. Only the latter interaction maintained significance after adjusted for covariates. Our study concludes that folate pathway variants exert contributory influence on susceptibility to CAD. We further suggest that tetraprimer ARMS-PCR successfully resolves the genotypes in selected samples and might prove to be a superior technique compared to the conventional approach.

  4. Enhanced capillary electrophoretic screening of Alzheimer based on direct apolipoprotein E genotyping and one-step multiplex PCR.

    Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho

    2018-01-01

    Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Selection of reference genes for quantitative real time RT-PCR during dimorphism in the zygomycete Mucor circinelloides.

    Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor

    2015-03-01

    Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.

  6. Selection of reference genes for RT-qPCR analysis in the monarch butterfly, Danaus plexippus (L.), a migrating bio-indicator

    Quantitative real-time PCR (qRT-PCR) is a reliable and reproducible technique for measuring and evaluating changes in gene expression. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. In this study, expres...

  7. Analysis of gene expression in small numbers of purified hemopoietic progenitor cells by RT-PCR.

    Ziegler, B L; Lamping, C P; Thoma, S J; Fliedner, T M

    1995-05-01

    Primitive hemopoietic stem cells represent the most probable targets for genetic alterations due to exposure to ionizing irradiation or chemical carcinogens. We have applied a two-step protocol for the purification of CD34+HLA-DR-/low hemopoietic progenitor cells from cord blood (CB). CD34+ cells were isolated by monoclonal antibody (mAb) against CD34 (My10) and immunomagnetic beads. Beads were cleaved off the CD34+ cells by enzymatic treatment with chymopapain. Due to chymopapain-resistance of epitopes recognized by the used mAbs purity control of CD34+ cells and separation into CD34+HLA-DR-/low and CD34+HLA-DR+ subsets could be performed by using flow cytometry. Two miniaturized procedures were applied to isolate poly(A)+ mRNA for the reverse transcription polymerase chain reaction (RT-PCR) from small numbers of CD34+HLA-DR-/low cells. In five experiments, the mean purity of immunomagnetically isolated CD34+ cells was 93.8% +/- 3.9. Flow cytometry sorting of CD34+ cells resulted in pure CD34+HLA-DR-/low populations (purity > 98.8%; range 98.8% to 99.9%; viability > 96%) with an average yield of 2600 +/- 800 cells/5 x 10(7) low density CB cells. By RT-PCR using both poly(A)+ mRNA isolation procedures, sequences corresponding to CD34 and beta 2-microglobulin were amplified from as few as 20 cells. Furthermore, a sequence-independent RT-PCR (SIP-RT-PCR) was applied to amplify the cDNA derived from five erythroblasts isolated from a burst-forming unit-erythroid (BFU-E). Upon hybridization, full-length c-fos message was detected in the SIP-RT-PCR amplified material. Our data demonstrate that gene expression can be detected at the transcriptional level in small numbers of hemopoietic progenitor cells. In addition, the SIP-RT-PCR may allow the amplification of unique mRNA species when subtractive hybridization procedures are performed. The presented data should be useful to analyze gene expression in rare subsets of radiation-exposed immature hemopoietic stem

  8. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  9. Internal quality control of PCR-based genotyping methods

    Bladbjerg, Else-Marie; Gram, Jørgen; Jespersen, Jørgen

    2002-01-01

    Internal quality control programmes for genetic analyses are needed. We have focused on quality control aspects of selected polymorphism analyses used in thrombosis research. DNA was isolated from EDTA-blood (n = 500) and analysed for 18 polymorphisms by polymerase chain reaction (PCR), i...... because of positive reagent blanks (controls (Control of data handling revealed 0.1% reading mistakes and 0.5% entry mistakes. Based on our experiences, we propose an internal quality control programme......, electrophoresis (analytical factors), result reading and entry into a database (post-analytical factors). Furthermore, we evaluated a procedure for result confirmation. Isolated DNA was of good quality (42 micrograms/ml blood, A260/A280 ratio > 1.75, negative DNAsis tests). Occasionally, results were reanalysed...

  10. Blood grouping based on PCR methods and agarose gel electrophoresis.

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  11. Rapid molecular characterization of Acinetobacter baumannii clones with rep-PCR and evaluation of carbapenemase genes by new multiplex PCR in Hospital District of Helsinki and Uusimaa.

    Tanja Pasanen

    Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.

  12. Identification of Mycobacterium tuberculosis in Clinical Specimens of Patients Suspected of Having Extrapulmonary Tuberculosis by Application of Nested PCR on Five Different Genes.

    Khosravi, Azar D; Alami, Ameneh; Meghdadi, Hossein; Hosseini, Atta A

    2017-01-01

    Definitive and rapid diagnosis of extrapulmonary tuberculosis (EPTB) is challenging since conventional techniques have limitations due to the paucibacillary nature of the disease. To increase the sensitivity of detection of Mycobacterium tuberculosis (MTB) in EPTB specimens, we performed a nested PCR assay targeting several genes of MTB on EPTB specimens. A total of 100 clinical specimens from suspected cases of EPTB were processed. Standard staining for acid fast bacilli (AFB) was performed as the preliminary screening test. Extracted DNAs from specimens were subjected to Nested PCR technique for the detection of five different MTB target genes of IS6110, IS1081, hsp65kd, mbp64 , and mtp40 . On performing AFB staining, only 13% of specimens were positive, of which ascites fluid (33.3%), followed by pleural effusion (30.8%) showed the greatest AFB positivity rate. We demonstrated slight improvement in yields in lymph node which comprised the majority of specimens in this study, by employing PCR targeted to IS6110 - and hsp65-genes in comparison to AFB staining. However, the yields in ascites fluid and pleural effusion were not substantially improved by PCR, but those from bone and wound were, as in nested PCR employing either gene, the same positivity rate were obtained for ascites fluid (33.3%), while for pleural effusion specimens only IS1081 based PCR showed identical positivity rate with AFB stain (30.8%). The results for bone and wound specimens, however, demonstrated an improved yield mainly by employing IS1081 gene. Here, we report higher detection rate of EPTB in clinical specimens using five different targeted MTB genes. This nested PCR approach facilitates the comparison and the selection of the most frequently detected genes. Of course this study demonstrated the priority of IS1081 followed by mtp40 and IS6110 , among the five tested genes and indicates the effectiveness of any of the three genes in the design of an efficient nested-PCR test that

  13. Population structure of Angiostrongylus cantonensis (Nematoda: Metastrongylidae) in Thailand based on PCR-RAPD markers.

    Thaenkham, Urusa; Pakdee, Wallop; Nuamtanong, Supaporn; Maipanich, Wanna; Pubampen, Somchit; Sa-Nguankiat, Surapol; Komalamisra, Chalit

    2012-05-01

    Angiostrongylus cantonensis is the causative agent of angiostrongyliasis, which is widely distributed throughout the world. It can specifically infect many species of intermediate and definitive hosts. This study examined the genetic differentiation and population structure using the RAPD-PCR method of parasites obtained from 8 different geographical areas of Thailand. Based on 8 primers, high levels of genetic diversity and low levels of gene flow among populations were found. Using genetic distance and neighbor-joining dendrogram methods, A. cantonensis in Thailand could be divided into two groups with statistically significant genetic differentiation of the two populations. However, genotypic variations and haplotype relationships need to be further elucidated using other markers.

  14. A rapid PCR-based approach for molecular identification of filamentous fungi.

    Chen, Yuanyuan; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang

    2011-08-01

    In this study, a novel rapid and efficient DNA extraction method based on alkaline lysis, which can deal with a large number of filamentous fungal isolates in the same batch, was established. The filamentous fungal genomic DNA required only 20 min to prepare and can be directly used as a template for PCR amplification. The amplified internal transcribed spacer regions were easy to identify by analysis. The extracted DNA also can be used to amplify other protein-coding genes for fungal identification. This method can be used for rapid systematic identification of filamentous fungal isolates.

  15. A PCR-based protocol to accurately size C9orf72 intermediate-length alleles.

    Biasiotto, Giorgio; Archetti, Silvana; Di Lorenzo, Diego; Merola, Francesca; Paiardi, Giulia; Borroni, Barbara; Alberici, Antonella; Padovani, Alessandro; Filosto, Massimiliano; Bonvicini, Cristian; Caimi, Luigi; Zanella, Isabella

    2017-04-01

    Although large expansions of the non-coding GGGGCC repeat in C9orf72 gene are clearly defined as pathogenic for Amyotrophic Lateral Sclerosis (ALS) and Frontotemporal Lobar Degeneration (FTLD), intermediate-length expansions have also been associated with those and other neurodegenerative diseases. Intermediate-length allele sizing is complicated by intrinsic properties of current PCR-based methodologies, in that somatic mosaicism could be suspected. We designed a protocol that allows the exact sizing of intermediate-length alleles, as well as the identification of large expansions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. A new detection method for the K variant of butyrylcholinesterase based on PCR primer introduced restriction analysis (PCR-PIRA).

    Shibuta, K; Abe, M; Suzuki, T

    1994-01-01

    The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197

  17. Pre-amplification in the context of high-throughput qPCR gene expression experiment

    Korenková, Vlasta; Scott, J.; Novosadová, Vendula; Jindřichová, Marie; Langerová, Lucie; Švec, David; Šídová, Monika; Sjoback, R.

    2015-01-01

    Roč. 16, č. 5 (2015) ISSN 1471-2199 R&D Projects: GA ČR(CZ) GAP304/12/1585; GA ČR(CZ) GA15-08239S; GA ČR GA13-02154S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:86652036 Keywords : High-throughput qPCR * Gene expression * Exponential pre-amplification Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.500, year: 2015

  18. A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi

    Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio

    2018-01-01

    A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297

  19. Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method

    Malorny, B.; Hoorfar, Jeffrey; Hugas, M.

    2003-01-01

    A collaborative study involving four European laboratories was conducted to investigate the diagnostic accuracy of a Salmonella specific PCR-based method, which was evaluated within the European FOOD-PCR project (http://www.pcr.dk). Each laboratory analysed by the PCR a set of independent obtained...... presumably naturally contaminated samples and compared the results with the microbiological culture method. The PCR-based method comprised a preenrichment step in buffered peptone water followed by a thermal cell lysis using a closed tube resin-based method. Artificially contaminated minced beef and whole......-based diagnostic methods and is currently proposed as international standard document....

  20. Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture.

    Kathleen D Cusick

    Full Text Available Neurospora crassa has served as a model organism for studying circadian pathways and more recently has gained attention in the biofuel industry due to its enhanced capacity for cellulase production. However, in order to optimize N. crassa for biotechnological applications, metabolic pathways during growth under different environmental conditions must be addressed. Reverse-transcription quantitative PCR (RT-qPCR is a technique that provides a high-throughput platform from which to measure the expression of a large set of genes over time. The selection of a suitable reference gene is critical for gene expression studies using relative quantification, as this strategy is based on normalization of target gene expression to a reference gene whose expression is stable under the experimental conditions. This study evaluated twelve candidate reference genes for use with N. crassa when grown in continuous culture bioreactors under different light and temperature conditions. Based on combined stability values from NormFinder and Best Keeper software packages, the following are the most appropriate reference genes under conditions of: (1 light/dark cycling: btl, asl, and vma1; (2 all-dark growth: btl, tbp, vma1, and vma2; (3 temperature flux: btl, vma1, act, and asl; (4 all conditions combined: vma1, vma2, tbp, and btl. Since N. crassa exists as different cell types (uni- or multi-nucleated, expression changes in a subset of the candidate genes was further assessed using absolute quantification. A strong negative correlation was found to exist between ratio and threshold cycle (CT values, demonstrating that CT changes serve as a reliable reflection of transcript, and not gene copy number, fluctuations. The results of this study identified genes that are appropriate for use as reference genes in RT-qPCR studies with N. crassa and demonstrated that even with the presence of different cell types, relative quantification is an acceptable method for measuring

  1. Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture.

    Cusick, Kathleen D; Fitzgerald, Lisa A; Pirlo, Russell K; Cockrell, Allison L; Petersen, Emily R; Biffinger, Justin C

    2014-01-01

    Neurospora crassa has served as a model organism for studying circadian pathways and more recently has gained attention in the biofuel industry due to its enhanced capacity for cellulase production. However, in order to optimize N. crassa for biotechnological applications, metabolic pathways during growth under different environmental conditions must be addressed. Reverse-transcription quantitative PCR (RT-qPCR) is a technique that provides a high-throughput platform from which to measure the expression of a large set of genes over time. The selection of a suitable reference gene is critical for gene expression studies using relative quantification, as this strategy is based on normalization of target gene expression to a reference gene whose expression is stable under the experimental conditions. This study evaluated twelve candidate reference genes for use with N. crassa when grown in continuous culture bioreactors under different light and temperature conditions. Based on combined stability values from NormFinder and Best Keeper software packages, the following are the most appropriate reference genes under conditions of: (1) light/dark cycling: btl, asl, and vma1; (2) all-dark growth: btl, tbp, vma1, and vma2; (3) temperature flux: btl, vma1, act, and asl; (4) all conditions combined: vma1, vma2, tbp, and btl. Since N. crassa exists as different cell types (uni- or multi-nucleated), expression changes in a subset of the candidate genes was further assessed using absolute quantification. A strong negative correlation was found to exist between ratio and threshold cycle (CT) values, demonstrating that CT changes serve as a reliable reflection of transcript, and not gene copy number, fluctuations. The results of this study identified genes that are appropriate for use as reference genes in RT-qPCR studies with N. crassa and demonstrated that even with the presence of different cell types, relative quantification is an acceptable method for measuring gene

  2. Selection of reliable reference genes for quantitative real-time PCR in human T cells and neutrophils

    Ledderose Carola

    2011-10-01

    Full Text Available Abstract Background The choice of reliable reference genes is a prerequisite for valid results when analyzing gene expression with real-time quantitative PCR (qPCR. This method is frequently applied to study gene expression patterns in immune cells, yet a thorough validation of potential reference genes is still lacking for most leukocyte subtypes and most models of their in vitro stimulation. In the current study, we evaluated the expression stability of common reference genes in two widely used cell culture models-anti-CD3/CD28 activated T cells and lipopolysaccharide stimulated neutrophils-as well as in unselected untreated leukocytes. Results The mRNA expression of 17 (T cells, 7 (neutrophils or 8 (unselected leukocytes potential reference genes was quantified by reverse transcription qPCR, and a ranking of the preselected candidate genes according to their expression stability was calculated using the programs NormFinder, geNorm and BestKeeper. IPO8, RPL13A, TBP and SDHA were identified as suitable reference genes in T cells. TBP, ACTB and SDHA were stably expressed in neutrophils. TBP and SDHA were also the most stable genes in untreated total blood leukocytes. The critical impact of reference gene selection on the estimated target gene expression is demonstrated for IL-2 and FIH expression in T cells. Conclusions The study provides a shortlist of suitable reference genes for normalization of gene expression data in unstimulated and stimulated T cells, unstimulated and stimulated neutrophils and in unselected leukocytes.

  3. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  4. PCR detection and identification of oral streptococci in saliva samples using gtf genes.

    Hoshino, Tomonori; Kawaguchi, Mamoru; Shimizu, Noriko; Hoshino, Naoko; Ooshima, Takashi; Fujiwara, Taku

    2004-03-01

    Oral streptococci are major constituents of dental plaque, and their prevalence is implicated in various pathologies. Therefore, accurate identification of oral streptococci would be valuable for studies of cariogenic plaque and for diagnostic use in infective endocarditis. Many oral streptococci possess glucosyltransferase enzymes that synthesize glucan, which is an obligate component of dental plaque. We established a rapid and precise method to identify oral streptococci by PCR using the species-specific region from the glucosyltransferase gene. With the species-specific primers, Streptococcus mutans, S. sobrinus, S. salivarius, S. sanguinis, S. oralis, and S. gordonii could be successfully distinguished. Further, we developed a simple method to extract the bacterial DNA from saliva. Using the resultant DNA as a template, the proposed PCR detection was performed. Their distribution was in accord with results of conventional biochemical tests. These findings indicate that the present PCR method is useful for the analysis of oral streptococci and can be successfully used in clinical applications to identify pathogenic bacteria associated with oral infectious disease and/or endocarditis.

  5. Reliable gene expression analysis by reverse transcription-quantitative PCR: reporting and minimizing the uncertainty in data accuracy.

    Remans, Tony; Keunen, Els; Bex, Geert Jan; Smeets, Karen; Vangronsveld, Jaco; Cuypers, Ann

    2014-10-01

    Reverse transcription-quantitative PCR (RT-qPCR) has been widely adopted to measure differences in mRNA levels; however, biological and technical variation strongly affects the accuracy of the reported differences. RT-qPCR specialists have warned that, unless researchers minimize this variability, they may report inaccurate differences and draw incorrect biological conclusions. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines describe procedures for conducting and reporting RT-qPCR experiments. The MIQE guidelines enable others to judge the reliability of reported results; however, a recent literature survey found low adherence to these guidelines. Additionally, even experiments that use appropriate procedures remain subject to individual variation that statistical methods cannot correct. For example, since ideal reference genes do not exist, the widely used method of normalizing RT-qPCR data to reference genes generates background noise that affects the accuracy of measured changes in mRNA levels. However, current RT-qPCR data reporting styles ignore this source of variation. In this commentary, we direct researchers to appropriate procedures, outline a method to present the remaining uncertainty in data accuracy, and propose an intuitive way to select reference genes to minimize uncertainty. Reporting the uncertainty in data accuracy also serves for quality assessment, enabling researchers and peer reviewers to confidently evaluate the reliability of gene expression data. © 2014 American Society of Plant Biologists. All rights reserved.

  6. Analysis of Dystrophin Gene Deletions by Multiplex PCR in Moroccan Patients

    Aziza Sbiti

    2002-01-01

    Full Text Available Duchenne and Becker muscular dystrophy (DMD and BMD are X-linked diseases resulting from a defect in the dystrophin gene located on Xp21. DMD is the most frequent neuromuscular disease in humans (1/3500 male newborn. Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. We have analyzed DNA from 72 Moroccan patients with DMD/BMD using the multiplex polymerase chain reaction (PCR to screen for exon deletions within the dystrophin gene, and to estimate the frequency of these abnormalities. We found dystrophin gene deletions in 37 cases. Therefore the frequency in Moroccan DMD/BMD patients is about 51.3%. All deletions were clustered in the two known hot-spots regions, and in 81% of cases deletions were detected in the region from exon 43 to exon 52. These findings are comparable to those reported in other studies. It is important to note that in our population, we can first search for deletions of DMD gene in the most frequently deleted exons determined by this study. This may facilitate the molecular diagnosis of DMD and BMD in our country.

  7. Expression analysis of fusarium wilt resistance gene in melon by real-time quantitative pcr

    Wang, X.; Xu, B.; Zhao, L.; Gao, P.; Luan, F.

    2014-01-01

    Melon Actin gene was used as a reference gene, to explore the gene expression profiles of the Fom-2 gene in roots, stems, and leaves of melon MR-1 under induction by Fusarium oxysporum f. sp. melonis. Monitoring using real-time quantitative PCR showed similar accumulation patterns of Fom-2 in roots, stems, and leaves over the observation period of 1 to 11 days; the expression level in stems was the highest. The expression of the Fom-2 gene was strengthened by the prolongation of induction time. In stems, the expression of Fom-2 was 5.737 times higher than in the control at three days; in roots, expression of Fom-2 was 5.617 times higher than in the control at five days. Similarly, the expression of Fom-2 in leaves obviously increased. It was 4.441 times higher than in the control at 5 days. The expression of Fom-2 was non-tissue specific, up-regulated under induction by Fusarium, and related to early resistance to Fusarium wilt. (author)

  8. Validation of Reference Genes for Quantitative Expression Analysis by Real-Time RT-PCR in Four Lepidopteran Insects

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae...

  9. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  10. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba skin biopsies

    Casini Silvia

    2006-09-01

    Full Text Available Abstract Background Odontocete cetaceans occupy the top position of the marine food-web and are particularly sensitive to the bioaccumulation of lipophilic contaminants. The effects of environmental pollution on these species are highly debated and various ecotoxicological studies have addressed the impact of xenobiotic compounds on marine mammals, raising conservational concerns. Despite its sensitivity, quantitative real-time PCR (qRT-PCR has never been used to quantify gene induction caused by exposure of cetaceans to contaminants. A limitation for the application of qRT-PCR is the need for appropriate reference genes which allow the correct quantification of gene expression. A systematic evaluation of potential reference genes in cetacean skin biopsies is presented, in order to validate future qRT-PCR studies aiming at using the expression of selected genes as non-lethal biomarkers. Results Ten commonly used housekeeping genes (HKGs were partially sequenced in the striped dolphin (Stenella coeruleoalba and, for each gene, PCR primer pairs were specifically designed and tested in qRT-PCR assays. The expression of these potential control genes was examined in 30 striped dolphin skin biopsy samples, obtained from specimens sampled in the north-western Mediterranean Sea. The stability of selected control genes was determined using three different specific VBA applets (geNorm, NormFinder and BestKeeper which produce highly comparable results. Glyceraldehyde-3P-dehydrogenase (GAPDH and tyrosine 3-monooxygenase (YWHAZ always rank as the two most stably expressed HKGs according to the analysis with geNorm and Normfinder, and are defined as optimal control genes by BestKepeer. Ribosomal protein L4 (RPL4 and S18 (RPS18 also exhibit a remarkable stability of their expression levels. On the other hand, transferrin receptor (TFRC, phosphoglycerate kinase 1 (PGK1, hypoxanthine ribosyltransferase (HPRT1 and β-2-microglobin (B2M show variable expression

  11. Cross-platform comparison of SYBR® Green real-time PCR with TaqMan PCR, microarrays and other gene expression measurement technologies evaluated in the MicroArray Quality Control (MAQC study

    Dial Stacey L

    2008-07-01

    Full Text Available Abstract Background The MicroArray Quality Control (MAQC project evaluated the inter- and intra-platform reproducibility of seven microarray platforms and three quantitative gene expression assays in profiling the expression of two commercially available Reference RNA samples (Nat Biotechnol 24:1115-22, 2006. The tested microarrays were the platforms from Affymetrix, Agilent Technologies, Applied Biosystems, GE Healthcare, Illumina, Eppendorf and the National Cancer Institute, and quantitative gene expression assays included TaqMan® Gene Expression PCR Assay, Standardized (Sta RT-PCR™ and QuantiGene®. The data showed great consistency in gene expression measurements across different microarray platforms, different technologies and test sites. However, SYBR® Green real-time PCR, another common technique utilized by half of all real-time PCR users for gene expression measurement, was not addressed in the MAQC study. In the present study, we compared the performance of SYBR Green PCR with TaqMan PCR, microarrays and other quantitative technologies using the same two Reference RNA samples as the MAQC project. We assessed SYBR Green real-time PCR using commercially available RT2 Profiler™ PCR Arrays from SuperArray, containing primer pairs that have been experimentally validated to ensure gene-specificity and high amplification efficiency. Results The SYBR Green PCR Arrays exhibit good reproducibility among different users, PCR instruments and test sites. In addition, the SYBR Green PCR Arrays have the highest concordance with TaqMan PCR, and a high level of concordance with other quantitative methods and microarrays that were evaluated in this study in terms of fold-change correlation and overlap of lists of differentially expressed genes. Conclusion These data demonstrate that SYBR Green real-time PCR delivers highly comparable results in gene expression measurement with TaqMan PCR and other high-density microarrays.

