WorldWideScience

Sample records for gene activation events

  1. Activating Event Knowledge

    Science.gov (United States)

    Hare, Mary; Jones, Michael; Thomson, Caroline; Kelly, Sarah; McRae, Ken

    2009-01-01

    An increasing number of results in sentence and discourse processing demonstrate that comprehension relies on rich pragmatic knowledge about real-world events, and that incoming words incrementally activate such knowledge. If so, then even outside of any larger context, nouns should activate knowledge of the generalized events that they denote or…

  2. Perinucleolar relocalization and nucleolin as crucial events in the transcriptional activation of key genes in mantle cell lymphoma.

    Science.gov (United States)

    Allinne, Jeanne; Pichugin, Andrei; Iarovaia, Olga; Klibi, Manel; Barat, Ana; Zlotek-Zlotkiewicz, Ewa; Markozashvili, Diana; Petrova, Natalia; Camara-Clayette, Valérie; Ioudinkova, Elena; Wiels, Joëlle; Razin, Sergey V; Ribrag, Vincent; Lipinski, Marc; Vassetzky, Yegor S

    2014-03-27

    In mantle cell lymphoma (MCL), one allele of the cyclin D1 (Ccnd1) gene is translocated from its normal localization on chromosome 11 to chromosome 14. This is considered as the crucial event in the transformation process of a normal naive B-cell; however, the actual molecular mechanism leading to Ccnd1 activation remains to be deciphered. Using a combination of three-dimensional and immuno-fluorescence in situ hybridization experiments, the radial position of the 2 Ccnd1 alleles was investigated in MCL-derived cell lines and malignant cells from affected patients. The translocated Ccnd1 allele was observed significantly more distant from the nuclear membrane than its nontranslocated counterpart, with a very high proportion of IgH-Ccnd1 chromosomal segments localized next to a nucleolus. These perinucleolar areas were found to contain active RNA polymerase II (PolII) clusters. Nucleoli are rich in nucleolin, a potent transcription factor that we found to bind sites within the Ccnd1 gene specifically in MCL cells and to activate Ccnd1 transcription. We propose that the Ccnd1 transcriptional activation in MCL cells relates to the repositioning of the rearranged IgH-Ccnd1-carrying chromosomal segment in a nuclear territory with abundant nucleolin and active PolII molecules. Similar transforming events could occur in Burkitt and other B-cell lymphomas.

  3. Event-Based Activity Modeling

    DEFF Research Database (Denmark)

    Bækgaard, Lars

    2004-01-01

    We present and discuss a modeling approach that supports event-based modeling of information and activity in information systems. Interacting human actors and IT-actors may carry out such activity. We use events to create meaningful relations between information structures and the related activit...

  4. Temporal Dissection of Rate Limiting Transcriptional Events Using Pol II ChIP and RNA Analysis of Adrenergic Stress Gene Activation.

    Directory of Open Access Journals (Sweden)

    Daniel P Morris

    Full Text Available In mammals, increasing evidence supports mechanisms of co-transcriptional gene regulation and the generality of genetic control subsequent to RNA polymerase II (Pol II recruitment. In this report, we use Pol II Chromatin Immunoprecipitation to investigate relationships between the mechanistic events controlling immediate early gene (IEG activation following stimulation of the α1a-Adrenergic Receptor expressed in rat-1 fibroblasts. We validate our Pol II ChIP assay by comparison to major transcriptional events assessable by microarray and PCR analysis of precursor and mature mRNA. Temporal analysis of Pol II density suggests that reduced proximal pausing often enhances gene expression and was essential for Nr4a3 expression. Nevertheless, for Nr4a3 and several other genes, proximal pausing delayed the time required for initiation of productive elongation, consistent with a role in ensuring transcriptional fidelity. Arrival of Pol II at the 3' cleavage site usually correlated with increased polyadenylated mRNA; however, for Nfil3 and probably Gprc5a expression was delayed and accompanied by apparent pre-mRNA degradation. Intragenic pausing not associated with polyadenylation was also found to regulate and delay Gprc5a expression. Temporal analysis of Nr4a3, Dusp5 and Nfil3 shows that transcription of native IEG genes can proceed at velocities of 3.5 to 4 kilobases/min immediately after activation. Of note, all of the genes studied here also used increased Pol II recruitment as an important regulator of expression. Nevertheless, the generality of co-transcriptional regulation during IEG activation suggests temporal and integrated analysis will often be necessary to distinguish causative from potential rate limiting mechanisms.

