WorldWideScience

Sample records for gene activation events

  1. Neurotensin receptor 1 gene activation by the Tcf/beta-catenin pathway is an early event in human colonic adenomas.

    Science.gov (United States)

    Souazé, Frédérique; Viardot-Foucault, Véronique; Roullet, Nicolas; Toy-Miou-Leong, Mireille; Gompel, Anne; Bruyneel, Erik; Comperat, Eva; Faux, Maree C; Mareel, Marc; Rostène, William; Fléjou, Jean-François; Gespach, Christian; Forgez, Patricia

    2006-04-01

    Alterations in the Wnt/APC (adenomatous polyposis coli) signalling pathway, resulting in beta-catenin/T cell factor (Tcf)-dependent transcriptional gene activation, are frequently detected in familial and sporadic colon cancers. The neuropeptide neurotensin (NT) is widely distributed in the gastrointestinal tract. Its proliferative and survival effects are mediated by a G-protein coupled receptor, the NT1 receptor. NT1 receptor is not expressed in normal colon epithelial cells, but is over expressed in a number of cancer cells and tissues suggesting a link to the outgrowth of human colon cancer. Our results demonstrate that the upregulation of NT1 receptor occurring in colon cancer is the result of Wnt/APC signalling pathway activation. We first established the functionality of the Tcf response element within the NT1 receptor promoter. Consequently, we observed the activation of NT1 receptor gene by agents causing beta-catenin cytosolic accumulation, as well as a strong decline of endogenous receptor when wt-APC was restored. At the cellular level, the re-establishment of wt-APC phenotype resulted in the impaired functionality of NT1 receptor, like the breakdown in NT-induced intracellular calcium mobilization and the loss of NT pro-invasive effect. We corroborated the Wnt/APC signalling pathway on the NT1 receptor promoter activation with human colon carcinogenesis, and showed that NT1 receptor gene activation was perfectly correlated with nuclear or cytoplasmic beta-catenin localization while NT1 receptor was absent when beta-catenin was localized at the cell-cell junction in early adenomas of patients with familial adenomatous polyposis, hereditary non-polyposis colorectal cancer and loss of heterozygosity tumours. In this report we establish a novel link in vitro between the Tcf/beta-catenin pathway and NT1 receptor promoter activation.

  2. Oncogenic Activation of Fibroblast Growth Factor Receptor-3 and RAS Genes as Non-Overlapping Mutual Exclusive Events in Urinary Bladder Cancer.

    Science.gov (United States)

    Pandith, Arshad A; Hussain, Aashaq; Khan, Mosin S; Shah, Zafar A; Wani, M Saleem; Siddiqi, Mushtaq A

    2016-01-01

    Urinary bladder cancer is a common malignancy in the West and ranks as the 7th most common cancer in our region of Kashmir, India. FGFR3 mutations are frequent in superficial urothelial carcinoma (UC) differing from the RAS gene mutational pattern. The aim of this study was to analyze the frequency and association of FGFR3 and RAS gene mutations in UC cases. Paired tumor and adjacent normal tissue specimens of 65 consecutive UC patients were examined. DNA preparations were evaluated for the occurrence of FGFR3 and RAS gene mutations by PCR-SCCP and DNA sequencing. Somatic point mutations of FGFR3 were identified in 32.3% (21 of 65). The pattern and distribution were significantly associated with low grade/stage (<0.05). The overall mutations in exon 1 and 2 in all the forms of RAS genes aggregated to 21.5% and showed no association with any clinic-pathological parameters. In total, 53.8% (35 of 65) of the tumors studied had mutations in either a RAS or FGFR3 gene, but these were totally mutually exclusive in and none of the samples showed both the mutational events in mutually exclusive RAS and FGFR3. We conclude that RAS and FGFR3 mutations in UC are mutually exclusive and non-overlapping events which reflect activation of oncogenic pathways through different elements.

  3. Computational challenges in modeling gene regulatory events.

    Science.gov (United States)

    Pataskar, Abhijeet; Tiwari, Vijay K

    2016-10-19

    Cellular transcriptional programs driven by genetic and epigenetic mechanisms could be better understood by integrating "omics" data and subsequently modeling the gene-regulatory events. Toward this end, computational biology should keep pace with evolving experimental procedures and data availability. This article gives an exemplified account of the current computational challenges in molecular biology.

  4. Physical activity: genes & health

    CERN Multimedia

    2002-01-01

    Carl Johan SUNDBERG is an Associate Professor in Physiology and Licenced Physician. His research focus is Molecular mechanisms involved in the adaptation of human skeletal muscle to physical activity.

  5. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Acute hypoxia stress induced abundant differential expression genes and alternative splicing events in heart of tilapia.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Li, Bi Jun; Gu, Xiao Hui; Lin, Hao Ran

    2018-01-10

    Hypoxia is one of the critical environmental stressors for fish in aquatic environments. Although accumulating evidences indicate that gene expression is regulated by hypoxia stress in fish, how genes undergoing differential gene expression and/or alternative splicing (AS) in response to hypoxia stress in heart are not well understood. Using RNA-seq, we surveyed and detected 289 differential expressed genes (DEG) and 103 genes that undergo differential usage of exons and splice junctions events (DUES) in heart of a hypoxia tolerant fish, Nile tilapia, Oreochromis niloticus following 12h hypoxic treatment. The spatio-temporal expression analysis validated the significant association of differential exon usages in two randomly selected DUES genes (fam162a and ndrg2) in 5 tissues (heart, liver, brain, gill and spleen) sampled at three time points (6h, 12h, and 24h) under acute hypoxia treatment. Functional analysis significantly associated the differential expressed genes with the categories related to energy conservation, protein synthesis and immune response. Different enrichment categories were found between the DEG and DUES dataset. The Isomerase activity, Oxidoreductase activity, Glycolysis and Oxidative stress process were significantly enriched for the DEG gene dataset, but the Structural constituent of ribosome and Structural molecule activity, Ribosomal protein and RNA binding protein were significantly enriched only for the DUES genes. Our comparative transcriptomic analysis reveals abundant stress responsive genes and their differential regulation function in the heart tissues of Nile tilapia under acute hypoxia stress. Our findings will facilitate future investigation on transcriptome complexity and AS regulation during hypoxia stress in fish. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Making memories of stressful events: a journey along epigenetic, gene transcription and signaling pathways

    Directory of Open Access Journals (Sweden)

    Johannes M.H.M. eReul

    2014-01-01

    Full Text Available Strong psychologically stressful events are known to have a long-lasting impact on behavior. The consolidation of such, largely adaptive, behavioral responses to stressful events involves changes in gene expression in limbic brain regions such as the hippocampus and amygdala. The underlying molecular mechanisms however were until recently unresolved. More than a decade ago we started to investigate the role of these hormones in signaling and epigenetic mechanisms participating in the effects of stress on gene transcription in hippocampal neurons. We discovered a novel, rapid non-genomic mechanism in which glucocorticoids via glucocorticoid receptors (GRs facilitate signaling of the ERK MAPK signaling pathway to the downstream nuclear kinases MSK1 and Elk-1 in dentate gyrus (DG granule neurons. Activation of this signaling pathway results in serine10 (S10 phosphorylation and lysine14 (K14 acetylation at histone H3 (H3S10p-K14ac, leading to the induction of the immediate early genes c-Fos and Egr-1. In addition, we found a role of the DNA methylation status of gene promoters. A series of studies showed that these molecular mechanisms play a critical role in the long-lasting consolidation of behavioral responses in the forced swim test and Morris water maze. Furthermore, an important role of GABA was found in controlling the epigenetic and gene transcriptional responses to psychological stress. Thus, psychologically stressful events evoke a long-term impact on behavior through changes in hippocampal function brought about by distinct glutamatergic and glucocorticoid-driven changes in epigenetic regulation of gene transcription which are modulated by (local GABAergic interneurons and limbic afferent inputs. These epigenetic processes may play an important role in the etiology of stress-related mental disorders such as major depressive and anxiety disorders like PTSD.

  8. Tyrosine kinase chromosomal translocations mediate distinct and overlapping gene regulation events

    International Nuclear Information System (INIS)

    Kim, Hani; Gillis, Lisa C; Jarvis, Jordan D; Yang, Stuart; Huang, Kai; Der, Sandy; Barber, Dwayne L

    2011-01-01

    Leukemia is a heterogeneous disease commonly associated with recurrent chromosomal translocations that involve tyrosine kinases including BCR-ABL, TEL-PDGFRB and TEL-JAK2. Most studies on the activated tyrosine kinases have focused on proximal signaling events, but little is known about gene transcription regulated by these fusions. Oligonucleotide microarray was performed to compare mRNA changes attributable to BCR-ABL, TEL-PDGFRB and TEL-JAK2 after 1 week of activation of each fusion in Ba/F3 cell lines. Imatinib was used to control the activation of BCR-ABL and TEL-PDGFRB, and TEL-JAK2-mediated gene expression was examined 1 week after Ba/F3-TEL-JAK2 cells were switched to factor-independent conditions. Microarray analysis revealed between 800 to 2000 genes induced or suppressed by two-fold or greater by each tyrosine kinase, with a subset of these genes commonly induced or suppressed among the three fusions. Validation by Quantitative PCR confirmed that eight genes (Dok2, Mrvi1, Isg20, Id1, gp49b, Cxcl10, Scinderin, and collagen Vα1(Col5a1)) displayed an overlapping regulation among the three tested fusion proteins. Stat1 and Gbp1 were induced uniquely by TEL-PDGFRB. Our results suggest that BCR-ABL, TEL-PDGFRB and TEL-JAK2 regulate distinct and overlapping gene transcription profiles. Many of the genes identified are known to be involved in processes associated with leukemogenesis, including cell migration, proliferation and differentiation. This study offers the basis for further work that could lead to an understanding of the specificity of diseases caused by these three chromosomal translocations

  9. The effects of curiosity-evoking events on activity enjoyment.

    Science.gov (United States)

    Isikman, Elif; MacInnis, Deborah J; Ülkümen, Gülden; Cavanaugh, Lisa A

    2016-09-01

    Whereas prior literature has studied the positive effects of curiosity-evoking events that are integral to focal activities, we explore whether and how a curiosity-evoking event that is incidental to a focal activity induces negative outcomes for enjoyment. Four experiments and 1 field study demonstrate that curiosity about an event that is incidental to an activity in which individuals are engaged, significantly affects enjoyment of a concurrent activity. The reason why is that curiosity diverts attention away from the concurrent activity and focuses attention on the curiosity-evoking event. Thus, curiosity regarding an incidental event decreases enjoyment of a positive focal activity but increases enjoyment of a negative focal activity. PsycINFO Database Record (c) 2016 APA, all rights reserved

  10. PROFESSIONAL AND NONPROFESSIONAL EVENT MANAGERS: AGENTS’ CHARACTERISTICS OF EVENT-ACTIVITIES FIELD

    Directory of Open Access Journals (Sweden)

    Natalia Nikolaevna Startseva

    2015-03-01

    Full Text Available The main research question focuses on studying of the «new», non-traditional, recent forming professional group of event managers in modernRussia. This article provides the event group boundaries, its numerical and structural composition. On the basis of existing community event stereotypes, perceptions of event managers, supervisors’ event agencies and customers such the all agents included in the event activities, the author designed the image of professional and nonprofessional manager.Scientific, theoretical and practical significance of the work is leading to characterize agent-field-event activities and outline the prospects for the professional groups’ formation of event managers in modernRussia.Conceptuality and validity of the study is based on using theoretical and methodological comparative, functional and activity approaches.The obtained results can be used for further investigations in the event managers’ field and for other professional-groups, as well as useful in the study plan such as «Sociology of professions and professional groups» and «Sociology of culture and spiritual life».

  11. Early events in the evolution of spider silk genes.

    Directory of Open Access Journals (Sweden)

    James Starrett

    Full Text Available Silk spinning is essential to spider ecology and has had a key role in the expansive diversification of spiders. Silk is composed primarily of proteins called spidroins, which are encoded by a multi-gene family. Spidroins have been studied extensively in the derived clade, Orbiculariae (orb-weavers, from the suborder Araneomorphae ('true spiders'. Orbicularians produce a suite of different silks, and underlying this repertoire is a history of duplication and spidroin gene divergence. A second class of silk proteins, Egg Case Proteins (ECPs, is known only from the orbicularian species, Lactrodectus hesperus (Western black widow. In L. hesperus, ECPs bond with tubuliform spidroins to form egg case silk fibers. Because most of the phylogenetic diversity of spiders has not been sampled for their silk genes, there is limited understanding of spidroin gene family history and the prevalence of ECPs. Silk genes have not been reported from the suborder Mesothelae (segmented spiders, which diverged from all other spiders >380 million years ago, and sampling from Mygalomorphae (tarantulas, trapdoor spiders and basal araneomorph lineages is sparse. In comparison to orbicularians, mesotheles and mygalomorphs have a simpler silk biology and thus are hypothesized to have less diversity of silk genes. Here, we present cDNAs synthesized from the silk glands of six mygalomorph species, a mesothele, and a non-orbicularian araneomorph, and uncover a surprisingly rich silk gene diversity. In particular, we find ECP homologs in the mesothele, suggesting that ECPs were present in the common ancestor of extant spiders, and originally were not specialized to complex with tubuliform spidroins. Furthermore, gene-tree/species-tree reconciliation analysis reveals that numerous spidroin gene duplications occurred after the split between Mesothelae and Opisthothelae (Mygalomorphae plus Araneomorphae. We use the spidroin gene tree to reconstruct the evolution of amino acid

  12. Gene conversion and reversion events in Saccharomyces cerevisiae. Model for study of gamma radiation damage

    International Nuclear Information System (INIS)

    Moreno, Damaris; Fuentes, Jorge L.; Prieto Miranda, Enrique F.; Sanchez Lamar, Angel; Baluja, Ligia

    2004-01-01

    Radiosensitivity and kinetics of induction of gene conversion and reversion events in Saccharomyces cerevisiae strain D7 to gamma radiation at dose ranges from 100 to 800 Gy and 50 to 300 Gy respectively were studied. A source of 60Co PX- -30 at a dose rate of 49,43 GY/min was utilized. The cell survival curve showed DL50 of 150 Gy. Cell death kinetics was linear and adjusted over 98 %. The induction of gene conversion events was significant in relation to control from 50 Gy on. However, gene reversion was significant only at 200 Gy. Generally speaking, gene conversion event frequencies were higher than those of reversion, which indicates that gamma radiation preferably induces recombinogenic events. Both the conversion and reversion events showed exponential dependence on gamma radiation dose. The relative benefits of this test for mutagenesis and anti-mutagenesis studies were debated in this paper

  13. Designing Technology for Active Spectator Experiences at Sporting Events

    DEFF Research Database (Denmark)

    Veerasawmy, Rune; Ludvigsen, Martin

    2010-01-01

    This paper explores the active spectator experience at sporting events, by presenting and reflecting upon a design experiment carried out at a number of football1 events. The initial hypothesis of the design process, leading to the design experiment has been that the spectator experience is not m......This paper explores the active spectator experience at sporting events, by presenting and reflecting upon a design experiment carried out at a number of football1 events. The initial hypothesis of the design process, leading to the design experiment has been that the spectator experience...... is not merely an experience of receiving and consuming entertainment. It is also heavily reliant on the active participation of the spectator in creating the atmosphere of the entire event. The BannerBattle experiment provides interactive technology in sport arenas with a form of interaction based on existing...

  14. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events

    Directory of Open Access Journals (Sweden)

    Tigst Demeke

    2018-05-01

    Full Text Available Droplet digital PCR (ddPCR has been used for absolute quantification of genetically engineered (GE events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences (HMG-I/Y, FatA(A, CruA and Ccf for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A, reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes. Keywords: Canola, Digital PCR, DNA extraction, GMO, Reference genes

  15. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events.

    Science.gov (United States)

    Demeke, Tigst; Eng, Monika

    2018-05-01

    Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.

  16. Agent Activity-Rescheduling Decisions under Unexpected Events

    NARCIS (Netherlands)

    Nijland, E.W.L.; Arentze, T.A.; Borgers, A.W.J.; Timmermans, H.J.P.; Neves, J.M.; Santos, M.F.; Machado, J.M.

    2007-01-01

    In the context of activity-based transport simulation models, rescheduling of daily activities and associated travel in response to unforeseen events such as traffic congestion is receiving increasing attention. This paper describes the results of a stated adaptation experiment on how individuals

  17. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Serial killers: ordering caspase activation events in apoptosis.

    Science.gov (United States)

    Slee, E A; Adrain, C; Martin, S J

    1999-11-01

    Caspases participate in the molecular control of apoptosis in several guises; as triggers of the death machinery, as regulatory elements within it, and ultimately as a subset of the effector elements of the machinery itself. The mammalian caspase family is steadily growing and currently contains 14 members. At present, it is unclear whether all of these proteases participate in apoptosis. Thus, current research in this area is focused upon establishing the repertoire and order of caspase activation events that occur during the signalling and demolition phases of cell death. Evidence is accumulating to suggest that proximal caspase activation events are typically initiated by molecules that promote caspase aggregation. As expected, distal caspase activation events are likely to be controlled by caspases activated earlier in the cascade. However, recent data has cast doubt upon the functional demarcation of caspases into signalling (upstream) and effector (downstream) roles based upon their prodomain lengths. In particular, caspase-3 may perform an important role in propagating the caspase cascade, in addition to its role as an effector caspase within the death programme. Here, we discuss the apoptosis-associated caspase cascade and the hierarchy of caspase activation events within it.

  19. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  20. Creating Activating Events for Transformative Learning in a Prison Classroom

    Science.gov (United States)

    Keen, Cheryl H.; Woods, Robert

    2016-01-01

    In this article, we interpreted, in light of Mezirow's theory of transformative learning, interviews with 13 educators regarding their work with marginalized adult learners in prisons in the northeastern United States. Transformative learning may have been aided by the educators' response to unplanned activating events, humor, and respect, and…

  1. Planning and managing a corporate event : case: Event Activation Galaxy Studio Samsung S7/ S7 Edge

    OpenAIRE

    Bui, Quyen; Tran, Fa

    2017-01-01

    The thesis was written about the case: Event Activation Studio Galaxy Samsung S7/S7 Edge. Samsung is a global leading conglomerate company in the technology industry. This thesis discusses how to plan and manage an Event Activation for Samsung. The primary objective of this thesis was to provide a step-by-step guideline for planning and managing a corporate event. This objective was achieved by performing the following tasks: clarifying the influential role of corporate events in marketi...

  2. T-cell activation and early gene response in dogs.

    Directory of Open Access Journals (Sweden)

    Sally-Anne Mortlock

    Full Text Available T-cells play a crucial role in canine immunoregulation and defence against invading pathogens. Proliferation is fundamental to T-cell differentiation, homeostasis and immune response. Initiation of proliferation following receptor mediated stimuli requires a temporally programmed gene response that can be identified as immediate-early, mid- and late phases. The immediate-early response genes in T-cell activation engage the cell cycle machinery and promote subsequent gene activation events. Genes involved in this immediate-early response in dogs are yet to be identified. The present study was undertaken to characterise the early T-cell gene response in dogs to improve understanding of the genetic mechanisms regulating immune function. Gene expression profiles were characterised using canine gene expression microarrays and quantitative reverse transcription PCR (qRT-PCR, and paired samples from eleven dogs. Significant functional annotation clusters were identified following stimulation with phytohemagluttinin (PHA (5μg/ml, including the Toll-like receptor signaling pathway and phosphorylation pathways. Using strict statistical criteria, 13 individual genes were found to be differentially expressed, nine of which have ontologies that relate to proliferation and cell cycle control. These included, prostaglandin-endoperoxide synthase 2 (PTGS2/COX2, early growth response 1 (EGR1, growth arrest and DNA damage-inducible gene (GADD45B, phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, V-FOS FBJ murine osteosarcoma viral oncogene homolog (FOS, early growth response 2 (EGR2, hemogen (HEMGN, polo-like kinase 2 (PLK2 and polo-like kinase 3 (PLK3. Differential gene expression was re-examined using qRT-PCR, which confirmed that EGR1, EGR2, PMAIP1, PTGS2, FOS and GADD45B were significantly upregulated in stimulated cells and ALAS2 downregulated. PTGS2 and EGR1 showed the highest levels of response in these dogs. Both of these genes are involved in

  3. Recent adaptive events in human brain revealed by meta-analysis of positively selected genes.

    Directory of Open Access Journals (Sweden)

    Yue Huang

    Full Text Available BACKGROUND AND OBJECTIVES: Analysis of positively-selected genes can help us understand how human evolved, especially the evolution of highly developed cognitive functions. However, previous works have reached conflicting conclusions regarding whether human neuronal genes are over-represented among genes under positive selection. METHODS AND RESULTS: We divided positively-selected genes into four groups according to the identification approaches, compiling a comprehensive list from 27 previous studies. We showed that genes that are highly expressed in the central nervous system are enriched in recent positive selection events in human history identified by intra-species genomic scan, especially in brain regions related to cognitive functions. This pattern holds when different datasets, parameters and analysis pipelines were used. Functional category enrichment analysis supported these findings, showing that synapse-related functions are enriched in genes under recent positive selection. In contrast, immune-related functions, for instance, are enriched in genes under ancient positive selection revealed by inter-species coding region comparison. We further demonstrated that most of these patterns still hold even after controlling for genomic characteristics that might bias genome-wide identification of positively-selected genes including gene length, gene density, GC composition, and intensity of negative selection. CONCLUSION: Our rigorous analysis resolved previous conflicting conclusions and revealed recent adaptation of human brain functions.

  4. A new computational method for the detection of horizontal gene transfer events.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

  5. Fusion and retrotransposition events in the evolution of the sea anemone Anemonia viridis neurotoxin genes.

    Science.gov (United States)

    Moran, Yehu; Weinberger, Hagar; Lazarus, Nimrod; Gur, Maya; Kahn, Roy; Gordon, Dalia; Gurevitz, Michael

    2009-08-01

    Sea anemones are sessile predators that use a variety of toxins to paralyze prey and foe. Among these toxins, Types I, II and III are short peptides that affect voltage-gated sodium channels. Anemonia viridis is the only sea anemone species that produces both Types I and III neurotoxin. Although the two toxin types are unrelated in sequence and three-dimensional structure, cloning and comparative analysis of their loci revealed a highly similar sequence at the 5' region, which encodes a signal peptide. This similarity was likely generated by gene fusion and could be advantageous in transcript stability and intracellular trafficking and secretion. In addition, these analyses identified the processed pseudogenes of the two gene families in the genome of A. viridis, probably resulting from retrotransposition events. As presence of processed pseudogenes in the genome requires transcription in germ-line cells, we analyzed oocyte-rich ovaries and found that indeed they contain Types I and III transcripts. This result raises questions regarding the role of toxin transcripts in these tissues. Overall, the retrotransposition and gene fusion events suggest that the genes of both Types I and III neurotoxins evolved in a similar fashion and share a partial common ancestry.

  6. Conservation of transcription factor binding events predicts gene expression across species

    Science.gov (United States)

    Hemberg, Martin; Kreiman, Gabriel

    2011-01-01

    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to function, defined as expression of the target genes. We show that (i) there is a significantly higher degree of conservation of TFBEs when the target gene is expressed in both species; (ii) there is increased conservation of binding events for groups of TFs compared to individual TFs; and (iii) conserved TFBEs have a greater impact on the expression of their target genes than non-conserved ones. These results link conservation of structural elements (TFBEs) to conservation of function (gene expression) and suggest a higher degree of functional conservation than implied by previous studies. PMID:21622661

  7. Earthquake precursory events around epicenters and local active faults

    Science.gov (United States)

    Valizadeh Alvan, H.; Mansor, S. B.; Haydari Azad, F.

    2013-05-01

    The chain of underground events which are triggered by seismic activities and physical/chemical interactions prior to a shake in the earth's crust may produce surface and above surface phenomena. During the past decades many researchers have been carried away to seek the possibility of short term earthquake prediction using remote sensing data. Currently, there are several theories about the preparation stages of earthquakes most of which stress on raises in heat and seismic waves as the main signs of an impending earthquakes. Their differences only lie in the secondary phenomena which are triggered by these events. In any case, with the recent advances in remote sensing sensors and techniques now we are able to provide wider, more accurate monitoring of land, ocean and atmosphere. Among all theoretical factors, changes in Surface Latent Heat Flux (SLHF), Sea & Land Surface Temperature (SST & LST) and surface chlorophyll-a are easier to record from earth observing satellites. SLHF is the amount of energy exchange in the form of water vapor between the earth's surface and atmosphere. Abnormal variations in this factor have been frequently reported as an earthquake precursor during the past years. The accumulated stress in the earth's crust during the preparation phase of earthquakes is said to be the main cause of temperature anomalies weeks to days before the main event and subsequent shakes. Chemical and physical interactions in the presence of underground water lead to higher water evaporation prior to inland earthquakes. In case of oceanic earthquakes, higher temperature at the ocean beds may lead to higher amount of Chl-a on the sea surface. On the other hand, it has been also said that the leak of Radon gas which occurs as rocks break during earthquake preparation causes the formation of airborne ions and higher Air Temperature (AT). We have chosen to perform a statistical, long-term, and short-term approach by considering the reoccurrence intervals of past

  8. Gene-Tree Reconciliation with MUL-Trees to Resolve Polyploidy Events.

    Science.gov (United States)

    Gregg, W C Thomas; Ather, S Hussain; Hahn, Matthew W

    2017-11-01

    Polyploidy can have a huge impact on the evolution of species, and it is a common occurrence, especially in plants. The two types of polyploids-autopolyploids and allopolyploids-differ in the level of divergence between the genes that are brought together in the new polyploid lineage. Because allopolyploids are formed via hybridization, the homoeologous copies of genes within them are at least as divergent as orthologs in the parental species that came together to form them. This means that common methods for estimating the parental lineages of allopolyploidy events are not accurate, and can lead to incorrect inferences about the number of gene duplications and losses. Here, we have adapted an algorithm for topology-based gene-tree reconciliation to work with multi-labeled trees (MUL-trees). By definition, MUL-trees have some tips with identical labels, which makes them a natural representation of the genomes of polyploids. Using this new reconciliation algorithm we can: accurately place allopolyploidy events on a phylogeny, identify the parental lineages that hybridized to form allopolyploids, distinguish between allo-, auto-, and (in most cases) no polyploidy, and correctly count the number of duplications and losses in a set of gene trees. We validate our method using gene trees simulated with and without polyploidy, and revisit the history of polyploidy in data from the clades including both baker's yeast and bread wheat. Our re-analysis of the yeast data confirms the allopolyploid origin and parental lineages previously identified for this group. The method presented here should find wide use in the growing number of genomes from species with a history of polyploidy. [Polyploidy; reconciliation; whole-genome duplication.]. © The Author(s) 2017. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Catechol-o-methyltransferase gene polymorphism modifies the effect of coffee intake on incidence of acute coronary events.

    Directory of Open Access Journals (Sweden)

    Pertti Happonen

    Full Text Available BACKGROUND: The role of coffee intake as a risk factor for coronary heart disease (CHD has been debated for decades. We examined whether the relationship between coffee intake and incidence of CHD events is dependent on the metabolism of circulating catecholamines, as determined by functional polymorphism of the catechol-O-methyltransferase (COMT gene. METHODOLOGY/PRINCIPAL FINDINGS: In a cohort of 773 men who were 42 to 60 years old and free of symptomatic CHD at baseline in 1984-89, 78 participants experienced an acute coronary event during an average follow-up of 13 years. In logistic regression adjusting for age, smoking, family history of CHD, vitamin C deficiency, blood pressure, plasma cholesterol concentration, and diabetes, the odds ratio (90% confidence interval comparing heavy coffee drinkers with the low activity COMT genotype with those with the high activity or heterozygotic genotypes was 3.2 (1.2-8.4. Urinary adrenaline excretion increased with increasing coffee intake, being over two-fold in heavy drinkers compared with nondrinkers (p = 0.008 for trend. CONCLUSIONS/SIGNIFICANCE: Heavy coffee consumption increases the incidence of acute coronary events in men with low but not high COMT activity. Further studies are required to determine to which extent circulating catecholamines mediate the relationship between coffee intake and CHD.

  10. Human active X-specific DNA methylation events showing stability across time and tissues

    Science.gov (United States)

    Joo, Jihoon Eric; Novakovic, Boris; Cruickshank, Mark; Doyle, Lex W; Craig, Jeffrey M; Saffery, Richard

    2014-01-01

    The phenomenon of X chromosome inactivation in female mammals is well characterised and remains the archetypal example of dosage compensation via monoallelic expression. The temporal series of events that culminates in inactive X-specific gene silencing by DNA methylation has revealed a ‘patchwork' of gene inactivation along the chromosome, with approximately 15% of genes escaping. Such genes are therefore potentially subject to sex-specific imbalance between males and females. Aside from XIST, the non-coding RNA on the X chromosome destined to be inactivated, very little is known about the extent of loci that may be selectively silenced on the active X chromosome (Xa). Using longitudinal array-based DNA methylation profiling of two human tissues, we have identified specific and widespread active X-specific DNA methylation showing stability over time and across tissues of disparate origin. Our panel of X-chromosome loci subject to methylation on Xa reflects a potentially novel mechanism for controlling female-specific X inactivation and sex-specific dimorphisms in humans. Further work is needed to investigate these phenomena. PMID:24713664

  11. Distinguishing the rates of gene activation from phenotypic variations.

    Science.gov (United States)

    Chen, Ye; Lv, Cheng; Li, Fangting; Li, Tiejun

    2015-06-18

    Stochastic genetic switching driven by intrinsic noise is an important process in gene expression. When the rates of gene activation/inactivation are relatively slow, fast, or medium compared with the synthesis/degradation rates of mRNAs and proteins, the variability of protein and mRNA levels may exhibit very different dynamical patterns. It is desirable to provide a systematic approach to identify their key dynamical features in different regimes, aiming at distinguishing which regime a considered gene regulatory network is in from their phenotypic variations. We studied a gene expression model with positive feedbacks when genetic switching rates vary over a wide range. With the goal of providing a method to distinguish the regime of the switching rates, we first focus on understanding the essential dynamics of gene expression system in different cases. In the regime of slow switching rates, we found that the effective dynamics can be reduced to independent evolutions on two separate layers corresponding to gene activation and inactivation states, and the transitions between two layers are rare events, after which the system goes mainly along deterministic ODE trajectories on a particular layer to reach new steady states. The energy landscape in this regime can be well approximated by using Gaussian mixture model. In the regime of intermediate switching rates, we analyzed the mean switching time to investigate the stability of the system in different parameter ranges. We also discussed the case of fast switching rates from the viewpoint of transition state theory. Based on the obtained results, we made a proposal to distinguish these three regimes in a simulation experiment. We identified the intermediate regime from the fact that the strength of cellular memory is lower than the other two cases, and the fast and slow regimes can be distinguished by their different perturbation-response behavior with respect to the switching rates perturbations. We proposed a

  12. Synchronous Parallel Emulation and Discrete Event Simulation System with Self-Contained Simulation Objects and Active Event Objects

    Science.gov (United States)

    Steinman, Jeffrey S. (Inventor)

    1998-01-01

    The present invention is embodied in a method of performing object-oriented simulation and a system having inter-connected processor nodes operating in parallel to simulate mutual interactions of a set of discrete simulation objects distributed among the nodes as a sequence of discrete events changing state variables of respective simulation objects so as to generate new event-defining messages addressed to respective ones of the nodes. The object-oriented simulation is performed at each one of the nodes by assigning passive self-contained simulation objects to each one of the nodes, responding to messages received at one node by generating corresponding active event objects having user-defined inherent capabilities and individual time stamps and corresponding to respective events affecting one of the passive self-contained simulation objects of the one node, restricting the respective passive self-contained simulation objects to only providing and receiving information from die respective active event objects, requesting information and changing variables within a passive self-contained simulation object by the active event object, and producing corresponding messages specifying events resulting therefrom by the active event objects.

  13. Large-scale event extraction from literature with multi-level gene normalization.

    Directory of Open Access Journals (Sweden)

    Sofie Van Landeghem

    Full Text Available Text mining for the life sciences aims to aid database curation, knowledge summarization and information retrieval through the automated processing of biomedical texts. To provide comprehensive coverage and enable full integration with existing biomolecular database records, it is crucial that text mining tools scale up to millions of articles and that their analyses can be unambiguously linked to information recorded in resources such as UniProt, KEGG, BioGRID and NCBI databases. In this study, we investigate how fully automated text mining of complex biomolecular events can be augmented with a normalization strategy that identifies biological concepts in text, mapping them to identifiers at varying levels of granularity, ranging from canonicalized symbols to unique gene and proteins and broad gene families. To this end, we have combined two state-of-the-art text mining components, previously evaluated on two community-wide challenges, and have extended and improved upon these methods by exploiting their complementary nature. Using these systems, we perform normalization and event extraction to create a large-scale resource that is publicly available, unique in semantic scope, and covers all 21.9 million PubMed abstracts and 460 thousand PubMed Central open access full-text articles. This dataset contains 40 million biomolecular events involving 76 million gene/protein mentions, linked to 122 thousand distinct genes from 5032 species across the full taxonomic tree. Detailed evaluations and analyses reveal promising results for application of this data in database and pathway curation efforts. The main software components used in this study are released under an open-source license. Further, the resulting dataset is freely accessible through a novel API, providing programmatic and customized access (http://www.evexdb.org/api/v001/. Finally, to allow for large-scale bioinformatic analyses, the entire resource is available for bulk download from

  14. Events

    Directory of Open Access Journals (Sweden)

    Igor V. Karyakin

    2016-02-01

    Full Text Available The 9th ARRCN Symposium 2015 was held during 21st–25th October 2015 at the Novotel Hotel, Chumphon, Thailand, one of the most favored travel destinations in Asia. The 10th ARRCN Symposium 2017 will be held during October 2017 in the Davao, Philippines. International Symposium on the Montagu's Harrier (Circus pygargus «The Montagu's Harrier in Europe. Status. Threats. Protection», organized by the environmental organization «Landesbund für Vogelschutz in Bayern e.V.» (LBV was held on November 20-22, 2015 in Germany. The location of this event was the city of Wurzburg in Bavaria.

  15. 2008 LHC Open Days: Super(-conducting) events and activities

    CERN Multimedia

    2008-01-01

    Superconductivity will be one of the central themes of the programme of events and discovery activities of the forthcoming LHC Open Days on 5 and 6 April. Visitors will be invited to take part in a range of activities, experiments and exchanges all about this amazing aspect of the LHC project. Why superconductivity? Simply because it’s the principle on which the very operation of the LHC is based. At the heart of the LHC magnets lie 7000 kilometres of superconducting cables, each strand containing between 6000 and 9000 filaments of the superconducting alloy niobium-titanium in a copper coating. These cables, cooled to a temperature close to absolute zero, are able to conduct electricity without resistance. 12000 amp currents - an intensity some 30000 times greater than that of a 100 watt light bulb - pass through the cables of the LHC magnets.   Programme:   BLDG 163 (Saturday 5 and Sunday 6 April): See weird and wonderful experiments with your own eyes In the workshop where the 2...

  16. Frequent gene conversion events between the X and Y homologous chromosomal regions in primates

    Directory of Open Access Journals (Sweden)

    Hirai Hirohisa

    2010-07-01

    Full Text Available Abstract Background Mammalian sex-chromosomes originated from a pair of autosomes. A step-wise cessation of recombination is necessary for the proper maintenance of sex-determination and, consequently, generates a four strata structure on the X chromosome. Each stratum shows a specific per-site nucleotide sequence difference (p-distance between the X and Y chromosomes, depending on the time of recombination arrest. Stratum 4 covers the distal half of the human X chromosome short arm and the p-distance of the stratum is ~10%, on average. However, a 100-kb region, which includes KALX and VCX, in the middle of stratum 4 shows a significantly lower p-distance (1-5%, suggesting frequent sequence exchanges or gene conversions between the X and Y chromosomes in humans. To examine the evolutionary mechanism for this low p-distance region, sequences of a corresponding region including KALX/Y from seven species of non-human primates were analyzed. Results Phylogenetic analysis of this low p-distance region in humans and non-human primate species revealed that gene conversion like events have taken place at least ten times after the divergence of New World monkeys and Catarrhini (i.e., Old World monkeys and hominoids. A KALY-converted KALX allele in white-handed gibbons also suggests a possible recent gene conversion between the X and Y chromosomes. In these primate sequences, the proximal boundary of this low p-distance region is located in a LINE element shared between the X and Y chromosomes, suggesting the involvement of this element in frequent gene conversions. Together with a palindrome on the Y chromosome, a segmental palindrome structure on the X chromosome at the distal boundary near VCX, in humans and chimpanzees, may mediate frequent sequence exchanges between X and Y chromosomes. Conclusion Gene conversion events between the X and Y homologous regions have been suggested, mainly in humans. Here, we found frequent gene conversions in the

  17. Morphogenesis in sea urchin embryos: linking cellular events to gene regulatory network states

    Science.gov (United States)

    Lyons, Deidre; Kaltenbach, Stacy; McClay, David R.

    2013-01-01

    Gastrulation in the sea urchin begins with ingression of the primary mesenchyme cells (PMCs) at the vegetal pole of the embryo. After entering the blastocoel the PMCs migrate, form a syncitium, and synthesize the skeleton of the embryo. Several hours after the PMCs ingress the vegetal plate buckles to initiate invagination of the archenteron. That morphogenetic process occurs in several steps. The non-skeletogenic cells produce the initial inbending of the vegetal plate. Endoderm cells then rearrange and extend the length of the gut across the blastocoel to a target near the animal pole. Finally, cells that will form part of the midgut and hindgut are added to complete gastrulation. Later, the stomodeum invaginates from the oral ectoderm and fuses with the foregut to complete the archenteron. In advance of, and during these morphogenetic events an increasingly complex gene regulatory network controls the specification and the cell biological events that conduct the gastrulation movements. PMID:23801438

  18. Identification of new alternative splice events in the TCIRG1 gene in different human tissues

    International Nuclear Information System (INIS)

    Smirnova, Anna S.; Morgun, Andrey; Shulzhenko, Natalia; Silva, Ismael D.C.G.; Gerbase-DeLima, Maria

    2005-01-01

    Two transcript variants (TV) of the T cell immune regulator gene 1 (TCIRG1) have already been characterized. TV1 encodes a subunit of the osteoclast vacuolar proton pump and TV2 encodes a T cell inhibitory receptor. Based on the search in dbEST, we validated by RT-PCR six new alternative splice events in TCIRG1 in most of the 28 human tissues studied. In addition, we observed that transcripts using the TV1 transcription start site and two splice forms previously described in a patient with infantile malignant osteopetrosis are also expressed in various tissues of healthy individuals. Studies of these nine splice forms in cytoplasmic RNA of peripheral blood mononuclear cells showed that at least six of them could be efficiently exported from the nucleus. Since various products with nearly ubiquitous tissue distribution are generated from TCIRG1, this gene may be involved in other processes besides immune response and bone resorption

  19. Diet Activity Characteristic of Large-scale Sports Events Based on HACCP Management Model

    OpenAIRE

    Xiao-Feng Su; Li Guo; Li-Hua Gao; Chang-Zhuan Shao

    2015-01-01

    The study proposed major sports events dietary management based on "HACCP" management model. According to the characteristic of major sports events catering activities. Major sports events are not just showcase level of competitive sports activities which have become comprehensive special events including social, political, economic, cultural and other factors, complex. Sporting events conferred reach more diverse goals and objectives of economic, political, cultural, technological and other ...

  20. Normally occurring environmental and behavioral influences on gene activity: from central dogma to probabilistic epigenesis.

    Science.gov (United States)

    Gottlieb, G

    1998-10-01

    The central dogma of molecular biology holds that "information" flows from the genes to the structure of the proteins that the genes bring about through the formula DNA-->RNA-->Protein. In this view, a set of master genes activates the DNA necessary to produce the appropriate proteins that the organism needs during development. In contrast to this view, probabilistic epigenesis holds that necessarily there are signals from the internal and external environment that activate DNA to produce the appropriate proteins. To support this view, a substantial body of evidence is reviewed showing that external environmental influences on gene activation are normally occurring events in a large variety of organisms, including humans. This demonstrates how genes and environments work together to produce functional organisms, thus extending the author's model of probabilistic epigenesis.

  1. Events

    Directory of Open Access Journals (Sweden)

    Marina Tkacheva

    2010-12-01

    Full Text Available Baikal Economic ForumInternational Scientific and Practical Conference"Culture of Wood - Wood in Culture"Summer Ateliers of UrbanistsMemorandum of Understanding between UIA and Active House AllianceKorean Team Wins the First Prize in the VELUX AwardUIA Professional Practice Commission"Zodchestvo 2010" International FestivalRainbow of "Zodchestvo 2010" in ManezhThree Opinions on One Book about Gogol's Two"Soviet Modernism" BookV Plenum of the Board of the Union of Architects of RussiaXXX Meeting of Chief ArchitectsCompetition of Graduation ProjectsInternational Day of Architecture

  2. Residual activation events functional after irradiation of mouse splenic lymphocytes

    International Nuclear Information System (INIS)

    Duncan, D.D.; Lawrence, D.A.

    1991-01-01

    We have sought to identify the radiosensitivity of lymphocytes by determining the extent of activation of mitogen-stimulated lymphocytes previously exposed to growth-inhibiting doses of radiation. Mouse splenic lymphocytes were exposed to 0-15 Gy 137Cs radiation, and structural and functional damage were assayed. Although damage to cellular thiols and nonprotein thiols was modest, there was a significant loss of viability by 6 h as determined by uptake of propidium iodide (PI). Since cells did not die immediately after irradiation, the activation events which remained were evaluated. Growth-inhibiting doses of radiation left cells partially responsive to mitogen, in that cells were able to exit G0 phase, but they could progress no further into the cell cycle than G1a phase. It is important to note that assessment of viability by uptake of PI indicated substantial cell death after 15 Gy (45%, 6 h; 90%, 24 h); however, cell cycle analysis at 24 h indicated no significant decrease in progression from G0 to G1a phase. The LPS-stimulated response of B cells was more radiosensitive than the Con A-stimulated response of T cells. Further analysis of the Con A response indicated that production of interleukin-2 (IL-2) was unaffected, but expression of the IL-2 receptor was inhibited. Inhibition of poly-ADP-ribosylation and damage to lipids did not prevent the lack of mitogen responsiveness, since neither the ADP-ribose transferase inhibitor 3-aminobenzamide nor lipid radical scavengers had restorative effects on the mitogenic response. Nor was Con A-stimulated incorporation of [3H]thymidine restored with inhibitors of prostaglandin or leukotriene synthesis, suggesting that inhibition was due to direct effects on the Con A responders, and not indirect effects mediated by arachidonate metabolites

  3. Adverse events in families with hypertrophic or dilated cardiomyopathy and mutations in the MYBPC3 gene

    Directory of Open Access Journals (Sweden)

    Lehrke Stephanie

    2008-10-01

    Full Text Available Abstract Background Mutations in MYBPC3 encoding myosin binding protein C belong to the most frequent causes of hypertrophic cardiomyopathy (HCM and may also lead to dilated cardiomyopathy (DCM. MYBPC3 mutations initially were considered to cause a benign form of HCM. The aim of this study was to examine the clinical outcome of patients and their relatives with 18 different MYBPC3 mutations. Methods 87 patients with HCM and 71 patients with DCM were screened for MYBPC3 mutations by denaturing gradient gel electrophoresis and sequencing. Close relatives of mutation carriers were genotyped for the respective mutation. Relatives with mutation were then evaluated by echocardiography and magnetic resonance imaging. A detailed family history regarding adverse clinical events was recorded. Results In 16 HCM (18.4% and two DCM (2.8% index patients a mutation was detected. Seven mutations were novel. Mutation carriers exhibited no additional mutations in genes MYH7, TNNT2, TNNI3, ACTC and TPM1. Including relatives of twelve families, a total number of 42 mutation carriers was identified of which eleven (26.2% had at least one adverse event. Considering the twelve families and six single patients with mutations, 45 individuals with cardiomyopathy and nine with borderline phenotype were identified. Among the 45 patients, 23 (51.1% suffered from an adverse event. In eleven patients of seven families an unexplained sudden death was reported at the age between 13 and 67 years. Stroke or a transient ischemic attack occurred in six patients of five families. At least one adverse event occurred in eleven of twelve families. Conclusion MYBPC3 mutations can be associated with cardiac events such as progressive heart failure, stroke and sudden death even at younger age. Therefore, patients with MYBPC3 mutations require thorough clinical risk assessment.

  4. Incorporating planned activities and events in a dynamic multi-day activity agenda generator

    NARCIS (Netherlands)

    Nijland, L.; Arentze, T.; Timmermans, H.J.P.

    2012-01-01

    Daily agenda formation is influenced by formal commitments, satisfaction of needs surpassing some threshold and the desire to conduct particular activities in anticipation of socially and religiously driven events such as birthdays, Christmas, etc. As part of a research program to develop a dynamic

  5. Activation of vitellogenin II gene expression by steroid hormones in the old Japanese quail.

    Science.gov (United States)

    Gupta, S; Upadhyay, R; Kanungo, M S

    1998-11-01

    Alterations in the basal transcription rates of eukaryotic genes are believed to involve the binding of trans-acting factor(s) with specific DNA sequences in the promoter. We show here two interrelated events for the VTGII gene of the old, non-egg laying Japanese quail: alterations in the structure of the chromatin encompassing the gene, and binding of trans-acting factors to the promoter of the gene. Estradiol/progesterone alone or together cause alterations in the conformation of the chromatin of the promoter region of the gene. This may allow free access of nuclear protein(s) to the cis-acting elements, ERE, PRE and NF1, in the promoter of the gene and cause activation of transcription.

  6. Prevention of adverse events of interferon γ gene therapy by gene delivery of interferon γ-heparin-binding domain fusion protein in mice

    Directory of Open Access Journals (Sweden)

    Mitsuru Ando

    2014-01-01

    Full Text Available Sustained gene delivery of interferon (IFN γ can be an effective treatment, but our previous study showed high levels of IFNγ-induced adverse events, including the loss of body weight. These unwanted events could be reduced by target-specific delivery of IFNγ after in vivo gene transfer. To achieve this, we selected the heparin-binding domain (HBD of extracellular superoxide dismutase as a molecule to anchor IFNγ to the cell surface. We designed three IFNγ derivatives, IFNγ-HBD1, IFNγ-HBD2, and IFNγ-HBD3, each of which had 1, 2, or 3 HBDs, respectively. Each plasmid-encoding fusion proteins was delivered to the liver, a model target in this study, by hydrodynamic tail vein injection. The serum concentration of IFNγ-HBD2 and IFNγ-HBD3 after gene delivery was lower than that of IFNγ or IFNγ-HBD1. Gene delivery of IFNγ-HBD2, but not of IFNγ-HBD3, effectively increased the mRNA expression of IFNγ-inducible genes in the liver, suggesting liver-specific distribution of IFNγ-HBD2. Gene delivery of IFNγ-HBD2-suppressed tumor growth in the liver as efficiently as that of IFNγ with much less symptoms of adverse effects. These results indicate that the adverse events of IFNγ gene transfer can be prevented by gene delivery of IFNγ-HBD2, a fusion protein with high cell surface affinity.

  7. Gene activation by induced DNA rearrangements

    International Nuclear Information System (INIS)

    Schnipper, L.E.; Chan, V.; Sedivy, J.; Jat, P.; Sharp, P.A.

    1989-01-01

    A murine cell line (EN/NIH) containing the retroviral vector ZIPNeoSV(x)1 that was modified by deletion of the enhancer elements in the viral long terminal repeats has been used as an assay system to detect induced DNA rearrangements that result in activation of a transcriptionally silent reporter gene encoded by the viral genome. The spontaneous frequency of G418 resistance is less than 10(-7), whereas exposure to the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) or the combination of UV irradiation plus TPA resulted in the emergence of drug resistant cell lines at a frequency of 5 per 10(6) and 67 per 10(6) cells, respectively. In several of the cell lines that were analyzed a low level of amplification of one of the two parental retroviral integrants was observed, whereas in others no alteration in the region of the viral genome was detected. To determine the effect of the SV40 large T antigen on induced DNA rearrangements, EN/NIH cells were transfected with a temperature sensitive (ts) mutant of SV40 T. Transfectants were maintained at the permissive temperature (33 degrees C) for varying periods of time (1-5 days) in order to vary SV40 T antigen exposure, after which they were shifted to 39.5 degrees C for selection in G418. The frequency of emergence of drug resistant cell clones increased with duration of exposure to large T antigen (9-52 per 10(6) cells over 1-5 days, respectively), and all cell lines analyzed demonstrated DNA rearrangements in the region of the neo gene. A novel 18-kilobase pair XbaI fragment was cloned from one cell line which revealed the presence of a 2.0-kilobase pair EcoRI segment containing an inverted duplication which hybridized to neo sequences. It is likely that the observed rearrangement was initiated by the specific binding of large T antigen to the SV40 origin of replication encoded within the viral genome

  8. Aspirin exposure reveals novel genes associated with platelet function and cardiovascular events.

    Science.gov (United States)

    Voora, Deepak; Cyr, Derek; Lucas, Joseph; Chi, Jen-Tsan; Dungan, Jennifer; McCaffrey, Timothy A; Katz, Richard; Newby, L Kristin; Kraus, William E; Becker, Richard C; Ortel, Thomas L; Ginsburg, Geoffrey S

    2013-10-01

    The aim of this study was to develop ribonucleic acid (RNA) profiles that could serve as novel biomarkers for the response to aspirin. Aspirin reduces death and myocardial infarction (MI), suggesting that aspirin interacts with biological pathways that may underlie these events. Aspirin was administered, followed by whole-blood RNA microarray profiling, in a discovery cohort of healthy volunteers (HV1) (n = 50) and 2 validation cohorts of healthy volunteers (HV2) (n = 53) and outpatient cardiology patients (OPC) (n = 25). Platelet function was assessed using the platelet function score (PFS) in HV1 and HV2 and the VerifyNow Aspirin Test (Accumetrics, Inc., San Diego, California) in OPC. Bayesian sparse factor analysis identified sets of coexpressed transcripts, which were examined for associations with PFS in HV1 and validated in HV2 and OPC. Proteomic analysis confirmed the association of validated transcripts in platelet proteins. Validated gene sets were tested for association with death or MI in 2 patient cohorts (n = 587 total) from RNA samples collected at cardiac catheterization. A set of 60 coexpressed genes named the "aspirin response signature" (ARS) was associated with PFS in HV1 (r = -0.31, p = 0.03), HV2 (r = -0.34, Bonferroni p = 0.03), and OPC (p = 0.046). Corresponding proteins for the 17 ARS genes were identified in the platelet proteome, of which 6 were associated with PFS. The ARS was associated with death or MI in both patient cohorts (odds ratio: 1.2 [p = 0.01]; hazard ratio: 1.5 [p = 0.001]), independent of cardiovascular risk factors. Compared with traditional risk factors, reclassification (net reclassification index = 31% to 37%, p ≤ 0.0002) was improved by including the ARS or 1 of its genes, ITGA2B. RNA profiles of platelet-specific genes are novel biomarkers for identifying patients who do not respond adequately to aspirin and who are at risk for death or MI. Copyright © 2013 American College of Cardiology Foundation. Published by

  9. Transcriptomic events involved in melon mature-fruit abscission comprise the sequential induction of cell-wall degrading genes coupled to a stimulation of endo and exocytosis.

    Directory of Open Access Journals (Sweden)

    Jorge Corbacho

    Full Text Available Mature-fruit abscission (MFA in fleshy-fruit is a genetically controlled process with mechanisms that, contrary to immature-fruit abscission, has not been fully characterized. Here, we use pyrosequencing to characterize the transcriptomes of melon abscission zone (AZ at three stages during AZ-cell separation in order to understand MFA control at an early stage of AZ-activation.The results show that by early induction of MFA, the melon AZ exhibits major gene induction, while by late induction of MFA, melon AZ shows major gene repression. Although some genes displayed similar regulation in both early and late induction of abscission, such as EXT1-EXT4, EGase1, IAA2, ERF1, AP2D15, FLC, MADS2, ERAF17, SAP5 and SCL13 genes, the majority had different expression patterns. This implies that time-specific events occur during MFA, and emphasizes the value of characterizing multiple time-specific abscission transcriptomes. Analysis of gene-expression from these AZs reveal that a sequential induction of cell-wall-degrading genes is associated with the upregulation of genes involved in endo and exocytosis, and a shift in plant-hormone metabolism and signaling genes during MFA. This is accompanied by transcriptional activity of small-GTPases and synthaxins together with tubulins, dynamins, V-type ATPases and kinesin-like proteins potentially involved in MFA signaling. Early events are potentially controlled by down-regulation of MADS-box, AP2/ERF and Aux/IAA transcription-factors, and up-regulation of homeobox, zinc finger, bZIP, and WRKY transcription-factors, while late events may be controlled by up-regulation of MYB transcription-factors.Overall, the data provide a comprehensive view on MFA in fleshy-fruit, identifying candidate genes and pathways associated with early induction of MFA. Our comprehensive gene-expression profile will be very useful for elucidating gene regulatory networks of the MFA in fleshy-fruit.

  10. Recombination activating activity of XRCC1 analogous genes in X-ray sensitive and resistant CHO cell lines

    International Nuclear Information System (INIS)

    Golubnitchaya-Labudova, O.; Hoefer, M.; Portele, A.; Vacata, V.; Rink, H.; Lubec, G.

    1997-01-01

    The XRCC1 gene (X-ray repair cross complementing) complements the DNA repair deficiency of the radiation sensitive Chinese hamster ovary (CHO) mutant cell line EM9 but the mechanism of the correction is not elucidated yet. XRCC1 shows substantial homology to the RAG2 gene (recombination activating gene) and we therefore tried to answer the question, whether structural similarities (sequence of a putative recombination activating domain, aa 332-362 for XRCC1 and aa 286-316 in RAG2) would reflect similar functions of the homologous, putative recombination activating domain. PCR experiments revealed that no sequence homologous to the structural part of human XRCC1 was present in cDNA of CHO. Differential display demonstrated two putative recombination activating in the parental CHO line AA8 and one in the radiosensitive mutant EM9. Southern blot experiments showed the presence of several genes with partial homology to human XRCC1. Recombination studies consisted of expressing amplified target domains within chimeric proteins in recA - bacteria and subsequent detection of recombination events by sequencing the recombinant plasmids. Recombination experiments demonstrated recombination activating activity of all putative recombination activating domains amplified from AA8 and EM9 genomes as reflected by deletions within the inserts of the recombinant plasmids. The recombination activating activity of XRCC1 analogues could explain a mechanism responsible for the correction of the DNA repair defect in EM9. (author)

  11. Gene program-specific regulation of PGC-1{alpha} activity

    DEFF Research Database (Denmark)

    Schmidt, Søren F; Mandrup, Susanne

    2011-01-01

    Peroxisome proliferator-activated receptor γ (PPARγ) coactivator 1 α (PGC-1α) activation coordinates induction of the hepatic fasting response through coactivation of numerous transcription factors and gene programs. In the June 15, 2011, issue of Genes & Development, Lustig and colleagues (pp....... 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...

  12. Gene-physical activity interactions and their impact on diabetes

    DEFF Research Database (Denmark)

    Oskari Kilpeläinen, Tuomas; Franks, Paul W

    2014-01-01

    to an equal bout of physical activity. Individuals with specific genetic profiles are also expected to be more responsive to the beneficial effects of physical activity in the prevention of type 2 diabetes. Identification of such gene-physical activity interactions could give new insights into the biological...... the reader to the recent advances in the genetics of type 2 diabetes, summarize the current evidence on gene-physical activity interactions in relation to type 2 diabetes, and outline how information on gene-physical activity interactions might help improve the prevention and treatment of type 2 diabetes....... Finally, we will discuss the existing and emerging strategies that might enhance our ability to identify and exploit gene-physical activity interactions in the etiology of type 2 diabetes. © 2014 S. Karger AG, Basel....

  13. A TAD further: exogenous control of gene activation.

    Science.gov (United States)

    Mapp, Anna K; Ansari, Aseem Z

    2007-01-23

    Designer molecules that can be used to impose exogenous control on gene transcription, artificial transcription factors (ATFs), are highly desirable as mechanistic probes of gene regulation, as potential therapeutic agents, and as components of cell-based devices. Recently, several advances have been made in the design of ATFs that activate gene transcription (activator ATFs), including reports of small-molecule-based systems and ATFs that exhibit potent activity. However, the many open mechanistic questions about transcriptional activators, in particular, the structure and function of the transcriptional activation domain (TAD), have hindered rapid development of synthetic ATFs. A compelling need thus exists for chemical tools and insights toward a more detailed portrait of the dynamic process of gene activation.

  14. On proton events of different solar activity cycles

    International Nuclear Information System (INIS)

    Sattarov, I.; Sherdanov, Ch.; Sattarov, B.

    1997-01-01

    In solar activity cycle N21 and N22 the latitude distribution of the proton large flares and sunspot groups is being studied. It was found that higher proton activity of cycle N22 is connected with its higher latitude sunspot activity (author)

  15. Paraoxonase 1 (Q192R) gene polymorphism, coronary heart disease and the risk of a new acute coronary event.

    Science.gov (United States)

    Martínez-Quintana, Efrén; Rodríguez-González, Fayna; Medina-Gil, José María; Garay-Sánchez, Paloma; Tugores, Antonio

    Paraoxonase 1 (PON1) plays a major role in the oxidation of low density lipoprotein and in the prevention of coronary atherogenesis. In this context, coding region polymorphisms of PON1 gene, responsible for the enzyme activity, has become of interest as a marker for atherogenesis. A study and follow-up was conducted on 529 patients with an acute coronary event in order to assess the association between the PON1 Q192R (rs662;A/G) polymorphism, the type of acute coronary syndrome, cardiovascular risk factors (arterial hypertension, diabetes mellitus, dyslipidaemia, and smoking), the extent and severity of coronary atherosclerosis, and the medium-term clinical follow-up. The QQ genotype was found in 245 (46.3%) patients, with 218 (41.2%) patients showing the QR genotype, and 66 (14.5%) patients had the RR genotype. No significant differences were found between the QQ and QR/RR genotypes as regards the clinical characteristics, the analytical data, and the angiographic variables. Similarly, Kaplan-Meier survival analysis showed no significant differences in presenting with a new acute coronary event (p=0.598), cardiac mortality (p=0.701), stent thrombosis (p=0.508), or stent re-stenosis (p=0.598) between QQ and QR/RR genotypes during the follow-up period (3.3±2.2 years). In patients with an acute coronary syndrome, the PON1 Q192R genotypes did not influence the risk of suffering a new acute coronary event during the medium-term follow-up. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

  16. The interaction of combined effects of the BDNF and PRKCG genes and negative life events in major depressive disorder.

    Science.gov (United States)

    Yang, Chunxia; Sun, Ning; Liu, Zhifen; Li, Xinrong; Xu, Yong; Zhang, Kerang

    2016-03-30

    Major depressive disorder (MDD) is a mental disorder that results from complex interplay between multiple and partially overlapping sets of susceptibility genes and environmental factors. The brain derived neurotrophic factor (BDNF) and Protein kinase C gamma type (PRKCG) are logical candidate genes in MDD. Among diverse environmental factors, negative life events have been suggested to exert a crucial impact on brain development. In the present study, we hypothesized that interactions between genetic variants in BDNF and PRKCG and negative life events may play an important role in the development of MDD. We recruited a total of 406 patients with MDD and 391 age- and gender-matched control subjects. Gene-environment interactions were analyzed using generalized multifactor dimensionality reduction (GMDR). Under a dominant model, we observed a significant three-way interaction among BDNF rs6265, PRKCG rs3745406, and negative life events. The gene-environment combination of PRKCG rs3745406 C allele, BDNF rs6265 G allele and high level of negative life events (C-G-HN) was significantly associated with MDD (OR, 5.97; 95% CI, 2.71-13.15). To our knowledge, this is the first report of evidence that the BDNF-PRKCG interaction may modify the relationship between negative life events and MDD in the Chinese population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Profiling gene expression induced by protease-activated receptor 2 (PAR2 activation in human kidney cells.

    Directory of Open Access Journals (Sweden)

    Jacky Y Suen

    Full Text Available Protease-Activated Receptor-2 (PAR2 has been implicated through genetic knockout mice with cytokine regulation and arthritis development. Many studies have associated PAR2 with inflammatory conditions (arthritis, airways inflammation, IBD and key events in tumor progression (angiogenesis, metastasis, but they have relied heavily on the use of single agonists to identify physiological roles for PAR2. However such probes are now known not to be highly selective for PAR2, and thus precisely what PAR2 does and what mechanisms of downstream regulation are truly affected remain obscure. Effects of PAR2 activation on gene expression in Human Embryonic Kidney cells (HEK293, a commonly studied cell line in PAR2 research, were investigated here by comparing 19,000 human genes for intersecting up- or down-regulation by both trypsin (an endogenous protease that activates PAR2 and a PAR2 activating hexapeptide (2f-LIGRLO-NH(2. Among 2,500 human genes regulated similarly by both agonists, there were clear associations between PAR2 activation and cellular metabolism (1,000 genes, the cell cycle, the MAPK pathway, HDAC and sirtuin enzymes, inflammatory cytokines, and anti-complement function. PAR-2 activation up-regulated four genes more than 5 fold (DUSP6, WWOX, AREG, SERPINB2 and down-regulated another six genes more than 3 fold (TXNIP, RARG, ITGB4, CTSD, MSC and TM4SF15. Both PAR2 and PAR1 activation resulted in up-regulated expression of several genes (CD44, FOSL1, TNFRSF12A, RAB3A, COPEB, CORO1C, THBS1, SDC4 known to be important in cancer. This is the first widespread profiling of specific activation of PAR2 and provides a valuable platform for better understanding key mechanistic roles of PAR2 in human physiology. Results clearly support the development of both antagonists and agonists of human PAR2 as potential disease modifying therapeutic agents.

  18. Modeling the Activity of Single Genes

    Science.gov (United States)

    Mjolsness, Eric; Gibson, Michael

    1999-01-01

    The central dogma of molecular biology states that information is stored in DNA, transcribed to messenger RNA (mRNA) and then translated into proteins. This picture is significantly augmentated when we consider the action of certain proteins in regulating transcription. These transcription factors provide a feedback pathway by which genes can regulate one another's expression as mRNA and then as protein. To review: DNA, RNA and proteins have different functions. DNA is the molecular storehouse of genetic information. When cells divide, the DNA is replicated, so that each daughter cell maintains the same genetic information as the mother cell. RNA acts as a go-between from DNA to proteins. Only a single copy of DNA is present, but multiple copies of the same piece of RNA may be present, allowing cells to make huge amounts of protein. In eukaryotes (organisms with a nucleus), DNA is found in the nucleus only. RNA is copied in the nucleus then translocates(moves) outside the nucleus, where it is transcribed into proteins. Along the way, the RNA may be spliced, i.e., may have pieces cut out. RNA then attaches to ribosomes and is translated to proteins. Proteins are the machinery of the cell other than DNA and RNA, all the complex molecules of the cell are proteins. Proteins are specialized machines, each of which fulfills its own task, which may be transporting oxygen, catalyzing reactions, or responding to extracellular signals, just to name a few. One of the more interesting functions a protein may have is binding directly or indirectly to DNA to perform transcriptional regulation, thus forming a closed feedback loop of gene regulation. The structure of DNA and the central dogma were understood in the 50s; in the early 80s it became possible to make arbitrary modifications to DNA and use cellular machinery to transcribe and translate the resulting genes; more recently, genomes (i.e., the complete DNA sequence) of many organisms have been sequenced. This large

  19. Controlling nuclear JAKs and STATs for specific gene activation by IFNγ

    International Nuclear Information System (INIS)

    Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea; Canton, Johnathan; Johnson, Howard M.