  12. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Francielle Gibson da Silva-Zacarias

    2009-11-01

    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  13. Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

    Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda

    2016-02-01

    Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

  14. Selection of Reliable Reference Genes for Gene Expression Studies of a Promising Oilseed Crop, Plukenetia volubilis, by Real-Time Quantitative PCR

    Longjian Niu

    2015-06-01

    Full Text Available Real-time quantitative PCR (RT-qPCR is a reliable and widely used method for gene expression analysis. The accuracy of the determination of a target gene expression level by RT-qPCR demands the use of appropriate reference genes to normalize the mRNA levels among different samples. However, suitable reference genes for RT-qPCR have not been identified in Sacha inchi (Plukenetia volubilis, a promising oilseed crop known for its polyunsaturated fatty acid (PUFA-rich seeds. In this study, using RT-qPCR, twelve candidate reference genes were examined in seedlings and adult plants, during flower and seed development and for the entire growth cycle of Sacha inchi. Four statistical algorithms (delta cycle threshold (ΔCt, BestKeeper, geNorm, and NormFinder were used to assess the expression stabilities of the candidate genes. The results showed that ubiquitin-conjugating enzyme (UCE, actin (ACT and phospholipase A22 (PLA were the most stable genes in Sacha inchi seedlings. For roots, stems, leaves, flowers, and seeds from adult plants, 30S ribosomal protein S13 (RPS13, cyclophilin (CYC and elongation factor-1alpha (EF1α were recommended as reference genes for RT-qPCR. During the development of reproductive organs, PLA, ACT and UCE were the optimal reference genes for flower development, whereas UCE, RPS13 and RNA polymerase II subunit (RPII were optimal for seed development. Considering the entire growth cycle of Sacha inchi, UCE, ACT and EF1α were sufficient for the purpose of normalization. Our results provide useful guidelines for the selection of reliable reference genes for the normalization of RT-qPCR data for seedlings and adult plants, for reproductive organs, and for the entire growth cycle of Sacha inchi.

  15. Selection of Reliable Reference Genes for Gene Expression Studies of a Promising Oilseed Crop, Plukenetia volubilis, by Real-Time Quantitative PCR

    Niu, Longjian; Tao, Yan-Bin; Chen, Mao-Sheng; Fu, Qiantang; Li, Chaoqiong; Dong, Yuling; Wang, Xiulan; He, Huiying; Xu, Zeng-Fu

    2015-01-01

    Real-time quantitative PCR (RT-qPCR) is a reliable and widely used method for gene expression analysis. The accuracy of the determination of a target gene expression level by RT-qPCR demands the use of appropriate reference genes to normalize the mRNA levels among different samples. However, suitable reference genes for RT-qPCR have not been identified in Sacha inchi (Plukenetia volubilis), a promising oilseed crop known for its polyunsaturated fatty acid (PUFA)-rich seeds. In this study, using RT-qPCR, twelve candidate reference genes were examined in seedlings and adult plants, during flower and seed development and for the entire growth cycle of Sacha inchi. Four statistical algorithms (delta cycle threshold (ΔCt), BestKeeper, geNorm, and NormFinder) were used to assess the expression stabilities of the candidate genes. The results showed that ubiquitin-conjugating enzyme (UCE), actin (ACT) and phospholipase A22 (PLA) were the most stable genes in Sacha inchi seedlings. For roots, stems, leaves, flowers, and seeds from adult plants, 30S ribosomal protein S13 (RPS13), cyclophilin (CYC) and elongation factor-1alpha (EF1α) were recommended as reference genes for RT-qPCR. During the development of reproductive organs, PLA, ACT and UCE were the optimal reference genes for flower development, whereas UCE, RPS13 and RNA polymerase II subunit (RPII) were optimal for seed development. Considering the entire growth cycle of Sacha inchi, UCE, ACT and EF1α were sufficient for the purpose of normalization. Our results provide useful guidelines for the selection of reliable reference genes for the normalization of RT-qPCR data for seedlings and adult plants, for reproductive organs, and for the entire growth cycle of Sacha inchi. PMID:26047338

  16. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  17. Multiplex PCR Study of Plasmid-Mediated AmpC Beta-Lactamases Genes in Clinical Isolates of Escherichia coli

    Maryam Dehghani

    2017-02-01

    Full Text Available Background:   AmpC β-lactamases are important cephalosporinases chromosomally encoded in many of Enterobacteriaceae and a few other organisms where they mediate resistance to cephalothin, cefazolin, cefoxitin and penicillins. The six different families of plasmid-mediated AmpC β-lactamases have been described, but no phenotypic test can discriminate among them. AmpC multiplex PCR has been successfully used to discriminate plasmid-mediated ampC specific families in organisms such as Klebsiella pneumonia and Escherichia coli. The aim of this study was to indicate the prevalence of AmpC β-lactamase genes by specifically designed primers through PCR test.Methods:   243 total clinical urine samples were collected, and 227 isolates were identified as Escherichia coli based on standard biochemical tests. Subsequently, the isolates were screened by disc diffusion and combined disc test for β-lactamase production. Resistant isolates were evaluated by PCR for ampC family determination. Results:  Antibiotic resistance pattern were observed as follows: cefepime (%25, ceftazidime (%31, ceftriaxone (%37, cefotaxime (%38. The ratio of isolates was detected as ESBLs and AmpC producers were 34% and 5.2%, respectively. PCR performed on 12 selected isolates via phenotypic tests and the results revealed that among 12 isolates, 11 contained blaCMY-42. Conclusion:  Unfortunately, antibiotic resistance has become an increasingly critical problem in many countries like Iran and occurrence of isolates co-expressing AmpC-β-lactamases and ESBLs can create serious problems in the future. As antibiotic options in the treatment of AmpC β-lactamases and ESBLs producing organisms are extremely limited, molecular screening by laboratories is suggested to reduce the risk of therapeutic defeat.

  18. High-Density Real-Time PCR-Based in Vivo Toxicogenomic Screen to Predict Organ-Specific Toxicity

    Laszlo G. Puskas

    2011-09-01

    Full Text Available Toxicogenomics, based on the temporal effects of drugs on gene expression, is able to predict toxic effects earlier than traditional technologies by analyzing changes in genomic biomarkers that could precede subsequent protein translation and initiation of histological organ damage. In the present study our objective was to extend in vivo toxicogenomic screening from analyzing one or a few tissues to multiple organs, including heart, kidney, brain, liver and spleen. Nanocapillary quantitative real-time PCR (QRT-PCR was used in the study, due to its higher throughput, sensitivity and reproducibility, and larger dynamic range compared to DNA microarray technologies. Based on previous data, 56 gene markers were selected coding for proteins with different functions, such as proteins for acute phase response, inflammation, oxidative stress, metabolic processes, heat-shock response, cell cycle/apoptosis regulation and enzymes which are involved in detoxification. Some of the marker genes are specific to certain organs, and some of them are general indicators of toxicity in multiple organs. Utility of the nanocapillary QRT-PCR platform was demonstrated by screening different references, as well as discovery of drug-like compounds for their gene expression profiles in different organs of treated mice in an acute experiment. For each compound, 896 QRT-PCR were done: four organs were used from each of the treated four animals to monitor the relative expression of 56 genes. Based on expression data of the discovery gene set of toxicology biomarkers the cardio- and nephrotoxicity of doxorubicin and sulfasalazin, the hepato- and nephrotoxicity of rotenone, dihydrocoumarin and aniline, and the liver toxicity of 2,4-diaminotoluene could be confirmed. The acute heart and kidney toxicity of the active metabolite SN-38 from its less toxic prodrug, irinotecan could be differentiated, and two novel gene markers for hormone replacement therapy were identified

  19. Selection of Reliable Reference Genes for Gene Expression Studies in the Biofuel Plant Jatropha curcas Using Real-Time Quantitative PCR

    Lu Zhang

    2013-12-01

    Full Text Available Jatropha curcas is a promising renewable feedstock for biodiesel and bio-jet fuel production. To study gene expression in Jatropha in different tissues throughout development and under stress conditions, we examined a total of 11 typical candidate reference genes using real-time quantitative polymerase chain reaction (RT-qPCR analysis, which is widely used for validating transcript levels in gene expression studies. The expression stability of these candidate reference genes was assessed across a total of 20 samples, including various tissues at vegetative and reproductive stages and under desiccation and cold stress treatments. The results obtained using software qBasePLUS showed that the top-ranked reference genes differed across the sample subsets. The combination of actin, GAPDH, and EF1α would be appropriate as a reference panel for normalizing gene expression data across samples at different developmental stages; the combination of actin, GAPDH, and TUB5 should be used as a reference panel for normalizing gene expression data across samples under various abiotic stress treatments. With regard to different developmental stages, we recommend the use of actin and TUB8 for normalization at the vegetative stage and GAPDH and EF1α for normalization at the reproductive stage. For abiotic stress treatments, we recommend the use of TUB5 and TUB8 for normalization under desiccation stress and GAPDH and actin for normalization under cold stress. These results are valuable for future research on gene expression during development or under abiotic stress in Jatropha. To our knowledge, this is the first report on the stability of reference genes in Jatropha.

  20. A PCR-aided transcript titration assay revealing very low expression of a gene at band 3p21 in 33 cells lines derived from all types of lung cancer

    Kok, K; Buchhagen, D L; Carritt, B; Buys, C H; van den Berg, Anke

    1993-01-01

    We have developed a general PCR-based method to quantify the amount of a specific mRNA present in a given cell line or tissue. We applied this quantitative PCR to analyse the expression of D8, a human gene which we recently identified in the chromosomal region 3p21, the common deletion region of

  1. Multiplex PCR analysis of fumonisin biosynthetic genes in fumonisin-nonproducing Aspergillus niger and A. awamori strains

    In order to determine the genetic basis for loss of fumonisin B¬2 (FB2) biosynthesis in FB2 non-producing A. niger strains, we developed multiplex PCR primer sets to amplify fragments of eight fumonisin biosynthetic pathway (fum) genes. Fragments of all eight fum genes were amplified in FB2-produci...

  2. Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

    Rozi; Rahayu, K.; Daruti, D. N.

    2018-04-01

    The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

  3. Identification of appropriate reference genes for human mesenchymal stem cell analysis by quantitative real-time PCR.

    Li, Xiuying; Yang, Qiwei; Bai, Jinping; Xuan, Yali; Wang, Yimin

    2015-01-01

    Normalization to a reference gene is the method of choice for quantitative reverse transcription-PCR (RT-qPCR) analysis. The stability of reference genes is critical for accurate experimental results and conclusions. We have evaluated the expression stability of eight commonly used reference genes found in four different human mesenchymal stem cells (MSC). Using geNorm, NormFinder and BestKeeper algorithms, we show that beta-2-microglobulin and peptidyl-prolylisomerase A were the optimal reference genes for normalizing RT-qPCR data obtained from MSC, whereas the TATA box binding protein was not suitable due to its extensive variability in expression. Our findings emphasize the significance of validating reference genes for qPCR analyses. We offer a short list of reference genes to use for normalization and recommend some commercially-available software programs as a rapid approach to validate reference genes. We also demonstrate that the two reference genes, β-actin and glyceraldehyde-3-phosphate dehydrogenase, are frequently used are not always successful in many cases.

  4. PCR detection of oxytetracycline resistance genes from diverse habitats in total community DNA and in streptomycete isolates.

    Nikolakopoulou, T.L.; Egan, S.; Overbeek, van L.S.; Guillaume, G.; Heuer, H.; Wellington, E.M.H.; Elsas, van J.D.; Collard, J.M.; Smalla, K.; Karagouni, A.D.

    2005-01-01

    A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (TcR) streptomycete isolates from

  5. In situ detection of the Clostridium botulinum type C1 toxin gene in wetland sediments with a nested PCR assay

    Williamson, Judy L.; Rocke, Tonie E.; Aiken, Judd M.

    1999-01-01

    A nested PCR was developed for detection of the Clostridium botulinum type C1 toxin gene in sediments collected from wetlands where avian botulism outbreaks had or had not occurred. The C1 toxin gene was detected in 16 of 18 sites, demonstrating both the ubiquitous distribution of C. botulinum type C in wetland sediments and the sensitivity of the detection assay.

  6. Identification and validation of quantitative real-time reverse transcription PCR reference genes for gene expression analysis in teak (Tectona grandis L.f.).

    Galeano, Esteban; Vasconcelos, Tarcísio Sales; Ramiro, Daniel Alves; De Martin, Valentina de Fátima; Carrer, Helaine

    2014-07-22

    Teak (Tectona grandis L.f.) is currently the preferred choice of the timber trade for fabrication of woody products due to its extraordinary qualities and is widely grown around the world. Gene expression studies are essential to explore wood formation of vascular plants, and quantitative real-time reverse transcription PCR (qRT-PCR) is a sensitive technique employed for quantifying gene expression levels. One or more appropriate reference genes are crucial to accurately compare mRNA transcripts through different tissues/organs and experimental conditions. Despite being the focus of some genetic studies, a lack of molecular information has hindered genetic exploration of teak. To date, qRT-PCR reference genes have not been identified and validated for teak. Identification and cloning of nine commonly used qRT-PCR reference genes from teak, including ribosomal protein 60s (rp60s), clathrin adaptor complexes medium subunit family (Cac), actin (Act), histone 3 (His3), sand family (Sand), β-Tubulin (Β-Tub), ubiquitin (Ubq), elongation factor 1-α (Ef-1α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Expression profiles of these genes were evaluated by qRT-PCR in six tissue and organ samples (leaf, flower, seedling, root, stem and branch secondary xylem) of teak. Appropriate gene cloning and sequencing, primer specificity and amplification efficiency was verified for each gene. Their stability as reference genes was validated by NormFinder, BestKeeper, geNorm and Delta Ct programs. Results obtained from all programs showed that TgUbq and TgEf-1α are the most stable genes to use as qRT-PCR reference genes and TgAct is the most unstable gene in teak. The relative expression of the teak cinnamyl alcohol dehydrogenase (TgCAD) gene in lignified tissues at different ages was assessed by qRT-PCR, using TgUbq and TgEf-1α as internal controls. These analyses exposed a consistent expression pattern with both reference genes. This study proposes a first broad

  7. Multiplex polymerase chain reaction (PCR) and fluorescence-based ...

    reading 7

    2011-12-28

    Dec 28, 2011 ... mitochondrial DNA and cytochrome b as an internal PCR control. The amplified species- ... more labour-saving than using each pair of species- specific primers separately for .... obtained from the NCBI nucleotide data bank.

  8. Comparison of a PCR-Based Method with Culture and Direct Examination for Diagnosis of Acanthamoeba keratitis

    S Farnia

    2009-05-01

    Full Text Available "nBackground: The aim was to compare three different methods (direct examination, culture and PCR meth­ods for the diagnosis of Acanthamoeba keratitis (AK in corneal scrapes."nMethods: Twenty eight corneal scrapes and contact lenses were collected from keratitis patients and re­ferred to the De­partment of Medical Parasitology and Mycology, School of Public Health, Tehran Univer­sity of Medical Sci­ences. Corneal scrapes were divided in three parts for direct examination, culture on non-nutrient agar and PCR analysis. PCR analysis was also performed using a 18S rRNA gene primer pair (DF3 region. DF3 (Diagnostic frag­ment 3 is a region of the nuclear small subunit ribosomal RNA gene which is specific for detecting Acan­thamoeba strains."nResults:  Acanthamoeba was the causative agent of keratitis in 50% of the patients. Direct smear of all pre­pared corneal scrapes in AK patients was negative and culture was positive in only 14.3% of the isolates. PCR analysis was positive in 71.4% of AK patients. These three methods were negative in corneal scrapes of non-AK patients. The sensitivity and specificity of PCR technique for the detection of Acanthamoeba sp. were calculated as 71.4% and 100%, respectively."nConclusion: According to high sensitivity and specificity of PCR-based method, this study confirmed that PCR using 18S rRNA gene primers (DF3 region is more useful for detecting AK cases compare to culture and direct microscopy methods.

  9. APPLICATION OF CDNA MICROARRAY TECHNOLOGY TO IN VITRO TOXICOLOGY AND THE SELECTION OF GENES FOR A REAL TIME RT-PCR-BASED SCREEN FOR OXIDATIVE STRESS IN HEP-G2 CELLS

    Large-scale analysis of gene expression using cDNA microarrays promises therapid detection of the mode of toxicity for drugs and other chemicals. cDNAmicroarrays were used to examine chemically-induced alterations of geneexpression in HepG2 cells exposed to oxidative ...

  10. Long-PCR based next generation sequencing of the whole mitochondrial genome of the peacock skate Pavoraja nitida (Elasmobranchii: Arhynchobatidae).

    Yang, Lei; Naylor, Gavin J P

    2016-01-01

    We determined the complete mitochondrial genome sequence (16,760 bp) of the peacock skate Pavoraja nitida using a long-PCR based next generation sequencing method. It has 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 control region in the typical vertebrate arrangement. Primers, protocols, and procedures used to obtain this mitogenome are provided. We anticipate that this approach will facilitate rapid collection of mitogenome sequences for studies on phylogenetic relationships, population genetics, and conservation of cartilaginous fishes.

  11. Validation of reference genes for RT-qPCR analysis of CYP4T expression in crucian carp

    Fei Mo

    2014-09-01

    Full Text Available Reference genes are commonly used for normalization of target gene expression during RT-qPCR analysis. However, no housekeeping genes or reference genes have been identified to be stable across different tissue types or under different experimental conditions. To identify the most suitable reference genes for RT-qPCR analysis of target gene expression in the hepatopancreas of crucian carp (Carassius auratus under various conditions (sex, age, water temperature, and drug treatments, seven reference genes, including beta actin (ACTB, beta-2 microglobulin (B2M, embryonic elongation factor-1 alpha (EEF1A, glyceraldehyde phosphate dehydrogenase (GAPDH, alpha tubulin (TUBA, ribosomal protein l8 (RPL8 and glucose-6-phosphate dehydrogenase (G6PDH, were evaluated in this study. The stability and ranking of gene expression were analyzed using three different statistical programs: GeNorm, Normfinder and Bestkeeper. The expression errors associated with selection of the genes were assessed by the relative quantity of CYP4T. The results indicated that all the seven genes exhibited variability under the experimental conditions of this research, and the combination of ACTB/TUBA/EEF1A or of ACTB/EEF1A was the best candidate that raised the accuracy of quantitative analysis of gene expression. The findings highlighted the importance of validation of housekeeping genes for research on gene expression under different conditions of experiment and species.

  12. A tissue biopsy-based epigenetic multiplex PCR assay for prostate cancer detection

    Van Neste Leander

    2012-06-01

    Full Text Available Abstract Background PSA-directed prostate cancer screening leads to a high rate of false positive identifications and an unnecessary biopsy burden. Epigenetic biomarkers have proven useful, exhibiting frequent and abundant inactivation of tumor suppressor genes through such mechanisms. An epigenetic, multiplex PCR test for prostate cancer diagnosis could provide physicians with better tools to help their patients. Biomarkers like GSTP1, APC and RASSF1 have demonstrated involvement with prostate cancer, with the latter two genes playing prominent roles in the field effect. The epigenetic states of these genes can be used to assess the likelihood of cancer presence or absence. Results An initial test cohort of 30 prostate cancer-positive samples and 12 cancer-negative samples was used as basis for the development and optimization of an epigenetic multiplex assay based on the GSTP1, APC and RASSF1 genes, using methylation specific PCR (MSP. The effect of prostate needle core biopsy sample volume and age of formalin-fixed paraffin-embedded (FFPE samples was evaluated on an independent follow-up cohort of 51 cancer-positive patients. Multiplexing affects copy number calculations in a consistent way per assay. Methylation ratios are therefore altered compared to the respective singleplex assays, but the correlation with patient outcome remains equivalent. In addition, tissue-biopsy samples as small as 20 μm can be used to detect methylation in a reliable manner. The age of FFPE-samples does have a negative impact on DNA quality and quantity. Conclusions The developed multiplex assay appears functionally similar to individual singleplex assays, with the benefit of lower tissue requirements, lower cost and decreased signal variation. This assay can be applied to small biopsy specimens, down to 20 microns, widening clinical applicability. Increasing the sample volume can compensate the loss of DNA quality and quantity in older samples.