  5. Inter-MAR association contributes to transcriptionally active looping events in human beta-globin gene cluster.

    Science.gov (United States)

    Wang, Li; Di, Li-Jun; Lv, Xiang; Zheng, Wei; Xue, Zheng; Guo, Zhi-Chen; Liu, De-Pei; Liang, Chi-Chuan

    2009-01-01

    Matrix attachment regions (MARs) are important in chromatin organization and gene regulation. Although it is known that there are a number of MAR elements in the beta-globin gene cluster, it is unclear that how these MAR elements are involved in regulating beta-globin genes expression. Here, we report the identification of a new MAR element at the LCR (locus control region) of human beta-globin gene cluster and the detection of the inter-MAR association within the beta-globin gene cluster. Also, we demonstrate that SATB1, a protein factor that has been implicated in the formation of network like higher order chromatin structures at some gene loci, takes part in beta-globin specific inter-MAR association through binding the specific MARs. Knocking down of SATB1 obviously reduces the binding of SATB1 to the MARs and diminishes the frequency of the inter-MAR association. As a result, the ACH establishment and the alpha-like globin genes and beta-like globin genes expressions are affected either. In summary, our results suggest that SATB1 is a regulatory factor of hemoglobin genes, especially the early differentiation genes at least through affecting the higher order chromatin structure.

  6. Origin of the plant Tm-1-like gene via two independent horizontal transfer events and one gene fusion event.

    Science.gov (United States)

    Yang, Zefeng; Liu, Li; Fang, Huimin; Li, Pengcheng; Xu, Shuhui; Cao, Wei; Xu, Chenwu; Huang, Jinling; Zhou, Yong

    2016-01-01

    The Tomato mosaic virus (ToMV) resistance gene Tm-1 encodes a direct inhibitor of ToMV RNA replication to protect tomato from infection. The plant Tm-1-like (Tm-1L) protein is predicted to contain an uncharacterized N-terminal UPF0261 domain and a C-terminal TIM-barrel signal transduction (TBST) domain. Homologous searches revealed that proteins containing both of these two domains are mainly present in charophyte green algae and land plants but absent from glaucophytes, red algae and chlorophyte green algae. Although Tm-1 homologs are widely present in bacteria, archaea and fungi, UPF0261- and TBST-domain-containing proteins are generally encoded by different genes in these linages. A co-evolution analysis also suggested a putative interaction between UPF0261- and TBST-domain-containing proteins. Phylogenetic analyses based on homologs of these two domains revealed that plants have acquired UPF0261- and TBST-domain-encoding genes through two independent horizontal gene transfer (HGT) events before the origin of land plants from charophytes. Subsequently, gene fusion occurred between these two horizontally acquired genes and resulted in the origin of the Tm-1L gene in streptophytes. Our results demonstrate a novel evolutionary mechanism through which the recipient organism may acquire genes with functional interaction through two different HGT events and further fuse them into one functional gene.

  7. Detecting rare gene transfer events in bacterial populations

    Directory of Open Access Journals (Sweden)

    Kaare Magne Nielsen

    2014-01-01

    Full Text Available Horizontal gene transfer (HGT enables bacteria to access, share, and recombine genetic variation, resulting in genetic diversity that cannot be obtained through mutational processes alone. In most cases, the observation of evolutionary successful HGT events relies on the outcome of initially rare events that lead to novel functions in the new host, and that exhibit a positive effect on host fitness. Conversely, the large majority of HGT events occurring in bacterial populations will go undetected due to lack of replication success of transformants. Moreover, other HGT events that would be highly beneficial to new hosts can fail to ensue due to lack of physical proximity to the donor organism, lack of a suitable gene transfer mechanism, genetic compatibility, and stochasticity in tempo-spatial occurrence. Experimental attempts to detect HGT events in bacterial populations have typically focused on the transformed cells or their immediate offspring. However, rare HGT events occurring in large and structured populations are unlikely to reach relative population sizes that will allow their immediate identification; the exception being the unusually strong positive selection conferred by antibiotics. Most HGT events are not expected to alter the likelihood of host survival to such an extreme extent, and will confer only minor changes in host fitness. Due to the large population sizes of bacteria and the time scales involved, the process and outcome of HGT are often not amenable to experimental investigation. Population genetic modeling of the growth dynamics of bacteria with differing HGT rates and resulting fitness changes is therefore necessary to guide sampling design and predict realistic time frames for detection of HGT, as it occurs in laboratory or natural settings. Here we review the key population genetic parameters, consider their complexity and highlight knowledge gaps for further research.