    2011-01-01

    Highlights: → Gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interact with the promoter region of IFNγ-associated genes along with transcription factor STAT1α. → We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. → The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interacted with the promoter region of IFNγ-activated genes along with transcription factor STAT1α. Recent studies have suggested that activated Janus kinases pJAK2 and pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFNγ. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFNγ treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The β-actin gene, which is not activated by IFNγ, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFNγ treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFNγ treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFNγ treatment resulted in its disassociation and then re-association as pSTAT1. The

  20. DNA methyl transferase (DNMT gene polymorphisms could be a primary event in epigenetic susceptibility to schizophrenia.

    Directory of Open Access Journals (Sweden)

    Koramannil Radha Saradalekshmi

    Full Text Available DNA methylation has been implicated in the etiopathology of various complex disorders. DNA methyltransferases are involved in maintaining and establishing new methylation patterns. The aim of the present study was to investigate the inherent genetic variations within DNA methyltransferase genes in predisposing to susceptibility to schizophrenia. We screened for polymorphisms in DNA methyltransferases, DNMT1, DNMT3A, DNMT3B and DNMT3L in 330 schizophrenia patients and 302 healthy controls for association with Schizophrenia in south Indian population. These polymorphisms were also tested for subgroup analysis with patient's gender, age of onset and family history. DNMT1 rs2114724 (genotype P = .004, allele P = 0.022 and rs2228611 (genotype P = 0.004, allele P = 0.022 were found to be significantly associated at genotypic and allelic level with Schizophrenia in South Indian population. DNMT3B rs2424932 genotype (P = 0.023 and allele (P = 0.0063 increased the risk of developing schizophrenia in males but not in females. DNMT3B rs1569686 (genotype P = 0.027, allele P = 0.033 was found to be associated with early onset of schizophrenia and also with family history and early onset (genotype P = 0.009. DNMT3L rs2070565 (genotype P = 0.007, allele P = 0.0026 confers an increased risk of developing schizophrenia at an early age in individuals with family history. In-silico prediction indicated functional relevance of these SNPs in regulating the gene. These observations might be crucial in addressing and understanding the genetic control of methylation level differences from ethnic viewpoint. Functional significance of genotype variations within the DNMTs indeed suggest that the genetic nature of methyltransferases should be considered while addressing epigenetic events mediated by methylation in Schizophrenia.

  1. Dietary methanol regulates human gene activity.

    Directory of Open Access Journals (Sweden)

    Anastasia V Shindyapina

    Full Text Available Methanol (MeOH is considered to be a poison in humans because of the alcohol dehydrogenase (ADH-mediated conversion of MeOH to formaldehyde (FA, which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD. There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling.

  2. In Silico Prediction of Horizontal Gene Transfer Events in Lactobacillus bulgaricus and Streptococcus thermophilus Reveals Protocooperation in Yogurt Manufacturing▿ †

    Science.gov (United States)

    Liu, Mengjin; Siezen, Roland J.; Nauta, Arjen

    2009-01-01

    Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions. PMID:19395564

  3. In silico prediction of horizontal gene transfer events in Lactobacillus bulgaricus and Streptococcus thermophilus reveals protocooperation in yogurt manufacturing.

    Science.gov (United States)

    Liu, Mengjin; Siezen, Roland J; Nauta, Arjen

    2009-06-01

    Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions.

  4. Interaction between serotonin transporter gene variants and life events predicts response to antidepressants in the GENDEP project

    DEFF Research Database (Denmark)

    Keers, R.; Uher, R.; Huezo-Diaz, P.

    2011-01-01

    , and several polymorphisms in the serotonin transporter gene (SLC6A4) have been genotyped including the serotonin transporter-linked polymorphic region (5-HTTLPR). Stressful life events were shown to predict a significantly better response to escitalopram but had no effect on response to nortriptyline...

  5. Endogenous Methanol Regulates Mammalian Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Petrunia, Igor V.; Shindyapina, Anastasia V.; Silachev, Denis N.; Sheshukova, Ekaterina V.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis. PMID:24587296

  6. Endogenous methanol regulates mammalian gene activity.

    Directory of Open Access Journals (Sweden)

    Tatiana V Komarova

    Full Text Available We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis.

  7. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang

    2011-01-01

    element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  8. Robust, synergistic regulation of human gene expression using TALE activators.

    Science.gov (United States)

    Maeder, Morgan L; Linder, Samantha J; Reyon, Deepak; Angstman, James F; Fu, Yanfang; Sander, Jeffry D; Joung, J Keith

    2013-03-01

    Artificial activators designed using transcription activator-like effector (TALE) technology have broad utility, but previous studies suggest that these monomeric proteins often exhibit low activities. Here we demonstrate that TALE activators can robustly function individually or in synergistic combinations to increase expression of endogenous human genes over wide dynamic ranges. These findings will encourage applications of TALE activators for research and therapy, and guide design of monomeric TALE-based fusion proteins.

  9. Social exclusion in middle childhood: rejection events, slow-wave neural activity, and ostracism distress.

    Science.gov (United States)

    Crowley, Michael J; Wu, Jia; Molfese, Peter J; Mayes, Linda C

    2010-01-01

    This study examined neural activity with event-related potentials (ERPs) in middle childhood during a computer-simulated ball-toss game, Cyberball. After experiencing fair play initially, children were ultimately excluded by the other players. We focused specifically on “not my turn” events within fair play and rejection events within social exclusion. Dense-array ERPs revealed that rejection events are perceived rapidly. Condition differences (“not my turn” vs. rejection) were evident in a posterior ERP peaking at 420 ms consistent, with a larger P3 effect for rejection events indicating that in middle childhood rejection events are differentiated in <500 ms. Condition differences were evident for slow-wave activity (500-900 ms) in the medial frontal cortical region and the posterior occipital-parietal region, with rejection events more negative frontally and more positive posteriorly. Distress from the rejection experience was associated with a more negative frontal slow wave and a larger late positive slow wave, but only for rejection events. Source modeling with Geosouce software suggested that slow-wave neural activity in cortical regions previously identified in functional imaging studies of ostracism, including subgenual cortex, ventral anterior cingulate cortex, and insula, was greater for rejection events vs. “not my turn” events. © 2010 Psychology Press

  10. Analysis of Paks NPP Personnel Activity during Safety Related Event Sequences

    International Nuclear Information System (INIS)

    Bareith, A.; Hollo, Elod; Karsa, Z.; Nagy, S.

    1998-01-01

    Within the AGNES Project (Advanced Generic and New Evaluation of Safety) the Level-1 PSA model of the Paks NPP Unit 3 was developed in form of a detailed event tree/fault tree structure (53 initiating events, 580 event sequences, 6300 basic events are involved). This model gives a good basis for quantitative evaluation of potential consequences of actually occurred safety-related events, i.e. for precursor event studies. To make these studies possible and efficient, the current qualitative event analysis practice should be reviewed and a new additional quantitative analysis procedure and system should be developed and applied. The present paper gives an overview of the method outlined for both qualitative and quantitative analyses of the operator crew activity during off-normal situations. First, the operator performance experienced during past operational events is discussed. Sources of raw information, the qualitative evaluation process, the follow-up actions, as well as the documentation requirements are described. Second, the general concept of the proposed precursor event analysis is described. Types of modeled interactions and the considered performance influences are presented. The quantification of the potential consequences of the identified precursor events is based on the task-oriented, Level-1 PSA model of the plant unit. A precursor analysis system covering the evaluation of operator activities is now under development. Preliminary results gained during a case study evaluation of a past historical event are presented. (authors)

  11. Pseudomonas aeruginosa invasion and cytotoxicity are independent events, both of which involve protein tyrosine kinase activity.

    Science.gov (United States)

    Evans, D J; Frank, D W; Finck-Barbançon, V; Wu, C; Fleiszig, S M

    1998-04-01

    Pseudomonas aeruginosa clinical isolates exhibit invasive or cytotoxic phenotypes. Cytotoxic strains acquire some of the characteristics of invasive strains when a regulatory gene, exsA, that controls the expression of several extracellular proteins, is inactivated. exsA mutants are not cytotoxic and can be detected within epithelial cells by gentamicin survival assays. The purpose of this study was to determine whether epithelial cell invasion precedes and/or is essential for cytotoxicity. This was tested by measuring invasion (gentamicin survival) and cytotoxicity (trypan blue staining) of PA103 mutants deficient in specific exsA-regulated proteins and by testing the effect of drugs that inhibit invasion for their effect on cytotoxicity. A transposon mutant in the exsA-regulated extracellular factor exoU was neither cytotoxic nor invasive. Furthermore, several of the drugs that inhibited invasion did not prevent cytotoxicity. These results show that invasion and cytotoxicity are mutually exclusive events, inversely regulated by an exsA-encoded invasion inhibitor(s). Both involve host cell protein tyrosine kinase (PTK) activity, but they differ in that invasion requires Src family tyrosine kinases and calcium-calmodulin activity. PTK inhibitor drugs such as genistein may have therapeutic potential through their ability to block both invasive and cytotoxicity pathways via an action on the host cell.

  12. Peroxisome Proliferator-Activated Receptor Alpha Target Genes

    Directory of Open Access Journals (Sweden)

    Maryam Rakhshandehroo

    2010-01-01

    Full Text Available The peroxisome proliferator-activated receptor alpha (PPARα is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well.

  13. Gene × physical activity interactions in obesity

    DEFF Research Database (Denmark)

    Ahmad, Shafqat; Rukh, Gull; Varga, Tibor V

    2013-01-01

    Numerous obesity loci have been identified using genome-wide association studies. A UK study indicated that physical activity may attenuate the cumulative effect of 12 of these loci, but replication studies are lacking. Therefore, we tested whether the aggregate effect of these loci is diminished...... in adults of European ancestry reporting high levels of physical activity. Twelve obesity-susceptibility loci were genotyped or imputed in 111,421 participants. A genetic risk score (GRS) was calculated by summing the BMI-associated alleles of each genetic variant. Physical activity was assessed using self...... combined using meta-analysis weighted by cohort sample size. The meta-analysis yielded a statistically significant GRS × physical activity interaction effect estimate (Pinteraction  = 0.015). However, a statistically significant interaction effect was only apparent in North American cohorts (n = 39...

  14. WANO Activities Related to Identifying and Reducing the Likelihood for Recurring Events

    International Nuclear Information System (INIS)

    Llewellyn, Michael

    2003-01-01

    Since its inception, WANO has encouraged members to share operating experience and events information through the WANO Operating Experience Programme. Preventing recurring events is a prime reason for sharing events information. Over 2500 events have been shared through WANO since 1989. However, a review of WANO activities in 1997 identified that this information was not being used very well by WANO members, and that WANO was not adding much 'value' to the events sharing process. At the time, WANO only provided the 'postal exchange' function for events sharing, and was not reviewing events across WANO to help members focus on the really important issues. Often, these very important issues involve recurring events. As a result of the 1997 review of the WANO operating experience process, WANO re-sourced and developed new analysis capabilities and began producing new types of reports for its members. The resource commitment includes four seconded engineers (one from each WANO Regional Centre) brought to Paris to staff a WANO Operating Experience Central Team. This team analyses events across WANO, writes WANO event reports, provides operating experience-related training, and provides technical support to members to improve their use of operating experience information. One focus area for events analysis by WANO is the identification and subsequent industry notification of recurring events. As a result of the 1997 review of WANO activities, in 1998 WANO began production of several new types of event-based reports to communicate significant industry events to our members. A key focus of analysis of these significant events is whether they are recurring events (that is, very similar to previous events either at that NPP or another NPP in the industry). The reports are called Significant Operating Experience Reports (SOERs) and Significant Event Reports (SERs). Significant Operating Experience Reports (SOERs) are written by WANO when several event reports indicate that

  15. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data

    DEFF Research Database (Denmark)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme

    2018-01-01

    activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...

  16. Activity-regulated genes as mediators of neural circuit plasticity.

    Science.gov (United States)

    Leslie, Jennifer H; Nedivi, Elly

    2011-08-01

    Modifications of neuronal circuits allow the brain to adapt and change with experience. This plasticity manifests during development and throughout life, and can be remarkably long lasting. Evidence has linked activity-regulated gene expression to the long-term structural and electrophysiological adaptations that take place during developmental critical periods, learning and memory, and alterations to sensory map representations in the adult. In all these cases, the cellular response to neuronal activity integrates multiple tightly coordinated mechanisms to precisely orchestrate long-lasting, functional and structural changes in brain circuits. Experience-dependent plasticity is triggered when neuronal excitation activates cellular signaling pathways from the synapse to the nucleus that initiate new programs of gene expression. The protein products of activity-regulated genes then work via a diverse array of cellular mechanisms to modify neuronal functional properties. Synaptic strengthening or weakening can reweight existing circuit connections, while structural changes including synapse addition and elimination create new connections. Posttranscriptional regulatory mechanisms, often also dependent on activity, further modulate activity-regulated gene transcript and protein function. Thus, activity-regulated genes implement varied forms of structural and functional plasticity to fine-tune brain circuit wiring. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Massive activation of archaeal defense genes during viral infection.

    Science.gov (United States)

    Quax, Tessa E F; Voet, Marleen; Sismeiro, Odile; Dillies, Marie-Agnes; Jagla, Bernd; Coppée, Jean-Yves; Sezonov, Guennadi; Forterre, Patrick; van der Oost, John; Lavigne, Rob; Prangishvili, David

    2013-08-01

    Archaeal viruses display unusually high genetic and morphological diversity. Studies of these viruses proved to be instrumental for the expansion of knowledge on viral diversity and evolution. The Sulfolobus islandicus rod-shaped virus 2 (SIRV2) is a model to study virus-host interactions in Archaea. It is a lytic virus that exploits a unique egress mechanism based on the formation of remarkable pyramidal structures on the host cell envelope. Using whole-transcriptome sequencing, we present here a global map defining host and viral gene expression during the infection cycle of SIRV2 in its hyperthermophilic host S. islandicus LAL14/1. This information was used, in combination with a yeast two-hybrid analysis of SIRV2 protein interactions, to advance current understanding of viral gene functions. As a consequence of SIRV2 infection, transcription of more than one-third of S. islandicus genes was differentially regulated. While expression of genes involved in cell division decreased, those genes playing a role in antiviral defense were activated on a large scale. Expression of genes belonging to toxin-antitoxin and clustered regularly interspaced short palindromic repeat (CRISPR)-Cas systems was specifically pronounced. The observed different degree of activation of various CRISPR-Cas systems highlights the specialized functions they perform. The information on individual gene expression and activation of antiviral defense systems is expected to aid future studies aimed at detailed understanding of the functions and interplay of these systems in vivo.

  18. Report of Animal Investigation Program activities for the Baneberry Event

    International Nuclear Information System (INIS)

    Smith, D.D.; Black, S.C.; Giles, K.R.; Moghissi, A.A.

    1975-11-01

    On December 18, 1970, an underground nuclear test, conducted at the Nevada Test Site, released radioactive materials into the atmosphere with resultant on-site and off-site contamination. The Animal Investigation Program of the National Environmental Research Center, Las Vegas developed studies to document the distribution of fission and activation products in the tissue of domestic and wild animals residing within contaminated areas on and surrounding the Nevada Test Site. A study of radioiodine secretion in milk from cows at the experimental dairy farm, including urine and fecal excretion from four of them, was started about 24 hours after the venting. A grazing intake study, which utilized fistulated steers, was also carried out. The analytical data collected from these studies are presented in this report

  19. 77 FR 17076 - Agency Information Collection Activities; Proposed Collection; Comment Request; Adverse Event...

    Science.gov (United States)

    2012-03-23

    ...,777 in FY2011. We expect this trend to continue and, in fact, increase due to continued industry...] Agency Information Collection Activities; Proposed Collection; Comment Request; Adverse Event Reporting... information associated with adverse event reporting and recordkeeping for dietary supplements as required by...

  20. H-RAS, K-RAS, and N-RAS gene activation in human bladder cancers.

    Science.gov (United States)

    Przybojewska, B; Jagiello, A; Jalmuzna, P

    2000-08-01

    Bladder cancer is one of the leading causes of cancer death in most developed countries. In this work, 19 bladder cancer specimens, along with their infiltrations of the urinary bladder wall from the same patients, were examined for the presence of H-RAS, K-RAS, and N-RAS activation using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. The H-RAS activation was found in 15 (about 84%) of the 19 bladder cancers studied. The same results were obtained in the infiltrating urinary bladder wall samples. N-RAS gene mutations were observed in all cases (except 1) in which H-RAS gene mutations were detected. The results suggest a strong relationship between H-RAS and N-RAS gene activation in bladder cancer. Changes in the K-RAS gene in bladder cancers seem to be a rare event; this is in agreement with findings of other authors. We found activation of the gene in one specimen of bladder cancer and its infiltration of the urinary bladder wall in the same patient.

  1. Low-dose gamma-rays and simulated solar particle event protons modify splenocyte gene and cytokine expression patterns

    International Nuclear Information System (INIS)

    Rizvi, A.; Pecaut, M.J.; Gridley, D.S.

    2011-01-01

    The goal was to investigate the T helper (Th) response in splenocytes of mice exposed to low-dose/low-dose-rate (LDR) γ-rays, simulated solar particle event protons (sSPE), or combination of both. C57BL/6 mice were exposed to LDR γ-radiation ( 57 Co) to a total dose of 0.05 Gray (Gy) at 0.024 cGy/h, either with or without subsequent exposure to 2 Gy sSPE protons. Expression of genes related to Th cells was evaluated immediately after exposure (day 0). On day 21, intra- and extracellular cytokine production was assessed after activation with anti-CD3 monoclonal antibodies (mAb) or phorbol 12-myristate 13-acetate/ionophore (PMA/I). Five genes were significantly modulated on day 0 in one or more of the irradiated groups compared to controls (p<0.05): Ccl11, Ccr5, Cd80, Inha, and Il9. On day 21, numbers of cells positive for interferon-γ were high in the LDR + sSPE group versus 0 Gy and LDR γ-rays (p<0.05), but there was no difference in interleukin (IL)-2 and tumor necrosis factor (TNF)-α. Levels of secreted cytokines after anti-CD3 mAb activation were high for 5 (maximum intensity projection (MIP)-1α, GM-CSF, interferon (IFN)-γ, TNF-α, IL-13) and low for 2 (IL-7, IL-9) in all irradiated groups. Priming with LDR photons had a significant effect on IFN-γ and IL-17 compared to sSPE protons alone; IL-2 was low only in the LDR + sSPE group. The cytokine patterns after anti-phorbol myristate acetate (PMA)/ionomycin (I) activation were different compared to anti-CD3 mAb and with fewer differences among groups. The data show that total-body exposure to space-relevant radiation has profound effects on Th cell status and that priming with LDR γ-rays can in some cases modulate the response to sSPE. (author)

  2. Medical Provider Ballistic Protection at Active Shooter Events.

    Science.gov (United States)

    Stopyra, Jason P; Bozeman, William P; Callaway, David W; Winslow, James; McGinnis, Henderson D; Sempsrott, Justin; Evans-Taylor, Lisa; Alson, Roy L

    2016-01-01

    There is some controversy about whether ballistic protective equipment (body armor) is required for medical responders who may be called to respond to active shooter mass casualty incidents. In this article, we describe the ongoing evolution of recommendations to optimize medical care to injured victims at such an incident. We propose that body armor is not mandatory for medical responders participating in a rapid-response capacity, in keeping with the Hartford Consensus and Arlington Rescue Task Force models. However, we acknowledge that the development and implementation of these programs may benefit from the availability of such equipment as one component of risk mitigation. Many police agencies regularly retire body armor on a defined time schedule before the end of its effective service life. Coordination with law enforcement may allow such retired body armor to be available to other public safety agencies, such as fire and emergency medical services, providing some degree of ballistic protection to medical responders at little or no cost during the rare mass casualty incident. To provide visual demonstration of this concept, we tested three "retired" ballistic vests with ages ranging from 6 to 27 years. The vests were shot at close range using police-issue 9mm, .40 caliber, .45 caliber, and 12-gauge shotgun rounds. Photographs demonstrate that the vests maintained their ballistic protection and defeated all of these rounds. 2016.

  3. Evolutionary relationships between miRNA genes and their activity.

    Science.gov (United States)

    Zhu, Yan; Skogerbø, Geir; Ning, Qianqian; Wang, Zhen; Li, Biqing; Yang, Shuang; Sun, Hong; Li, Yixue

    2012-12-22

    The emergence of vertebrates is characterized by a strong increase in miRNA families. MicroRNAs interact broadly with many transcripts, and the evolution of such a system is intriguing. However, evolutionary questions concerning the origin of miRNA genes and their subsequent evolution remain unexplained. In order to systematically understand the evolutionary relationship between miRNAs gene and their function, we classified human known miRNAs into eight groups based on their evolutionary ages estimated by maximum parsimony method. New miRNA genes with new functional sequences accumulated more dynamically in vertebrates than that observed in Drosophila. Different levels of evolutionary selection were observed over miRNA gene sequences with different time of origin. Most genic miRNAs differ from their host genes in time of origin, there is no particular relationship between the age of a miRNA and the age of its host genes, genic miRNAs are mostly younger than the corresponding host genes. MicroRNAs originated over different time-scales are often predicted/verified to target the same or overlapping sets of genes, opening the possibility of substantial functional redundancy among miRNAs of different ages. Higher degree of tissue specificity and lower expression level was found in young miRNAs. Our data showed that compared with protein coding genes, miRNA genes are more dynamic in terms of emergence and decay. Evolution patterns are quite different between miRNAs of different ages. MicroRNAs activity is under tight control with well-regulated expression increased and targeting decreased over time. Our work calls attention to the study of miRNA activity with a consideration of their origin time.

  4. Distinguishing the rates of gene activation from phenotypic variations

    OpenAIRE

    Chen, Ye; Lv, Cheng; Li, Fangting; Li, Tiejun

    2015-01-01

    Background Stochastic genetic switching driven by intrinsic noise is an important process in gene expression. When the rates of gene activation/inactivation are relatively slow, fast, or medium compared with the synthesis/degradation rates of mRNAs and proteins, the variability of protein and mRNA levels may exhibit very different dynamical patterns. It is desirable to provide a systematic approach to identify their key dynamical features in different regimes, aiming at distinguishing which r...

  5. Active learning for ontological event extraction incorporating named entity recognition and unknown word handling.

    Science.gov (United States)

    Han, Xu; Kim, Jung-jae; Kwoh, Chee Keong

    2016-01-01

    Biomedical text mining may target various kinds of valuable information embedded in the literature, but a critical obstacle to the extension of the mining targets is the cost of manual construction of labeled data, which are required for state-of-the-art supervised learning systems. Active learning is to choose the most informative documents for the supervised learning in order to reduce the amount of required manual annotations. Previous works of active learning, however, focused on the tasks of entity recognition and protein-protein interactions, but not on event extraction tasks for multiple event types. They also did not consider the evidence of event participants, which might be a clue for the presence of events in unlabeled documents. Moreover, the confidence scores of events produced by event extraction systems are not reliable for ranking documents in terms of informativity for supervised learning. We here propose a novel committee-based active learning method that supports multi-event extraction tasks and employs a new statistical method for informativity estimation instead of using the confidence scores from event extraction systems. Our method is based on a committee of two systems as follows: We first employ an event extraction system to filter potential false negatives among unlabeled documents, from which the system does not extract any event. We then develop a statistical method to rank the potential false negatives of unlabeled documents 1) by using a language model that measures the probabilities of the expression of multiple events in documents and 2) by using a named entity recognition system that locates the named entities that can be event arguments (e.g. proteins). The proposed method further deals with unknown words in test data by using word similarity measures. We also apply our active learning method for the task of named entity recognition. We evaluate the proposed method against the BioNLP Shared Tasks datasets, and show that our method

  6. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.

    Science.gov (United States)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T

    2018-03-16

    Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.

  7. Complex active regions as the main source of extreme and large solar proton events

    Science.gov (United States)

    Ishkov, V. N.

    2013-12-01

    A study of solar proton sources indicated that solar flare events responsible for ≥2000 pfu proton fluxes mostly occur in complex active regions (CARs), i.e., in transition structures between active regions and activity complexes. Different classes of similar structures and their relation to solar proton events (SPEs) and evolution, depending on the origination conditions, are considered. Arguments in favor of the fact that sunspot groups with extreme dimensions are CARs are presented. An analysis of the flare activity in a CAR resulted in the detection of "physical" boundaries, which separate magnetic structures of the same polarity and are responsible for the independent development of each structure.

  8. The Influence of Major Life Events on Economic Attitudes in a World of Gene-Environment Interplay.

    Science.gov (United States)

    Hatemi, Peter K

    2013-10-01

    The role of "genes" on political attitudes has gained attention across disciplines. However, person-specific experiences have yet to be incorporated into models that consider genetic influences. Relying on a gene-environment interplay approach, this study explicates how life-events, such as losing one's job or suffering a financial loss, influence economic policy attitudes. The results indicate genetic and environmental variance on support for unions, immigration, capitalism, socialism and property tax is moderated by financial risks. Changes in the magnitude of genetic influences, however, are temporary. After two years, the phenotypic effects of the life events remain on most attitudes, but changes in the sources of individual differences do not. Univariate twin models that estimate the independent contributions of genes and environment on the variation of attitudes appear to provide robust baseline indicators of sources of individual differences. These estimates, however, are not event or day specific. In this way, genetic influences add stability, while environment cues change, and this process is continually updated.

  9. Motivation and intention to integrate physical activity into daily school life: the JAM World Record event.

    Science.gov (United States)

    Vazou, Spyridoula; Vlachopoulos, Symeon P

    2014-11-01

    Research on the motivation of stakeholders to integrate physical activity into daily school life is limited. The purpose was to examine the motivation of stakeholders to participate in a world record physical activity event and whether motivation was associated with future intention to use activity breaks during the daily school life and future participation in a similar event. After the 2012 JAM (Just-a-Minute) World Record event, 686 adults (591 women; 76.1% participated for children amotivation for participation in the next event were reported. Hierarchical regression analysis, controlling for age, gender, and occupation, showed that intrinsic forms of motivation positively predicted, whereas amotivation negatively predicted, future intention to participate in the event and use the activity breaks. Multivariate analyses of variance revealed that school-related participants were more intrinsically motivated and intended to use the activity breaks and repeat the event more than those who were not affiliated with a school. Nonschool participants reported higher extrinsic motivation and amotivation than school-related participants. © 2014 Society for Public Health Education.

  10. Gene expression in IFN-g-activated murine macrophages

    Directory of Open Access Journals (Sweden)

    Pereira C.A.

    2004-01-01

    Full Text Available Macrophages are critical for natural immunity and play a central role in specific acquired immunity. The IFN-gamma activation of macrophages derived from A/J or BALB/c mice yielded two different patterns of antiviral state in murine hepatitis virus 3 infection, which were related to a down-regulation of the main virus receptor. Using cDNA hybridization to evaluate mRNA accumulation in the cells, we were able to identify several genes that are differently up- or down-regulated by IFN-gamma in A/J (267 and 266 genes, respectively, up- and down-regulated or BALB/c (297 and 58 genes, respectively, up- and down-regulated mouse macrophages. Macrophages from mice with different genetic backgrounds behave differently at the molecular level and comparison of the patterns of non-activated and IFN-gamma-activated A/J or BALB/c mouse macrophages revealed, for instance, an up-regulation and a down-regulation of genes coding for biological functions such as enzymatic reactions, nucleic acid synthesis and transport, protein synthesis, transport and metabolism, cytoskeleton arrangement and extracellular matrix, phagocytosis, resistance and susceptibility to infection and tumors, inflammation, and cell differentiation or activation. The present data are reported in order to facilitate future correlation of proteomic/transcriptomic findings as well as of results obtained from a classical approach for the understanding of biological phenomena. The possible implication of the role of some of the gene products relevant to macrophage biology can now be further scrutinized. In this respect, a down-regulation of the main murine hepatitis virus 3 receptor gene was detected only in IFN-gamma-activated macrophages of resistant mice.

  11. Available processing resources influence encoding-related brain activity before an event

    OpenAIRE

    Galli, Giulia; Gebert, A. Dorothea; Otten, Leun J.

    2013-01-01

    Effective cognitive functioning not only relies on brain activity elicited by an event, but also on activity that precedes it. This has been demonstrated in a number of cognitive domains, including memory. Here, we show that brain activity that precedes the effective encoding of a word into long-term memory depends on the availability of sufficient processing resources. We recorded electrical brain activity from the scalps of healthy adult men and women while they memorized intermixed visual ...

  12. Evolution of GHF5 endoglucanase gene structure in plant-parasitic nematodes: no evidence for an early domain shuffling event.

    Science.gov (United States)

    Kyndt, Tina; Haegeman, Annelies; Gheysen, Godelieve

    2008-11-03

    the whole gene cassette, i.e. the GHF5 catalytic domain and the CBM2, rather than that it evolved by domain shuffling. Our evolutionary model for the gene structure in PPN GHF5 endoglucanases implies the occurrence of an early duplication event, and more recent gene duplications at genus or species level.

  13. Evolution of GHF5 endoglucanase gene structure in plant-parasitic nematodes: no evidence for an early domain shuffling event

    Directory of Open Access Journals (Sweden)

    Gheysen Godelieve

    2008-11-01

    PPN GHF5 endoglucanase gene most probably consisted of the whole gene cassette, i.e. the GHF5 catalytic domain and the CBM2, rather than that it evolved by domain shuffling. Our evolutionary model for the gene structure in PPN GHF5 endoglucanases implies the occurrence of an early duplication event, and more recent gene duplications at genus or species level.

  14. Processing data communications events by awakening threads in parallel active messaging interface of a parallel computer

    Science.gov (United States)

    Archer, Charles J.; Blocksome, Michael A.; Ratterman, Joseph D.; Smith, Brian E.

    2016-03-15

    Processing data communications events in a parallel active messaging interface (`PAMI`) of a parallel computer that includes compute nodes that execute a parallel application, with the PAMI including data communications endpoints, and the endpoints are coupled for data communications through the PAMI and through other data communications resources, including determining by an advance function that there are no actionable data communications events pending for its context, placing by the advance function its thread of execution into a wait state, waiting for a subsequent data communications event for the context; responsive to occurrence of a subsequent data communications event for the context, awakening by the thread from the wait state; and processing by the advance function the subsequent data communications event now pending for the context.

  15. Processing communications events in parallel active messaging interface by awakening thread from wait state

    Science.gov (United States)

    Archer, Charles J; Blocksome, Michael A; Ratterman, Joseph D; Smith, Brian E

    2013-10-22

    Processing data communications events in a parallel active messaging interface (`PAMI`) of a parallel computer that includes compute nodes that execute a parallel application, with the PAMI including data communications endpoints, and the endpoints are coupled for data communications through the PAMI and through other data communications resources, including determining by an advance function that there are no actionable data communications events pending for its context, placing by the advance function its thread of execution into a wait state, waiting for a subsequent data communications event for the context; responsive to occurrence of a subsequent data communications event for the context, awakening by the thread from the wait state; and processing by the advance function the subsequent data communications event now pending for the context.

  16. Information Sharing during the University of Texas at Austin Active Shooter/Suicide Event

    Science.gov (United States)

    Egnoto, Michael J.; Griffin, Darrin J.; Svetieva, Elena; Winslow, Luke

    2016-01-01

    Emergency response systems can be improved by investigating the motives and manner in which people share information during an active shooter crisis. This article analyzed survey data collected from undergraduate participants at The University of Texas at Austin who were enrolled during the fall of 2010 when an active shooter event occurred on…

  17. RNA-Guided Activation of Pluripotency Genes in Human Fibroblasts

    DEFF Research Database (Denmark)

    Xiong, Kai; Zhou, Yan; Blichfeld, Kristian Aabo

    2017-01-01

    -associated protein 9 (dCas9)-VP64 (CRISPRa) alone, or a combination of dCas9-VP64 and MS2-P65-HSF1 [synergistic activation mediator (SAM) system] mediated activation of five pluripotency genes: KLF4 (K), LIN28 (L), MYC (M), OCT4 (O), and SOX2 (S) in human cells (HEK293T, HeLa, HepG2, and primary fibroblasts...... could be obtained from these SAM fibroblasts. In conclusion, our study showed that CRISPR/Cas9-based ATFs are potent to activate and maintain transcription of endogenous human pluripotent genes. However, future improvements of the system are still required to improve activation efficiency and cellular...

  18. July 1974 solar events: a possible lower limit for microwave activity

    Energy Technology Data Exchange (ETDEWEB)

    Kaufmann, P; Iacomo, P Jr; Koppe, E H; Marques dos Santos, P; Schaal, R E [Universidade Mackenzie, Sao Paulo (Brazil). Centro de Radio-Astronomia e Astrofisica; Blakey, J R [Surrey Univ., Guildford (UK). Dept. of Physics

    1975-11-01

    The active region McMath 10433 was the source of several flares and radio outbursts during the early part of July 1974. This region was tracked continuously, for several periods during the month at 22.2 GHz using a telescope with a 4 minutes of arc beam. Comparison with the results obtained simultaneously with a normal 7 GHz solar instrument indicate that there is important burst activity occurring at levels below the detection limit of normal solar patrol instruments. The time-development morphology of these bursts is similar to those normally observed and has enabled the simple events to be re-interpreted. A completely new type of event-the fast absorption-has also been recognized. The correlation of the microwave events with SPA events observed on VLF propagation is also discussed.

  19. Gene expression profiling of resting and activated vascular smooth muscle cells by serial analysis of gene expression and clustering analysis

    NARCIS (Netherlands)

    Beauchamp, Nicholas J.; van Achterberg, Tanja A. E.; Engelse, Marten A.; Pannekoek, Hans; de Vries, Carlie J. M.

    2003-01-01

    Migration and proliferation of vascular smooth muscle cells (SMCs) are key events in atherosclerosis. However, little is known about alterations in gene expression upon transition of the quiescent, contractile SMC to the proliferative SMC. We performed serial analysis of gene expression (SAGE) of

  20. Definition of herpes simplex virus type 1 helper activities for adeno-associated virus early replication events.

    Directory of Open Access Journals (Sweden)

    Nathalie Alazard-Dany

    2009-03-01

    Full Text Available The human parvovirus Adeno-Associated Virus (AAV type 2 can only replicate in cells co-infected with a helper virus, such as Adenovirus or Herpes Simplex Virus type 1 (HSV-1; whereas, in the absence of a helper virus, it establishes a latent infection. Previous studies demonstrated that the ternary HSV-1 helicase/primase (HP complex (UL5/8/52 and the single-stranded DNA-Binding Protein (ICP8 were sufficient to induce AAV-2 replication in transfected cells. We independently showed that, in the context of a latent AAV-2 infection, the HSV-1 ICP0 protein was able to activate rep gene expression. The present study was conducted to integrate these observations and to further explore the requirement of other HSV-1 proteins during early AAV replication steps, i.e. rep gene expression and AAV DNA replication. Using a cellular model that mimics AAV latency and composite constructs coding for various sets of HSV-1 genes, we first confirmed the role of ICP0 for rep gene expression and demonstrated a synergistic effect of ICP4 and, to a lesser extent, ICP22. Conversely, ICP27 displayed an inhibitory effect. Second, our analyses showed that the effect of ICP0, ICP4, and ICP22 on rep gene expression was essential for the onset of AAV DNA replication in conjunction with the HP complex and ICP8. Third, and most importantly, we demonstrated that the HSV-1 DNA polymerase complex (UL30/UL42 was critical to enhance AAV DNA replication to a significant level in transfected cells and that its catalytic activity was involved in this process. Altogether, this work represents the first comprehensive study recapitulating the series of early events taking place during HSV-1-induced AAV replication.

  1. Substorm activity during the main phase of magnetic storms induced by the CIR and ICME events

    Science.gov (United States)

    Boroyev, R. N.; Vasiliev, M. S.

    2018-01-01

    In this work, the relation of high-latitude indices of geomagnetic activity (AE, Kp) with the rate of storm development and a solar wind electric field during the main phase of magnetic storm induced by the CIR and ICME events is investigated. 72 magnetic storms induced by CIR and ICME events have been selected. It is shown that for the CIR and ICME events the increase of average value of the Kp index (Kpaver) is observed with the growth of rate of storm development. The value of Kpaver index correlates with the magnitude of minimum value of Dst index (|Dstmin|) only for the ICME events. The analysis of average values of AE and Kp indices during the main phase of magnetic storm depending on the SW electric field has shown that for the CIR events, unlike the ICME events, the value of AEaver increases with the growth of average value of the electric field (Eswaver). The value of Kpaver correlates with the Eswaver only for the ICME events. The relation between geomagnetic indices and the maximum value of SW electric field (Eswmax) is weak. However, for the ICME events Kpaver correlates with Eswmax.

  2. Gene expression profiling of porcine skeletal muscle in the early recovery phase following acute physical activity

    DEFF Research Database (Denmark)

    Hansen, Jeanette; Conley, Lene; Hedegaard, Jakob

    2012-01-01

    Acute physical activity elicits changes in gene expression in skeletal muscles to promote metabolic changes and to repair exercise-induced muscle injuries. In the present time-course study, pigs were submitted to an acute bout of treadmill running until near exhaustion to determine the impact...... associated with proteolytic events, such as the muscle-specific E3 ubiquitin ligase atrogin-1, were significantly upregulated, suggesting that protein breakdown, prevention of protein aggregation and stabilization of unfolded proteins are important processes for restoration of cellular homeostasis. We also...... detected an upregulation of genes that are associated with muscle cell proliferation and differentiation, including MUSTN1, ASB5 and CSRP3, possibly reflecting activation, differentiation and fusion of satellite cells to facilitate repair of muscle damage. In addition, exercise increased expression...

  3. Physical activity habits in a European sports event: A case study

    Directory of Open Access Journals (Sweden)

    Leonor Gallardo

    2014-12-01

    Full Text Available The aim of this study is to learn more about the physical activity habits of participants in a popular sporting event such as European Sports Day, which is held simultaneously in five European countries (Spain, Italy, Cyprus, Ireland, and Hungary, and to measure the influence of socio-demographic variables on these habits. This is a cross-sectional study conducted with a sample of 856 participants, stratified by gender, age, and nationality. We statistically analyzed five variables related to physical activity habits: frequency of physical activity practice, places of practice, motives of practice, perceived fitness level, and popular event attendance. Of the participants, 76.8% said they perform physical activity weekly. Fitness/health improvement (34.63% and entertainment/leisure (26.52% are the main reasons for the practice of physical activity. Age and nationality are differentiating factors on physical activity habits.

  4. LARGE SOLAR ENERGETIC PARTICLE EVENTS ASSOCIATED WITH FILAMENT ERUPTIONS OUTSIDE ACTIVE REGIONS

    Energy Technology Data Exchange (ETDEWEB)

    Gopalswamy, N.; Mäkelä, P.; Akiyama, S.; Yashiro, S.; Xie, H.; Thakur, N. [Solar Physics Laboratory, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Kahler, S. W., E-mail: nat.gopalswamy@nasa.gov [Air Force Research Laboratory, Albuquerque, NM 87117 (United States)

    2015-06-10

    We report on four large filament eruptions (FEs) from solar cycles 23 and 24 that were associated with large solar energetic particle (SEP) events and interplanetary type II radio bursts. The post-eruption arcades corresponded mostly to C-class soft X-ray enhancements, but an M1.0 flare was associated with one event. However, the associated coronal mass ejections (CMEs) were fast (speeds ∼ 1000 km s{sup −1}) and appeared as halo CMEs in the coronagraph field of view. The interplanetary type II radio bursts occurred over a wide wavelength range, indicating the existence of strong shocks throughout the inner heliosphere. No metric type II bursts were present in three events, indicating that the shocks formed beyond 2–3 Rs. In one case, there was a metric type II burst with low starting frequency, indicating a shock formation height of ∼2 Rs. The FE-associated SEP events did have softer spectra (spectral index >4) in the 10–100 MeV range, but there were other low-intensity SEP events with spectral indices ≥4. Some of these events are likely FE-SEP events, but were not classified as such in the literature because they occurred close to active regions. Some were definitely associated with large active region flares, but the shock formation height was large. We definitely find a diminished role for flares and complex type III burst durations in these large SEP events. Fast CMEs and shock formation at larger distances from the Sun seem to be the primary characteristics of the FE-associated SEP events.

  5. Change in activity of catalysts for the oxidation of tritium during a fire event

    International Nuclear Information System (INIS)

    Iwai, Yasunori; Sato, Katsumi; Yamanishi, Toshihiko

    2012-01-01

    Highlights: ► We experimentally demonstrated the influence of produced gases from burned low-halogen cable on the activity of catalysts for tritium oxidation. ► At 423 K, no considerable decrease in catalytic activity was observed. ► At 293 K, considerable increase in catalytic activity was initially observed due to the effect of produced hydrogen. Then the temporary decrease was observed due mainly to the effect of produced moisture, however the activity was gradually recovered. - Abstract: The catalytic performance should be maintained in any off normal events. Fire accident is the typical off normal event. In the fusion plant, typical combustibles are evaluated to be polymeric low-halogen cables. Produced gases from burned low-halogen cable may affect the activity of catalysts for the oxidation of tritium. We experimentally demonstrated the influence of produced gases from burned low-halogen cable on the activity of catalyst using tritium gas. Our evaluation showed that ethylene, methane and benzene were major produced gases. The activity of catalysts for the oxidation of tritium during a fire event was evaluated using a commercial hydrophilic Pt/Al 2 O 3 catalyst and a commercial hydrophobic Pt-catalyst. The temperature of catalytic reactor was selected to be 423 and 293 K. At 423 K, no considerable decrease in catalytic activity was observed for both catalysts even in the presence of produced gases from burned low-halogen cable. At 293 K, considerable increase in catalytic activity was initially observed for both catalysts due to the effect of produced hydrogen. Then the temporary decrease was observed, however the catalytic activity was gradually recovered to be the original activity. Consequently, the irreversible decrease in activity of the catalysts during a fire event was not observed.

  6. Life review based on remembering specific positive events in active aging.

    Science.gov (United States)

    Latorre, José M; Serrano, Juan P; Ricarte, Jorge; Bonete, Beatriz; Ros, Laura; Sitges, Esther

    2015-02-01

    The aim of this study is to evaluate the effectiveness of life review (LR) based on specific positive events in non-depressed older adults taking part in an active aging program. Fifty-five older adults were randomly assigned to an experimental group or an active control (AC) group. A six-session individual training of LR based on specific positive events was carried out with the experimental group. The AC group undertook a "media workshop" of six sessions focused on learning journalistic techniques. Pre-test and post-test measures included life satisfaction, depressive symptoms, experiencing the environment as rewarding, and autobiographical memory (AM) scales. LR intervention decreased depressive symptomatology, improved life satisfaction, and increased specific memories. The findings suggest that practice in AM for specific events is an effective component of LR that could be a useful tool in enhancing emotional well-being in active aging programs, thus reducing depressive symptoms. © The Author(s) 2014.

  7. Antecedent occipital alpha band activity predicts the impact of oculomotor events in perceptual switching

    Directory of Open Access Journals (Sweden)

    Hironori eNakatani

    2013-05-01

    Full Text Available Oculomotor events such as blinks and saccades transiently interrupt the visual input and, even though this mostly goes undetected, these brief interruptions could still influence the percept. In particular, both blinking and saccades facilitate switching in ambiguous figures such as the Necker cube. To investigate the neural state antecedent to these oculomotor events during the perception of an ambiguous figure, we measured the human scalp electroencephalogram (EEG. When blinking led to perceptual switching, antecedent occipital alpha band activity exhibited a transient increase in amplitude. When a saccade led to switching, a series of transient increases and decreases in amplitude was observed in the antecedent occipital alpha band activity. Our results suggest that the state of occipital alpha band activity predicts the impact of oculomotor events on the percept.

  8. Gene Transfer in Eukaryotic Cells Using Activated Dendrimers

    Science.gov (United States)

    Dennig, Jörg

    Gene transfer into eukaryotic cells plays an important role in cell biology. Over the last 30 years a number of transfection methods have been developed to mediate gene transfer into eukaryotic cells. Classical methods include co-precipitation of DNA with calcium phosphate, charge-dependent precipitation of DNA with DEAE-dextran, electroporation of nucleic acids, and formation of transfection complexes between DNA and cationic liposomes. Gene transfer technologies based on activated PAMAM-dendrimers provide another class of transfection reagents. PAMAM-dendrimers are highly branched, spherical molecules. Activation of newly synthesized dendrimers involves hydrolytic removal of some of the branches, and results in a molecule with a higher degree of flexibility. Activated dendrimers assemble DNA into compact structures via charge interactions. Activated dendrimer - DNA complexes bind to the cell membrane of eukaryotic cells, and are transported into the cell by non-specific endocytosis. A structural model of the activated dendrimer - DNA complex and a potential mechanism for its uptake into cells will be discussed.

  9. Insulators target active genes to transcription factories and polycomb-repressed genes to polycomb bodies.

    Directory of Open Access Journals (Sweden)

    Hua-Bing Li

    2013-04-01

    Full Text Available Polycomb bodies are foci of Polycomb proteins in which different Polycomb target genes are thought to co-localize in the nucleus, looping out from their chromosomal context. We have shown previously that insulators, not Polycomb response elements (PREs, mediate associations among Polycomb Group (PcG targets to form Polycomb bodies. Here we use live imaging and 3C interactions to show that transgenes containing PREs and endogenous PcG-regulated genes are targeted by insulator proteins to different nuclear structures depending on their state of activity. When two genes are repressed, they co-localize in Polycomb bodies. When both are active, they are targeted to transcription factories in a fashion dependent on Trithorax and enhancer specificity as well as the insulator protein CTCF. In the absence of CTCF, assembly of Polycomb bodies is essentially reduced to those representing genomic clusters of Polycomb target genes. The critical role of Trithorax suggests that stable association with a specialized transcription factory underlies the cellular memory of the active state.

  10. Temporal variations in the gene expression levels of cyanobacterial anti-oxidant enzymes through geological history: implications for biological evolution during the Great Oxidation Event

    Science.gov (United States)

    Harada, M.; Furukawa, R.; Yokobori, S. I.; Tajika, E.; Yamagishi, A.

    2016-12-01

    A significant rise in atmospheric O2 levels during the GOE (Great Oxidation Event), ca. 2.45-2.0 Ga, must have caused a great stress to biosphere, enforcing life to adapt to oxic conditions. Cyanobacteria, oxygenic photosynthetic bacteria that had been responsible for the GOE, are at the same time one of the organisms that would have been greatly affected by the rise of O2 level in the surface environments. Knowledge on the evolution of cyanobacteria is not only important to elucidate the cause of the GOE, but also helps us to better understand the adaptive evolution of life in response to the GOE. Here we performed phylogenetic analysis of an anti-oxidant enzyme Fe-SOD (iron superoxide dismutase) of cyanobacteria, to assess the adaptive evolution of life under the GOE. The rise of O2 level must have increased the level of toxic reactive oxygen species in cyanobacterial cells, thus forced them to change activities or the gene expression levels of Fe-SOD. In the present study, we focus on the change in the gene expression levels of the enzyme, which can be estimated from the promoter sequences of the gene. Promoters are DNA sequences found upstream of protein encoding regions, where RNA polymerase binds and initiates transcription. "Strong" promoters that efficiently interact with RNA polymerase induce high rates of transcription, leading to high levels of gene expression. Thus, from the temporal changes in the promoter sequences, we can estimate the variations in the gene expression levels during the geological time. Promoter sequences of Fe-SOD at each ancestral node of cyanobacteria were predicted from phylogenetic analysis, and the ancestral promoter sequences were compared to the promoters of known highly expressed genes. The similarity was low at the time of the emergence of cyanobacteria; however, increased at the branching nodes diverged 2.4 billon years ago. This roughly coincided with the onset of the GOE, implying that the transition from low to high gene

  11. Specific Genes Associated with Adverse Events of Methylphenidate Use in the Pediatric Population

    DEFF Research Database (Denmark)

    Joensen, Beinta; Meyer, Morten; Aagaard, Lise

    2017-01-01

    were significantly associated with the following genes: appetite reduction (CES1*G); buccal-lingual movements (T1065G); diastolic blood pressure (ADRA2A Mspl C/C-GC); emotionality (DAT1*9/9); irritability (SNAP25 T1065G); picking (DRD4*7/DRD4*4); social withdrawal (DRD4*7/DRD4*4); somatic complaints...

  12. Gene-Environment Interaction Effects of Peer Deviance, Parental Knowledge and Stressful Life Events on Adolescent Alcohol Use.

    Science.gov (United States)

    Cooke, Megan E; Meyers, Jacquelyn L; Latvala, Antti; Korhonen, Tellervo; Rose, Richard J; Kaprio, Jaakko; Salvatore, Jessica E; Dick, Danielle M

    2015-10-01

    The purpose of this study was to address two methodological issues that have called into question whether previously reported gene-environment interaction (GxE) effects for adolescent alcohol use are 'real'. These issues are (1) the potential correlation between the environmental moderator and the outcome across twins and (2) non-linear transformations of the behavioral outcome. Three environments that have been previously studied (peer deviance, parental knowledge, and potentially stressful life events) were examined here. For each moderator (peer deviance, parental knowledge, and potentially stressful life events), a series of models was fit to both a raw and transformed measure of monthly adolescent alcohol use in a sample that included 825 dizygotic (DZ) and 803 monozygotic (MZ) twin pairs. The results showed that the moderating effect of peer deviance was robust to transformation, and that although the significance of moderating effects of parental knowledge and potentially stressful life events were dependent on the scale of the adolescent alcohol use outcome, the overall results were consistent across transformation. In addition, the findings did not vary across statistical models. The consistency of the peer deviance results and the shift of the parental knowledge and potentially stressful life events results between trending and significant, shed some light on why previous findings for certain moderators have been inconsistent and emphasize the importance of considering both methodological issues and previous findings when conducting and interpreting GxE analyses.

  13. The Effect of Local Events to Rural Tourism as a Recreational Activity

    Directory of Open Access Journals (Sweden)

    Elif Zeynep ÖZER

    2014-08-01

    Full Text Available Recreation is the activities that person attends voluntarily in his/her spare time to refreshing, relaxing and motivation. Activities that are made in rural area are option for recreational activities. There is an increase in consumer demand for rural tour ism as an alternative tourism option. Participants get a chance to know different cultural structures and chance to see natural beauties by attending rural activities. Events that are performed with attendees form different destinations are support area fr om economy, development and advertising point of view. Objective of this work is making contribution to development rural tourism and recreational activities by defining the effect of local events to rural tourism as a recreational activity. In this work, the effect of participation of recreational tourism activities to rural tourism is investigated. Data that is required is gathered by semi structured interview technique. The result of this work has a potential to use a resource to lead event managers. Thi s work also has a potential to use a resource for studies that are related to recreation tourism, local activities and rural tourism.

  14. Expected reward modulates encoding-related theta activity before an event.

    Science.gov (United States)

    Gruber, Matthias J; Watrous, Andrew J; Ekstrom, Arne D; Ranganath, Charan; Otten, Leun J

    2013-01-01

    Oscillatory brain activity in the theta frequency range (4-8 Hz) before the onset of an event has been shown to affect the likelihood of successfully encoding the event into memory. Recent work has also indicated that frontal theta activity might be modulated by reward, but it is not clear how reward expectancy, anticipatory theta activity, and memory formation might be related. Here, we used scalp electroencephalography (EEG) to assess the relationship between these factors. EEG was recorded from healthy adults while they memorized a series of words. Each word was preceded by a cue that indicated whether a high or low monetary reward would be earned if the word was successfully remembered in a later recognition test. Frontal theta power between the presentation of the reward cue and the onset of a word was predictive of later memory for the word, but only in the high reward condition. No theta differences were observed before word onset following low reward cues. The magnitude of prestimulus encoding-related theta activity in the high reward condition was correlated with the number of high reward words that were later confidently recognized. These findings provide strong evidence for a link between reward expectancy, theta activity, and memory encoding. Theta activity before event onset seems to be especially important for the encoding of motivationally significant stimuli. One possibility is that dopaminergic activity during reward anticipation mediates frontal theta activity related to memory. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Binding of TFIIIC to sine elements controls the relocation of activity-dependent neuronal genes to transcription factories.

    Directory of Open Access Journals (Sweden)

    Luca Crepaldi

    Full Text Available In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE conditions. We discovered that Short Interspersed Elements (SINEs located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs, and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes.

  16. Binding of TFIIIC to sine elements controls the relocation of activity-dependent neuronal genes to transcription factories.

    Science.gov (United States)

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T; Jongbloets, Bart C; Down, Thomas A; Riccio, Antonella

    2013-01-01

    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes.

  17. Deduction of probable events of lateral gene transfer through comparison of phylogenetic trees by recursive consolidation and rearrangement

    Directory of Open Access Journals (Sweden)

    Charlebois Robert L

    2005-04-01

    Full Text Available Abstract Background When organismal phylogenies based on sequences of single marker genes are poorly resolved, a logical approach is to add more markers, on the assumption that weak but congruent phylogenetic signal will be reinforced in such multigene trees. Such approaches are valid only when the several markers indeed have identical phylogenies, an issue which many multigene methods (such as the use of concatenated gene sequences or the assembly of supertrees do not directly address. Indeed, even when the true history is a mixture of vertical descent for some genes and lateral gene transfer (LGT for others, such methods produce unique topologies. Results We have developed software that aims to extract evidence for vertical and lateral inheritance from a set of gene trees compared against an arbitrary reference tree. This evidence is then displayed as a synthesis showing support over the tree for vertical inheritance, overlaid with explicit lateral gene transfer (LGT events inferred to have occurred over the history of the tree. Like splits-tree methods, one can thus identify nodes at which conflict occurs. Additionally one can make reasonable inferences about vertical and lateral signal, assigning putative donors and recipients. Conclusion A tool such as ours can serve to explore the reticulated dimensionality of molecular evolution, by dissecting vertical and lateral inheritance at high resolution. By this, we mean that individual nodes can be examined not only for congruence, but also for coherence in light of LGT. We assert that our tools will facilitate the comparison of phylogenetic trees, and the interpretation of conflicting data.

  18. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Directory of Open Access Journals (Sweden)

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  19. Differentially expressed genes in embryonic cardiac tissues of mice lacking Folr1 gene activity

    Directory of Open Access Journals (Sweden)

    Schwartz Robert J

    2007-11-01

    motility as well as cellular redox status, which may contribute to cardiovascular abnormalities in mouse embryos lacking Folr1 gene activity.

  20. Conservation of transcription factor binding events predicts gene expression across species

    OpenAIRE

    Hemberg, Martin; Kreiman, Gabriel

    2011-01-01

    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to funct...

  1. Using Active Learning to Identify Health Information Technology Related Patient Safety Events.

    Science.gov (United States)

    Fong, Allan; Howe, Jessica L; Adams, Katharine T; Ratwani, Raj M

    2017-01-18

    The widespread adoption of health information technology (HIT) has led to new patient safety hazards that are often difficult to identify. Patient safety event reports, which are self-reported descriptions of safety hazards, provide one view of potential HIT-related safety events. However, identifying HIT-related reports can be challenging as they are often categorized under other more predominate clinical categories. This challenge of identifying HIT-related reports is exacerbated by the increasing number and complexity of reports which pose challenges to human annotators that must manually review reports. In this paper, we apply active learning techniques to support classification of patient safety event reports as HIT-related. We evaluated different strategies and demonstrated a 30% increase in average precision of a confirmatory sampling strategy over a baseline no active learning approach after 10 learning iterations.

  2. Multi-day activity scheduling reactions to planned activities and future events in a dynamic model of activity-travel behavior

    NARCIS (Netherlands)

    Nijland, L.; Arentze, T.A.; Timmermans, H.J.P.

    2014-01-01

    Modeling multi-day planning has received scarce attention in activity-based transport demand modeling so far. However, new dynamic activity-based approaches are being developed at the current moment. The frequency and inflexibility of planned activities and events in activity schedules of

  3. Multi-Day Activity Scheduling Reactions to Planned Activities and Future Events in a Dynamic Model of Activity-Travel Behavior

    NARCIS (Netherlands)

    Nijland, L.; Arentze, T.; Timmermans, H.

    2014-01-01

    Modeling multi-day planning has received scarce attention in activity-based transport demand modeling so far. However, new dynamic activity-based approaches are being developed at the current moment. The frequency and inflexibility of planned activities and events in activity schedules of

  4. Evolution of High Cellulolytic Activity in Symbiotic Streptomyces through Selection of Expanded Gene Content and Coordinated Gene Expression

    Science.gov (United States)

    McDonald, Bradon R.; Takasuka, Taichi E.; Wendt-Pienkowski, Evelyn; Doering, Drew T.; Raffa, Kenneth F.; Fox, Brian G.; Currie, Cameron R.

    2016-01-01

    The evolution of cellulose degradation was a defining event in the history of life. Without efficient decomposition and recycling, dead plant biomass would quickly accumulate and become inaccessible to terrestrial food webs and the global carbon cycle. On land, the primary drivers of plant biomass deconstruction are fungi and bacteria in the soil or associated with herbivorous eukaryotes. While the ecological importance of plant-decomposing microbes is well established, little is known about the distribution or evolution of cellulolytic activity in any bacterial genus. Here we show that in Streptomyces, a genus of Actinobacteria abundant in soil and symbiotic niches, the ability to rapidly degrade cellulose is largely restricted to two clades of host-associated strains and is not a conserved characteristic of the Streptomyces genus or host-associated strains. Our comparative genomics identify that while plant biomass degrading genes (CAZy) are widespread in Streptomyces, key enzyme families are enriched in highly cellulolytic strains. Transcriptomic analyses demonstrate that cellulolytic strains express a suite of multi-domain CAZy enzymes that are coregulated by the CebR transcriptional regulator. Using targeted gene deletions, we verify the importance of a highly expressed cellulase (GH6 family cellobiohydrolase) and the CebR transcriptional repressor to the cellulolytic phenotype. Evolutionary analyses identify complex genomic modifications that drive plant biomass deconstruction in Streptomyces, including acquisition and selective retention of CAZy genes and transcriptional regulators. Our results suggest that host-associated niches have selected some symbiotic Streptomyces for increased cellulose degrading activity and that symbiotic bacteria are a rich biochemical and enzymatic resource for biotechnology. PMID:27276034

  5. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  6. Valsartan Decreases Platelet Activity and Arterial Thrombotic Events in Elderly Patients with Hypertension

    Directory of Open Access Journals (Sweden)

    Fang Wu

    2015-01-01

    Conclusions: AT 1 R antagonist valsartan decreases platelet activity by attenuating COX-2/TXA 2 expression through p38MAPK and NF-kB pathways and reduces the occurrence of cardio-cerebral thrombotic events in elderly patients with hypertension.

  7. Brain activity and cognitive transition during childhood: A longitudinal event-related brain potential study.

    NARCIS (Netherlands)

    Stauder, J.E.A.; Molenaar, P.C.M.; van der Molen, M.W.

    1998-01-01

    Examined the relation between brain activation and cognitive development using event-related brain potentials (ERPs) and a longitudinal design. 5 yr old females performed a visual recognition ('oddball') task and an experimental analogue of the Piagetian conservation of liquid quantity task At three

  8. Vaxtracker: Active on-line surveillance for adverse events following inactivated influenza vaccine in children.

    Science.gov (United States)

    Cashman, Patrick; Moberley, Sarah; Dalton, Craig; Stephenson, Jody; Elvidge, Elissa; Butler, Michelle; Durrheim, David N

    2014-09-22

    Vaxtracker is a web based survey for active post marketing surveillance of Adverse Events Following Immunisation. It is designed to efficiently monitor vaccine safety of new vaccines by early signal detection of serious adverse events. The Vaxtracker system automates contact with the parents or carers of immunised children by email and/or sms message to their smart phone. A hyperlink on the email and text messages links to a web based survey exploring adverse events following the immunisation. The Vaxtracker concept was developed during 2011 (n=21), and piloted during the 2012 (n=200) and 2013 (n=477) influenza seasons for children receiving inactivated influenza vaccine (IIV) in the Hunter New England Local Health District, New South Wales, Australia. Survey results were reviewed by surveillance staff to detect any safety signals and compare adverse event frequencies among the different influenza vaccines administered. In 2012, 57% (n=113) of the 200 participants responded to the online survey and 61% (290/477) in 2013. Vaxtracker appears to be an effective method for actively monitoring adverse events following influenza vaccination in children. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  9. Effect of physical activity after a cardiac event on smoking habits and/or Quetelet index.

    Science.gov (United States)

    Huijbrechts, I P A M; Duivenvoorden, H J; Passchier, J; Deckers, J W; Kazemier, M; Erdman, R A M

    2003-02-01

    To further elucidate earlier findings, the present study investigated whether physical activity could serve as a positive stimulus to modify other changeable cardiac risk factors. Participants were 140 patients who had completed a cardiac rehabilitation programme focused on physical activity. Their present level of physical activity, smoking habits and Quetelet index were investigated as well as that before the cardiac event, in retrospect. Current feelings of anxiety and depression were also assessed. Participants were divided into two categories according to their present level of physical activity after finishing the rehabilitation programme, compared with that before the cardiac event. It appeared that the more physically active category contained more smokers. Although many of them had quitted smoking, significantly more persisted in their smoking habits compared with the patients who did not increase their physical activity. Significantly less depression was found in the more active patients. Although it could not be confirmed that physical activity stimulated a positive change in smoking and Quetelet index, the more active patients appeared to be less depressed.

  10. Discrete gene replication events drive coupling between the cell cycle and circadian clocks.

    Science.gov (United States)

    Paijmans, Joris; Bosman, Mark; Ten Wolde, Pieter Rein; Lubensky, David K

    2016-04-12

    Many organisms possess both a cell cycle to control DNA replication and a circadian clock to anticipate changes between day and night. In some cases, these two rhythmic systems are known to be coupled by specific, cross-regulatory interactions. Here, we use mathematical modeling to show that, additionally, the cell cycle generically influences circadian clocks in a nonspecific fashion: The regular, discrete jumps in gene-copy number arising from DNA replication during the cell cycle cause a periodic driving of the circadian clock, which can dramatically alter its behavior and impair its function. A clock built on negative transcriptional feedback either phase-locks to the cell cycle, so that the clock period tracks the cell division time, or exhibits erratic behavior. We argue that the cyanobacterium Synechococcus elongatus has evolved two features that protect its clock from such disturbances, both of which are needed to fully insulate it from the cell cycle and give it its observed robustness: a phosphorylation-based protein modification oscillator, together with its accompanying push-pull read-out circuit that responds primarily to the ratios of different phosphoform concentrations, makes the clock less susceptible to perturbations in protein synthesis; the presence of multiple, asynchronously replicating copies of the same chromosome diminishes the effect of replicating any single copy of a gene.

  11. World’s First Clinical Case of Gene-Activated Bone Substitute Application

    Directory of Open Access Journals (Sweden)

    I. Y. Bozo

    2016-01-01

    Full Text Available Treatment of patients with large bone defects is a complex clinical problem. We have initiated the first clinical study of a gene-activated bone substitute composed of the collagen-hydroxyapatite scaffold and plasmid DNA encoding vascular endothelial growth factor. The first patient with two nonunions of previously reconstructed mandible was enrolled into the study. Scar tissues were excised; bone defects (5–14 mm between the mandibular fragments and nonvascularized rib-bone autograft were filled in with the gene-activated bone substitute. No adverse events were observed during 12 months of follow-up. In 3 months, the average density of newly formed tissues within the implantation zone was 402.21 ± 84.40 and 447.68 ± 106.75 HU in the frontal and distal regions, respectively, which correlated with the density of spongy bone. Complete distal bone defect repair with vestibular and lingual cortical plates formation was observed in 6 and 12 months after surgery; thereby the posterior nonunion was successfully eliminated. However, there was partial resorption of the proximal edge of the autograft entailed to relapse of the anterior nonunion. Thus, the first clinical data on the safety and efficacy of the gene-activated bone substitute were obtained. Given a high complexity of the clinical situation the treatment, results might be considered as promising. NCT02293031.