  13. Real-time PCR to supplement gold-standard culture-based detection of Legionella in environmental samples.

    Collins, S; Jorgensen, F; Willis, C; Walker, J

    2015-10-01

    Culture remains the gold-standard for the enumeration of environmental Legionella. However, it has several drawbacks including long incubation and poor sensitivity, causing delays in response times to outbreaks of Legionnaires' disease. This study aimed to validate real-time PCR assays to quantify Legionella species (ssrA gene), Legionella pneumophila (mip gene) and Leg. pneumophila serogroup-1 (wzm gene) to support culture-based detection in a frontline public health laboratory. Each qPCR assay had 100% specificity, excellent sensitivity (5 GU/reaction) and reproducibility. Comparison of the assays to culture-based enumeration of Legionella from 200 environmental samples showed that they had a negative predictive value of 100%. Thirty eight samples were positive for Legionella species by culture and qPCR. One hundred samples were negative by both methods, whereas 62 samples were negative by culture but positive by qPCR. The average log10 increase between culture and qPCR for Legionella spp. and Leg. pneumophila was 0·72 (P = 0·0002) and 0·51 (P = 0·006), respectively. The qPCR assays can be conducted on the same 1 l water sample as culture thus can be used as a supplementary technique to screen out negative samples and allow more rapid indication of positive samples. The assay could prove informative in public health investigations to identify or rule out sources of Legionella as well as to specifically identify Leg. pneumophila serogroup 1 in a timely manner not possible with culture. © 2015 The Society for Applied Microbiology.

  14. Quantitative PCR analysis reveals a high incidence of large intragenic deletions in the FANCA gene in Spanish Fanconi anemia patients.

    Callén, E; Tischkowitz, M D; Creus, A; Marcos, R; Bueren, J A; Casado, J A; Mathew, C G; Surrallés, J

    2004-01-01

    Fanconi anaemia is an autosomal recessive disease characterized by chromosome fragility, multiple congenital abnormalities, progressive bone marrow failure and a high predisposition to develop malignancies. Most of the Fanconi anaemia patients belong to complementation group FA-A due to mutations in the FANCA gene. This gene contains 43 exons along a 4.3-kb coding sequence with a very heterogeneous mutational spectrum that makes the mutation screening of FANCA a difficult task. In addition, as the FANCA gene is rich in Alu sequences, it was reported that Alu-mediated recombination led to large intragenic deletions that cannot be detected in heterozygous state by conventional PCR, SSCP analysis, or DNA sequencing. To overcome this problem, a method based on quantitative fluorescent multiplex PCR was proposed to detect intragenic deletions in FANCA involving the most frequently deleted exons (exons 5, 11, 17, 21 and 31). Here we apply the proposed method to detect intragenic deletions in 25 Spanish FA-A patients previously assigned to complementation group FA-A by FANCA cDNA retroviral transduction. A total of eight heterozygous deletions involving from one to more than 26 exons were detected. Thus, one third of the patients carried a large intragenic deletion that would have not been detected by conventional methods. These results are in agreement with previously published data and indicate that large intragenic deletions are one of the most frequent mutations leading to Fanconi anaemia. Consequently, this technology should be applied in future studies on FANCA to improve the mutation detection rate. Copyright 2003 S. Karger AG, Basel

  15. Validation of Suitable Reference Genes for RT-qPCR Data in Achyranthes bidentata Blume under Different Experimental Conditions

    Jinting Li

    2017-05-01

    Full Text Available Real-time quantitative polymerase chain reaction (RT-qPCR is a sensitive technique for gene expression studies. However, choosing the appropriate reference gene is essential to obtain reliable results for RT-qPCR assays. In the present work, the expression of eight candidate reference genes, EF1-α (elongation factor 1-α, GAPDH (glyceraldehyde 3-phosphate dehydrogenase, UBC (ubiquitin-conjugating enzyme, UBQ (polyubiquitin, ACT (actin, β-TUB (β-tubulin, APT1 (adenine phosphoribosyltransferase 1, and 18S rRNA (18S ribosomal RNA, was evaluated in Achyranthes bidentata samples using two algorithms, geNorm and NormFinder. The samples were classified into groups according to developmental stages, various tissues, stresses (cold, heat, drought, NaCl, and hormone treatments (MeJA, IBA, SA. Suitable combination of reference genes for RT-qPCR normalization should be applied according to different experimental conditions. In this study, EF1-α, UBC, and ACT genes were verified as the suitable reference genes across all tested samples. To validate the suitability of the reference genes, we evaluated the relative expression of CAS, which is a gene that may be involved in phytosterol synthesis. Our results provide the foundation for gene expression analysis in A. bidentata and other species of Amaranthaceae.

  16. Evaluation of reference genes for quantitative real-time PCR in oil palm elite planting materials propagated by tissue culture.

    Pek-Lan Chan

    Full Text Available BACKGROUND: The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR. With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. RESULTS: In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569 outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN. PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. CONCLUSIONS: Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection

  17. Evaluation and validation of candidate endogenous control genes for real-time quantitative PCR studies of breast cancer

    Miller Nicola

    2007-11-01

    Full Text Available Abstract Background Real-time quantitative PCR (RQ-PCR forms the basis of many breast cancer biomarker studies and novel prognostic assays, paving the way towards personalised cancer treatments. Normalisation of relative RQ-PCR data is required to control for non-biological variation introduced during sample preparation. Endogenous control (EC genes, used in this context, should ideally be expressed constitutively and uniformly across treatments in all test samples. Despite widespread recognition that the accuracy of the normalised data is largely dependent on the reliability of the EC, there are no reports of the systematic validation of genes commonly used for this purpose in the analysis of gene expression by RQ-PCR in primary breast cancer tissues. The aim of this study was to identify the most suitable endogenous control genes for RQ-PCR analysis of primary breast tissue from a panel of eleven candidates in current use. Oestrogen receptor alpha (ESR1 was used a target gene to compare the effect of choice of EC on the estimate of gene quantity. Results The expression and validity of candidate ECs (GAPDH, TFRC, ABL, PPIA, HPRT1, RPLP0, B2M, GUSB, MRPL19, PUM1 and PSMC4 was determined in 6 benign and 21 malignant primary breast cancer tissues. Gene expression data was analysed using two different statistical models. MRPL19 and PPIA were identified as the most stable and reliable EC genes, while GUSB, RPLP0 and ABL were least stable. There was a highly significant difference in variance between ECs. ESR1 expression was appreciably higher in malignant compared to benign tissues and there was a significant effect of EC on the magnitude of the error associated with the relative quantity of ESR1. Conclusion We have validated two endogenous control genes, MRPL19 and PPIA, for RQ-PCR analysis of gene expression in primary breast tissue. Of the genes in current use in this field, the above combination offers increased accuracy and resolution in the

  18. Evaluation of Reference Genes for Quantitative Real-Time PCR in Oil Palm Elite Planting Materials Propagated by Tissue Culture

    Chan, Pek-Lan; Rose, Ray J.; Abdul Murad, Abdul Munir; Zainal, Zamri; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ooi, Siew-Eng; Yahya, Suzaini; Singh, Rajinder

    2014-01-01

    Background The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR). With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. Results In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper) confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569) outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN). PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. Conclusions Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection of appropriate

  19. Construction of an adult barnacle (Balanus amphitrite cDNA library and selection of reference genes for quantitative RT-PCR studies

    Burgess J Grant

    2009-06-01

    Full Text Available Abstract Background Balanus amphitrite is a barnacle commonly used in biofouling research. Although many aspects of its biology have been elucidated, the lack of genetic information is impeding a molecular understanding of its life cycle. As part of a wider multidisciplinary approach to reveal the biogenic cues influencing barnacle settlement and metamorphosis, we have sequenced and annotated the first cDNA library for B. amphitrite. We also present a systematic validation of potential reference genes for normalization of quantitative real-time PCR (qRT-PCR data obtained from different developmental stages of this animal. Results We generated a cDNA library containing expressed sequence tags (ESTs from adult B. amphitrite. A total of 609 unique sequences (comprising 79 assembled clusters and 530 singlets were derived from 905 reliable unidirectionally sequenced ESTs. Bioinformatics tools such as BLAST, HMMer and InterPro were employed to allow functional annotation of the ESTs. Based on these analyses, we selected 11 genes to study their ability to normalize qRT-PCR data. Total RNA extracted from 7 developmental stages was reverse transcribed and the expression stability of the selected genes was compared using geNorm, BestKeeper and NormFinder. These software programs produced highly comparable results, with the most stable gene being mt-cyb, while tuba, tubb and cp1 were clearly unsuitable for data normalization. Conclusion The collection of B. amphitrite ESTs and their annotation has been made publically available representing an important resource for both basic and applied research on this species. We developed a qRT-PCR assay to determine the most reliable reference genes. Transcripts encoding cytochrome b and NADH dehydrogenase subunit 1 were expressed most stably, although other genes also performed well and could prove useful to normalize gene expression studies.

  20. A novel gene signature for molecular diagnosis of human prostate cancer by RT-qPCR.

    Federica Rizzi

    Full Text Available Prostate cancer (CaP is one of the most relevant causes of cancer death in Western Countries. Although detection of CaP at early curable stage is highly desirable, actual screening methods present limitations and new molecular approaches are needed. Gene expression analysis increases our knowledge about the biology of CaP and may render novel molecular tools, but the identification of accurate biomarkers for reliable molecular diagnosis is a real challenge. We describe here the diagnostic power of a novel 8-genes signature: ornithine decarboxylase (ODC, ornithine decarboxylase antizyme (OAZ, adenosylmethionine decarboxylase (AdoMetDC, spermidine/spermine N(1-acetyltransferase (SSAT, histone H3 (H3, growth arrest specific gene (GAS1, glyceraldehyde 3-phosphate dehydrogenase (GAPDH and Clusterin (CLU in tumour detection/classification of human CaP.The 8-gene signature was detected by retrotranscription real-time quantitative PCR (RT-qPCR in frozen prostate surgical specimens obtained from 41 patients diagnosed with CaP and recommended to undergo radical prostatectomy (RP. No therapy was given to patients at any time before RP. The bio-bank used for the study consisted of 66 specimens: 44 were benign-CaP paired from the same patient. Thirty-five were classified as benign and 31 as CaP after final pathological examination. Only molecular data were used for classification of specimens. The Nearest Neighbour (NN classifier was used in order to discriminate CaP from benign tissue. Validation of final results was obtained with 10-fold cross-validation procedure. CaP versus benign specimens were discriminated with (80+/-5% accuracy, (81+/-6% sensitivity and (78+/-7% specificity. The method also correctly classified 71% of patients with Gleason score or =7, an important predictor of final outcome.The method showed high sensitivity in a collection of specimens in which a significant portion of the total (13/31, equal to 42% was considered CaP on the basis

  1. Genotyping of β-Lactoglobulin gene by PCR-RFLP in Sahiwal and Tharparkar cattle breeds

    Gupta Neelam

    2006-05-01

    Full Text Available Abstract Background Improvement of efficiency and economic returns is an important goal in dairy farming, as in any agricultural enterprise. The primary goal of dairy industry has been to identify an efficient and economical way of increasing milk production and its constituents without increasing the size of the dairy herd. Selection of animals with desirable genotypes and mating them to produce the next generation has been the basis of livestock improvement and this would continue to remain the same in the coming years. The use of polymorphic genes as detectable molecular markers is a promising alternative to the current methods of trait selection once these genes are proven to be associated with traits of interest in animals. The point mutations in exon IV of bovine β-Lactoglobulin gene determine two allelic variants A and B. These variants were distinguished by Polymerase Chain Reaction and Restriction Fragment Length Polymorphism (PCR-RFLP analysis in two indigenous Bos indicus breeds viz. Sahiwal and Tharparkar cattle. DNA samples (228 in Sahiwal and 86 in Tharparkar were analyzed for allelic variants of β-Lactoglobulin gene. Polymorphism was detected by digestion of PCR amplified products with Hae III enzyme, and separation on 12% non-denaturing gels and resolved by silver staining. Results The allele B of β-Lactoglobulin occurred at a higher frequency than the allele A in both Sahiwal and Tharparkar breeds. The genotypic frequencies of AA, AB, and BB in Sahiwal and Tharparkar breeds were 0.031, 0.276, 0.693 and 0.023, 0.733, 0.244 respectively. Frequencies of A and B alleles were 0.17 and 0.83, and 0.39 and 0.61 in Sahiwal and Tharparkar breeds respectively. The Chi-square test results (at one degree of freedom at one per cent level revealed that the Tharparkar population was not in Hardy-Weinberg equilibrium as there was a continuous migration of animals in the herd studied, where as, the results are not significant for the Sahiwal

  2. The TEL-AML1 real-time quantitative polymerase chain reaction (PCR) might replace the antigen receptor-based genomic PCR in clinical minimal residual disease studies in children with acute lymphoblastic leukaemia

    de Haas, V.; Breunis, W. B.; dee, R.; Verhagen, O. J. H. M.; Kroes, W.; van Wering, E. R.; van Dongen, J. J. M.; van den Berg, H.; van der Schoot, C. E.

    2002-01-01

    Prospective studies in children with B-precursor acute lymphoblastic leukaemia (ALL) have shown that polymerase chain reaction (PCR)-based detection of minimal residual disease (MRD) using immunoglobin (Ig) and T-cell receptor (TCR) gene rearrangements as targets can be used to identify patients

  3. Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

    Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

    1995-06-01

    For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

  4. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues or cells under investigation

  5. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Radtke Arnold

    2008-11-01

    Full Text Available Abstract Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR. The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC is presented. Methods Six genes, beta-2-microglobulin (B2M, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, hydroxymethyl-bilane synthase (HMBS, hypoxanthine phosphoribosyl-transferase 1 (HPRT1, succinate dehydrogenase complex, subunit A (SDHA and ubiquitin C (UBC, with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the

  6. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Methods Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues

  7. Quality control for quantitative PCR based on amplification compatibility test

    Tichopád, Aleš; Bar, T.; Pecen, Ladislav; Kitchen, R.R.; Kubista, Mikael; Pfaffl, M.W.

    2010-01-01

    Roč. 50, č. 4 (2010), s. 308-312 ISSN 1046-2023 R&D Projects: GA AV ČR IAA500520809; GA AV ČR IAA500970904 Institutional research plan: CEZ:AV0Z50520701 Keywords : Quantitative PCR * Quality control * Amplification efficiency Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.527, year: 2010

  8. Identification of reference genes for expression analysis by real-time quantitative PCR in drought-stressed soybean

    Renata Stolf-Moreira

    2011-01-01

    Full Text Available The objective of this work was to validate, by quantitative PCR in real time (RT-qPCR, genes to be used as reference in studies of gene expression in soybean in drought-stressed trials. Four genes commonly used in soybean were evaluated: Gmβ-actin, GmGAPDH, GmLectin and GmRNAr18S. Total RNA was extracted from six samples: three from roots in a hydroponic system with different drought intensities (0, 25, 50, 75 and 100 minutes of water stress, and three from leaves of plants grown in sand with different soil moistures (15, 5 and 2.5% gravimetric humidity. The raw cycle threshold (Ct data were analyzed, and the efficiency of each primer was calculated for an overall analysis of the Ct range among the different samples. The GeNorm application was used to evaluate the best reference gene, according to its stability. The GmGAPDH was the least stable gene, with the highest mean values of expression stability (M, and the most stable genes, with the lowest M values, were the Gmβ-actin and GmRNAr18S, when both root and leaves samples were tested. These genes can be used in RT-qPCR as reference gene for expression analysis.

  9. PCR-based diagnosis, molecular characterization and detection of atypical strains of avian Chlamydia psittaci in companion and wild birds.

    Madani, S A; Peighambari, S M

    2013-02-01

    Chlamydiosis is one of the most important infectious diseases of birds. In this study, 253 clinical samples were taken from 27 bird species belonging to seven orders. Thirty-two (12.6%) samples were positive for Chlamydia psittaci major outer membrane gene (ompA) DNA by a nested polymerase chain reaction (PCR). Twelve nested PCR-positive specimens were typed by ompA gene-based PCR-restricted fragment length polymorphism, using CTU/CTL primers and AluI restriction enzyme. Four restriction patterns were identified, including genotype A (two specimens from an African grey parrot [Psittacus erithacus] and a lorikeet [Trichoglossus haematodus]), genotype B (two specimens from a rock dove [Columbia livia] and a canary [Serinus canaria]), a third new restriction pattern (six specimens from African grey parrots), and a fourth new restriction pattern (two specimens from a ring-necked parakeet [Psittacula krameri] and an Alexandrine parakeet [Psittacula eupatria]). The third and the fourth restriction patterns are suggested to be provisional genotypes I and J, respectively. Partial sequencing of the ompA gene of seven specimens completely correlated with the results of PCR-restricted fragment length polymorphism and confirmed the presence of genotypes A and B and the two new provisional genotypes I and J. The two new genotypes have the closest identity with C. psittaci genotype F and Chlamydia abortus, respectively. From an evolutionary perspective, both new genotypes, particularly genotype J, are intermediate between the two species, C. psittaci and C. abortus.

  10. Determining the analytical specificity of PCR-based assays for the diagnosis of IA: What is Aspergillus?

    Morton, C Oliver; White, P Lewis; Barnes, Rosemary A; Klingspor, Lena; Cuenca-Estrella, Manuel; Lagrou, Katrien; Bretagne, Stéphane; Melchers, Willem; Mengoli, Carlo; Caliendo, Angela M; Cogliati, Massimo; Debets-Ossenkopp, Yvette; Gorton, Rebecca; Hagen, Ferry; Halliday, Catriona; Hamal, Petr; Harvey-Wood, Kathleen; Jaton, Katia; Johnson, Gemma; Kidd, Sarah; Lengerova, Martina; Lass-Florl, Cornelia; Linton, Chris; Millon, Laurence; Morrissey, C Orla; Paholcsek, Melinda; Talento, Alida Fe; Ruhnke, Markus; Willinger, Birgit; Donnelly, J Peter; Loeffler, Juergen

    2017-06-01

    A wide array of PCR tests has been developed to aid the diagnosis of invasive aspergillosis (IA), providing technical diversity but limiting standardisation and acceptance. Methodological recommendations for testing blood samples using PCR exist, based on achieving optimal assay sensitivity to help exclude IA. Conversely, when testing more invasive samples (BAL, biopsy, CSF) emphasis is placed on confirming disease, so analytical specificity is paramount. This multicenter study examined the analytical specificity of PCR methods for detecting IA by blind testing a panel of DNA extracted from a various fungal species to explore the range of Aspergillus species that could be detected, but also potential cross reactivity with other fungal species. Positivity rates were calculated and regression analysis was performed to determine any associations between technical specifications and performance. The accuracy of Aspergillus genus specific assays was 71.8%, significantly greater (P Aspergillus species (47.2%). For genus specific assays the most often missed species were A. lentulus (25.0%), A. versicolor (24.1%), A. terreus (16.1%), A. flavus (15.2%), A. niger (13.4%), and A. fumigatus (6.2%). There was a significant positive association between accuracy and using an Aspergillus genus PCR assay targeting the rRNA genes (P = .0011). Conversely, there was a significant association between rRNA PCR targets and false positivity (P = .0032). To conclude current Aspergillus PCR assays are better suited for detecting A. fumigatus, with inferior detection of most other Aspergillus species. The use of an Aspergillus genus specific PCR assay targeting the rRNA genes is preferential. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. A TaqMan real-time PCR-based assay for the identification of Fasciola spp.

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-30

    Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Diagnosis of Giardia infections by PCR-based methods in children of an endemic area

    EB David

    2011-01-01

    Full Text Available The present study was designed to estimate the prevalence of Giardia infection in preschool- and school-aged children living in an endemic area. Fecal samples from 573 children were processed by zinc sulfate centrifugal flotation, centrifugal sedimentation (using a commercial device for fecal concentration - TF-Test kit® and polymerase chain reaction (PCR-based methods. Of the stool samples assessed, 277 (48.3% were positive for intestinal parasites and/or commensal protozoa. Centrifugal flotation presented the highest diagnostic sensitivity for Giardia infections. The kappa index revealed that both coproparasitological techniques closely agreed on the Giardia diagnosis (86% versus satisfactory (72% and poor (35% concordances for commensal protozoan and helminth infections, respectively. Concerning Giardia molecular diagnosis, from the 71 microscopy-positive samples, specific amplification of gdh and tpi fragments was noted in 68 (95.7% and 64 (90% samples, respectively. Amplification of gdh and tpi genes was observed, respectively, in 95.7% and 90% of microscopy-positive Giardia samples. For 144 microscopy-negative samples, gdh and tpi gene amplification products were obtained from 8.3% and 35.9% samples, respectively. The agreement between these genes was about 40%. The centrifuge-flotation based method was the most suitable means of Giardia diagnosis assessed in the present study by combining accuracy and low cost.

  13. Reference gene selection for real-time quantitative PCR analysis of the mouse uterus in the peri-implantation period.

    Pengfei Lin

    Full Text Available The study of uterine gene expression patterns is valuable for understanding the biological and molecular mechanisms that occur during embryo implantation. Real-time quantitative RT-PCR (qRT-PCR is an extremely sensitive technique that allows for the precise quantification of mRNA abundance; however, selecting stable reference genes suitable for the normalization of qRT-PCR data is required to avoid the misinterpretation of experimental results and erroneous analyses. This study employs several mouse models, including an early pregnancy, a pseudopregnancy, a delayed implantation and activation, an artificial decidualization and a hormonal treatment model; ten candidate reference genes (PPIA, RPLP0, HPRT1, GAPDH, ACTB, TBP, B2M, 18S, UBC and TUBA that are found in uterine tissues were assessed for their suitability as internal controls for relative qRT-PCR quantification. GeNorm(PLUS, NormFinder, and BestKeeper were used to evaluate these candidate reference genes, and all of these methods identified RPLP0 and GAPDH as the most stable candidates and B2M and 18S as the least stable candidates. However, when the different models were analyzed separately, the reference genes exhibited some variation in their expression levels.