  8. Combined effects of thrombosis pathway gene variants predict cardiovascular events.

    Directory of Open Access Journals (Sweden)

    Kirsi Auro

    2007-07-01

    Full Text Available The genetic background of complex diseases is proposed to consist of several low-penetrance risk loci. Addressing this complexity likely requires both large sample size and simultaneous analysis of different predisposing variants. We investigated the role of four thrombosis genes: coagulation factor V (F5, intercellular adhesion molecule 1 (ICAM1, protein C (PROC, and thrombomodulin (THBD in cardiovascular diseases. Single allelic gene variants and their pair-wise combinations were analyzed in two independently sampled population cohorts from Finland. From among 14,140 FINRISK participants (FINRISK-92, n = 5,999 and FINRISK-97, n = 8,141, we selected for genotyping a sample of 2,222, including 528 incident cardiovascular disease (CVD cases and random subcohorts totaling 786. To cover all known common haplotypes (>10%, 54 single nucleotide polymorphisms (SNPs were genotyped. Classification-tree analysis identified 11 SNPs that were further analyzed in Cox's proportional hazard model as single variants and pair-wise combinations. Multiple testing was controlled by use of two independent cohorts and with false-discovery rate. Several CVD risk variants were identified: In women, the combination of F5 rs7542281 x THBD rs1042580, together with three single F5 SNPs, was associated with CVD events. Among men, PROC rs1041296, when combined with either ICAM1 rs5030341 or F5 rs2269648, was associated with total mortality. As a single variant, PROC rs1401296, together with the F5 Leiden mutation, was associated with ischemic stroke events. Our strategy to combine the classification-tree analysis with more traditional genetic models was successful in identifying SNPs-acting either in combination or as single variants--predisposing to CVD, and produced consistent results in two independent cohorts. These results suggest that variants in these four thrombosis genes contribute to arterial cardiovascular events at population level.

  9. Physical activity: genes & health

    CERN Document Server

    2002-01-01

    Carl Johan SUNDBERG is an Associate Professor in Physiology and Licenced Physician. His research focus is Molecular mechanisms involved in the adaptation of human skeletal muscle to physical activity.

  10. Gene conversion-like events in the diversification of human rearranged IGHV3-23*01 gene sequences

    Directory of Open Access Journals (Sweden)

    Bhargavi eDuvvuri

    2012-06-01

    Full Text Available Gene conversion (GCV as a mechanism of immunoglobulin diversification is well established in a few species. However, definitive evidence of GCV-like events in human immunoglobulin genes is scarce. GCV is mediated by activation-induced cytidine deaminase (AID. The lack of evidence of GCV in human rearranged immunoglobulin gene sequences is puzzling given the presence of highly similar germline donors and all the enzymatic machinery required for GCV. In this study, we undertook a computational analysis of rearranged IGHV3-23*01 gene sequences from common variable immunodeficiency (CVID patients and healthy individuals to survey ‘GCV-like’ activities. Our search identified strong evidence of GCV-like patterns. Germline VH sequences were identified as potential donors for clustered mutations in rearranged IGHV3-23*01 gene sequences. We identified minimum and maximum sequence identities between donor and recipient sequences that can serve as targets for GCV and our findings are consistent with those reported in literature. We observed that GCV-like tracts are flanked by activation-induced cytidine deaminase (AID hotspot motifs. Structural modeling of IGHV3-23*01 gene sequence revealed that hypermutable bases flanking GCV-like tracts, are in the single stranded DNA (ssDNA of stable stem-loop structures (SLSs. SsDNA is inherently fragile and also an optimal target for AID. We speculate that GCV could have been initiated by the targeting of hypermutable bases in ssDNA state in stable SLSs, plausibly by AID. We have observed that the frequency of GCV-like events is significantly higher in rearranged IGHV323-*01 sequences from healthy individuals compared to that of CVID patients. GCV, unlike SHM, can result in multiple base substitutions that can alter many amino acids. The extensive changes in antibody affinity by GCV-like events, as identified in this study would be instrumental in protecting humans against pathogens that diversify their genome by

  11. The effects of curiosity-evoking events on activity enjoyment.

    Science.gov (United States)

    Isikman, Elif; MacInnis, Deborah J; Ülkümen, Gülden; Cavanaugh, Lisa A

    2016-09-01

    Whereas prior literature has studied the positive effects of curiosity-evoking events that are integral to focal activities, we explore whether and how a curiosity-evoking event that is incidental to a focal activity induces negative outcomes for enjoyment. Four experiments and 1 field study demonstrate that curiosity about an event that is incidental to an activity in which individuals are engaged, significantly affects enjoyment of a concurrent activity. The reason why is that curiosity diverts attention away from the concurrent activity and focuses attention on the curiosity-evoking event. Thus, curiosity regarding an incidental event decreases enjoyment of a positive focal activity but increases enjoyment of a negative focal activity.