  12. Gene expression profiling of preovulatory follicle in the buffalo cow: effects of increased IGF-I concentration on periovulatory events.

    Directory of Open Access Journals (Sweden)

    Jyotsna U Rao

    Full Text Available The preovulatory follicle in response to gonadotropin surge undergoes dramatic biochemical, and morphological changes orchestrated by expression changes in hundreds of genes. Employing well characterized bovine preovulatory follicle model, granulosa cells (GCs and follicle wall were collected from the preovulatory follicle before, 1, 10 and 22 h post peak LH surge. Microarray analysis performed on GCs revealed that 450 and 111 genes were differentially expressed at 1 and 22 h post peak LH surge, respectively. For validation, qPCR and immunocytochemistry analyses were carried out for some of the differentially expressed genes. Expression analysis of many of these genes showed distinct expression patterns in GCs and the follicle wall. To study molecular functions and genetic networks, microarray data was analyzed using Ingenuity Pathway Analysis which revealed majority of the differentially expressed genes to cluster within processes like steroidogenesis, cell survival and cell differentiation. In the ovarian follicle, IGF-I is established to be an important regulator of the above mentioned molecular functions. Thus, further experiments were conducted to verify the effects of increased intrafollicular IGF-I levels on the expression of genes associated with the above mentioned processes. For this purpose, buffalo cows were administered with exogenous bGH to transiently increase circulating and intrafollicular concentrations of IGF-I. The results indicated that increased intrafollicular concentrations of IGF-I caused changes in expression of genes associated with steroidogenesis (StAR, SRF and apoptosis (BCL-2, FKHR, PAWR. These results taken together suggest that onset of gonadotropin surge triggers activation of various biological pathways and that the effects of growth factors and peptides on gonadotropin actions could be examined during preovulatory follicle development.

  13. Make Celebrations Fun, Healthy, and Active: 10 Tips to Creating Healthy, Active Events

    Science.gov (United States)

    United States Department of Agriculture 10 tips Nutrition Education Series MyPlate MyWins Based on the Dietary Guidelines for Americans Make celebrations fun, healthy, and active Eating healthy and being physically active can be a ...

  14. Postnatal events in intestinal gene expression and splenic cell composition is altered in NOD mice

    DEFF Research Database (Denmark)

    Damlund, Dina Silke Malling; Metzdorff, Stine Broeng; Kristensen, Matilde Bylov

    2013-01-01

    microbiota seems to play an important role in the development and control of T1D. We hypothesized that NOD mice in the perinatal period respond differently than mice not prone to develop T1D (C57/Bl6), and we investigated the differences in postnatal expression of genes in gut, spleen, liver and pancreas......Evidence suggests that colonisation pattern of the gut in the early postnatal period is highly correlated with the risk of developing type 1 diabetes (T1D). We have recently shown that colonization in SPF mice accelerates gut maturation and that at postnatal day (PND) 1, in comparison with germ...... free mice, certain chemokines, including Cxcl2 encoding macrophage inflammatory protein (MIP)-2 and involved in attraction of neutrophils was downregulated in the gut epithelium. The non-obese diabetes (NOD) mouse is widely used as a model for studying the pathogenesis of T1D. The neonatal gut...

  15. Stereotype activation is unintentional: Behavioural and event-related potenials evidence.

    Science.gov (United States)

    Wang, Pei; Yang, Ya-Ping; Tan, Chen-Hao; Zhao, Xiang-Xia; Liu, Yong-He; Lin, Chong-De

    2016-04-01

    In this study, a priming Stroop paradigm was used to determine whether stereotype activation is unintentional. Priming conditions (priming/no-priming) and the relationship between priming and target (consistent/inconsistent/no-relation) were the independent variables; accuracy, reaction time and N400 amplitude were used as dependent variables. The reaction time revealed that stereotype activation is, to some extent, unintentional. Furthermore, the event-related potenial (ERP) results showed that N400 amplitude was larger for inconsistent conditions than for consistent conditions. This result supported the notion that stereotype activation is an unintentional and automatic process. © 2015 International Union of Psychological Science.

  16. Multi-day activity scheduling reactions to planned activities and future events in a dynamic agent-based model of activity-travel behavior

    NARCIS (Netherlands)

    Nijland, E.W.L.; Arentze, T.A.; Timmermans, H.J.P.

    2009-01-01

    Modeling multi-day planning has received scarce attention today in activity-based transport demand modeling. Elaborating and combining previous work on event-driven activity generation, the aim of this paper is to develop and illustrate an extension of a need-based model of activity generation that

  17. Ultrasound-responsive gene-activated matrices for osteogenic gene therapy using matrix-assisted sonoporation.

    Science.gov (United States)

    Nomikou, N; Feichtinger, G A; Saha, S; Nuernberger, S; Heimel, P; Redl, H; McHale, A P

    2018-01-01

    Gene-activated matrix (GAM)-based therapeutics for tissue regeneration are limited by efficacy, the lack of spatiotemporal control and availability of target cells, all of which impact negatively on their translation to the clinic. Here, an advanced ultrasound-responsive GAM is described containing target cells that facilitates matrix-assisted sonoporation (MAS) to induce osteogenic differentiation. Ultrasound-responsive GAMs consisting of fibrin/collagen hybrid-matrices containing microbubbles, bone morphogenetic protein BMP2/7 coexpression plasmids together with C2C12 cells were treated with ultrasound either in vitro or following parenteral intramuscular implantation in vivo. Using direct measurement for alkaline phosphatase activity, von Kossa staining and immunohistochemical analysis for osteocalcin expression, MAS-stimulated osteogenic differentiation was confirmed in the GAMs in vitro 7 days after treatment with ultrasound. At day 30 post-treatment with ultrasound, ectopic osteogenic differentiation was confirmed in vivo using X-ray microcomputed tomography and histological analysis. Osteogenic differentiation was indicated by the presence of ectopic bone structures in all animals treated with MAS. In addition, bone volumes in this group were statistically greater than those in the control groups. This novel approach of incorporating a MAS capability into GAMs could be exploited to facilitate ex vivo gene transfer with subsequent surgical implantation or alternatively provide a minimally invasive means of stimulating in situ transgene delivery for osteoinductive gene-based therapies. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  18. Childhood life events, immune activation and the development of mood and anxiety disorders: the TRAILS study.

    Science.gov (United States)

    Jonker, I; Rosmalen, J G M; Schoevers, R A

    2017-05-02

    The experience of childhood life events is associated with higher vulnerability to develop psychiatric disorders. One of the pathways suggested to lead to this vulnerability is activation of the immune system. The aim of this study is to find out whether the association between childhood life events and the development of mood and anxiety disorders is predicted by the activation of the immune system. This study was performed in TRAILS, a large prospective population cohort, from which a subgroup was selected (N=1084, 54.3% female, mean age 19.0 (s.d., 0.6)). Childhood life events before age 16 were assessed using questionnaires at age 12, 14, 16 and 19. Immune activation was assessed at age 16 by elevated high-sensitive C-reactive protein (hsCRP) and by levels of immunoglobulin G antibodies against the herpes viruses herpes simplex virus 1, cytomegalovirus and Epstein-Barr virus. At age 19, the presence of mood and anxiety disorders was determined using the World Health Organization Composite International Diagnostic Interview Version 3.0. Regression analyses were used to study the association between life events, the inflammatory markers and mental health. We found that childhood life events score was associated with risk of mood disorders (B=0.269, P<0.001) and anxiety disorders (B=0.129, P<0.001). Childhood life events score was marginally associated with elevated hsCRP (B=0.076, P=0.006), but not with the antibody levels. This was especially due to separation trauma (P=0.015) and sexual abuse (P=0.019). Associations lost significance after correcting for lifestyle factors such as body mass index and substance abuse (P=0.042). None of the inflammatory markers were associated with development of anxiety disorders or mood disorders. In conclusion, the life event scores predicted the development of anxiety disorders and mood disorders at age 19. Life event scores were associated with elevated hsCRP, which was partly explained by lifestyle factors. Elevated hs

  19. Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression

    International Nuclear Information System (INIS)

    Teodorov, E.; Ferrari, M.F.R.; Fior-Chadi, D.R.; Camarini, R.; Felício, L.F.

    2012-01-01

    The periaqueductal gray (PAG) has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc) or 0.9% saline (up to 1 mL/kg) and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05) because a lower percentage of U69593 group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR). A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05) and lactating female rats (P < 0.01), with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in female

  20. Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Teodorov, E. [Centro de Matemática, Computação e Cognição, Universidade Federal do ABC, São Paulo, SP (Brazil); Ferrari, M.F.R. [Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Fior-Chadi, D.R. [Departamento de Fisiologia, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Camarini, R. [Departamento de Farmacologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, SP (Brazil); Felício, L.F. [Departamento de Patologia, Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo, São Paulo, SP (Brazil)

    2012-06-01

    The periaqueductal gray (PAG) has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc) or 0.9% saline (up to 1 mL/kg) and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05) because a lower percentage of U69593 group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR). A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05) and lactating female rats (P < 0.01), with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in female

  1. Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression

    Directory of Open Access Journals (Sweden)

    E. Teodorov

    2012-10-01

    Full Text Available The periaqueductal gray (PAG has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc or 0.9% saline (up to 1 mL/kg and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05 because a lower percentage of kappa group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR. A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05 and lactating female rats (P < 0.01, with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in

  2. Recent events in NPPs and incident reporting system (IRS) activity. Working material

    International Nuclear Information System (INIS)

    1996-01-01

    The IAEA convened the 1996 Joint Meeting to Exchange Information on Recent Events in Nuclear Power Plants and the Technical Committee-Annual Meeting of the Incident Reporting System (IRS) national co-ordinators, organized jointly with the Nuclear Energy Agency (NEA) of the OECD in Paris, France from 22-26 April 1996. These consecutive meetings took place at the OECD Headquarters, 2 rue Andre Pascal. The main objective of the first meeting (22-24 April 1996) was to exchange and discuss information on recent events which occurred in NPPs. The second meeting (25-26 April 1996) was devoted to the IAEA and NEA activity in the framework of the IRS. The main issues of the programme at the meetings were as follows: in-depth discussion on NPP recent events, presented by the participants; panel discussion on operational safety experience issues identified by the participants; IAEA and NEA activities on IRS subjects in 1995-1996 and plans for the future; issues from the inter-agency's IRS Advisory Committee. Annexes I and II provide more information on the programme at the meetings. A list of participants is given in Annex III (50 participants from 22 countries and 3 international organization). Annexes IV and V provide information on national presentations on recent events. Figs, tabs

  3. Depletion of Key Meiotic Genes and Transcriptome-Wide Abiotic Stress Reprogramming Mark Early Preparatory Events Ahead of Apomeiotic Transition

    Directory of Open Access Journals (Sweden)

    Jubin N Shah

    2016-10-01

    Full Text Available Molecular dissection of apomixis - an asexual reproductive mode - is anticipated to solve the enigma of loss of meiotic sex, and to help fixing elite agronomic traits. The Brassicaceae genus Boechera comprises of both sexual and apomictic species, permitting comparative analyses of meiotic circumvention (apomeiosis and parthenogenesis. Whereas previous studies reported local transcriptome changes during these events, it remained unclear whether global changes associated with hybridization, polyploidy and environmental adaptation that arose during evolution of Boechera might hint as (epigenetic regulators of early development prior apomictic initiation. To identify these signatures during vegetative stages, we compared seedling RNA-seq transcriptomes of an obligate triploid apomict and a diploid sexual, both isolated from a drought-prone habitat. Uncovered were several genes differentially expressed between sexual and apomictic seedlings, including homologues of meiotic genes ASYNAPTIC 1 (ASY1 and MULTIPOLAR SPINDLE 1 (MPS1 that were down-regulated in apomicts. An intriguing class of apomict-specific deregulated genes included several NAC transcription factors, homologues of which are known to be transcriptionally reprogrammed during abiotic stress in other plants. Deregulation of both meiotic and stress-response genes during seedling stages might possibly be important in preparation for meiotic circumvention, as similar transcriptional alteration was discernible in apomeiotic floral buds too. Furthermore, we noted that the apomict showed better tolerance to osmotic stress in vitro than the sexual, in conjunction with significant upregulation of a subset of NAC genes. In support of the current model that DNA methylation epigenetically regulates stress, ploidy, hybridization and apomixis, we noted that ASY1, MPS1 and NAC019 homologues were deregulated in Boechera seedlings upon DNA demethylation, and ASY1 in particular seems to be repressed by

  4. Association of single nucleotide polymorphisms in a glutamate receptor gene (GRM8) with theta power of event-related oscillations and alcohol dependence.

    Science.gov (United States)

    Chen, Andrew C H; Tang, Yongqiang; Rangaswamy, Madhavi; Wang, Jen C; Almasy, Laura; Foroud, Tatiana; Edenberg, Howard J; Hesselbrock, Victor; Nurnberger, John; Kuperman, Samuel; O'Connor, Sean J; Schuckit, Marc A; Bauer, Lance O; Tischfield, Jay; Rice, John P; Bierut, Laura; Goate, Alison; Porjesz, Bernice

    2009-04-05

    Evidence suggests the P3 amplitude of the event-related potential and its underlying superimposed event-related oscillations (EROs), primarily in the theta (4-5 Hz) and delta (1-3 Hz) frequencies, as endophenotypes for the risk of alcoholism and other disinhibitory disorders. Major neurochemical substrates contributing to theta and delta rhythms and P3 involve strong GABAergic, cholinergic and glutamatergic system interactions. The aim of this study was to test the potential associations between single nucleotide polymorphisms (SNPs) in glutamate receptor genes and ERO quantitative traits. GRM8 was selected because it maps at chromosome 7q31.3-q32.1 under the peak region where we previously identified significant linkage (peak LOD = 3.5) using a genome-wide linkage scan of the same phenotype (event-related theta band for the target visual stimuli). Neural activities recorded from scalp electrodes during a visual oddball task in which rare target elicited P3s were analyzed in a subset of the Collaborative Study on the Genetics of Alcoholism (COGA) sample comprising 1,049 Caucasian subjects from 209 families (with 472 DSM-IV alcohol dependent individuals). The family-based association test (FBAT) detected significant association (P power to target visual stimuli, and also with alcohol dependence, even after correction for multiple comparisons by false discovery rate (FDR). Our results suggest that variation in GRM8 may be involved in modulating event-related theta oscillations during information processing and also in vulnerability to alcoholism. These findings underscore the utility of electrophysiology and the endophenotype approach in the genetic study of psychiatric disorders. (c) 2008 Wiley-Liss, Inc.

  5. WRKY Transcription Factors Involved in Activation of SA Biosynthesis Genes

    Directory of Open Access Journals (Sweden)

    Bol John F

    2011-05-01

    Full Text Available Abstract Background Increased defense against a variety of pathogens in plants is achieved through activation of a mechanism known as systemic acquired resistance (SAR. The broad-spectrum resistance brought about by SAR is mediated through salicylic acid (SA. An important step in SA biosynthesis in Arabidopsis is the conversion of chorismate to isochorismate through the action of isochorismate synthase, encoded by the ICS1 gene. Also AVRPPHB SUSCEPTIBLE 3 (PBS3 plays an important role in SA metabolism, as pbs3 mutants accumulate drastically reduced levels of SA-glucoside, a putative storage form of SA. Bioinformatics analysis previously performed by us identified WRKY28 and WRKY46 as possible regulators of ICS1 and PBS3. Results Expression studies with ICS1 promoter::β-glucuronidase (GUS genes in Arabidopsis thaliana protoplasts cotransfected with 35S::WRKY28 showed that over expression of WRKY28 resulted in a strong increase in GUS expression. Moreover, qRT-PCR analyses indicated that the endogenous ICS1 and PBS3 genes were highly expressed in protoplasts overexpressing WRKY28 or WRKY46, respectively. Electrophoretic mobility shift assays indentified potential WRKY28 binding sites in the ICS1 promoter, positioned -445 and -460 base pairs upstream of the transcription start site. Mutation of these sites in protoplast transactivation assays showed that these binding sites are functionally important for activation of the ICS1 promoter. Chromatin immunoprecipitation assays with haemagglutinin-epitope-tagged WRKY28 showed that the region of the ICS1 promoter containing the binding sites at -445 and -460 was highly enriched in the immunoprecipitated DNA. Conclusions The results obtained here confirm results from our multiple microarray co-expression analyses indicating that WRKY28 and WRKY46 are transcriptional activators of ICS1 and PBS3, respectively, and support this in silico screening as a powerful tool for identifying new components of stress

  6. Matrix metalloproteinase-2 of human carotid atherosclerotic plaques promotes platelet activation. Correlation with ischaemic events.

    Science.gov (United States)

    Lenti, Massimo; Falcinelli, Emanuela; Pompili, Marcella; de Rango, Paola; Conti, Valentina; Guglielmini, Giuseppe; Momi, Stefania; Corazzi, Teresa; Giordano, Giuseppe; Gresele, Paolo

    2014-06-01

    Purified active matrix metalloproteinase-2 (MMP-2) is able to promote platelet aggregation. We aimed to assess the role of MMP-2 expressed in atherosclerotic plaques in the platelet-activating potential of human carotid plaques and its correlation with ischaemic events. Carotid plaques from 81 patients undergoing endarterectomy were tested for pro-MMP-2 and TIMP-2 content by zymography and ELISA. Plaque extracts were incubated with gel-filtered platelets from healthy volunteers for 2 minutes before the addition of a subthreshold concentration of thrombin receptor activating peptide-6 (TRAP-6) and aggregation was assessed. Moreover, platelet deposition on plaque extracts immobilised on plastic coverslips under high shear-rate flow conditions was measured. Forty-three plaque extracts (53%) potentiated platelet aggregation (+233 ± 26.8%), an effect prevented by three different specific MMP-2 inhibitors (inhibitor II, TIMP-2, moAb anti-MMP-2). The pro-MMP-2/TIMP-2 ratio of plaques potentiating platelet aggregation was significantly higher than that of plaques not potentiating it (3.67 ± 1.21 vs 1.01 ± 0.43, p<0.05). Moreover, the platelet aggregation-potentiating effect, the active-MMP-2 content and the active MMP-2/pro-MMP-2 ratio of plaque extracts were significantly higher in plaques from patients who developed a subsequent major cardiovascular event. In conclusion, atherosclerotic plaques exert a prothrombotic effect by potentiating platelet activation due to their content of MMP-2; an elevated MMP-2 activity in plaques is associated with a higher rate of subsequent ischaemic cerebrovascular events.

  7. Activation of the human beta interferon gene by the adenovirus type 12 E1B gene

    International Nuclear Information System (INIS)

    Shiroki, K.; Toth, M.

    1988-01-01

    The transcription of endogenous beta interferon mRNA was activated in human embryo kidney (HEK) cells infected with adenovirus 12 (Ad12) but was activated only inefficiently or not at all in HEK cells infected with Ad5 and rc-1 (Ad5 dl312 containing the Ad12 E1A region). The analysis with Ad12 mutants showed that Ad12 E1B products, especially the 19K protein, were important for the expression of the endogenous beta interferon gene and Ad12 E1A products were not involved in the expression. The expression of exogeneously transfected pIFN-CAT (a hybrid plasmid having the human beta interferon promoter fused with the CAT gene) was activated in HEK and chicken embryo fibroblast (CEF) cells infected with either Ad12 or Ad5. The analysis of cotransfection of CEF cells with pIFN-CAT and plasmids containing fragments of Ad12 or Ad5 DNA showed that Ad12 or Ad5 E1B (possibly the 19K protein) was and E1A was not involved in the expression of the exogenous pIFN-CAT

  8. Brand Activation Batik Semarangan melalui Event “Cah Semarang Duwe Batik”

    OpenAIRE

    Saputra, Ginanjar; Setiabudi, Djoko; Ulfa, Nurist Surayya

    2013-01-01

    Nama : Ginanjar SaputraNIM : D2C008088Judul : Brand Activation Batik Semarangan melalui Event “Cah Semarang Duwe Batik” Abstrak Koperasi Sekar Arum sebagai sebuah lembaga koperasi dibawah naungan TP – PKK Kota Semarang yang salah satunya fokus terhadap batik semarangan, tentu harus dapat melestarikan dan mengembangkan produk batik semarangan sehingga dapat menjadi produk andalan dari Kota Semarang. Akan tetapi terjadi permasalahan dimana produk batik semarangan ini belum banyak dikenal oleh w...

  9. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Science.gov (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

    2013-01-01

    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  10. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  11. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner.

    Science.gov (United States)

    Pai, Vaibhav P; Willocq, Valerie; Pitcairn, Emily J; Lemire, Joan M; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A; Levin, Michael

    2017-10-15

    Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels ( I h currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal , Lefty , and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. © 2017. Published by The Company of Biologists Ltd.

  12. Gene expression analysis after receptor tyrosine kinase activation reveals new potential melanoma proteins

    International Nuclear Information System (INIS)

    Teutschbein, Janka; Haydn, Johannes M; Samans, Birgit; Krause, Michael; Eilers, Martin; Schartl, Manfred; Meierjohann, Svenja

    2010-01-01

    Melanoma is an aggressive tumor with increasing incidence. To develop accurate prognostic markers and targeted therapies, changes leading to malignant transformation of melanocytes need to be understood. In the Xiphophorus melanoma model system, a mutated version of the EGF receptor Xmrk (Xiphophorus melanoma receptor kinase) triggers melanomagenesis. Cellular events downstream of Xmrk, such as the activation of Akt, Ras, B-Raf or Stat5, were also shown to play a role in human melanomagenesis. This makes the elucidation of Xmrk downstream targets a useful method for identifying processes involved in melanoma formation. Here, we analyzed Xmrk-induced gene expression using a microarray approach. Several highly expressed genes were confirmed by realtime PCR, and pathways responsible for their induction were revealed using small molecule inhibitors. The expression of these genes was also monitored in human melanoma cell lines, and the target gene FOSL1 was knocked down by siRNA. Proliferation and migration of siRNA-treated melanoma cell lines were then investigated. Genes with the strongest upregulation after receptor activation were FOS-like antigen 1 (Fosl1), early growth response 1 (Egr1), osteopontin (Opn), insulin-like growth factor binding protein 3 (Igfbp3), dual-specificity phosphatase 4 (Dusp4), and tumor-associated antigen L6 (Taal6). Interestingly, most genes were blocked in presence of a SRC kinase inhibitor. Importantly, we found that FOSL1, OPN, IGFBP3, DUSP4, and TAAL6 also exhibited increased expression levels in human melanoma cell lines compared to human melanocytes. Knockdown of FOSL1 in human melanoma cell lines reduced their proliferation and migration. Altogether, the data show that the receptor tyrosine kinase Xmrk is a useful tool in the identification of target genes that are commonly expressed in Xmrk-transgenic melanocytes and melanoma cell lines. The identified molecules constitute new possible molecular players in melanoma development

  13. Gene expression analysis after receptor tyrosine kinase activation reveals new potential melanoma proteins

    Directory of Open Access Journals (Sweden)

    Krause Michael

    2010-07-01

    Full Text Available Abstract Background Melanoma is an aggressive tumor with increasing incidence. To develop accurate prognostic markers and targeted therapies, changes leading to malignant transformation of melanocytes need to be understood. In the Xiphophorus melanoma model system, a mutated version of the EGF receptor Xmrk (Xiphophorus melanoma receptor kinase triggers melanomagenesis. Cellular events downstream of Xmrk, such as the activation of Akt, Ras, B-Raf or Stat5, were also shown to play a role in human melanomagenesis. This makes the elucidation of Xmrk downstream targets a useful method for identifying processes involved in melanoma formation. Methods Here, we analyzed Xmrk-induced gene expression using a microarray approach. Several highly expressed genes were confirmed by realtime PCR, and pathways responsible for their induction were revealed using small molecule inhibitors. The expression of these genes was also monitored in human melanoma cell lines, and the target gene FOSL1 was knocked down by siRNA. Proliferation and migration of siRNA-treated melanoma cell lines were then investigated. Results Genes with the strongest upregulation after receptor activation were FOS-like antigen 1 (Fosl1, early growth response 1 (Egr1, osteopontin (Opn, insulin-like growth factor binding protein 3 (Igfbp3, dual-specificity phosphatase 4 (Dusp4, and tumor-associated antigen L6 (Taal6. Interestingly, most genes were blocked in presence of a SRC kinase inhibitor. Importantly, we found that FOSL1, OPN, IGFBP3, DUSP4, and TAAL6 also exhibited increased expression levels in human melanoma cell lines compared to human melanocytes. Knockdown of FOSL1 in human melanoma cell lines reduced their proliferation and migration. Conclusion Altogether, the data show that the receptor tyrosine kinase Xmrk is a useful tool in the identification of target genes that are commonly expressed in Xmrk-transgenic melanocytes and melanoma cell lines. The identified molecules constitute

  14. Combating oncogene activation associated with retrovirus-mediated gene therapy of X-linked severe combined immunodeficiency

    Directory of Open Access Journals (Sweden)

    B.E. Strauss

    2007-05-01

    Full Text Available A successful gene therapy clinical trial that also encountered serious adverse effects has sparked extensive study and debate about the future directions for retrovirus-mediated interventions. Treatment of X-linked severe combined immunodeficiency with an oncoretrovirus harboring a normal copy of the gc gene was applied in two clinical trials, essentially curing 13 of 16 infants, restoring a normal immune system without the need for additional immune-related therapies. Approximately 3 years after their gene therapy, tragically, 3 of these children, all from the same trial, developed leukemia as a result of this experimental treatment. The current understanding of the mechanism behind this leukemogenesis involves three critical and cooperating factors, i.e., viral integration, oncogene activation, and the function of the therapeutic gene. In this review, we will explore the causes of this unwanted event and some of the possibilities for reducing the risk of its reoccurrence.

  15. Gene activation of heavy ion treated bacillus subtilis 168 endospores during germination involved DNA-repair

    International Nuclear Information System (INIS)

    Moeller, R.; Berger, T.; Reitz, G.; Okayasu, Ryuichi

    2006-01-01

    This research project is aimed at correlating radiation effects induced DNA damage in Bacillus subtilis endospores with the linear energy transfer (LET) of the used radiation by investigating survival and gene activation after irradiation with high-LET particles. During the stationary growth phase Bacillus subtilis change their metabolic active state from the vegetative cells to the metabolic inactive but even more resistant endospores. If spores find optimal conditions, they could germinate and switch to the vegetative growth. With these outgrowth spores can and/or must repair the induced formed DNA damage. During germination spores lose their most resistance. In more detail, DNA repair and mutation induction events investigated will include the survivability, behaviour against specific antibiotics and their germination. DNA repair pattern will be detected during germination by using DNA microarrays, which contain the whole genome of Bacillus subtilis 168. (author)

  16. 2014 volcanic activity in Alaska: Summary of events and response of the Alaska Volcano Observatory

    Science.gov (United States)

    Cameron, Cheryl E.; Dixon, James P.; Neal, Christina A.; Waythomas, Christopher F.; Schaefer, Janet R.; McGimsey, Robert G.

    2017-09-07

    The Alaska Volcano Observatory (AVO) responded to eruptions, possible eruptions, volcanic unrest or suspected unrest, and seismic events at 18 volcanic centers in Alaska during 2014. The most notable volcanic activity consisted of intermittent ash eruptions from long-active Cleveland and Shishaldin Volcanoes in the Aleutian Islands, and two eruptive episodes at Pavlof Volcano on the Alaska Peninsula. Semisopochnoi and Akutan volcanoes had seismic swarms, both likely the result of magmatic intrusion. The AVO also installed seismometers and infrasound instruments at Mount Cleveland during 2014.

  17. Genomic Evidence of Chemotrophic Metabolisms in Deep-Dwelling Chloroflexi Conferred by Ancient Horizontal Gene Transfer Events

    Science.gov (United States)

    Momper, L. M.; Magnabosco, C.; Amend, J.; Osburn, M. R.; Fournier, G. P.

    2017-12-01

    The marine and terrestrial subsurface biospheres represent quite likely the largest reservoirs for life on Earth, directly impacting surface processes and global cycles throughout Earth's history. In the deep subsurface biosphere (DSB) organic carbon and energy are often extremely scarce. However, archaea and bacteria are able to persist in the DSB to at least 3.5 km below surface [1]. Understanding how they persist, and by what metabolisms they subsist, are key questions in this biosphere. To address these questions we investigated 5 global DSB environments: one legacy mine in South Dakota, USA, 3 mines in South Africa and marine fluids circulating beneath the Juan de Fuca Ridge. Boreholes within these mines provided access to fluids buried beneath the earth's surface and sampled depths down to 3.1 km. Geochemical data were collected concomitantly with DNA for metagenomic sequencing. We examined genomes of the ancient and deeply branching Chloroflexi for metabolic capabilities and interrogated the geochemical drivers behind those metabolisms with in situ thermodynamic modeling of reaction energetics. In total, 23 Chloroflexi genomes were identified and analyzed from the 5 subsurface sites. Genes for nitrate reduction (nar) and sulfite reduction (dsr) were found in many of the South Africa Chloroflexi but were absent from genomes collected in South Dakota. Indeed, nitrate reduction was among the most energetically favorable reactions in South African fluids (10-14 kJ cell-1 sec -1 per mol of reactant) and sulfur reduction with Fe2+ or H2 was also exergonic [2]. Conversely, genes for nitrite and nitrous oxide reduction (nrf, nir and nos) were found in genomes collected in South Dakota and Juan de Fuca, but not South Africa. We examined the origin of genes conferring these metabolisms in the Chloroflexi genomes. We discovered evidence for horizontal gene transfer (HGT) for all of these putative metabolisms. Retention of these genes in Chloroflexi lineages indicates

  18. A serotonin transporter gene polymorphism (5-HTTLPR), drinking-to-cope motivation, and negative life events among college students.

    Science.gov (United States)

    Armeli, Stephen; Conner, Tamlin S; Covault, Jonathan; Tennen, Howard; Kranzler, Henry R

    2008-11-01

    This study was performed to examine whether a polymorphism (5-HTTLPR) in the serotonin transporter gene was related to college students' reports of relief drinking (drinking-to-cope motives) and whether it moderated the associations between negative life events and drinking to cope. We examined reward drinking (drinking-to-enhance motives) as a comparison and to see whether these effects varied across gender. Using an Internet-based survey, college students (N = 360; 192 women) self-reported on drinking motives and negative life events for up to 4 years. Study participants provided saliva for genotyping the triallelic (LA vs LG or S) variants of 5-HTTLPR. Among men, individuals with two risk alleles (LG or S), compared with individuals with the LA/LA allele, displayed lower drinking-to-cope motives. Among women, individuals with one risk allele (either LG or S), compared with individuals with the LA/LA allele, displayed stronger drinking-to-enhance motives. The association between yearly changes in negative life events and drinking-to-cope motives varied across 5-HTTLPR genotype and gender and was strongest in the positive direction for women with the LA/LA variant. Our findings are not consistent with prior speculation that stronger positive associations between life stress and alcohol use among individuals with the LG or S allele are the result of increased use of alcohol as a method for coping with stress. The importance of examining gender differences in the relations between 5-HTTLPR, substance use, and related constructs is also noted.

  19. Genes Important for Catalase Activity in Enterococcus faecalis

    Science.gov (United States)

    Baureder, Michael; Hederstedt, Lars

    2012-01-01

    Little in general is known about how heme proteins are assembled from their constituents in cells. The Gram-positive bacterium Enterococcus faecalis cannot synthesize heme and does not depend on it for growth. However, when supplied with heme in the growth medium the cells can synthesize two heme proteins; catalase (KatA) and cytochrome bd (CydAB). To identify novel factors important for catalase biogenesis libraries of E. faecalis gene insertion mutants were generated using two different types of transposons. The libraries of mutants were screened for clones deficient in catalase activity using a colony zymogram staining procedure. Analysis of obtained clones identified, in addition to katA (encoding the catalase enzyme protein), nine genes distributed over five different chromosomal loci. No factors with a dedicated essential role in catalase biogenesis or heme trafficking were revealed, but the results indicate the RNA degradosome (srmB, rnjA), an ABC-type oligopeptide transporter (oppBC), a two-component signal transducer (etaR), and NADH peroxidase (npr) as being important for expression of catalase activity in E. faecalis. It is demonstrated that catalase biogenesis in E. faecalis is independent of the CydABCD proteins and that a conserved proline residue in the N-terminal region of KatA is important for catalase assembly. PMID:22590595

  20. Valsartan decreases platelet activity and arterial thrombotic events in elderly patients with hypertension.

    Science.gov (United States)

    Wu, Fang; Wang, Hong-Yan; Cai, Fan; Wang, Ling-Jie; Zhang, Feng-Ru; Chen, Xiao-Nan; Yang, Qian; Jiang, Meng-Hui; Wang, Xue-Feng; Shen, Wei-Feng

    2015-01-20

    Angiotensin type 1 receptor (AT 1 R) antagonists are extensively used for blood pressure control in elderly patients with hypertension. This study aimed to investigate the inhibitory effects of AT 1 R antagonist valsartan on platelet aggregation and the occurrence of cardio-cerebral thrombotic events in elderly patients with hypertension. Two-hundred and ten patients with hypertension and aged > 60 years were randomized to valsartan (n = 140) or amlodipine (n = 70) on admission. The primary endpoint was platelet aggregation rate (PAR) induced by arachidonic acid at discharge, and the secondary endpoint was the rate of thrombotic events including brain infarction and myocardial infarction during follow-up. Human aortic endothelial cells (HAECs) were stimulated by angiotensin II (Ang II, 100 nmol/L) with or without pretreatment of valsartan (100 nmol/L), and relative expression of cyclooxygenase-2 (COX-2) and thromboxane B 2 (TXB 2 ) and both p38 mitogen-activated protein kinase (p38MAPK) and nuclear factor-kB (NF-kB) activities were assessed. Statistical analyses were performed by GraphPad Prism 5.0 software (GraphPad Software, Inc., California, USA). PAR was lower after treatment with valsartan (11.49 ± 0.69% vs. 18.71 ± 2.47%, P event rate in patients treated with valsartan (14.3% vs. 32.8%, P = 0.002). Relative expression of COX-2 and secretion of TXB 2 with concordant phosphorylation of p38MAPK and NF-kB were increased in HAECs when stimulated by Ang II (100 nmol/L) but were significantly decreased by valsartan pretreatment (100 nmol/L). AT 1 R antagonist valsartan decreases platelet activity by attenuating COX-2/TXA 2 expression through p38MAPK and NF-kB pathways and reduces the occurrence of cardio-cerebral thrombotic events in elderly patients with hypertension.

  1. Cardiac Events During Competitive, Recreational, and Daily Activities in Children and Adolescents With Long QT Syndrome.

    Science.gov (United States)

    Chambers, Kristina D; Beausejour Ladouceur, Virginie; Alexander, Mark E; Hylind, Robyn J; Bevilacqua, Laura; Mah, Douglas Y; Bezzerides, Vassilios; Triedman, John K; Walsh, Edward P; Abrams, Dominic J

    2017-09-21

    The 2005 Bethesda Conference Guidelines advise patients with long QT syndrome against competitive sports. We assessed cardiac event rates during competitive and recreational sports, and daily activities among treated long QT syndrome patients. Long QT syndrome patients aged ≥4 years treated with anti-adrenergic therapy were included. Demographics included mechanism of presentation, corrected QT interval pretreatment, symptom history, medication compliance, and administration of QT-prolonging medications. Corrected QT interval ≥550 ms or prior cardiac arrest defined high risk. Sports were categorized by cardiovascular demand per the 2005 Bethesda Conference Guidelines. Each was classified as recreational or competitive. One hundred seventy-two patients (90; 52% female) with median age 15.2 years (interquartile range 11.4, 19.4) were included. Evaluation was performed for family history (102; 59%), incidental finding (34; 20%), and symptoms (36; 21%). Median corrected QT interval was 474 ms (interquartile range 446, 496) and 14 patients (8%) were deemed high risk. Treatment included β-blockers (171; 99%), implantable cardioverter-defibrillator (27; 16%), left cardiac sympathetic denervation (7; 4%), and pacemaker (3; 2%). Sports participation was recreational (66; 38%) or competitive (106; 62%), with 92 (53%) exercising against the Bethesda Conference Guidelines. There were no cardiac events in competitive athletes and no deaths. There were 13 cardiac events in 9 previously symptomatic patients during either recreational exercise or activities of daily life. In this cohort of appropriately managed children with long QT syndrome, cardiac event rates were low and occurred during recreational but not competitive activities. This study further supports the need for increased assessment of arrhythmia risk during exercise in this patient population. © 2017 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

  2. Temporal integration of sequential auditory events: silent period in sound pattern activates human planum temporale.

    Science.gov (United States)

    Mustovic, Henrietta; Scheffler, Klaus; Di Salle, Francesco; Esposito, Fabrizio; Neuhoff, John G; Hennig, Jürgen; Seifritz, Erich

    2003-09-01

    Temporal integration is a fundamental process that the brain carries out to construct coherent percepts from serial sensory events. This process critically depends on the formation of memory traces reconciling past with present events and is particularly important in the auditory domain where sensory information is received both serially and in parallel. It has been suggested that buffers for transient auditory memory traces reside in the auditory cortex. However, previous studies investigating "echoic memory" did not distinguish between brain response to novel auditory stimulus characteristics on the level of basic sound processing and a higher level involving matching of present with stored information. Here we used functional magnetic resonance imaging in combination with a regular pattern of sounds repeated every 100 ms and deviant interspersed stimuli of 100-ms duration, which were either brief presentations of louder sounds or brief periods of silence, to probe the formation of auditory memory traces. To avoid interaction with scanner noise, the auditory stimulation sequence was implemented into the image acquisition scheme. Compared to increased loudness events, silent periods produced specific neural activation in the right planum temporale and temporoparietal junction. Our findings suggest that this area posterior to the auditory cortex plays a critical role in integrating sequential auditory events and is involved in the formation of short-term auditory memory traces. This function of the planum temporale appears to be fundamental in the segregation of simultaneous sound sources.

  3. Rheumatoid arthritis disease activity and disability affect the risk of serious infection events in RADIUS 1.

    Science.gov (United States)

    Weaver, Arthur; Troum, Orrin; Hooper, Michele; Koenig, Andrew S; Chaudhari, Sandeep; Feng, Jingyuan; Wenkert, Deborah

    2013-08-01

    To determine whether disease activity and disability independently correlate with serious infection event (SIE) risk in a large rheumatoid arthritis (RA) cohort. The associations between SIE and Clinical Disease Activity Index (CDAI) and Health Assessment Questionnaire-Disability Index (HAQ-DI) in the Rheumatoid Arthritis Disease-Modifying Antirheumatic Drug Intervention and Utilization Study (RADIUS 1) cohort were evaluated using the Andersen-Gill model (a proportional HR model allowing > 1 event per patient). Of 4084 patients with 347 SIE, 271 patients experienced ≥ 1 SIE. A 5-unit CDAI increase and 0.4-unit HAQ-DI increase corresponded to an increase in SIE risk with and without covariate adjustments. A 5-unit CDAI increase corresponded with a 7.7% increased SIE risk (adjusted HR 1.077, 95% CI 1.044-1.112, p < 0.0001) and a 0.4-unit HAQ-DI increase with a 30.1% increased risk (adjusted HR 1.301, 95% CI 1.225-1.381, p < 0.0001). Categorical analysis showed that more severe RA activity (even after controlling for disability) and disability were associated with an increased SIE risk. Increased RA disease activity and disability were each associated with a significantly increased SIE risk in the RADIUS 1 cohort, which could not be completely accounted for by disability.

  4. Observing a fictitious stressful event: haematological changes, including circulating leukocyte activation.

    Science.gov (United States)

    Mian, Rubina; Shelton-Rayner, Graham; Harkin, Brendan; Williams, Paul

    2003-03-01

    The aim of this study was to assess the effect of watching a psychological stressful event on the activation of leukocytes in healthy human volunteers. Blood samples were obtained from 32 healthy male and female subjects aged between 20 and 26 years before, during and after either watching an 83-minute horror film that none of the subjects had previously seen (The Texas Chainsaw Massacre, 1974) or by sitting quietly in a room (control group). Total differential cell counts, leukocyte activation as measured by the nitroblue tetrazolium (NBT) test, heart rate and blood pressure (BP) measurements were taken at defined time points. There were significant increases in peripheral circulating leukocytes, the number of activated circulating leukocytes, haemoglobin (Hb) concentration and haematocrit (Hct) in response to the stressor. These were accompanied by significant increases in heart rate, systolic and diastolic BP (P<0.05 from baseline). This is the first reported study on the effects of observing a psychologically stressful, albeit fictitious event on circulating leukocyte numbers and the state of leukocyte activation as determined by the nitrotetrazolium test.

  5. MED1 independent activation of endogenous target genes by PPARα

    DEFF Research Database (Denmark)

    Grøntved, Lars; Bugge, Anne K.; Roeder, Robert G.

    The mediator complex serves as a transcriptional co-activator complex by acting as a bridge between promoter-bound transcription factors and the preinitiation complex. Genetic and biochemical studies indicate that nuclear receptors recruit the mediator complex through direct interaction with the ......The mediator complex serves as a transcriptional co-activator complex by acting as a bridge between promoter-bound transcription factors and the preinitiation complex. Genetic and biochemical studies indicate that nuclear receptors recruit the mediator complex through direct interaction...... derived from TRAP220 KO mice. Interestingly, rescue experiments in confluent TRAP220 KO MEFs with different versions of MED1 indicate that the LXXLL motif is not necessary for PPARgamma mediated gene activation (Ge et al, MCB published online ahead of print 2007). By analogy, we show here that MED1...... is dispensable for PPARalpha transcriptional activity in proliferating but is necessary in confluent AML-12 cells and TRAP220 KO MEFs. Collectively this indicates that the PPARs might have adopted an alternative mediator recruitment mechanism that is dispensable of direct interaction with MED1 on endogenous...

  6. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    Science.gov (United States)

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  7. Prediction and Characterization of High-Activity Events in Social Media Triggered by Real-World News.

    Science.gov (United States)

    Kalyanam, Janani; Quezada, Mauricio; Poblete, Barbara; Lanckriet, Gert

    2016-01-01

    On-line social networks publish information on a high volume of real-world events almost instantly, becoming a primary source for breaking news. Some of these real-world events can end up having a very strong impact on on-line social networks. The effect of such events can be analyzed from several perspectives, one of them being the intensity and characteristics of the collective activity that it produces in the social platform. We research 5,234 real-world news events encompassing 43 million messages discussed on the Twitter microblogging service for approximately 1 year. We show empirically that exogenous news events naturally create collective patterns of bursty behavior in combination with long periods of inactivity in the network. This type of behavior agrees with other patterns previously observed in other types of natural collective phenomena, as well as in individual human communications. In addition, we propose a methodology to classify news events according to the different levels of intensity in activity that they produce. In particular, we analyze the most highly active events and observe a consistent and strikingly different collective reaction from users when they are exposed to such events. This reaction is independent of an event's reach and scope. We further observe that extremely high-activity events have characteristics that are quite distinguishable at the beginning stages of their outbreak. This allows us to predict with high precision, the top 8% of events that will have the most impact in the social network by just using the first 5% of the information of an event's lifetime evolution. This strongly implies that high-activity events are naturally prioritized collectively by the social network, engaging users early on, way before they are brought to the mainstream audience.

  8. Exercise-Induced Rhabdomyolysis and Stress-Induced Malignant Hyperthermia Events, Association with Malignant Hyperthermia Susceptibility, and RYR1 Gene Sequence Variations

    Directory of Open Access Journals (Sweden)

    Antonella Carsana

    2013-01-01

    Full Text Available Exertional rhabdomyolysis (ER and stress-induced malignant hyperthermia (MH events are syndromes that primarily afflict military recruits in basic training and athletes. Events similar to those occurring in ER and in stress-induced MH events are triggered after exposure to anesthetic agents in MH-susceptible (MHS patients. MH is an autosomal dominant hypermetabolic condition that occurs in genetically predisposed subjects during general anesthesia, induced by commonly used volatile anesthetics and/or the neuromuscular blocking agent succinylcholine. Triggering agents cause an altered intracellular calcium regulation. Mutations in RYR1 gene have been found in about 70% of MH families. The RYR1 gene encodes the skeletal muscle calcium release channel of the sarcoplasmic reticulum, commonly known as ryanodine receptor type 1 (RYR1. The present work reviews the documented cases of ER or of stress-induced MH events in which RYR1 sequence variations, associated or possibly associated to MHS status, have been identified.

  9. Cosmogenic activation of germanium used for tonne-scale rare event search experiments

    Science.gov (United States)

    Wei, W.-Z.; Mei, D.-M.; Zhang, C.

    2017-11-01

    We report a comprehensive study of cosmogenic activation of germanium used for tonne-scale rare event search experiments. The germanium exposure to cosmic rays on the Earth's surface are simulated with and without a shielding container using Geant4 for a given cosmic muon, neutron, and proton energy spectrum. The production rates of various radioactive isotopes are obtained for different sources separately. We find that fast neutron induced interactions dominate the production rate of cosmogenic activation. Geant4-based simulation results are compared with the calculation of ACTIVIA and the available experimental data. A reasonable agreement between Geant4 simulations and several experimental data sets is presented. We predict that cosmogenic activation of germanium can set limits to the sensitivity of the next generation of tonne-scale experiments.

  10. Turbulent Reynolds stress and quadrant event activity in wind flow over a coastal foredune

    Science.gov (United States)

    Chapman, Connie A.; Walker, Ian J.; Hesp, Patrick A.; Bauer, Bernard O.; Davidson-Arnott, Robin G. D.

    2012-05-01

    Recent research on quasi-instantaneous turbulent kinematic Reynolds stresses (RS, - u'w') and decomposed quadrant event activity (e.g., ejections and sweeps) over dunes in fluvial settings and in wind tunnels has shown that turbulent stresses at the toe of a dune often exceed time-averaged, streamwise shear stress (ρ u * 2) estimates. It is believed that semi-coherent turbulent structures are conveyed toward the bed along concave streamlines in this region and that impact of these structures cause fluctuations in local surface stresses that assist in grain entrainment. This has been hypothesized to explain how sand is supplied to the windward slope through a region of flow stagnation. Toward the crest, surface stress increases and becomes dominated by streamwise accelerations resulting from streamline compression and convexity that suppress vertical motions. High-frequency (32 Hz) measurements of turbulent wind flow from 3-D ultrasonic anemometers are analyzed for oblique onshore flow over a vegetated coastal foredune in Prince Edward Island, Canada. Reynolds stress and quadrant activity distributions varied with height (0.60 m and 1.66 m) and location over the dune. In general, quadrant 2 ejection (u' 0) and quadrant 4 sweep activity (u' > 0, w' 0, w' > 0) and quadrant 3 inward interaction (u' dune and may help to explain sand transport potential and dune maintenance. For example, areas with a high frequency of ejection and sweep activity may have higher rates of sediment entrainment and transport, whereas areas with lower ejection and sweep activity and an increase in outward and inward interactions, which contribute negatively to Reynolds stress generation, may experience a greater potential for deposition. Further research on associations between quadrant event activity and coincident sand transport is required to confirm this hypothesis and the resultant significance of the flow exuberance effect in aeolian dune morphodynamics.

  11. Multi-day activity scheduling reactions to planned activities and future events in a dynamic model of activity-travel behavior

    Science.gov (United States)

    Nijland, Linda; Arentze, Theo; Timmermans, Harry

    2014-01-01

    Modeling multi-day planning has received scarce attention in activity-based transport demand modeling so far. However, new dynamic activity-based approaches are being developed at the current moment. The frequency and inflexibility of planned activities and events in activity schedules of individuals indicate the importance of incorporating those pre-planned activities in the new generation of dynamic travel demand models. Elaborating and combining previous work on event-driven activity generation, the aim of this paper is to develop and illustrate an extension of a need-based model of activity generation that takes into account possible influences of pre-planned activities and events. This paper describes the theory and shows the results of simulations of the extension. The simulation was conducted for six different activities, and the parameter values used were consistent with an earlier estimation study. The results show that the model works well and that the influences of the parameters are consistent, logical, and have clear interpretations. These findings offer further evidence of face and construct validity to the suggested modeling approach.

  12. Polycomb-group genes sustaining the stem cell activity

    International Nuclear Information System (INIS)

    Takihara, Yoshihiro

    2006-01-01

    Polycomb-group genes (PcG) have a role in constituting the cellular memory mechanisms through which the once expressed phenotypes during development are transmitted thereafter and this review describes, together with authors' findings of sustaining hematopoietic stem cell activity by the PcG products, what molecular bases, involving the control of histone code, are concerned in the memory. Recent investigations have gradually elucidated the outline of epigenetic control mechanisms of the memory: messages are set up as a histone code in the chromatin and the PcG complex recruited by recognition of the code regulates the chromatin structure leading to DNA transcription and maintenance of the phenotype. Proliferation of hematopoietic stem cells ex vivo will be possible if exact and detailed mechanisms for PcG are made clear in future. Such ex vivo techniques are especially awaited for marrow remodeling treatment of hematopoietic failure induced by radiation exposure. (T.I.)

  13. Activation of silenced cytokine gene promoters by the synergistic effect of TBP-TALE and VP64-TALE activators.

    Science.gov (United States)

    Anthony, Kim; More, Abhijit; Zhang, Xiaoliu

    2014-01-01

    Recent work has shown that the combinatorial use of multiple TALE activators can selectively activate certain cellular genes in inaccessible chromatin regions. In this study, we aimed to interrogate the activation potential of TALEs upon transcriptionally silenced immune genes in the context of non-immune cells. We designed a unique strategy, in which a single TALE fused to the TATA-box binding protein (TBP-TALE) is coupled with multiple VP64-TALE activators. We found that our strategy is significantly more potent than multiple TALE activators alone in activating expression of IL-2 and GM-CSF in diverse cell origins in which both genes are otherwise completely silenced. Chromatin analysis revealed that the gene activation was due in part to displacement of a distinctly positioned nucleosome. These studies provide a novel epigenetic mechanism for artificial gene induction and have important implications for targeted cancer immunotherapy, DNA vaccine development, as well as rational design of TALE activators.

  14. Prediction of Increasing Production Activities using Combination of Query Aggregation on Complex Events Processing and Neural Network

    Directory of Open Access Journals (Sweden)

    Achmad Arwan

    2016-07-01

    Full Text Available AbstrakProduksi, order, penjualan, dan pengiriman adalah serangkaian event yang saling terkait dalam industri manufaktur. Selanjutnya hasil dari event tersebut dicatat dalam event log. Complex Event Processing adalah metode yang digunakan untuk menganalisis apakah terdapat pola kombinasi peristiwa tertentu (peluang/ancaman yang terjadi pada sebuah sistem, sehingga dapat ditangani secara cepat dan tepat. Jaringan saraf tiruan adalah metode yang digunakan untuk mengklasifikasi data peningkatan proses produksi. Hasil pencatatan rangkaian proses yang menyebabkan peningkatan produksi digunakan sebagai data latih untuk mendapatkan fungsi aktivasi dari jaringan saraf tiruan. Penjumlahan hasil catatan event log dimasukkan ke input jaringan saraf tiruan untuk perhitungan nilai aktivasi. Ketika nilai aktivasi lebih dari batas yang ditentukan, maka sistem mengeluarkan sinyal untuk meningkatkan produksi, jika tidak, sistem tetap memantau kejadian. Hasil percobaan menunjukkan bahwa akurasi dari metode ini adalah 77% dari 39 rangkaian aliran event.Kata kunci: complex event processing, event, jaringan saraf tiruan, prediksi peningkatan produksi, proses. AbstractProductions, orders, sales, and shipments are series of interrelated events within manufacturing industry. Further these events were recorded in the event log. Complex event processing is a method that used to analyze whether there are patterns of combinations of certain events (opportunities / threats that occur in a system, so it can be addressed quickly and appropriately. Artificial neural network is a method that we used to classify production increase activities. The series of events that cause the increase of the production used as a dataset to train the weight of neural network which result activation value. An aggregate stream of events inserted into the neural network input to compute the value of activation. When the value is over a certain threshold (the activation value results

  15. Retroviral insertional mutagenesis identifies Zeb2 activation as a novel leukemogenic collaborating event in CALM-AF10 transgenic mice.

    Science.gov (United States)

    Caudell, David; Harper, David P; Novak, Rachel L; Pierce, Rachel M; Slape, Christopher; Wolff, Linda; Aplan, Peter D

    2010-02-11

    The t(10;11) translocation results in a CALM-AF10 fusion gene in a subset of leukemia patients. Expression of a CALM-AF10 transgene results in leukemia, with prolonged latency and incomplete penetrance, suggesting that additional events are necessary for leukemic transformation. CALM-AF10 mice infected with the MOL4070LTR retrovirus developed acute leukemia, and ligation-mediated polymerase chain reaction was used to identify retroviral insertions at 19 common insertion sites, including Zeb2, Nf1, Mn1, Evi1, Ift57, Mpl, Plag1, Kras, Erg, Vav1, and Gata1. A total of 26% (11 of 42) of the mice had retroviral integrations near Zeb2, a transcriptional corepressor leading to overexpression of the Zeb2-transcript. A total of 91% (10 of 11) of mice with Zeb2 insertions developed B-lineage acute lymphoblastic leukemia, suggesting that Zeb2 activation promotes the transformation of CALM-AF10 hematopoietic precursors toward B-lineage leukemias. More than half of the mice with Zeb2 integrations also had Nf1 integrations, suggesting cooperativity among CALM-AF10, Zeb2, and Ras pathway mutations. We searched for Nras, Kras, and Ptpn11 point mutations in the CALM-AF10 leukemic mice. Three mutations were identified, all of which occurred in mice with Zeb2 integrations, consistent with the hypothesis that Zeb2 and Ras pathway activation promotes B-lineage leukemic transformation in concert with CALM-AF10.

  16. Searches for Dark Matter in Events with Hadronic Activity at ATLAS

    CERN Document Server

    Kalderon, Charles William; The ATLAS collaboration

    2017-01-01

    The astrophysical evidence of dark matter provides some of the most compelling clues to the nature of physics beyond the Standard Model. From these clues, ATLAS has developed a broad and systematic search program for dark matter production in LHC collisions.  The results of searches in 13 TeV pp collisions for dark matter using events with large missing transverse momentum and hadronic activity is presented along with the complementary searches for the dark matter mediator in resonance searches.

  17. 2015 Volcanic activity in Alaska—Summary of events and response of the Alaska Volcano Observatory

    Science.gov (United States)

    Dixon, James P.; Cameron, Cheryl E.; Iezzi, Alexandra M.; Wallace, Kristi

    2017-09-28

    The Alaska Volcano Observatory (AVO) responded to eruptions, volcanic unrest or suspected unrest, and seismic events at 14 volcanic centers in Alaska during 2015. The most notable volcanic activity consisted of continuing intermittent ash eruptions from Cleveland and Shishaldin volcanoes in the Aleutian Islands. Two eruptive episodes, at Veniaminof and Pavlof, on the Alaska Peninsula ended in 2015. During 2015, AVO re-established the seismograph network at Aniakchak, installed six new broadband seismometers throughout the Aleutian Islands, and added a Multiple component Gas Analyzer System (MultiGAS) station on Augustine.

  18. C-reactive protein gene C1444T polymorphism and risk of recurrent ischemic events in patients with symptomatic intracranial atherostenoses.

    Science.gov (United States)

    Arenillas, Juan F; Massot, Andreu; Alvarez-Sabín, Jose; Fernandez-Cadenas, Israel; del Rio-Espinola, Albert; Chacon, Pilar; Quintana, Manuel; Molina, Carlos A; Rovira, Alex; Montaner, Joan

    2009-01-01

    High levels of C-reactive protein (CRP) are associated with an increased risk of further ischemic events in patients with symptomatic intracranial atherosclerotic disease (ICAD). It remains unknown to which extent this increased risk might be genetically predetermined. We aimed to investigate the relationship between a common genetic polymorphism of the CRP gene and the risk of recurrent ischemic events in symptomatic ICAD patients. We studied 75 consecutive patients with a first-ever cerebral ischemic event attributable to symptomatic ICAD. Blood samples were drawn 3 months after the qualifying event. Genomic DNA was isolated and the C1444T single nucleotide polymorphism (SNP) of the CRP gene was determined. The blood concentration of CRP was also measured. Patients underwent long-term clinical follow-up to detect the occurrence of further major ischemic events. During a median follow-up time of 23 months, 18 patients (24%) suffered a major ischemic event (10 ischemic strokes, 3 transient ischemic attacks and 5 myocardial infarctions). Raised CRP levels at baseline (p = 0.02) and the presence of the T allele within the CRP C1444T SNP were associated with a higher risk of recurrent ischemic events (p = 0.02). Kaplan-Meier and multivariable Cox regression analyses adjusted for age, sex, vascular risk factors and CRP level identified that the presence of the T allele in the studied polymorphism predicted the occurrence of further ischemic events (hazard ratio 3.6, 95% confidence interval 1.2-11.1; p = 0.025). The presence of the T allele within the CRP gene C1444T polymorphism may be associated with a higher risk of further ischemic events in symptomatic ICAD patients. (c) 2009 S. Karger AG, Basel.

  19. Observations of Blue Discharges Associated With Negative Narrow Bipolar Events in Active Deep Convection

    Science.gov (United States)

    Liu, Feifan; Zhu, Baoyou; Lu, Gaopeng; Qin, Zilong; Lei, Jiuhou; Peng, Kang-Ming; Chen, Alfred B.; Huang, Anjing; Cummer, Steven A.; Chen, Mingli; Ma, Ming; Lyu, Fanchao; Zhou, Helin

    2018-03-01

    On 19 August 2012, the Imager of Sprites and Upper Atmospheric Lightning on board the FORMOSAT-2 satellite captured a sequence of seven blue discharges within 1 min that emanated from a parent thunderstorm over Lake Taihu in East China. The analysis of lightning activity produced in the thunderstorm indicates that at least six of these events occurred in association with negative narrow bipolar events (NBEs) that were concurrent with the blue discharge by less than 1 ms, and negative cloud-to-ground occurred within 6 s before each blue discharge, which is in agreement with the modeling presented by Krehbiel et al. (2008). Therefore, the frequent occurrence of negative cloud-to-ground could provide the favorable condition for the production of blue discharges, and negative NBEs are probably the initial event of blue discharges. The detection of negative NBEs might provide a convenient approach to detect the occurrence of blue discharges as lightning bolt shooting upward from the top of energetic thunderstorms.

  20. CONNECTING FLARES AND TRANSIENT MASS-LOSS EVENTS IN MAGNETICALLY ACTIVE STARS

    Energy Technology Data Exchange (ETDEWEB)

    Osten, Rachel A. [Space Telescope Science Institute 3700 San Martin Drive, Baltimore, MD 21218 (United States); Wolk, Scott J., E-mail: osten@stsci.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge MA 02138 (United States)

    2015-08-10

    We explore the ramification of associating the energetics of extreme magnetic reconnection events with transient mass-loss in a stellar analogy with solar eruptive events. We establish energy partitions relative to the total bolometric radiated flare energy for different observed components of stellar flares and show that there is rough agreement for these values with solar flares. We apply an equipartition between the bolometric radiated flare energy and kinetic energy in an accompanying mass ejection, seen in solar eruptive events and expected from reconnection. This allows an integrated flare rate in a particular waveband to be used to estimate the amount of associated transient mass-loss. This approach is supported by a good correspondence between observational flare signatures on high flaring rate stars and the Sun, which suggests a common physical origin. If the frequent and extreme flares that young solar-like stars and low-mass stars experience are accompanied by transient mass-loss in the form of coronal mass ejections, then the cumulative effect of this mass-loss could be large. We find that for young solar-like stars and active M dwarfs, the total mass lost due to transient magnetic eruptions could have significant impacts on disk evolution, and thus planet formation, and also exoplanet habitability.

  1. Simulating flaring events in complex active regions driven by observed magnetograms

    Science.gov (United States)

    Dimitropoulou, M.; Isliker, H.; Vlahos, L.; Georgoulis, M. K.

    2011-05-01

    Context. We interpret solar flares as events originating in active regions that have reached the self organized critical state, by using a refined cellular automaton model with initial conditions derived from observations. Aims: We investigate whether the system, with its imposed physical elements, reaches a self organized critical state and whether well-known statistical properties of flares, such as scaling laws observed in the distribution functions of characteristic parameters, are reproduced after this state has been reached. Methods: To investigate whether the distribution functions of total energy, peak energy and event duration follow the expected scaling laws, we first applied a nonlinear force-free extrapolation that reconstructs the three-dimensional magnetic fields from two-dimensional vector magnetograms. We then locate magnetic discontinuities exceeding a threshold in the Laplacian of the magnetic field. These discontinuities are relaxed in local diffusion events, implemented in the form of cellular automaton evolution rules. Subsequent loading and relaxation steps lead the system to self organized criticality, after which the statistical properties of the simulated events are examined. Physical requirements, such as the divergence-free condition for the magnetic field vector, are approximately imposed on all elements of the model. Results: Our results show that self organized criticality is indeed reached when applying specific loading and relaxation rules. Power-law indices obtained from the distribution functions of the modeled flaring events are in good agreement with observations. Single power laws (peak and total flare energy) are obtained, as are power laws with exponential cutoff and double power laws (flare duration). The results are also compared with observational X-ray data from the GOES satellite for our active-region sample. Conclusions: We conclude that well-known statistical properties of flares are reproduced after the system has

  2. Available processing resources influence encoding-related brain activity before an event.

    Science.gov (United States)

    Galli, Giulia; Gebert, A Dorothea; Otten, Leun J

    2013-09-01

    Effective cognitive functioning not only relies on brain activity elicited by an event, but also on activity that precedes it. This has been demonstrated in a number of cognitive domains, including memory. Here, we show that brain activity that precedes the effective encoding of a word into long-term memory depends on the availability of sufficient processing resources. We recorded electrical brain activity from the scalps of healthy adult men and women while they memorized intermixed visual and auditory words for later recall. Each word was preceded by a cue that indicated the modality of the upcoming word. The degree to which processing resources were available before word onset was manipulated by asking participants to make an easy or difficult perceptual discrimination on the cue. Brain activity before word onset predicted later recall of the word, but only in the easy discrimination condition. These findings indicate that anticipatory influences on long-term memory are limited in capacity and sensitive to the degree to which attention is divided between tasks. Prestimulus activity that affects later encoding can only be engaged when the necessary cognitive resources can be allocated to the encoding process. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Behavioral science and the study of gene-nutrition and gene-physical activity interactions in obesity research.

    Science.gov (United States)

    Faith, Myles S

    2008-12-01

    This report summarizes emerging opportunities for behavioral science to help advance the field of gene-environment and gene-behavior interactions, based on presentations at The National Cancer Institute (NCI) Workshop, "Gene-Nutrition and Gene-Physical Activity Interactions in the Etiology of Obesity." Three opportunities are highlighted: (i) designing potent behavioral "challenges" in experiments, (ii) determining viable behavioral phenotypes for genetics studies, and (iii) identifying specific measures of the environment or environmental exposures. Additional points are underscored, including the need to incorporate novel findings from neuroimaging studies regarding motivation and drive for eating and physical activity. Advances in behavioral science theory and methods can play an important role in advancing understanding of gene-brain-behavior relationships in obesity onset.

  4. Search for supersymmetry in events with at least one photon, missing transverse momentum, and large transverse event activity in proton-proton collisions at 13 TeV

    CERN Document Server

    CMS Collaboration

    2017-01-01

    A search for physics beyond the standard model in final states with at least one photon, large transverse momentum imbalance, and large total transverse event activity is presented. This event selection provides good sensitivity for gauge mediated supersymmetry models in which pair-produced gluinos or squarks decay via short-living neutralinos to photons and gravitinos. The data sample corresponds to an integrated luminosity of $35.9~\\mathrm{fb}^{-1}$ of proton-proton collisions recorded by the CMS experiment at the LHC in 2016. No excess of events above the standard model background is observed. The data is interpreted in simplified models of gluino- and squark pair production, in which gluinos and squarks decay via gauginos to photons. Gluino masses of up to $2~\\mathrm{TeV}$ masses up to $1.6~\\mathrm{TeV}$ are excluded.