  14. Stability of Reference Genes for Messenger RNA Quantification by Real-Time PCR in Mouse Dextran Sodium Sulfate Experimental Colitis.

    Nour Eissa

    Full Text Available Many animal models have been developed to characterize the complexity of colonic inflammation. In dextran sodium sulfate (DSS experimental colitis in mice the choice of reference genes is critical for accurate quantification of target genes using quantitative real time PCR (RT-qPCR. No studies have addressed the performance of reference genes in mice DSS-experimental colitis. This study aimed to determine the stability of reference genes expression (RGE in DSS-experimental murine colitis.Colitis was induced in male C57BL/6 mice using DSS5% for 5 days, control group received water. RNA was extracted from inflamed and non-inflamed colon. Using RT-qPCR, comparative analysis of 13 RGE was performed according to predefined criteria and relative colonic TNF-α and IL-1β gene expression was determined by calculating the difference in the threshold cycle.Colitis significantly altered the stability of mucosal RGE. Commonly used glyceraldehyde-3-phosphate dehydrogenase (Gapdh, β-actin (Actb, or β2-microglobulin (β2m showed the highest variability within the inflamed and control groups. Conversely, TATA-box-binding protein (Tbp and eukaryotic translation elongation factor 2 (Eef2 were not affected by inflammation and were the most stable genes. Normalization of colonic TNF-α and IL-1β mRNA levels was dependent on the reference gene used. Depending on the genes used to normalize the data, statistical significance varied from significant when TBP / Eef2 were used to non-significant when Gapdh, Actb or β2m were used.This study highlights the appropriate choice of RGE to ensure adequate normalization of RT-qPCR data when using this model. Suboptimal RGE may explain controversial results from published studies. We recommend using Tbp and Eef2 instead of Gapdh, Actb or β2m as reference genes.

  15. Identification of internal control genes for quantitative expression analysis by real-time PCR in bovine peripheral lymphocytes.

    Spalenza, Veronica; Girolami, Flavia; Bevilacqua, Claudia; Riondato, Fulvio; Rasero, Roberto; Nebbia, Carlo; Sacchi, Paola; Martin, Patrice

    2011-09-01

    Gene expression studies in blood cells, particularly lymphocytes, are useful for monitoring potential exposure to toxicants or environmental pollutants in humans and livestock species. Quantitative PCR is the method of choice for obtaining accurate quantification of mRNA transcripts although variations in the amount of starting material, enzymatic efficiency, and the presence of inhibitors can lead to evaluation errors. As a result, normalization of data is of crucial importance. The most common approach is the use of endogenous reference genes as an internal control, whose expression should ideally not vary among individuals and under different experimental conditions. The accurate selection of reference genes is therefore an important step in interpreting quantitative PCR studies. Since no systematic investigation in bovine lymphocytes has been performed, the aim of the present study was to assess the expression stability of seven candidate reference genes in circulating lymphocytes collected from 15 dairy cows. Following the characterization by flow cytometric analysis of the cell populations obtained from blood through a density gradient procedure, three popular softwares were used to evaluate the gene expression data. The results showed that two genes are sufficient for normalization of quantitative PCR studies in cattle lymphocytes and that YWAHZ, S24 and PPIA are the most stable genes. Copyright © 2010 Elsevier Ltd. All rights reserved.

  16. Evaluation of reference genes for real-time quantitative PCR studies in Candida glabrata following azole treatment

    Li Qingdi

    2012-06-01

    Full Text Available Abstract Background The selection of stable and suitable reference genes for real-time quantitative PCR (RT-qPCR is a crucial prerequisite for reliable gene expression analysis under different experimental conditions. The present study aimed to identify reference genes as internal controls for gene expression studies by RT-qPCR in azole-stimulated Candida glabrata. Results The expression stability of 16 reference genes under fluconazole stress was evaluated using fold change and standard deviation computations with the hkgFinder tool. Our data revealed that the mRNA expression levels of three ribosomal RNAs (RDN5.8, RDN18, and RDN25 remained stable in response to fluconazole, while PGK1, UBC7, and UBC13 mRNAs showed only approximately 2.9-, 3.0-, and 2.5-fold induction by azole, respectively. By contrast, mRNA levels of the other 10 reference genes (ACT1, EF1α, GAPDH, PPIA, RPL2A, RPL10, RPL13A, SDHA, TUB1, and UBC4 were dramatically increased in C. glabrata following antifungal treatment, exhibiting changes ranging from 4.5- to 32.7-fold. We also assessed the expression stability of these reference genes using the 2-ΔΔCT method and three other software packages. The stability rankings of the reference genes by geNorm and the 2-ΔΔCT method were identical to those by hkgFinder, whereas the stability rankings by BestKeeper and NormFinder were notably different. We then validated the suitability of six candidate reference genes (ACT1, PGK1, RDN5.8, RDN18, UBC7, and UBC13 as internal controls for ten target genes in this system using the comparative CT method. Our validation experiments passed for all six reference genes analyzed except RDN18, where the amplification efficiency of RDN18 was different from that of the ten target genes. Finally, we demonstrated that the relative quantification of target gene expression varied according to the endogenous control used, highlighting the importance of the choice of internal controls in such

  17. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  18. Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

    Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

  19. Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

    Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

    2008-01-01

    Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory

  20. Expression stabilities of candidate reference genes for RT-qPCR under different stress conditions in soybean.

    Shuhua Ma

    Full Text Available Due to its accuracy, sensitivity and high throughput, real time quantitative PCR (RT-qPCR has been widely used in analysing gene expression. The quality of data from such analyses is affected by the quality of reference genes used. Expression stabilities for nine candidate reference genes widely used in soybean were evaluated under different stresses in this study. Our results showed that EF1A and ACT11 were the best under salinity stress, TUB4, TUA5 and EF1A were the best under drought stress, ACT11 and UKN2 were the best under dark treatment, and EF1B and UKN2 were the best under virus infection. EF1B and UKN2 were the top two genes which can be reliably used in all of the stress conditions assessed.

  1. Suitable reference genes for real-time PCR in human HBV-related hepatocellular carcinoma with different clinical prognoses

    Fu, Li-Yun; Jia, Hu-Liang; Dong, Qiong-Zhu; Wu, Jin-Cai; Zhao, Yue; Zhou, Hai-Jun; Ren, Ning; Ye, Qin-Hai; Qin, Lun-Xiu

    2009-01-01

    Housekeeping genes are routinely used as endogenous references to account for experimental differences in gene expression assays. However, recent reports show that they could be de-regulated in different diseases, model animals, or even under varied experimental conditions, which may lead to unreliable results and consequently misinterpretations. This study focused on the selection of suitable reference genes for quantitative PCR in human hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC) with different clinical outcomes. We evaluated 6 commonly used housekeeping genes' expression levels in 108 HBV-related HCCs' matched tumor and non-tomor tissue samples with different clinical outcomes and 26 normal liver specimens by real-time PCR. The expression stability of the 6 genes was compared using the software programs geNorm and NormFinder. To show the impact of reference genes on data analysis, we took PGK1 as a target gene normalized by each reference gene, and performed one-way ANOVA and the equivalence test. With the geNorm and NormFinder software programs, analysis of TBP and HPRT1 showed the best stability in all tissue samples, while 18s and ACTB were less stable. When 18s or ACTB was used for normalization, no significant difference of PGK1 expression (p > 0.05) was found among HCC tissues with and without metastasis, and normal liver specimens; however, dramatically differences (p < 0.001) were observed when either TBP or the combination of TBP and HPRT1 were selected as reference genes. TBP and HPRT1 are the most reliable reference genes for q-PCR normalization in HBV-related HCC specimens. However, the well-used ACTB and 18S are not suitable, which actually lead to the misinterpretation of the results in gene expression analysis

  2. A PCR-based epidemiological survey of Hepatozoon canis in dogs in Nigeria.

    Sasaki, Mizuki; Omobowale, Olutayo; Ohta, Kaisaku; Tozuka, Morito; Matsuu, Aya; Hirata, Haruyuki; Nottidge, Helen Oyebukola; Ikadai, Hiromi; Oyamada, Takashi

    2008-07-01

    The prevalence of Hepatozoon canis infections in dogs in Nigeria was surveyed using molecular methods. DNA was extracted from blood samples obtained from 400 dogs. A primer set that amplified the Babesia canis 18S rRNA gene, which has high similarity to the H. canis 18S rRNA gene, was used for the PCR. As a result, samples from 81 dogs (20.3%) produced 757 bp bands, which differed from the 698 bp band that corresponded to B. canis infection. The sequence of the PCR products of 10 samples were determined, all of which corresponded with the H. canis sequence.

  3. In situ reverse transcription-PCR for monitoring gene expression in individual Methanosarcina mazei S-6 cells

    Lange, Marianne; Tolker-Nielsen, Tim; Molin, Søren

    2000-01-01

    An in situ reverse transcription-PCR protocol for detecting specific mRNA in Methanosarcina mazei S-6 is described. This method allowed us to detect heat shock-induced increases in the intracellular levels of the transcript of the universal stress gene dnaK. The cell walls of paraformaldehyde...

  4. PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

    Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

    2009-01-01

    Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

  5. In situ PCR detection and significance of IL-3 gene expression in irradiated hematopoietic cells of mouse bone marrow

    Peng Ruiyun; Wang Dewen; Xiong Chengqi; Gao Yabing; Li Yanping; Yang Hong; Cui Yufang

    2000-01-01

    Objective: To study the significance of endogenous interleukin 3(IL-3) gene expression in repair of irradiated mouse bone marrow. Methods: Seventy-eight LACA mice were subjected to total body irradiation with 60 Co γ-rays and were sacrificed within 4 weeks after irradiation. The bone marrow histopathological sections were stained with HE, and the expression of endogenous IL-3 gene was detected by means of immunocytochemistry,in situ hybridization(ISH) and in situ reverse transcription PCR(IS RT-PCR). Results: Obvious injury of bone marrow occurred after irradiation and then recovered within 4 weeks. IL-3 protein was obviously increased in the cytoplasm of recovering hematopoietic cells(HCs), especially on day 21 after irradiation, while its mRNA was poorly positive by ISH on days 10-21, especially day 15.IS RT-PCR showed that IL-3 mRNA was strongly positive in recovering HCs cytoplasm, especially on days 10 to 15. Conclusion: In situ RT-PCR can objectively reflect the regulation of IL-3 gene expression in bone marrow after irradiation, and the expression of endogenous IL-3 gene may play an important role in hematopoietic reconstruction of irradiated bone marrow

  6. Clinical Assessment of a Nocardia PCR-Based Assay for Diagnosis of Nocardiosis.

    Rouzaud, Claire; Rodriguez-Nava, Véronica; Catherinot, Emilie; Méchaï, Frédéric; Bergeron, Emmanuelle; Farfour, Eric; Scemla, Anne; Poirée, Sylvain; Delavaud, Christophe; Mathieu, Daniel; Durupt, Stéphane; Larosa, Fabrice; Lengelé, Jean-Philippe; Christophe, Jean-Louis; Suarez, Felipe; Lortholary, Olivier; Lebeaux, David

    2018-06-01

    The diagnosis of nocardiosis, a severe opportunistic infection, is challenging. We assessed the specificity and sensitivity of a 16S rRNA Nocardia PCR-based assay performed on clinical samples. In this multicenter study (January 2014 to April 2015), patients who were admitted to three hospitals and had an underlying condition favoring nocardiosis, clinical and radiological signs consistent with nocardiosis, and a Nocardia PCR assay result for a clinical sample were included. Patients were classified as negative control (NC) (negative Nocardia culture results and proven alternative diagnosis or improvement at 6 months without anti- Nocardia treatment), positive control (PC) (positive Nocardia culture results), or probable nocardiosis (positive Nocardia PCR results, negative Nocardia culture results, and no alternative diagnosis). Sixty-eight patients were included; 47 were classified as NC, 8 as PC, and 13 as probable nocardiosis. PCR results were negative for 35/47 NC patients (74%). For the 12 NC patients with positive PCR results, the PCR assay had been performed with respiratory samples. These NC patients had chronic bronchopulmonary disease more frequently than did the NC patients with negative PCR results (8/12 patients [67%] versus 11/35 patients [31%]; P = 0.044). PCR results were positive for 7/8 PC patients (88%). There were 13 cases of probable nocardiosis, diagnosed solely using the PCR results; 9 of those patients (69%) had lung involvement (consolidation or nodule). Nocardia PCR testing had a specificity of 74% and a sensitivity of 88% for the diagnosis of nocardiosis. Nocardia PCR testing may be helpful for the diagnosis of nocardiosis in immunocompromised patients but interpretation of PCR results from respiratory samples is difficult, because the PCR assay may also detect colonization. Copyright © 2018 American Society for Microbiology.

  7. Applying real-time quantitative PCR to diagnosis of freemartin in Holstein cattle by quantifying SRY gene: a comparison experiment

    Qinghua Qiu

    2018-04-01

    Full Text Available Background Freemartinism generally occurs in female offspring of dizygotic twins in a mixed-sex pregnancy. Most bovine heterosexual twin females are freemartins. However, about 10% of bovine heterosexual twin females are fertile. Farmers mostly cull bovine fertile heterosexual twin females due to the lack of a practical diagnostic approach. Culling of such animals results in economic and genetic-material losses both for dairy and beef industry. Methods In this study, a comparative test, including qualitative detection of SRY gene by polymerase chain reaction (PCR, quantitative detection of relative content of SRY by real-time quantitative polymerase chain reaction (qPCR, and quantitative detection of H-Y antigen, was performed to establish the most accurate diagnosis for freemartin. Twelve Holstein heterosexual twin females were used in this study, while three normal Holstein bulls and three normal Holstein cows were used as a positive and negative control, respectively. Results Polymerase chain reaction results revealed that SRY gene were absent in three heterosexual twin females and only two of them were verified as fertile in later age. The qPCR results showed that relative content of SRY was more than 14.2% in freemartins and below 0.41% in fertile heterosexual twin females. The H-Y antigen test showed no significant numerical difference between freemartin and fertile heterosexual twin female. Discussion Our results show that relative content of SRY quantified by qPCR is a better detection method for diagnosis of freemartin in Holstein cattle as compare to qualitative detection of SRY gene by PCR or quantitative detection of H-Y antigen. To the authors’ knowledge, this is the first time we applied qPCR to diagnosing freemartin by quantifying SRY gene and got relative SRY content of each freemartin and fertile heterosexual twin female. We concluded that low-level of SRY would not influence fertility of bovine heterosexual twin female.

  8. Detection of exogenous gene doping of IGF-I by a real-time quantitative PCR assay.

    Zhang, Jin-Ju; Xu, Jing-Feng; Shen, Yong-Wei; Ma, Shi-Jiao; Zhang, Ting-Ting; Meng, Qing-Lin; Lan, Wen-Jun; Zhang, Chun; Liu, Xiao-Mei

    2017-07-01

    Gene doping can be easily concealed since its product is similar to endogenous protein, making its effective detection very challenging. In this study, we selected insulin-like growth factor I (IGF-I) exogenous gene for gene doping detection. First, the synthetic IGF-I gene was subcloned to recombinant adeno-associated virus (rAAV) plasmid to produce recombinant rAAV2/IGF-I-GFP vectors. Second, in an animal model, rAAV2/IGF-I-GFP vectors were injected into the thigh muscle tissue of mice, and then muscle and blood specimens were sampled at different time points for total DNA isolation. Finally, real-time quantitative PCR was employed to detect the exogenous gene doping of IGF-I. In view of the characteristics of endogenous IGF-I gene sequences, a TaqMan probe was designed at the junction of exons 2 and 3 of IGF-I gene to distinguish it from the exogenous IGF-I gene. In addition, an internal reference control plasmid and its probe were used in PCR to rule out false-positive results through comparison of their threshold cycle (Ct) values. Thus, an accurate exogenous IGF-I gene detection approach was developed in this study. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

  9. DAG expression: high-throughput gene expression analysis of real-time PCR data using standard curves for relative quantification.

    María Ballester

    Full Text Available BACKGROUND: Real-time quantitative PCR (qPCR is still the gold-standard technique for gene-expression quantification. Recent technological advances of this method allow for the high-throughput gene-expression analysis, without the limitations of sample space and reagent used. However, non-commercial and user-friendly software for the management and analysis of these data is not available. RESULTS: The recently developed commercial microarrays allow for the drawing of standard curves of multiple assays using the same n-fold diluted samples. Data Analysis Gene (DAG Expression software has been developed to perform high-throughput gene-expression data analysis using standard curves for relative quantification and one or multiple reference genes for sample normalization. We discuss the application of DAG Expression in the analysis of data from an experiment performed with Fluidigm technology, in which 48 genes and 115 samples were measured. Furthermore, the quality of our analysis was tested and compared with other available methods. CONCLUSIONS: DAG Expression is a freely available software that permits the automated analysis and visualization of high-throughput qPCR. A detailed manual and a demo-experiment are provided within the DAG Expression software at http://www.dagexpression.com/dage.zip.

  10. Quantitative Real Time PCR approach to study gene expression profile during prenatal growth of skeletal muscle in pig of Duroc and Pietrain breeds

    M. Cagnazzo

    2010-01-01

    Full Text Available The quantitative real time-PCR (QRT-PCR is a very sensitive method used to quantify mRNA level in gene expression analysis. Combining amplification, detection and quantification in a single step, allows a more accurate measurement compared to the traditional PCR end point analysis (Pfaffl, 2001; Bustin, 2002.

  11. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia persica in Animal Blood Samples.

    Naddaf, S R; Kishdehi, M; Siavashi, Mr

    2011-01-01

    The mainstay of diagnosis of relapsing fever (RF) is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL) was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.

  12. Selection of reference genes for expression analysis using quantitative real-time PCR in the pea aphid, Acyrthosiphon pisum (Harris (Hemiptera, Aphidiae.

    Chunxiao Yang

    Full Text Available To facilitate gene expression study and obtain accurate qRT-PCR analysis, normalization relative to stable expressed housekeeping genes is required. In this study, expression profiles of 11 candidate reference genes, including actin (Actin, elongation factor 1 α (EF1A, TATA-box-binding protein (TATA, ribosomal protein L12 (RPL12, β-tubulin (Tubulin, NADH dehydrogenase (NADH, vacuolar-type H+-ATPase (v-ATPase, succinate dehydrogenase B (SDHB, 28S ribosomal RNA (28S, 16S ribosomal RNA (16S, and 18S ribosomal RNA (18S from the pea aphid Acyrthosiphon pisum, under different developmental stages and temperature conditions, were investigated. A total of four analytical tools, geNorm, Normfinder, BestKeeper, and the ΔCt method, were used to evaluate the suitability of these genes as endogenous controls. According to RefFinder, a web-based software tool which integrates all four above-mentioned algorithms to compare and rank the reference genes, SDHB, 16S, and NADH were the three most stable house-keeping genes under different developmental stages and temperatures. This work is intended to establish a standardized qRT-PCR protocol in pea aphid and serves as a starting point for the genomics and functional genomics research in this emerging insect model.

  13. Validation of potential reference genes for qPCR in maize across abiotic stresses, hormone treatments, and tissue types.

    Yueai Lin

    Full Text Available The reverse transcription quantitative polymerase chain reaction (RT-qPCR is a powerful and widely used technique for the measurement of gene expression. Reference genes, which serve as endogenous controls ensure that the results are accurate and reproducible, are vital for data normalization. To bolster the literature on reference gene selection in maize, ten candidate reference genes, including eight traditionally used internal control genes and two potential candidate genes from our microarray datasets, were evaluated for expression level in maize across abiotic stresses (cold, heat, salinity, and PEG, phytohormone treatments (abscisic acid, salicylic acid, jasmonic acid, ethylene, and gibberellins, and different tissue types. Three analytical software packages, geNorm, NormFinder, and Bestkeeper, were used to assess the stability of reference gene expression. The results revealed that elongation factor 1 alpha (EF1α, tubulin beta (β-TUB, cyclophilin (CYP, and eukaryotic initiation factor 4A (EIF4A were the most reliable reference genes for overall gene expression normalization in maize, while GRP (Glycine-rich RNA-binding protein, GLU1(beta-glucosidase, and UBQ9 (ubiquitin 9 were the least stable and most unsuitable genes. In addition, the suitability of EF1α, β-TUB, and their combination as reference genes was confirmed by validating the expression of WRKY50 in various samples. The current study indicates the appropriate reference genes for the urgent requirement of gene expression normalization in maize across certain abiotic stresses, hormones, and tissue types.

  14. A dual PCR-based sequencing approach for the identification and discrimination of Echinococcus and Taenia taxa.

    Boubaker, Ghalia; Marinova, Irina; Gori, Francesca; Hizem, Amani; Müller, Norbert; Casulli, Adriano; Jerez Puebla, Luis Enrique; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

    2016-08-01

    Reliable and rapid molecular tools for the genetic identification and differentiation of Echinococcus species and/or genotypes are crucial for studying spatial and temporal transmission dynamics. Here, we describe a novel dual PCR targeting regions in the small (rrnS) and large (rrnL) subunits of mitochondrial ribosomal RNA (rRNA) genes, which enables (i) the specific identification of species and genotypes of Echinococcus (rrnS + L-PCR) and/or (ii) the identification of a range of taeniid cestodes, including different species of Echinococcus, Taenia and some others (17 species of diphyllidean helminths). This dual PCR approach was highly sensitive, with an analytical detection limit of 1 pg for genomic DNA of Echinococcus. Using concatenated sequence data derived from the two gene markers (1225 bp), we identified five unique and geographically informative single nucleotide polymorphisms (SNPs) that allowed genotypes (G1 and G3) of Echinococcus granulosus sensu stricto to be distinguished, and 25 SNPs that allowed differentiation within Echinococcus canadensis (G6/7/8/10). In conclusion, we propose that this dual PCR-based sequencing approach can be used for molecular epidemiological studies of Echinococcus and other taeniid cestodes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Combined use of real-time PCR and nested sequence-based typing in survey of human Legionella infection.

    Qin, T; Zhou, H; Ren, H; Shi, W; Jin, H; Jiang, X; Xu, Y; Zhou, M; Li, J; Wang, J; Shao, Z; Xu, X

    2016-07-01

    Legionnaires' disease (LD) is a globally distributed systemic infectious disease. The burden of LD in many regions is still unclear, especially in Asian countries including China. A survey of Legionella infection using real-time PCR and nested sequence-based typing (SBT) was performed in two hospitals in Shanghai, China. A total of 265 bronchoalveolar lavage fluid (BALF) specimens were collected from hospital A between January 2012 and December 2013, and 359 sputum specimens were collected from hospital B throughout 2012. A total of 71 specimens were positive for Legionella according to real-time PCR focusing on the 5S rRNA gene. Seventy of these specimens were identified as Legionella pneumophila as a result of real-time PCR amplification of the dotA gene. Results of nested SBT revealed high genetic polymorphism in these L. pneumophila and ST1 was the predominant sequence type. These data revealed that the burden of LD in China is much greater than that recognized previously, and real-time PCR may be a suitable monitoring technology for LD in large sample surveys in regions lacking the economic and technical resources to perform other methods, such as urinary antigen tests and culture methods.

  16. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  17. A web-based adaptive tutor to teach PCR primer design

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  18. A Web-based Adaptive Tutor to Teach PCR Primer Design

    Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  19. Development of PCR for WWTP based on a case study

    Del Borghi, A.; Gallo, M.; Strazza, C.; Gaggero, P.L.

    2009-01-01

    In order to apply the Environmental Product Declaration (EPD) to products or services, specific rules (PCR, Product Category Rules) have to be issued to ensure comparability among different declarations within the same service group. The aim of the present study is to describe the reasons leading to each choice in the development of PCR applied to collecting and treatment service of municipal wastewater and to evaluate, through life cycle analysis (LCA), their influence on the potential environmental impact of a wastewater treatment plant (WWTP), analysed as a case study. Specific data were collected during the year 2003 from an Italian active sludge treatment plant with separate wastewater and sludge treatment lines. The life-cycle approach applied to the case study shows that LCA represents an environmental management tool able both to communicate environmental information by the Type 3. environmental label EPD, and to look for different scenarios that can improve the environmental performance of the Collecting and Treatment Service of Municipal Wastewater. [it

  20. Real-time PCR analysis of carbon catabolite repression of cellobiose gene transcription in Trametes versicolor

    Stapleton, P. C.; O' Mahoney, J.; Dobson, A. D. W. [National University of Ireland, Microbiology Department, Cork (Ireland)

    2004-02-01

    Previous reports indicate that in white rot fungi such as Trametes versicolor, the production of cellobiose dehydrogenase (CDH), an extracellular haemo-flavo-enzyme, is subject to carbon catabolite repression by both glucose and maltose, and that the repression is mediated at the transcriptional level. This paper describes the results of an investigation of CDH gene transcription in cellulolytic cultures of T. versicolor, in the presence of other additional carbon sources such as glucose, arabinose, and xylose. Using real time polymerase chain reaction (RT-PCR) assay methods in the presence of these other additional carbon sources, the levels of repression observed are quantitatively determined in an effort to obtain more accurate measurements of carbon catabolite repression of CDH production in this ligninolytic fungus. Ninety-six hours after addition, results of the analysis showed reduction in CDH transcript levels of 19-fold for galactose, 92-fold for arabinose and 114-fold for xylose. The greatest repressive effect was exhibited by glucose. In this case the reduction in CDH transcript levels was 3400-fold. CDH plays an important role in lignin degradation, and there is also substantial interest in the biotechnological applications of CDH, most particularly in the pulp and paper industry. 24 refs., 4 figs.

  1. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

    2016-03-01

    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

  2. A multiplex real-time PCR assay targeting virulence and resistance genes in Salmonella enterica serotype Typhimurium

    Brisabois Anne

    2011-06-01

    Full Text Available Abstract Background Typhimurium is the main serotype of Salmonella enterica subsp. enterica implicated in food-borne diseases worldwide. This study aimed to detect the prevalence of ten markers combined in a macro-array based on multiplex real-time PCR. We targeted characteristic determinants located on pathogenicity islands (SPI-2 to -5, virulence plasmid pSLT and Salmonella genomic island 1 (SGI1 as well as a specific 16S-23S rRNA intergenic spacer sequence of definitive type 104 (DT104. To investigate antimicrobial resistance, the study also targeted the presence of genes involved in sulfonamide (sul1 and beta-lactam (blaTEM resistance. Finally, the intI1 determinant encoding integrase from class 1 integron was also investigated. Results A total of 538 unrelated S. Typhimurium strains isolated between 1999 and 2009 from various sources, including food animals, food products, human and environmental samples were studied. Based on the combined presence or absence of these markers, we distinguished 34 different genotypes, including three major genotypes encountered in 75% of the studied strains, Although SPI determinants were almost always detected, SGI1, intI1, sul1 and blaTEM determinants were found 47%, 52%, 54% and 12% of the time respectively, varying according to isolation source. Low-marker patterns were most often detected in poultry sources whereas full-marker patterns were observed in pig, cattle and human sources. Conclusion The GeneDisc® assay developed in this study madeit easier to explore variability within serotype Typhimurium by analyzing ten relevant gene determinants in a large collection of strains. This real-time multiplex method constitutes a valuable tool for strains characterization on epidemiological purposes.

  3. Nasal PCR assay for the detection of Mycobacterium leprae pra gene to study subclinical infection in a community.

    Arunagiri, Kamalanathan; Sangeetha, Gopalakrishnan; Sugashini, Padmavathy Krishnan; Balaraman, Sekar; Showkath Ali, M K

    2017-03-01

    Leprosy is a chronic infectious disease caused by Mycobacterium leprae. Identification of Mycobacterium leprae is difficult in part due to the inability of the leprosy bacillus to grow in vitro. A number of diagnostic methods for leprosy diagnosis have been proposed. Both serological tests and molecular probes have shown certain potential for detection and identification of Mycobacterium leprae in patients. In this study, we have investigated whether Mycobacterium leprae DNA from the nasal secretion of healthy household contacts and the non contacts could be detected through PCR amplification as a method to study the sub clinical infection in a community. A total of 200 samples, 100 each from contacts and non contacts representing all age groups and sex were included in this study. The M. leprae specific primer (proline-rich region) of pra gene was selected and PCR was performed using extracted DNA from the sample. A total of 13 samples were found to be positive for nasal PCR for pra gene among the male and female contacts out of which 7% were males and 6% were females. Even though several diagnostic tools are available to detect the cases of leprosy, they lack the specificity and sensitivity. PCR technology has demonstrated the improved diagnostic accuracy for epidemiological studies and requires minimal time. Although nasal PCR studies have been reported from many countries it is not usually recommended due to the high percentage of negative results in the contact. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Application of PCR-based DNA sequencing technique for the detection of Leptospira in peripheral blood of septicemia patients

    Ram, S.

    2012-01-01

    Full Text Available Aim: Isolation, dark field detection and microscopic agglutination test (MAT are considered ―gold standard‖ tests for diagnosis of Leptospirosis. Several PCR assays are reported but very few have been evaluated for detection of Leptospirosis. Therefore, this study was undertaken. This study aims to design and standardize polymerase chain reaction (PCR - based DNA sequencing technique for the detection of pathogenic Leptospira from peripheral blood of patients clinically diagnosed with septicemia. Methodology and Results: Two hundred and seven (207 blood samples from patients were diagnosed with septicemia which includes 100 bacterial (other than Leptospira culture positive and 107 bacterial culture negative samples were studied. Primers for Nested PCR targeting LipL32 gene of Leptospira interrogans were designed and the specificity of primers was tested against serum samples positive/negative by either MAT or dark field microscopy. PCR amplified products were further confirmed by DNA sequencing. The standardized nPCR was sensitive and specific to Leptospira interrogans. Twenty-one (21% out of 100 culture positive blood samples, three (2.8% out of 107 culture negative samples showed nPCR positivity and were confirmed as Leptospira interrogans by DNA sequencing (p<0.001. A sensitive nPCR specific to Leptospira interrogans was developed. Conclusion, significance and impact of study: The p value (<0.001 signifies that Leptospira is commonly associated with other bacteria circulating in blood indicating that a decreased immune status is created primarily by a bacterium with enhanced possibility of development of Leptospiral infection probably be of an endogenous origin.

  5. Real-time PCR detection of Fe-type nitrile hydratase genes from environmental isolates suggests horizontal gene transfer between multiple genera.

    Coffey, Lee; Owens, Erica; Tambling, Karen; O'Neill, David; O'Connor, Laura; O'Reilly, Catherine

    2010-11-01

    Nitriles are widespread in the environment as a result of biological and industrial activity. Nitrile hydratases catalyse the hydration of nitriles to the corresponding amide and are often associated with amidases, which catalyze the conversion of amides to the corresponding acids. Nitrile hydratases have potential as biocatalysts in bioremediation and biotransformation applications, and several successful examples demonstrate the advantages. In this work a real-time PCR assay was designed for the detection of Fe-type nitrile hydratase genes from environmental isolates purified from nitrile-enriched soils and seaweeds. Specific PCR primers were also designed for amplification and sequencing of the genes. Identical or highly homologous nitrile hydratase genes were detected from isolates of numerous genera from geographically diverse sites, as were numerous novel genes. The genes were also detected from isolates of genera not previously reported to harbour nitrile hydratases. The results provide further evidence that many bacteria have acquired the genes via horizontal gene transfer. The real-time PCR assay should prove useful in searching for nitrile hydratases that could have novel substrate specificities and therefore potential in industrial applications.

  6. Identification of Reference Genes for Quantitative Real Time PCR Assays in Aortic Tissue of Syrian Hamsters with Bicuspid Aortic Valve.

    Rueda-Martínez, Carmen; Fernández, M Carmen; Soto-Navarrete, María Teresa; Jiménez-Navarro, Manuel; Durán, Ana Carmen; Fernández, Borja

    2016-01-01

    Bicuspid aortic valve (BAV) is the most frequent congenital cardiac malformation in humans, and appears frequently associated with dilatation of the ascending aorta. This association is likely the result of a common aetiology. Currently, a Syrian hamster strain with a relatively high (∼40%) incidence of BAV constitutes the only spontaneous animal model of BAV disease. The characterization of molecular alterations in the aorta of hamsters with BAV may serve to identify pathophysiological mechanisms and molecular markers of disease in humans. In this report, we evaluate the expression of ten candidate reference genes in aortic tissue of hamsters in order to identify housekeeping genes for normalization using quantitative real time PCR (RT-qPCR) assays. A total of 51 adult (180-240 days old) and 56 old (300-440 days old) animals were used. They belonged to a control strain of hamsters with normal, tricuspid aortic valve (TAV; n = 30), or to the affected strain of hamsters with TAV (n = 45) or BAV (n = 32). The expression stability of the candidate reference genes was determined by RT-qPCR using three statistical algorithms, GeNorm, NormFinder and Bestkeeper. The expression analyses showed that the most stable reference genes for the three algorithms employed were Cdkn1β, G3pdh and Polr2a. We propose the use of Cdkn1β, or both Cdkn1β and G3pdh as reference genes for mRNA expression analyses in Syrian hamster aorta.

  7. Identification of Reference Genes for Quantitative Real Time PCR Assays in Aortic Tissue of Syrian Hamsters with Bicuspid Aortic Valve.

    Carmen Rueda-Martínez

    Full Text Available Bicuspid aortic valve (BAV is the most frequent congenital cardiac malformation in humans, and appears frequently associated with dilatation of the ascending aorta. This association is likely the result of a common aetiology. Currently, a Syrian hamster strain with a relatively high (∼40% incidence of BAV constitutes the only spontaneous animal model of BAV disease. The characterization of molecular alterations in the aorta of hamsters with BAV may serve to identify pathophysiological mechanisms and molecular markers of disease in humans. In this report, we evaluate the expression of ten candidate reference genes in aortic tissue of hamsters in order to identify housekeeping genes for normalization using quantitative real time PCR (RT-qPCR assays. A total of 51 adult (180-240 days old and 56 old (300-440 days old animals were used. They belonged to a control strain of hamsters with normal, tricuspid aortic valve (TAV; n = 30, or to the affected strain of hamsters with TAV (n = 45 or BAV (n = 32. The expression stability of the candidate reference genes was determined by RT-qPCR using three statistical algorithms, GeNorm, NormFinder and Bestkeeper. The expression analyses showed that the most stable reference genes for the three algorithms employed were Cdkn1β, G3pdh and Polr2a. We propose the use of Cdkn1β, or both Cdkn1β and G3pdh as reference genes for mRNA expression analyses in Syrian hamster aorta.

  8. Digital quantification of gene methylation in stool DNA by emulsion-PCR coupled with hydrogel immobilized bead-array.

    Liu, Yunlong; Wu, Haiping; Zhou, Qiang; Song, Qinxin; Rui, Jianzhong; Zou, Bingjie; Zhou, Guohua

    2017-06-15

    Aberrations of gene methylation in stool DNA (sDNA) is an effective biomarker for non-invasive colorectal cancer diagnosis. However, it is challenging to accurately quantitate the gene methylation levels in sDNA due to the low abundance and degradation of sDNA. In this study, a digital quantification strategy was proposed by combining emulsion PCR (emPCR) with hydrogel immobilized bead-array. The assay includes following steps: bisulfite conversion of sDNA, pre-amplification by PCR with specific primers containing 5' universal sequences, emPCR of pre-amplicons with beaded primers to achieve single-molecular amplification and identification of hydrogel embedding beads coated with amplicons. The sensitivity and the specificity of the method are high enough to pick up 0.05% methylated targets from unmethylated DNA background. The successful detection of hypermethylated vimentin gene in clinical stool samples suggests that the proposed method should be a potential tool for non-invasive colorectal cancer screening. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. [Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

    Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

    2017-08-10

    To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

  10. A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates

    Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.

    1999-01-01

    The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories......, which did not result in any DNA band. A total of 32 out of the 36 rough presumptive isolates were positive in the PCR. All but one isolate were also identified as Salmonella by the two biochemical methods. All 80 Salmonella strains were also tested in the two multiplex serogroup tests based on PCR beads....... The sensitivity of the BAX Salmonella PCR test was assessed by testing a total of 80 Salmonella isolates, covering most serogroups, which correctly identified all the Salmonella strains by resulting in one 800-bp band in the sample tubes. The specificity of the PCR was assessed using 20 non-Salmonella strains...

  11. Viability-qPCR for detecting Legionella: Comparison of two assays based on different amplicon lengths.

    Ditommaso, Savina; Giacomuzzi, Monica; Ricciardi, Elisa; Zotti, Carla M

    2015-08-01

    Two different real-time quantitative PCR (PMA-qPCR) assays were applied for quantification of Legionella spp. by targeting a long amplicon (approx 400 bp) of 16S rRNA gene and a short amplicon (approx. 100 bp) of 5S rRNA gene. Purified DNA extracts from pure cultures of Legionella spp. and from environmental water samples were quantified. Application of the two assays to quantify Legionella in artificially contaminated water achieved that both assays were able to detect Legionella over a linear range of 10 to 10(5) cells ml(-1). A statistical analysis of the standard curves showed that both assays were linear with a good correlation coefficient (R(2) = 0.99) between the Ct and the copy number. Amplification with the reference assay was the most effective for detecting low copy numbers (1 bacterium per PCR mixture). Using selective quantification of viable Legionella by the PMA-qPCR method we obtained a greater inhibition of the amplification of the 400-bp 16S gene fragment (Δlog(10) = 3.74 ± 0.39 log(10) GU ml(-1)). A complete inhibition of the PCR signal was obtained when heat-killed cells in a concentration below 1 × 10(5) cells ml(-1) were pretreated with PMA. Analysing short amplicon sizes led to only 2.08 log reductions in the Legionella dead-cell signal. When we tested environmental water samples, the two qPCR assays were in good agreement according to the kappa index (0.741). Applying qPCR combined with PMA treatment, we also obtained a good agreement (kappa index 0.615). The comparison of quantitative results shows that both assays yielded the same quantification sensitivity (mean log = 4.59 vs mean log = 4.31). Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. A Multiplex SYBR Green Real-Time PCR Assay for the Detection of Three Colistin Resistance Genes from Cultured Bacteria, Feces, and Environment Samples

    Jiyun Li

    2017-10-01

    Full Text Available The aim of the study was to develop a multiplex assay for rapid detection of mcr-1, mcr-2, and mcr-3, a group of genes of conferring resistance to colistin mediated by plasmid in Enterobacteriaceae. A SYBR Green based real-time PCR assay has been designed to detect the mcr genes, and applied to cultured bacteria, feces and soil samples. All three mcr genes could be detected with a lower limit of 102 cultured bacteria. This test was highly specific and sensitive, and generated no false-positive results. The assay was also conclusive when applied to feces and soil samples containing mcr-1-positive Escherichia coli, which could facilitate the screening of mcr genes not only in the bacteria, but also directly from the environment. This simple, rapid, sensitive, and specific multiplex assay will be useful for rapid screening of the colistin resistance in both clinical medicine and animal husbandry.

  13. A molecular-beacon-based asymmetric PCR assay for easy visualization of amplicons in the diagnosis of trichomoniasis.

    Sonkar, Subash C; Sachdev, Divya; Mishra, Prashant K; Kumar, Anita; Mittal, Pratima; Saluja, Daman

    2016-12-15

    The currently available nucleic acid amplification tests (NAATs) for trichomoniasis are accurate, quick and confirmative with superior sensitivity than traditional culture-based microbiology assays. However, these assays are associated with problems of carry over contamination, false positive results, requirement of technical expertise for performance and detection of end product. Hence, a diagnostic assay with easy visualization of the amplified product will be profitable. An in-house, rapid, sensitive, specific molecular-beacon-based PCR assay, using primers against pfoB gene of Trichomonas vaginalis, was developed and evaluated using dry ectocervical swabs (n=392) from symptomatic females with vaginal discharge. Total DNA was isolated and used as template for the PCR assays. The performance and reproducibility of PCR assay was evaluated by composite reference standard (CRS). For easy visualization of the amplified product, molecular-beacon was designed and amplicons were visualized directly using fluorescent handheld dark reader or by Micro-Plate Reader. Molecular-beacons are single-stranded hairpin shaped nucleic acid probes composed of a stem, with fluorophore/quencher pair and a loop region complementary to the desired DNA. The beacon-based PCR assay designed in the present study is highly specific as confirmed by competition experiments and extremely sensitive with detection limit of 20fg of genomic DNA (3-4 pathogens). The minimum infrastructure requirement and ease to perform the assay makes this method highly useful for resource poor countries for better disease management. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR.

    Tatti, Enrico; McKew, Boyd A; Whitby, Corrine; Smith, Cindy J

    2016-06-11

    Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

  15. Digital PCR (dPCR) analysis reveals that the homozygous c.315-48T>C variant in the FECH gene might cause erythropoietic protoporphyria (EPP).

    Brancaleoni, Valentina; Granata, Francesca; Missineo, Pasquale; Fustinoni, Silvia; Graziadei, Giovanna; Di Pierro, Elena

    2018-06-13

    Alterations in the ferrochelatase gene (FECH) are the basis of the phenotypic expressions in erythropoietic protoporphyria. The phenotype is due to the presence of a mutation in the FECH gene associated in trans to the c.315-48 T > C variant in the intron 3. The latter is able to increase the physiological quota of alternative splicing events in the intron 3. Other two variants in the FECH gene (c.1-252A > G and c.68-23C > T) have been found to be associated to the intron 3 variant in some populations and together, they constitute a haplotype (ACT/GTC), but eventually, their role in the alternative splicing event has never been elucidated. The absolute number of the aberrantly spliced FECH mRNA molecules and the absolute expression of the FECH gene were evaluated by digital PCR technique in a comprehensive cohort. The number of splicing events that rose in the presence of the c.315-48 T > C variant, both in the heterozygous and homozygous condition was reported for the first time. Also, the percentage of the inserted FECH mRNA increased, even doubled in the T/C cases, compared to T/T cases. The constant presence of variants in the promoter and intron 2 did not influence or modulate the aberrant splicing. The results of FECH gene expression suggested that the homozygosity for the c.315-48 T > C variant could be considered pathological. Thus, this study identified the homozygotes for the c.315-48 T > C variant as pathological. By extension, when the samples were categorised according to the haplotypes, the GTC haplotype in homozygosis was pathological. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Engineered XcmI cassette-containing vector for PCR-based ...

    Unknown

    A simple and general method is described to construct a new vector bearing a synthetic XcmI cassette for direct cloning of PCR-amplified genes of interest. Cleavage of the vector with XcmI generates a linearized molecule with a single thymidine (T) overhang at the 3′ ends (T-vector) that facilitates TA cloning of PCR ...

  17. Assessment of reference gene stability in Rice stripe virus and Rice black streaked dwarf virus infection rice by quantitative Real-time PCR.