  5. Rubisco activity and gene expression of tropical tree species under ...

    African Journals Online (AJOL)

    Young

    2013-05-15

    May 15, 2013 ... Proteomics analysis associated with gene expression of plants reveal .... Consequently, Rubisco enzyme plays a role in assi- milating into ... technique for examining gene expression encoded at the. mRNA level .... Ammonia.

  6. Tumor-produced, active Interleukin-1 β regulates gene expression in carcinoma-associated fibroblasts

    International Nuclear Information System (INIS)

    Dudas, Jozsef; Fullar, Alexandra; Bitsche, Mario; Schartinger, Volker; Kovalszky, Ilona; Sprinzl, Georg Mathias; Riechelmann, Herbert

    2011-01-01

    Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1β (IL1-β) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-β expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-β processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-β. IL1-β signaling was investigated by western blot and immunocytochemistry. IL1-β-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-β, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NFκBα. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-β reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-β-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-β in the tumor cells leads to IL1-β-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-β. PDL fibroblasts possess receptor for IL1-β, and its expression is increased 4.56-times in the presence of SCC-25 tumor cells. IL1-β receptor expression in

  7. Tumor-produced, active Interleukin-1 {beta} regulates gene expression in carcinoma-associated fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Dudas, Jozsef, E-mail: Jozsef.Dudas@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Fullar, Alexandra, E-mail: fullarsz@gmail.com [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); 1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Bitsche, Mario, E-mail: Mario.Bitsche@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Schartinger, Volker, E-mail: Volker.Schartinger@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Kovalszky, Ilona, E-mail: koval@korb1.sote.hu [1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Sprinzl, Georg Mathias, E-mail: Georg.Sprinzl@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Riechelmann, Herbert, E-mail: Herbert.Riechelmann@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria)

    2011-09-10

    Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1{beta} (IL1-{beta}) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-{beta} expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-{beta} processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-{beta}. IL1-{beta} signaling was investigated by western blot and immunocytochemistry. IL1-{beta}-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-{beta}, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NF{kappa}B{alpha}. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-{beta} reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-{beta}-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-{beta} in the tumor cells leads to IL1-{beta}-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-{beta}. PDL fibroblasts possess receptor for IL1-{beta}, and its expression is increased 4.56-times in the

  8. Nonvolcanic Tremor Activity is Highly Correlated With Slow Slip Events, Mexico

    Science.gov (United States)

    Kostoglodov, V.; Shapiro, N.; Larson, K. M.; Payero, J. S.; Husker, A.; Santiago, L. A.; Clayton, R. W.

    2008-12-01

    Significant activity of nonvolcanic tremor (NVT) has been observed in the central Mexico (Guerrero) subduction zone since 2001 when continuous seismic records became available. Although the quality of these records is poor, it is possible to estimate a temporal variation of energy in the range of 1-2Hz (best signal/noise ratio for the NVT). These clearly indicate a maximum of NVT energy release (En) during the 2001-2002 and 2006 large aseismic slow slip events (SSE) registered by the Guerrero GPS network. In particular En is higher for the 2001-2002 SSE which had larger surface displacements and extension than the 2006 SSE. A more detailed and accurate study of NVT activity was carried out using the data collected during the MASE experiment in Mexico. MASE consisted of 100 broad band seismometers in operation for ~2.5 years (2005-2007) along the profile oriented SSW-NNE from Acapulco, and crossing over the subduction zone for a distance of ~500 km. Epicenters and depths of individual tremor events determined using the envelope cross-correlation technique have rather large uncertainties, partly originated from the essentially 2D geometry of the network. The 'energy' approach is more efficient in this case because it provides an average NVT activity evolution in time and space. The data processing consists of a band pass (1-2Hz) filter of the raw 100 Hz sampled N-S component records, application a 10 min-width median filter to eliminate the effect of local seismic events and noise, and integration of the energy and normalization of daily En using an average coda amplitude from several regional earthquakes of M~5. A time-space distribution of En reveals a strong correlation between NVT energy release and the 2006 SSE, which also replicates the two-phase character of this slow event and a migration of the slow slip maximum from North to South. There are also a few clear episodes of relatively high NVT energy release that do not correspond to any significant geodetic

  9. Interleukin-1 beta gene deregulation associated with chromosomal rearrangement: A candidate initiating event for murine radiation-myeloid leukemogenesis

    International Nuclear Information System (INIS)

    Silver, A.; Boultwood, J.; Breckon, G.; Masson, W.; Adam, J.; Shaw, A.R.; Cox, R.

    1989-01-01

    The incidence of acute myeloid leukemia (AML) in CBA/H mice following exposure to single acute doses of ionizing radiation has previously been determined. A high proportion of these AMLs are characterized by rearrangement of murine chromosome 2 in the C2 and/or E5-F regions, and there is evidence that these events are a direct consequence of radiation damage to multipotential hemopoietic cells. Using a combination of in situ chromosome hybridization and mRNA analyses, we show that the cytokine gene interleukin-1 beta (IL-1 beta) is encoded in the chromosome 2 F region and is translocated in a chromosome 2---2 rearrangement in an x-ray-induced AML (N36). Also, IL-1 beta is specifically deregulated in N36 and in two other chromosome 2-rearranged AMLs but not in a fourth, which has two cytogenetically normal chromosome 2 copies. We suggest that radiation-induced specific chromosome 2 rearrangement associated with IL-1 beta deregulation may initiate murine leukemogenesis through the uncoupling of normal proliferative control mechanisms in multipotential hemopoietic cells

  10. Detection of Cardiopulmonary Activity and Related Abnormal Events Using Microsoft Kinect Sensor.

    Science.gov (United States)

    Al-Naji, Ali; Chahl, Javaan

    2018-03-20

    Monitoring of cardiopulmonary activity is a challenge when attempted under adverse conditions, including different sleeping postures, environmental settings, and an unclear region of interest (ROI). This study proposes an efficient remote imaging system based on a Microsoft Kinect v2 sensor for the observation of cardiopulmonary-signal-and-detection-related abnormal cardiopulmonary events (e.g., tachycardia, bradycardia, tachypnea, bradypnea, and central apnoea) in many possible sleeping postures within varying environmental settings including in total darkness and whether the subject is covered by a blanket or not. The proposed system extracts the signal from the abdominal-thoracic region where cardiopulmonary activity is most pronounced, using a real-time image sequence captured by Kinect v2 sensor. The proposed system shows promising results in any sleep posture, regardless of illumination conditions and unclear ROI even in the presence of a blanket, whilst being reliable, safe, and cost-effective.

  11. Detection of Cardiopulmonary Activity and Related Abnormal Events Using Microsoft Kinect Sensor

    Directory of Open Access Journals (Sweden)

    Ali Al-Naji

    2018-03-01

    Full Text Available Monitoring of cardiopulmonary activity is a challenge when attempted under adverse conditions, including different sleeping postures, environmental settings, and an unclear region of interest (ROI. This study proposes an efficient remote imaging system based on a Microsoft Kinect v2 sensor for the observation of cardiopulmonary-signal-and-detection-related abnormal cardiopulmonary events (e.g., tachycardia, bradycardia, tachypnea, bradypnea, and central apnoea in many possible sleeping postures within varying environmental settings including in total darkness and whether the subject is covered by a blanket or not. The proposed system extracts the signal from the abdominal-thoracic region where cardiopulmonary activity is most pronounced, using a real-time image sequence captured by Kinect v2 sensor. The proposed system shows promising results in any sleep posture, regardless of illumination conditions and unclear ROI even in the presence of a blanket, whilst being reliable, safe, and cost-effective.

  12. Increased PRPP synthetase activity in cultured rat hepatoma cells containing mutations in the hypoxanthine-guanine phosphoribosyltransferase gene.

    Science.gov (United States)

    Graf, L H; McRoberts, J A; Harrison, T M; Martin, D W

    1976-07-01

    Nine independently derived clones of mutagenized rat hepatoma cells selected for resistance to 6-mercaptopurine (6-MP) or 6-thioguanine (6-ThioG) have been isolated. Each has severely reduced catalytic activity of hypoxanthine-guanine phosphoribosyltransferase (HPRT) and seven of them possess significantly increased activities of phosphoribosylpyrophosphate (PRPP) synthetase. The degrees of elevations of PRPP synthetase activities do not correlate with the degrees of deficiencies of HPRT activities. The cells from one of these clones, 1020/12, posses 40% of the normal HPRT catalytic activity and overproduce purines. We have extensively examined the cells from this clone. Immunotration studies of 1020/12 cells indicate that there is a mutation in the structural gene for HPRT. Although they possess increased specific catalytic activities of the enzyme. PRPP synthetase, the catalytic parameters, heat stability, and isoelectric pH of PRPP synthetase from 1020/12 cells are indistinguishable from those of the enzyme from wild-type cells. The cause of purine overproduction by 1020/12 cells appears to be the elevated PRPP synthetase activity, rather than a PRPP "sparing" effect stemming from reduced HPRT activity. Support for this idea is provided by the observation that the complete loss of HPRT activity in a clone derived from 1020/12 cells does not further enhance the levels of PRPP synthetase or purine overproduction. We propose that the elevated levels of PRPP synthetase activity in these HPRT deficient cells result from a mutational event in the structural gene for HPRT, and that this causes the disruption of a previously undescribed regulatory function of this gene on the expression of the PRPP synthetase gene.

  13. Real-time polymerase chain reaction-based approach for quantification of the pat gene in the T25 Zea mays event.

    Science.gov (United States)

    Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy

    2004-01-01

    In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement

  14. Root-Knot and Cyst Nematodes Activate Procambium-Associated Genes in Arabidopsis Roots

    Directory of Open Access Journals (Sweden)

    Yasuka L. Yamaguchi

    2017-07-01

    Full Text Available Developmental plasticity is one of the most striking features of plant morphogenesis, as plants are able to vary their shapes in response to environmental cues. Biotic or abiotic stimuli often promote organogenesis events in plants not observed under normal growth conditions. Root-knot nematodes (RKNs are known to parasitize multiple species of rooting plants and to induce characteristic tissue expansion called galls or root-knots on the roots of their hosts by perturbing the plant cellular machinery. Galls contain giant cells (GCs and neighboring cells, and the GCs are a source of nutrients for the parasitizing nematode. Highly active cell proliferation was observed in galls. However, the underlying mechanisms that regulate the symptoms triggered by the plant-nematode interaction have not yet been elucidated. In this study, we deciphered the molecular mechanism of gall formation with an in vitro infection assay system using RKN Meloidogyne incognita, and the model plant Arabidopsis thaliana. By taking advantages of this system, we performed next-generation sequencing-based transcriptome profiling, and found that the expression of procambium identity-associated genes were enriched during gall formation. Clustering analyses with artificial xylogenic systems, together with the results of expression analyses of the candidate genes, showed a significant correlation between the induction of gall cells and procambium-associated cells. Furthermore, the promoters of several procambial marker genes such as ATHB8, TDR and WOX4 were activated not only in M. incognita-induced galls, but similarly in M. javanica induced-galls and Heterodera schachtii-induced syncytia. Our findings suggest that phytoparasitic nematodes modulate the host’s developmental regulation of the vascular stem cells during gall formation.

  15. Root-Knot and Cyst Nematodes Activate Procambium-Associated Genes in Arabidopsis Roots.

    Science.gov (United States)

    Yamaguchi, Yasuka L; Suzuki, Reira; Cabrera, Javier; Nakagami, Satoru; Sagara, Tomomi; Ejima, Chika; Sano, Ryosuke; Aoki, Yuichi; Olmo, Rocio; Kurata, Tetsuya; Obayashi, Takeshi; Demura, Taku; Ishida, Takashi; Escobar, Carolina; Sawa, Shinichiro

    2017-01-01

    Developmental plasticity is one of the most striking features of plant morphogenesis, as plants are able to vary their shapes in response to environmental cues. Biotic or abiotic stimuli often promote organogenesis events in plants not observed under normal growth conditions. Root-knot nematodes (RKNs) are known to parasitize multiple species of rooting plants and to induce characteristic tissue expansion called galls or root-knots on the roots of their hosts by perturbing the plant cellular machinery. Galls contain giant cells (GCs) and neighboring cells, and the GCs are a source of nutrients for the parasitizing nematode. Highly active cell proliferation was observed in galls. However, the underlying mechanisms that regulate the symptoms triggered by the plant-nematode interaction have not yet been elucidated. In this study, we deciphered the molecular mechanism of gall formation with an in vitro infection assay system using RKN Meloidogyne incognita , and the model plant Arabidopsis thaliana. By taking advantages of this system, we performed next-generation sequencing-based transcriptome profiling, and found that the expression of procambium identity-associated genes were enriched during gall formation. Clustering analyses with artificial xylogenic systems, together with the results of expression analyses of the candidate genes, showed a significant correlation between the induction of gall cells and procambium-associated cells. Furthermore, the promoters of several procambial marker genes such as ATHB8 , TDR and WOX4 were activated not only in M. incognita -induced galls, but similarly in M. javanica induced-galls and Heterodera schachtii -induced syncytia. Our findings suggest that phytoparasitic nematodes modulate the host's developmental regulation of the vascular stem cells during gall formation.

  16. [Effect of Chinese drugs for activating blood circulation and removing blood stasis on carotid atherosclerosis and ischemic cerebrovascular events].

    Science.gov (United States)

    Lu, Yan; Li, Tao

    2014-03-01

    To explore the effect of Chinese drugs for activating blood circulation and removing blood stasis (CDABCRBS) on carotid atherosclerotic plaque and long-term ischemic cerebrovascular events. By using open and control method, effect of 4 groups of platelet antagonists, platelet antagonists + CDABCRBS, platelet antagonists +atorvastatin, platelet antagonists +atorvastatin +CDABCRBS on carotid atherosclerotic plaque and long-term ischemic cerebrovascular events of 90 cerebral infarction patients were analyzed. Through survival analysis, there was no statistical difference in the effect of the 4 interventions on the variation of carotid stenosis rates or ischemic cerebrovascular events (P > 0.05). The occurrence of ischemic cerebrovascular events could be postponed by about 4 months in those treated with platelet antagonists + CDABCRBS and platelet antagonists + atorvastatin +CDABCRBS. By multivariate Logistic analysis, age, hypertension, and clopidogrel were associated with stenosis of extracranial carotid arteries (P cerebrovascular accidents (P cerebrovascular events. CDABCRBS could effectively prolong the occurrence time of ischemic cerebrovascular events.

  17. Basal Ganglia Activity Mirrors a Benefit of Action and Reward on Long-Lasting Event Memory.

    Science.gov (United States)

    Koster, Raphael; Guitart-Masip, Marc; Dolan, Raymond J; Düzel, Emrah

    2015-12-01

    The expectation of reward is known to enhance a consolidation of long-term memory for events. We tested whether this effect is driven by positive valence or action requirements tied to expected reward. Using a functional magnetic resonance imaging (fMRI) paradigm in young adults, novel images predicted gain or loss outcomes, which in turn were either obtained or avoided by action or inaction. After 24 h, memory for these images reflected a benefit of action as well as a congruence of action requirements and valence, namely, action for reward and inaction for avoidance. fMRI responses in the hippocampus, a region known to be critical for long-term memory function, reflected the anticipation of inaction. In contrast, activity in the putamen mirrored the congruence of action requirement and valence, whereas other basal ganglia regions mirrored overall action benefits on long-lasting memory. The findings indicate a novel type of functional division between the hippocampus and the basal ganglia in the motivational regulation of long-term memory consolidation, which favors remembering events that are worth acting for. © The Author 2015. Published by Oxford University Press.

  18. Active surveillance for influenza vaccine adverse events: the integrated vaccine surveillance system.

    Science.gov (United States)

    Newes-Adeyi, Gabriella; Greece, Jacey; Bozeman, Sam; Walker, Deborah Klein; Lewis, Faith; Gidudu, Jane

    2012-02-01

    We conducted a pilot study of the Integrated Vaccine Surveillance System (IVSS), a novel active surveillance system for monitoring influenza vaccine adverse events that could be used in mass vaccination settings. We recruited 605 adult vaccinees from a convenience sample of 12 influenza vaccine clinics conducted by public health departments of two U.S. metropolitan regions. Vaccinees provided daily reports on adverse reactions following immunization (AEFI) using an interactive voice response system (IVR) or the internet for 14 consecutive days following immunization. Followup with nonrespondents was conducted through computer-assisted telephone interviewing (CATI). Data on vaccinee reports were available real-time through a dedicated secure website. 90% (545) of vaccinees made at least one daily report and 49% (299) reported consecutively for the full 14-day period. 58% (315) used internet, 20% (110) IVR, 6% (31) CATI, and 16% (89) used a combination for daily reports. Of the 545 reporters, 339 (62%) reported one or more AEFI, for a total of 594 AEFIs reported. The majority (505 or 85%) of these AEFIs were mild symptoms. It is feasible to develop a system to obtain real-time data on vaccine adverse events. Vaccinees are willing to provide daily reports for a considerable time post vaccination. Offering multiple modes of reporting encourages high response rates. Study findings on AEFIs showed that the IVSS was able to exhibit the emerging safety profile of the 2008 seasonal influenza vaccine. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Several nuclear events during apoptosis depend on caspase-3 activation but do not constitute a common pathway.

    Directory of Open Access Journals (Sweden)

    Lisa Trisciuoglio

    Full Text Available A number of nuclear events occur during apoptosis, including DNA laddering, nuclear lamina breakdown, phosphorylation of histones H2B and histone H2AX, and the tight binding to chromatin of HMGB1 and CAD, the nuclease responsible for DNA laddering. We have performed an epistasis analysis to investigate whether these events cluster together in pathways. We find that all depend directly or indirectly on caspase-3 activation. CAD activation, H2AX phosphorylation and DNA laddering cluster together into a pathway, but all other events appear to be independent of each other downstream of caspase-3, and likely evolved subject to different functional pressures.

  20. Radiocaesium activity in rape oil and in rape cake after a wet deposition event

    Energy Technology Data Exchange (ETDEWEB)

    Chaiko, Y.; Rappe-George, M.; Bengtsson, S. [Department of Soil and Environment (Sweden)

    2014-07-01

    After a release of radionuclides in agricultural areas there can be concerns on the levels of radionuclides in food products produced. The uptake of radionuclides via the above ground plant parts is a very important transport route into the food chain for humans as caesium is relatively mobile inside plants. In the production of rape oil the use of a processing factor (Pf) is used to estimate the activity concentration of radioactivity in the final oil product based on the activity concentration in rape seeds. The processing factor has been estimated to be 0.004 for caesium in rape oil by IAEA, and is based on a limited numbers of studies (1). In this project we analysed the activity concentration of radiocaesium ({sup 134}Cs) in rape oil and in rape cake from rape seeds contaminated after a wet deposition event with {sup 134}Cs. With the information of activity concentration of {sup 134}Cs in rape oil and in rape cake, we calculated the Pf-value and confirm or suggest new enhanced Pf-value. We analysed the activity concentration of {sup 134}Cs in rape oil and in rape cake from spring oilseed rape seeds (Brassica napus L.) that had been contaminated experimentally by wet deposited {sup 134}Cs in an earlier experiment by Bengtsson et al. (2013). The estimation of activity concentration of {sup 134}Cs in rape oil and in rape cake was achieved by performing extraction of the oil (and other extractable compounds) from the seeds based on the Randall extraction method (Randall, 1974) using petroleum ether as extraction chemical. The extracted oil and the rape cake samples were weighed and the activity concentration was measured with High-Purity Germanium (HPGe) detectors. Pf-values were calculated by dividing the measured activity concentration in rape oil after extraction by the activity concentration in oilseed rape seeds before extraction. Results from the present study will be presented at the international conference on radioecology and environmental radioactivity

  1. Flux balance modeling to predict bacterial survival during pulsed-activity events

    Science.gov (United States)

    Jose, Nicholas A.; Lau, Rebecca; Swenson, Tami L.; Klitgord, Niels; Garcia-Pichel, Ferran; Bowen, Benjamin P.; Baran, Richard; Northen, Trent R.

    2018-04-01

    Desert biological soil crusts (BSCs) are cyanobacteria-dominated surface soil microbial communities common to plant interspaces in arid environments. The capability to significantly dampen their metabolism allows them to exist for extended periods in a desiccated dormant state that is highly robust to environmental stresses. However, within minutes of wetting, metabolic functions reboot, maximizing activity during infrequent permissive periods. Microcoleus vaginatus, a primary producer within the crust ecosystem and an early colonizer, initiates crust formation by binding particles in the upper layer of soil via exopolysaccharides, making microbial dominated biological soil crusts highly dependent on the viability of this organism. Previous studies have suggested that biopolymers play a central role in the survival of this organism by powering resuscitation, rapidly forming compatible solutes, and fueling metabolic activity in dark, hydrated conditions. To elucidate the mechanism of this phenomenon and provide a basis for future modeling of BSCs, we developed a manually curated, genome-scale metabolic model of Microcoleus vaginatus (iNJ1153). To validate this model, gas chromatography-mass spectroscopy (GC-MS) and liquid chromatography-mass spectroscopy (LC-MS) were used to characterize the rate of biopolymer accumulation and depletion in in hydrated Microcoleus vaginatus under light and dark conditions. Constraint-based flux balance analysis showed agreement between model predictions and experimental reaction fluxes. A significant amount of consumed carbon and light energy is invested into storage molecules glycogen and polyphosphate, while β-polyhydroxybutyrate may function as a secondary resource. Pseudo-steady-state modeling suggests that glycogen, the primary carbon source with the fastest depletion rate, will be exhausted if M. vaginatus experiences dark wetting events 4 times longer than light wetting events.

  2. Detecting microRNA activity from gene expression data

    LENUS (Irish Health Repository)

    Madden, Stephen F

    2010-05-18

    Abstract Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  3. Detecting microRNA activity from gene expression data.

    LENUS (Irish Health Repository)

    Madden, Stephen F

    2010-01-01

    BACKGROUND: MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. RESULTS: Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. CONCLUSIONS: We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  4. The relationship of lightning activity and short-duation rainfall events during warm seasons over the Beijing metropolitan region

    Science.gov (United States)

    Wu, F.; Cui, X.; Zhang, D. L.; Lin, Q.

    2017-12-01

    The relationship between lightning activity and rainfall associated with 2925 short-duration rainfall (SDR) events over the Beijing metropolitan region (BMR) is examined during the warm seasons of 2006-2007, using the cloud-to-ground (CG) and intracloud (IC) lightning data from Surveillance et Alerte Foudre par Interférometrie Radioélectrique (SAFIR)-3000 and 5-min rainfall data from automatic weather stations (AWSs). To facilitate the analysis of the rainfall-lightning correlations, the SDR events are categorized into six different intensity grades according to their hourly rainfall rates (HRRs), and an optimal radius of 10 km from individual AWSs for counting their associated lightning flashes is used. Results show that the lightning-rainfall correlations vary significantly with different intensity grades. Weak correlations (R 0.4) are found in the weak SDR events, and 40-50% of the events are no-flash ones. And moderate correlation (R 0.6) are found in the moderate SDR events, and > 10-20% of the events are no-flash ones. In contrast, high correlations (R 0.7) are obtained in the SDHR events, and < 10% of the events are no-flash ones. The results indicate that lightning activity is observed more frequently and correlated more robust with the rainfall in the SDHR events. Significant time lagged correlations between lightning and rainfall are also found. About 80% of the SDR events could reach their highest correlation coefficients when the associated lightning flashes shift at time lags of < 25 min before and after rainfall begins. The percentages of SDR events with CG or total lightning activity preceding, lagging or coinciding with rainfall shows that (i) in about 55% of the SDR events lightning flashes preceded rainfall; (ii) the SDR events with lightning flashes lagging behind rainfall accounted for about 30%; and (iii) the SDR events without any time shifts accounted for the remaining 15%. Better lightning-rainfall correlations can be attained when time

  5. Event-Associated Oxygen Consumption Rate Increases ca. Five-Fold When Interictal Activity Transforms into Seizure-Like Events In Vitro

    Directory of Open Access Journals (Sweden)

    Karl Schoknecht

    2017-09-01

    Full Text Available Neuronal injury due to seizures may result from a mismatch of energy demand and adenosine triphosphate (ATP synthesis. However, ATP demand and oxygen consumption rates have not been accurately determined, yet, for different patterns of epileptic activity, such as interictal and ictal events. We studied interictal-like and seizure-like epileptiform activity induced by the GABAA antagonist bicuculline alone, and with co-application of the M-current blocker XE-991, in rat hippocampal slices. Metabolic changes were investigated based on recording partial oxygen pressure, extracellular potassium concentration, and intracellular flavine adenine dinucleotide (FAD redox potential. Recorded data were used to calculate oxygen consumption and relative ATP consumption rates, cellular ATP depletion, and changes in FAD/FADH2 ratio by applying a reactive-diffusion and a two compartment metabolic model. Oxygen-consumption rates were ca. five times higher during seizure activity than interictal activity. Additionally, ATP consumption was higher during seizure activity (~94% above control than interictal activity (~15% above control. Modeling of FAD transients based on partial pressure of oxygen recordings confirmed increased energy demand during both seizure and interictal activity and predicted actual FAD autofluorescence recordings, thereby validating the model. Quantifying metabolic alterations during epileptiform activity has translational relevance as it may help to understand the contribution of energy supply and demand mismatches to seizure-induced injury.

  6. The occurrence of respiratory events in young subjects with a frequent rhythmic masticatory muscle activity: a pilot study.

    Science.gov (United States)

    Tsujisaka, Akiko; Haraki, Shingo; Nonoue, Shigeru; Mikami, Akira; Adachi, Hiroyoshi; Mizumori, Takahiro; Yatani, Hirofumi; Yoshida, Atsushi; Kato, Takafumi

    2018-02-21

    Concomitant occurrence of respiratory events can be often overlooked in the clinical practice of SB. This study assessed physiological characteristics of rhythmic masticatory muscle activity (RMMA) and concomitant respiratory events in young SB subjects asymptomatic to obstructive sleep apnea (OSA). Twenty-two subjects (age: 24.1±1.9years; F 8: M 14; BMI: 20.2±1.9kg/m 2 ) were polysomnographically diagnosed as moderate-severe SB. Sleep architecture, oromotor (RMMA and non-specific masseter activity [NSMA]) and apnea/hypopnea events were scored. All subjects showed normal sleep architecture whereas 6 exhibited respiratory events at a mild level of OSA. In all subjects, RMMA predominantly occurred in Stage N1+N2 while NSMA occurred in Stage N1+N2 (approximately 60 %) and in Stage R (up to 30 %). Up to 50% of respiratory events were scored in Stage R. RMMA occurred more frequently in close association (e.g., within 10s) with respiratory events in 6 subjects with OSA than those without. The percentage of RMMA occurring closely to respiratory events was positively correlated with apnea-hypopnea index (AHI) in Stage N1+N2 only while that of NSMA was positively correlated with AHI in Stage N1+N2 and Stage R. A sub-analysis in 6 subjects with OSA, RMMA after respiratory events was followed to arousals while those before respiratory events were mostly associated with central apnea. A subpopulation of young SB subjects can show concomitant respiratory events. Further large sample studies are needed to demonstrate that the occurrence of subclinical respiratory events represents a clinical subtype of SB. Copyright © 2017 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.

  7. Coordination activities of human planners during rescheduling: Case analysis and event handling procedure

    OpenAIRE

    2010-01-01

    Abstract This paper addresses the process of event handling and rescheduling in manufacturing practice. Firms are confronted with many diverse events, like new or changed orders, machine breakdowns, and material shortages. These events influence the feasibility and optimality of schedules, and thus induce rescheduling. In many manufacturing firms, schedules are created by several human planners. Coordination between them is needed to respond to events adequately. In this paper,...

  8. TERT promoter mutation as an early genetic event activating telomerase in follicular thyroid adenoma (FTA) and atypical FTA.

    Science.gov (United States)

    Wang, Na; Liu, Tiantian; Sofiadis, Anastasios; Juhlin, C Christofer; Zedenius, Jan; Höög, Anders; Larsson, Catharina; Xu, Dawei

    2014-10-01

    The telomerase reverse transcriptase (TERT) promoter mutations C228T and C250T have been found in many malignancies, including in thyroid carcinomas. However, it is unclear how early these mutations occur in thyroid tumorigenesis. The study included primary tumors from 58 patients initially diagnosed with follicular thyroid adenoma (FTA), a benign entity, 18 with atypical FTA (AFTA) having an uncertain malignant potential, and 52 with follicular thyroid carcinoma (FTC). Sanger sequencing was used to investigate the mutational status of the TERT promoter. Telomere length and TERT messenger RNA (mRNA) expression were determined using quantitative polymerase chain reaction (PCR). Telomerase activity was assessed using a Telomerase PCR enzyme-linked immunosorbent assay kit. The C228T mutation was identified in 1 of 58 FTA (2%) and 3 of 18 AFTA (17%) samples. These 4 tumors all expressed TERT mRNA and telomerase activity, whereas the majority of C228T-negative adenomas lacked TERT expression (C228T versus wild-type, P = .008). The C228T mutation was associated with NRAS gene mutations (P = .016). The patient with C228T-mutated FTA later developed a scar recurrence and died of FTC, whereas none of the remaining 57 patients with FTA had recurrence. No recurrence occurred in 3 patients with AFTA who carried C228T during the follow-up period (36-285 months). Nine of the 52 FTCs (17%) exhibited the TERT mutation (8 of 9 C228T and 1 of 9 C250T), and the presence of the mutation was associated with shorter patient survival. TERT promoter mutations may occur as an early genetic event in thyroid follicular tumors that have not developed malignant features on routine histopathological workup. © 2014 American Cancer Society.

  9. ASPIE: A Framework for Active Sensing and Processing of Complex Events in the Internet of Manufacturing Things

    Directory of Open Access Journals (Sweden)

    Shaobo Li

    2018-03-01

    Full Text Available Rapid perception and processing of critical monitoring events are essential to ensure healthy operation of Internet of Manufacturing Things (IoMT-based manufacturing processes. In this paper, we proposed a framework (active sensing and processing architecture (ASPIE for active sensing and processing of critical events in IoMT-based manufacturing based on the characteristics of IoMT architecture as well as its perception model. A relation model of complex events in manufacturing processes, together with related operators and unified XML-based semantic definitions, are developed to effectively process the complex event big data. A template based processing method for complex events is further introduced to conduct complex event matching using the Apriori frequent item mining algorithm. To evaluate the proposed models and methods, we developed a software platform based on ASPIE for a local chili sauce manufacturing company, which demonstrated the feasibility and effectiveness of the proposed methods for active perception and processing of complex events in IoMT-based manufacturing.

  10. Dual gene activation and knockout screen reveals directional dependencies in genetic networks. | Office of Cancer Genomics

    Science.gov (United States)

    Understanding the direction of information flow is essential for characterizing how genetic networks affect phenotypes. However, methods to find genetic interactions largely fail to reveal directional dependencies. We combine two orthogonal Cas9 proteins from Streptococcus pyogenes and Staphylococcus aureus to carry out a dual screen in which one gene is activated while a second gene is deleted in the same cell. We analyze the quantitative effects of activation and knockout to calculate genetic interaction and directionality scores for each gene pair.

  11. Activated Very Low Frequency Earthquakes By the Slow Slip Events in the Ryukyu Subduction Zone

    Science.gov (United States)

    Nakamura, M.; Sunagawa, N.

    2014-12-01

    The Ryukyu Trench (RT), where the Philippine Sea plate is subducting, has had no known thrust earthquakes with a Mw>8.0 in the last 300 years. However, the rupture source of the 1771 tsunami has been proposed as an Mw > 8.0 earthquake in the south RT. Based on the dating of tsunami boulders, it has been estimated that large tsunamis occur at intervals of 150-400 years in the south Ryukyu arc (RA) (Araoka et al., 2013), although they have not occurred for several thousand years in the central and northern Ryukyu areas (Goto et al., 2014). To address the discrepancy between recent low moment releases by earthquakes and occurrence of paleo-tsunamis in the RT, we focus on the long-term activity of the very low frequency earthquakes (VLFEs), which are good indicators of the stress release in the shallow plate interface. VLFEs have been detected along the RT (Ando et al., 2012), which occur on the plate interface or at the accretionary prism. We used broadband data from the F-net of NIED along the RT and from the IRIS network. We applied two filters to all the raw broadband seismograms: a 0.02-0.05 Hz band-pass filter and a 1 Hz high-pass filter. After identification of the low-frequency events from the band-pass-filtered seismograms, the local and teleseismic events were removed. Then we picked the arrival time of the maximum amplitude of the surface wave of the VLFEs and determined the epicenters. VLFEs occurred on the RA side within 100 km from the trench axis along the RT. Distribution of the 6670 VLFEs from 2002 to 2013 could be divided to several clusters. Principal large clusters were located at 27.1°-29.0°N, 25.5°-26.6°N, and 122.1°-122.4°E (YA). We found that the VLFEs of the YA are modulated by repeating slow slip events (SSEs) which occur beneath south RA. The activity of the VLFEs increased to two times of its ordinary rate in 15 days after the onset of the SSEs. Activation of the VLFEs could be generated by low stress change of 0.02-20 kPa increase in

  12. Participant-centred active surveillance of adverse events following immunisation: a narrative review.

    Science.gov (United States)

    Cashman, Patrick; Macartney, Kristine; Khandaker, Gulam; King, Catherine; Gold, Michael; Durrheim, David N

    2017-05-01

    The importance of active, participant-centred monitoring of adverse events following immunisation (AEFI) is increasingly recognised as a valuable adjunct to traditional passive AEFI surveillance. The databases OVID Medline and OVID Embase were searched to identify all published articles referring to AEFI. Only studies which sought participant response after vaccination were included. A total of 6060 articles published since the year 2000 were identified. After the application of screening inclusion and exclusion criteria, 25 articles describing 23 post-marketing AEFI systems were identified. Most countries had a single system: Ghana, Japan, China, Korea, Netherlands, Singapore, Brazil, Cambodia, Sri Lanka, Turkey and Cameroon except the USA (2), Canada (4) and Australia (6). Data were collected from participants with and without AEFI in all studies reviewed with denominator data enabling AEFI rate calculations. All studies considered either a single vaccine or specified vaccines or were time limited except one Australian system, which provides continuous automated participant-centred active surveillance of all vaccines. Post-marketing surveillance systems using solicited patient feedback are emerging as a novel AEFI monitoring tool. A number of exploratory systems utilising e-technology have been developed and their potential for scaling up and application in low and middle income countries deserves further investigation. © The Author 2017. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene.

  13. PDGF-receptor beta-targeted adenovirus redirects gene transfer from hepatocytes to activated stellate cells

    NARCIS (Netherlands)

    Schoemaker, Marieke H.; Rots, Marianne G.; Beljaars, Leonie; Ypma, Arjen Y.; Jansen, Peter L. M.; Poelstra, Klaas; Moshage, Albert; Haisma, Hidde J.

    2008-01-01

    Chronic liver damage may lead to liver fibrosis. In this process, hepatic activated stellate cells are the key players. Thus, activated stellate cells are attractive targets for antifibrotic gene therapy. Recombinant, adenovirus is a promising vehicle for delivering therapeutic genes to liver cells.

  14. TALE activators regulate gene expression in a position- and strand-dependent manner in mammalian cells.

    Science.gov (United States)

    Uhde-Stone, Claudia; Cheung, Edna; Lu, Biao

    2014-01-24

    Transcription activator-like effectors (TALEs) are a class of transcription factors that are readily programmable to regulate gene expression. Despite their growing popularity, little is known about binding site parameters that influence TALE-mediated gene activation in mammalian cells. We demonstrate that TALE activators modulate gene expression in mammalian cells in a position- and strand-dependent manner. To study the effects of binding site location, we engineered TALEs customized to recognize specific DNA sequences located in either the promoter or the transcribed region of reporter genes. We found that TALE activators robustly activated reporter genes when their binding sites were located within the promoter region. In contrast, TALE activators inhibited the expression of reporter genes when their binding sites were located on the sense strand of the transcribed region. Notably, this repression was independent of the effector domain utilized, suggesting a simple blockage mechanism. We conclude that TALE activators in mammalian cells regulate genes in a position- and strand-dependent manner that is substantially different from gene activation by native TALEs in plants. These findings have implications for optimizing the design of custom TALEs for genetic manipulation in mammalian cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Presence of activating KRAS mutations correlates significantly with expression of tumour suppressor genes DCN and TPM1 in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Rems Miran

    2009-08-01

    Full Text Available Abstract Background Despite identification of the major genes and pathways involved in the development of colorectal cancer (CRC, it has become obvious that several steps in these pathways might be bypassed by other as yet unknown genetic events that lead towards CRC. Therefore we wanted to improve our understanding of the genetic mechanisms of CRC development. Methods We used microarrays to identify novel genes involved in the development of CRC. Real time PCR was used for mRNA expression as well as to search for chromosomal abnormalities within candidate genes. The correlation between the expression obtained by real time PCR and the presence of the KRAS mutation was investigated. Results We detected significant previously undescribed underexpression in CRC for genes SLC26A3, TPM1 and DCN, with a suggested tumour suppressor role. We also describe the correlation between TPM1 and DCN expression and the presence of KRAS mutations in CRC. When searching for chromosomal abnormalities, we found deletion of the TPM1 gene in one case of CRC, but no deletions of DCN and SLC26A3 were found. Conclusion Our study provides further evidence of decreased mRNA expression of three important tumour suppressor genes in cases of CRC, thus implicating them in the development of this type of cancer. Moreover, we found underexpression of the TPM1 gene in a case of CRCs without KRAS mutations, showing that TPM1 might serve as an alternative path of development of CRC. This downregulation could in some cases be mediated by deletion of the TPM1 gene. On the other hand, the correlation of DCN underexpression with the presence of KRAS mutations suggests that DCN expression is affected by the presence of activating KRAS mutations, lowering the amount of the important tumour suppressor protein decorin.

  16. Cardiovascular events in a physical activity intervention compared with a successful aging intervention: The LIFE Study randomized trial

    Science.gov (United States)

    IMPORTANCE: Whether sustained physical activity prevents cardiovascular disease (CVD) events in older adults is uncertain. OBJECTIVE: To test the hypothesis that cardiovascular morbidity and mortality would be reduced in participants in a long-term physical activity program. DESIGN, SETTING, AND PAR...

  17. Resistance to dual-gene Bt maize in Spodoptera frugiperda: selection, inheritance, and cross-resistance to other transgenic events.

    Science.gov (United States)

    Santos-Amaya, Oscar F; Rodrigues, João V C; Souza, Thadeu C; Tavares, Clébson S; Campos, Silverio O; Guedes, Raul N C; Pereira, Eliseu J G

    2015-12-17

    Transgenic crop "pyramids" producing two or more Bacillus thuringiensis (Bt) toxins active against the same pest are used to delay evolution of resistance in insect pest populations. Laboratory and greenhouse experiments were performed with fall armyworm, Spodoptera frugiperda, to characterize resistance to Bt maize producing Cry1A.105 and Cry2Ab and test some assumptions of the "pyramid" resistance management strategy. Selection of a field-derived strain of S. frugiperda already resistant to Cry1F maize with Cry1A.105 + Cry2Ab maize for ten generations produced resistance that allowed the larvae to colonize and complete the life cycle on these Bt maize plants. Greenhouse experiments revealed that the resistance was completely recessive (Dx = 0), incomplete, autosomal, and without maternal effects or cross-resistance to the Vip3Aa20 toxin produced in other Bt maize events. This profile of resistance supports some of the assumptions of the pyramid strategy for resistance management. However, laboratory experiments with purified Bt toxin and plant leaf tissue showed that resistance to Cry1A.105 + Cry2Ab2 maize further increased resistance to Cry1Fa, which indicates that populations of fall armyworm have high potential for developing resistance to some currently available pyramided maize used against this pest, especially where resistance to Cry1Fa was reported in the field.

  18. Increased anion channel activity is an unavoidable event in ozone-induced programmed cell death.

    Directory of Open Access Journals (Sweden)

    Takashi Kadono

    Full Text Available BACKGROUND: Ozone is a major secondary air pollutant often reaching high concentrations in urban areas under strong daylight, high temperature and stagnant high-pressure systems. Ozone in the troposphere is a pollutant that is harmful to the plant. PRINCIPAL FINDINGS: By exposing cells to a strong pulse of ozonized air, an acute cell death was observed in suspension cells of Arabidopsis thaliana used as a model. We demonstrated that O(3 treatment induced the activation of a plasma membrane anion channel that is an early prerequisite of O(3-induced cell death in A. thaliana. Our data further suggest interplay of anion channel activation with well known plant responses to O(3, Ca(2+ influx and NADPH-oxidase generated reactive oxygen species (ROS in mediating the oxidative cell death. This interplay might be fuelled by several mechanisms in addition to the direct ROS generation by O(3; namely, H(2O(2 generation by salicylic and abscisic acids. Anion channel activation was also shown to promote the accumulation of transcripts encoding vacuolar processing enzymes, a family of proteases previously reported to contribute to the disruption of vacuole integrity observed during programmed cell death. SIGNIFICANCE: Collectively, our data indicate that anion efflux is an early key component of morphological and biochemical events leading to O(3-induced programmed cell death. Because ion channels and more specifically anion channels assume a crucial position in cells, an understanding about the underlying role(s for ion channels in the signalling pathway leading to programmed cell death is a subject that warrants future investigation.

  19. Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

    Science.gov (United States)

    Boulila, Moncef

    2010-06-01

    To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

  20. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  1. Blood troponin levels in acute cardiac events depends on space weather activity components (a correlative study).

    Science.gov (United States)

    Stoupel, Eliiyahu; Radishauskas, Richardas; Bernotiene, Gailute; Tamoshiunas, Abdonas; Virvichiute, Daiva

    2018-02-05

    Many biological processes are influenced by space weather activity components such as solar activity (SA), geomagnetic activity (GMA) and cosmic ray activity (CRA). Examples are total mortality, acute myocardial infarction (AMI), stroke (cerebrovascular accident), sudden cardiac death, some congenital maladies (congenital heart disease and Down syndrome), many events in neonatology, ophtalmology, blood pressure regulation, blood coagulation, inflammation, etc. The aim of this study was to check if the level of blood troponins (Tns) - markers of myocardial damage and recognized components of modern description of AMI - is connected with the mentioned space weather parameters. Patients admitted to a 3000-bed tertiary university hospital in Kaunas, Lithuania, with suspected AMI were the object of the study. Data for the time between 2008 and 2013 - 72 consecutive months - were studied. Of the patients, 1896 (1398 male, 498 female) had elevated troponin I (Tn I) or troponin T (Tn T, sensitive Tn) levels. Normal values were 0.00-0.03 ng/mL for Tn I and 0.00-14.00 ng/mL for Tn T. Monthly means and standard deviation of Tn I and Tn T were compared with monthly markers of SA, GMA and CRA. Pearson correlation coefficients and their probabilities were established (in addition to the consecutive graphs of both comparing physical and biological data). The cosmophysical data came from space service institutions in the United States, Russia and Finland. AMI was diagnosed in 1188 patients (62.66%), and intermediate coronary syndrome in 698 patients (36.81%). There were significant links of the Tn blood levels with four SA indices and CRA (neutron activity in imp/min); there was no significant correlation with GMA indices Ap and Cp (p=0.27 and p=0.235). Tn T levels significantly correlated with the GMA indices and not with the SA and CRA levels (Ap: r=0.77, p=0.0021; Cp: r=0.729, p=0.0047). First, the monthly level of blood Tn I in ACS is significantly correlated with the indices

  2. Activating human genes with zinc finger proteins, transcription activator-like effectors and CRISPR/Cas9 for gene therapy and regenerative medicine.

    Science.gov (United States)

    Gersbach, Charles A; Perez-Pinera, Pablo

    2014-08-01

    New technologies have recently been developed to control the expression of human genes in their native genomic context by engineering synthetic transcription factors that can be targeted to any DNA sequence. The ability to precisely regulate any gene as it occurs naturally in the genome provides a means to address a variety of diseases and disorders. This approach also circumvents some of the traditional challenges of gene therapy. In this editorial, we review the technologies that have enabled targeted human gene activation, including the engineering of transcription factors based on zinc finger proteins, transcription activator-like effectors and the CRISPR/Cas9 system. Additionally, we highlight examples in which these methods have been developed for therapeutic applications and discuss challenges and opportunities.

  3. High-intensity, long-duration, continuous AE activity events associated with Alfvénic fluctuations in 2003

    Science.gov (United States)

    Prestes, Alan; Klausner, Virginia; Ojeda-González, Arian

    2017-11-01

    The interaction between a fast-speed and a low-speed stream causes large-amplitude Alfvénic fluctuations; consequently, the intermittency and the brief intervals of southward magnetic field associated with Alfvén waves may cause high levels of AE activity, the so-called high-intensity, long-duration, continuous AE activity (HILDCAA). In this article, the 4 h windowed Pearson cross-correlation (4WPCC) between the solar wind velocity and the interplanetary magnetic field (IMF) components is performed in order to confirm that the less strict HILDCAA (HILDCAAs*) events include a larger number of Alfvén waves than the HILDCAA events, once HILDCAAs disregard part of the phenomenon. Actually, a HILDCAA event is entirely contained within a HILDCAA* event. However, the opposite is not necessarily true. This article provides a new insight, since the increase of Alfvén waves results in an increase of auroral electrojet activity; consequently, it can cause HILDCAAs* events. Another important aspect of this article is that the superposed epoch analysis (SEA) results reaffirm that the HILDCAAs* are associated with high-speed solar streams (HSSs), and also the HILDCAAs* present the same physical characteristics of the traditional HILDCAA events.

  4. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  5. Gene expression profiling in cells with enhanced gamma-secretase activity.

    Directory of Open Access Journals (Sweden)

    Alexandra I Magold

    2009-09-01

    Full Text Available Processing by gamma-secretase of many type-I membrane protein substrates triggers signaling cascades by releasing intracellular domains (ICDs that, following nuclear translocation, modulate the transcription of different genes regulating a diverse array of cellular and biological processes. Because the list of gamma-secretase substrates is growing quickly and this enzyme is a cancer and Alzheimer's disease therapeutic target, the mapping of gamma-secretase activity susceptible gene transcription is important for sharpening our view of specific affected genes, molecular functions and biological pathways.To identify genes and molecular functions transcriptionally affected by gamma-secretase activity, the cellular transcriptomes of Chinese hamster ovary (CHO cells with enhanced and inhibited gamma-secretase activity were analyzed and compared by cDNA microarray. The functional clustering by FatiGO of the 1,981 identified genes revealed over- and under-represented groups with multiple activities and functions. Single genes with the most pronounced transcriptional susceptibility to gamma-secretase activity were evaluated by real-time PCR. Among the 21 validated genes, the strikingly decreased transcription of PTPRG and AMN1 and increased transcription of UPP1 potentially support data on cell cycle disturbances relevant to cancer, stem cell and neurodegenerative diseases' research. The mapping of interactions of proteins encoded by the validated genes exclusively relied on evidence-based data and revealed broad effects on Wnt pathway members, including WNT3A and DVL3. Intriguingly, the transcription of TERA, a gene of unknown function, is affected by gamma-secretase activity and was significantly altered in the analyzed human Alzheimer's disease brain cortices.Investigating the effects of gamma-secretase activity on gene transcription has revealed several affected clusters of molecular functions and, more specifically, 21 genes that hold significant

  6. Antisense long noncoding RNAs regulate var gene activation in the malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Amit-Avraham, Inbar; Pozner, Guy; Eshar, Shiri; Fastman, Yair; Kolevzon, Netanel; Yavin, Eylon; Dzikowski, Ron

    2015-03-03

    The virulence of Plasmodium falciparum, the causative agent of the deadliest form of human malaria, is attributed to its ability to evade human immunity through antigenic variation. These parasites alternate between expression of variable antigens, encoded by members of a multicopy gene family named var. Immune evasion through antigenic variation depends on tight regulation of var gene expression, ensuring that only a single var gene is expressed at a time while the rest of the family is maintained transcriptionally silent. Understanding how a single gene is chosen for activation is critical for understanding mutually exclusive expression but remains a mystery. Here, we show that antisense long noncoding RNAs (lncRNAs) initiating from var introns are associated with the single active var gene at the time in the cell cycle when the single var upstream promoter is active. We demonstrate that these antisense transcripts are incorporated into chromatin, and that expression of these antisense lncRNAs in trans triggers activation of a silent var gene in a sequence- and dose-dependent manner. On the other hand, interference with these lncRNAs using complement peptide nucleic acid molecules down-regulated the active var gene, erased the epigenetic memory, and induced expression switching. Altogether, our data provide evidence that these antisense lncRNAs play a key role in regulating var gene activation and mutually exclusive expression.

  7. Event based neutron activation spectroscopy and analysis algorithm using MLE and meta-heuristics

    International Nuclear Information System (INIS)

    Wallace, B.

    2014-01-01

    Techniques used in neutron activation analysis are often dependent on the experimental setup. In the context of developing a portable and high efficiency detection array, good energy resolution and half-life discrimination are difficult to obtain with traditional methods given the logistic and financial constraints. An approach different from that of spectrum addition and standard spectroscopy analysis was needed. The use of multiple detectors prompts the need for a flexible storage of acquisition data to enable sophisticated post processing of information. Analogously to what is done in heavy ion physics, gamma detection counts are stored as two-dimensional events. This enables post-selection of energies and time frames without the need to modify the experimental setup. This method of storage also permits the use of more complex analysis tools. Given the nature of the problem at hand, a light and efficient analysis code had to be devised. A thorough understanding of the physical and statistical processes involved was used to create a statistical model. Maximum likelihood estimation was combined with meta-heuristics to produce a sophisticated curve-fitting algorithm. Simulated and experimental data were fed into the analysis code prompting positive results in terms of half-life discrimination, peak identification and noise reduction. The code was also adapted to other fields of research such as heavy ion identification of the quasi-target (QT) and quasi-particle (QP). The approach used seems to be able to translate well into other fields of research. (author)

  8. Hepatic adverse events during highly active antiretroviral therapy containing nevirapine: a case report

    Directory of Open Access Journals (Sweden)

    Yamazhan Tansu

    2002-09-01

    Full Text Available Abstract Background Hepatotoxicity is one of the most serious complications of highly active antiretroviral therapy (HAART. The aim of this report is to analyse an HIV infected patient on HAART including nevirapine and taking antidepressive agents, with acute toxic hepatitis. Case presentation A 39 year old patient diagnosed as HIV positive one month ago administered to the clinical ward of the Department of Infectious Diseases and Clinical Microbiology in Ege University Medical School with high fever, malaise, nausea, diarrheae and elevated liver enzymes (ALT 1558 U/L, AST 4288 U/L. He has been using HAART including zidovudine+lamivudine (2 × 1/day and nevirapine (2 × 200 mg/day, following dose escalation for 22 days, sertralin and diazepam for 12 days and lithium for 10 days. The patient was hospitalized. Antiretroviral and antidepressant treatments were stopped. The day after admission, his fever dropped and his symptoms improved. Clinical improvement continued on the following days. The patient was discharged upon his request on the 14th day of hospitalization. The liver function tests returned to normal levels in two weeks following discharge. Conclusion Close monitoring of liver enzymes during the first 12 weeks of nevirapine therapy is critical to prevent life threatening events.

  9. Event based neutron activation spectroscopy and analysis algorithm using MLE and metaheuristics

    Science.gov (United States)

    Wallace, Barton

    2014-03-01

    Techniques used in neutron activation analysis are often dependent on the experimental setup. In the context of developing a portable and high efficiency detection array, good energy resolution and half-life discrimination are difficult to obtain with traditional methods [1] given the logistic and financial constraints. An approach different from that of spectrum addition and standard spectroscopy analysis [2] was needed. The use of multiple detectors prompts the need for a flexible storage of acquisition data to enable sophisticated post processing of information. Analogously to what is done in heavy ion physics, gamma detection counts are stored as two-dimensional events. This enables post-selection of energies and time frames without the need to modify the experimental setup. This method of storage also permits the use of more complex analysis tools. Given the nature of the problem at hand, a light and efficient analysis code had to be devised. A thorough understanding of the physical and statistical processes [3] involved was used to create a statistical model. Maximum likelihood estimation was combined with metaheuristics to produce a sophisticated curve-fitting algorithm. Simulated and experimental data were fed into the analysis code prompting positive results in terms of half-life discrimination, peak identification and noise reduction. The code was also adapted to other fields of research such as heavy ion identification of the quasi-target (QT) and quasi-particle (QP). The approach used seems to be able to translate well into other fields of research.

  10. Life-threatening event reduces subjective well-being through activating avoidance motivation: a longitudinal study.

    Science.gov (United States)

    Van Dijk, Dina; Seger-Guttmann, Tali; Heller, Daniel

    2013-04-01

    Drawing on the approach-avoidance theory, we have examined the role of avoidance motivation in explaining the negative effects of a life-threatening event on subjective well-being (SWB). Residents of the south of Israel were surveyed during heavy missile attacks in January 2009 (T1; n = 283), and again after 6 months (T2; n = 212) and 1 year (T3; n = 154). During the missile attacks, we also surveyed a group from the center of the country (T1; n = 102), not exposed to the attacks. The results indicate that avoidance motivation was activated by the life threat and further mediated its detrimental influence on SWB measures (positive/negative affects, anxiety, and subjective health). Moreover, within the southern sample, the drop in avoidance motivation over time mediated the parallel drop in SWB. In contrast to avoidance motivation, approach motivation remained stable over time and was related to positive emotions. The role of avoidance and approach motivations in life-threatening situations is further discussed. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  11. Effects of subtherapeutic concentrations of antimicrobials on gene acquisition events in Yersinia, Proteus, Shigella, and Salmonella recipient organisms in isolated ligated intestinal loops of swine.

    Science.gov (United States)

    Brewer, Matt T; Xiong, Nalee; Anderson, Kristi L; Carlson, Steve A

    2013-08-01

    To assess antimicrobial resistance and transfer of virulence genes facilitated by subtherapeutic concentrations of antimicrobials in swine intestines. 20 anesthetized pigs experimentally inoculated with donor and recipient bacteria. 4 recipient pathogenic bacteria (Salmonella enterica serotype Typhimurium, Yersinia enterocolitica, Shigella flexneri, or Proteus mirabilis) were incubated with donor bacteria in the presence of subinhibitory concentrations of 1 of 16 antimicrobials in isolated ligated intestinal loops in swine. Donor Escherichia coli contained transferrable antimicrobial resistance or virulence genes. After coincubations, intestinal contents were removed and assessed for pathogens that acquired new antimicrobial resistance or virulence genes following exposure to the subtherapeutic concentrations of antimicrobials. 3 antimicrobials (apramycin, lincomycin, and neomycin) enhanced transfer of an antimicrobial resistance plasmid from commensal E coli organisms to Yersinia and Proteus organisms, whereas 7 antimicrobials (florfenicol, hygromycin, penicillin G, roxarsone, sulfamethazine, tetracycline, and tylosin) exacerbated transfer of an integron (Salmonella genomic island 1) from Salmonella organisms to Yersinia organisms. Sulfamethazine induced the transfer of Salmonella pathogenicity island 1 from pathogenic to nonpathogenic Salmonella organisms. Six antimicrobials (bacitracin, carbadox, erythromycin, sulfathiazole, tiamulin, and virginiamycin) did not mediate any transfer events. Sulfamethazine was the only antimicrobial implicated in 2 types of transfer events. 10 of 16 antimicrobials at subinhibitory or subtherapeutic concentrations augmented specific antimicrobial resistance or transfer of virulence genes into pathogenic bacteria in isolated intestinal loops in swine. Use of subtherapeutic antimicrobials in animal feed may be associated with unwanted collateral effects.

  12. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  13. Active versus passive adverse event reporting after pediatric chiropractic manual therapy: study protocol for a cluster randomized controlled trial.

    Science.gov (United States)

    Pohlman, Katherine A; Carroll, Linda; Tsuyuki, Ross T; Hartling, Lisa; Vohra, Sunita

    2017-12-01

    Patient safety performance can be assessed with several systems, including passive and active surveillance. Passive surveillance systems provide opportunity for health care personnel to confidentially and voluntarily report incidents, including adverse events, occurring in their work environment. Active surveillance systems systematically monitor patient encounters to seek detailed information about adverse events that occur in work environments; unlike passive surveillance, active surveillance allows for collection of both numerator (number of adverse events) and denominator (number of patients seen) data. Chiropractic manual therapy is commonly used in both adults and children, yet few studies have been done to evaluate the safety of chiropractic manual therapy for children. In an attempt to evaluate this, this study will compare adverse event reporting in passive versus active surveillance systems after chiropractic manual therapy in the pediatric population. This cluster randomized controlled trial aims to enroll 70 physicians of chiropractic (unit of randomization) to either passive or active surveillance system to report adverse events that occur after treatment for 60 consecutive pediatric (13 years of age and younger) patient visits (unit of analysis). A modified enrollment process with a two-phase consent procedure will be implemented to maintain provider blinding and minimize dropouts. The first phase of consent is for the provider to confirm their interest in a trial investigating the safety of chiropractic manual therapy. The second phase ensures that they understand the specific requirements for the group to which they were randomized. Percentages, incidence estimates, and 95% confidence intervals will be used to describe the count of reported adverse events in each group. The primary outcome will be the number and quality of the adverse event reports in the active versus the passive surveillance group. With 80% power and 5% one-sided significance

  14. The relationship of lightning activity and short-duration rainfall events during warm seasons over the Beijing metropolitan region

    Science.gov (United States)

    Wu, Fan; Cui, Xiaopeng; Zhang, Da-Lin; Qiao, Lin

    2017-10-01

    The relationship between lightning activity and rainfall associated with 2925 short-duration rainfall (SDR) events over the Beijing metropolitan region (BMR) is examined during the warm seasons of 2006-2007, using the cloud-to-ground (CG) and intracloud (IC) lightning data from Surveillance et Alerte Foudre par Interférometrie Radioélectrique (SAFIR)-3000 and 5-min rainfall data from automatic weather stations (AWSs). An optimal radius of 10 km around selected AWSs is used to determine the lightning-rainfall relationship. The lightning-rainfall correlations vary significantly, depending upon the intensity of SDR events. That is, correlation coefficient (R 0.7) for the short-duration heavy rainfall (SDHR, i.e., ≥ 20 mm h- 1) events is found higher than that (R 0.4) for the weak SDR (i.e., 5-10 mm h- 1) events, and lower percentage of the SDHR events (< 10%) than the weak SDR events (40-50%) are observed with few flashes. Significant time-lagged correlations between lightning and rainfall are also found. About 80% of the SDR events could reach their highest correlation coefficients when the associated lightning flashes shift at time lags of < 25 min before and after rainfall begins. Those events with lightning preceding rainfall account for 50-60% of the total SDR events. Better lightning-rainfall correlations can be attained when time lags are incorporated, with the use of total (CG and IC) lightning data. These results appear to have important implications for improving the nowcast of SDHR events.

  15. Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity.

    Science.gov (United States)

    Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio

    2014-11-07

    Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and

  16. Lightning activity, rainfall and flash flooding – occasional or interrelated events? A case study in the island of Crete

    Directory of Open Access Journals (Sweden)

    A. G. Koutroulis

    2012-04-01

    Full Text Available The majority of cyclones passing over Crete in late autumn to early winter originate from southwest, west and northwest and are of varying size and intensity. A number of these cyclones cause flash floods. The present study reports the possible relationships between lighting activity and high precipitation related to flash flood events. In this study an attempt was made to correlate the lightning number and location, recorded by the ZEUS lightning detection system, with the rainfall characteristics for sixteen rain events (4 flood and 12 non-flood events on the island of Crete, during the period 2008–2009. Spatiotemporal analysis of rain and rain rate with flash count was performed with respect to distance (radius of flashes from raingauge location at various temporal scales, in order to examine the correlation of accumulated rainfall and lightning activity. The maximum attained statistical significant correlation was obtained within a circular area of an average radius of 15 km around the raingauge, and an average time lag of flash count prior precipitation accumulation of 15 min. The maximum correlation between the lightning and rainfall data is obtained for shorter time lags for the flood events (15 min than the non-flood events (25 min, that could reflect the faster propagation of flood triggering storms due to high convective activity. Results show increased lightning activity occurring during flood triggering storms, by an average of four times higher. Furthermore, there is evidence that the number of flashes that occur during a precipitation event is related to precipitation depth when the latter is adequate to produce a flood event. Differences between flood and non-flood producing storms need to be further assessed by analyzing more independent parameters, including the synoptic conditions and dominant flash flood hydrological generating processes.

  17. Dopamine transporter gene variation modulates activation of striatum in youth with ADHD.

    Science.gov (United States)

    Bédard, Anne-Claude; Schulz, Kurt P; Cook, Edwin H; Fan, Jin; Clerkin, Suzanne M; Ivanov, Iliyan; Halperin, Jeffrey M; Newcorn, Jeffrey H

    2010-11-15

    Polymorphisms in the 3'UTR variable number tandem repeat (VNTR) of exon 15 of the dopamine transporter gene (DAT1) have been linked to attention-deficit hyperactivity disorder (ADHD); moreover, variability in DAT1 3'UTR genotype may contribute to both heterogeneity of the ADHD phenotype and differences in response to stimulant medications. The impact of this VNTR on neuronal function in individuals with ADHD remains unclear despite evidence that the polymorphisms influence dopamine transporter expression. Thus, we used event-related functional magnetic resonance imaging to examine the impact of DAT1 3'UTR genotype on brain activation during response inhibition in unmedicated children and adolescents with ADHD. Twenty-one youth with ADHD who were homozygous for the 10-repeat (10R) allele of the DAT1 3'UTR and 12 youth who were carriers of the 9-repeat (9R) allele were scanned while they performed a Go/No-Go task. Response inhibition was modeled by contrasting activation during correct No-Go trials versus correct Go trials. Participants who were homozygous for the DAT1 3'UTR 10R allele and those who had a single 9R allele did not differ on percent of trials with successful inhibition, which was the primary measure of inhibitory control. Yet, youth with the DAT1 3'UTR 10R/10R genotype had significantly greater inhibitory control-related activation than those with one 9R allele in the left striatum, right dorsal premotor cortex, and bilaterally in the temporoparietal cortical junction. These findings provide preliminary evidence that neural activity related to inhibitory control may differ as a function of DAT1 3'UTR genotype in youth with ADHD. Copyright 2009 Elsevier Inc. All rights reserved.

  18. Impact of physical activity and doping on epigenetic gene regulation.

    Science.gov (United States)

    Schwarzenbach, Heidi

    2011-10-01

    To achieve success in sports, many athletes consume doping substances, such as anabolic androgenic steroids and growth hormones, and ignore the negative influence of these drugs on their health. Apart from the unethical aspect of doping in sports, it is essential to consider the tremendous risk it represents to their physical condition. The abuse of pharmaceuticals which improve athletic performance may alter the expression of specific genes involved in muscle and bone metabolism by epigenetic mechanisms, such as DNA methylation and histone modifications. Moreover, excessive and relentless training to increase the muscle mass, may also have an influence on the health of the athletes. This stress releases neurotransmitters and growth factors, and may affect the expression of endogenous genes by DNA methylation, too. This paper focuses on the relationship between epigenetic mechanisms and sports, highlights the potential consequences of abuse of doping drugs on gene expression, and describes methods to molecularly detect epigenetic changes of gene markers reflecting the physiological or metabolic effects of doping agents. Copyright © 2011 John Wiley & Sons, Ltd.

  19. Phenylalanine ammonia-lyase (PAL) gene activity in response to ...

    African Journals Online (AJOL)

    Phenylalanine ammonia-lyase (PAL) catalyzes the biosynthesis of rosmarinic acid (RA), tyrosine and phenylalanine are the precursors of RA, while proline drives metabolite precursors toward Shikimate and phenylpropanoid pathway ending with the production of RA. The aim of this study was to investigate the PAL gene ...

  20. Active Construction of Profession-Related Events: The Priming Effect among Pre-service Teachers with Different Professional Identity.

    Science.gov (United States)

    Wang, Xin-Qiang; Zhu, Jun-Cheng; Liu, Lu; Chen, Xiang-Yu; Huo, Jun-Yu

    2018-01-01

    Pre-service teachers with different professional identity may actively construct different subjective profession-related events based on the same objective profession-related events. To explore the priming effect among pre-service teachers with different professional identity, this study examined the effect of positive, negative, or neutral priming sentences in an individualized narration of profession-related events through a priming paradigm. Forty-two female volunteers were asked to complete positive, negative, and neutral priming sentences describing profession-related events. The results showed that, relative to those with weak professional identity, participants with strong professional identity generated a higher number of positive items when primed with different stimuli and displayed greater positive priming bias for positive and neutral stimuli. In addition, relative to those with strong professional identity, participants with weak professional identity generated a higher number of neutral and negative items when primed with positive and negative stimuli, respectively, and displayed greater negative priming bias toward negative stimuli. These results indicate that pre-service teachers with strong professional identity were likely to have established positive self-schemas involving profession-related events, which facilitated active, positive construction of such events.

  1. Active Construction of Profession-Related Events: The Priming Effect among Pre-service Teachers with Different Professional Identity

    Directory of Open Access Journals (Sweden)

    Xin-qiang Wang

    2018-02-01

    Full Text Available Pre-service teachers with different professional identity may actively construct different subjective profession-related events based on the same objective profession-related events. To explore the priming effect among pre-service teachers with different professional identity, this study examined the effect of positive, negative, or neutral priming sentences in an individualized narration of profession-related events through a priming paradigm. Forty-two female volunteers were asked to complete positive, negative, and neutral priming sentences describing profession-related events. The results showed that, relative to those with weak professional identity, participants with strong professional identity generated a higher number of positive items when primed with different stimuli and displayed greater positive priming bias for positive and neutral stimuli. In addition, relative to those with strong professional identity, participants with weak professional identity generated a higher number of neutral and negative items when primed with positive and negative stimuli, respectively, and displayed greater negative priming bias toward negative stimuli. These results indicate that pre-service teachers with strong professional identity were likely to have established positive self-schemas involving profession-related events, which facilitated active, positive construction of such events.

  2. Differences between Dorsal and Ventral Striatum in the Sensitivity of Tonically Active Neurons to Rewarding Events

    Directory of Open Access Journals (Sweden)

    Kevin Marche

    2017-07-01

    Full Text Available Within the striatum, cholinergic interneurons, electrophysiologically identified as tonically active neurons (TANs, represent a relatively homogeneous group in terms of their functional properties. They display typical pause in tonic firing in response to rewarding events which are of crucial importance for reinforcement learning. These responses are uniformly distributed throughout the dorsal striatum (i.e., motor and associative striatum, but it is unknown, at least in monkeys, whether differences in the modulation of TAN activity exist in the ventral striatum (i.e., limbic striatum, a region specialized for processing of motivational information. To address this issue, we examined the activity of dorsal and ventral TANs in two monkeys trained on a Pavlovian conditioning task in which a visual stimulus preceded the delivery of liquid reward by a fixed time interval. We found that the proportion of TANs responding to the stimulus predictive of reward did not vary significantly across regions (58%–80%, whereas the fraction of TANs responding to reward was higher in the limbic striatum (100% compared to the motor (65% and associative striatum (52%. By examining TAN modulation at the level of both the population and the individual neurons, we showed that the duration of pause responses to the stimulus and reward was longer in the ventral than in the dorsal striatal regions. Also, the magnitude of the pause was greater in ventral than dorsal striatum for the stimulus predictive of reward but not for the reward itself. We found similar region-specific differences in pause response duration to the stimulus when the timing of reward was less predictable (fixed replaced by variable time interval. Regional variations in the duration and magnitude of the pause response were transferred from the stimulus to reward when reward was delivered in the absence of any predictive stimulus. It therefore appears that ventral TANs exhibit stronger responses to

  3. Process and genes for expression and overexpression of active [FeFe] hydrogenases

    Science.gov (United States)

    Seibert, Michael; King, Paul W; Ghirardi, Maria Lucia; Posewitz, Matthew C; Smolinski, Sharon L

    2014-09-16

    A process for expression of active [FeFe]-hydrogenase in a host organism that does not contain either the structural gene(s) for [FeFe]-hydrogenases and/or homologues for the maturation genes HydE, HydF and HyG, comprising: cloning the structural hydrogenase gene(s) and/or the maturation genes HydE, HydF and HydG from an organisms that contains these genes into expression plasmids; transferring the plasmids into an organism that lacks a native [FeFe]-hydrogenase or that has a disrupted [FeFe]-hydrogenase and culturing it aerobically; and inducing anaerobiosis to provide [FeFe] hydrogenase biosynthesis and H?2#191 production.

  4. Interactions between the vascular endothelial growth factor gene polymorphism and life events in susceptibility to major depressive disorder in a Chinese population.

    Science.gov (United States)

    Han, Dong; Qiao, Zhengxue; Chen, Lu; Qiu, Xiaohui; Fang, Deyu; Yang, Xiuxian; Ma, Jingsong; Chen, Mingqi; Yang, Jiarun; Wang, Lin; Zhu, Xiongzhao; Zhang, Congpei; Yang, Yanjie; Pan, Hui

    2017-08-01

    Recent studies suggest that vascular endothelial growth factor (VEGF) is involved in the development of major depressive disorder. The aim of this study is to investigate the interaction between vascular endothelial growth factor (VEGF) polymorphism (+405G/C, rs2010963) and negative life events in the pathogenesis of major depressive disorder (MDD). DNA genotyping was performed on peripheral blood leukocytes in 274 patients with MDD and 273 age-and sex-matched controls. The frequency and severity of negative life events were assessed by the Life Events Scale (LES). A logistics method was employed to assess the gene-environment interaction (G×E). Differences in rs2010963 genotype distributions were observed between MDD patients and controls. Significant G×E interactions between allelic variation of rs2010963 and negative life events were observed. Individuals carrying the C alleles were susceptible to MDD only when exposed to high-negative life events. These results indicate that interactions between the VEGF rs2010963 polymorphism and environment increases the risk of developing MDD. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. BRAIN NETWORKS. Correlated gene expression supports synchronous activity in brain networks.

    Science.gov (United States)

    Richiardi, Jonas; Altmann, Andre; Milazzo, Anna-Clare; Chang, Catie; Chakravarty, M Mallar; Banaschewski, Tobias; Barker, Gareth J; Bokde, Arun L W; Bromberg, Uli; Büchel, Christian; Conrod, Patricia; Fauth-Bühler, Mira; Flor, Herta; Frouin, Vincent; Gallinat, Jürgen; Garavan, Hugh; Gowland, Penny; Heinz, Andreas; Lemaître, Hervé; Mann, Karl F; Martinot, Jean-Luc; Nees, Frauke; Paus, Tomáš; Pausova, Zdenka; Rietschel, Marcella; Robbins, Trevor W; Smolka, Michael N; Spanagel, Rainer; Ströhle, Andreas; Schumann, Gunter; Hawrylycz, Mike; Poline, Jean-Baptiste; Greicius, Michael D

    2015-06-12

    During rest, brain activity is synchronized between different regions widely distributed throughout the brain, forming functional networks. However, the molecular mechanisms supporting functional connectivity remain undefined. We show that functional brain networks defined with resting-state functional magnetic resonance imaging can be recapitulated by using measures of correlated gene expression in a post mortem brain tissue data set. The set of 136 genes we identify is significantly enriched for ion channels. Polymorphisms in this set of genes significantly affect resting-state functional connectivity in a large sample of healthy adolescents. Expression levels of these genes are also significantly associated with axonal connectivity in the mouse. The results provide convergent, multimodal evidence that resting-state functional networks correlate with the orchestrated activity of dozens of genes linked to ion channel activity and synaptic function. Copyright © 2015, American Association for the Advancement of Science.

  6. A Cbx8-containing polycomb complex facilitates the transition to gene activation during ES cell differentiation.

    Directory of Open Access Journals (Sweden)

    Catherine Creppe

    2014-12-01

    Full Text Available Polycomb proteins play an essential role in maintaining the repression of developmental genes in self-renewing embryonic stem cells. The exact mechanism allowing the derepression of polycomb target genes during cell differentiation remains unclear. Our project aimed to identify Cbx8 binding sites in differentiating mouse embryonic stem cells. Therefore, we used a genome-wide chromatin immunoprecipitation of endogenous Cbx8 coupled to direct massive parallel sequencing (ChIP-Seq. Our analysis identified 171 high confidence peaks. By crossing our data with previously published microarray analysis, we show that several differentiation genes transiently recruit Cbx8 during their early activation. Depletion of Cbx8 partially impairs the transcriptional activation of these genes. Both interaction analysis, as well as chromatin immunoprecipitation experiments support the idea that activating Cbx8 acts in the context of an intact PRC1 complex. Prolonged gene activation results in eviction of PRC1 despite persisting H3K27me3 and H2A ubiquitination. The composition of PRC1 is highly modular and changes when embryonic stem cells commit to differentiation. We further demonstrate that the exchange of Cbx7 for Cbx8 is required for the effective activation of differentiation genes. Taken together, our results establish a function for a Cbx8-containing complex in facilitating the transition from a Polycomb-repressed chromatin state to an active state. As this affects several key regulatory differentiation genes this mechanism is likely to contribute to the robust execution of differentiation programs.

  7. Activation and clustering of a Plasmodium falciparum var gene are affected by subtelomeric sequences.

    Science.gov (United States)

    Duffy, Michael F; Tang, Jingyi; Sumardy, Fransisca; Nguyen, Hanh H T; Selvarajah, Shamista A; Josling, Gabrielle A; Day, Karen P; Petter, Michaela; Brown, Graham V

    2017-01-01

    The Plasmodium falciparum var multigene family encodes the cytoadhesive, variant antigen PfEMP1. P. falciparum antigenic variation and cytoadhesion specificity are controlled by epigenetic switching between the single, or few, simultaneously expressed var genes. Most var genes are maintained in perinuclear clusters of heterochromatic telomeres. The active var gene(s) occupy a single, perinuclear var expression site. It is unresolved whether the var expression site forms in situ at a telomeric cluster or whether it is an extant compartment to which single chromosomes travel, thus controlling var switching. Here we show that transcription of a var gene did not require decreased colocalisation with clusters of telomeres, supporting var expression site formation in situ. However following recombination within adjacent subtelomeric sequences, the same var gene was persistently activated and did colocalise less with telomeric clusters. Thus, participation in stable, heterochromatic, telomere clusters and var switching are independent but are both affected by subtelomeric sequences. The var expression site colocalised with the euchromatic mark H3K27ac to a greater extent than it did with heterochromatic H3K9me3. H3K27ac was enriched within the active var gene promoter even when the var gene was transiently repressed in mature parasites and thus H3K27ac may contribute to var gene epigenetic memory. © 2016 Federation of European Biochemical Societies.

  8. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    Energy Technology Data Exchange (ETDEWEB)

    Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia); Slamka, Tomas; Martinicky, David; Ilencikova, Denisa [National Cancer Institute, Department of Oncologic Genetics, Klenova 1, 833 01 Bratislava (Slovakia); Bartosova, Zdena [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia)

    2009-11-20

    Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or

  9. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    Directory of Open Access Journals (Sweden)

    Ilencikova Denisa

    2009-11-01

    Full Text Available Abstract Background Depending on the population studied, large genomic rearrangements (LGRs of the mismatch repair (MMR genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC. It has been reported that loss of heterozygosity (LOH at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. Methods The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. Results We found six rearrangements in the MSH2 gene (five deletions and dup5-6, and one aberration in the MLH1 gene (del5-6. The MSH2 deletions were of three types (del1, del1-3, del1-7. We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. Conclusion LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1

  10. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    International Nuclear Information System (INIS)

    Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova; Slamka, Tomas; Martinicky, David; Ilencikova, Denisa; Bartosova, Zdena

    2009-01-01

    Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or

  11. Gene conversion of ribosomal DNA in Nicotiana tabacum is associated with undermethylated, decondensed and probably active gene units.

    Science.gov (United States)

    Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R

    2000-06-01

    We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N

  12. Behavioral activation for dementia caregivers: scheduling pleasant events and enhancing communications

    Directory of Open Access Journals (Sweden)

    Au A

    2015-03-01

    Full Text Available Alma Au,1,2 Dolores Gallagher-Thompson,3 Meng-Kong Wong,4 Jess Leung,4 Wai-Chi Chan,5 Chun Chung Chan,6 Hui-Jing Lu,1 Man Kin Lai,1 Kevin Chan11Department of Applied Social Sciences, 2Institute of Active Aging, The Hong Kong Polytechnic University, Hong Kong, People’s Republic of China; 3Department of Psychiatry and Behavioral Sciences and Geriatric Education Centre, School of Medicine, Stanford University, Stanford, CA, USA; 4Department of Psychiatry, United Christian Hospital, 5Department of Psychiatry, University of Hong Kong, 6Department of Medicine and Geriatrics, United Christian Hospital, Hong Kong, People’s Republic of ChinaBackground: Dementia caregiving is often associated with increase in depressive symptoms and strained relationships. This study tested whether telephone-delivered psychoeducation combined with an enhanced behavioral activation (BA module had a better effect on the well-being of Alzheimer’s caregivers than psychoeducation alone. The focus is on enhancing the competent use of coping skills via BA. The program is delivered by telephone to increase accessibility and sustainability for caregivers. Senior citizens are trained as paraprofessionals to deliver the BA module to increase the potential for sustainability of the program.Methods and subjects: The study compared two telephone interventions using a 4-month longitudinal randomized controlled trial. For the first 4 weeks, all participants received the same psychoeducation program via telephone. Then for the following 4 months, eight biweekly telephone follow-up calls were carried out. For these eight follow-up calls, participants were randomized into either one of the two following groups with different conditions. For the psychoeducation with BA (PsyED-BA group, participants received eight biweekly sessions of BA practice focused on pleasant event scheduling and improving communications. For the psychoeducation only (PsyED only group, participants received

  13. Annotating activation/inhibition relationships to protein-protein interactions using gene ontology relations.

    Science.gov (United States)

    Yim, Soorin; Yu, Hasun; Jang, Dongjin; Lee, Doheon

    2018-04-11

    Signaling pathways can be reconstructed by identifying 'effect types' (i.e. activation/inhibition) of protein-protein interactions (PPIs). Effect types are composed of 'directions' (i.e. upstream/downstream) and 'signs' (i.e. positive/negative), thereby requiring directions as well as signs of PPIs to predict signaling events from PPI networks. Here, we propose a computational method for systemically annotating effect types to PPIs using relations between functional information of proteins. We used regulates, positively regulates, and negatively regulates relations in Gene Ontology (GO) to predict directions and signs of PPIs. These relations indicate both directions and signs between GO terms so that we can project directions and signs between relevant GO terms to PPIs. Independent test results showed that our method is effective for predicting both directions and signs of PPIs. Moreover, our method outperformed a previous GO-based method that did not consider the relations between GO terms. We annotated effect types to human PPIs and validated several highly confident effect types against literature. The annotated human PPIs are available in Additional file 2 to aid signaling pathway reconstruction and network biology research. We annotated effect types to PPIs by using regulates, positively regulates, and negatively regulates relations in GO. We demonstrated that those relations are effective for predicting not only signs, but also directions of PPIs. The usefulness of those relations suggests their potential applications to other types of interactions such as protein-DNA interactions.

  14. Active and passive surveillance of yellow fever vaccine 17D or 17DD-associated serious adverse events: systematic review.

    Science.gov (United States)

    Thomas, Roger E; Lorenzetti, Diane L; Spragins, Wendy; Jackson, Dave; Williamson, Tyler

    2011-06-20

    To identify the rate of serious adverse events attributable to yellow fever vaccination with 17D and 17DD strains reported in active and passive surveillance data. We conducted a systematic review of published literature on adverse events associated with yellow fever. We searched 9 electronic databases for peer reviewed and grey literature in all languages. There were no restrictions on date of publication. Reference lists of key studies were also reviewed to identify additional studies. We identified 66 relevant studies: 24 used active, 17 a combination of passive and active (15 of which were pharmacovigilance databases), and 25 passive surveillance. ACTIVE SURVEILLANCE: A total of 2,660,929 patients in general populations were followed for adverse events after vaccination, heavily weighted (97.7%) by one large Brazilian study. There were no observed cases of viscerotropic or neurotropic disease, one of anaphylaxis and 26 cases of urticaria (hypersensitivity). We also identified four studies of infants and children (n=2199), four studies of women (n=1334), and one study of 174 HIV+, and no serious adverse events were observed. PHARMACOVIGILANCE DATABASES: 10 of the 15 databases contributed data to this review, with 107,621,154 patients, heavily weighted (94%) by the Brazilian database. The estimates for Australia were low at 0/210,656 for "severe neurological disease" and 1/210,656 for YEL-AVD, and also low for Brazil with 9 hypersensitivity events, 0.23 anaphylactic shock events, 0.84 neurologic syndrome events and 0.19 viscerotropic events cases/million doses. The five analyses of partly overlapping periods for the US VAERS database provided an estimate of 6.6 YEL-AVD and YEL-AND cases per million, and estimates between 11.1 and 15.6 of overall "serious adverse events" per million. The estimates for the UK were higher at 34 "serious adverse events" and also for Switzerland with 14.6 "neurologic events" and 40 "serious events not neurological"/million doses

  15. Effects of different activity and inactivity paradigms on myosin heavy chain gene expression in striated muscle

    Science.gov (United States)

    Baldwin, K. M.; Haddad, F.

    2001-01-01

    The goal of this mini-review is to summarize findings concerning the role that different models of muscular activity and inactivity play in altering gene expression of the myosin heavy chain (MHC) family of motor proteins in mammalian cardiac and skeletal muscle. This was done in the context of examining parallel findings concerning the role that thyroid hormone (T(3), 3,5,3'-triiodothyronine) plays in MHC expression. Findings show that both cardiac and skeletal muscles of experimental animals are initially undifferentiated at birth and then undergo a marked level of growth and differentiation in attaining the adult MHC phenotype in a T(3)/activity level-dependent fashion. Cardiac MHC expression in small mammals is highly sensitive to thyroid deficiency, diabetes, energy deprivation, and hypertension; each of these interventions induces upregulation of the beta-MHC isoform, which functions to economize circulatory function in the face of altered energy demand. In skeletal muscle, hyperthyroidism, as well as interventions that unload or reduce the weight-bearing activity of the muscle, causes slow to fast MHC conversions. Fast to slow conversions, however, are seen under hypothyroidism or when the muscles either become chronically overloaded or subjected to intermittent loading as occurs during resistance training and endurance exercise. The regulation of MHC gene expression by T(3) or mechanical stimuli appears to be strongly regulated by transcriptional events, based on recent findings on transgenic models and animals transfected with promoter-reporter constructs. However, the mechanisms by which T(3) and mechanical stimuli exert their control on transcriptional processes appear to be different. Additional findings show that individual skeletal muscle fibers have the genetic machinery to express simultaneously all of the adult MHCs, e.g., slow type I and fast IIa, IIx, and IIb, in unique combinations under certain experimental conditions. This degree of

  16. Redox-Active Antibiotics Control Gene Expression and Community Behavior in Divergent Bacteria

    OpenAIRE

    Dietrich, Lars E. P.; Teal, Tracy K.; Price-Whelan, Alexa; Newman, Dianne K.

    2008-01-01

    It is thought that bacteria excrete redox-active pigments as antibiotics to inhibit competitors. In Pseudomonas aeruginosa, the endogenous antibiotic pyocyanin activates SoxR, a transcription factor conserved in Proteo- and Actinobacteria. In Escherichia coli, SoxR regulates the superoxide stress response. Bioinformatic analysis coupled with gene expression studies in P. aeruginosa and Streptomyces coelicolor revealed that the majority of SoxR regulons in bacteria lack the genes required for ...

  17. Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia.

    Science.gov (United States)

    Asada, Miki; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

    2014-02-01

    Ecdysone is a hormone known to play a pivotal role in crustaceans and insects. In order to evaluate the ecdysone activities in the environment and within the organism, we have developed a biomonitoring Daphnia strain by introducing a reporter gene. In this study, the ecdysone response element was inserted in the upstream region of a reporter gene, and the DNA construct was injected into Daphnia eggs. The expression of the reporter gene was detected during the early embryonic development stage. In addition, when the eggs expressing the reporter gene were exposed to ecdysone, there was enhanced expression of the reporter gene at detectable levels, while the presence of an antagonist led to its downregulation. These results suggested that this system could be potentially developed for monitoring ecdysone activities in media. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    International Nuclear Information System (INIS)

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.

    1988-01-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene

  19. A Place for Every Event and Every Event in Its Place: Memory for Locations and Activities by 4-Year-Old Children

    Science.gov (United States)

    Bauer, Patricia J.; Stewart, Rebekah; White, Elizabeth A.; Larkina, Marina

    2016-01-01

    Episodic memories are of specific events and experiences associated with particular times and places. Whereas memory for the temporal aspects of past events has been a focus of research attention, memory for the location in which events were experienced has been less fully investigated. The limited developmental research suggests that…

  20. Low TLR7 gene expression in atherosclerotic plaques is associated with major adverse cardio- and cerebrovascular events

    DEFF Research Database (Denmark)

    Karadimou, Glykeria; Folkersen, Lasse; Berg, Martin

    2016-01-01

    Aims: Processes in the development of atherosclerotic lesions can lead to plaque rupture or erosion, which can in turn elicit myocardial infarction or ischaemic stroke. The aims of this study were to determine whether Toll-like receptor 7 (TLR7) gene expression levels influence patient outcome an...

  1. Origin of the CMS gene locus in rapeseed cybrid mitochondria: active and inactive recombination produces the complex CMS gene region in the mitochondrial genomes of Brassicaceae.

    Science.gov (United States)

    Oshima, Masao; Kikuchi, Rie; Imamura, Jun; Handa, Hirokazu

    2010-01-01

    CMS (cytoplasmic male sterile) rapeseed is produced by asymmetrical somatic cell fusion between the Brassica napus cv. Westar and the Raphanus sativus Kosena CMS line (Kosena radish). The CMS rapeseed contains a CMS gene, orf125, which is derived from Kosena radish. Our sequence analyses revealed that the orf125 region in CMS rapeseed originated from recombination between the orf125/orfB region and the nad1C/ccmFN1 region by way of a 63 bp repeat. A precise sequence comparison among the related sequences in CMS rapeseed, Kosena radish and normal rapeseed showed that the orf125 region in CMS rapeseed consisted of the Kosena orf125/orfB region and the rapeseed nad1C/ccmFN1 region, even though Kosena radish had both the orf125/orfB region and the nad1C/ccmFN1 region in its mitochondrial genome. We also identified three tandem repeat sequences in the regions surrounding orf125, including a 63 bp repeat, which were involved in several recombination events. Interestingly, differences in the recombination activity for each repeat sequence were observed, even though these sequences were located adjacent to each other in the mitochondrial genome. We report results indicating that recombination events within the mitochondrial genomes are regulated at the level of specific repeat sequences depending on the cellular environment.

  2. Does erotic stimulus presentation design affect brain activation patterns? Event-related vs. blocked fMRI designs.

    Science.gov (United States)

    Bühler, Mira; Vollstädt-Klein, Sabine; Klemen, Jane; Smolka, Michael N

    2008-07-22

    Existing brain imaging studies, investigating sexual arousal via the presentation of erotic pictures or film excerpts, have mainly used blocked designs with long stimulus presentation times. To clarify how experimental functional magnetic resonance imaging (fMRI) design affects stimulus-induced brain activity, we compared brief event-related presentation of erotic vs. neutral stimuli with blocked presentation in 10 male volunteers. Brain activation differed depending on design type in only 10% of the voxels showing task related brain activity. Differences between blocked and event-related stimulus presentation were found in occipitotemporal and temporal regions (Brodmann Area (BA) 19, 37, 48), parietal areas (BA 7, 40) and areas in the frontal lobe (BA 6, 44). Our results suggest that event-related designs might be a potential alternative when the core interest is the detection of networks associated with immediate processing of erotic stimuli.Additionally, blocked, compared to event-related, stimulus presentation allows the emergence and detection of non-specific secondary processes, such as sustained attention, motor imagery and inhibition of sexual arousal.

  3. Does erotic stimulus presentation design affect brain activation patterns? Event-related vs. blocked fMRI designs

    Directory of Open Access Journals (Sweden)

    Klemen Jane

    2008-07-01

    Full Text Available Abstract Background Existing brain imaging studies, investigating sexual arousal via the presentation of erotic pictures or film excerpts, have mainly used blocked designs with long stimulus presentation times. Methods To clarify how experimental functional magnetic resonance imaging (fMRI design affects stimulus-induced brain activity, we compared brief event-related presentation of erotic vs. neutral stimuli with blocked presentation in 10 male volunteers. Results Brain activation differed depending on design type in only 10% of the voxels showing task related brain activity. Differences between blocked and event-related stimulus presentation were found in occipitotemporal and temporal regions (Brodmann Area (BA 19, 37, 48, parietal areas (BA 7, 40 and areas in the frontal lobe (BA 6, 44. Conclusion Our results suggest that event-related designs might be a potential alternative when the core interest is the detection of networks associated with immediate processing of erotic stimuli. Additionally, blocked, compared to event-related, stimulus presentation allows the emergence and detection of non-specific secondary processes, such as sustained attention, motor imagery and inhibition of sexual arousal.

  4. Targeted in vitro and in vivo gene transfer into T Lymphocytes: potential of direct inhibition of allo-immune activation

    Directory of Open Access Journals (Sweden)

    Mehra Mandeep R

    2006-11-01

    Full Text Available Abstract Background Successful inhibition of alloimmune activation in organ transplantation remains one of the key events in achieving a long-term graft survival. Since T lymphocytes are largely responsible for alloimmune activation, targeted gene transfer of gene of cyclin kinase inhibitor p21 into T cells might inhibit their aberrant proliferation. A number of strategies using either adenoviral or lentiviral vectors linked to mono or bispecific antibodies directed against T cell surface markers/cytokines did not yield the desired results. Therefore, this study was designed to test if a CD3promoter-p21 chimeric construct would in vitro and in vivo transfer p21 gene to T lymphocytes and result in inhibition of proliferation. CD3 promoter-p21 chimeric constructs were prepared with p21 in the sense and antisense orientation. For in vitro studies EL4-IL-2 thyoma cells were used and for in vivo studies CD3p21 sense and antisense plasmid DNA was injected intramuscularly in mice. Lymphocyte proliferation was quantified by 3H-thymidine uptake assay; IL-2 mRNA expression was studied by RT-PCR and using Real Time PCR assay, we monitored the CD3, p21, TNF-α and IFN-γ mRNA expression. Results Transfection of CD3p21 sense and antisense in mouse thyoma cell line (EL4-IL-2 resulted in modulation of mitogen-induced proliferation. The intramuscular injection of CD3p21 sense and antisense plasmid DNA into mice also modulated lymphocyte proliferation and mRNA expression of pro-inflammatory cytokines. Conclusion These results demonstrate a novel strategy of in vitro and in vivo transfer of p21 gene to T cells using CD3-promoter to achieve targeted inhibition of lymphocyte proliferation and immune activation.

  5. Mitogen activated protein kinases selectively regulate palytoxin-stimulated gene expression in mouse keratinocytes

    International Nuclear Information System (INIS)

    Zeliadt, Nicholette A.; Warmka, Janel K.; Wattenberg, Elizabeth V.

    2003-01-01

    We have been investigating how the novel skin tumor promoter palytoxin transmits signals through mitogen activated protein kinases (MAPKs). Palytoxin activates three major MAPKs, extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38, in a keratinocyte cell line derived from initiated mouse skin (308). We previously showed that palytoxin requires ERK to increase matrix metalloproteinase-13 (MMP-13) gene expression, an enzyme implicated in carcinogenesis. Diverse stimuli require JNK and p38 to increase MMP-13 gene expression, however. We therefore used the JNK and p38 inhibitors SP 600125 and SB 202190, respectively, to investigate the role of these MAPKs in palytoxin-induced MMP-13 gene expression. Surprisingly, palytoxin does not require JNK and p38 to increase MMP-13 gene expression. Accordingly, ERK activation, independent of palytoxin and in the absence of JNK and p38 activation, is sufficient to induce MMP-13 gene expression in 308 keratinocytes. Dexamethasone, a synthetic glucocorticoid that inhibits activator protein-1 (AP-1), blocked palytoxin-stimulated MMP-13 gene expression. Therefore, the AP-1 site present in the promoter of the MMP-13 gene appears to be functional and to play a key role in palytoxin-stimulated gene expression. Previous studies showed that palytoxin simulates an ERK-dependent selective increase in the c-Fos content of AP-1 complexes that bind to the promoter of the MMP-13 gene. JNK and p38 can also modulate c-Fos. Palytoxin does not require JNK or p38 to increase c-Fos binding, however. Altogether, these studies indicate that ERK plays a distinctly essential role in transmitting palytoxin-stimulated signals to specific nuclear targets in keratinocytes derived from initiated mouse skin

  6. Identification and analysis of Eimeria nieschulzi gametocyte genes reveal splicing events of gam genes and conserved motifs in the wall-forming proteins within the genus Eimeria (Coccidia, Apicomplexa

    Directory of Open Access Journals (Sweden)

    Wiedmer Stefanie

    2017-01-01

    Full Text Available The genus Eimeria (Apicomplexa, Coccidia provides a wide range of different species with different hosts to study common and variable features within the genus and its species. A common characteristic of all known Eimeria species is the oocyst, the infectious stage where its life cycle starts and ends. In our study, we utilized Eimeria nieschulzi as a model organism. This rat-specific parasite has complex oocyst morphology and can be transfected and even cultivated in vitro up to the oocyst stage. We wanted to elucidate how the known oocyst wall-forming proteins are preserved in this rodent Eimeria species compared to other Eimeria. In newly obtained genomics data, we were able to identify different gametocyte genes that are orthologous to already known gam genes involved in the oocyst wall formation of avian Eimeria species. These genes appeared putatively as single exon genes, but cDNA analysis showed alternative splicing events in the transcripts. The analysis of the translated sequence revealed different conserved motifs but also dissimilar regions in GAM proteins, as well as polymorphic regions. The occurrence of an underrepresented gam56 gene version suggests the existence of a second distinct E. nieschulzi genotype within the E. nieschulzi Landers isolate that we maintain.

  7. Identification and analysis of Eimeria nieschulzi gametocyte genes reveal splicing events of gam genes and conserved motifs in the wall-forming proteins within the genus Eimeria (Coccidia, Apicomplexa)

    Science.gov (United States)

    Wiedmer, Stefanie; Erdbeer, Alexander; Volke, Beate; Randel, Stephanie; Kapplusch, Franz; Hanig, Sacha; Kurth, Michael

    2017-01-01

    The genus Eimeria (Apicomplexa, Coccidia) provides a wide range of different species with different hosts to study common and variable features within the genus and its species. A common characteristic of all known Eimeria species is the oocyst, the infectious stage where its life cycle starts and ends. In our study, we utilized Eimeria nieschulzi as a model organism. This rat-specific parasite has complex oocyst morphology and can be transfected and even cultivated in vitro up to the oocyst stage. We wanted to elucidate how the known oocyst wall-forming proteins are preserved in this rodent Eimeria species compared to other Eimeria. In newly obtained genomics data, we were able to identify different gametocyte genes that are orthologous to already known gam genes involved in the oocyst wall formation of avian Eimeria species. These genes appeared putatively as single exon genes, but cDNA analysis showed alternative splicing events in the transcripts. The analysis of the translated sequence revealed different conserved motifs but also dissimilar regions in GAM proteins, as well as polymorphic regions. The occurrence of an underrepresented gam56 gene version suggests the existence of a second distinct E. nieschulzi genotype within the E. nieschulzi Landers isolate that we maintain. PMID:29210668

  8. Regulation of myelin genes implicated in psychiatric disorders by functional activity in axons

    Directory of Open Access Journals (Sweden)

    Philip R Lee

    2009-06-01

    Full Text Available Myelination is a highly dynamic process that continues well into adulthood in humans. Several recent gene expression studies have found abnormal expression of genes involved in myelination in the prefrontal cortex of brains from patients with schizophrenia and other psychiatric illnesses. Defects in myelination could contribute to the pathophysiology of psychiatric illness by impairing information processing as a consequence of altered impulse conduction velocity and synchrony between cortical regions carrying out higher level cognitive functions. Myelination can be altered by impulse activity in axons and by environmental experience. Psychiatric illness is treated by psychotherapy, behavioral modification, and drugs affecting neurotransmission, raising the possibility that myelinating glia may not only contribute to such disorders, but that activity-dependent effects on myelinating glia could provide one of the cellular mechanisms contributing to the therapeutic effects of these treatments. This review examines evidence showing that genes and gene networks important for myelination can be regulated by functional activity in axons.

  9. Assessing molecular initiating events (MIEs), key events (KEs) and modulating factors (MFs) for styrene responses in mouse lungs using whole genome gene expression profiling following 1-day and multi-week exposures.

    Science.gov (United States)

    Andersen, Melvin E; Cruzan, George; Black, Michael B; Pendse, Salil N; Dodd, Darol; Bus, James S; Sarang, Satinder S; Banton, Marcy I; Waites, Robbie; McMullen, Patrick D

    2017-11-15

    Styrene increased lung tumors in mice at chronic inhalation exposures of 20ppm and greater. MIEs, KEs and MFs were examined using gene expression in three strains of male mice (the parental C57BL/6 strain, a CYP2F2(-/-) knock out and a CYP2F2(-/-) transgenic containing human CYP2F1, 2A13 and 2B6). Exposures were for 1-day and 1, 4 and 26weeks. After 1-day exposures at 1, 5, 10, 20, 40 and 120ppm significant increases in differentially expressed genes (DEGs) occurred only in parental strain lungs where there was already an increase in DEGs at 5ppm and then many thousands of DEGs by 120ppm. Enrichment for 1-day and 1-week exposures included cell cycle, mitotic M-M/G1 phases, DNA-synthesis and metabolism of lipids and lipoproteins pathways. The numbers of DEGs decreased steadily over time with no DEGs meeting both statistical significance and fold-change criteria at 26weeks. At 4 and 26weeks, some key transcription factors (TFs) - Nr1d1, Nr1d2, Dbp, Tef, Hlf, Per3, Per2 and Bhlhe40 - were upregulated (|FC|>1.5), while others - Npas, Arntl, Nfil3, Nr4a1, Nr4a2, and Nr4a3 - were down-regulated. At all times, consistent changes in gene expression only occurred in the parental strain. Our results support a MIE for styrene of direct mitogenicity from mouse-specific CYP2F2-mediated metabolites activating Nr4a signaling. Longer-term MFs include down-regulation of Nr4a genes and shifts in both circadian clock TFs and other TFs, linking circadian clock to cellular metabolism. We found no gene expression changes indicative of cytotoxicity or activation of p53-mediated DNA-damage pathways. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Gene-carried hepatoma targeting complex induced high gene transfection efficiency with low toxicity and significant antitumor activity

    Directory of Open Access Journals (Sweden)

    Zhao QQ

    2012-06-01

    Full Text Available Qing-Qing Zhao,1,2 Yu-Lan Hu,1 Yang Zhou,3 Ni Li,1 Min Han,1 Gu-Ping Tang,4 Feng Qiu,2 Yasuhiko Tabata,5 Jian-Qing Gao,11Institute of Pharmaceutics, Zhejiang University, Hangzhou, China; 2Department of Pharmacy, The First Affiliated Hospital of Chongqing Medical University, Chongqing, China; 3Institute of Biochemistry, Iowa State University, Ames, IA, USA; 4Institute of Chemical Biology and Pharmaceutical Chemistry, Zhejiang University, Hangzhou, China; 5Institute for Frontier Medical Sciences, Kyoto University, Kyoto, JapanBackground: The success of gene transfection is largely dependent on the development of a vehicle or vector that can efficiently deliver a gene to cells with minimal toxicity.Methods: A liver cancer-targeted specific peptide (FQHPSF sequence was successfully synthesized and linked with chitosan-linked polyethylenimine (CP to form a new targeted gene delivery vector called CPT (CP/peptide. The structure of CPT was confirmed by 1H nuclear magnetic resonance spectroscopy and ultraviolet spectrophotometry. The particle size of CPT/DNA complexes was measured using laser diffraction spectrometry and the cytotoxicity of the copolymer was evaluated by methylthiazol tetrazolium method. The transfection efficiency evaluation of the CP copolymer was performed using luciferase activity assay. Cellular internalization of the CP/DNA complex was observed under confocal laser scanning microscopy. The targeting specificity of the polymer coupled to peptide was measured by competitive inhibition transfection study. The liver targeting specificity of the CPT copolymer in vivo was demonstrated by combining the copolymer with a therapeutic gene, interleukin-12, and assessed by its abilities in suppressing the growth of ascites tumor in mouse model.Results: The results showed that the liver cancer-targeted specific peptide was successfully synthesized and linked with CP to form a new targeted gene delivery vector called CPT. The composition of CPT

  11. Late Holocene environmental reconstructions and the implications on flood events, typhoon patterns, and agriculture activities in NE Taiwan

    Science.gov (United States)

    Wang, L.-C.; Behling, H.; Lee, T.-Q.; Li, H.-C.; Huh, C.-A.; Shiau, L.-J.; Chang, Y.-P.

    2014-05-01

    In this study, we reconstructed the paleoenvironmental changes from a sediment archive of the floodplain lake in Ilan Plain of NE Taiwan on multi-decadal resolution for the last ca. 1900 years. On the basis of pollen and diatom records, we evaluated the record of past vegetation, floods, typhoons and agriculture activities of this area, which is sensitive to the hydrological conditions of the West Pacific. High sedimentation rates with low microfossil preservations reflected multiple flood events and humid climatic conditions during 100-1400 AD. A shortly interrupted dry phase can be found during 940-1010 AD. The driest phase corresponds to the Little Ice Age phase 1 (LIA1, 1400-1620 AD) with less disturbance by flood events, which enhanced the occurrence of wetlands (Cyperaceae) and diatom depositions. Humid phases with frequent typhoons are inferred by high percentages of Lagerstroemia and high ratios of planktonic/benthic diatoms, respectively, during 500-700 AD and Little Ice Age phase 2 (LIA2, 1630-1850 AD). The occurrences of cultivated Poaceae (Oryza) during 1250-1300 AD and the last ~400 years, reflect agriculture activities, which seems to implicate strongly with the environmental stability. Finally, we found flood events which dominated during the El Niño-like stage, but dry events as well as frequent typhoon events happened during the La Niña-like stage. After comparing our results with the reconstructed proxy for tropical hydrological conditions, we suggested that the local hydrology in coastal East Asia were strongly affected by the typhoon-triggered heavy rainfalls which were influenced by the variation of global temperature, expansion of the Pacific warm pool and intensification of ENSO events.

  12. Gene conversion events and variable degree of homogenization of rDNA loci in cultivars of Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Sochorova, Jana; Coriton, O.; Kuderová, Alena; Lunerová Bedřichová, Jana; Chevre, A.-M.; Kovařík, Aleš

    2017-01-01

    Roč. 119, č. 1 (2017), s. 13-26 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA13-10057S Institutional support: RVO:68081707 Keywords : ribosomal-rna genes * concerted evolution * intergenic spacer Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 4.041, year: 2016

  13. Recombination Events Involving the atp9 Gene Are Associated with Male Sterility of CMS PET2 in Sunflower.

    Science.gov (United States)

    Reddemann, Antje; Horn, Renate

    2018-03-11

    Cytoplasmic male sterility (CMS) systems represent ideal mutants to study the role of mitochondria in pollen development. In sunflower, CMS PET2 also has the potential to become an alternative CMS source for commercial sunflower hybrid breeding. CMS PET2 originates from an interspecific cross of H. petiolaris and H. annuus as CMS PET1, but results in a different CMS mechanism. Southern analyses revealed differences for atp6 , atp9 and cob between CMS PET2, CMS PET1 and the male-fertile line HA89. A second identical copy of atp6 was present on an additional CMS PET2-specific fragment. In addition, the atp9 gene was duplicated. However, this duplication was followed by an insertion of 271 bp of unknown origin in the 5' coding region of the atp9 gene in CMS PET2, which led to the creation of two unique open reading frames orf288 and orf231 . The first 53 bp of orf288 are identical to the 5' end of atp9 . Orf231 consists apart from the first 3 bp, being part of the 271-bp-insertion, of the last 228 bp of atp9 . These CMS PET2-specific orfs are co-transcribed. All 11 editing sites of the atp9 gene present in orf231 are fully edited. The anther-specific reduction of the co-transcript in fertility-restored hybrids supports the involvement in male-sterility based on CMS PET2.

  14. Recombination Events Involving the atp9 Gene Are Associated with Male Sterility of CMS PET2 in Sunflower

    Directory of Open Access Journals (Sweden)

    Antje Reddemann

    2018-03-01

    Full Text Available Cytoplasmic male sterility (CMS systems represent ideal mutants to study the role of mitochondria in pollen development. In sunflower, CMS PET2 also has the potential to become an alternative CMS source for commercial sunflower hybrid breeding. CMS PET2 originates from an interspecific cross of H. petiolaris and H. annuus as CMS PET1, but results in a different CMS mechanism. Southern analyses revealed differences for atp6, atp9 and cob between CMS PET2, CMS PET1 and the male-fertile line HA89. A second identical copy of atp6 was present on an additional CMS PET2-specific fragment. In addition, the atp9 gene was duplicated. However, this duplication was followed by an insertion of 271 bp of unknown origin in the 5′ coding region of the atp9 gene in CMS PET2, which led to the creation of two unique open reading frames orf288 and orf231. The first 53 bp of orf288 are identical to the 5′ end of atp9. Orf231 consists apart from the first 3 bp, being part of the 271-bp-insertion, of the last 228 bp of atp9. These CMS PET2-specific orfs are co-transcribed. All 11 editing sites of the atp9 gene present in orf231 are fully edited. The anther-specific reduction of the co-transcript in fertility-restored hybrids supports the involvement in male-sterility based on CMS PET2.

  15. Design of chimeric expression elements that confer high-level gene activity in chromoplasts.

    Science.gov (United States)

    Caroca, Rodrigo; Howell, Katharine A; Hasse, Claudia; Ruf, Stephanie; Bock, Ralph

    2013-02-01

    Non-green plastids, such as chromoplasts, generally have much lower activity of gene expression than chloroplasts in photosynthetically active tissues. Suppression of plastid genes in non-green tissues occurs through a complex interplay of transcriptional and translational control, with the contribution of regulation of transcript abundance versus translational activity being highly variable between genes. Here, we have investigated whether the low expression of the plastid genome in chromoplasts results from inherent limitations in gene expression capacity, or can be overcome by designing appropriate combinations of promoters and translation initiation signals in the 5' untranslated region (5'-UTR). We constructed chimeric expression elements that combine promoters and 5'-UTRs from plastid genes, which are suppressed during chloroplast-to-chromoplast conversion in Solanum lycopersicum (tomato) fruit ripening, either just at the translational level or just at the level of mRNA accumulation. These chimeric expression elements were introduced into the tomato plastid genome by stable chloroplast transformation. We report the identification of promoter-UTR combinations that confer high-level gene expression in chromoplasts of ripe tomato fruits, resulting in the accumulation of reporter protein GFP to up to 1% of total cellular protein. Our work demonstrates that non-green plastids are capable of expressing genes to high levels. Moreover, the chimeric cis-elements for chromoplasts developed here are widely applicable in basic and applied research using transplastomic methods. © 2012 The Authors The Plant Journal © 2012 Blackwell Publishing Ltd.

  16. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  17. Tracing footprints of environmental events in tree ring chemistry using neutron activation analysis

    Science.gov (United States)

    Sahin, Dagistan

    The aim of this study is to identify environmental effects on tree-ring chemistry. It is known that industrial pollution, volcanic eruptions, dust storms, acid rain and similar events can cause substantial changes in soil chemistry. Establishing whether a particular group of trees is sensitive to these changes in soil environment and registers them in the elemental chemistry of contemporary growth rings is the over-riding goal of any Dendrochemistry research. In this study, elemental concentrations were measured in tree-ring samples of absolutely dated eleven modern forest trees, grown in the Mediterranean region, Turkey, collected and dated by the Malcolm and Carolyn Wiener Laboratory for Aegean and Near Eastern Dendrochronology laboratory at Cornell University. Correlations between measured elemental concentrations in the tree-ring samples were analyzed using statistical tests to answer two questions. Does the current concentration of a particular element depend on any other element within the tree? And, are there any elements showing correlated abnormal concentration changes across the majority of the trees? Based on the detailed analysis results, the low mobility of sodium and bromine, positive correlations between calcium, zinc and manganese, positive correlations between trace elements lanthanum, samarium, antimony, and gold within tree-rings were recognized. Moreover, zinc, lanthanum, samarium and bromine showed strong, positive correlations among the trees and were identified as possible environmental signature elements. New Dendrochemistry information found in this study would be also useful in explaining tree physiology and elemental chemistry in Pinus nigra species grown in Turkey. Elemental concentrations in tree-ring samples were measured using Neutron Activation Analysis (NAA) at the Pennsylvania State University Radiation Science and Engineering Center (RSEC). Through this study, advanced methodologies for methodological, computational and

  18. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  19. WRKY transcription factors involved in activation of SA biosynthesis genes

    NARCIS (Netherlands)

    van Verk, Marcel C; Bol, John F; Linthorst, Huub J M

    2011-01-01

    Increased defense against a variety of pathogens in plants is achieved through activation of a mechanism known as systemic acquired resistance (SAR). The broad-spectrum resistance brought about by SAR is mediated through salicylic acid (SA). An important step in SA biosynthesis in Arabidopsis is the

  20. Serine Proteolytic Pathway Activation Reveals an Expanded Ensemble of Wound Response Genes in Drosophila

    Science.gov (United States)

    Patterson, Rachel A.; Juarez, Michelle T.; Hermann, Anita; Sasik, Roman; Hardiman, Gary; McGinnis, William

    2013-01-01

    After injury to the animal epidermis, a variety of genes are transcriptionally activated in nearby cells to regenerate the missing cells and facilitate barrier repair. The range and types of diffusible wound signals that are produced by damaged epidermis and function to activate repair genes during epidermal regeneration remains a subject of very active study in many animals. In Drosophila embryos, we have discovered that serine protease function is locally activated around wound sites, and is also required for localized activation of epidermal repair genes. The serine protease trypsin is sufficient to induce a striking global epidermal wound response without inflicting cell death or compromising the integrity of the epithelial barrier. We developed a trypsin wounding treatment as an amplification tool to more fully understand the changes in the Drosophila transcriptome that occur after epidermal injury. By comparing our array results with similar results on mammalian skin wounding we can see which evolutionarily conserved pathways are activated after epidermal wounding in very diverse animals. Our innovative serine protease-mediated wounding protocol allowed us to identify 8 additional genes that are activated in epidermal cells in the immediate vicinity of puncture wounds, and the functions of many of these genes suggest novel genetic pathways that may control epidermal wound repair. Additionally, our data augments the evidence that clean puncture wounding can mount a powerful innate immune transcriptional response, with different innate immune genes being activated in an interesting variety of ways. These include puncture-induced activation only in epidermal cells in the immediate vicinity of wounds, or in all epidermal cells, or specifically in the fat body, or in multiple tissues. PMID:23637905

  1. * Three-Dimensional Bioprinting of Polycaprolactone Reinforced Gene Activated Bioinks for Bone Tissue Engineering.

    Science.gov (United States)

    Cunniffe, Gráinne M; Gonzalez-Fernandez, Tomas; Daly, Andrew; Sathy, Binulal N; Jeon, Oju; Alsberg, Eben; Kelly, Daniel J

    2017-09-01

    Regeneration of complex bone defects remains a significant clinical challenge. Multi-tool biofabrication has permitted the combination of various biomaterials to create multifaceted composites with tailorable mechanical properties and spatially controlled biological function. In this study we sought to use bioprinting to engineer nonviral gene activated constructs reinforced by polymeric micro-filaments. A gene activated bioink was developed using RGD-γ-irradiated alginate and nano-hydroxyapatite (nHA) complexed to plasmid DNA (pDNA). This ink was combined with bone marrow-derived mesenchymal stem cells (MSCs) and then co-printed with a polycaprolactone supporting mesh to provide mechanical stability to the construct. Reporter genes were first used to demonstrate successful cell transfection using this system, with sustained expression of the transgene detected over 14 days postbioprinting. Delivery of a combination of therapeutic genes encoding for bone morphogenic protein and transforming growth factor promoted robust osteogenesis of encapsulated MSCs in vitro, with enhanced levels of matrix deposition and mineralization observed following the incorporation of therapeutic pDNA. Gene activated MSC-laden constructs were then implanted subcutaneously, directly postfabrication, and were found to support superior levels of vascularization and mineralization compared to cell-free controls. These results validate the use of a gene activated bioink to impart biological functionality to three-dimensional bioprinted constructs.

  2. Evaluating Transcription Factor Activity Changes by Scoring Unexplained Target Genes in Expression Data.

    Directory of Open Access Journals (Sweden)

    Evi Berchtold

    Full Text Available Several methods predict activity changes of transcription factors (TFs from a given regulatory network and measured expression data. But available gene regulatory networks are incomplete and contain many condition-dependent regulations that are not relevant for the specific expression measurement. It is not known which combination of active TFs is needed to cause a change in the expression of a target gene. A method to systematically evaluate the inferred activity changes is missing. We present such an evaluation strategy that indicates for how many target genes the observed expression changes can be explained by a given set of active TFs. To overcome the problem that the exact combination of active TFs needed to activate a gene is typically not known, we assume a gene to be explained if there exists any combination for which the predicted active TFs can possibly explain the observed change of the gene. We introduce the i-score (inconsistency score, which quantifies how many genes could not be explained by the set of activity changes of TFs. We observe that, even for these minimal requirements, published methods yield many unexplained target genes, i.e. large i-scores. This holds for all methods and all expression datasets we evaluated. We provide new optimization methods to calculate the best possible (minimal i-score given the network and measured expression data. The evaluation of this optimized i-score on a large data compendium yields many unexplained target genes for almost every case. This indicates that currently available regulatory networks are still far from being complete. Both the presented Act-SAT and Act-A* methods produce optimal sets of TF activity changes, which can be used to investigate the difficult interplay of expression and network data. A web server and a command line tool to calculate our i-score and to find the active TFs associated with the minimal i-score is available from https://services.bio.ifi.lmu.de/i-score.

  3. Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression

    Science.gov (United States)

    Xiong, Li-Ping; Ma, Yu-Qiang; Tang, Lei-Han

    2010-09-01

    Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if working solely, only leads to monostability. Within the stochastic framework, the base pairing strength between sRNA and mRNA plays an important role in controlling the transition time between on and off states. The noise strength of protein number in the off state approaches 1 and is smaller than that in the on state. The noise strength also depends on which parameters, the feedback strength or the synthesis rate of small RNA, are tuned in switching the gene expression on and off. Our findings may provide a new insight into gene-regulation mechanism and can be applied in synthetic biology.

  4. Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression

    International Nuclear Information System (INIS)

    Li-Ping, Xiong; Yu-Qiang, Ma; Lei-Han, Tang

    2010-01-01

    Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if working solely, only leads to monostability. Within the stochastic framework, the base pairing strength between sRNA and mRNA plays an important role in controlling the transition time between on and off states. The noise strength of protein number in the off state approaches 1 and is smaller than that in the on state. The noise strength also depends on which parameters, the feedback strength or the synthesis rate of small RNA, are tuned in switching the gene expression on and off. Our findings may provide a new insight into gene-regulation mechanism and can be applied in synthetic biology

  5. Growth enhancement and gene expression of Arabidopsis thaliana irradiated with active oxygen species

    Science.gov (United States)

    Watanabe, Satoshi; Ono, Reoto; Hayashi, Nobuya; Shiratani, Masaharu; Tashiro, Kosuke; Kuhara, Satoru; Inoue, Asami; Yasuda, Kaori; Hagiwara, Hiroko

    2016-07-01

    The characteristics of plant growth enhancement effect and the mechanism of the enhancement induced by plasma irradiation are investigated using various active species in plasma. Active oxygen species in oxygen plasma are effective for growth enhancement of plants. DNA microarray analysis of Arabidopsis thaliana indicates that the genes coding proteins that counter oxidative stresses by eliminating active oxygen species are expressed at significantly high levels. The size of plant cells increases owing to oxygen plasma irradiation. The increases in gene expression levels and cell size suggest that the increase in the expression level of the expansin protein is essential for plant growth enhancement phenomena.

  6. Rain events and their effect on effluent quality studied at a full scale activated sludge treatment plant.

    Science.gov (United States)

    Wilén, B M; Lumley, D; Mattsson, A; Mino, T

    2006-01-01

    The effect of rain events on effluent quality dynamics was studied at a full scale activated sludge wastewater treatment plant which has a process solution incorporating pre-denitrification in activated sludge with post-nitrification in trickling filters. The incoming wastewater flow varies significantly due to a combined sewer system. Changed flow conditions have an impact on the whole treatment process since the recirculation to the trickling filters is set by the hydraulic limitations of the secondary settlers. Apart from causing different hydraulic conditions in the plant, increased flow due to rain or snow-melting, changes the properties of the incoming wastewater which affects process performance and effluent quality, especially the particle removal efficiency. A comprehensive set of on-line and laboratory data were collected and analysed to assess the impact of rain events on the plant performance.

  7. Centrosome clustering and cyclin D1 gene amplification in double minutes are common events in chromosomal unstable bladder tumors

    International Nuclear Information System (INIS)

    Rey, Javier del; Prat, Esther; Ponsa, Immaculada; Lloreta, Josep; Gelabert, Antoni; Algaba, Ferran; Camps, Jordi; Miró, Rosa

    2010-01-01

    Aneuploidy, centrosome abnormalities and gene amplification are hallmarks of chromosome instability (CIN) in cancer. Yet there are no studies of the in vivo behavior of these phenomena within the same bladder tumor. Twenty-one paraffin-embedded bladder tumors were analyzed by conventional comparative genome hybridization and fluorescence in situ hybridization (FISH) with a cyclin D1 gene (CCND1)/centromere 11 dual-color probe. Immunofluorescent staining of α, β and γ tubulin was also performed. Based on the CIN index, defined as the percentage of cells not displaying the modal number for chromosome 11, tumors were classified as CIN-negative and CIN-positive. Fourteen out of 21 tumors were considered CIN-positive. All T1G3 tumors were included in the CIN-positive group whereas the majority of Ta samples were classified as CIN-negative tumors. Centrosome clustering was observed in six out of 12 CIN-positive tumors analyzed. CCND1 amplification in homogeneously staining regions was present in six out of 14 CIN-positive tumors; three of them also showed amplification of this gene in double minutes. Complex in vivo behavior of CCND1 amplicon in bladder tumor cells has been demonstrated by accurate FISH analysis on paraffin-embedded tumors. Positive correlation between high heterogeneity, centrosome abnormalities and CCND1 amplification was found in T1G3 bladder carcinomas. This is the first study to provide insights into the coexistence of CCND1 amplification in homogeneously staining regions and double minutes in primary bladder tumors. It is noteworthy that those patients whose tumors showed double minutes had a significantly shorter overall survival rate (p < 0.001)

  8. Quantitative Structure-Activity Relationships and Docking Studies of Calcitonin Gene-Related Peptide Antagonists

    DEFF Research Database (Denmark)

    Jenssen, Håvard; Mehrabian, Mohadeseh; Kyani, Anahita

    2012-01-01

    Defining the role of calcitonin gene-related peptide in migraine pathogenesis could lead to the application of calcitonin gene-related peptide antagonists as novel migraine therapeutics. In this work, quantitative structure-activity relationship modeling of biological activities of a large range...... of calcitonin gene-related peptide antagonists was performed using a panel of physicochemical descriptors. The computational studies evaluated different variable selection techniques and demonstrated shuffling stepwise multiple linear regression to be superior over genetic algorithm-multiple linear regression....... The linear quantitative structure-activity relationship model revealed better statistical parameters of cross-validation in comparison with the non-linear support vector regression technique. Implementing only five peptide descriptors into this linear quantitative structure-activity relationship model...

  9. Redox-active antibiotics control gene expression and community behavior in divergent bacteria.

    Science.gov (United States)

    Dietrich, Lars E P; Teal, Tracy K; Price-Whelan, Alexa; Newman, Dianne K

    2008-08-29

    It is thought that bacteria excrete redox-active pigments as antibiotics to inhibit competitors. In Pseudomonas aeruginosa, the endogenous antibiotic pyocyanin activates SoxR, a transcription factor conserved in Proteo- and Actinobacteria. In Escherichia coli, SoxR regulates the superoxide stress response. Bioinformatic analysis coupled with gene expression studies in P. aeruginosa and Streptomyces coelicolor revealed that the majority of SoxR regulons in bacteria lack the genes required for stress responses, despite the fact that many of these organisms still produce redox-active small molecules, which indicates that redox-active pigments play a role independent of oxidative stress. These compounds had profound effects on the structural organization of colony biofilms in both P. aeruginosa and S. coelicolor, which shows that "secondary metabolites" play important conserved roles in gene expression and development.

  10. Effects of alpha-AMPK knockout on exercise-induced gene activation in mouse skeletal muscle

    DEFF Research Database (Denmark)

    Jørgensen, Sebastian Beck; Wojtaszewski, Jørgen; Viollet, Benoit

    2005-01-01

    We tested the hypothesis that 5'AMP-activated protein kinase (AMPK) plays an important role in regulating the acute, exercise-induced activation of metabolic genes in skeletal muscle, which were dissected from whole-body a2- and a1-AMPK knockout (KO) and wild-type (WT) mice at rest, after treadmi...

  11. Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution

    Directory of Open Access Journals (Sweden)

    Tartar Aurélien

    2010-06-01

    Full Text Available Abstract Background Glutamine synthetase (GS is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae, and additional green algal (Chlorophyceae and Prasinophytae and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB and eukaryotic (GSIIE GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT. Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida. However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting

  12. Activity changes of the cat paraventricular hypothalamus during phasic respiratory events

    DEFF Research Database (Denmark)

    Kristensen, Morten Pilgaard; Poe, G R; Rector, D M

    1997-01-01

    We monitored the spatiotemporal organization of cellular activity in the medial paraventricular hypothalamus during spontaneously-occurring periods of increased inspiratory effort followed by prolonged respiratory pauses (sigh/apnea) in the freely-behaving cat. Paraventricular hypothalamic activity...

  13. The Interacting Effect of the BDNF Val66Met Polymorphism and Stressful Life Events on Adolescent Depression Is Not an Artifact of Gene-Environment Correlation: Evidence from a Longitudinal Twin Study

    Science.gov (United States)

    Chen, Jie; Li, Xinying; McGue, Matt

    2013-01-01

    Background: Confounding introduced by gene-environment correlation (rGE) may prevent one from observing a true gene-environment interaction (G × E) effect on psychopathology. The present study investigated the interacting effect of the BDNF Val66Met polymorphism and stressful life events (SLEs) on adolescent depression while controlling for the…

  14. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  15. Engaging Students in a Bioinformatics Activity to Introduce Gene Structure and Function

    Directory of Open Access Journals (Sweden)

    Barbara J. May

    2013-02-01

    Full Text Available Bioinformatics spans many fields of biological research and plays a vital role in mining and analyzing data. Therefore, there is an ever-increasing need for students to understand not only what can be learned from this data, but also how to use basic bioinformatics tools.  This activity is designed to provide secondary and undergraduate biology students to a hands-on activity meant to explore and understand gene structure with the use of basic bioinformatic tools.  Students are provided an “unknown” sequence from which they are asked to use a free online gene finder program to identify the gene. Students then predict the putative function of this gene with the use of additional online databases.

  16. CHD1 regulates cell fate determination by activation of differentiation-induced genes

    DEFF Research Database (Denmark)

    Baumgart, Simon J; Najafova, Zeynab; Hossan, Tareq

    2017-01-01

    The coordinated temporal and spatial activation of gene expression is essential for proper stem cell differentiation. The Chromodomain Helicase DNA-binding protein 1 (CHD1) is a chromatin remodeler closely associated with transcription and nucleosome turnover downstream of the transcriptional start...... site (TSS). In this study, we show that CHD1 is required for the induction of osteoblast-specific gene expression, extracellular-matrix mineralization and ectopic bone formation in vivo. Genome-wide occupancy analyses revealed increased CHD1 occupancy around the TSS of differentiation-activated genes....... Furthermore, we observed that CHD1-dependent genes are mainly induced during osteoblast differentiation and are characterized by higher levels of CHD1 occupancy around the TSS. Interestingly, CHD1 depletion resulted in increased pausing of RNA Polymerase II (RNAPII) and decreased H2A.Z occupancy close...

  17. Effects of stress and adrenalectomy on activity-regulated cytoskeleton protein (Arc) gene expression

    DEFF Research Database (Denmark)

    Mikkelsen, Jens D; Larsen, Marianne Hald

    2006-01-01

    Activity-regulated cytoskeletal-associated protein (Arc) is an effector immediate early gene induced by novelty and involved in consolidation of long-term memory. Since activation of glucocorticoid receptors is a prerequisite for memory consolidation, we therefore aimed to study the effect of acute...... restraint stress on Arc gene expression in adrenalectomized rats. Acute stress produced a significant increase in Arc gene expression in the medial prefrontal cortex, but not in the parietal cortex or in the pyramidal cell layer of the hippocampus. The basal level of Arc mRNA in adrenalectomized animals...... was high in the medial prefrontal cortex and unaffected by acute stress in these animals. These data are consistent with the role of Arc as an integrative modulator of synaptic plasticity by emphasizing the potential role of stress and glucocorticoids in the control of Arc gene expression....

  18. Mucosal CCR1 gene expression as a marker of molecular activity in Crohn's disease: preliminary data.

    Science.gov (United States)

    Dobre, Maria; Mănuc, Teodora Ecaterina; Milanesi, Elena; Pleşea, Iancu Emil; Ţieranu, Eugen Nicolae; Popa, Caterina; Mănuc, Mircea; Preda, Carmen Monica; Ţieranu, Ioana; Diculescu, Mihai Mircea; Ionescu, Elena Mirela; Becheanu, Gabriel

    2017-01-01

    A series of mechanisms of immune response, inflammation and apoptosis have been demonstrated to contribute to the appearance and evolution of Crohn's disease (CD) through the overexpression of several cytokines and chemokines in a susceptible host. The aim of this study was to identify the differences in gene expression profiles analyzing a panel of candidate genes in the mucosa from patients with active CD (CD-A), patients in remission (CD-R), and normal controls. Nine individuals were enrolled in the study: six CD patients (three with active lesions, three with mucosal healing) and three controls without inflammatory bowel disease (IBD) seen on endoscopy. All the individuals underwent mucosal biopsy during colonoscopy. Gene expression levels of 84 genes previously associated with CD were evaluated by polymerase chain reaction (PCR) array. Ten genes out of 84 were found significantly differentially expressed in CD-A (CCL11, CCL25, DEFA5, GCG, IL17A, LCN2, REG1A, STAT3, MUC1, CCR1) and eight genes in CD-R (CASP1, IL23A, STAT1, STAT3, TNF, CCR1, CCL5, and HSP90B1) when compared to controls. A quantitative gene expression analysis revealed that CCR1 gene was more expressed in CD-A than in CD-R. Our data suggest that CCR1 gene may be a putative marker of molecular activity of Crohn's disease. Following these preliminary data, a confirmation in larger cohort studies could represent a useful method in order to identify new therapeutic targets.