    Fang, Peng; Lu, Rongfei; Sun, Feng; Lan, Ying; Shen, Wenbiao; Du, Linlin; Zhou, Yijun; Zhou, Tong

    2015-10-24

    Stably expressed reference gene(s) normalization is important for the understanding of gene expression patterns by quantitative Real-time PCR (RT-qPCR), particularly for Rice stripe virus (RSV) and Rice black streaked dwarf virus (RBSDV) that caused seriously damage on rice plants in China and Southeast Asia. The expression of fourteen common used reference genes of Oryza sativa L. were evaluated by RT-qPCR in RSV and RBSDV infected rice plants. Suitable normalization reference gene(s) were identified by geNorm and NormFinder algorithms. UBQ 10 + GAPDH and UBC + Actin1 were identified as suitable reference genes for RT-qPCR normalization under RSV and RBSDV infection, respectively. When using multiple reference genes, the expression patterns of OsPRIb and OsWRKY, two virus resistance genes, were approximately similar with that reported previously. Comparatively, by using single reference gene (TIP41-Like), a weaker inducible response was observed. We proposed that the combination of two reference genes could obtain more accurate and reliable normalization of RT-qPCR results in RSV- and RBSDV-infected plants. This work therefore sheds light on establishing a standardized RT-qPCR procedure in RSV- and RBSDV-infected rice plants, and might serve as an important point for discovering complex regulatory networks and identifying genes relevant to biological processes or implicated in virus.

  18. Validation of reference genes for quantitative expression analysis by real-time rt-PCR in four lepidopteran insects.

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2(-ΔΔCt) method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR.

  19. Genotyping of the 19-bp insertion/deletion polymorphism in the 5' flank of beta-hydroxylase gene by dissociation analysis of allele-specific PCR products

    Rasmussen, Henrik Berg; Werge, Thomas

    2005-01-01

    The 19-bp insertion/deletion polymorphism in the 5' flank of the dopamine beta-hydroxylase (DBH) gene has been associated with psychiatric disorders. We have developed a simple, reliable and inexpensive closed-tube assay for genotyping of this polymorphism based upon T(m) determination of amplified...... and a conventional approach based upon agarose gel electrophoresis of amplified fragments revealed complete concordance between the two procedures. The insights obtained in this study may be utilized to develop assays based upon dissociation analysis of PCR products for genotyping of other insertion...

  20. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    Gangwar, Maulshree; Waters, Alicia M.; Bej, Gautam A.; Bej, Asim K.; Mojib, Nazia

    2012-01-01

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  1. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    Gangwar, Maulshree

    2012-09-23

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  2. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  3. Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in melon.

    Qiusheng Kong

    Full Text Available Melon (Cucumis melo. L is not only an economically important cucurbitaceous crop but also an attractive model for studying many biological characteristics. Screening appropriate reference genes is essential to reverse transcription quantitative real-time PCR (RT-qPCR, which is key to many studies involving gene expression analysis. In this study, 14 candidate reference genes were selected, and the variations in their expression in roots and leaves of plants subjected to biotic stress, abiotic stress, and plant growth regulator treatment were assessed by RT-qPCR. The stability of the expression of the selected genes was determined and ranked using geNorm and NormFinder. geNorm identified the two most stable genes for each set of conditions: CmADP and CmUBIep across all samples, CmUBIep and CmRPL in roots, CmRAN and CmACT in leaves, CmADP and CmRPL under abiotic stress conditions, CmTUA and CmACT under biotic stress conditions, and CmRAN and CmACT under plant growth regulator treatments. NormFinder determined CmRPL to be the best reference gene in roots and under biotic stress conditions and CmADP under the other experimental conditions. CmUBC2 and CmPP2A were not found to be suitable under many experimental conditions. The catalase family genes CmCAT1, CmCAT2, and CmCAT3 were identified in melon genome and used as target genes to validate the reliability of identified reference genes. The catalase family genes showed the most upregulation 3 days after inoculation with Fusarium wilt in roots, after which they were downregulated. Their levels of expression were significantly overestimated when the unsuitable reference gene was used for normalization. These results not only provide guidelines for the selection of reference genes for gene expression analyses in melons but may also provide valuable information for studying the functions of catalase family genes in stress responses.

  4. Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L..

    Candy M Taylor

    Full Text Available Quantitative Reverse Transcription PCR (qRT-PCR is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC, Helicase (HEL, and Polypyrimidine tract-binding protein (PTB] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other

  5. Specific PCR-based detection of Alternaria helianthi

    Udayashankar, A.C.; Nayaka, S. Chandra; Archana, B.

    2012-01-01

    Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method...... tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification...

  6. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Identification and validation of superior reference gene for gene expression normalization via RT-qPCR in staminate and pistillate flowers of Jatropha curcas - A biodiesel plant.

    Karuppaiya, Palaniyandi; Yan, Xiao-Xue; Liao, Wang; Wu, Jun; Chen, Fang; Tang, Lin

    2017-01-01

    Physic nut (Jatropha curcas L) seed oil is a natural resource for the alternative production of fossil fuel. Seed oil production is mainly depended on seed yield, which was restricted by the low ratio of staminate flowers to pistillate flowers. Further, the mechanism of physic nut flower sex differentiation has not been fully understood yet. Quantitative Real Time-Polymerase Chain Reaction is a reliable and widely used technique to quantify the gene expression pattern in biological samples. However, for accuracy of qRT-PCR, appropriate reference gene is highly desirable to quantify the target gene level. Hence, the present study was aimed to identify the stable reference genes in staminate and pistillate flowers of J. curcas. In this study, 10 candidate reference genes were selected and evaluated for their expression stability in staminate and pistillate flowers, and their stability was validated by five different algorithms (ΔCt, BestKeeper, NormFinder, GeNorm and RefFinder). Resulting, TUB and EF found to be the two most stably expressed reference for staminate flower; while GAPDH1 and EF found to be the most stably expressed reference gene for pistillate flowers. Finally, RT-qPCR assays of target gene AGAMOUS using the identified most stable reference genes confirmed the reliability of selected reference genes in different stages of flower development. AGAMOUS gene expression levels at different stages were further proved by gene copy number analysis. Therefore, the present study provides guidance for selecting appropriate reference genes for analyzing the expression pattern of floral developmental genes in staminate and pistillate flowers of J. curcas.

  8. Gene array and real time PCR analysis of the adrenal sensitivity to adrenocorticotropic hormone in pig

    SanCristobal Magali

    2008-02-01

    Full Text Available Abstract Background Variability in hypothalamic-pituitary-adrenal (HPA axis activity has been shown to be influenced by genetic factors and related to great metabolic differences such as obesity. The aim of this study was to investigate molecular bases of genetic variability of the adrenal sensitivity to ACTH, a major source of variability, in Meishan (MS and Large White (LW pigs, MS being reported to exhibit higher basal cortisol levels, response to ACTH and fatness than LW. A pig cDNA microarray was used to identify changes in gene expression in basal conditions and in response to ACTH stimulation. Results Genotype and/or ACTH affected the expression of 211 genes related to transcription, cell growth/maintenance, signal transduction, cell structure/adhesion/extra cellular matrix and protein kinase/phosphatase activity. No change in the expression of known key regulator proteins of the ACTH signaling pathway or of steroidogenic enzymes was found. However, Mdh2, Sdha, Suclg2, genes involved in the tricarboxylic acid (TCA pathway, were over-expressed in MS pigs. Higher TCA cycle activity in MS than in LW may thus result in higher steroidogenic activity and thus explain the typically higher cortisol levels in MS compared to LW. Moreover, up-regulation of Star and Ldlr genes in MS and/or in response to ACTH suggest that differences in the adrenal function between MS and LW may also involve mechanisms requisite for cholesterol supply to steroidogenesis. Conclusion The present study provides new potential candidate genes to explain genetic variations in the adrenal sensitivity to ACTH and better understand relationship between HPA axis activity and obesity.

  9. A Nonlinear Model for Gene-Based Gene-Environment Interaction

    Jian Sa

    2016-06-01

    Full Text Available A vast amount of literature has confirmed the role of gene-environment (G×E interaction in the etiology of complex human diseases. Traditional methods are predominantly focused on the analysis of interaction between a single nucleotide polymorphism (SNP and an environmental variable. Given that genes are the functional units, it is crucial to understand how gene effects (rather than single SNP effects are influenced by an environmental variable to affect disease risk. Motivated by the increasing awareness of the power of gene-based association analysis over single variant based approach, in this work, we proposed a sparse principle component regression (sPCR model to understand the gene-based G×E interaction effect on complex disease. We first extracted the sparse principal components for SNPs in a gene, then the effect of each principal component was modeled by a varying-coefficient (VC model. The model can jointly model variants in a gene in which their effects are nonlinearly influenced by an environmental variable. In addition, the varying-coefficient sPCR (VC-sPCR model has nice interpretation property since the sparsity on the principal component loadings can tell the relative importance of the corresponding SNPs in each component. We applied our method to a human birth weight dataset in Thai population. We analyzed 12,005 genes across 22 chromosomes and found one significant interaction effect using the Bonferroni correction method and one suggestive interaction. The model performance was further evaluated through simulation studies. Our model provides a system approach to evaluate gene-based G×E interaction.

  10. A novel PCR-based marker for identifying Ns chromosomes in wheat-Psathyrostachys huashanica Keng derivative lines

    J. Wang

    2013-10-01

    Full Text Available Psathyrostachys huashanica Keng is an endangered species that is endemic to China, which provides an important gene pool for wheat improvement. We developed a quick and reliable PCR-based diagnostic assay to accurately and efficiently detect P. huashanica DNA sequences from introgression lines, which was based on a species-specific marker derived from genomic DNA. The 900-bp PCR-amplified band used as a P. huashanica-specific RAPD marker was tested with 21 different plant species and was converted into a sequence-characterized amplified region (SCAR marker by cloning and sequencing the selected fragments (pHs11. This SCAR marker, which was designated as RHS23, could clearly distinguish the presence of P. huashanica DNA repetitive sequences in wheat-P. huashanica derivative lines. The specificity of the marker was validated using 21 different plant species and a complete set of wheat-P. huashanica disomic addition lines (1Ns–7Ns, 2n=44=22II. This specific sequence targeted the Ns genome of P. huashanica and it was present in all the seven P. huashanica chromosomes. Therefore, this SCAR marker is specific for P. huashanica chromosomes and may be used in the identification of alien repetitive sequences in large gene pools. This diagnostic PCR assay for screening the target genetic material may play a key role in marker-assisted selective breeding programs.

  11. Detection of the mosquitocidal toxin genes encoding Cry11 proteins from Bacillus thuringiensis using a novel PCR-RFLP method Detección de genes que codifican proteínas mosquitocidas Cry11 de Bacillus thuringiensis mediante un método de PCR-RFLP novedoso

    D. H. Sauka

    2010-02-01

    Full Text Available A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP method for detection of cry11 genes from Bacillus thuringiensis was established. Based on the analysis of conserved regions of the cry11 genes, 2 oligonucleotide primers were designed to amplify a 1459-bp fragment of the cry11Aa gene, and a 1471-bp of the cry11Ba and cry11Bb genes. The amplification products were digested with restriction endonuclease HinfI. Exotic B. thuringiensis strains and native isolates collected from soils, leaves and stored product dust of Argentina were analyzed to study the distribution of cry11 genes. The PCR-RFLP patterns revealed the detection of cry11 genes in 3 of 64 exotic strains and in 10 of 107 native B. thuringiensis isolates tested. Just the cry11Aa gene subclass was detected among these bacteria. Since the methodology was also developed to detect cry11Ba and cry11Bb genes, an experimental future confirmation will be required. Based on the results obtained, the PCR-RFLP method presented may be a valuable tool for specific detection of the mosquitocidal toxin genes encoding Cry11 proteins from B. thuringiensis.En el presente estudio se estableció una estrategia basada en la amplificación génica (PCR y el posterior análisis de restricción (RFLP para detectar todos los genes cry11 de Bacillus thuringiensis informados hasta ahora. De acuerdo con el análisis de las regiones conservadas en los genes cry11, se diseñaron dos cebadores para amplificar un fragmento de 1459 pb de los genes cry11Aa y un fragmento de 1471 pb de los genes cry11Ba y cry11Bb. Los productos de la amplificación fueron digeridos con la enzima de restricción HinfI. Se analizaron cepas exóticas de B. thuringiensis y aislamientos nativos de Argentina obtenidos a partir de muestras de suelos, hojas y polvillo de silos, para estudiar la distribución de los genes cry11. Los patrones de PCR-RFLP revelaron la presencia de genes cry11 en 3 de las 64 cepas ex

  12. Multiway real-time PCR gene expression profiling in yeast Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli.

    Ståhlberg, Anders; Elbing, Karin; Andrade-Garda, José Manuel; Sjögreen, Björn; Forootan, Amin; Kubista, Mikael

    2008-04-16

    The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.

  13. Multiway real-time PCR gene expression profiling in yeast Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli

    Andrade-Garda José

    2008-04-01

    Full Text Available Abstract Background The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. Results We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Conclusion Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.

  14. Identification of Five Novel Salmonella Typhi-Specific Genes as Markers for Diagnosis of Typhoid Fever Using Single-Gene Target PCR Assays

    Yuan Xin Goay

    2016-01-01

    Full Text Available Salmonella Typhi (S. Typhi causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S. Typhi with other enteric pathogens was performed, and 6 S. Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico. Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro. The diagnostic sensitivities and specificities of each assay were determined using 39 S. Typhi, 62 non-Typhi Salmonella, and 10 non-Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39 and 100% specificity (0/72. The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.

  15. Identification of Five Novel Salmonella Typhi-Specific Genes as Markers for Diagnosis of Typhoid Fever Using Single-Gene Target PCR Assays.

    Goay, Yuan Xin; Chin, Kai Ling; Tan, Clarissa Ling Ling; Yeoh, Chiann Ying; Ja'afar, Ja'afar Nuhu; Zaidah, Abdul Rahman; Chinni, Suresh Venkata; Phua, Kia Kien

    2016-01-01

    Salmonella Typhi ( S . Typhi) causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S . Typhi with other enteric pathogens was performed, and 6 S . Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico . Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro . The diagnostic sensitivities and specificities of each assay were determined using 39 S . Typhi, 62 non-Typhi Salmonella , and 10 non- Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39) and 100% specificity (0/72). The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.

  16. Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

    González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

    2008-08-15

    Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

  17. PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato

    Singh, Om P; Bali, Prerna; Hemingway, Janet; Subbarao, Sarala K; Dash, Aditya P; Adak, Tridibes

    2009-01-01

    Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr) is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F) in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F) in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR), an Amplification Refractory Mutation System (ARMS) and Primer Introduced Restriction Analysis-PCR (PIRA-PCR) were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method was refractory to non

  18. PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato

    Dash Aditya P

    2009-07-01

    Full Text Available Abstract Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR, an Amplification Refractory Mutation System (ARMS and Primer Introduced Restriction Analysis-PCR (PIRA-PCR were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method

  19. Comparison of semi-automated commercial rep-PCR fingerprinting, spoligotyping, 12-locus MIRU-VNTR typing and single nucleotide polymorphism analysis of the embB gene as molecular typing tools for Mycobacterium bovis.

    Armas, Federica; Camperio, Cristina; Coltella, Luana; Selvaggini, Serena; Boniotti, Maria Beatrice; Pacciarini, Maria Lodovica; Di Marco Lo Presti, Vincenzo; Marianelli, Cinzia

    2017-08-04

    Highly discriminatory genotyping strategies are essential in molecular epidemiological studies of tuberculosis. In this study we evaluated, for the first time, the efficacy of the repetitive sequence-based PCR (rep-PCR) DiversiLab Mycobacterium typing kit over spoligotyping, 12-locus mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR) typing and embB single nucleotide polymorphism (SNP) analysis for Mycobacterium bovis typing. A total of 49 M. bovis animal isolates were used. DNA was extracted and genomic DNA was amplified using the DiversiLab Mycobacterium typing kit. The amplified fragments were separated and detected using a microfluidics chip with Agilent 2100. The resulting rep-PCR-based DNA fingerprints were uploaded to and analysed using web-based DiversiLab software through Pearson's correlation coefficient. Rep-PCR DiversiLab grouped M. bovis isolates into ten different clusters. Most isolates sharing identical spoligotype, MIRU-VNTR profile or embB gene polymorphism were grouped into different rep-PCR clusters. Rep-PCR DiversiLab displayed greater discriminatory power than spoligotyping and embB SNP analysis but a lower resolution power than the 12-locus MIRU-VNTR analysis. MIRU-VNTR confirmed that it is superior to the other PCR-based methods tested here. In combination with spoligotyping and 12-locus MIRU-VNTR analysis, rep-PCR improved the discriminatory power for M. bovis typing.

  20. Development and Evaluation of a PCR and Mass Spectroscopy-based (PCR-MS) Method for Quantitative, Type-specific Detection of Human Papillomavirus

    Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.

    2010-01-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602

  1. Development and evaluation of a PCR and mass spectroscopy (PCR-MS)-based method for quantitative, type-specific detection of human papillomavirus.

    Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M

    2009-09-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.

  2. Reference gene selection for molecular studies of dormancy in wild oat (Avena fatua L. caryopses by RT-qPCR method.

    Izabela Ruduś

    Full Text Available Molecular studies of primary and secondary dormancy in Avena fatua L., a serious weed of cereal and other crops, are intended to reveal the species-specific details of underlying molecular mechanisms which in turn may be useable in weed management. Among others, quantitative real-time PCR (RT-qPCR data of comparative gene expression analysis may give some insight into the involvement of particular wild oat genes in dormancy release, maintenance or induction by unfavorable conditions. To assure obtaining biologically significant results using this method, the expression stability of selected candidate reference genes in different data subsets was evaluated using four statistical algorithms i.e. geNorm, NormFinder, Best Keeper and ΔCt method. Although some discrepancies in their ranking outputs were noticed, evidently two ubiquitin-conjugating enzyme homologs, AfUBC1 and AfUBC2, as well as one homolog of glyceraldehyde 3-phosphate dehydrogenase AfGAPDH1 and TATA-binding protein AfTBP2 appeared as more stably expressed than AfEF1a (translation elongation factor 1α, AfGAPDH2 or the least stable α-tubulin homolog AfTUA1 in caryopses and seedlings of A. fatua. Gene expression analysis of a dormancy-related wild oat transcription factor VIVIPAROUS1 (AfVP1 allowed for a validation of candidate reference genes performance. Based on the obtained results it can be recommended that the normalization factor calculated as a geometric mean of Cq values of AfUBC1, AfUBC2 and AfGAPDH1 would be optimal for RT-qPCR results normalization in the experiments comprising A. fatua caryopses of different dormancy status.

  3. Reference gene selection for molecular studies of dormancy in wild oat (Avena fatua L.) caryopses by RT-qPCR method.

    Ruduś, Izabela; Kępczyński, Jan

    2018-01-01

    Molecular studies of primary and secondary dormancy in Avena fatua L., a serious weed of cereal and other crops, are intended to reveal the species-specific details of underlying molecular mechanisms which in turn may be useable in weed management. Among others, quantitative real-time PCR (RT-qPCR) data of comparative gene expression analysis may give some insight into the involvement of particular wild oat genes in dormancy release, maintenance or induction by unfavorable conditions. To assure obtaining biologically significant results using this method, the expression stability of selected candidate reference genes in different data subsets was evaluated using four statistical algorithms i.e. geNorm, NormFinder, Best Keeper and ΔCt method. Although some discrepancies in their ranking outputs were noticed, evidently two ubiquitin-conjugating enzyme homologs, AfUBC1 and AfUBC2, as well as one homolog of glyceraldehyde 3-phosphate dehydrogenase AfGAPDH1 and TATA-binding protein AfTBP2 appeared as more stably expressed than AfEF1a (translation elongation factor 1α), AfGAPDH2 or the least stable α-tubulin homolog AfTUA1 in caryopses and seedlings of A. fatua. Gene expression analysis of a dormancy-related wild oat transcription factor VIVIPAROUS1 (AfVP1) allowed for a validation of candidate reference genes performance. Based on the obtained results it can be recommended that the normalization factor calculated as a geometric mean of Cq values of AfUBC1, AfUBC2 and AfGAPDH1 would be optimal for RT-qPCR results normalization in the experiments comprising A. fatua caryopses of different dormancy status.

  4. Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene

    Kumar, Deepak; Singh, S. P.; Karabasanavar, Nagappa S.; Singh, Rashmi; Umapathi, V.

    2012-01-01

    Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168–776 b...

  5. Predator-induced defences in Daphnia pulex: Selection and evaluation of internal reference genes for gene expression studies with real-time PCR

    Gilbert Don

    2010-06-01

    Full Text Available Abstract Background The planktonic microcrustacean Daphnia pulex is among the best-studied animals in ecological, toxicological and evolutionary research. One aspect that has sustained interest in the study system is the ability of D. pulex to develop inducible defence structures when exposed to predators, such as the phantom midge larvae Chaoborus. The available draft genome sequence for D. pulex is accelerating research to identify genes that confer plastic phenotypes that are regularly cued by environmental stimuli. Yet for quantifying gene expression levels, no experimentally validated set of internal control genes exists for the accurate normalization of qRT-PCR data. Results In this study, we tested six candidate reference genes for normalizing transcription levels of D. pulex genes; alpha tubulin (aTub, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, TATA box binding protein (Tbp syntaxin 16 (Stx16, X-box binding protein 1 (Xbp1 and CAPON, a protein associated with the neuronal nitric oxide synthase, were selected on the basis of an earlier study and from microarray studies. One additional gene, a matrix metalloproteinase (MMP, was tested to validate its transcriptional response to Chaoborus, which was earlier observed in a microarray study. The transcription profiles of these seven genes were assessed by qRT-PCR from RNA of juvenile D. pulex that showed induced defences in comparison to untreated control animals. We tested the individual suitability of genes for expression normalization using the programs geNorm, NormFinder and BestKeeper. Intriguingly, Xbp1, Tbp, CAPON and Stx16 were selected as ideal reference genes. Analyses on the relative expression level using the software REST showed that both classical housekeeping candidate genes (aTub and GAPDH were significantly downregulated, whereas the MMP gene was shown to be significantly upregulated, as predicted. aTub is a particularly ill suited reference gene because five copies are

  6. Validation and comparison of reference genes for qPCR normalization of celery (Apium graveolens at different development stages

    Meng-Yao eLi

    2016-03-01

    Full Text Available A suitable reference gene is an important prerequisite for guarantying accurate and reliable results in qPCR analysis. Celery is one of the representative vegetable in Apiaceae and is widely cultivated and consumed in the world. However, no reports have been previously published concerning reference genes in celery. In this study, the expression stabilities of nine candidate reference genes in leaf blade and petiole at different development stages were evaluated using three statistics algorithms geNorm, NormFinder, and BestKeeper. Our results showed that TUB-B, TUB-A, and UBC were the most reference genes among all tested samples. GAPDH represented the maximum stability for most individual sample, while the UBQ displayed the minimum stability. To further validate the stability of reference genes, the expression pattern of AgAP2-2 was calculated by using the selected genes for normalization. In addition, the expression patterns of several development-related genes were studied using the selected reference gene. Our results will be beneficial for further studies on gene transcription in celery.