  19. Pollination: a key event controlling the expression of genes related to phytohormone biosynthesis during grapevine berry formation.

    Science.gov (United States)

    Kühn, Nathalie; Arce-Johnson, Patricio

    2012-01-01

    Berry formation is the process of ovary conversion into a functional fruit, and is characterized by abrupt changes in the content of several phytohormones, associated with pollination and fertilization. Much effort has been made in order to improve our understanding of berry development, particularly from veraison to post-harvest time. However, the period of berry formation has been poorly investigated, despite its importance. Phytohormones are involved in the control of fruit formation; hence it is important to understand the regulation of their content at this stage. Grapevine is an excellent fleshy-fruit plant model since its fruits have particularities that differentiate them from those of commonly studied organisms. For instance, berries are prepared to cope with stress by producing several antioxidants and they are non-climacteric fruits. Also its genome is fully sequenced, which allows to identify genes involved in developmental processes. In grapevine, no link has been established between pollination and phytohormone biosynthesis, until recently. Here we highlight relevant findings regarding pollination effect on gene expression related to phytohormone biosynthesis, and present unpublished results showing how quickly this effect is achieved.

  20. UV Radiation Activates Toll-Like Receptor 9 Expression in Primary Human Keratinocytes, an Event Inhibited by Human Papillomavirus 38 E6 and E7 Oncoproteins.

    Science.gov (United States)

    Pacini, Laura; Ceraolo, Maria Grazia; Venuti, Assunta; Melita, Giusi; Hasan, Uzma A; Accardi, Rosita; Tommasino, Massimo

    2017-10-01

    Several lines of evidence indicate that cutaneous human papillomavirus (HPV) types belonging to the beta genus of the HPV phylogenetic tree synergize with UV radiation in the development of skin cancer. Accordingly, the E6 and E7 oncoproteins from some beta HPV types are able to deregulate pathways related to immune response and cellular transformation. Toll-like receptor 9 (TLR9), in addition to playing a role in innate immunity, has been shown to be involved in the cellular stress response. Using primary human keratinocytes as experimental models, we have shown that UV irradiation (and other cellular stresses) activates TLR9 expression. This event is closely linked to p53 activation. Silencing the expression of p53 or deleting its encoding gene affected the activation of TLR9 expression after UV irradiation. Using various strategies, we have also shown that the transcription factors p53 and c-Jun are recruited onto a specific region of the TLR9 promoter after UV irradiation. Importantly, the E6 and E7 oncoproteins from beta HPV38, by inducing the accumulation of the p53 antagonist ΔNp73α, prevent the UV-mediated recruitment of these transcription factors onto the TLR9 promoter, with subsequent impairment of TLR9 gene expression. This study provides new insight into the mechanism that mediates TLR9 upregulation in response to cellular stresses. In addition, we show that HPV38 E6 and E7 are able to interfere with this mechanism, providing another explanation for the possible cooperation of beta HPV types with UV radiation in skin carcinogenesis. IMPORTANCE Beta HPV types have been suggested to act as cofactors in UV-induced skin carcinogenesis by altering several cellular mechanisms activated by UV radiation. We show that the expression of TLR9, a sensor of damage-associated molecular patterns produced during cellular stress, is activated by UV radiation in primary human keratinocytes (PHKs). Two transcription factors known to be activated by UV radiation, p53

  1. SCREENING OF ANTIMICROBIAL ACTIVITY AND GENES CODING POLYKETIDE SYNTHETASE AND NONRIBOSOMAL PEPTIDE SYNTHETASE OF ACTINOMYCETE ISOLATES

    Directory of Open Access Journals (Sweden)

    Silvia Kovácsová

    2013-12-01

    Full Text Available The aim of this study was to observe antimicrobial activity using agar plate diffusion method and screening genes coding polyketide synthetase (PKS-I and nonribosomal peptide synthetase (NRPS from actinomycetes. A total of 105 actinomycete strains were isolated from arable soil. Antimicrobial activity was demonstrated at 54 strains against at least 1 of total 12 indicator organisms. Antifungal properties were recorded more often than antibacterial properties. The presence of PKS-I and NRPS genes were founded at 61 of total 105 strains. The number of strains with mentioned biosynthetic enzyme gene fragments matching the anticipated length were 19 (18% and 50 (47% respectively. Overall, five actinomycete strains carried all the biosynthetical genes, yet no antimicrobial activity was found against any of tested pathogens. On the other hand, twenty-one strains showed antimicrobial activity even though we were not able to amplify any of the PKS or NRPS genes from them. Combination of the two methods showed broad-spectrum antimicrobial activity of actinomycetes isolated from arable soil, which indicate that actinomycetes are valuable reservoirs of novel bioactive compounds.

  2. Targeted Editing of Myostatin Gene in Sheep by Transcription Activator-like Effector Nucleases

    Directory of Open Access Journals (Sweden)

    Xinxia Zhao

    2016-03-01

    Full Text Available Myostatin (MSTN is a secreted growth factor expressed in skeletal muscle and adipose tissue that negatively regulates skeletal muscle mass. Gene knockout of MSTN can result in increasing muscle mass in sheep. The objectives were to investigate whether myostatin gene can be edited in sheep by transcription activator-like effector nucleases (TALENs in tandem with single-stranded DNA oligonucleotides (ssODNs. We designed a pair of TALENs to target a highly conserved sequence in the coding region of the sheep MSTN gene. The activity of the TALENs was verified by using luciferase single-strand annealing reporter assay in HEK 293T cell line. Co-transfection of TALENs and ssODNs oligonucleotides induced precise gene editing of myostatin gene in sheep primary fibroblasts. MSTN gene-edited cells were successfully used as nuclear donors for generating cloned embryos. TALENs combined with ssDNA oligonucleotides provide a useful approach for precise gene modification in livestock animals.

  3. Replicative Stress Induces Intragenic Transcription of the ASE1 Gene that Negatively Regulates Ase1 Activity

    OpenAIRE

    McKnight, Kelly; Liu, Hong; Wang, Yanchang

    2014-01-01

    Intragenic transcripts initiate within the coding region of a gene, thereby producing shorter mRNAs and proteins. Although intragenic transcripts are widely expressed [1], their role in the functional regulation of genes remains largely unknown. In budding yeast, DNA replication stress activates the S-phase checkpoint that stabilizes replication forks and arrests cells in S-phase with a short spindle [2-4]. When yeast cells were treated with hydroxyurea (HU) to block DNA synthesis and induce ...

  4. Aberrant activity of NKL homeobox gene NKX3-2 in a T-ALL subset

    Science.gov (United States)

    Meyer, Corinna; Kaufmann, Maren; Zaborski, Margarete; MacLeod, Roderick A. F.; Drexler, Hans G.

    2018-01-01

    T-cell acute lymphoblastic leukemia (T-ALL) is a hematopoietic malignancy originating from T-cell progenitors in which differentiation is blocked at early stages. Physiological expression of specific NKL homeobox genes obeys a hematopoietic NKL-code implicated in the process of lymphopoiesis while in differentiated T-cells these genes are silenced. We propose that this developmental expression pattern underlies the observation that NKL homeobox genes are the most ubiquitous group of transcription factors deregulated in T-ALL, including TLX1, TLX3, NKX2-5 and NKX3-1. Here, we describe a novel member of the NKL homeobox gene subclass, NKX3-2 (BAPX1), which is aberrantly activated in 18% of pediatric T-ALL patients analyzed while being normally expressed in developing spleen. Identification of NKX3-2 expression in T-ALL cell line CCRF-CEM qualified these cells to model its deregulation and function in a leukemic context. Genomic and chromosomal analyses demonstrated normal configuration of the NKX3-2 locus at chromosome 4p15, thus excluding cytogenetic dysregulation. Comparative expression profiling analysis of NKX3-2 patient data revealed deregulated activity of BMP- and MAPK-signalling. These candidate pathways were experimentally confirmed to mediate aberrant NKX3-2 expression. We also show that homeobox gene SIX6, plus MIR17HG and GATA3 are downstream targets of NKX3-2 and plausibly contribute to the pathogenesis of this malignancy by suppressing T-cell differentiation. Finally, NKL homeobox gene NKX2-5 was activated by NKX3-2 in CCRF-CEM and by FOXG1 in PEER, representing mutually inhibitory activators of this translocated oncogene. Together, our findings reveal a novel oncogenic NKL homeobox gene subclass member which is aberrantly expressed in a large subset of T-ALL patients and participates in a deregulated gene network likely to arise in developing spleen. PMID:29746601

  5. PPARα gene expression is up-regulated by LXR and PXR activators in the small intestine

    International Nuclear Information System (INIS)

    Inoue, Jun; Satoh, Shin-ichi; Kita, Mariko; Nakahara, Mayuko; Hachimura, Satoshi; Miyata, Masaaki; Nishimaki-Mogami, Tomoko; Sato, Ryuichiro

    2008-01-01

    LXR, PXR, and PPARα are members of a nuclear receptor family which regulate the expression of genes involved in lipid metabolism. Here, we show the administration of T0901317 stimulates PPARα gene expression in the small intestine but not in the liver of both normal and FXR-null mice. The administration of LXR specific ligand GW3965, or PXR specific ligand PCN has the same effect, indicating that ligand-dependent activation of LXR and PXR, but not FXR, is responsible for the increased gene expression of PPARα in the mouse small intestine

  6. Early interglacial carbonate-dilution events in the South China Sea: Implications for strengthened typhoon activities over subtropical East Asia

    Science.gov (United States)

    Huang, Enqing; Tian, Jun; Qiao, Peijun; Wan, Sui; Xie, Xin; Yang, Wenguang

    2015-10-01

    A compilation of many late Quaternary marine sediment records from the northern South China Sea (SCS) continental slope confirms 15-50% reductions in sedimentary calcium carbonate concentrations between 11.0 and 8.5 ka BP in the early Holocene. This low carbonate% event occurred at a time when the regional sea level rose from -50 m to -10 m, which drowned large areas of continental shelves especially those near and within the Taiwan Strait. This event is associated with a significant increase in bulk sedimentation rates on the upper continental slope and the relative abundance of fine-grained detritus. Sediment provenance analyses suggest a dominant terrigenous input from Taiwan and a minor contribution from Luzon during the low carbonate% event, similar to the background terrigenous deposition in other periods of the Holocene. Two comparable low carbonate% events, respectively from the beginning of marine isotope stages 5.5 and 7.3, have also been recognized, pointing to similar causal factors. While carbonate dissolution and carbonate accumulation rate should not have been responsible, increased terrigenous input and dilution is considered as the main cause for the recurrent low carbonate% events in early interglacials. We further hypothesize that, during early interglacials, fluvial sediment discharge from Taiwan and Luzon intensified due to stronger typhoon activities, and massive fine-grained sediments from these two end members may have been transported to the northern SCS continental slope via surface and deep ocean currents. The conjecture of strengthened typhoon activities over East Asia during the early Holocene is supported by high ocean heat contents in the West Pacific Warm Pool area with the prevailing La Niña-like conditions.

  7. Association of a Chromosomal Rearrangement Event with Mouse Posterior Polymorphous Corneal Dystrophy and Alterations in Csrp2bp, Dzank1, and Ovol2 Gene Expression.

    Directory of Open Access Journals (Sweden)

    Anna L Shen

    Full Text Available We have previously described a mouse model of human posterior polymorphous corneal dystrophy (PPCD and localized the causative mutation to a 6.2 Mbp region of chromosome 2, termed Ppcd1. We now show that the gene rearrangement linked to mouse Ppcd1 is a 3.9 Mbp chromosomal inversion flanked by 81 Kbp and 542 bp deletions. This recombination event leads to deletion of Csrp2bp Exons 8 through 11, Dzank1 Exons 20 and 21, and the pseudogene Znf133. In addition, we identified translocation of novel downstream sequences to positions adjacent to Csrp2bp Exon 7 and Dzank1 Exon 20. Twelve novel fusion transcripts involving Csrp2bp or Dzank1 linked to downstream sequences have been identified. Eight are expressed at detectable levels in PPCD1 but not wildtype eyes. Upregulation of two Csrp2bp fusion transcripts, as well as upregulation of the adjacent gene, Ovol2, was observed. Absence of the PPCD1 phenotype in animals haploinsufficient for Csrp2bp or both Csrp2bp and Dzank1 rules out haploinsufficiency of these genes as a cause of mouse PPCD1. Complementation experiments confirm that PPCD1 embryonic lethality is due to disruption of Csrp2bp expression. The ocular expression pattern of Csrp2bp is consistent with a role for this protein in corneal development and pathogenesis of PPCD1.

  8. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  9. SATB1 packages densely-looped, transciptionally-active chromatinfor coordinated expression of cytokine genes

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Shutao; Lee, Charles C.; Kohwi-Shigematsu, Terumi

    2006-05-23

    SATB1 is an important regulator of nuclear architecture that anchors specialized DNA sequences onto its cage-like network and recruits chromatin remodeling/modifying factors to control gene transcription. We studied the role of SATB1 in regulating the coordinated expression of Il5, Il4, and Il13 from the 200kb cytokine gene cluster region of mouse chromosome 11 during T-helper 2 (Th2)-cell activation. We show that upon cell activation, SATB1 is rapidly induced to form a unique transcriptionally-active chromatin structure that includes the cytokine gene region. Chromatin is folded into numerous small loops all anchored by SATB1, is histone H3 acetylated at lysine 9/14, and associated with Th2-specific factors, GATA3, STAT6, c-Maf, the chromatin-remodeling enzyme Brg-1, and RNA polymerase II across the 200kb region. Before activation, the chromatin displays some of these features, such as association with GATA3 and STAT6, but these were insufficient for cytokine gene expression. Using RNA interference (RNAi), we show that upon cell activation, SATB1 is not only required for chromatin folding into dense loops, but also for c-Maf induction and subsequently for Il4, Il5, and Il13 transcription. Our results show that SATB1 is an important determinant for chromatin architecture that constitutes a novel higher-order, transcriptionally-active chromatin structure upon Th2-cell activation.

  10. [The study on metabolic difference of human body affected by active stress and passive stress under special events].

    Science.gov (United States)

    Guo, Guang-hong; Gu, Feng; Dong, Zhen-nan; Yuan, Xin-hong; Wang, Ling; Tian, Ya-ping

    2010-05-01

    To study the metabolic difference of body influenced by active stress and passive stress under special events. To detect serum multiple biochemistry index of 57 earthquake rescue medical team and 13 victims of a natural calamity in Wenchuan earthquake by using Hitachi 7600 automatic analyzer. Stress affected biochemistry index deeply. To compared with rescue medical team, the serum ADA, ALP and TG of victims increased obviously and TP, ALB, MAO, Cr, UA, K, Na, Cl, Ca, ApoA1 and HDL decreased obviously. Many biochemistry index have been changed under stress and it relate with stress extent. The human body function status was better in active stress than in passive stress.

  11. Rapid and preferential activation of the c-jun gene during the mammalian UV response

    International Nuclear Information System (INIS)

    Devary, Y.; Gottlieb, R.A.; Lau, L.F.; Karin, M.

    1991-01-01

    Exposure of mammalian cells to DNA-damaging agents leads to activation of a genetic response known as the UV response. Because several previously identified UV-inducible genes contain AP-1 binding sites within their promoters, we investigated the induction of AP-1 activity by DNA-damaging agents. We found that expression of both c-jun and c-fos, which encode proteins that participate in formation of the AP-1 complex, is rapidly induced by two different DNA-damaging agents: UV and H2O2. Interestingly, the c-jun gene is far more responsive to UV than any other immediate-early gene that was examined, including c-fos. Other jun and fos genes were only marginally affected by UV or H2O2. Furthermore, UV is a much more efficient inducer of c-jun than phorbol esters, the standard inducers of c-jun expression. This preferential response of the c-jun gene is mediated by its 5' control region and requires the TPA response element, suggesting that this element also serves as an early target for the signal transduction pathway elicited by DNA damage. Both UV and H2O2 lead to a long-lasting increase in AP-1 binding activity, suggesting that AP-1 may mediate the induction of other damage-inducible genes such as human collagenase

  12. A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

    Directory of Open Access Journals (Sweden)

    Mi Zhao

    Full Text Available We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

  13. A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

    Science.gov (United States)

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

  14. A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

    Science.gov (United States)

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

  15. Quasi-periodic fractal patterns in geomagnetic reversals, geological activity, and astronomical events

    International Nuclear Information System (INIS)

    Puetz, Stephen J.; Borchardt, Glenn

    2015-01-01

    Highlights: • Spectral analysis indicates similar harmonics in astronomical and geological events. • Quasi-periodic cycles occur in tripling patterns of 30.44, 91.33, 274, 822, and 2466 myr. • Similar astro- and geo-phases suggest that the cycles develop from a common source. - Abstract: The cause of geomagnetic reversals remains a geological mystery. With the availability of improved paleomagnetic databases in the past three years, a reexamination of possible periodicity in the geomagnetic reversal rate seems warranted. Previous reports of cyclicity in the reversal rate, along with the recent discovery of harmonic cycles in a variety of natural events, sparked our interest in reevaluating possible patterns in the reversal rate. Here, we focus on geomagnetic periodicity, but also analyze paleointensity, zircon formation, star formation, quasar formation, supernova, and gamma ray burst records to determine if patterns that occur in other types of data have similar periodicity. If so, then the degree of synchronization will indicate likely causal relationships with geomagnetic reversals. To achieve that goal, newly available time-series records from these disciplines were tested for cyclicity by using spectral analysis and time-lagged cross-correlation techniques. The results showed evidence of period-tripled cycles of 30.44, 91.33, 274, 822, and 2466 million years, corresponding to the periodicity from a new Universal Cycle model. Based on the results, a fractal model of the universe is hypothesized in which sub-electron fractal matter acts as a dynamic medium for large-scale waves that cause the cycles in astronomical and geological processes. According to this hypothesis, the medium of sub-electron fractal matter periodically compresses and decompresses according to the standard laws for mechanical waves. Consequently, the compressions contribute to high-pressure environments and vice versa for the decompressions, which are hypothesized to cause the

  16. Disease activity and lifestyle influence comorbidities and cardiovascular events in patients with acromegaly.

    Science.gov (United States)

    Sardella, Chiara; Cappellani, Daniele; Urbani, Claudio; Manetti, Luca; Marconcini, Giulia; Tomisti, Luca; Lupi, Isabella; Rossi, Giuseppe; Scattina, Ilaria; Lombardi, Martina; Di Bello, Vitantonio; Marcocci, Claudio; Martino, Enio; Bogazzi, Fausto

    2016-11-01

    The primary objective of this study is to identify the predictors of comorbidities and major adverse cardiovascular events (MACE) that can develop after diagnosis of acromegaly. The role of therapy for acromegaly in the event of such complications was also evaluated. Retrospective cohort study was conducted on 200 consecutive acromegalic patients in a tertiary referral center. The following outcomes were evaluated: diabetes, hypertension and MACE. Each patient was included in the analysis of a specific outcome, unless they were affected when acromegaly was diagnosed, and further classified as follows: (i) in remission after adenomectomy (Hx), (ii) controlled by somatostatin analogues (SSA) (SSAc) or (iii) not controlled by SSA (SSAnc). Data were evaluated using Cox regression analysis. After diagnosis of acromegaly, diabetes occurred in 40.8% of patients. The SSAnc group had a three-fold higher risk of diabetes (HR: 3.32, P = 0.006), whereas the SSAc group had a 1.4-fold higher risk of diabetes (HR: 1.43, P = 0.38) compared with the Hx group. Hypertension occurred in 35.5% of patients, after diagnosis. The determinants of hypertension were age (HR: 1.06, P = 0.01) and BMI (HR: 1.05, P = 0.01). MACE occurred in 11.8% of patients, after diagnosis. Age (HR: 1.09, P = 0.005) and smoking habit (HR: 5.95, P = 0.01) were predictors of MACE. Conversely, therapy for acromegaly did not influence hypertension or MACE. After diagnosis of acromegaly, control of the disease (irrespective of the type of treatment) and lifestyle are predictors of comorbidities and major adverse cardiovascular events. © 2016 European Society of Endocrinology.

  17. CLICs-dependent chloride efflux is an essential and proximal upstream event for NLRP3 inflammasome activation.

    Science.gov (United States)

    Tang, Tiantian; Lang, Xueting; Xu, Congfei; Wang, Xiaqiong; Gong, Tao; Yang, Yanqing; Cui, Jun; Bai, Li; Wang, Jun; Jiang, Wei; Zhou, Rongbin

    2017-08-04

    The NLRP3 inflammasome can sense different pathogens or danger signals, and has been reported to be involved in the development of many human diseases. Potassium efflux and mitochondrial damage are both reported to mediate NLRP3 inflammasome activation, but the underlying, orchestrating signaling events are still unclear. Here we show that chloride intracellular channels (CLIC) act downstream of the potassium efflux-mitochondrial reactive oxygen species (ROS) axis to promote NLRP3 inflammasome activation. NLRP3 agonists induce potassium efflux, which causes mitochondrial damage and ROS production. Mitochondrial ROS then induces the translocation of CLICs to the plasma membrane for the induction of chloride efflux to promote NEK7-NLRP3 interaction, inflammasome assembly, caspase-1 activation, and IL-1β secretion. Thus, our results identify CLICs-dependent chloride efflux as an essential and proximal upstream event for NLRP3 activation.The NLRP3 inflammasome is key to the regulation of innate immunity against pathogens or stress, but the underlying signaling regulation is still unclear. Here the authors show that chloride intracellular channels (CLIC) interface between mitochondria stress and inflammasome activation to modulate inflammatory responses.

  18. Pediatric near-drowning events: do they warrant trauma team activation?

    Science.gov (United States)

    Chotai, Pranit N; Manning, Lisa; Eithun, Benjamin; Ross, Joshua C; Eubanks, James W; Hamner, Chad; Gosain, Ankush

    2017-05-15

    The purpose of this study was to determine the incidence of traumatic injuries, factors associated with mortality, and need for pediatric trauma surgery involvement for drowning and near-drowning events in children. An institutional review board-approved, retrospective chart review was performed at three American College of Surgeons-verified Pediatric Trauma Centers (2011-2014). Patients with International Classification of Diseases, Ninth Revision, codes or E-codes for fatal-nonfatal drowning, fall into water, accidental drowning, or submersion were included. Bivariate analysis using chi-square or Fisher exact test for nominal variables and Mann-Whitney U test for continuous variables was performed. A total of 363 patients (median 3.17 y [18 d-17 y]) met the inclusion criteria. Drowning sites included pool (81.5%), bathtub (12.9%), and natural water (5.2%). A witnessed fall or dive was reported in 34.9%, 57.9% did not fall or dive, and 7% had an unwitnessed event. Most patients did not undergo cervical spine (83%) or brain imaging (75.5%). Seven patients (1.92%) had associated soft tissue injuries. Two patients (0.006%) received surgical intervention (bronchoscopy and extracorporeal membrane oxygenation) within 24 h of presentation. Only 2.2% were admitted to the pediatric trauma service. The percentage of patients discharged home from the emergency department was 10.2%. Overall mortality was 12.4%. Factors associated with mortality included transfer from outside hospital (P = 0.016), presence of hypothermia on arrival (P drowning in a pool (P = 0.013), or undergoing brain cooling at admission (P = 0.011). This is the largest reported series of pediatric near-drowning events. Only rarely did patients require immediate surgical attention and the majority were admitted to nonsurgical services. These data suggest that routine pediatric trauma surgery service involvement in patients with near-drowning events may be unnecessary. Copyright © 2017 Elsevier

  19. Plasminogen activator inhibitor-2 polymorphism associates with recurrent coronary event risk in patients with high HDL and C-reactive protein levels.

    Directory of Open Access Journals (Sweden)

    James P Corsetti

    Full Text Available The objective of this work was to investigate whether fibrinolysis plays a role in establishing recurrent coronary event risk in a previously identified group of postinfarction patients. This group of patients was defined as having concurrently high levels of high-density lipoprotein cholesterol (HDL-C and C-reactive protein (CRP and was previously demonstrated to be at high-risk for recurrent coronary events. Potential risk associations of a genetic polymorphism of plasminogen activator inhibitor-2 (PAI-2 were probed as well as potential modulatory effects on such risk of a polymorphism of low-density lipoprotein receptor related protein (LRP-1, a scavenger receptor known to be involved in fibrinolysis in the context of cellular internalization of plasminogen activator/plansminogen activator inhibitor complexes. To this end, Cox multivariable modeling was performed as a function of genetic polymorphisms of PAI-2 (SERPINB, rs6095 and LRP-1 (LRP1, rs1800156 as well as a set of clinical parameters, blood biomarkers, and genetic polymorphisms previously demonstrated to be significantly and independently associated with risk in the study population including cholesteryl ester transfer protein (CETP, rs708272, p22phox (CYBA, rs4673, and thrombospondin-4 (THBS4, rs1866389. Risk association was demonstrated for the reference allele of the PAI-2 polymorphism (hazard ratio 0.41 per allele, 95% CI 0.20-0.84, p=0.014 along with continued significant risk associations for the p22phox and thrombospondin-4 polymorphisms. Additionally, further analysis revealed interaction of the LRP-1 and PAI-2 polymorphisms in generating differential risk that was illustrated using Kaplan-Meier survival analysis. We conclude from the study that fibrinolysis likely plays a role in establishing recurrent coronary risk in postinfarction patients with concurrently high levels of HDL-C and CRP as manifested by differential effects on risk by polymorphisms of several genes linked

  20. The formation of estrogen-like tamoxifen metabolites and their influence on enzyme activity and gene expression of ADME genes.

    Science.gov (United States)

    Johänning, Janina; Kröner, Patrick; Thomas, Maria; Zanger, Ulrich M; Nörenberg, Astrid; Eichelbaum, Michel; Schwab, Matthias; Brauch, Hiltrud; Schroth, Werner; Mürdter, Thomas E

    2018-03-01

    Tamoxifen, a standard therapy for breast cancer, is metabolized to compounds with anti-estrogenic as well as estrogen-like action at the estrogen receptor. Little is known about the formation of estrogen-like metabolites and their biological impact. Thus, we characterized the estrogen-like metabolites tamoxifen bisphenol and metabolite E for their metabolic pathway and their influence on cytochrome P450 activity and ADME gene expression. The formation of tamoxifen bisphenol and metabolite E was studied in human liver microsomes and Supersomes™. Cellular metabolism and impact on CYP enzymes was analyzed in upcyte® hepatocytes. The influence of 5 µM of tamoxifen, anti-estrogenic and estrogen-like metabolites on CYP activity was measured by HPLC MS/MS and on ADME gene expression using RT-PCR analyses. Metabolite E was formed from tamoxifen by CYP2C19, 3A and 1A2 and from desmethyltamoxifen by CYP2D6, 1A2 and 3A. Tamoxifen bisphenol was mainly formed from (E)- and (Z)-metabolite E by CYP2B6 and CYP2C19, respectively. Regarding phase II metabolism, UGT2B7, 1A8 and 1A3 showed highest activity in glucuronidation of tamoxifen bisphenol and metabolite E. Anti-estrogenic metabolites (Z)-4-hydroxytamoxifen, (Z)-endoxifen and (Z)-norendoxifen inhibited the activity of CYP2C enzymes while tamoxifen bisphenol consistently induced CYPs similar to rifampicin and phenobarbital. On the transcript level, highest induction up to 5.6-fold was observed for CYP3A4 by tamoxifen, (Z)-4-hydroxytamoxifen, tamoxifen bisphenol and (E)-metabolite E. Estrogen-like tamoxifen metabolites are formed in CYP-dependent reactions and are further metabolized by glucuronidation. The induction of CYP activity by tamoxifen bisphenol and the inhibition of CYP2C enzymes by anti-estrogenic metabolites may lead to drug-drug-interactions.

  1. Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat

    International Nuclear Information System (INIS)

    Kenney, S.; Kamine, J.; Markovitz, D.; Fenrick, R.; Pagano, J.

    1988-01-01

    Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, the authors demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses

  2. [Placental gene activity of significant angiogenetic factors in the background of intrauterine growth restriction].

    Science.gov (United States)

    Kovács, Péter; Rab, Attila; Szentpéteri, Imre; Joó, József Gábor; Kornya, László

    2017-04-01

    Placental vascular endothelial growth factor A (VEGF-A) gene and endoglin gene are both overexpressed in placental samples obtained from pregnancies with intrauterine growth restriction compared to normal pregnancies. In the background of these changes a mechanism can be supposed, in which the increased endoglin activity in intrauterine growth restriction (IUGR) leads to impaired placental circulation through an antioangiogenetic effect. This results in the development of placental vascular dysfunction and chronic fetal hypoxia. It is chronic hypoxia that turns on VEGF-A as a compensatory mechanism to improve fetal vascular blood supply by promoting placental blood vessel formation. Although the maternal serum placental growth factor (PlGF) level is a potential predictor for both IUGR and praeeclampsia, placental PlGF gene activity may be less of an active in the regulation of placental circulation in IUGR pregnancies during the later stages of gestation. Orv. Hetil., 2017, 158(16), 612-617.

  3. A Novel Event-Based Incipient Slip Detection Using Dynamic Active-Pixel Vision Sensor (DAVIS).

    Science.gov (United States)

    Rigi, Amin; Baghaei Naeini, Fariborz; Makris, Dimitrios; Zweiri, Yahya

    2018-01-24

    In this paper, a novel approach to detect incipient slip based on the contact area between a transparent silicone medium and different objects using a neuromorphic event-based vision sensor (DAVIS) is proposed. Event-based algorithms are developed to detect incipient slip, slip, stress distribution and object vibration. Thirty-seven experiments were performed on five objects with different sizes, shapes, materials and weights to compare precision and response time of the proposed approach. The proposed approach is validated by using a high speed constitutional camera (1000 FPS). The results indicate that the sensor can detect incipient slippage with an average of 44.1 ms latency in unstructured environment for various objects. It is worth mentioning that the experiments were conducted in an uncontrolled experimental environment, therefore adding high noise levels that affected results significantly. However, eleven of the experiments had a detection latency below 10 ms which shows the capability of this method. The results are very promising and show a high potential of the sensor being used for manipulation applications especially in dynamic environments.

  4. OVERVIEW OF THE ACTIVITIES OF THE NUCLEAR ENERGY AGENCY WORKING GROUP ON EXTERNAL EVENTS

    Energy Technology Data Exchange (ETDEWEB)

    Nakoski, John A.; Smith, Curtis L.; Kim, Min Kyu

    2016-10-01

    The Orgranisation for Economic Cooperation and Development (OECD) Nuclear Energy Agency (NEA) has established a Working Group on External Events (WGEV) that provides a forum for subject matter experts from the nuclear industry and regulators to improve the understanding and treatment of external hazards that would support the continued safety performance of nuclear installations, and improve the effectiveness of regulatory practices, in NEA member countries. This report provides a description of the ongoing work of the WGEV. The work of the WGEV includes the collection of information and conducting a workshop on severe weather and storm surge that brought together a diverse group of subject matter experts to identify commendable practices related to the treatment of severe weather and storm surge consideration in regulatory and operational decision-making. Other work of the WGEV includes looking at science-based screening of external events that are factored into decisions on the safe operation of nuclear facilities; and identification of commendable practices and knowledge gaps on riverine flooding.

  5. Activation of Innate Immune-Response Genes in Little Brown Bats (Myotis lucifugus) Infected with the Fungus Pseudogymnoascus destructans

    Science.gov (United States)

    Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M.; Bollinger, Trent K.; Willis, Craig K. R.; Voyles, Jamie; Misra, Vikram

    2014-01-01

    Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes. PMID:25391018

  6. Activation of innate immune-response genes in little brown bats (Myotis lucifugus infected with the fungus Pseudogymnoascus destructans.

    Directory of Open Access Journals (Sweden)

    Noreen Rapin

    Full Text Available Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes.

  7. Activation of innate immune-response genes in little brown bats (Myotis lucifugus) infected with the fungus Pseudogymnoascus destructans.

    Science.gov (United States)

    Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M; Bollinger, Trent K; Willis, Craig K R; Voyles, Jamie; Misra, Vikram

    2014-01-01

    Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes.

  8. Macro optical projection tomography for large scale 3D imaging of plant structures and gene activity.

    Science.gov (United States)

    Lee, Karen J I; Calder, Grant M; Hindle, Christopher R; Newman, Jacob L; Robinson, Simon N; Avondo, Jerome J H Y; Coen, Enrico S

    2017-01-01

    Optical projection tomography (OPT) is a well-established method for visualising gene activity in plants and animals. However, a limitation of conventional OPT is that the specimen upper size limit precludes its application to larger structures. To address this problem we constructed a macro version called Macro OPT (M-OPT). We apply M-OPT to 3D live imaging of gene activity in growing whole plants and to visualise structural morphology in large optically cleared plant and insect specimens up to 60 mm tall and 45 mm deep. We also show how M-OPT can be used to image gene expression domains in 3D within fixed tissue and to visualise gene activity in 3D in clones of growing young whole Arabidopsis plants. A further application of M-OPT is to visualise plant-insect interactions. Thus M-OPT provides an effective 3D imaging platform that allows the study of gene activity, internal plant structures and plant-insect interactions at a macroscopic scale. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  9. Reactive oxygen species activate differentiation gene transcription of acute myeloid leukemia cells via the JNK/c-JUN signaling pathway.

    Science.gov (United States)

    Lam, Chung Fan; Yeung, Hoi Ting; Lam, Yuk Man; Ng, Ray Kit

    2018-05-01

    Reactive oxygen species (ROS) and altered cellular redox status are associated with many malignancies. Acute myeloid leukemia (AML) cells are maintained at immature state by differentiation blockade, which involves deregulation of transcription factors in myeloid differentiation. AML cells can be induced to differentiate by phorbol-12-myristate-13-acetate (PMA), which possesses pro-oxidative activity. However, the signaling events mediated by ROS in the activation of transcriptional program during AML differentiation has not been fully elucidated. Here, we investigated AML cell differentiation by treatment with PMA and ROS scavenger N-acetyl-l-cysteine (NAC). We observed elevation of intracellular ROS level in the PMA-treated AML cells, which correlated with differentiated cell morphology and increased CD11b + mature cell population. The effect of PMA can be abolished by NAC co-treatment, supporting the involvement of ROS in the process. Moreover, we demonstrated that short ROS elevation mediated cell cycle arrest, but failed to activate myeloid gene transcription; whereas prolonged ROS elevation activated JNK/c-JUN signaling pathway. Inhibition of JNK suppressed the expression of key myeloid transcriptional regulators c-JUN, SPI-1 and MAFB, and prevented AML cells from undergoing terminal differentiation. These findings provide new insights into the crucial role of JNK/c-Jun signaling pathway in the activation of transcriptional program during ROS-mediated AML differentiation. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Synergistic and Antagonistic Interplay between Myostatin Gene Expression and Physical Activity Levels on Gene Expression Patterns in Triceps Brachii Muscles of C57/BL6 Mice

    Science.gov (United States)

    Caetano-Anollés, Kelsey; Mishra, Sanjibita; Rodriguez-Zas, Sandra L.

    2015-01-01

    Levels of myostatin expression and physical activity have both been associated with transcriptome dysregulation and skeletal muscle hypertrophy. The transcriptome of triceps brachii muscles from male C57/BL6 mice corresponding to two genotypes (wild-type and myostatin-reduced) under two conditions (high and low physical activity) was characterized using RNA-Seq. Synergistic and antagonistic interaction and ortholog modes of action of myostatin genotype and activity level on genes and gene pathways in this skeletal muscle were uncovered; 1,836, 238, and 399 genes exhibited significant (FDR-adjusted P-value myostatin-reduced relative to active and inactive wild-type, (ii) inactive myostatin-reduced and active wild-type, and (iii) inactive myostatin-reduced and inactive wild-type. Several remarkable genes and gene pathways were identified. The expression profile of nascent polypeptide-associated complex alpha subunit (Naca) supports a synergistic interaction between activity level and myostatin genotype, while Gremlin 2 (Grem2) displayed an antagonistic interaction. Comparison between activity levels revealed expression changes in genes encoding for structural proteins important for muscle function (including troponin, tropomyosin and myoglobin) and for fatty acid metabolism (some linked to diabetes and obesity, DNA-repair, stem cell renewal, and various forms of cancer). Conversely, comparison between genotype groups revealed changes in genes associated with G1-to-S-phase transition of the cell cycle of myoblasts and the expression of Grem2 proteins that modulate the cleavage of the myostatin propeptide. A number of myostatin-feedback regulated gene products that are primarily regulatory were uncovered, including microRNA impacting central functions and Piezo proteins that make cationic current-controlling mechanosensitive ion channels. These important findings extend hypotheses of myostatin and physical activity master regulation of genes and gene pathways

  11. Developing Clinical Competency in Crisis Event Management: An Integrated Simulation Problem-Based Learning Activity

    Science.gov (United States)

    Liaw, S. Y.; Chen, F. G.; Klainin, P.; Brammer, J.; O'Brien, A.; Samarasekera, D. D.

    2010-01-01

    This study aimed to evaluate the integration of a simulation based learning activity on nursing students' clinical crisis management performance in a problem-based learning (PBL) curriculum. It was hypothesized that the clinical performance of first year nursing students who participated in a simulated learning activity during the PBL session…

  12. Estrogenic activity, estrogens, and calcium in runoff post-layer litter application from rainfall simulated events

    Science.gov (United States)

    Estrogens in runoff from fields fertilized with animal wastes have been implicated as endocrine disruptors of fish in recipient surface waters. The goal of this study was to measure estrogenic activity in runoff post-application of animal waste with the greatest potential for estrogenic activity - ...

  13. Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins.

    Science.gov (United States)

    Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo

    2003-04-01

    We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

  14. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  15. A High-Speed, Event-Driven, Active Pixel Sensor Readout for Photon-Counting Microchannel Plate Detectors

    Science.gov (United States)

    Kimble, Randy A.; Pain, Bedabrata; Norton, Timothy J.; Haas, J. Patrick; Oegerle, William R. (Technical Monitor)

    2002-01-01

    Silicon array readouts for microchannel plate intensifiers offer several attractive features. In this class of detector, the electron cloud output of the MCP intensifier is converted to visible light by a phosphor; that light is then fiber-optically coupled to the silicon array. In photon-counting mode, the resulting light splashes on the silicon array are recognized and centroided to fractional pixel accuracy by off-chip electronics. This process can result in very high (MCP-limited) spatial resolution while operating at a modest MCP gain (desirable for dynamic range and long term stability). The principal limitation of intensified CCD systems of this type is their severely limited local dynamic range, as accurate photon counting is achieved only if there are not overlapping event splashes within the frame time of the device. This problem can be ameliorated somewhat by processing events only in pre-selected windows of interest of by using an addressable charge injection device (CID) for the readout array. We are currently pursuing the development of an intriguing alternative readout concept based on using an event-driven CMOS Active Pixel Sensor. APS technology permits the incorporation of discriminator circuitry within each pixel. When coupled with suitable CMOS logic outside the array area, the discriminator circuitry can be used to trigger the readout of small sub-array windows only when and where an event splash has been detected, completely eliminating the local dynamic range problem, while achieving a high global count rate capability and maintaining high spatial resolution. We elaborate on this concept and present our progress toward implementing an event-driven APS readout.

  16. Only low frequency event-related EEG activity is compromised in multiple sclerosis: insights from an independent component clustering analysis.

    Directory of Open Access Journals (Sweden)

    Hanni Kiiski

    Full Text Available Cognitive impairment (CI, often examined with neuropsychological tests such as the Paced Auditory Serial Addition Test (PASAT, affects approximately 65% of multiple sclerosis (MS patients. The P3b event-related potential (ERP, evoked when an infrequent target stimulus is presented, indexes cognitive function and is typically compared across subjects' scalp electroencephalography (EEG data. However, the clustering of independent components (ICs is superior to scalp-based EEG methods because it can accommodate the spatiotemporal overlap inherent in scalp EEG data. Event-related spectral perturbations (ERSPs; event-related mean power spectral changes and inter-trial coherence (ITCs; event-related consistency of spectral phase reveal a more comprehensive overview of EEG activity. Ninety-five subjects (56 MS patients, 39 controls completed visual and auditory two-stimulus P3b event-related potential tasks and the PASAT. MS patients were also divided into CI and non-CI groups (n = 18 in each based on PASAT scores. Data were recorded from 128-scalp EEG channels and 4 IC clusters in the visual, and 5 IC clusters in the auditory, modality were identified. In general, MS patients had significantly reduced ERSP theta power versus controls, and a similar pattern was observed for CI vs. non-CI MS patients. The ITC measures were also significantly different in the theta band for some clusters. The finding that MS patients had reduced P3b task-related theta power in both modalities is a reflection of compromised connectivity, likely due to demyelination, that may have disrupted early processes essential to P3b generation, such as orientating and signal detection. However, for posterior sources, MS patients had a greater decrease in alpha power, normally associated with enhanced cognitive function, which may reflect a compensatory mechanism in response to the compromised early cognitive processing.

  17. Identification of target genes of transcription factor activator protein 2 gamma in breast cancer cells

    International Nuclear Information System (INIS)

    Ailan, He; Shuanglin, Xiang; Xiangwen, Xiao; Daolong, Ren; Lu, Gan; Xiaofeng, Ding; Xi, Qiao; Xingwang, Hu; Rushi, Liu; Jian, Zhang

    2009-01-01

    Activator protein 2 gamma (AP-2γ) is a member of the transcription factor activator protein-2 (AP-2) family, which is developmentally regulated and plays a role in human neoplasia. AP-2γ has been found to be overexpressed in most breast cancers, and have a dual role to inhibit tumor initiation and promote tumor progression afterwards during mammary tumorigensis. To identify the gene targets that mediate its effects, we performed chromatin immunoprecipitation (ChIP) to isolate AP-2γ binding sites on genomic DNA from human breast cancer cell line MDA-MB-453. 20 novel DNA fragments proximal to potential AP-2γ targets were obtained. They are categorized into functional groups of carcinogenesis, metabolism and others. A combination of sequence analysis, reporter gene assays, quantitative real-time PCR, electrophoretic gel mobility shift assays and immunoblot analysis further confirmed the four AP-2γ target genes in carcinogenesis group: ErbB2, CDH2, HPSE and IGSF11. Our results were consistent with the previous reports that ErbB2 was the target gene of AP-2γ. Decreased expression and overexpression of AP-2γ in human breast cancer cells significantly altered the expression of these four genes, indicating that AP-2γ directly regulates them. This suggested that AP-2γ can coordinate the expression of a network of genes, involving in carcinogenesis, especially in breast cancer. They could serve as therapeutic targets against breast cancers in the future

  18. Transformation of Inhibitor of Meristem Activity (IMA Gene into Jatropha curcas L.

    Directory of Open Access Journals (Sweden)

    Asri Pirade Paserang

    2015-09-01

    Full Text Available Jatropha is one of the many biodiesel plants developed in tropical countries. Efforts to increase its productivity can be done using various methods of breeding. One of the breeding methods is the introduction of genes into the Jatropha plant. The aim of this study is to assess the success of genetic transformation using the Inhibitor of Meristem Activity (IMA gene in Jatropha curcas. The research procedures included inoculation of explants with Agrobacterium tumefaciens, callus induction, screening test of selection media, regeneration, and gene expression analysis using Polymerase Chain Reaction (PCR. IMA is one of the genes that controls flowering genes and ovule development. It was first isolated from tomato plants and has been successfully overexpressed in these plants using the Cauliflower Mosaic Virus (CaMV 35S promoter. In this experiment, plant transformation was performed on J. curcas as the target. Explant callus formation in both the control and treated samples was good, but shoot formation decreased dramatically in the treated explants. PCR analysis indicated that IMA genes can be inserted into J. curcas with the size of the IMA gene is 500 bp.

  19. The risk of cardiovascular events during leisure time activities at altitude.

    Science.gov (United States)

    Burtscher, Martin; Ponchia, Andrea

    2010-01-01

    Annually, more than 100 million tourists are attracted by the mountainous areas around the world. On the one hand, leisure time activities at altitude may well contribute to the well-established beneficial effects of exercise; on the other hand, these activities are also associated with a relatively high risk of death. Sudden cardiac death (SCD) is the most frequent cause of nontraumatic death in males older than 34 years at altitude during leisure time activities such as downhill skiing and hiking. Whereas prior myocardial infarction is the most important risk factor for SCD, particularly relevant in downhill skiers, the unusual physical activity during the first days at altitude and the prolonged abstinence from food and fluid intake during exercise at altitude are the most important triggers. Unaccustomed physical activity seems more likely to trigger SCD than altitude per se. The detection of subjects at risk, evidence-based therapy, and advice on adequate behavior during the altitude sojourn will help to prevent SCD and to increase the health benefits generated by mountaineering activities.

  20. Dysregulation of gene expression within the peroxisome proliferator activated receptor pathway in morbidly obese patients.

    Science.gov (United States)

    Hindle, A Katharine; Koury, Jadd; McCaffrey, Tim; Fu, Sidney W; Brody, Fred

    2009-06-01

    The causes of obesity are multifactorial but may include dysregulation of a family of related genes, such as the peroxisome proliferator activated receptor gamma (PPARgamma). When activated, the PPARgamma pathway promotes lipid metabolism. This study used microarray technology to evaluate differential gene expression profiles in obese patients undergoing bariatric surgery. The study enrolled six morbidly obese patients with a body mass index (BMI) exceeding 35 and four nonobese individuals. Blood samples were stabilized in PaxGene tubes (PreAnalytiX), and total RNA was extracted. Next, 100 ng of total RNA was amplified and labeled using the Ovation RNA Amplification System V2 with the Ovation whole-blood reagent (NuGen) before it was hybridized to an Affymetrix (Santa Clara, CA) focus array containing more than 8,500 verified genes. The data were analyzed using an analysis of variance (ANOVA) (p < 0.05) in the GeneSpring program, and potential pathways were identified with the Ingenuity program. Real-time quantitative reverse transcriptase-polymerase chain reaction was used to validate the array data. A total of 97 upregulated genes and 125 downregulated genes were identified. More than a 1.5-fold change was identified between the morbidly obese patients and the control subjects for a cluster of dysregulated genes involving pathways regulating cell metabolism and lipid formation. Specifically, the PPARgamma pathway showed a plethora of dysregulated genes including tumor necrosis factor-alpha (TNFalpha). In morbidly obese patients, TNFalpha expression was increased (upregulated) 1.6-fold. These findings were confirmed using quantitative polymerase chain reaction with a 2.8-fold change. Microarrays are a powerful tool for identifying biomarkers indicating morbid obesity by analyzing differential gene expression profiles. This study confirms the association of PPARgamma with morbid obesity. Also, these findings in blood support previous work documented in tissue

  1. GCN5 Regulates FGF Signaling and Activates Selective MYC Target Genes during Early Embryoid Body Differentiation

    Directory of Open Access Journals (Sweden)

    Li Wang

    2018-01-01

    Full Text Available Precise control of gene expression during development is orchestrated by transcription factors and co-regulators including chromatin modifiers. How particular chromatin-modifying enzymes affect specific developmental processes is not well defined. Here, we report that GCN5, a histone acetyltransferase essential for embryonic development, is required for proper expression of multiple genes encoding components of the fibroblast growth factor (FGF signaling pathway in early embryoid bodies (EBs. Gcn5−/− EBs display deficient activation of ERK and p38, mislocalization of cytoskeletal components, and compromised capacity to differentiate toward mesodermal lineage. Genomic analyses identified seven genes as putative direct targets of GCN5 during early differentiation, four of which are cMYC targets. These findings established a link between GCN5 and the FGF signaling pathway and highlighted specific GCN5-MYC partnerships in gene regulation during early differentiation.

  2. Transcriptional activation of the mouse obese (ob) gene by CCAAT/enhancer binding protein alpha

    DEFF Research Database (Denmark)

    Hwang, C S; Mandrup, S; MacDougald, O A

    1996-01-01

    Like other adipocyte genes that are transcriptionally activated by CCAAT/enhancer binding protein alpha (C/EBP alpha) during preadipocyte differentiation, expression of the mouse obese (ob) gene is immediately preceded by the expression of C/EBP alpha. While the 5' flanking region of the mouse ob...... gene contains several consensus C/EBP binding sites, only one of these sites appears to be functional. DNase I cleavage inhibition patterns (footprinting) of the ob gene promoter revealed that recombinant C/EBP alpha, as well as a nuclear factor present in fully differentiated 3T3-L1 adipocytes...... to a consensus C/EBP binding site at nucleotides -55 to -47 generated a specific protein-oligonucleotide complex that was supershifted by antibody against C/EBP alpha. Probes corresponding to two upstream consensus C/EBP binding sites failed to generate protein-oligonucleotide complexes. Cotransfection of a C...

  3. Gene expression profile of endoscopically active and inactive ulcerative colitis: preliminary data.

    Science.gov (United States)

    Ţieranu, Cristian George; Dobre, Maria; Mănuc, Teodora Ecaterina; Milanesi, Elena; Pleşea, Iancu Emil; Popa, Caterina; Mănuc, Mircea; Ţieranu, Ioana; Preda, Carmen Monica; Diculescu, Mihai Mircea; Ionescu, Elena Mirela; Becheanu, Gabriel

    2017-01-01

    Multiple cytokines and chemokines related to immune response, apoptosis and inflammation have been identified as molecules implicated in ulcerative colitis (UC) pathogenesis. The aim of this study was to identify the differences at gene expression level of a panel of candidate genes in mucosa from patients with active UC (UCA), patients in remission (UCR), and normal controls. Eleven individuals were enrolled in the study: eight UC patients (four with active lesions, four with mucosal healing) and three controls without inflammatory bowel disease (IBD) seen on endoscopy. All the individuals underwent mucosal biopsy during colonoscopy. Gene expression profile was evaluated by polymerase chain reaction (PCR) array, investigating 84 genes implicated in apoptosis, inflammation, immune response, cellular adhesion, tissue remodeling and mucous secretion. Seventeen and three genes out of 84 were found significantly differentially expressed in UCA and UCR compared to controls, respectively. In particular, REG1A and CHI3L1 genes reported an up-regulation in UCA with a fold difference above 200. In UCR patients, the levels of CASP1, LYZ and ISG15 were different compared to controls. However, since a significant up-regulation of both CASP1 and LYZ was observed also in the UCA group, only ISG15 levels remained associated to the remission state. ISG15, that plays a key role in the innate immune response, seemed to be specifically associated to the UC remission state. These preliminary data represent a starting point for defining the gene profile of UC in different stages in Romanian population. Identification of genes implicated in UC pathogenesis could be useful to select new therapeutic targets.

  4. Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

    Science.gov (United States)

    Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

    1997-03-14

    Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

  5. DMPD: Genetic regulation of macrophage priming/activation: the Lsh gene story. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 1757110 Genetic regulation of macrophage priming/activation: the Lsh gene story. Bl... (.svg) (.html) (.csml) Show Genetic regulation of macrophage priming/activation: the Lsh gene story. Pubmed...ID 1757110 Title Genetic regulation of macrophage priming/activation: the Lsh gen

  6. Characterization of the biocontrol activity of pseudomonas fluorescens strain X reveals novel genes regulated by glucose.

    Directory of Open Access Journals (Sweden)

    Gerasimos F Kremmydas

    Full Text Available Pseudomonas fluorescens strain X, a bacterial isolate from the rhizosphere of bean seedlings, has the ability to suppress damping-off caused by the oomycete Pythium ultimum. To determine the genes controlling the biocontrol activity of strain X, transposon mutagenesis, sequencing and complementation was performed. Results indicate that, biocontrol ability of this isolate is attributed to gcd gene encoding glucose dehydrogenase, genes encoding its co-enzyme pyrroloquinoline quinone (PQQ, and two genes (sup5 and sup6 which seem to be organized in a putative operon. This operon (named supX consists of five genes, one of which encodes a non-ribosomal peptide synthase. A unique binding site for a GntR-type transcriptional factor is localized upstream of the supX putative operon. Synteny comparison of the genes in supX revealed that they are common in the genus Pseudomonas, but with a low degree of similarity. supX shows high similarity only to the mangotoxin operon of Ps. syringae pv. syringae UMAF0158. Quantitative real-time PCR analysis indicated that transcription of supX is strongly reduced in the gcd and PQQ-minus mutants of Ps. fluorescens strain X. On the contrary, transcription of supX in the wild type is enhanced by glucose and transcription levels that appear to be higher during the stationary phase. Gcd, which uses PQQ as a cofactor, catalyses the oxidation of glucose to gluconic acid, which controls the activity of the GntR family of transcriptional factors. The genes in the supX putative operon have not been implicated before in the biocontrol of plant pathogens by pseudomonads. They are involved in the biosynthesis of an antimicrobial compound by Ps. fluorescens strain X and their transcription is controlled by glucose, possibly through the activity of a GntR-type transcriptional factor binding upstream of this putative operon.

  7. A taurine-supplemented vegan diet may blunt the contribution of neutrophil activation to acute coronary events.

    Science.gov (United States)

    McCarty, Mark F

    2004-01-01

    Neutrophils are activated in the coronary circulation during acute coronary events (unstable angina and myocardial infarction), often prior to the onset of ischemic damage. Moreover, neutrophils infiltrate coronary plaque in these circumstances, and may contribute to the rupture or erosion of this plaque, triggering thrombosis. Activated neutrophils secrete proteolytic enzymes in latent forms which are activated by the hypochlorous acid (HOCl) generated by myeloperoxidase. These phenomena may help to explain why an elevated white cell count has been found to be an independent coronary risk factor. Low-fat vegan diets can decrease circulating leukocytes--neutrophils and monocytes--possibly owing to down-regulation of systemic IGF-I activity. Thus, a relative neutropenia may contribute to the coronary protection afforded by such diets. However, vegetarian diets are devoid of taurine - the physiological antagonist of HOCl--and tissue levels of this nutrient are relatively low in vegetarians. Taurine has anti-atherosclerotic activity in animal models, possibly reflecting a role for macrophage-derived myeloperoxidase in the atherogenic process. Taurine also has platelet-stabilizing and anti-hypertensive effects that presumably could reduce coronary risk. Thus, it is proposed that a taurine-supplemented low-fat vegan diet represents a rational strategy for diminishing the contribution of activated neutrophils to acute coronary events; moreover, such a regimen would work in a number of other complementary ways to promote cardiovascular health. Moderate alcohol consumption, the well-tolerated drug pentoxifylline, and 5-lipoxygenase inhibitors--zileuton, boswellic acids, fish oil--may also have potential in this regard. Copyright 2004 Elsevier Ltd.

  8. Caspase-dependant activation of chymotrypsin-like proteases mediates nuclear events during Jurkat T cell apoptosis

    International Nuclear Information System (INIS)

    O'Connell, A.R.; Lee, B.W.; Stenson-Cox, C.

    2006-01-01

    Apoptosis involves a cascade of biochemical and morphological changes resulting in the systematic disintegration of the cell. Caspases are central mediators of this process. Supporting and primary roles for serine proteases as pro-apoptotic mediators have also been highlighted. Evidence for such roles comes largely from the use of pharmacological inhibitors; as a consequence information regarding their apoptotic function and biochemical properties has been limited. Here, we circumvented limitations associated with traditional serine protease inhibitors through use of a fluorescently labelled inhibitor of serine proteases (FLISP) that allowed for analysis of the specificity, regulation and positioning of apoptotic serine proteases within a classical apoptotic cascade. We demonstrate that staurosporine triggers a caspase-dependant induction of chymotrypsin-like activity in the nucleus of apoptotic Jurkat T cells. We show that serine protease activity is required for the generation of late stage nuclear events including condensation, fragmentation and DNA degradation. Furthermore, we reveal caspase-dependant activation of two chymotrypsin-like protein species that we hypothesize mediate cell death-associated nuclear events

  9. Association of Allelic Interaction of Single Nucleotide Polymorphisms of Influx and Efflux Transporters Genes With Nonhematologic Adverse Events of Docetaxel in Breast Cancer Patients.

    Science.gov (United States)

    Jabir, Rafid Salim; Ho, Gwo Fuang; Annuar, Muhammad Azrif Bin Ahmad; Stanslas, Johnson

    2018-05-04

    Nonhematologic adverse events (AEs) of docetaxel constitute an extra burden in the treatment of cancer patients and necessitate either a dose reduction or an outright switch of docetaxel for other regimens. These AEs are frequently associated with genetic polymorphisms of genes encoding for proteins involved docetaxel disposition. Therefore, we investigated that association in Malaysian breast cancer patients. A total of 110 Malaysian breast cancer patients were enrolled in the present study, and their blood samples were investigated for different single nucleotide polymorphisms using polymerase chain reaction restriction fragment length polymorphism. AEs were evaluated using the Common Terminology Criteria for Adverse Events, version 4.0. Fatigue, nausea, oral mucositis, and vomiting were the most common nonhematologic AEs. Rash was associated with heterozygous and mutant genotypes of ABCB1 3435C>T (P A/T reported more fatigue than those carrying the heterozygous genotype GA (P T polymorphism could be a potential predictive biomarker of docetaxel-induced rash, and homozygous wild-type ABCB1 2677G>A/T might predict for a greater risk of fatigue. In addition, the concurrent presence of specific alleles could be predictive of vomiting, nausea, and oral mucositis. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Signaling pathways activation profiles make better markers of cancer than expression of individual genes

    OpenAIRE

    Borisov, Nikolay M.; Terekhanova, Nadezhda V.; Aliper, Alexander M.; Venkova, Larisa S.; Smirnov, Philip Yu; Roumiantsev, Sergey; Korzinkin, Mikhail B.; Zhavoronkov, Alex A.; Buzdin, Anton A.

    2014-01-01

    Identification of reliable and accurate molecular markers remains one of the major challenges of contemporary biomedicine. We developed a new bioinformatic technique termed OncoFinder that for the first time enables to quantatively measure activation of intracellular signaling pathways basing on transcriptomic data. Signaling pathways regulate all major cellular events in health and disease. Here, we showed that the Pathway Activation Strength (PAS) value itself may serve as the biomarker for...

  11. Association between ß2-adrenergic receptor gene polymorphisms and adverse events of ritodrine in the treatment of preterm labor: a prospective observational study.

    Science.gov (United States)

    Chung, Jee Eun; Choi, Soo An; Hwang, Han Sung; Park, Jin Young; Lee, Kyung Eun; Yee, Jeong; Kim, Young Ju; Gwak, Hye Sun

    2017-11-13

    Ritodrine, a tocolytic β2-agonist, has been used extensively in Europe and Asia despite its safety concerns. This study was designed to identify associations between β2-adrenergic receptor (ADRB2) polymorphisms and adverse drug events (ADEs) in patients with preterm labor treated with ritodrine. This follow-up study was prospectively conducted at Ewha Womans University Mokdong Hospital in Korea. Five single nucleotide polymorphisms (SNPs) of the ADRB2 gene (rs1042713, rs1042714, rs1042717, rs1042718, and rs1042719) were analyzed in 186 pregnant women with preterm labor. Patients with the AA genotype of rs1042717 had significantly lower incidence of ADEs compared to those with the G allele (p = 0.009). In multivariate analysis, one of the predictors of ADEs was the maximum infusion rate of ritodrine (AOR 4.47, 95% CI 1.31-15.25). Rs1042719 was also a significant factor for ritodrine-induced ADEs. The CC genotype carriers had 78% decreased risk of ADEs compared to those with other genotypes. This study demonstrates that ADEs induced by ritodrine are associated with ADRB2 gene polymorphisms, as well as the infusion rate of ritodrine in pregnant women with preterm labor.

  12. LimTox: a web tool for applied text mining of adverse event and toxicity associations of compounds, drugs and genes.

    Science.gov (United States)

    Cañada, Andres; Capella-Gutierrez, Salvador; Rabal, Obdulia; Oyarzabal, Julen; Valencia, Alfonso; Krallinger, Martin

    2017-07-03

    A considerable effort has been devoted to retrieve systematically information for genes and proteins as well as relationships between them. Despite the importance of chemical compounds and drugs as a central bio-entity in pharmacological and biological research, only a limited number of freely available chemical text-mining/search engine technologies are currently accessible. Here we present LimTox (Literature Mining for Toxicology), a web-based online biomedical search tool with special focus on adverse hepatobiliary reactions. It integrates a range of text mining, named entity recognition and information extraction components. LimTox relies on machine-learning, rule-based, pattern-based and term lookup strategies. This system processes scientific abstracts, a set of full text articles and medical agency assessment reports. Although the main focus of LimTox is on adverse liver events, it enables also basic searches for other organ level toxicity associations (nephrotoxicity, cardiotoxicity, thyrotoxicity and phospholipidosis). This tool supports specialized search queries for: chemical compounds/drugs, genes (with additional emphasis on key enzymes in drug metabolism, namely P450 cytochromes-CYPs) and biochemical liver markers. The LimTox website is free and open to all users and there is no login requirement. LimTox can be accessed at: http://limtox.bioinfo.cnio.es. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Apoptotic activity and gene responses in Drosophila melanogaster S2 cells, induced by azadirachtin A.

    Science.gov (United States)

    Xu, Lin; Li, Sheng; Ran, Xueqin; Liu, Chang; Lin, Rutao; Wang, Jiafu

    2016-09-01

    Azadirachtin has been used as an antifeedant and growth disruption agent for many insect species. Previous investigations have reported the apoptotic effects of azadirachtin on some insect cells, but the molecular mechanisms are still not clear. This study investigated the underlying molecular mechanisms for the apoptotic effects induced by azadirachtin on Drosophila melanogaster S2 cells in vitro. The results of the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide assay demonstrated that azadirachtin exhibited significant cytotoxicity to S2 cells in a time- and dose-dependent manner. The changes in cellular morphology and the DNA fragmentation demonstrated that azadirachtin induced remarkable apoptosis of S2 cells. Expression levels of 276 genes were found to be significantly changed in S2 cells after exposure to azadirachtin, as detected by Drosophila genome array. Among these genes, calmodulin (CaM) was the most highly upregulated gene. Azadirachtin was further demonstrated to trigger intracellular Ca(2+) release in S2 cells. The genes related to the apoptosis pathway, determined from chip data, were validated by the real-time quantitative polymerase chain reaction method. The results showed that azadirachtin-mediated intracellular Ca(2+) release was the primary event that triggered apoptosis in Drosophila S2 cells through both pathways of the Ca(2+) -CaM and EcR/Usp signalling cascade. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  14. Hippocampal activity during transient respiratory events in the freely behaving cat

    DEFF Research Database (Denmark)

    Poe, G R; Kristensen, Morten Pilgaard; Rector, D M

    1996-01-01

    We measured dorsal hippocampal activity accompanying sighs and apnea using reflectance imaging and electrophysiologic measures in freely behaving cats. Reflected 660-nm light from a 1-mm2 area of CA1 was captured during sighs and apnea at 25 Hz through a coherent image conduit coupled to a charge...

  15. Extranuclear detection of histones and nucleosomes in activated human lymphoblasts as an early event in apoptosis.

    NARCIS (Netherlands)

    Gabler, C.; Blank, N.; Hieronymus, T.; Schiller, M.; Berden, J.H.M.; Kalden, J.R.; Lorenz, H.M.

    2004-01-01

    OBJECTIVE: To evaluate the presence of histones and nucleosomes in cell lysates of freshly isolated peripheral blood mononuclear cells (PBMC), fully activated lymphoblasts, or lymphoblasts after induction of apoptosis. METHODS: Each histone class (H1, H2A, H2B, H3, and H4) was detected by western

  16. 77 FR 47603 - Takes of Marine Mammals Incidental to Specified Activities; Construction and Race Event...

    Science.gov (United States)

    2012-08-09

    ... elephant seals during the IHA, which is valid for one year from the date of issuance. Any activities that... effective for a period of 1 year from the date of issuance. ADDRESSES: A copy of the IHA and related..., an IHA may be effective for a maximum of one year from date of issuance. Except with respect to...