  7. Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

    Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2015-07-01

    Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

  8. Defining suitable reference genes for RT-qPCR analysis on human sertoli cells after 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) exposure.

    Ribeiro, Mariana Antunes; dos Reis, Mariana Bisarro; de Moraes, Leonardo Nazário; Briton-Jones, Christine; Rainho, Cláudia Aparecida; Scarano, Wellerson Rodrigo

    2014-11-01

    Quantitative real-time RT-PCR (qPCR) has proven to be a valuable molecular technique to quantify gene expression. There are few studies in the literature that describe suitable reference genes to normalize gene expression data. Studies of transcriptionally disruptive toxins, like tetrachlorodibenzo-p-dioxin (TCDD), require careful consideration of reference genes. The present study was designed to validate potential reference genes in human Sertoli cells after exposure to TCDD. 32 candidate reference genes were analyzed to determine their applicability. geNorm and NormFinder softwares were used to obtain an estimation of the expression stability of the 32 genes and to identify the most suitable genes for qPCR data normalization.

  9. Comparison between Radioisotopic and Non-radioisotopic Polymerase Chain Reaction-Single Strand Conformation Polymorphism (PCR-SSCP) Procedures in the Detection of Mutations at the rpoB Gene Associated with Rifampicin Resistance in Mycobacterium tuberculosis

    Lee, H.; Bang, H.E.; Johnson, R.; Jordaan, A.M.; Victor, T.C. . E-mail : tv@sun.ac.za; Dar, L.; Khan, B.K.; Cho, S.N. . E-mail : raycho@yonsei.ac.kr

    2006-01-01

    Rapid and sensitive detection of mutations at the rpoB gene of Mycobacterium tuberculosis would be of great importance for proper management of tuberculosis (TB) patients and control of multi-drug resistant TB. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) using both radioisotopic and non-radioisotopic methods have been widely used for detecting such mutations. However, the silver staining method, which is the most frequently employed in PCR-SSCP, has been reported to be producing results of varying sensitivity. Radioisotope-based methods have shown greater sensitivity in detecting the rpoB mutations than the silver staining method. The primary objective of this study was therefore to compare the radioisotopic method with the silver staining method detection of mutations of rpoB gene by PCR-SSCP in the same laboratory. Purified DNAs from M. tuberculosis H37Rv were serially diluted and used for PCR amplification with and without radionuclides. The PCR products were then detected by silver staining and autoradiography methods. In addition, clinical isolates were analyzed by PCR-SSCP. The radioisotopic method showed about four-fold increase in the detection of PCR products over ethidium bromide staining in agarose gel. When compared with silver staining, the radioisotopic method gave a sensitivity of more than 10-fold in detecting PCR products and about 8-fold in PCR-SSCP. Radioisotope-based detection methods provided a clearer resolution in PCR-SSCP than the silver staining method when applied to clinical isolates of M. tuberculosis. Radioisotope-based detection method was shown to be more sensitive than non-isotope-based method in detecting PCR products and mutations at the rpoB gene of M. tuberculosis by PCR-SSCP. It may be noted that mutations in the rpoB gene as a marker have significant clinical importance because of the increasing number of MDR-TB cases in the world. It is especially relevant to MDR and Extreme Drug Resistance TB

  10. Differentiation of sheep pox and goat poxviruses by sequence analysis and PCR-RFLP of P32 gene.

    Hosamani, Madhusudan; Mondal, Bimalendu; Tembhurne, Prabhakar A; Bandyopadhyay, Santanu Kumar; Singh, Raj Kumar; Rasool, Thaha Jamal

    2004-08-01

    Sheep pox and Goat pox are highly contagious viral diseases of small ruminants. These diseases were earlier thought to be caused by a single species of virus, as they are serologically indistinguishable. P32, one of the major immunogenic genes of Capripoxvirus, was isolated and Sequenced from two Indian isolates of goat poxvirus (GPV) and a vaccine strain of sheep poxvirus (SPV). The sequences were compared with other P32 sequences of capripoxviruses available in the database. Sequence analysis revealed that sheep pox and goat poxviruses share 97.5 and 94.7% homology at nucleotide and amino acid level, respectively. A major difference between them is the presence of an additional aspartic acid at 55th position of P32 of sheep poxvirus that is absent in both goat poxvirus and lumpy skin disease virus. Further, six unique neutral nucleotide substitutions were observed at positions 77, 275, 403, 552, 867 and 964 in the sequence of goat poxvirus, which can be taken as GPV signature residues. Similar unique nucleotide signatures could be identified in SPV and LSDV sequences also. Phylogenetic analysis showed that members of the Capripoxvirus could be delineated into three distinct clusters of GPV, SPV and LSDV based on the P32 genomic sequence. Using this information, a PCR-RFLP method has been developed for unequivocal genomic differentiation of SPV and GPV.

  11. Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley.

    Jing Cai

    Full Text Available Hulless barley (Hordeum vulgare L. var. nudum. hook. f. has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin, E2 (Ubiquitin conjugating enzyme 2, TUBα (Alpha-tubulin, TUBβ6 (Beta-tubulin 6, GAPDH (Glyceraldehyde 3-phosphate dehydrogenase, EF-1α (Elongation factor 1-alpha, SAMDC (S-adenosylmethionine decarboxylase, PKABA1 (Gene for protein kinase HvPKABA1, PGK (Phosphoglycerate kinase, and HSP90 (Heat shock protein 90-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression

  12. Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley.

    Cai, Jing; Li, Pengfei; Luo, Xiao; Chang, Tianliang; Li, Jiaxing; Zhao, Yuwei; Xu, Yao

    2018-01-01

    Hulless barley (Hordeum vulgare L. var. nudum. hook. f.) has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin), E2 (Ubiquitin conjugating enzyme 2), TUBα (Alpha-tubulin), TUBβ6 (Beta-tubulin 6), GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), EF-1α (Elongation factor 1-alpha), SAMDC (S-adenosylmethionine decarboxylase), PKABA1 (Gene for protein kinase HvPKABA1), PGK (Phosphoglycerate kinase), and HSP90 (Heat shock protein 90)-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression analysis

  13. Real-Time PCR-Based Quantitation Method for the Genetically Modified Soybean Line GTS 40-3-2.

    Kitta, Kazumi; Takabatake, Reona; Mano, Junichi

    2016-01-01

    This chapter describes a real-time PCR-based method for quantitation of the relative amount of genetically modified (GM) soybean line GTS 40-3-2 [Roundup Ready(®) soybean (RRS)] contained in a batch. The method targets a taxon-specific soybean gene (lectin gene, Le1) and the specific DNA construct junction region between the Petunia hybrida chloroplast transit peptide sequence and the Agrobacterium 5-enolpyruvylshikimate-3-phosphate synthase gene (epsps) sequence present in GTS 40-3-2. The method employs plasmid pMulSL2 as a reference material in order to quantify the relative amount of GTS 40-3-2 in soybean samples using a conversion factor (Cf) equal to the ratio of the RRS-specific DNA to the taxon-specific DNA in representative genuine GTS 40-3-2 seeds.

  14. Investigation of Virulence Genes by PCR in Stapylococcus aureus Isolates Originated from Subclinical Bovine Mastitis in Turkey

    Murat Karahan, Mehmet Nuri Acik1* and Burhan Cetinkaya

    2011-06-01

    Full Text Available The aim of the present study was to characterize coagulase (coa positive Staphylococcus aureus strains (n=92 isolated from bovine subclinical mastitis in Turkey by PCR amplification of clumping factor A (clfA and protein A (spa genes. All the coa-positive S. aureus isolates were determined to harbor the genes encoding the IgG binding region (spa-IgG and the X region (spa-X of spa. On the other hand, 84 (91.3% isolates were positive for clfA gene. These three genes displayed size polymorphisms. It was concluded that spa gene polymorphisms for S. aureus, when used together with coa-PCR, can be proposed as good alternatives to conventional methods in typing S. aureus isolates of bovine origin which may provide valuable data for the development of effective control strategies against staphylococcal mastitis. The results of the present study showed that S. aureus isolates responsible for the mastitis cases in Turkey were genetically diverse.

  15. A specific endogenous reference for genetically modified common bean (Phaseolus vulgaris L.) DNA quantification by real-time PCR targeting lectin gene.

    Venturelli, Gustavo L; Brod, Fábio C A; Rossi, Gabriela B; Zimmermann, Naíra F; Oliveira, Jaison P; Faria, Josias C; Arisi, Ana C M

    2014-11-01

    The Embrapa 5.1 genetically modified (GM) common bean was approved for commercialization in Brazil. Methods for the quantification of this new genetically modified organism (GMO) are necessary. The development of a suitable endogenous reference is essential for GMO quantification by real-time PCR. Based on this, a new taxon-specific endogenous reference quantification assay was developed for Phaseolus vulgaris L. Three genes encoding common bean proteins (phaseolin, arcelin, and lectin) were selected as candidates for endogenous reference. Primers targeting these candidate genes were designed and the detection was evaluated using the SYBR Green chemistry. The assay targeting lectin gene showed higher specificity than the remaining assays, and a hydrolysis probe was then designed. This assay showed high specificity for 50 common bean samples from two gene pools, Andean and Mesoamerican. For GM common bean varieties, the results were similar to those obtained for non-GM isogenic varieties with PCR efficiency values ranging from 92 to 101 %. Moreover, this assay presented a limit of detection of ten haploid genome copies. The primers and probe developed in this work are suitable to detect and quantify either GM or non-GM common bean.

  16. Evaluation of candidate reference genes for normalization of quantitative RT-PCR in soybean tissues under various abiotic stress conditions.

    Dung Tien Le

    Full Text Available Quantitative RT-PCR can be a very sensitive and powerful technique for measuring differential gene expression. Changes in gene expression induced by abiotic stresses are complex and multifaceted, which make determining stably expressed genes for data normalization difficult. To identify the most suitable reference genes for abiotic stress studies in soybean, 13 candidate genes collected from literature were evaluated for stability of expression under dehydration, high salinity, cold and ABA (abscisic acid treatments using delta CT and geNorm approaches. Validation of reference genes indicated that the best reference genes are tissue- and stress-dependent. With respect to dehydration treatment, the Fbox/ABC, Fbox/60s gene pairs were found to have the highest expression stability in the root and shoot tissues of soybean seedlings, respectively. Fbox and 60s genes are the most suitable reference genes across dehydrated root and shoot tissues. Under salt stress the ELF1b/IDE and Fbox/ELF1b are the most stably expressed gene pairs in roots and shoots, respectively, while 60s/Fbox is the best gene pair in both tissues. For studying cold stress in roots or shoots, IDE/60s and Fbox/Act27 are good reference gene pairs, respectively. With regard to gene expression analysis under ABA treatment in either roots, shoots or across these tissues, 60s/ELF1b, ELF1b/Fbox and 60s/ELF1b are the most suitable reference genes, respectively. The expression of ELF1b/60s, 60s/Fbox and 60s/Fbox genes was most stable in roots, shoots and both tissues, respectively, under various stresses studied. Among the genes tested, 60s was found to be the best reference gene in different tissues and under various stress conditions. The highly ranked reference genes identified from this study were proved to be capable of detecting subtle differences in expression rates that otherwise would be missed if a less stable reference gene was used.

  17. Benzimidazole -Resistance in Haemonchus Contortus: New PCR-RFLP Method for the Detection of Point Mutation at Codon 167 of Isotype 1 Β-Tubulin Gene

    A Eslami

    2012-12-01

    Full Text Available Background: Due to the lack of a suitable and economic test for the analysis of the polymorphism at codon 167, we developed a new PCR-RFLP technique, based on a modified forward primer (UT-HC167 MF-primer, to identify simultaneously the SNPs at codons 167 and 200 of isotype 1 β-tubu­lin gene of Haemonchus contortus.Methods: There already are several safe and easy methods for identification of point mutations at codons 198 and 200. Due to the lack of a reliable and easy method for the detection of the single nucleo­tide polymorphism (SNP at codon 167, we developed an innovative PCR-RFLP technique based on a modified forward primer (UT-HC167 MF-primer, in which the nucleotide T at the posi­tion 443 was substituted through a nucleotide A creating a restriction site for restriction endonuc­lease SnaB I in the nucleotide sequences including codon 167. A total of 138 adult male H. contortus were collected from three different geo-climatic areas of Iran. The isolated genomic DNA of each single worm was amplified by PCR using primers flanking codon 167. The PCR product (527 bp was then amplified by semi-nested PCR using the UT-HC167 MF-primer and the reverse primer achiev­ing a PCR product of 451 bp in length. This PCR product was subsequently digested with the restriction endonucleases SnaB I and TaaI for analysis of the mutations at codons 167 and 200, respec­tively.Results: All worms had two alleles encoding for phenylalanine (BZss homozygote for both codons.Conclusion: Using the UT-HC167 MF-primer and a suitable reverse primer designed upstream from codon 200, it is possible to amplify a PCR product which can be used for analysis of the SNPs at all three mentioned codons using RFLP.

  18. In silico and in vitro evaluation of PCR-based assays for the detection of Bacillus anthracis chromosomal signature sequences

    Ågren, Joakim; Hamidjaja, Raditijo A.; Hansen, Trine

    2013-01-01

    Bacillus anthracis, the causative agent of anthrax, is a zoonotic pathogen that is relatively common throughout the world and may cause life threatening diseases in animals and humans. There are many PCR-based assays in use for the detection of B. anthracis. While most of the developed assays rely...... on unique markers present on virulence plasmids pXO1 and pXO2, relatively few assays incorporate chromosomal DNA markers due to the close relatedness of B. anthracis to the B. cereus group strains. For the detection of chromosomal DNA, different genes have been used, such as BA813, rpoB, gyrA, plcR, S...... targets evaluated are claimed to be specific to B. anthracis, cross-reactions with closely related B. cereus and B. thuringiensis strains were often observed. Of the 35 investigated PCR assays, only 4 were 100% specific for the B. anthracis chromosome. An interlaboratory ring trial among five European...

  19. Toward an international standard for PCR-based detection of Escherichia coli O157 - Part 1. Assay development and multi-center validation

    Abdulmawjood, A.; Bulte, M.; Cook, N.

    2003-01-01

    As part of a major European research project, a diagnostic PCR assay, including an internal amplification control, was developed and validated in a collaborative trial for the detection of Escherichia coli O157. The assay is based on amplification of sequences of the rJbE O157 gene. The collabora...

  20. GENE EXPRESSION CHANGES AND ANTI-PROLIFERATIVE EFFECT OF NONI (Morinda citrifolia FRUIT EXTRACT ANALYSED BY REAL TIME-PCR

    hermansyah hermansyah

    2017-05-01

    Full Text Available To elucidate the anti-proliferative effect of noni (Morinda citrifolia fruit extract for a Saccharomyces cerevisiae model organism, analysis of gene expression changes related to cell cycle associated with inhibition effect of noni fruit extract was carried out. Anti-proliferative of noni fruit extract was analyzed using gene expression changes of Saccharomyces cerevisiae (strains FY833 and BY4741.  Transcriptional analysis of genes that play a role in cell cycle was conducted by growing cells on YPDAde broth medium containing 1% (w/v noni fruit extract, and then subjected using quantitative real-time polymerase chain reaction (RT-PCR.  Transcriptional level of genes CDC6 (Cell Division Cycle-6, CDC20 (Cell Division Cycle-20, FAR1 (Factor ARrest-1, FUS3 (FUSsion-3, SIC1 (Substrate/Subunit Inhibitor of Cyclin-dependent protein kinase-1, WHI5 (WHIskey-5, YOX1 (Yeast homeobOX-1 and YHP1 (Yeast Homeo-Protein-1 increased, oppositely genes expression of DBF4 (DumbBell Forming, MCM1 (Mini Chromosome Maintenance-1 and TAH11 (Topo-A Hypersensitive-11 decreased, while the expression level of genes CDC7 (Cell Division Cycle-7, MBP1 (MIul-box Binding Protein-1 and SWI6 (SWItching deficient-6 relatively unchanged. These results indicated that gene expression changes might associate with anti-proliferative effect from noni fruit extract. These gene expressions changes lead to the growth inhibition of S.cerevisiae cell because of cell cycle defect.

  1. Gene expression profiling of acute myeloid leukemia samples from adult patients with AML-M1 and -M2 through boutique microarrays, real-time PCR and droplet digital PCR.

    Handschuh, Luiza; Kaźmierczak, Maciej; Milewski, Marek C; Góralski, Michał; Łuczak, Magdalena; Wojtaszewska, Marzena; Uszczyńska-Ratajczak, Barbara; Lewandowski, Krzysztof; Komarnicki, Mieczysław; Figlerowicz, Marek

    2018-03-01

    Acute myeloid leukemia (AML) is the most common and severe form of acute leukemia diagnosed in adults. Owing to its heterogeneity, AML is divided into classes associated with different treatment outcomes and specific gene expression profiles. Based on previous studies on AML, in this study, we designed and generated an AML-array containing 900 oligonucleotide probes complementary to human genes implicated in hematopoietic cell differentiation and maturation, proliferation, apoptosis and leukemic transformation. The AML-array was used to hybridize 118 samples from 33 patients with AML of the M1 and M2 subtypes of the French-American‑British (FAB) classification and 15 healthy volunteers (HV). Rigorous analysis of the microarray data revealed that 83 genes were differentially expressed between the patients with AML and the HV, including genes not yet discussed in the context of AML pathogenesis. The most overexpressed genes in AML were STMN1, KITLG, CDK6, MCM5, KRAS, CEBPA, MYC, ANGPT1, SRGN, RPLP0, ENO1 and SET, whereas the most underexpressed genes were IFITM1, LTB, FCN1, BIRC3, LYZ, ADD3, S100A9, FCER1G, PTRPE, CD74 and TMSB4X. The overexpression of the CPA3 gene was specific for AML with mutated NPM1 and FLT3. Although the microarray-based method was insufficient to differentiate between any other AML subgroups, quantitative PCR approaches enabled us to identify 3 genes (ANXA3, S100A9 and WT1) whose expression can be used to discriminate between the 2 studied AML FAB subtypes. The expression levels of the ANXA3 and S100A9 genes were increased, whereas those of WT1 were decreased in the AML-M2 compared to the AML-M1 group. We also examined the association between the STMN1, CAT and ABL1 genes, and the FLT3 and NPM1 mutation status. FLT3+/NPM1- AML was associated with the highest expression of STMN1, and ABL1 was upregulated in FLT3+ AML and CAT in FLT3- AML, irrespectively of the NPM1 mutation status. Moreover, our results indicated that CAT and WT1

  2. Combined mutation and rearrangement screening by quantitative PCR high-resolution melting: is it relevant for hereditary recurrent Fever genes?

    Nathalie Pallares-Ruiz

    2010-11-01

    Full Text Available The recent identification of genes implicated in hereditary recurrent fevers has allowed their specific diagnosis. So far however, only punctual mutations have been identified and a significant number of patients remain with no genetic confirmation of their disease after routine molecular approaches such as sequencing. The possible involvement of sequence rearrangements in these patients has only been examined in familial Mediterranean fever and was found to be unlikely. To assess the existence of larger genetic alterations in 3 other concerned genes, MVK (Mevalonate kinase, NLRP3 (Nod like receptor family, pyrin domain containing 3 and TNFRSF1A (TNF receptor superfamily 1A, we adapted the qPCR-HRM method to study possible intragenic deletions and duplications. This single-tube approach, combining both qualitative (mutations and quantitative (rearrangement screening, has proven effective in Lynch syndrome diagnosis. Using this approach, we studied 113 unselected (prospective group and 88 selected (retrospective group patients and identified no intragenic rearrangements in the 3 genes. Only qualitative alterations were found with a sensitivity similar to that obtained using classical molecular techniques for screening punctual mutations. Our results support that deleterious copy number alterations in MVK, NLRP3 and TNFRSF1A are rare or absent from the mutational spectrum of hereditary recurrent fevers, and demonstrate that a routine combined method such as qPCR-HRM provides no further help in genetic diagnosis. However, quantitative approaches such as qPCR or SQF-PCR did prove to be quick and effective and could still be useful after non contributory punctual mutation screening in the presence of clinically evocative signs.

  3. Bone to pick: the importance of evaluating reference genes for RT-qPCR quantification of gene expression in craniosynostosis and bone-related tissues and cells

    Yang Xianxian

    2012-05-01

    Full Text Available Abstract Background RT-qPCR is a common tool for quantification of gene expression, but its accuracy is dependent on the choice and stability (steady state expression levels of the reference gene/s used for normalization. To date, in the bone field, there have been few studies to determine the most stable reference genes and, usually, RT-qPCR data is normalised to non-validated reference genes, most commonly GAPDH, ACTB and 18 S rRNA. Here we draw attention to the potential deleterious impact of using classical reference genes to normalise expression data for bone studies without prior validation of their stability. Results Using the geNorm and Normfinder programs, panels of mouse and human genes were assessed for their stability under three different experimental conditions: 1 disease progression of Crouzon syndrome (craniosynostosis in a mouse model, 2 proliferative culture of cranial suture cells isolated from craniosynostosis patients and 3 osteogenesis of a mouse bone marrow stromal cell line. We demonstrate that classical reference genes are not always the most ‘stable’ genes and that gene ‘stability’ is highly dependent on experimental conditions. Selected stable genes, individually or in combination, were then used to normalise osteocalcin and alkaline phosphatase gene expression data during cranial suture fusion in the craniosynostosis mouse model and strategies compared. Strikingly, the expression trends of alkaline phosphatase and osteocalcin varied significantly when normalised to the least stable, the most stable or the three most stable genes. Conclusion To minimise errors in evaluating gene expression levels, analysis of a reference panel and subsequent normalization to several stable genes is strongly recommended over normalization to a single gene. In particular, we conclude that use of single, non-validated “housekeeping” genes such as GAPDH, ACTB and 18 S rRNA, currently a widespread practice by researchers in

  4. Phylogenetic analysis of the genus Anabaena based on PCR ...

    In this study, ten species of Anabaena were used to test the congruence between the traditional morphological classification system and the present molecular classification system. For morphological classification, strains were categorized into two different groups based on the whether or not the akinetes were directly ...

  5. Detection of Toxoplasma gondii in Diabetic Patients Using the Nested PCR Assay via RE and B1 Genes.

    Mousavi, Mohammad; Saravani, Ramin; Jafari Modrek, Mohammad; Shahrakipour, Mahnaz; Sekandarpour, Sina

    2016-02-01

    Toxoplasma gondii is an obligate intracellular protozoan parasite that exists worldwide. Various techniques have been developed for T. gondii detection. The aim of this study was the detection of T. gondii in diabetic patients with RE and B1 genes and the comparison of these two genes for diagnosis using the nested-PCR assay method. DNA samples from 205 diabetic patients who had been referred to the diabetes center of Ali Asghar hospital in Zahedan, Iran, were collected and analyzed using the nested-PCR assay method. Toxoplasma antibody data gathered using the enzyme-linked immunosorbent assay (ELISA) method from a previous study was used to group patients. The data were analyzed using SPSS 18. The chi-square test was used for comparison. Of the diabetic patients selected, the following results were obtained: 53 (IgG+, IgM+); 20 (IgG-, IgM+); 72 (IgG+, IgM-); and 60 (IgG-, IgM-). The nested-PCR detected the following: in the acute group, 21/53 (39.63%), 30/53 (56.60%) (IgM+, IgG+); in the chronic group, 40/72 (55.56%), 51/72 (70.83%), (IgG+, IgM-); in the false positive group, 18/20 (90%), 17/20 (85%) (IgM+, IgG-); and sero-negative samples of 38/60 (63.33%) and 60/ 41 (77.35%) for RE and B1 genes, respectively. The prevalence of toxoplasmosis showed positive in patients with diabetes in the B1 gene 139 (67.8%) and RE gene 117 (57.1%). Our study demonstrated that the B1 gene, more so than the RE gene, showed positive samples and can be used to detect toxoplasmosis, although the B1 gene, in comparison to the RE gene, did not show any superiority of molecular diagnosing capability. Results also showed that toxoplasma molecular detection methods can be used instead of routine serological detection methods in a clinical laboratory testing.

  6. Variations among Japanese of the factor IX gene (F9) detected by PCR-denaturing gradient gel electrophoresis

    Satoh, Chiyoko; Takahashi, Norio; Asakawa, Junichi; Hiyama, Keiko; Kodaira, Meiko (Radiation Effects Research Foundation, Hiroshima (Japan))

    1993-01-01

    In the course of feasibility studies to examine the efficiencies and practicalities of various techniques for screening for genetic variations, the human coagulation factor IX (F9) genes of 63 Japanese families were examined by PCR-denaturing gradient gel electrophoresis (PCR-DGGE). Four target sequences with lengths of 983-2,891 bp from the F9 genes of 126 unrelated individuals from Hiroshima and their 100 children were amplified by PCR, digested with restriction enzymes to approximately 500-bp fragments, and examined by DGGE - a total of 6,724 bp being examined per individual. GC-rich sequences (GC-clamps) of 40 bp were attached to both ends of the target sequences, as far as was feasible. Eleven types of new nucleotide substitutions were detected in the population, none of which produced RFLPs or caused hemophilia B. By examining two target sequences in a single lane, approximately 8,000 bp in a diploid individual could be examined. This approach is very effective for the detection of variations in DNA and is applicable to large-scale population studies. 46 refs., 3 figs., 1 tab.

  7. Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene.

    Kumar, Deepak; Singh, S P; Karabasanavar, Nagappa S; Singh, Rashmi; Umapathi, V

    2014-11-01

    Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168-776 bp) of mitochondrial cytochrome-b (cytb) gene for targeted species was designed which yielded a 609 bp PCR amplicon. Further, restriction enzyme digestion of the amplicons with Alu1 and Taq1 restriction enzymes resulted in a distinctive digestion pattern that was able to discriminate each species. The repeatability of the PCR-RFLP assay was validated ten times with consistent results observed. The developed assay can be used in routine diagnostic laboratories to differentiate the meats of closely related domestic livestock species namely cattle from buffalo and sheep from goat.

  8. A Java program for LRE-based real-time qPCR that enables large-scale absolute quantification.

    Rutledge, Robert G

    2011-03-02

    Linear regression of efficiency (LRE) introduced a new paradigm for real-time qPCR that enables large-scale absolute quantification by eliminating the need for standard curves. Developed through the application of sigmoidal mathematics to SYBR Green I-based assays, target quantity is derived directly from fluorescence readings within the central region of an amplification profile. However, a major challenge of implementing LRE quantification is the labor intensive nature of the analysis. Utilizing the extensive resources that are available for developing Java-based software, the LRE Analyzer was written using the NetBeans IDE, and is built on top of the modular architecture and windowing system provided by the NetBeans Platform. This fully featured desktop application determines the number of target molecules within a sample with little or no intervention by the user, in addition to providing extensive database capabilities. MS Excel is used to import data, allowing LRE quantification to be conducted with any real-time PCR instrument that provides access to the raw fluorescence readings. An extensive help set also provides an in-depth introduction to LRE, in addition to guidelines on how to implement LRE quantification. The LRE Analyzer provides the automated analysis and data storage capabilities required by large-scale qPCR projects wanting to exploit the many advantages of absolute quantification. Foremost is the universal perspective afforded by absolute quantification, which among other attributes, provides the ability to directly compare quantitative data produced by different assays and/or instruments. Furthermore, absolute quantification has important implications for gene expression profiling in that it provides the foundation for comparing transcript quantities produced by any gene with any other gene, within and between samples.

  9. A Java program for LRE-based real-time qPCR that enables large-scale absolute quantification.

    Robert G Rutledge

    Full Text Available BACKGROUND: Linear regression of efficiency (LRE introduced a new paradigm for real-time qPCR that enables large-scale absolute quantification by eliminating the need for standard curves. Developed through the application of sigmoidal mathematics to SYBR Green I-based assays, target quantity is derived directly from fluorescence readings within the central region of an amplification profile. However, a major challenge of implementing LRE quantification is the labor intensive nature of the analysis. FINDINGS: Utilizing the extensive resources that are available for developing Java-based software, the LRE Analyzer was written using the NetBeans IDE, and is built on top of the modular architecture and windowing system provided by the NetBeans Platform. This fully featured desktop application determines the number of target molecules within a sample with little or no intervention by the user, in addition to providing extensive database capabilities. MS Excel is used to import data, allowing LRE quantification to be conducted with any real-time PCR instrument that provides access to the raw fluorescence readings. An extensive help set also provides an in-depth introduction to LRE, in addition to guidelines on how to implement LRE quantification. CONCLUSIONS: The LRE Analyzer provides the automated analysis and data storage capabilities required by large-scale qPCR projects wanting to exploit the many advantages of absolute quantification. Foremost is the universal perspective afforded by absolute quantification, which among other attributes, provides the ability to directly compare quantitative data produced by different assays and/or instruments. Furthermore, absolute quantification has important implications for gene expression profiling in that it provides the foundation for comparing transcript quantities produced by any gene with any other gene, within and between samples.

  10. Development of a qPCR strategy to select bean genes involved in plant defence response and regulated by the Trichoderma velutinum - Rhizoctonia solani interaction

    Sara Mayo

    2016-08-01

    Full Text Available Bean production is affected by a wide diversity of fungal pathogens, among them Rhizoctonia solani is one of the most important. A strategy to control bean infectious diseases, mainly those caused by fungi, is based on the use of biocontrol agents that can reduce the negative effects of plant pathogens and also can promote positive responses in the plant. Trichoderma is a fungal genus that is able to induce the expression of genes involved in plant defence response and also to promote plant growth, root development and nutrient uptake. In this article, a strategy that combines in silico analysis and real time PCR to detect additional bean defence-related genes, regulated by the presence of Trichoderma velutinum and/or R. solani has been applied. Based in this strategy, from From the 48 bean genes initially analysed, 14 were selected, and only WRKY33, CH5b and hGS showed an up-regulatory response in the presence of T. velutinum. The other genes were or not affected (OSM34 or down-regulated by the presence of this fungus. R. solani infection resulted in a down-regulation of most of the genes analyzed, except PR1, OSM34 and CNGC2 that were not affected, and the presence of both, T. velutinum and R. solani, up-regulates hGS and down-regulates all the other genes analyzed, except CH5b which was not significantly affected.As conclusion, the strategy described in the present work has been shown to be effective to detect genes involved in plant defence, which respond to the presence of a biocontrol agent or to a pathogen and also to the presence of both. The selected genes show significant homology with previously described plant defence genes and they are expressed in bean leaves of plants treated with T. velutinum and/or infected with R. solani.

  11. Genetic Diversity Analysis of Tagetes Species Using PCR Based Molecular Markers

    Shahzadi, I.; Ahmad, R.; Waheed, U.; Shah, M. F.

    2016-01-01

    Tagetes is a genus of medicinally important wild and cultivated plants containing several chemical compounds. Lack of information on variation at molecular level present in Tagetes species is paramount to understand the genetic basis of medicinally important compounds. Current study aims at finding genetic variability in Tagetes species using random and specific molecular markers. Two primer systems including 25 RAPD and 3 STS (limonene gene) were used to ascertain genetic diversity of 15 Tagetes genotypes belonging to different species. We found that 20 of the 25 tested RAPD primers generated stable band patterns with 167 loci of amplification products. The proportion of polymorphic bands was 95.21 percent for RAPD primers. Three STS primers generated a total of 29 amplification products, of which 96.55 percent were polymorphic. Homology of genotypes was 53.18 percent and 51.11 percent with RAPD and STS primers respectively. The dendrogram obtained revealed that the range of overall genetic distances estimated was 22 percent to 100 percent through RAPD and 9 percent to 100 percent through STS markers. The findings help to establish that PCR-based assay such as RAPD and STS could be used successfully for estimation of genetic diversity of different genotypes of Tagetes that can be used for selection of parents for improvement of the species. (author)

  12. Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

    Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

    2015-03-01

    Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Identification and Evaluation of Reliable Reference Genes for Quantitative Real-Time PCR Analysis in Tea Plant (Camellia sinensis (L.) O. Kuntze)

    Hao, Xinyuan; Horvath, David P.; Chao, Wun S.; Yang, Yajun; Wang, Xinchao; Xiao, Bin

    2014-01-01

    Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a crucial step in qRT-PCR normalization. To date, only a few housekeeping genes have been identified and used as reference genes in tea plant. The validity of those reference genes are not clear since their expression stabilities have not been rigorously examined. To identify more appropriate reference genes for qRT-PCR studies on tea plant, we examined the expression stability of 11 candidate reference genes from three different sources: the orthologs of Arabidopsis traditional reference genes and stably expressed genes identified from whole-genome GeneChip studies, together with three housekeeping gene commonly used in tea plant research. We evaluated the transcript levels of these genes in 94 experimental samples. The expression stabilities of these 11 genes were ranked using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ∆CT method. Results showed that the three commonly used housekeeping genes of CsTUBULIN1, CsACINT1 and Cs18S rRNA1 together with CsUBQ1 were the most unstable genes in all sample ranking order. However, CsPTB1, CsEF1, CsSAND1, CsCLATHRIN1 and CsUBC1 were the top five appropriate reference genes for qRT-PCR analysis in complex experimental conditions. PMID:25474086

  14. Identification of three novel OA1 gene mutations identified in three families misdiagnosed with congenital nystagmus and carrier status determination by real-time quantitative PCR assay

    Hamel Christian

    2003-01-01

    Full Text Available Abstract Background X-linked ocular albinism type 1 (OA1 is caused by mutations in OA1 gene, which encodes a membrane glycoprotein localised to melanosomes. OA1 mainly affects pigment production in the eye, resulting in optic changes associated with albinism including hypopigmentation of the retina, nystagmus, strabismus, foveal hypoplasia, abnormal crossing of the optic fibers and reduced visual acuity. Affected Caucasian males usually appear to have normal skin and hair pigment. Results We identified three previously undescribed mutations consisting of two intragenic deletions (one encompassing exon 6, the other encompassing exons 7–8, and a point mutation (310delG in exon 2. We report the development of a new method for diagnosis of heterozygous deletions in OA1 gene based on measurement of gene copy number using real-time quantitative PCR from genomic DNA. Conclusion The identification of OA1 mutations in families earlier reported as families with hereditary nystagmus indicate that ocular albinism type 1 is probably underdiagnosed. Our method of real-time quantitative PCR of OA1 exons with DMD exon as external standard performed on the LightCycler™ allows quick and accurate carrier-status assessment for at-risk females.

  15. Real-time PCR-based method for rapid detection of Aspergillus niger and Aspergillus welwitschiae isolated from coffee.

    von Hertwig, Aline Morgan; Sant'Ana, Anderson S; Sartori, Daniele; da Silva, Josué José; Nascimento, Maristela S; Iamanaka, Beatriz Thie; Pelegrinelli Fungaro, Maria Helena; Taniwaki, Marta Hiromi

    2018-05-01

    Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B 2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia Persica in Animal Blood Samples

    SR Naddaf

    2011-06-01

    Full Text Available Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by mi­cros­copy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spi­ro­chetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR tar­get­ing flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were per­formed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spi­ro­chete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentra­tion as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.

  17. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia persica in Animal Blood Samples

    SR Naddaf

    2011-06-01

    Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by mi­cros­copy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spi­ro­chetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR tar­get­ing flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were per­formed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spi­ro­chete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentra­tion as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml.  Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.  

  18. High sensitive diagnostic technique for virus gene using radioisotope. Development of PCR in situ hybridization and its application

    Iwasaki, Takuya; Sada, Tetsutaro; Terai, Masanori; Sato, Yuko; Kurata, Takeshi [National Inst. of Infectious Diseases, Tokyo (Japan); Yamaguchi, Kazuyoshi; Yanagisawa, Akio; Sakai, Yuzo

    1998-02-01

    An animal model, experimentally induced squamous cell carcinoma was produced in hamster mucosa to establish a carcinogenic system inducible by interaction of a virus and chemical(s). Human hydatid mole and cholioepithelioma were chosen as the target subjects. Several tumor cells and host cells were isolated under microscopy and DNA was extracted from these cells to indentify the respective origins (maternal, paternal or host origin). The base sequence of HLADRB region was analyzed by PCR using synthetic primer and the tissue localization was examined by PCR in situ hybridization. A PCR product of 82 bp was found in 15 of 17 samples and there were 2 samples in which the product was not detectable with the constructed primer and 6 samples were negative. While significant differences were not observed by in situ hybridization compared with the negative control. (M.N.)

  19. High sensitive diagnostic technique for virus gene using radioisotope. Development of PCR in situ hybridization and its application

    Iwasaki, Takuya; Sada, Tetsutaro; Terai, Masanori; Sato, Yuko; Kurata, Takeshi; Yamaguchi, Kazuyoshi; Yanagisawa, Akio; Sakai, Yuzo

    1998-01-01

    An animal model, experimentally induced squamous cell carcinoma was produced in hamster mucosa to establish a carcinogenic system inducible by interaction of a virus and chemical(s). Human hydatid mole and cholioepithelioma were chosen as the target subjects. Several tumor cells and host cells were isolated under microscopy and DNA was extracted from these cells to indentify the respective origins (maternal, paternal or host origin). The base sequence of HLADRB region was analyzed by PCR using synthetic primer and the tissue localization was examined by PCR in situ hybridization. A PCR product of 82 bp was found in 15 of 17 samples and there were 2 samples in which the product was not detectable with the constructed primer and 6 samples were negative. While significant differences were not observed by in situ hybridization compared with the negative control. (M.N.)

  20. Microgravity validation of a novel system for RNA isolation and multiplex quantitative real time PCR analysis of gene expression on the International Space Station.

    Macarena Parra

    Full Text Available The International Space Station (ISS National Laboratory is dedicated to studying the effects of space on life and physical systems, and to developing new science and technologies for space exploration. A key aspect of achieving these goals is to operate the ISS National Lab more like an Earth-based laboratory, conducting complex end-to-end experimentation, not limited to simple microgravity exposure. Towards that end NASA developed a novel suite of molecular biology laboratory tools, reagents, and methods, named WetLab-2, uniquely designed to operate in microgravity, and to process biological samples for real-time gene expression analysis on-orbit. This includes a novel fluidic RNA Sample Preparation Module and fluid transfer devices, all-in-one lyophilized PCR assays, centrifuge, and a real-time PCR thermal cycler. Here we describe the results from the WetLab-2 validation experiments conducted in microgravity during ISS increment 47/SPX-8. Specifically, quantitative PCR was performed on a concentration series of DNA calibration standards, and Reverse Transcriptase-quantitative PCR was conducted on RNA extracted and purified on-orbit from frozen Escherichia coli and mouse liver tissue. Cycle threshold (Ct values and PCR efficiencies obtained on-orbit from DNA standards were similar to Earth (1 g controls. Also, on-orbit multiplex analysis of gene expression from bacterial cells and mammalian tissue RNA samples was successfully conducted in about 3 h, with data transmitted within 2 h of experiment completion. Thermal cycling in microgravity resulted in the trapping of gas bubbles inside septa cap assay tubes, causing small but measurable increases in Ct curve noise and variability. Bubble formation was successfully suppressed in a rapid follow-up on-orbit experiment using standard caps to pressurize PCR tubes and reduce gas release during heating cycles. The WetLab-2 facility now provides a novel operational on-orbit research capability for

  1. Evaluation of the suitability of six host genes as internal control in real-time RT-PCR assays in chicken embryo cell cultures infected with infectious bursal disease virus

    Li, Yiping; Bang, Dang Duong; Handberg, Kurt

    2005-01-01

    following a 7-day IBDV infection. The CE cells were inoculated with various multiplicity of infection (MOI) of IBDV vaccine strain Bursine-2, the expression of genes was measured by quantitative real-time PCR-based on cDNA synthesized from either normalized (100 ng) or non-normalized (10 mu l) total RNA...

  2. Housekeeping gene expression during fetal brain development in the rat-validation by semi-quantitative RT-PCR.

    Al-Bader, Maie Dawoud; Al-Sarraf, Hameed Ali

    2005-04-21

    Mammalian gene expression is usually carried out at the level of mRNA where the amount of mRNA of interest is measured under different conditions such as growth and development. It is therefore important to use a "housekeeping gene", that does not change in relative abundance during the experimental conditions, as a standard or internal control. However, recent data suggest that expression of some housekeeping genes may vary with the extent of cell proliferation, differentiation and under various experimental conditions. In this study, the expression of various housekeeping genes (18S rRNA [18S], glyceraldehydes-3-phosphate dehydrogenase [G3PDH], beta-glucuronidase [BGLU], histone H4 [HH4], ribosomal protein L19 [RPL19] and cyclophilin [CY]) was investigated during fetal rat brain development using semi-quantitative RT-PCR at 16, 19 and 21 days gestation. It was found that all genes studied, with exception to G3PDH, did not show any change in their expression levels during development. G3PDH, on the other hand, showed increased expression with development. These results suggest that the choice of a housekeeping gene is critical to the interpretation of experimental results and should be modified according to the nature of the study.

  3. Diagnosis of Neisseria gonorrhoeae among pregnant women by culture method and PCR on cppB gene

    Jalal Mardaneh

    2013-11-01

    Full Text Available Background: Neisseria gonorrhoeae is a human obligate pathogen and the etiological agent of gonorrhea. Health irreparable complications resulting from gonorrhea disease occur mainly in pregnant women and neonates. Aim of this study was diagnosis of Neisseria gonorrhoeae among pregnant women with using culture and molecular method by amplification of cppB gene with PCR. Material and Methods: In this cross-sectional study, two endocervical swab specimens were obtained from 1100 pregnant women who referred to Shiraz Hospitals. Culture on nonselective and selective media and nucleic acid amplification test (NAAT were performed for detection of Neisseria gonorrhoeae cppB gene. Results: All endocervical swabs cultures on selective and nonselective media were negative for Neisseria gonorrhoeae. Among examined endocervical swabs, 13samples (1.18% were positive by nucleic acid amplification of Neisseria gonorrgoeae cppB gene. Conclusion: Negative results of culture and positive results of PCR in this study indicate that however culture is gold standard method for detection of Neisseria gonorrhoeae but due to bacterial autolysis, poor sampling techniques and improper specimen storage and transport, its value decline as compared with Nucleic acid amplification test (NAAT.

  4. Selection and validation of appropriate reference genes for quantitative real-time PCR analysis in Salvia hispanica.

    Rahul Gopalam

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR has become the most popular choice for gene expression studies. For accurate expression analysis, it is pertinent to select a stable reference gene to normalize the data. It is now known that the expression of internal reference genes varies considerably during developmental stages and under different experimental conditions. For S