  17. Activation tagging of the two closely linked genes LEP and VAS independently affects vascular cell number

    DEFF Research Database (Denmark)

    van der Graaff, Eric; Hooykaas, Paul J J; Keller, Beat

    2002-01-01

    report that in addition to this leafy petiole phenotype, the size of the vascular bundles is increased in all aerial organs in let as a result of an increase in the number of xylem, phloem (pro)cambial and pericycle cells. This vascular phenotype is caused by activation tagging of the two genes VASCULAR......-promoting factor. The activation tagging of VAS only resulted in a specific increase in phloem (pro)cambial and pericycle cells. We conclude that activation tagging of LEP and VAS results in additive phenotypes. Insertional mutants for LEP and VAS display wild-type vascular development, indicating the relevance...... of activation tagging for functional analysis of novel genes involved in plant development....

  18. Reporter gene assay for the quantification of the activity and neutralizing antibody response to TNFα antagonists

    DEFF Research Database (Denmark)

    Lallemand, Christophe; Kavrochorianou, Nadia; Steenholdt, Casper

    2011-01-01

    A cell-based assay has been developed for the quantification of the activity of TNFα antagonists based on human erythroleukemic K562 cells transfected with a NFκB regulated firefly luciferase reporter-gene construct. Both drug activity and anti-drug neutralizing antibodies can be quantified...... with a high degree of precision within 2h, and without interference from cytokines and other factors known to activate NFκB. The assay cells also contain the Renilla luciferase reporter gene under the control of a constitutive promoter that allows TNFα-induced firefly luciferase activity to be normalized...... relative to Renilla luciferase expression. Thus, results are independent of cell number or differences in cell viability, resulting in intra and inter assay coefficients of variation of 10% or less. Normalization of results relative to the expression of an internal standard also provides a means...

  19. Mapping of brain activity by automated volume analysis of immediate early genes

    Science.gov (United States)

    Renier, Nicolas; Adams, Eliza L.; Kirst, Christoph; Wu, Zhuhao; Azevedo, Ricardo; Kohl, Johannes; Autry, Anita E.; Kadiri, Lolahon; Venkataraju, Kannan Umadevi; Zhou, Yu; Wang, Victoria X.; Tang, Cheuk Y.; Olsen, Olav; Dulac, Catherine; Osten, Pavel; Tessier-Lavigne, Marc

    2016-01-01

    Summary Understanding how neural information is processed in physiological and pathological states would benefit from precise detection, localization and quantification of the activity of all neurons across the entire brain, which has not to date been achieved in the mammalian brain. We introduce a pipeline for high speed acquisition of brain activity at cellular resolution through profiling immediate early gene expression using immunostaining and light-sheet fluorescence imaging, followed by automated mapping and analysis of activity by an open-source software program we term ClearMap. We validate the pipeline first by analysis of brain regions activated in response to Haloperidol. Next, we report new cortical regions downstream of whisker-evoked sensory processing during active exploration. Lastly, we combine activity mapping with axon tracing to uncover new brain regions differentially activated during parenting behavior. This pipeline is widely applicable to different experimental paradigms, including animal species for which transgenic activity reporters are not readily available. PMID:27238021

  20. Use of an activated beta-catenin to identify Wnt pathway target genes in caenorhabditis elegans, including a subset of collagen genes expressed in late larval development.

    Science.gov (United States)

    Jackson, Belinda M; Abete-Luzi, Patricia; Krause, Michael W; Eisenmann, David M

    2014-04-16

    The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin-dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1 col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle.

  1. CicLAvia: Evaluation of participation, physical activity and cost of an open streets event in Los Angeles

    OpenAIRE

    Cohen, Deborah; Han, Bing; Derose, Kathryn P.; Williamson, Stephanie; Paley, Aaron; Batteate, Christina

    2016-01-01

    Physical activity is beneficial for health, but there are limited opportunities in urban areas to safely access public streets for traffic-free cycling, skating or walking. Ciclovías are open streets programs that close major roads to motor vehicles so they can be exclusively used by bicyclists and pedestrians. We estimated participation in one Los Angeles Ciclovía event (CicLAvia) using intercept surveys and 14 surveillance cameras which were placed along the 6-mile route in April, 2014. We ...

  2. Influence of Nitrous Oxide Anesthesia, B-Vitamins, and MTHFR gene polymorphisms on Perioperative Cardiac Events: The Vitamins in Nitrous Oxide (VINO) Randomized Trial

    Science.gov (United States)

    Nagele, Peter; Brown, Frank; Francis, Amber; Scott, Mitchell G.; Gage, Brian F.; Miller, J. Philip

    2013-01-01

    Background Nitrous oxide causes an acute increase in plasma homocysteine that is more pronounced in patients with the MTHFR C677T or A1298C gene variant. In this randomized controlled trial we sought to determine if patients carrying the MTHFR C677T or A1298C variant had a higher risk for perioperative cardiac events after nitrous oxide anesthesia and if this risk could be mitigated by B-vitamins. Methods We randomized adult patients with cardiac risk factors undergoing noncardiac surgery to receive nitrous oxide plus intravenous B-vitamins before and after surgery or to nitrous oxide and placebo. Serial cardiac biomarkers and 12-lead electrocardiograms were obtained. The primary study endpoint was the incidence of myocardial injury, as defined by cardiac troponin I elevation within the first 72 hours after surgery. Results A total of 500 patients completed the trial. Patients who were homozygous for either MTHFR C677T or A1298C gene variant (n= 98; 19.6%) had no increased rate of postoperative cardiac troponin I elevation compared to wild-type and heterozygous patients (11.2% vs. 14.0%; relative risk 0.96, 95% CI 0.85 to 1.07, p=0.48). B-vitamins blunted the rise in homocysteine, but had no effect on cardiac troponin I elevation compared to patients receiving placebo (13.2% vs. 13.6%; relative risk 1.02, 95% CI 0.78 to 1.32, p=0.91). Conclusions Neither MTHFR C677T and A1298C gene variant nor acute homocysteine increase are associated with perioperative cardiac troponin elevation after nitrousoxide anesthesia. B-vitamins blunt nitrous oxide-induced homocysteine increase but have no effect on cardiac troponin elevation. PMID:23856660

  3. Influence of nitrous oxide anesthesia, B-vitamins, and MTHFR gene polymorphisms on perioperative cardiac events: the vitamins in nitrous oxide (VINO) randomized trial.

    Science.gov (United States)

    Nagele, Peter; Brown, Frank; Francis, Amber; Scott, Mitchell G; Gage, Brian F; Miller, J Philip

    2013-07-01

    Nitrous oxide causes an acute increase in plasma homocysteine that is more pronounced in patients with the methylenetetrahydrofolate reductase (MTHFR) C677T or A1298C gene variant. In this randomized controlled trial, the authors sought to determine whether patients carrying the MTHFR C677T or A1298C variant had a higher risk for perioperative cardiac events after nitrous oxide anesthesia and whether this risk could be mitigated by B-vitamins. The authors randomized adult patients with cardiac risk factors undergoing noncardiac surgery, to receive nitrous oxide plus intravenous B-vitamins before and after surgery, or to nitrous oxide and placebo. Serial cardiac biomarkers and 12-lead electrocardiograms were obtained. The primary study endpoint was the incidence of myocardial injury, as defined by cardiac troponin I increase within the first 72 h after surgery. A total of 500 patients completed the trial. Patients who were homozygous for either MTHFR C677T, or A1298C gene variant (n=98; 19.6%) had no increased rate of postoperative cardiac troponin I increase compared with wild-type and heterozygous patients (11.2 vs. 14.0%; relative risk 0.96; 95% CI, 0.85-1.07; P=0.48). B-vitamins blunted the rise in homocysteine, but had no effect on cardiac troponin I increase compared with patients receiving placebo (13.2 vs. 13.6%; relative risk 1.02; 95% CI 0.78 to 1.32; P=0.91). Neither MTHFR C677T and A1298C gene variant, nor acute homocysteine increase are associated with perioperative cardiac troponin increase after nitrous oxide anesthesia. B-vitamins blunt nitrous oxide-induced homocysteine increase but have no effect on cardiac troponin I increase.

  4. Nerve Growth Factor Gene Therapy: Activation of Neuronal Responses in Alzheimer Disease.

    Science.gov (United States)

    Tuszynski, Mark H; Yang, Jennifer H; Barba, David; U, Hoi-Sang; Bakay, Roy A E; Pay, Mary M; Masliah, Eliezer; Conner, James M; Kobalka, Peter; Roy, Subhojit; Nagahara, Alan H

    2015-10-01

    Alzheimer disease (AD) is the most common neurodegenerative disorder and lacks effective disease-modifying therapies. In 2001, we initiated a clinical trial of nerve growth factor (NGF) gene therapy in AD, the first effort at gene delivery in an adult neurodegenerative disorder. This program aimed to determine whether a nervous system growth factor prevents or reduces cholinergic neuronal degeneration in patients with AD. We present postmortem findings in 10 patients with survival times ranging from 1 to 10 years after treatment. To determine whether degenerating neurons in AD retain an ability to respond to a nervous system growth factor delivered after disease onset. Patients in this anatomicopathological study were enrolled in clinical trials from March 2001 to October 2012 at the University of California, San Diego, Medical Center in La Jolla. Ten patients with early AD underwent NGF gene therapy using ex vivo or in vivo gene transfer. The brains of all 8 patients in the first phase 1 ex vivo trial and of 2 patients in a subsequent phase 1 in vivo trial were examined. Brains were immunolabeled to evaluate in vivo gene expression, cholinergic neuronal responses to NGF, and activation of NGF-related cell signaling. In 2 patients, NGF protein levels were measured by enzyme-linked immunosorbent assay. Among 10 patients, degenerating neurons in the AD brain responded to NGF. All patients exhibited a trophic response to NGF in the form of axonal sprouting toward the NGF source. Comparing treated and nontreated sides of the brain in 3 patients who underwent unilateral gene transfer, cholinergic neuronal hypertrophy occurred on the NGF-treated side (P < .05). Activation of cellular signaling and functional markers was present in 2 patients who underwent adeno-associated viral vectors (serotype 2)-mediated NGF gene transfer. Neurons exhibiting tau pathology and neurons free of tau expressed NGF, indicating that degenerating cells can be infected with therapeutic

  5. ACTIVATION OF A CRYPTIC D-SERINE DEAMINASE (DSD) GENE FROM PSEUDOMONAS CEPACIA 17616

    Science.gov (United States)

    D-serine inhibits growth of P. cepacia 17616; however, resistant mutants able to express an ordinarily cryptic D-serine deaminase (dsd) gene were isolated readily. The resistant strains formed high levels of a D-serine deaminase active on D-threonine as well as D-serine. IS eleme...

  6. Genomic organization of the mouse peroxisome proliferator-activated receptor beta/delta gene

    DEFF Research Database (Denmark)

    Larsen, Leif K; Amri, Ez-Zoubir; Mandrup, Susanne

    2002-01-01

    Peroxisome proliferator-activated receptor (PPAR) beta/delta is ubiquitously expressed, but the level of expression differs markedly between different cell types. In order to determine the molecular mechanisms governing PPARbeta/delta gene expression, we have isolated and characterized the mouse...

  7. Late Holocene environmental reconstructions and their implications on flood events, typhoon, and agricultural activities in NE Taiwan

    Science.gov (United States)

    Wang, L.-C.; Behling, H.; Lee, T.-Q.; Li, H.-C.; Huh, C.-A.; Shiau, L.-J.; Chang, Y.-P.

    2014-10-01

    We reconstructed paleoenvironmental changes from a sediment archive of a lake in the floodplain of the Ilan Plain of NE Taiwan on multi-decadal resolution for the last ca. 1900 years. On the basis of pollen and diatom records, we evaluated past floods, typhoons, and agricultural activities in this area which are sensitive to the hydrological conditions in the western Pacific. Considering the high sedimentation rates with low microfossil preservations in our sedimentary record, multiple flood events were. identified during the period AD 100-1400. During the Little Ice Age phase 1 (LIA 1 - AD 1400-1620), the abundant occurrences of wetland plant (Cyperaceae) and diatom frustules imply less flood events under stable climate conditions in this period. Between AD 500 and 700 and the Little Ice Age phase 2 (LIA 2 - AD 1630-1850), the frequent typhoons were inferred by coarse sediments and planktonic diatoms, which represented more dynamical climate conditions than in the LIA 1. By comparing our results with the reconstructed changes in tropical hydrological conditions, we suggested that the local hydrology in NE Taiwan is strongly influenced by typhoon-triggered heavy rainfalls, which could be influenced by the variation of global temperature, the expansion of the Pacific warm pool, and the intensification of El Niño-Southern Oscillation (ENSO) events.

  8. Computational inference of replication and transcription activator regulator activity in herpesvirus from gene expression data

    NARCIS (Netherlands)

    Recchia, A.; Wit, E.; Vinciotti, V.; Kellam, P.

    One of the main aims of system biology is to understand the structure and dynamics of genomic systems. A computational approach, facilitated by new technologies for high-throughput quantitative experimental data, is put forward to investigate the regulatory system of dynamic interaction among genes

  9. Regulation of crp gene expression by the catabolite repressor/activator, Cra, in Escherichia coli.

    Science.gov (United States)

    Zhang, Zhongge; Aboulwafa, Mohammad; Saier, Milton H

    2014-01-01

    Growth of E. coli on several carbon sources is dependent on the catabolite repressor/activator (Cra) protein although a Cra consensus DNA-binding site is not present in the control regions of the relevant catabolic operons. We show that Cra regulates growth by activating expression of the crp gene. It thereby mediates catabolite repression of catabolic operons by an indirect mechanism. © 2014 S. Karger AG, Basel.

  10. Activation of Hh Signaling: A Critical Biological Consequence of ETS Gene Anomalies in Prostate Cancer

    Science.gov (United States)

    2013-01-01

    Mian BM. Hedgehog Signaling Pathway Activation in Bladder Transitional Cell Carcinoma (TCC). J Urol., 2010, 184(1):344-351. PMID: 20488474 3...Tanner MJ, Welliver RC Jr, Chen M, Shtutman M, Godoy A, Smith G, Mian BM, Buttyan R. Effects of Androgen Receptor and Androgen on Gene Expression in...activities. Proc. Natl. Acad. Sci. USA, 2012, 109(34):13799-804. PMID: 22869755 Manuscripts in Preparation 1. Chen M* (co-first author), Li N*, Carkner

  11. Contributions of human activities to suspended-sediment yield during storm events from a steep, small, tropical watershed, American Samoa

    Science.gov (United States)

    Messina, A. T.; Biggs, T. W.

    2014-12-01

    Anthropogenic watershed disturbance by agriculture, deforestation, roads, and urbanization can alter the timing, composition, and mass of sediment loads to adjacent coral reefs, causing enhanced sediment stress on corals near the outlets of impacted watersheds like Faga'alu, American Samoa. To quantify the increase in sediment loading to the adjacent priority coral reef experiencing sedimentation stress, suspended-sediment yield (SSY) from undisturbed and human-disturbed portions of a small, steep, tropical watershed was measured during baseflow and storm events of varying magnitude. Data on precipitation, discharge, turbidity, and suspended-sediment concentration (SSC) were collected over three field campaigns and continuous monitoring from January 2012 to March 2014, which included 88 storm events. A combination of paired- and nested-watershed study designs using sediment budget, disturbance ratio, and sediment rating curve methodologies was used to quantify the contribution of human-disturbed areas to total SSY. SSC during base- and stormflows was significantly higher downstream of an open-pit aggregate quarry, indicating the quarry is a key sediment source requiring sediment discharge mitigation. Comparison of event-wise SSY from the upper, undisturbed watershed, and the lower, human-disturbed watershed showed the Lower watershed accounted for more than 80% of total SSY on average, and human activities have increased total sediment loading to the coast by approximately 200%. Four storm characteristics were tested as predictors of event SSY using Pearson's and Spearman's correlation coefficients. Similar to mountainous watersheds in semi-arid and temperate watersheds, SSY from both the undisturbed and disturbed watersheds had the highest correlation with event maximum discharge, Qmax (Pearson's R=0.88 and 0.86 respectively), and were best fit by a power law relationship. The resulting model of event-SSY from Faga'alu is being incorporated as part of a larger

  12. Combined passive detection and ultrafast active imaging of cavitation events induced by short pulses of high-intensity ultrasound.

    Science.gov (United States)

    Gateau, Jérôme; Aubry, Jean-François; Pernot, Mathieu; Fink, Mathias; Tanter, Mickaël

    2011-03-01

    The activation of natural gas nuclei to induce larger bubbles is possible using short ultrasonic excitations of high amplitude, and is required for ultrasound cavitation therapies. However, little is known about the distribution of nuclei in tissues. Therefore, the acoustic pressure level necessary to generate bubbles in a targeted zone and their exact location are currently difficult to predict. To monitor the initiation of cavitation activity, a novel all-ultrasound technique sensitive to single nucleation events is presented here. It is based on combined passive detection and ultrafast active imaging over a large volume using the same multi-element probe. Bubble nucleation was induced using a focused transducer (660 kHz, f-number = 1) driven by a high-power electric burst (up to 300 W) of one to two cycles. Detection was performed with a linear array (4 to 7 MHz) aligned with the single-element focal point. In vitro experiments in gelatin gel and muscular tissue are presented. The synchronized passive detection enabled radio-frequency data to be recorded, comprising high-frequency coherent wave fronts as signatures of the acoustic emissions linked to the activation of the nuclei. Active change detection images were obtained by subtracting echoes collected in the unnucleated medium. These indicated the appearance of stable cavitating regions. Because of the ultrafast frame rate, active detection occurred as quickly as 330 μs after the high-amplitude excitation and the dynamics of the induced regions were studied individually.

  13. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    OpenAIRE

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitut...

  14. Protein phosphatases decrease their activity during capacitation: a new requirement for this event.

    Directory of Open Access Journals (Sweden)

    Janetti R Signorelli

    Full Text Available There are few reports on the role of protein phosphatases during capacitation. Here, we report on the role of PP2B, PP1, and PP2A during human sperm capacitation. Motile sperm were resuspended in non-capacitating medium (NCM, Tyrode's medium, albumin- and bicarbonate-free or in reconstituted medium (RCM, NCM plus 2.6% albumin/25 mM bicarbonate. The presence of the phosphatases was evaluated by western blotting and the subcellular localization by indirect immunofluorescence. The function of these phosphatases was analyzed by incubating the sperm with specific inhibitors: okadaic acid, I2, endothall, and deltamethrin. Different aliquots were incubated in the following media: 1 NCM; 2 NCM plus inhibitors; 3 RCM; and 4 RCM plus inhibitors. The percent capacitated sperm and phosphatase activities were evaluated using the chlortetracycline assay and a phosphatase assay kit, respectively. The results confirm the presence of PP2B and PP1 in human sperm. We also report the presence of PP2A, specifically, the catalytic subunit and the regulatory subunits PR65 and B. PP2B and PP2A were present in the tail, neck, and postacrosomal region, and PP1 was present in the postacrosomal region, neck, middle, and principal piece of human sperm. Treatment with phosphatase inhibitors rapidly (≤1 min increased the percent of sperm depicting the pattern B, reaching a maximum of ∼40% that was maintained throughout incubation; after 3 h, the percent of capacitated sperm was similar to that of the control. The enzymatic activity of the phosphatases decreased during capacitation without changes in their expression. The pattern of phosphorylation on threonine residues showed a sharp increase upon treatment with the inhibitors. In conclusion, human sperm express PP1, PP2B, and PP2A, and the activity of these phosphatases decreases during capacitation. This decline in phosphatase activities and the subsequent increase in threonine phosphorylation may be an important

  15. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    Science.gov (United States)

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

  16. Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53

    International Nuclear Information System (INIS)

    O'Hagan, Heather M.; Ljungman, Mats

    2004-01-01

    It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation

  17. Icariin Is A PPARα Activator Inducing Lipid Metabolic Gene Expression in Mice

    Directory of Open Access Journals (Sweden)

    Yuan-Fu Lu

    2014-11-01

    Full Text Available Icariin is effective in the treatment of hyperlipidemia. To understand the effect of icariin on lipid metabolism, effects of icariin on PPARα and its target genes were investigated. Mice were treated orally with icariin at doses of 0, 100, 200, and 400 mg/kg, or clofibrate (500 mg/kg for five days. Liver total RNA was isolated and the expressions of PPARα and lipid metabolism genes were examined. PPARα and its marker genes Cyp4a10 and Cyp4a14 were induced 2-4 fold by icariin, and 4-8 fold by clofibrate. The fatty acid (FA binding and co-activator proteins Fabp1, Fabp4 and Acsl1 were increased 2-fold. The mRNAs of mitochondrial FA β-oxidation enzymes (Cpt1a, Acat1, Acad1 and Hmgcs2 were increased 2-3 fold. The mRNAs of proximal β-oxidation enzymes (Acox1, Ech1, and Ehhadh were also increased by icariin and clofibrate. The expression of mRNAs for sterol regulatory element-binding factor-1 (Srebf1 and FA synthetase (Fasn were unaltered by icariin. The lipid lysis genes Lipe and Pnpla2 were increased by icariin and clofibrate. These results indicate that icariin is a novel PPARα agonist, activates lipid metabolism gene expressions in liver, which could be a basis for its lipid-lowering effects and its beneficial effects against diabetes.

  18. Enhanced Virulence Gene Activity of Agrobacterium in Muskmelon (Cucumis melo L. cv. ‘Birdie’

    Directory of Open Access Journals (Sweden)

    Abul K.M. MOHIUDDIN

    2011-05-01

    Full Text Available Muskmelon (Cucumis melo L. cultivar ‘Birdie’, was evaluated for its response to the tumorigenic Agrobacterium tumefaciens and the oncogenic A. rhizogenes strains. Stem and petiole of three week-old in vitro-grown muskmelon plants were inoculated with five strains of A. tumefaciens and A. rhizogenes each and observed phenotypic expressions i.e. induction of crown galls and hairy roots. This phenotypic expression was efficaciously increased when virulence gene activity of different strains of two Agrobacterium species was enhanced. Intensive studies on enhancement of virulence gene activity of Agrobacterium found to be correlated to the appropriate light intensity (39.3 μmol m-2 s-1 with a specific concentration of monocyclic phenolic compound, acetosyringone (20 μM. The gene activity was also influenced by several other physical factors e.g. plant tissue type, Agrobacterium species and their strains, and plant tissue-Agrobacterium interaction. Among the different A. tumefaciens strains, LBA4404 showed the best virulence gene activity in both stem and petiole through the formation of higher rate of crown galls. On the other hand, strain 15834 of A. rhizogenes showed better gene activity in stem and 8196 in petiole through the formation of higher rate of hairy roots as well as higher average number of hairy roots. Among the two different types of explants, petiole was more susceptible to both Agrobacterium species. Thus it was concluded that future muskmelon transformation study can efficiently be carried out with LBA4404, 15834 and 8196 strains using petiole explants by adding 20 μM of acetosyringone in the medium.

  19. Dopamine signaling leads to loss of Polycomb repression and aberrant gene activation in experimental parkinsonism.

    Directory of Open Access Journals (Sweden)

    Erik Södersten

    2014-09-01

    Full Text Available Polycomb group (PcG proteins bind to and repress genes in embryonic stem cells through lineage commitment to the terminal differentiated state. PcG repressed genes are commonly characterized by the presence of the epigenetic histone mark H3K27me3, catalyzed by the Polycomb repressive complex 2. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation. The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP experiments showed that increased H3K27me3S28p was accompanied by reduced PcG binding to regulatory regions of genes. An analysis of the genome wide distribution of L-DOPA-induced H3K27me3S28 phosphorylation by ChIP sequencing (ChIP-seq in combination with expression analysis by RNA-sequencing (RNA-seq showed that the induction of H3K27me3S28p correlated with increased expression of a subset of PcG repressed genes. We found that induction of H3K27me3S28p persisted during chronic L-DOPA administration to parkisonian mice and correlated with aberrant gene expression. We propose that dopaminergic transmission can activate PcG repressed genes in the adult brain and thereby contribute to long-term maladaptive responses including the motor complications, or dyskinesia, caused by prolonged administration of L-DOPA in Parkinson's disease.

  20. Investigation of the mechanisms by which UV irradiation activates the tyrosinase gene

    International Nuclear Information System (INIS)

    Bao, Y.

    2000-04-01

    Tyrosinase, tyrosinase related protein-1 (TRP-1) and tyrosinase related protein-2 (TRP-2) are the enzymes involved in melanin pigment synthesis. They are expressed specifically in melanocytic cells. UV irradiation is the major physiological stimulant of melanogenesis. Tyrosinase is the rate-limiting enzyme in melanin synthesis and its activity is regulated by UV irradiation in melanocytes. The molecular mechanism underlying the activation of tyrosinase by UV is still not clear. In this thesis, the effects of UV irradiation on tyrosinase, TRP-1 and TRP-2 gene expression in mouse B16 melanoma cells were studied as well as the effects of UV irradiation on the activity of the tyrosinase promoter in mouse, and human melanoma cells. UV irradiation caused an increase in tyrosinase mRNA level, without change in either TRP-1 or TRP-2 mRNA levels, as determined by Northern blot analysis. In order to determine whether UV- induced increase of tyrosinase mRNA expression involved modulation of tyrosinase promoter activity, transient transfection approaches involving a series of constructs containing either chloramphenicol acetyl transferase (CAT) or luciferase reporter genes linked to different lengths of the tyrosinase gene- promoter were used. UV irradiation specifically induced CAT gene expression from both the mouse and the human tyrosinase promoters, suggesting that UV irradiation induced the transcription of the tyrosinase gene. These observations indicated that the promoter region between -250 and -150 bp of the human tyrosinase promoter may contain important cis-regulatory elements involved in the UV response. To localise the cis-regulatory elements responsible for the UV response of the tyrosinase promoter, the 100-bp between -250 bp and -150 bp of the tyrosinase promoter was inserted upstream of a CAT reporter. It was shown that transcription from the 100-bp promoter fragment was activated by UV irradiation. Mutations of a potential cAMP response element (CRE) motif

  1. Integrating circadian activity and gene expression profiles to predict chronotoxicity of Drosophila suzukii response to insecticides.

    Science.gov (United States)

    Hamby, Kelly A; Kwok, Rosanna S; Zalom, Frank G; Chiu, Joanna C

    2013-01-01

    Native to Southeast Asia, Drosophila suzukii (Matsumura) is a recent invader that infests intact ripe and ripening fruit, leading to significant crop losses in the U.S., Canada, and Europe. Since current D. suzukii management strategies rely heavily on insecticide usage and insecticide detoxification gene expression is under circadian regulation in the closely related Drosophila melanogaster, we set out to determine if integrative analysis of daily activity patterns and detoxification gene expression can predict chronotoxicity of D. suzukii to insecticides. Locomotor assays were performed under conditions that approximate a typical summer or winter day in Watsonville, California, where D. suzukii was first detected in North America. As expected, daily activity patterns of D. suzukii appeared quite different between 'summer' and 'winter' conditions due to differences in photoperiod and temperature. In the 'summer', D. suzukii assumed a more bimodal activity pattern, with maximum activity occurring at dawn and dusk. In the 'winter', activity was unimodal and restricted to the warmest part of the circadian cycle. Expression analysis of six detoxification genes and acute contact bioassays were performed at multiple circadian times, but only in conditions approximating Watsonville summer, the cropping season, when most insecticide applications occur. Five of the genes tested exhibited rhythmic expression, with the majority showing peak expression at dawn (ZT0, 6am). We observed significant differences in the chronotoxicity of D. suzukii towards malathion, with highest susceptibility at ZT0 (6am), corresponding to peak expression of cytochrome P450s that may be involved in bioactivation of malathion. High activity levels were not found to correlate with high insecticide susceptibility as initially hypothesized. Chronobiology and chronotoxicity of D. suzukii provide valuable insights for monitoring and control efforts, because insect activity as well as insecticide timing

  2. Quantification of pancreatic cancer proteome and phosphorylome: indicates molecular events likely contributing to cancer and activity of drug targets.

    Directory of Open Access Journals (Sweden)

    David Britton

    Full Text Available LC-MS/MS phospho-proteomics is an essential technology to help unravel the complex molecular events that lead to and propagate cancer. We have developed a global phospho-proteomic workflow to determine activity of signaling pathways and drug targets in pancreatic cancer tissue for clinical application.Peptides resulting from tryptic digestion of proteins extracted from frozen tissue of pancreatic ductal adenocarcinoma and background pancreas (n = 12, were labelled with tandem mass tags (TMT 8-plex, separated by strong cation exchange chromatography, then were analysed by LC-MS/MS directly or first enriched for phosphopeptides using IMAC and TiO2, prior to analysis. In-house, commercial and freeware bioinformatic platforms were used to identify relevant biological events from the complex dataset.Of 2,101 proteins identified, 152 demonstrated significant difference in abundance between tumor and non-tumor tissue. They included proteins that are known to be up-regulated in pancreatic cancer (e.g. Mucin-1, but the majority were new candidate markers such as HIPK1 & MLCK. Of the 6,543 unique phosphopeptides identified (6,284 unique phosphorylation sites, 635 showed significant regulation, particularly those from proteins involved in cell migration (Rho guanine nucleotide exchange factors & MRCKα and formation of focal adhesions. Activator phosphorylation sites on FYN, AKT1, ERK2, HDAC1 and other drug targets were found to be highly modulated (≥2 fold in different cases highlighting their predictive power.Here we provided critical information enabling us to identify the common and unique molecular events likely contributing to cancer in each case. Such information may be used to help predict more bespoke therapy suitable for an individual case.

  3. Quantification of pancreatic cancer proteome and phosphorylome: indicates molecular events likely contributing to cancer and activity of drug targets.

    Science.gov (United States)

    Britton, David; Zen, Yoh; Quaglia, Alberto; Selzer, Stefan; Mitra, Vikram; Löβner, Christopher; Jung, Stephan; Böhm, Gitte; Schmid, Peter; Prefot, Petra; Hoehle, Claudia; Koncarevic, Sasa; Gee, Julia; Nicholson, Robert; Ward, Malcolm; Castellano, Leandro; Stebbing, Justin; Zucht, Hans Dieter; Sarker, Debashis; Heaton, Nigel; Pike, Ian

    2014-01-01

    LC-MS/MS phospho-proteomics is an essential technology to help unravel the complex molecular events that lead to and propagate cancer. We have developed a global phospho-proteomic workflow to determine activity of signaling pathways and drug targets in pancreatic cancer tissue for clinical application. Peptides resulting from tryptic digestion of proteins extracted from frozen tissue of pancreatic ductal adenocarcinoma and background pancreas (n = 12), were labelled with tandem mass tags (TMT 8-plex), separated by strong cation exchange chromatography, then were analysed by LC-MS/MS directly or first enriched for phosphopeptides using IMAC and TiO2, prior to analysis. In-house, commercial and freeware bioinformatic platforms were used to identify relevant biological events from the complex dataset. Of 2,101 proteins identified, 152 demonstrated significant difference in abundance between tumor and non-tumor tissue. They included proteins that are known to be up-regulated in pancreatic cancer (e.g. Mucin-1), but the majority were new candidate markers such as HIPK1 & MLCK. Of the 6,543 unique phosphopeptides identified (6,284 unique phosphorylation sites), 635 showed significant regulation, particularly those from proteins involved in cell migration (Rho guanine nucleotide exchange factors & MRCKα) and formation of focal adhesions. Activator phosphorylation sites on FYN, AKT1, ERK2, HDAC1 and other drug targets were found to be highly modulated (≥2 fold) in different cases highlighting their predictive power. Here we provided critical information enabling us to identify the common and unique molecular events likely contributing to cancer in each case. Such information may be used to help predict more bespoke therapy suitable for an individual case.

  4. Behavioral activation for dementia caregivers: scheduling pleasant events and enhancing communications

    OpenAIRE

    Au, Alma; Gallagher-Thompson, Dolores; Wong, Meng-Kong; Leung, Jess; Chan, Wai-Chi; Chan, Chun Chung; Lu, Hui-Jing; Lai, Man Kin; Chan, Kevin

    2015-01-01

    Alma Au,1,2 Dolores Gallagher-Thompson,3 Meng-Kong Wong,4 Jess Leung,4 Wai-Chi Chan,5 Chun Chung Chan,6 Hui-Jing Lu,1 Man Kin Lai,1 Kevin Chan11Department of Applied Social Sciences, 2Institute of Active Aging, The Hong Kong Polytechnic University, Hong Kong, People’s Republic of China; 3Department of Psychiatry and Behavioral Sciences and Geriatric Education Centre, School of Medicine, Stanford University, Stanford, CA, USA; 4Department of Psychiatry, United Christian Hosp...

  5. Earthquake precursory events around epicenters and local active faults; the cases of two inland earthquakes in Iran

    Science.gov (United States)

    Valizadeh Alvan, H.; Mansor, S.; Haydari Azad, F.

    2012-12-01

    The possibility of earthquake prediction in the frame of several days to few minutes before its occurrence has stirred interest among researchers, recently. Scientists believe that the new theories and explanations of the mechanism of this natural phenomenon are trustable and can be the basis of future prediction efforts. During the last thirty years experimental researches resulted in some pre-earthquake events which are now recognized as confirmed warning signs (precursors) of past known earthquakes. With the advances in in-situ measurement devices and data analysis capabilities and the emergence of satellite-based data collectors, monitoring the earth's surface is now a regular work. Data providers are supplying researchers from all over the world with high quality and validated imagery and non-imagery data. Surface Latent Heat Flux (SLHF) or the amount of energy exchange in the form of water vapor between the earth's surface and atmosphere has been frequently reported as an earthquake precursor during the past years. The accumulated stress in the earth's crust during the preparation phase of earthquakes is said to be the main cause of temperature anomalies weeks to days before the main event and subsequent shakes. Chemical and physical interactions in the presence of underground water lead to higher water evaporation prior to inland earthquakes. On the other hand, the leak of Radon gas occurred as rocks break during earthquake preparation causes the formation of airborne ions and higher Air Temperature (AT) prior to main event. Although co-analysis of direct and indirect observation for precursory events is considered as a promising method for future successful earthquake prediction, without proper and thorough knowledge about the geological setting, atmospheric factors and geodynamics of the earthquake-prone regions we will not be able to identify anomalies due to seismic activity in the earth's crust. Active faulting is a key factor in identification of the

  6. Subsidence hazards connected to quarrying activities in a karst area: the case of the Moncalvo sinkhole event (Piedmont, NW Italy

    Directory of Open Access Journals (Sweden)

    Bonetto, Sabrina

    2008-09-01

    Full Text Available Gypsum is an important raw material for constructions and other industrial sectors. In Piedmont (NW Italy, main gypsum bodies are located in the Monferrato area, where large open pits and underground quarries are present. The gypsum-bearing formation outcropping in this area shows typical geological, structural, and hydrogeological features, which affect the quarrying and the related interaction with natural phenomena, human activities, and land use. In particular, gypsum karst has considerable influence on mining operations, as well as mining operations can produce strong impact on gypsum karst. In Monferrato, a specific case of interaction between the quarrying activity and geological, hydrogeological, and territorial setting is represented by the event of water inrush that happened in the Moncalvo underground quarry in association with the development of a surface sinkhole phenomenon.

  7. Change and Stability in Active and Passive Social Influence Dynamics during Natural Drinking Events: A Longitudinal Measurement-Burst Study

    Science.gov (United States)

    Cullum, Jerry; O’Grady, Megan; Armeli, Stephen; Tennen, Howard

    2011-01-01

    We examined the link between social norms and active social influences occurring during natural social drinking contexts. Across 4 yearly measurement-bursts, college students (N = 523) reported daily for 30-day periods on drinking norms, drinking offers, how many drinks they accepted, and personal drinking levels during social drinking events. In contexts where drinking norms were higher, students were more likely to both receive and comply with drinking offers. These acute social influences were highly stable throughout college, but affected men and women differently across time: Women received more drinking offers than men, especially at the beginning of college and when norms were higher, but men complied with more drinking offers per occasion. These effects were not attributable to between-person differences in social drinking motives or drinking levels, nor to within-person patterns of situation-selection. The present work suggests that context-specific drinking norms catalyze active social influence attempts, and further promote compliance drinking. PMID:22661826

  8. Resolving Early Signaling Events in T-Cell Activation Leading to IL-2 and FOXP3 Transcription

    Directory of Open Access Journals (Sweden)

    Jeffrey P. Perley

    2014-11-01

    Full Text Available Signal intensity and feedback regulation are known to be major factors in the signaling events stemming from the T-cell receptor (TCR and its various coreceptors, but the exact nature of these relationships remains in question. We present a mathematical model of the complex signaling network involved in T-cell activation with cross-talk between the Erk, calcium, PKC and mTOR signaling pathways. The model parameters are adjusted to fit new and published data on TCR trafficking, Zap70, calcium, Erk and Isignaling. The regulation of the early signaling events by phosphatases, CD45 and SHP1, and the TCR dynamics are critical to determining the behavior of the model. Additional model corroboration is provided through quantitative and qualitative agreement with experimental data collected under different stimulating and knockout conditions. The resulting model is analyzed to investigate how signal intensity and feedback regulation affect TCR- and coreceptor-mediated signal transduction and their downstream transcriptional profiles to predict the outcome for a variety of stimulatory and knockdown experiments. Analysis of the model shows that: (1 SHP1 negative feedback is necessary for preventing hyperactivity in TCR signaling; (2 CD45 is required for TCR signaling, but also partially suppresses it at high expression levels; and (3 elevated FOXP3 and reduced IL-2 signaling, an expression profile often associated with T regulatory cells (Tregs, is observed when the system is subjected to weak TCR and CD28 costimulation or a severe reduction in CD45 activity.

  9. Nerve Growth Factor Gene Therapy Activates Neuronal Responses in Alzheimer’s Disease

    Science.gov (United States)

    Tuszynski, Mark H.; Yang, Jennifer H.; Barba, David; U, H S.; Bakay, Roy; Pay, Mary M.; Masliah, Eliezer; Conner, James M.; Kobalka, Peter; Roy, Subhojit; Nagahara, Alan H.

    2016-01-01

    IMPORTANCE Alzheimer’s disease (AD) is the most common neurodegenerative disorder, and lacks effective disease modifying therapies. In 2001 we initiated a clinical trial of Nerve Growth Factor (NGF) gene therapy in AD, the first effort at gene delivery in an adult neurodegenerative disorder. This program aimed to determine whether a nervous system growth factor prevents or reduces cholinergic neuronal degeneration in AD patients. We present post-mortem findings in 10 subjects with survival times ranging from 1 to 10 years post-treatment. OBJECTIVE To determine whether degenerating neurons in AD retain an ability to respond to a nervous system growth factor delivered after disease onset. DESIGN, SETTING, AND PARTICIPANTS 10 patients with early AD underwent NGF gene therapy using either ex vivo or in vivo gene transfer. The brains of all eight patients in the first Phase 1 ex vivo trial and two patients in a subsequent Phase 1 in vivo trial were examined. MAIN OUTCOME MEASURES Brains were immunolabeled to evaluate in vivo gene expression, cholinergic neuronal responses to NGF, and activation of NGF-related cell signaling. In two cases, NGF protein levels were measured by ELISA. RESULTS Degenerating neurons in the AD brain respond to NGF. All patients exhibited a trophic response to NGF, in the form of axonal sprouting toward the NGF source. Comparing treated and non-treated sides of the brain in three patients that underwent unilateral gene transfer, cholinergic neuronal hypertrophy occurred on the NGF-treated side (P>0.05). Activation of cellular signaling and functional markers were present in two patients that underwent AAV2-mediated NGF gene transfer. Neurons exhibiting tau pathology as well as neurons free of tau expressed NGF, indicating that degenerating cells can be infected with therapeutic genes with resulting activation of cell signaling. No adverse pathological effects related to NGF were observed. CONCLUSIONS AND RELEVANCE These findings indicate that

  10. Enhanced synaptic activity and epileptiform events in the embryonic Kcc2 deficient hippocampus

    Directory of Open Access Journals (Sweden)

    Ilgam eKhalilov

    2011-11-01

    Full Text Available The neuronal potassium-chloride co-transporter Kcc2 is thought to play an important role in the post natal excitatory to inhibitory switch of GABA actions in the rodent hippocampus. Here, by studying hippocampi of wild-type (Kcc2+/+ and Kcc2 deficient (Kcc2-/- mouse embryos, we unexpectedly found increased spontaneous neuronal network activity at E18.5, a developmental stage when Kcc2 is thought not to be functional in the hippocampus. Embryonic Kcc2-/- hippocampi have also an augmented synapse density and a higher frequency of spontaneous glutamatergic and GABAergic postsynaptic currents (PSCs than naïve age matched neurons. However, intracellular chloride concentration ([Cl-]i and the reversal potential of GABA-mediated currents (EGABA were similar in embryonic Kcc2+/+ and Kcc2-/- CA3 neurons. In addition, Kcc2 immuno-labelling was cytoplasmic in the majority of neurons suggesting that the molecule is not functional as a plasma membrane chloride co-transporter. Collectively, our results show that already at an embryonic stage, Kcc2 controls the formation of synapses and, when deleted, the hippocampus has a higher density of GABAergic and glutamatergic synapses and generates spontaneous and evoked epileptiform activities. These results may be explained either by a small population of orchestrating neurons in which Kcc2 operates early as a chloride exporter or by transporter independent actions of Kcc2 that are instrumental in synapses formation and networks construction.

  11. Design and Test of an Event Detector and Locator for the ReflectoActive Seals System

    International Nuclear Information System (INIS)

    Stinson, Brad J.

    2006-01-01

    The purpose of this work was to research, design, develop and test a novel instrument for detecting fiber optic loop continuity and spatially locating fiber optic breaches. The work is for an active seal system called ReflectoActive(trademark) Seals whose purpose is to provide real time container tamper indication. A Field Programmable Gate Array was used to implement a loop continuity detector and a spatial breach locator based on a high acquisition speed single photon counting optical time domain reflectometer. Communication and other control features were added in order to create a usable instrument that met defined requirements. A host graphical user interface was developed to illustrate system use and performance. The resulting device meets performance specifications by exhibiting a dynamic range of 27dB and a spatial resolution of 1.5 ft. The communication scheme used expands installation options and allows the device to communicate to a central host via existing Local Area Networks and/or the Internet.

  12. Development of FEP database for geological and climatic disruptive events. Uplift, subsidence, earthquake activity, and climate change (Contract research)

    International Nuclear Information System (INIS)

    Sakai, Ryutaro; Takeda, Seiji; Kimura, Hideo; Matsuba, Hisashi

    2011-06-01

    In the safety assessment for a geological disposal of radioactive waste such as high-level radioactive waste, it is necessary to estimate the hydrological environmental changes affected by external factors such as long-termed earthquake activity and volcanic activity. Therefore it is important to perform the informations including a wide range of future processes and conditions of engineered barriers and geosphere in a systematic manner and to construct scenarios considering external factors. Generation of geological and climatic disruptive events such as earthquake activity, volcanic activity, uplift, subsidence, climatic change and sea-level change and propagation process of their impacts and their types are needed to be clarified in order to understand the phenomena of their influence on a disposal system in case of our country. Japan Atomic Energy Agency started to develop FEP database including the correlation of FEPs and FEP data sheet. This paper presents the FEP data base of upheaval, submergence, earthquake activity and climate change in this study and also presents the results of the questionnaire survey to external experts to update the technical reliability and to keep the objective view in selecting the critical safety correlations. (author)

  13. Truncating PREX2 mutations activate its GEF activity and alter gene expression regulation in NRAS-mutant melanoma

    KAUST Repository

    Lissanu Deribe, Yonathan

    2016-03-01

    PREX2 (phosphatidylinositol-3,4,5-triphosphate-dependent Rac-exchange factor 2) is a PTEN (phosphatase and tensin homolog deleted on chromosome 10) binding protein that is significantly mutated in cutaneous melanoma and pancreatic ductal adenocarcinoma. Here, genetic and biochemical analyses were conducted to elucidate the nature and mechanistic basis of PREX2 mutation in melanoma development. By generating an inducible transgenic mouse model we showed an oncogenic role for a truncating PREX2 mutation (PREX2E824*) in vivo in the context of mutant NRAS. Using integrative cross-species gene expression analysis, we identified deregulated cell cycle and cytoskeleton organization as significantly perturbed biological pathways in PREX2 mutant tumors. Mechanistically, truncation of PREX2 activated its Rac1 guanine nucleotide exchange factor activity, abolished binding to PTEN and activated the PI3K (phosphatidyl inositol 3 kinase)/Akt signaling pathway. We further showed that PREX2 truncating mutations or PTEN deletion induces down-regulation of the tumor suppressor and cell cycle regulator CDKN1C (also known as p57KIP2). This down-regulation occurs, at least partially, through DNA hypomethylation of a differentially methylated region in chromosome 11 that is a known regulatory region for expression of the CDKN1C gene. Together, these findings identify PREX2 as a mediator of NRAS-mutant melanoma development that acts through the PI3K/PTEN/Akt pathway to regulate gene expression of a cell cycle regulator.

  14. Truncating PREX2 mutations activate its GEF activity and alter gene expression regulation in NRAS-mutant melanoma.

    Science.gov (United States)

    Lissanu Deribe, Yonathan; Shi, Yanxia; Rai, Kunal; Nezi, Luigi; Amin, Samir B; Wu, Chia-Chin; Akdemir, Kadir C; Mahdavi, Mozhdeh; Peng, Qian; Chang, Qing Edward; Hornigold, Kirsti; Arold, Stefan T; Welch, Heidi C E; Garraway, Levi A; Chin, Lynda

    2016-03-01

    PREX2 (phosphatidylinositol-3,4,5-triphosphate-dependent Rac-exchange factor 2) is a PTEN (phosphatase and tensin homolog deleted on chromosome 10) binding protein that is significantly mutated in cutaneous melanoma and pancreatic ductal adenocarcinoma. Here, genetic and biochemical analyses were conducted to elucidate the nature and mechanistic basis of PREX2 mutation in melanoma development. By generating an inducible transgenic mouse model we showed an oncogenic role for a truncating PREX2 mutation (PREX2(E824)*) in vivo in the context of mutant NRAS. Using integrative cross-species gene expression analysis, we identified deregulated cell cycle and cytoskeleton organization as significantly perturbed biological pathways in PREX2 mutant tumors. Mechanistically, truncation of PREX2 activated its Rac1 guanine nucleotide exchange factor activity, abolished binding to PTEN and activated the PI3K (phosphatidyl inositol 3 kinase)/Akt signaling pathway. We further showed that PREX2 truncating mutations or PTEN deletion induces down-regulation of the tumor suppressor and cell cycle regulator CDKN1C (also known as p57(KIP2)). This down-regulation occurs, at least partially, through DNA hypomethylation of a differentially methylated region in chromosome 11 that is a known regulatory region for expression of the CDKN1C gene. Together, these findings identify PREX2 as a mediator of NRAS-mutant melanoma development that acts through the PI3K/PTEN/Akt pathway to regulate gene expression of a cell cycle regulator.

  15. Truncating PREX2 mutations activate its GEF activity and alter gene expression regulation in NRAS-mutant melanoma

    KAUST Repository

    Lissanu Deribe, Yonathan; Shi, Yanxia; Rai, Kunal; Nezi, Luigi; Amin, Samir B.; Wu, Chia-Chin; Akdemir, Kadir C.; Mahdavi, Mozhdeh; Peng, Qian; Chang, Qing Edward; Hornigold, Kirsti; Arold, Stefan T.; Welch, Heidi C. E.; Garraway, Levi A.; Chin, Lynda

    2016-01-01

    PREX2 (phosphatidylinositol-3,4,5-triphosphate-dependent Rac-exchange factor 2) is a PTEN (phosphatase and tensin homolog deleted on chromosome 10) binding protein that is significantly mutated in cutaneous melanoma and pancreatic ductal adenocarcinoma. Here, genetic and biochemical analyses were conducted to elucidate the nature and mechanistic basis of PREX2 mutation in melanoma development. By generating an inducible transgenic mouse model we showed an oncogenic role for a truncating PREX2 mutation (PREX2E824*) in vivo in the context of mutant NRAS. Using integrative cross-species gene expression analysis, we identified deregulated cell cycle and cytoskeleton organization as significantly perturbed biological pathways in PREX2 mutant tumors. Mechanistically, truncation of PREX2 activated its Rac1 guanine nucleotide exchange factor activity, abolished binding to PTEN and activated the PI3K (phosphatidyl inositol 3 kinase)/Akt signaling pathway. We further showed that PREX2 truncating mutations or PTEN deletion induces down-regulation of the tumor suppressor and cell cycle regulator CDKN1C (also known as p57KIP2). This down-regulation occurs, at least partially, through DNA hypomethylation of a differentially methylated region in chromosome 11 that is a known regulatory region for expression of the CDKN1C gene. Together, these findings identify PREX2 as a mediator of NRAS-mutant melanoma development that acts through the PI3K/PTEN/Akt pathway to regulate gene expression of a cell cycle regulator.

  16. LWD–TCP complex activates the morning gene CCA1 in Arabidopsis

    Science.gov (United States)

    Wu, Jing-Fen; Tsai, Huang-Lung; Joanito, Ignasius; Wu, Yi-Chen; Chang, Chin-Wen; Li, Yi-Hang; Wang, Ying; Hong, Jong Chan; Chu, Jhih-Wei; Hsu, Chao-Ping; Wu, Shu-Hsing

    2016-01-01

    A double-negative feedback loop formed by the morning genes CIRCADIAN CLOCK ASSOCIATED1 (CCA1)/LATE ELONGATED HYPOCOTYL (LHY) and the evening gene TIMING OF CAB EXPRESSION1 (TOC1) contributes to regulation of the circadian clock in Arabidopsis. A 24-h circadian cycle starts with the peak expression of CCA1 at dawn. Although CCA1 is targeted by multiple transcriptional repressors, including PSEUDO-RESPONSE REGULATOR9 (PRR9), PRR7, PRR5 and CCA1 HIKING EXPEDITION (CHE), activators of CCA1 remain elusive. Here we use mathematical modelling to infer a co-activator role for LIGHT-REGULATED WD1 (LWD1) in CCA1 expression. We show that the TEOSINTE BRANCHED 1-CYCLOIDEA-PCF20 (TCP20) and TCP22 proteins act as LWD-interacting transcriptional activators. The concomitant binding of LWD1 and TCP20/TCP22 to the TCP-binding site in the CCA1 promoter activates CCA1. Our study reveals activators of the morning gene CCA1 and provides an action mechanism that ensures elevated expression of CCA1 at dawn to sustain a robust clock. PMID:27734958

  17. LWD-TCP complex activates the morning gene CCA1 in Arabidopsis.

    Science.gov (United States)

    Wu, Jing-Fen; Tsai, Huang-Lung; Joanito, Ignasius; Wu, Yi-Chen; Chang, Chin-Wen; Li, Yi-Hang; Wang, Ying; Hong, Jong Chan; Chu, Jhih-Wei; Hsu, Chao-Ping; Wu, Shu-Hsing

    2016-10-13

    A double-negative feedback loop formed by the morning genes CIRCADIAN CLOCK ASSOCIATED1 (CCA1)/LATE ELONGATED HYPOCOTYL (LHY) and the evening gene TIMING OF CAB EXPRESSION1 (TOC1) contributes to regulation of the circadian clock in Arabidopsis. A 24-h circadian cycle starts with the peak expression of CCA1 at dawn. Although CCA1 is targeted by multiple transcriptional repressors, including PSEUDO-RESPONSE REGULATOR9 (PRR9), PRR7, PRR5 and CCA1 HIKING EXPEDITION (CHE), activators of CCA1 remain elusive. Here we use mathematical modelling to infer a co-activator role for LIGHT-REGULATED WD1 (LWD1) in CCA1 expression. We show that the TEOSINTE BRANCHED 1-CYCLOIDEA-PCF20 (TCP20) and TCP22 proteins act as LWD-interacting transcriptional activators. The concomitant binding of LWD1 and TCP20/TCP22 to the TCP-binding site in the CCA1 promoter activates CCA1. Our study reveals activators of the morning gene CCA1 and provides an action mechanism that ensures elevated expression of CCA1 at dawn to sustain a robust clock.

  18. Liver cell-derived microparticles activate hedgehog signaling and alter gene expression in hepatic endothelial cells.

    Science.gov (United States)

    Witek, Rafal P; Yang, Liu; Liu, Renshui; Jung, Youngmi; Omenetti, Alessia; Syn, Wing-Kin; Choi, Steve S; Cheong, Yeiwon; Fearing, Caitlin M; Agboola, Kolade M; Chen, Wei; Diehl, Anna Mae

    2009-01-01

    Angiogenesis contributes to vascular remodeling during cirrhosis. In cirrhotic livers, cholangiocytes, and myofibroblastic hepatic stellate cells (MF-HSC) produce Hedgehog (Hh) ligands. During embryogenesis Hh ligands are released from ligand-producing cells in microparticles and activate Hh signaling in endothelial cells. We studied whether adult liver cell-derived microparticles contain Hh ligands that alter hepatic sinusoidal endothelial cells (SEC). MF-HSC and cholangiocytes were exposed to platelet-derived growth factor to induce Hh ligands; microparticles were isolated from medium, analyzed by transmission electron microscopy and immunoblots, and applied to Hh-reporter-containing cells. Microparticles were obtained from serum and bile of rats after bile duct ligation (BDL) or sham surgery and applied to normal primary liver SEC with or without cyclopamine, an Hh signaling inhibitor. Effects on SEC gene expression were evaluated by quantitative reverse-transcription polymerase chain reaction and immunoblotting. Hh target gene expression and SEC activation markers were compared in primary SEC and in liver sections from healthy and BDL rats. Platelet-derived growth factor-treated MF-HSC and cholangiocytes released exosome-enriched microparticles containing biologically-active Hh ligands. BDL increased release of Hh-containing exosome-enriched microparticles into plasma and bile. Transmission electron microscopy and immunoblots revealed similarities among microparticles from all sources; all microparticles induced similar Hh-dependent changes in SEC gene expression. SEC from healthy livers did not express Hh target genes or activation markers, but both were up-regulated in SEC after BDL. Hh-containing exosome-enriched microparticles released from liver cells alter hepatic SEC gene expression, suggesting a novel mechanism for cirrhotic vasculopathy.

  19. Influence of the gene xthA in the activation of SOS response of Escherichia coli

    International Nuclear Information System (INIS)

    Dominguez M, V.

    2013-01-01

    The SOS response is one of the strategies that has Escherichia coli to counteract the lesions in the genetic material. The response is integrated for approximately 60 genes that when are activated they provide to the cell a bigger opportunity to survive. For the activation of this system is necessary that DNA regions of simple chain are generated, in such a way that most of the lesions should be processed, to be able to induce this answer. Some genes that intervene in this procedure, as recO, recB and recJ are recognized since when being exposed to the radiation, their activity SOS is smaller than in a wild strain. In previous works has been studied that to inactivate the genes that are involves in the lesions processing to generate DNA of simple chain, the SOS induction level diminishes with regard to a wild strain, but that when eliminating the genes that are involves directly in the repair, the SOS response increases. In this work a strain with defects in the gene xthA was built, which encodes for an endonuclease AP that participates in the repair mechanism by base excision and was evaluated their sensibility as the activity of the SOS response when exposing it to UV light and gamma radiation. The results showed that the lethality of the strain with the defect is very similar to the wild strain; while the activation level of the SOS response is bigger in comparison with the wild strain when being exposed to UV light; suggesting the existence of an enzyme that recognizes the lesions that produces this radiation, however, is not this the main repair channel, since the survival is similar to that of the wild strain. On the contrary, the results obtained with gamma radiation showed that the lethality diminishes in comparison to that of the wild strain, like the SOS activity; due surely to that the gene product intervenes in the repair for base excision, participating in the formation of the previous substrate to the activation of the SOS response. (Author)

  20. An effort to 'leverage' the effect of participation in a mass event on physical activity.

    Science.gov (United States)

    Lane, Aoife; Murphy, Niamh; Bauman, Adrian

    2015-09-01

    Despite the considerable interest in community-based physical activity (PA) interventions, there is a lack of clarity on which strategies are most effective and most likely to work in different contexts. The purpose of this study was to use existing community resources to promote PA in a population sample of insufficiently active women using a cluster RCT design. Participants (n = 402) were grouped into 32 geographical-based clusters, which were randomly allocated into 16 intervention (n = 193) and 16 control (n = 209) regions. The intervention was delivered in conjunction with regional units of the Irish Sports Council; participants received a pack containing tailored information about local PA options in their community, training plans, stage-matched behaviour change booklets and a pedometer. Control participants received health promotion leaflets. Evaluation was conducted using the RE-AIM framework to assess both effectiveness and generalizability. Repeated measures ANOVAs with adjustment for clustering revealed that both groups displayed an approximate 39 min increase in PA, but decreases in sitting were greater in the intervention group than the control group (32.9 versus 1.2 min). Recall of materials was high ranging between 85 and 97% for the various intervention components. Finally, those who received higher doses of the intervention (three or more components) reported an approximate 50 min increase in PA compared with 18 min among those who did not use any aspect of the intervention. While no clear intervention effect was evident, this research was successful in linking and implementing good research design with PA promoting networks. © The Author (2013). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Effect of Gene and Physical Activity Interaction on Trunk Fat Percentage Among the Newfoundland Population

    Directory of Open Access Journals (Sweden)

    Anthony Payne

    2014-01-01

    Full Text Available Objective To explore the effect of FTO gene and physical activity interaction on trunk fat percentage. Design and Methods Subjects are 3,004 individuals from Newfoundland and Labrador whose trunk fat percentage and physical activity were recorded, and who were genotyped for 11 single-nucleotide polymorphisms (SNPs in the FTO gene. Subjects were stratified by gender. Multiple tests and multiple regressions were used to analyze the effects of physical activity, variants of FTO , age, and their interactions on trunk fat percentage. Dietary information and other environmental factors were not considered. Results Higher levels of physical activity tend to reduce trunk fat percentage in all individuals. Furthermore, in males, rs9939609 and rs1421085 were significant (α = 0.05 in explaining central body fat, but no SNPs were significant in females. For highly active males, trunk fat percentage varied significantly between variants of rs9939609 and rs1421085, but there is no significant effect among individuals with low activity. The other SNPs examined were not significant in explaining trunk fat percentage. Conclusions Homozygous male carriers of non-obesity risk alleles at rs9939609 and rs1421085 will have significant reduction in central body fat from physical activity in contrast to homozygous males of the obesity-risk alleles. The additive effect of these SNPs is found in males with high physical activity only.

  2. How To Select an Event Management System: A Guide to Selecting the Most Effective Resource Management System for College Union and Student Activities Professionals.

    Science.gov (United States)

    Anderson, Scott; Raasch, Kevin

    2002-01-01

    Provides an evaluation template for student activities professionals charged with evaluating competitive event scheduling software. Guides staff in making an informed decision on whether to retain event management technology provided through an existing vendor or choose "best-of-breed" scheduling software. (EV)

  3. Aberrant neuronal activity-induced signaling and gene expression in a mouse model of RASopathy.

    Directory of Open Access Journals (Sweden)

    Franziska Altmüller

    2017-03-01

    Full Text Available Noonan syndrome (NS is characterized by reduced growth, craniofacial abnormalities, congenital heart defects, and variable cognitive deficits. NS belongs to the RASopathies, genetic conditions linked to mutations in components and regulators of the Ras signaling pathway. Approximately 50% of NS cases are caused by mutations in PTPN11. However, the molecular mechanisms underlying cognitive impairments in NS patients are still poorly understood. Here, we report the generation and characterization of a new conditional mouse strain that expresses the overactive Ptpn11D61Y allele only in the forebrain. Unlike mice with a global expression of this mutation, this strain is viable and without severe systemic phenotype, but shows lower exploratory activity and reduced memory specificity, which is in line with a causal role of disturbed neuronal Ptpn11 signaling in the development of NS-linked cognitive deficits. To explore the underlying mechanisms we investigated the neuronal activity-regulated Ras signaling in brains and neuronal cultures derived from this model. We observed an altered surface expression and trafficking of synaptic glutamate receptors, which are crucial for hippocampal neuronal plasticity. Furthermore, we show that the neuronal activity-induced ERK signaling, as well as the consecutive regulation of gene expression are strongly perturbed. Microarray-based hippocampal gene expression profiling revealed profound differences in the basal state and upon stimulation of neuronal activity. The neuronal activity-dependent gene regulation was strongly attenuated in Ptpn11D61Y neurons. In silico analysis of functional networks revealed changes in the cellular signaling beyond the dysregulation of Ras/MAPK signaling that is nearly exclusively discussed in the context of NS at present. Importantly, changes in PI3K/AKT/mTOR and JAK/STAT signaling were experimentally confirmed. In summary, this study uncovers aberrant neuronal activity

  4. A Gene Implicated in Activation of Retinoic Acid Receptor Targets Is a Novel Renal Agenesis Gene in Humans

    DEFF Research Database (Denmark)

    Brophy, Patrick D.; Rasmussen, Maria; Parida, Mrutyunjaya

    2017-01-01

    investigations have identified several gene variants that cause RA, including EYA1, LHX1, and WT1 However, whereas compound null mutations of genes encoding α and γ retinoic acid receptors (RARs) cause RA in mice, to date there have been no reports of variants in RAR genes causing RA in humans. In this study, we...... in humans....

  5. Trichomonas vaginalis Cysteine Proteinases: Iron Response in Gene Expression and Proteolytic Activity

    Science.gov (United States)

    Cárdenas-Guerra, Rosa Elena; Figueroa-Angulo, Elisa Elvira; Puente-Rivera, Jonathan; Zamudio-Prieto, Olga; Ortega-López, Jaime

    2015-01-01

    We focus on the iron response of Trichomonas vaginalis to gene family products such as the cysteine proteinases (CPs) involved in virulence properties. In particular, we examined the effect of iron on the gene expression regulation and function of cathepsin L-like and asparaginyl endopeptidase-like CPs as virulence factors. We addressed some important aspects about CPs genomic organization and we offer possible explanations to the fact that only few members of this large gene family are expressed at the RNA and protein levels and the way to control their proteolytic activity. We also summarized all known iron regulations of CPs at transcriptional, posttranscriptional, and posttranslational levels along with new insights into the possible epigenetic and miRNA processes. PMID:26090464

  6. Prepatterning of developmental gene expression by modified histones before zygotic genome activation

    DEFF Research Database (Denmark)

    Lindeman, Leif C.; Andersen, Ingrid S.; Reiner, Andrew H.

    2011-01-01

    A hallmark of anamniote vertebrate development is a window of embryonic transcription-independent cell divisions before onset of zygotic genome activation (ZGA). Chromatin determinants of ZGA are unexplored; however, marking of developmental genes by modified histones in sperm suggests a predictive...... role of histone marks for ZGA. In zebrafish, pre-ZGA development for ten cell cycles provides an opportunity to examine whether genomic enrichment in modified histones is present before initiation of transcription. By profiling histone H3 trimethylation on all zebrafish promoters before and after ZGA......, we demonstrate here an epigenetic prepatterning of developmental gene expression. This involves pre-ZGA marking of transcriptionally inactive genes involved in homeostatic and developmental regulation by permissive H3K4me3 with or without repressive H3K9me3 or H3K27me3. Our data suggest that histone...

  7. Inoculum pretreatment affects bacterial survival, activity and catabolic gene expression during phytoremediation of diesel contaminated soil.

    Science.gov (United States)

    Khan, Sumia; Afzal, Muhammad; Iqbal, Samina; Mirza, Muhammad Sajjad; Khan, Qaiser M

    2013-04-01

    Plant-bacteria partnership is a promising approach for remediating soil contaminated with organic pollutants. The colonization and metabolic activity of an inoculated microorganism depend not only on environmental conditions but also on the physiological condition of the applied microorganisms. This study assessed the influence of different inoculum pretreatments on survival, gene abundance and catabolic gene expression of an applied strain (Pantoea sp. strain BTRH79) in the rhizosphere of ryegrass vegetated in diesel contaminated soil. Maximum bacterium survival, gene abundance and expression were observed in the soil inoculated with bacterial cells that had been pregrown on complex medium, and hydrocarbon degradation and genotoxicity reduction were also high in this soil. These findings propose that use of complex media for growing plant inocula may enhance bacterial survival and colonization and subsequently the efficiency of pollutant degradation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. A population of highly energetic transient events in the centres of active galaxies

    Science.gov (United States)

    Kankare, E.; Kotak, R.; Mattila, S.; Lundqvist, P.; Ward, M. J.; Fraser, M.; Lawrence, A.; Smartt, S. J.; Meikle, W. P. S.; Bruce, A.; Harmanen, J.; Hutton, S. J.; Inserra, C.; Kangas, T.; Pastorello, A.; Reynolds, T.; Romero-Cañizales, C.; Smith, K. W.; Valenti, S.; Chambers, K. C.; Hodapp, K. W.; Huber, M. E.; Kaiser, N.; Kudritzki, R.-P.; Magnier, E. A.; Tonry, J. L.; Wainscoat, R. J.; Waters, C.

    2017-12-01

    Recent all-sky surveys have led to the discovery of new types of transients. These include stars disrupted by the central supermassive black hole, and supernovae that are 10-100 times more energetic than typical ones. However, the nature of even more energetic transients that apparently occur in the innermost regions of their host galaxies is hotly debated1-3. Here we report the discovery of the most energetic of these to date: PS1-10adi, with a total radiated energy of 2.3 × 1052 erg. The slow evolution of its light curve and persistently narrow spectral lines over ˜ 3 yr are inconsistent with known types of recurring black hole variability. The observed properties imply powering by shock interaction between expanding material and large quantities of surrounding dense matter. Plausible sources of this expanding material are a star that has been tidally disrupted by the central black hole, or a supernova. Both could satisfy the energy budget. For the former, we would be forced to invoke a new and hitherto unseen variant of a tidally disrupted star, while a supernova origin relies principally on environmental effects resulting from its nuclear location. Remarkably, we also discover that PS1-10adi is not an isolated case. We therefore surmise that this new population of transients has previously been overlooked due to incorrect association with underlying central black hole activity.

  9. Semantic activation by Japanese kanji: evidence from event-related potentials.

    Science.gov (United States)

    Hayashi, M; Kayamoto, Y; Tanaka, H; Yamada, J

    1998-04-01

    In a character-judgment paradigm, the subject quickly pressed a key when a hiragana (Japanese syllabary) appeared on a display and did nothing when a kanji (Japanese logograph) appeared. The amplitude of the N400 component was compared when four types of visual stimuli were used: (Type 1) single kanji--Grade 1- to 3-level words, (Type 2) single kanji--Grade 1- to 3-level bound morphemes, (Type 3) single kanji--high school- and college-level bound morphemes, and (Type 4) obsolete kanji. Analysis showed that N400 was largest in the temporal-occipital areas for the Type 1 stimuli and larger in the right parietal area for Type 2 than Type 3 stimuli. The analyses of N400 to semantic stimulations have been conducted and discussed in terms of their meaningfulness, age when writing of these kanji was mastered, and linguistic status (kanji versus nonkanji). Most interestingly, the Types 3 and 4 kanji did not activate semantic responses, showing that they did not function as linguistic units, i.e., kanji, in the mental lexicon.

  10. Mechanical stress activates Smad pathway through PKCδ to enhance interleukin-11 gene transcription in osteoblasts.

    Directory of Open Access Journals (Sweden)

    Shinsuke Kido

    Full Text Available BACKGROUND: Mechanical stress rapidly induces ΔFosB expression in osteoblasts, which binds to interleukin (IL-11 gene promoter to enhance IL-11 expression, and IL-11 enhances osteoblast differentiation. Because bone morphogenetic proteins (BMPs also stimulate IL-11 expression in osteoblasts, there is a possibility that BMP-Smad signaling is involved in the enhancement of osteoblast differentiation by mechanical stress. The present study was undertaken to clarify whether mechanical stress affects BMP-Smad signaling, and if so, to elucidate the role of Smad signaling in mechanical stress-induced enhancement of IL-11 gene transcription. METHODOLOGY/PRINCIPAL FINDINGS: Mechanical loading by fluid shear stress (FSS induced phosphorylation of BMP-specific receptor-regulated Smads (BR-Smads, Smad1/5, in murine primary osteoblasts (mPOBs. FSS rapidly phosphorylated Y311 of protein kinase C (PKCδ, and phosphorylated PKCδ interacted with BR-Smads to phosphorylate BR-Smads. Transfection of PKCδ siRNA or Y311F mutant PKCδ abrogated BR-Smads phosphorylation and suppressed IL-11 gene transcription enhanced by FSS. Activated BR-Smads bound to the Smad-binding element (SBE of IL-11 gene promoter and formed complex with ΔFosB/JunD heterodimer via binding to the C-terminal region of JunD. Site-directed mutagenesis in the SBE and the AP-1 site revealed that both SBE and AP-1 sites were required for full activation of IL-11 gene promoter by FSS. CONCLUSIONS/SIGNIFICANCE: These results demonstrate that PKCδ-BR-Smads pathway plays an important role in the intracellular signaling in response to mechanical stress, and that a cross-talk between PKCδ-BR-Smads and ΔFosB/JunD pathways synergistically stimulates IL-11 gene transcription in response to mechanical stress.

  11. Chronic activation of the epithelial immune system of the fruit fly's salivary glands has a negative effect on organismal growth and induces a peculiar set of target genes

    Directory of Open Access Journals (Sweden)

    Abdelsadik Ahmed

    2010-04-01

    Full Text Available Abstract Background Epithelial and especially mucosal immunity represents the first line of defence against the plethora of potential pathogens trying to invade via the gastrointestinal tract. The salivary glands of the fruit fly are an indispensable part of the gastrointestinal tract, but their contribution to the mucosal immunity has almost completely been neglected. Our major goal was to elucidate if the fly's salivary glands are able to mount an immune response and what the major characteristics of this immune response are. Results Ectopic activation of the IMD-pathway within the salivary gland cells is able to induce an immune response, indicating that the salivary glands are indeed immune competent. This reaction is characterized by the concurrent expression of numerous antimicrobial peptide genes. In addition, ectopic activation of the salivary gland's immune response induces morphological changes such as dwarfism throughout all developmental stages and a significantly decreased length of the salivary glands themselves. DNA-microarray analyses of the reaction revealed a complex pattern of up- and downregulated genes. Gene ontology analyses of regulated genes revealed a significant increase in genes associated with ribosomal and proteasomal function. On the other hand, genes coding for peptide receptors and some potassium channels are downregulated. In addition, the comparison of the transcriptional events induced following IMD-activation in the trachea and the salivary glands shows also only a small overlap, indicating that the general IMD-activated core transcriptome is rather small and that the tissue specific component of this response is dominating. Among the regulated genes, those that code for signaling associated protease activity are significantly modulated. Conclusions The salivary glands are immune-competent and they contribute to the overall intestinal immune system. Although they produce antimicrobial peptides, their overall

  12. Gene expression profiling in Ishikawa cells: A fingerprint for estrogen active compounds

    International Nuclear Information System (INIS)

    Boehme, Kathleen; Simon, Stephanie; Mueller, Stefan O.

    2009-01-01

    Several anthropogenous and naturally occurring substances, referred to as estrogen active compounds (EACs), are able to interfere with hormone and in particular estrogen receptor signaling. EACs can either cause adverse health effects in humans and wildlife populations or have beneficial effects on estrogen-dependent diseases. The aim of this study was to examine global gene expression profiles in estrogen receptor (ER)-proficient Ishikawa plus and ER-deficient Ishikawa minus endometrial cancer cells treated with selected well-known EACs (Diethylstilbestrol, Genistein, Zearalenone, Resveratrol, Bisphenol A and o,p'-DDT). We also investigated the effect of the pure antiestrogen ICI 182,780 (ICI) on the expression patterns caused by these compounds. Transcript levels were quantified 24 h after compound treatment using Illumina BeadChip Arrays. We identified 87 genes with similar expression changes in response to all EAC treatments in Ishikawa plus. ICI lowered the magnitude or reversed the expression of these genes, indicating ER dependent regulation. Apart from estrogenic gene regulation, Bisphenol A, o,p'-DDT, Zearalenone, Genistein and Resveratrol displayed similarities to ICI in their expression patterns, suggesting mixed estrogenic/antiestrogenic properties. In particular, the predominant antiestrogenic expression response of Resveratrol could be clearly distinguished from the other test compounds, indicating a distinct mechanism of action. Divergent gene expression patterns of the phytoestrogens, as well as weaker estrogenic gene expression regulation determined for the anthropogenous chemicals Bisphenol A and o,p'-DDT, warrants a careful assessment of potential detrimental and/or beneficial effects of EACs. The characteristic expression fingerprints and the identified subset of putative marker genes can be used for screening chemicals with an unknown mode of action and for predicting their potential to exert endocrine disrupting effects

  13. Dysfunctional frontal lobe activity during inhibitory tasks in individuals with childhood trauma: An event-related potential study.

    Science.gov (United States)

    Kim, Sungkean; Kim, Ji Sun; Jin, Min Jin; Im, Chang-Hwan; Lee, Seung-Hwan

    2018-01-01

    Individuals who experience childhood trauma are vulnerable to various psychological and behavioral problems throughout their lifetime. This study aimed to investigate whether individuals with childhood trauma show altered frontal lobe activity during response inhibition tasks. In total, 157 healthy individuals were recruited and instructed to perform a Go/Nogo task during electroencephalography recording. Source activities of N2 and P3 of Nogo event-related potentials (ERP) were analyzed. The Childhood Trauma Questionnaire (CTQ) and Barratt Impulsivity Scale (BIS) were applied. Individuals were divided into three groups based on their total CTQ score: low CTQ, middle CTQ, and high CTQ groups. The high CTQ group exhibited significantly higher BIS scores than the low CTQ group. P3 amplitudes of the differences between Nogo and Go ERP waves exhibited higher mean values in the low CTQ than the high CTQ group, with trending effects. In Nogo-P3, the source activities of the right anterior cingulate cortex, bilateral medial frontal cortex (MFC), bilateral superior frontal gyrus (SFG), and right precentral gyrus were significantly lower in the high CTQ than the low CTQ group. Motor impulsivity showed a significant negative correlation with activities of the bilateral MFC and SFG in Nogo-P3 conditions. Our study revealed that individuals with childhood trauma have inhibitory failure and frontal lobe dysfunction in regions related to Nogo-P3.

  14. Association between angiotensin II receptor gene polymorphism and serum angiotensin converting enzyme (SACE) activity in patients with sarcoidosis

    OpenAIRE

    Takemoto, Y.; Sakatani, M.; Takami, S.; Tachibana, T.; Higaki, J.; Ogihara, T.; Miki, T.; Katsuya, T.; Tsuchiyama, T.; Yoshida, A.; Yu, H.; Tanio, Y.; Ueda, E.

    1998-01-01

    BACKGROUND—Serum angiotensin converting enzyme (SACE) is considered to reflect disease activity in sarcoidosis. SACE activity is increased in many patients with active sarcoid lesions. The mechanism for the increased SACE activity in this disease has not been clarified. ACE insertion/deletion (I/D) gene polymorphism has been reported to have an association with SACE levels in sarcoidosis, but no evidence of an association between angiotensin II receptor gene polymorphism and SA...

  15. Multi-level gene/MiRNA feature selection using deep belief nets and active learning.

    Science.gov (United States)

    Ibrahim, Rania; Yousri, Noha A; Ismail, Mohamed A; El-Makky, Nagwa M

    2014-01-01

    Selecting the most discriminative genes/miRNAs has been raised as an important task in bioinformatics to enhance disease classifiers and to mitigate the dimensionality curse problem. Original feature selection methods choose genes/miRNAs based on their individual features regardless of how they perform together. Considering group features instead of individual ones provides a better view for selecting the most informative genes/miRNAs. Recently, deep learning has proven its ability in representing the data in multiple levels of abstraction, allowing for better discrimination between different classes. However, the idea of using deep learning for feature selection is not widely used in the bioinformatics field yet. In this paper, a novel multi-level feature selection approach named MLFS is proposed for selecting genes/miRNAs based on expression profiles. The approach is based on both deep and active learning. Moreover, an extension to use the technique for miRNAs is presented by considering the biological relation between miRNAs and genes. Experimental results show that the approach was able to outperform classical feature selection methods in hepatocellular carcinoma (HCC) by 9%, lung cancer by 6% and breast cancer by around 10% in F1-measure. Results also show the enhancement in F1-measure of our approach over recently related work in [1] and [2].

  16. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    Science.gov (United States)

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  17. Gene activated by growth factors is related to the oncogene v-jun

    International Nuclear Information System (INIS)

    Ryder, K.; Lau, L.F.; Nathans, D.

    1988-01-01

    The authors have recently identified by cDNA cloning a set of genes that are rapidly activated in cultured mouse cells by protein growth factors. Here they report that the nucleotide sequence of a cDNA (clone 465) derived from one of these immediate early genes (hereafter called jun-B) encodes a protein homologous to that encoded by the avian sarcoma virus 17 oncogene v-jun. Homology between the jun-B and v-jun proteins is in two regions: one near the N terminus and the other at the C terminus. The latter sequence was shown to have regions of sequence similarity to the DNA-binding domain of the yeast transcriptional regulatory protein GCN4 and to the oncogenic protein fos. Southern blots of human, mouse, and chicken DNA demonstrate that jun-B and c-jun are different genes and that there may be other vertebrate genes related to jun-B and c-jun. These findings suggest that there is a jun family of genes encoding related transcriptional regulatory proteins. The jun-B protein, and perhaps other members of the jun family, may play a role in regulating the genomic response to growth factors

  18. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  19. Transcriptional Activity of Nuclear Factor κB Family Genes in Patients with Systemic Sclerosis.

    Science.gov (United States)

    Lis-Święty, Anna; Gola, Joanna; Mazurek, Urszula; Brzezińska-Wcisło, Ligia

    2017-05-01

    Systemic sclerosis (SSc) is a connective tissue disease of unknown etiology and unclear pathogenesis. Evaluation of the activation of nuclear factor κB (NF-κB) family genes IκBα, p50, p52, p65, and c-Rel, potentially involved in the regulation of immunity, inflammation, angiogenesis, and tissue remodeling in SSc, was carried out. The study included 19 patients with limited SSc, 11 patients with early SSc, and 10 healthy persons constituting the control group. Real-time QRT-PCR was used to evaluate the mRNAs in peripheral blood samples. The patients with early SSc showed a decrease in transcriptional activity of IκBα inhibitor and c-Rel subunit. Transcriptional activity decrease in the other patients with limited SSc included genes encoding c-Rel and p50, subunits of NF-κB factor. Deregulation of intracellular signal transduction by NF-κB takes place at the beginning of SSc and in its fibrosis stage. Associations between clinical variables and NF-κB related gene expression as well as the activation of NF-κB family members in SSc patients should be addressed in future studies. © 2017 by the Association of Clinical Scientists, Inc.

  20. Interleukin-21 gene polymorphism rs2221903 is associated with disease activity in patients with rheumatoid arthritis.

    Science.gov (United States)

    Malinowski, Damian; Paradowska-Gorycka, Agnieszka; Safranow, Krzysztof; Pawlik, Andrzej

    2017-08-01

    Interleukin-21 (IL-21) is a cytokine which plays a significant role in the pathogenesis and disease activity of rheumatoid arthritis (RA). Genetic polymorphisms in the IL-21 gene may alter the synthesis of IL-21. The aim of this study was to examine IL-21 and IL-21R polymorphisms in patients with RA. We examined 422 patients with RA and 338 healthy controls. Single nucleotide polymorphisms (SNPs) within the IL-21 (rs6822844 G>T, rs6840978 C>T, rs2221903 T>C) and IL-21R (rs2285452 G>A) genes were genotyped using TaqMan genotyping assays. There were no statistically significant differences in the distribution of studied genotypes and alleles between RA patients and the control group. To examine whether IL-21 polymorphisms affect disease activity in RA patients, we compared the distribution of IL-21 genotypes between patients with DAS28 ≤ 2.5 (patients with remission of disease symptoms) and patients with DAS28 > 2.5 (patients with active RA). Among patients with DAS28 > 2.5, increased prevalence of rs2221903 CT and CC genotypes was observed (OR = 1.54; 95% CI: 1.04-2.28; p = 0.035). The results of this study suggest that IL-21 and IL-21R gene polymorphisms are not risk loci for RA susceptibility, whereas the IL-21 rs2221903 polymorphism is associated with disease activity.

  1. Influence of apolipoprotein-E gene on lipid profile, physical activity and body fat relationship

    Directory of Open Access Journals (Sweden)

    Thales Boaventura Rachid Nascimento

    2012-03-01

    Full Text Available Physical activity and body fat modify lipemia, and this effect seems to be influenced by apolipoprotein-E (APOE gene polymorphism. Thus, the purpose of this article was to review main results of studies that have analyzed the relation of APOE gene with physical activity and body fat on triglycerides, total cholesterol and low (LDL and high density lipoprotein (HDL concentrations. The Scientific Electronic Library Online – SciELO, Web of Science and PubMed database were used to locate the articles. The keywords used in combination were: apoe genotype, apolipoprotein-E polymorphism, physical exercise, physical activity, aerobic exercise, body fat and obesity. Originals scientific investigations performed with humans were included, and excluded those ones which involved samples with diseases, except obesity and/or lipemic disorders. It was observed a trend, that ε2 allele carriers are the ones with the greater improvements on lipemia from physical exercise. In addition, the body fat impact on the elevation of triglycerides and LDL are stronger in carriers of the ε2 and ε4 allele, respectively. Considering the small number of originals scientific investigations and their divergent results, reliable inferences can not be made about the APOE gene polymorphism influences on physical activity and body fat effect on lipemia. Thus, further studies with others populations and more volunteers for allele, as well as others exercise modalities and intensities, are necessary.

  2. Altered gene activity correlated with long-term memory formation of conditioned taste aversion in Lymnaea.

    Science.gov (United States)

    Azami, Sachiyo; Wagatsuma, Akiko; Sadamoto, Hisayo; Hatakeyama, Dai; Usami, Takeshi; Fujie, Manabu; Koyanagi, Ryo; Azumi, Kaoru; Fujito, Yutaka; Lukowiak, Ken; Ito, Etsuro

    2006-11-15

    The pond snail Lymnaea stagnalis is capable of learning conditioned taste aversion (CTA) and then consolidating that learning into long-term memory (LTM) that persists for at least 1 month. LTM requires de novo protein synthesis and altered gene activity. Changes in gene activity in Lymnaea that are correlated with, much less causative, memory formation have not yet been identified. As a first step toward rectifying this situation, we constructed a cDNA microarray with mRNAs extracted from the central nervous system (CNS) of Lymnaea. We then, using this microarray assay, identified genes whose activity either increased or decreased following CTA memory consolidation. We also identified genes whose expression levels were altered after inhibition of the cyclic AMP response element-binding protein (CREB) that is hypothesized to be a key transcription factor for CTA memory. We found that the molluscan insulin-related peptide II (MIP II) was up-regulated during CTA-LTM, whereas the gene encoding pedal peptide preprohormone (Pep) was down-regulated by CREB2 RNA interference. We next examined mRNAs of MIP II and Pep using real-time RT-PCR with SYBR Green. The MIP II mRNA level in the CNS of snails exhibiting "good" memory for CTA was confirmed to be significantly higher than that from the CNS of snails exhibiting "poor" memory. In contrast, there was no significant difference in expression levels of the Pep mRNA between "good" and "poor" performers. These data suggest that in Lymnaea MIP II may play a role in the consolidation process that forms LTM following CTA training.

  3. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    Science.gov (United States)

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  4. Restricted expression of recombination activating gene (RAG-1) in mouse lymphoid tissues

    International Nuclear Information System (INIS)

    Yamamoto, Akihito; Fujinaga, Hiroyuki; Hamatani, Kiyohiro; Atsuta, Mitsuru.

    1993-03-01

    In an attempt to determine the distribution of recombinase activity in the mouse thymus, spleen, and lymph nodes, we used the in situ hybridization method to examine the expression of the recombination activating genes RAG-1 and RAG-2. Expression of RAG-1 was found in most cortical thymocytes but not in the majority of medullary thymocytes. Although hybridization signals of RAG-2 were not as intense as those of RAG-1, the localization of RAG-2 transcripts was similar to that of RAG-1. In the spleen, expression of RAG-1 was found only in limited cells near the splenic sinus, and the majority of the cells within the follicle were negative for RAG-1 transcript. In nude mice, RAG-1-expressing cells were detected in the same regions, which suggests that in situ hybridization signals of RAG-1 in the spleen are due to the cells of B-cell origin. In the lymph nodes, expression of RAG-1 was found only in the medullary region. Expression of RAG-2 transcript in the spleen and the lymph nodes, if any, was too faint to allow determination of the specific localization. These results suggest that most of the cortical thymocytes and some cells in the spleen are capable of rearranging T-cell receptor genes and immunoglobulin genes, respectively, but the possible involvement of the RAG-1 transcript in RAG-1-positive cells of the spleen and the lymph nodes in functions other than the rearrangement of genes could not be ruled out. (author)

  5. An inducible CRISPR-ON system for controllable gene activation in human pluripotent stem cells.

    Science.gov (United States)

    Guo, Jianying; Ma, Dacheng; Huang, Rujin; Ming, Jia; Ye, Min; Kee, Kehkooi; Xie, Zhen; Na, Jie

    2017-05-01

    Human pluripotent stem cells (hPSCs) are an important system to study early human development, model human diseases, and develop cell replacement therapies. However, genetic manipulation of hPSCs is challenging and a method to simultaneously activate multiple genomic sites in a controllable manner is sorely needed. Here, we constructed a CRISPR-ON system to efficiently upregulate endogenous genes in hPSCs. A doxycycline (Dox) inducible dCas9-VP64-p65-Rta (dCas9-VPR) transcription activator and a reverse Tet transactivator (rtTA) expression cassette were knocked into the two alleles of the AAVS1 locus to generate an iVPR hESC line. We showed that the dCas9-VPR level could be precisely and reversibly controlled by the addition and withdrawal of Dox. Upon transfection of multiplexed gRNA plasmid targeting the NANOG promoter and Dox induction, we were able to control NANOG gene expression from its endogenous locus. Interestingly, an elevated NANOG level promoted naïve pluripotent gene expression, enhanced cell survival and clonogenicity, and enabled hESCs to integrate with the inner cell mass (ICM) of mouse blastocysts in vitro. Thus, iVPR cells provide a convenient platform for gene function studies as well as high-throughput screens in hPSCs.

  6. CHD1 regulates cell fate determination by activation of differentiation-induced genes.

    Science.gov (United States)

    Baumgart, Simon J; Najafova, Zeynab; Hossan, Tareq; Xie, Wanhua; Nagarajan, Sankari; Kari, Vijayalakshmi; Ditzel, Nicholas; Kassem, Moustapha; Johnsen, Steven A

    2017-07-27

    The coordinated temporal and spatial activation of gene expression is essential for proper stem cell differentiation. The Chromodomain Helicase DNA-binding protein 1 (CHD1) is a chromatin remodeler closely associated with transcription and nucleosome turnover downstream of the transcriptional start site (TSS). In this study, we show that CHD1 is required for the induction of osteoblast-specific gene expression, extracellular-matrix mineralization and ectopic bone formation in vivo. Genome-wide occupancy analyses revealed increased CHD1 occupancy around the TSS of differentiation-activated genes. Furthermore, we observed that CHD1-dependent genes are mainly induced during osteoblast differentiation and are characterized by higher levels of CHD1 occupancy around the TSS. Interestingly, CHD1 depletion resulted in increased pausing of RNA Polymerase II (RNAPII) and decreased H2A.Z occupancy close to the TSS, but not at enhancer regions. These findings reveal a novel role for CHD1 during osteoblast differentiation and provide further insights into the intricacies of epigenetic regulatory mechanisms controlling cell fate determination. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Platelet-derived growth factor (PDGF) B-chain gene expression by activated blood monocytes precedes the expression of the PDGF A-chain gene

    International Nuclear Information System (INIS)

    Martinet, Y.; Jaffe, H.A.; Yamauchi, K.; Betsholtz, C.; Westermark, B.; Heldin, C.H.; Crystal, R.G.

    1987-01-01

    When activated, normal human blood monocytes are known to express the c-sis proto-oncogene coding for PDGF B-chain. Since normal human platelet PDGF molecules are dimers of A and B chains and platelets and monocytes are derived from the same marrow precursors, activated blood monocytes were simultaneously evaluated for their expression of PDGF A and B chain genes. Human blood monocytes were purified by adherence, cultured with or without activation by lipopolysaccharide and poly(A)+ RNA evaluated using Northern analysis and 32 P-labeled A-chain and B-chain (human c-sis) probes. Unstimulated blood monocytes did not express either A-chain or B-chain genes. In contrast, activated monocytes expressed a 4.2 kb mRNA B-chain transcript at 4 hr, but the B-chain mRNA levels declined significantly over the next 18 hr. In comparison, activated monocytes expressed very little A-chain mRNA at 4 hr, but at 12 hr 1.9, 2.3, and 2.8 kb transcripts were observed and persisted through 24 hr. Thus, activation of blood monocytes is followed by PDGF B-chain gene expression preceding PDGF A-chain gene expression, suggesting a difference in the regulation of the expression of the genes for these two chains by these cells

  8. Active ribosomal genes, translational homeostasis and oxidative stress in the pathogenesis of schizophrenia and autism.

    Science.gov (United States)

    Porokhovnik, Lev N; Passekov, Vladimir P; Gorbachevskaya, Nataliya L; Sorokin, Alexander B; Veiko, Nataliya N; Lyapunova, Nataliya A

    2015-04-01

    Infantile autism and schizophrenia are severe multifactorial disorders with a pronounced genetic predisposition. Their pathogeneses are often associated with oxidative stress in the brain. Previously, we established that a cell's resistance to oxidative stress depended on the copy number of transcriptionally active genes for rRNA (ribosomal genes) in the cell's genome. The feature is measured cytogenetically in cultured lymphocytes derived from patients. It varies from 120 up to 190 copies per diploid genome, with an arithmetic mean of 150±4 (SE) copies in a healthy population (n=239), being considerably lower, according to our previous results, in a sample of patients with rheumatoid arthritis (n=49), another multifactorial disease with a proven significant role of oxidative stress in its pathogenesis: from 115 to 165 copies, with a mean of 140±4 (SE). Conversely, a sample of schizophrenic patients (n=42) previously showed a higher value of copy number of active rRNA genes compared with a healthy population: from 145 to 190 copies, with a mean of 170±4. This fact is of special interest in the context of the well-known, but still unexplained phenomenon of the reduced comorbidity rate of schizophrenia and rheumatoid arthritis. The copy number of active ribosomal genes was estimated in a sample of autistic children (n=51). In contrast with the schizophrenic patients studied previously, we found that the values were significantly lower than those in the healthy population: from 125 to 160 copies, with a mean of 142±5. In this work, we suggest a mathematical model of the oxidative stress dynamics on the basis of Lotka-Volterra's approach to predator-prey interactions. In our model, the 'prey' represents reactive oxygen species, whereas the 'predator' simulates molecules of the antioxidant enzymes. The rate of biosynthesis of the latter is limited by the number of ribosomes available, which, in turn, is determined by the copy number of active rRNA genes. Analysis of

  9. Identification of a new gene regulatory circuit involving B cell receptor activated signaling using a combined analysis of experimental, clinical and global gene expression data

    Science.gov (United States)

    Schrader, Alexandra; Meyer, Katharina; Walther, Neele; Stolz, Ailine; Feist, Maren; Hand, Elisabeth; von Bonin, Frederike; Evers, Maurits; Kohler, Christian; Shirneshan, Katayoon; Vockerodt, Martina; Klapper, Wolfram; Szczepanowski, Monika; Murray, Paul G.; Bastians, Holger; Trümper, Lorenz; Spang, Rainer; Kube, Dieter

    2016-01-01

    To discover new regulatory pathways in B lymphoma cells, we performed a combined analysis of experimental, clinical and global gene expression data. We identified a specific cluster of genes that was coherently expressed in primary lymphoma samples and suppressed by activation of the B cell receptor (BCR) through αIgM treatment of lymphoma cells in vitro. This gene cluster, which we called BCR.1, includes numerous cell cycle regulators. A reduced expression of BCR.1 genes after BCR activation was observed in different cell lines and also in CD10+ germinal center B cells. We found that BCR activation led to a delayed entry to and progression of mitosis and defects in metaphase. Cytogenetic changes were detected upon long-term αIgM treatment. Furthermore, an inverse correlation of BCR.1 genes with c-Myc co-regulated genes in distinct groups of lymphoma patients was observed. Finally, we showed that the BCR.1 index discriminates activated B cell-like and germinal centre B cell-like diffuse large B cell lymphoma supporting the functional relevance of this new regulatory circuit and the power of guided clustering for biomarker discovery. PMID:27166259

  10. The costs associated with adverse event procedures for an international HIV clinical trial determined by activity-based costing.

    Science.gov (United States)

    Chou, Victoria B; Omer, Saad B; Hussain, Hamidah; Mugasha, Christine; Musisi, Maria; Mmiro, Francis; Musoke, Philippa; Jackson, J Brooks; Guay, Laura A

    2007-12-01

    To determine costs for adverse event (AE) procedures for a large HIV perinatal trial by analyzing actual resource consumption using activity-based costing (ABC) in an international research setting. The AE system for an ongoing clinical trial in Uganda was evaluated using ABC techniques to determine costs from the perspective of the study. Resources were organized into cost categories (eg, personnel, patient care expenses, laboratory testing, equipment). Cost drivers were quantified, and unit cost per AE was calculated. A subset of time and motion studies was performed prospectively to observe clinic personnel time required for AE identification. In 18 months, there were 9028 AEs, with 970 (11%) reported as serious adverse events. Unit cost per AE was $101.97. Overall, AE-related costs represented 32% ($920,581 of $2,834,692) of all study expenses. Personnel ($79.30) and patient care ($11.96) contributed the greatest proportion of component costs. Reported AEs were predominantly nonserious (mild or moderate severity) and unrelated to study drug(s) delivery. Intensive identification and management of AEs to conduct clinical trials ethically and protect human subjects require expenditure of substantial human and financial resources. Better understanding of these resource requirements should improve planning and funding of international HIV-related clinical trials.

  11. Neuronal DNA Methyltransferases: Epigenetic Mediators between Synaptic Activity and Gene Expression?

    Science.gov (United States)

    Bayraktar, Gonca; Kreutz, Michael R

    2018-04-01

    DNMT3A and 3B are the main de novo DNA methyltransferases (DNMTs) in the brain that introduce new methylation marks to non-methylated DNA in postmitotic neurons. DNA methylation is a key epigenetic mark that is known to regulate important cellular processes in neuronal development and brain plasticity. Accumulating evidence disclosed rapid and dynamic changes in DNA methylation of plasticity-relevant genes that are important for learning and memory formation. To understand how DNMTs contribute to brain function and how they are regulated by neuronal activity is a prerequisite for a deeper appreciation of activity-dependent gene expression in health and disease. This review discusses the functional role of de novo methyltransferases and in particular DNMT3A1 in the adult brain with special emphasis on synaptic plasticity, memory formation, and brain disorders.

  12. Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.

    Science.gov (United States)

    Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C

    2014-03-07

    To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.

  13. Common Variation in the DOPA Decarboxylase (DDC) Gene and Human Striatal DDC Activity In Vivo.

    Science.gov (United States)

    Eisenberg, Daniel P; Kohn, Philip D; Hegarty, Catherine E; Ianni, Angela M; Kolachana, Bhaskar; Gregory, Michael D; Masdeu, Joseph C; Berman, Karen F

    2016-08-01

    The synthesis of multiple amine neurotransmitters, such as dopamine, norepinephrine, serotonin, and trace amines, relies in part on DOPA decarboxylase (DDC, AADC), an enzyme that is required for normative neural operations. Because rare, loss-of-function mutations in the DDC gene result in severe enzymatic deficiency and devastating autonomic, motor, and cognitive impairment, DDC common genetic polymorphisms have been proposed as a source of more moderate, but clinically important, alterations in DDC function that may contribute to risk, course, or treatment response in complex, heritable neuropsychiatric illnesses. However, a direct link between common genetic variation in DDC and DDC activity in the living human brain has never been established. We therefore tested for this association by conducting extensive genotyping across the DDC gene in a large cohort of 120 healthy individuals, for whom DDC activity was then quantified with [(18)F]-FDOPA positron emission tomography (PET). The specific uptake constant, Ki, a measure of DDC activity, was estimated for striatal regions of interest and found to be predicted by one of five tested haplotypes, particularly in the ventral striatum. These data provide evidence for cis-acting, functional common polymorphisms in the DDC gene and support future work to determine whether such variation might meaningfully contribute to DDC-mediated neural processes relevant to neuropsychiatric illness and treatment.

  14. Cloning and characterization of the pheromone biosynthesis activating neuropeptide receptor gene in Spodoptera littoralis larvae.

    Science.gov (United States)

    Zheng, Lei; Lytle, Christian; Njauw, Ching-Ni; Altstein, Miriam; Martins-Green, Manuela

    2007-05-15

    In noctuid moths cuticular pigmentation is regulated by the pyrokinin/pheromone biosynthesis activating neuropeptide (PK/PBAN) family, which also mediates a variety of other functions in moths and other insects. Numerous studies have shown that these neuropeptides exert their functions through activation of the PBAN receptor (PBAN-R), with subsequent Ca(2+) influx, followed by either activation of cAMP or direct activation of downstream kinases. Recently, several PBAN-Rs have been identified, all of which are from the pheromone gland of adult female moths, but evidence shows that functional PK/PBAN-Rs can also be expressed in insect larvae, where they mediate melanization and possibly other functions (e.g., diapause). Here, we identified a gene encoding a G-protein-coupled receptor from the 5th instar larval tissue of the moth Spodoptera littoralis. The cDNA of this gene contains an open reading frame with a length of 1050 nucleotides, which translates to a 350-amino acid, 42-kDa protein that shares 92% amino acid identity with Helicoverpa zea and Helicoverpa armigera PBAN-R, 81% with Bombyx mori PBAN-R and 72% with Plutella xylostella PBAN-R. The S. littoralis PBAN-R gene was stably expressed in NIH3T3 cells and transiently in HEK293 cells. We show that it mediates the dose-dependent PBAN-induced intracellular Ca(2+) response and activation of the MAP kinase via a PKC-dependent but Galphai-independent signaling mechanism. Other PK/PBAN family peptides (pheromonotropin and a C-terminally PBAN-derived peptide PBAN(28-33)NH(2)) also triggered MAP kinase activation. This receptor, together with the previously cloned PBAN-R, may facilitate our understanding of the cell-specific responses and functional diversities of this diverse neuropeptide family.

  15. Nitrogenase activity of Herbaspirillum seropedicae grown under low iron levels requires the products of nifXorf1 genes.

    Science.gov (United States)

    Klassen, Giseli; de Oliveira Pedrosa, Fábio; de Souza, Emanuel M; Yates, M Geoffrey; Rigo, Liu Un

    2003-07-29

    Herbaspirillum seropedicae strains mutated in the nifX or orf1 genes showed 90% or 50% reduction in nitrogenase activity under low levels of iron or molybdenum respectively. Mutations in nifX or orf1 genes did not affect nif gene expression since a nifH::lacZ fusion was fully active in both mutants. nifX and the contiguous gene orf1 are essential for maximum nitrogen fixation under iron limitation and are probably involved in synthesis of nitrogenase iron or iron-molybdenum clusters.

  16. Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene

    International Nuclear Information System (INIS)

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-01-01

    Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.

  17. Conferences and Events

    International Development Research Centre (IDRC) Digital Library (Canada)

    André Lavoie

    2016-06-14

    Jun 14, 2016 ... Approved by the Management Executive Committee. - 1 - ... Event ‒ represents activities related to IDRC operations and may include both ... Events include business meetings; corporate, branch or divisional management.

  18. The X protein of hepatitis B virus activates hepatoma cell proliferation through repressing melanoma inhibitory activity 2 gene

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Yilin; Yang, Yang; Cai, Yanyan; Liu, Fang; Liu, Yingle; Zhu, Ying [State Key Laboratory of Virology, College of Life Sciences, and Chinese-French Liver Disease Research Institute at Zhongnan Hospital, Wuhan University, Wuhan 430072 (China); Wu, Jianguo, E-mail: jwu@whu.edu.cn [State Key Laboratory of Virology, College of Life Sciences, and Chinese-French Liver Disease Research Institute at Zhongnan Hospital, Wuhan University, Wuhan 430072 (China)

    2011-12-16

    Highlights: Black-Right-Pointing-Pointer We demonstrated that HBV represses MIA2 gene expression both invitro and in vivo. Black-Right-Pointing-Pointer The X protein of HBV plays a major role in such regulation. Black-Right-Pointing-Pointer Knock-down of MIA2 in HepG2 cells activates cell growth and proliferation. Black-Right-Pointing-Pointer HBx activates cell proliferation, over-expression of MIA2 impaired such regulation. Black-Right-Pointing-Pointer HBx activates hepatoma cell proliferation through repressing MIA2 expression. -- Abstract: Hepatocellular carcinoma (HCC) is the fourth leading cause of cancer deaths globally. Chronic hepatitis B virus (HBV) infection accounts for over 75% of all HCC cases; however, the molecular pathogenesis of HCC is not well understood. In this study, we found that the expression of the newly identified gene melanoma inhibitory activity 2 (MIA2) was reduced by HBV infection invitro and invivo, and that HBV X protein (HBx) plays a major role in this regulation. Recent studies have revealed that MIA2 is a potential tumor suppressor, and that, in most HCCs, MIA2 expression is down-regulated or lost. We found that the knock-down of MIA2 in HepG2 cells activated cell growth and proliferation, suggesting that MIA2 inhibits HCC cell growth and proliferation. In addition, the over-expression of HBx alone induced cell proliferation, whereas MIA2 over-expression impaired the HBx-mediated induction of proliferation. Taken together, our results suggest that HBx activates hepatoma cell growth and proliferation through repression of the potential tumor suppressor MIA2.

  19. Association of peroxisome proliferator-activated receptor single-nucleotide polymorphisms and gene-gene interactions with the lipoprotein(a)

    Institute of Scientific and Technical Information of China (English)

    解惠坚

    2014-01-01

    Objective To examine the associations of 10 singlenucleotide polymorphisms(SNPs)in peroxisome proliferator-activated receptor(PPARs)gene with lipoprotein(a)level,and to investigate if there is gene-gene interaction among the SNPs on lipoprotein(a)level.Methods Totally 644 subjects(234 men and 410 women)were enrolled from Prevention of Multiple Metabolic Disorders and Metabolic Syndrome Study Cohort,which was an urban community survey study conducted in Jiangsu province.Ten SNPs in PPARα(rs135539,rs4253778,

  20. Hepatocyte-specific deletion of the keap1 gene activates Nrf2 and confers potent resistance against acute drug toxicity

    International Nuclear Information System (INIS)

    Okawa, Hiromi; Motohashi, Hozumi; Kobayashi, Akira; Aburatani, Hiroyuki; Kensler, Thomas W.; Yamamoto, Masayuki

    2006-01-01

    Nrf2 is a key regulator of many detoxifying enzyme genes, and cytoplasmic protein Keap1 represses the Nrf2 activity under quiescent conditions. Germ line deletion of the keap1 gene results in constitutive activation of Nrf2, but the pups unexpectedly died before weaning. To investigate how constitutive activation of Nrf2 influences the detoxification system in adult mice, we generated mice bearing a hepatocyte-specific disruption of the keap1 gene. Homozygous mice were viable and their livers displayed no apparent abnormalities, but nuclear accumulation of Nrf2 is elevated. Microarray analysis revealed that, while many detoxifying enzyme genes are highly expressed, some of the typical Nrf2-dependent genes are only marginally increased in the Keap1-deficient liver. The mutant mice were significantly more resistant to toxic doses of acetaminophen than control animals. These results demonstrate that chronic activation of Nrf2 confers animals with resistance to xenobiotics without affecting the morphological and physiological integrity of hepatocytes

  1. Expression of an Acid Urease with Urethanase Activity in E. coli and Analysis of Urease Gene.

    Science.gov (United States)

    Liu, Xiaofeng; Zhang, Qian; Zhou, Nandi; Tian, Yaping

    2017-03-01

    Urea in alcoholic beverage is a precursor of ethyl carbamate (EC), which is carcinogenic. Enzymatic elimination of urea has attracted much research interest. Acid urease with good tolerance toward ethanol and acid is ideal enzyme for such applications. In the present work, the structural genes of urease from Providencia rettgeri JN-B815, ureABC were efficiently expressed in E. coli BL21(DE3) in an active form (apourease) exhibiting both urease and urethanase (hydrolyze EC) activities. The specific activities of the purified apourease were comparatively low, which were 2.1 U/mg for urease and 0.6 U/mg for urethanase, respectively. However, apourease exhibited good resistance toward ethanol and acidic conditions. The relative activities of urease and urethanase remained over 80% in the buffers within pH 4-7. And the recoveries of both urease and urethanase activities were more than 50% in 5-25% ethanol solution. Apourease was utilized to eliminate urea in wine, and the residual urea in model wine was less than 50% after treatment with apourease for 30 h. Then 3D structure of UreC was predicted, and it was docked with urea and EC, respectively. The docking result revealed that three hydrogen bonds were formed between urea and amino acid residues in the active site of urease, whereas only one hydrogen bond can be formed between EC and the active center. Moreover, EC exhibited greater steric hindrance than urea when combined with the active site. Due to the low specific activities of apourease, both structural genes and accessory genes of urease were co-expressed in E. coli BL21(DE3). The holoenzyme was expressed as inclusion body. After renaturation and purification, the specific activities of urease and urethanase reached 10.7 and 3.8 U/mg, which were 5.62-fold and 6.33-fold of those of apourease, respectively. Therefore, accessory subunits of urease play an important role in enhancing urease and urethanase activities.

  2. Gene activation by UV light, fungal elicitor or fungal infection in Petroselinum crispum is correlated with repression of cell cycle-related genes

    International Nuclear Information System (INIS)

    Logemann, E.; Wu ShengCheng; Schröder, J.; Schmelzer, E.; Somssich, I.E.; Hahlbrock, K.

    1995-01-01

    The effects of UV light or fungal elicitors on plant cells have so far been studied mostly with respect to defense-related gene activation. Here, an inverse correlation of these stimulatory effects with the activities of several cell cycle-related genes is demonstrated. Concomitant with the induction of flavonoid biosynthetic enzymes in UV-irradiated cell suspension cultures of parsley (Petroselinum crispum), total histone synthesis declined to about half the initial rate. A subclass of the histone H3 gene family was selected to demonstrate the close correlation of its expression with cell division, both in intact plants and cultured cells. Using RNA-blot and run-on transcription assays, it was shown that one arbitrarily selected subclass of each of the histone H2A, H2B, H3 and H4 gene families and of the genes encoding a p34cdc2 protein kinase and a mitotic cyclin were transcriptionally repressed in UV-irradiated as well as fungal elicitor-treated parsley cells. The timing and extent of repression differed between the two stimuli; the response to light was more transient and smaller in magnitude. These differential responses to light and elicitor were inversely correlated with the induction of phenylalanine ammonia-lyase, a key enzyme of phenylpropanoid metabolism. Essentially the same result was obtained with a defined oligopeptide elicitor, indicating that the same signaling pathway is responsible for defense-related gene activation and cell cycle-related gene repression. A temporary (UV light) or long-lasting (fungal elicitor) cessation of cell culture growth is most likely due to an arrest of cell division which may be a prerequisite for full commitment of the cells to transcriptional activation of full commitment of the cells to transcriptional activation of pathways involved in UV protection or pathogen defense. This conclusion is corroborated by the observation that the histone H3 mRNA level greatly declined around fungal infection sites in young parsley

  3. PEP activity and expression of photosynthesis genes required for embryo and seed development in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Dmitry eKremnev

    2014-08-01

    Full Text Available Chloroplast biogenesis and function is essential for proper plant embryo and seed development but the molecular mechanisms underlying the role of plastids during embryogenesis are poorly understood. Expression of plastid encoded genes is dependent on two different transcription machineries; a plastid-encoded bacterial-type RNA polymerase (PEP and a nuclear-encoded phage-type RNA polymerase (NEP, which recognize distinct types of promoters. However, the division of labor between PEP and NEP during plastid development and in mature chloroplasts is unclear. We show here that PRIN2 and CSP41b, two proteins identified in plastid nucleoid preparations, are essential for proper plant embryo development. Using Co-IP assays and native PAGE we have shown a direct physical interaction between PRIN2 and CSP41b. Moreover, PRIN2 and CSP41b form a distinct protein complex in vitro that binds DNA. The prin2.2 and csp41b-2 single mutants displayed pale phenotypes, abnormal chloroplasts with reduced transcript levels of photosynthesis genes and defects in embryo development. The respective csp41b-2prin2.2 homo/heterozygote double mutants produced abnormal white colored ovules and shrunken seeds. Thus, the csp41b-2prin2.2 double mutant is embryo lethal. In silico analysis of available array data showed that a large number of genes traditionally classified as PEP dependent genes are transcribed during early embryo development from the pre-globular stage to the mature-green-stage. Taken together, our results suggest that PEP activity and consequently the switch from NEP to PEP activity, is essential during embryo development and that the PRIN2-CSP41b DNA binding protein complex possibly is important for full PEP activity during this process.

  4. Tumor Suppressor Genes within Common Fragile Sites Are Active Players in the DNA Damage Response.

    Directory of Open Access Journals (Sweden)

    Idit Hazan

    2016-12-01

    Full Text Available The role of common fragile sites (CFSs in cancer remains controversial. Two main views dominate the discussion: one suggests that CFS loci are hotspots of genomic instability leading to inactivation of genes encoded within them, while the other view proposes that CFSs are functional units and that loss of the encoded genes confers selective pressure, leading to cancer development. The latter view is supported by emerging evidence showing that expression of a given CFS is associated with genome integrity and that inactivation of CFS-resident tumor suppressor genes leads to dysregulation of the DNA damage response (DDR and increased genomic instability. These two viewpoints of CFS function are not mutually exclusive but rather coexist; when breaks at CFSs are not repaired accurately, this can lead to deletions by which cells acquire growth advantage because of loss of tumor suppressor activities. Here, we review recent advances linking some CFS gene products with the DDR, genomic instability, and carcinogenesis and discuss how their inactivation might represent a selective advantage for cancer cells.

  5. Synthesis, antimicrobial activity and gene structure of a novel member of the dermaseptin B family.

    Science.gov (United States)

    Fleury, Y; Vouille, V; Beven, L; Amiche, M; Wróblewski, H; Delfour, A; Nicolas, P

    1998-03-09

    Dermaseptins are a family of cationic (Lys-rich) antimicrobial peptides that are abundant in the skin secretions of the arboreal frogs Phyllomedusa bicolor and P. sauvagii. In vitro, these peptides are microbicidal against a wide variety of microorganisms including Gram-positive and Gram-negative bacteria, yeasts, protozoa and fungi. To date, 6 dermaseptin B mature peptides, 24-34 residues long, 2 dermaseptin B cDNAs and 2 gene sequences have been identified in P. bicolor. To assess dermaseptin related genes further, we screened a P. bicolor genomic library with 32P-labeled cDNAs coding either for prepro-dermaseptins B1 or B2 (adenoregulin). A gene sequence was identified that coded a novel dermaseptin B, termed Drg3, which exhibits 23-42% amino acids identities with other members of the family. Analysis of the cDNAs coding precursors for several opioid and antimicrobial peptides originating from the skin of various amphibian species revealed that the 25-residue preproregion of these preproforms are all encoded by conserved nucleotides encompassed by the first coding exon of the Drg3 gene. Synthetic dermaseptin Drg3 exhibited a bactericidal activity towards several species of mollicutes (wall-less eubacteria), firmicutes (Gram-positive eubacteria), and gracilicutes (Gram-negative eubacteria), with minimal inhibitory concentrations (MICs) ranging from 6.25 to 100 microM. Experiments performed on Acholeplasma laidlawii cells revealed that this peptide is membranotropic and that if efficiently depolarizes the plasma membrane.

  6. Cannabidiol Activates Neuronal Precursor Genes in Human Gingival Mesenchymal Stromal Cells.

    Science.gov (United States)

    Soundara Rajan, Thangavelu; Giacoppo, Sabrina; Scionti, Domenico; Diomede, Francesca; Grassi, Gianpaolo; Pollastro, Federica; Piattelli, Adriano; Bramanti, Placido; Mazzon, Emanuela; Trubiani, Oriana

    2017-06-01

    In the last years, mesenchymal stromal cells (MSCs) from oral tissues have received considerable interest in regenerative medicine since they can be obtained with minimal invasive procedure and exhibit immunomodulatory properties. This study was aimed to investigate whether in vitro pre-treatment of MSCs obtained from human gingiva (hGMSCs) with Cannabidiol (CBD), a cannabinoid component produced by the plant Cannabis sativa, may promote human gingiva derived MSCs to differentiate toward neuronal precursor cells. Specifically, we have treated the hGMSCs with CBD (5 µM) for 24 h in order to evaluate the expression of genes involved in cannabidiol signaling, cell proliferation, self-renewal and multipotency, and neural progenitor cells differentiation. Next generation sequencing (NGS) demonstrated that CBD activates genes associated with G protein coupled receptor signaling in hGMSCs. Genes involved in DNA replication, cell cycle, proliferation, and apoptosis were regulated. Moreover, genes associated with the biological process of neuronal progenitor cells (NCPs) proliferation, neuron differentiation, neurogenesis, and nervous system development were significantly modulated. From our results, we hypothesize that human gingiva-derived MSCs conditioned with CBD could represent a valid method for improving the hGMSCs phenotype and thus might be a potential therapeutic tool in the treatment of neurodegenerative diseases. J. Cell. Biochem. 118: 1531-1546, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  7. Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp.

    Directory of Open Access Journals (Sweden)

    Hamed Esmaeil Lashgarian

    2016-10-01

    Full Text Available Cholesterol oxidase (CHO is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. This enzyme was produced by several bacterial strains. Wild type enzyme produced by Rhodococcus sp. secret two forms of CHO enzyme: extra cellular and membrane bound type which its amount is low and unstable. The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. CHO gene was isolated from native bacteria and cloned into pET23a. In the next step, the construct was expressed in E.coli BL21 and induced by different concentration of IPTG ranges from 0.1 - 0.9 mM. This gene contains 1642 bp and encodes a protein consists of 533 amino acids. It has about 96 % homology with CHO gene isolated from Rhodococcus equi. The high expression was obtained in 0.5 mM concentration of IPTG after 4 hour induction. This recombinant enzyme had a molecular weight of 55 kDa, that secretion of intra cellular type is much more than extracellular form. The optimum pH and temperature conditions for the recombinant enzyme were 7.5 and 45°C, respectively. CHO enzyme obtained from Rhodococcus sp. is a cheap enzyme with medical and industrial applications that can be produced easily and purified in large scale with simple methods.

  8. Hypoxia-Inducible Regulation of a Prodrug-Activating Enzyme for Tumor-Specific Gene Therapy

    Directory of Open Access Journals (Sweden)

    Toru Shibata

    2002-01-01

    Full Text Available Previous studies have suggested that tumor hypoxia could be exploited for cancer gene therapy. Using hypoxia-responsive elements derived from the human vascular endothelial growth factor gene, we have generated vectors expressing a bacterial nitroreductase. (20NTR gene that can activate the anticancer prodrug CB1954. Stable transfectants of human HT1080 tumor cells with hypoxia-inducible vectors were established with G418 selection. Hypoxic induction of NTR protein correlated with increased sensitivity to in vitro exposure of HT 1080 cells to the prodrug. Growth delay assays were performed with established tumor xenografts derived from the same cells to detect the in vivo efficacy of CB1954 conversion to its cytotoxic form. Significant antitumor effects were achieved with intraperitoneal injections of CB1954 both in tumors that express NTR constitutively or with a hypoxia-inducible promoter. In addition, respiration of 10% O2 increased tumor hypoxia in vivo and enhanced the antitumor effects. Taken together, these results demonstrate that hypoxia-inducible vectors may be useful for tumor-selective gene therapy, although the problem of delivery of the vector to the tumors, particularly to the hypoxic cells in the tumors, is not addressed by these studies.

  9. The homeobox gene mirror links EGF signalling to embryonic dorso-ventral axis formation through notch activation.

    Science.gov (United States)

    Jordan, K C; Clegg, N J; Blasi, J A; Morimoto, A M; Sen, J; Stein, D; McNeill, H; Deng, W M; Tworoger, M; Ruohola-Baker, H

    2000-04-01

    Recent studies in vertebrates and Drosophila melanogaster have revealed that Fringe-mediated activation of the Notch pathway has a role in patterning cell layers during organogenesis. In these processes, a homeobox-containing transcription factor is responsible for spatially regulating fringe (fng) expression and thus directing activation of the Notch pathway along the fng expression border. Here we show that this may be a general mechanism for patterning epithelial cell layers. At three stages in Drosophila oogenesis, mirror (mirr) and fng have complementary expression patterns in the follicle-cell epithelial layer, and at all three stages loss of mirr enlarges, and ectopic expression of mirr restricts, fng expression, with consequences for follicle-cell patterning. These morphological changes are similar to those caused by Notch mutations. Ectopic expression of mirr in the posterior follicle cells induces a stripe of rhomboid (rho) expression and represses pipe (pip), a gene with a role in the establishment of the dorsal-ventral axis, at a distance. Ectopic Notch activation has a similar long-range effect on pip. Our results suggest that Mirror and Notch induce secretion of diffusible morphogens and we have identified TGF-beta (encoded by dpp) as such a molecule in germarium. We also found that mirr expression in dorsal follicle cells is induced by the EGF-receptor (EGFR) pathway and that mirr then represses pip expression in all but the ventral follicle cells, connecting EGFR activation in the dorsal follicle cells to repression of pip in the dorsal and lateral follicle cells. Our results suggest that the differentiation of ventral follicle cells is not a direct consequence of germline signalling, but depends on long-range signals from dorsal follicle cells, and provide a link between early and late events in Drosophila embryonic dorsal-ventral axis formation.

  10. Pain Modulation in Waking and Hypnosis in Women: Event-Related Potentials and Sources of Cortical Activity

    Science.gov (United States)

    De Pascalis, Vilfredo; Varriale, Vincenzo; Cacace, Immacolata

    2015-01-01

    Using a strict subject selection procedure, we tested in High and Low Hypnotizable subjects (HHs and LHs) whether treatments of hypoalgesia and hyperalgesia, as compared to a relaxation-control, differentially affected subjective pain ratings and somatosensory event-related potentials (SERPs) during painful electric stimulation. Treatments were administered in waking and hypnosis conditions. LHs showed little differentiation in pain and distress ratings between hypoalgesia and hyperalgesia treatments, whereas HHs showed a greater spread in the instructed direction. HHs had larger prefrontal N140 and P200 waves of the SERPs during hypnotic hyperalgesia as compared to relaxation-control treatment. Importantly, HHs showed significant smaller frontocentral N140 and frontotemporal P200 waves during hypnotic hypoalgesia. LHs did not show significant differences for these SERP waves among treatments in both waking and hypnosis conditions. Source localization (sLORETA) method revealed significant activations of the bilateral primary somatosensory (BA3), middle frontal gyrus (BA6) and anterior cingulate cortices (BA24). Activity of these contralateral regions significantly correlated with subjective numerical pain scores for control treatment in waking condition. Moreover, multivariate regression analyses distinguished the contralateral BA3 as the only region reflecting a stable pattern of pain coding changes across all treatments in waking and hypnosis conditions. More direct testing showed that hypnosis reduced the strength of the association of pain modulation and brain activity changes at BA3. sLORETA in HHs revealed, for the N140 wave, that during hypnotic hyperalgesia, there was an increased activity within medial, supramarginal and superior frontal gyri, and cingulated gyrus (BA32), while for the P200 wave, activity was increased in the superior (BA22), middle (BA37), inferior temporal (BA19) gyri and superior parietal lobule (BA7). Hypnotic hypoalgesia in HHs, for N

  11. Pain modulation in waking and hypnosis in women: event-related potentials and sources of cortical activity.

    Directory of Open Access Journals (Sweden)

    Vilfredo De Pascalis

    Full Text Available Using a strict subject selection procedure, we tested in High and Low Hypnotizable subjects (HHs and LHs whether treatments of hypoalgesia and hyperalgesia, as compared to a relaxation-control, differentially affected subjective pain ratings and somatosensory event-related potentials (SERPs during painful electric stimulation. Treatments were administered in waking and hypnosis conditions. LHs showed little differentiation in pain and distress ratings between hypoalgesia and hyperalgesia treatments, whereas HHs showed a greater spread in the instructed direction. HHs had larger prefrontal N140 and P200 waves of the SERPs during hypnotic hyperalgesia as compared to relaxation-control treatment. Importantly, HHs showed significant smaller frontocentral N140 and frontotemporal P200 waves during hypnotic hypoalgesia. LHs did not show significant differences for these SERP waves among treatments in both waking and hypnosis conditions. Source localization (sLORETA method revealed significant activations of the bilateral primary somatosensory (BA3, middle frontal gyrus (BA6 and anterior cingulate cortices (BA24. Activity of these contralateral regions significantly correlated with subjective numerical pain scores for control treatment in waking condition. Moreover, multivariate regression analyses distinguished the contralateral BA3 as the only region reflecting a stable pattern of pain coding changes across all treatments in waking and hypnosis conditions. More direct testing showed that hypnosis reduced the strength of the association of pain modulation and brain activity changes at BA3. sLORETA in HHs revealed, for the N140 wave, that during hypnotic hyperalgesia, there was an increased activity within medial, supramarginal and superior frontal gyri, and cingulated gyrus (BA32, while for the P200 wave, activity was increased in the superior (BA22, middle (BA37, inferior temporal (BA19 gyri and superior parietal lobule (BA7. Hypnotic hypoalgesia in

  12. Immunomodulatory role of interleukin-10 in visceral leishmaniasis: defective activation of protein kinase C-mediated signal transduction events.

    Science.gov (United States)

    Bhattacharyya, S; Ghosh, S; Jhonson, P L; Bhattacharya, S K; Majumdar, S

    2001-03-01

    Leishmania donovani, an intracellular protozoan parasite, challenges host defense mechanisms by impairing the signal transduction of macrophages. In this study we investigated whether interleukin-10 (IL-10)-mediated alteration of signaling events in a murine model of visceral leishmaniasis is associated with macrophage deactivation. Primary in vitro cultures of macrophages infected with leishmanial parasites markedly elevated the endogenous release of IL-10. Treatment with either L. donovani or recombinant IL-10 (rIL-10) inhibited both the activity and expression of the Ca2+-dependent protein kinase C (PKC) isoform. However, preincubation with neutralizing anti-IL-10 monoclonal antibody (MAb) restored the PKC activity in the parasitized macrophage. Furthermore, we observed that coincubation of macrophages with rIL-10 and L. donovani increased the intracellular parasite burden, which was abrogated by anti-IL-10 MAb. Consistent with these observations, generation of superoxide (O2-) and nitric oxide and the release of murine tumor necrosis factor-alpha were attenuated in response to L. donovani or rIL-10 treatment. On the other hand, preincubation of the infected macrophages with neutralizing anti-IL-10 MAb significantly blocked the inhibition of nitric oxide and murine tumor necrosis factor-alpha release by the infected macrophages. These findings imply that infection with L. donovani induces endogenous secretion of murine IL-10, which in turn facilitates the intracellular survival of the protozoan and orchestrates several immunomodulatory roles via selective impairment of PKC-mediated signal transduction.

  13. Fast joint detection-estimation of evoked brain activity in event-related FMRI using a variational approach

    Science.gov (United States)

    Chaari, Lotfi; Vincent, Thomas; Forbes, Florence; Dojat, Michel; Ciuciu, Philippe

    2013-01-01

    In standard within-subject analyses of event-related fMRI data, two steps are usually performed separately: detection of brain activity and estimation of the hemodynamic response. Because these two steps are inherently linked, we adopt the so-called region-based Joint Detection-Estimation (JDE) framework that addresses this joint issue using a multivariate inference for detection and estimation. JDE is built by making use of a regional bilinear generative model of the BOLD response and constraining the parameter estimation by physiological priors using temporal and spatial information in a Markovian model. In contrast to previous works that use Markov Chain Monte Carlo (MCMC) techniques to sample the resulting intractable posterior distribution, we recast the JDE into a missing data framework and derive a Variational Expectation-Maximization (VEM) algorithm for its inference. A variational approximation is used to approximate the Markovian model in the unsupervised spatially adaptive JDE inference, which allows automatic fine-tuning of spatial regularization parameters. It provides a new algorithm that exhibits interesting properties in terms of estimation error and computational cost compared to the previously used MCMC-based approach. Experiments on artificial and real data show that VEM-JDE is robust to model mis-specification and provides computational gain while maintaining good performance in terms of activation detection and hemodynamic shape recovery. PMID:23096056

  14. Cloned Bacillus subtilis alkaline protease (aprA) gene showing high level of keratinolytic activity.

    Science.gov (United States)

    Zaghloul, T I

    1998-01-01

    The Bacillus subtilis alkaline protease(aprA) gene was previously cloned on a pUBHO-derivative plasmid. High levels of expression and gene stability were demonstrated when B. subtilis cells were grown on the laboratory medium 2XSG. B. subtilis cells harboring the multicopy aprA gene were grown on basal medium, supplemented with 1 % chicken feather as a source of energy, carbon, and nitrogen. Proteolytic and keratinolytic activities were monitored throughout the cultivation time. A high level of keratinolytic activity was obtained, and this indicates that alkaline protease is acting as a keratinase. Furthermore, considerable amounts of soluble proteins and free amino acids were obtained as a result of the enzymatic hydrolysis of feather. Biodegradation of feather waste using these cells represents an alternative way to improve the nutritional value of feather, since feather waste is currently utilized on a limited basis as a dietary protein supplement for animal feedstuffs. Moreover, the release of free amino acids from feather and the secreted keratinase enzyme would promote industries based on feather waste.

  15. Solar Activity from 2006 to 2014 and Short-term Forecasts of Solar Proton Events Using the ESPERTA Model

    Energy Technology Data Exchange (ETDEWEB)

    Alberti, T.; Lepreti, F. [Dipartimento di Fisica, Università della Calabria, Ponte P. Bucci, Cubo 31C, 87036, Rende (CS) (Italy); Laurenza, M.; Storini, M.; Consolini, G. [INAF-IAPS, Via del Fosso del Cavaliere 100, I-00133, Roma (Italy); Cliver, E. W., E-mail: tommaso.alberti@unical.it, E-mail: monica.laurenza@iaps.inaf.it [National Solar Observatory, Boulder, CO (United States)

    2017-03-20

    To evaluate the solar energetic proton (SEP) forecast model of Laurenza et al., here termed ESPERTA, we computed the input parameters (soft X-ray (SXR) fluence and ∼1 MHz radio fluence) for all ≥M2 SXR flares from 2006 to 2014. This database is outside the 1995–2005 interval on which ESPERTA was developed. To assess the difference in the general level of activity between these two intervals, we compared the occurrence frequencies of SXR flares and SEP events for the first six years of cycles 23 (1996 September–2002 September) and 24 (2008 December–2014 December). We found a reduction of SXR flares and SEP events of 40% and 46%, respectively, in the latter period. Moreover, the numbers of ≥M2 flares with high values of SXR and ∼1 MHz fluences (>0.1 J m{sup −2} and >6 × 10{sup 5} sfu × minute, respectively) are both reduced by ∼30%. A somewhat larger percentage decrease of these two parameters (∼40% versus ∼30%) is obtained for the 2006–2014 interval in comparison with 1995–2005. Despite these differences, ESPERTA performance was compa