  12. Verb Aspect and the Activation of Event Knowledge

    Science.gov (United States)

    Ferretti, Todd R.; Kutas, Marta; McRae, Ken

    2007-01-01

    The authors show that verb aspect influences the activation of event knowledge with 4 novel results. First, common locations of events (e.g., arena) are primed following verbs with imperfective aspect (e.g., was skating) but not verbs with perfect aspect (e.g., had skated). Second, people generate more locative prepositional phrases as…

  13. Making memories of stressful events: a journey along epigenetic, gene transcription and signaling pathways

    Directory of Open Access Journals (Sweden)

    Johannes M.H.M. eReul

    2014-01-01

    Full Text Available Strong psychologically stressful events are known to have a long-lasting impact on behavior. The consolidation of such, largely adaptive, behavioral responses to stressful events involves changes in gene expression in limbic brain regions such as the hippocampus and amygdala. The underlying molecular mechanisms however were until recently unresolved. More than a decade ago we started to investigate the role of these hormones in signaling and epigenetic mechanisms participating in the effects of stress on gene transcription in hippocampal neurons. We discovered a novel, rapid non-genomic mechanism in which glucocorticoids via glucocorticoid receptors (GRs facilitate signaling of the ERK MAPK signaling pathway to the downstream nuclear kinases MSK1 and Elk-1 in dentate gyrus (DG granule neurons. Activation of this signaling pathway results in serine10 (S10 phosphorylation and lysine14 (K14 acetylation at histone H3 (H3S10p-K14ac, leading to the induction of the immediate early genes c-Fos and Egr-1. In addition, we found a role of the DNA methylation status of gene promoters. A series of studies showed that these molecular mechanisms play a critical role in the long-lasting consolidation of behavioral responses in the forced swim test and Morris water maze. Furthermore, an important role of GABA was found in controlling the epigenetic and gene transcriptional responses to psychological stress. Thus, psychologically stressful events evoke a long-term impact on behavior through changes in hippocampal function brought about by distinct glutamatergic and glucocorticoid-driven changes in epigenetic regulation of gene transcription which are modulated by (local GABAergic interneurons and limbic afferent inputs. These epigenetic processes may play an important role in the etiology of stress-related mental disorders such as major depressive and anxiety disorders like PTSD.

  14. An event-driven approach for studying gene block evolution in bacteria.

    Science.gov (United States)

    Ream, David C; Bankapur, Asma R; Friedberg, Iddo

    2015-07-01

    Gene blocks are genes co-located on the chromosome. In many cases, gene blocks are conserved between bacterial species, sometimes as operons, when genes are co-transcribed. The conservation is rarely absolute: gene loss, gain, duplication, block splitting and block fusion are frequently observed. An open question in bacterial molecular evolution is that of the formation and breakup of gene blocks, for which several models have been proposed. These models, however, are not generally applicable to all types of gene blocks, and consequently cannot be used to broadly compare and study gene block evolution. To address this problem, we introduce an event-based method for tracking gene block evolution in bacteria. We show here that the evolution of gene blocks in proteobacteria can be described by a small set of events. Those include the insertion of genes into, or the splitting of genes out of a gene block, gene loss, and gene duplication. We show how the event-based method of gene block evolution allows us to determine the evolutionary rateand may be used to trace the ancestral states of their formation. We conclude that the event-based method can be used to help us understand the formation of these important bacterial genomic structures. The software is available under GPLv3 license on http://github.com/reamdc1/gene_block_evolution.git. Supplementary online material: http://iddo-friedberg.net/operon-evolution © The Author 2015. Published by Oxford University Press.

  15. Phylogenetic analyses of cyanobacterial genomes: Quantification of horizontal gene transfer events

    OpenAIRE

    Zhaxybayeva, Olga; Gogarten, J. Peter; Charlebois, Robert L.; Doolittle, W Ford; Papke, R Thane

    2006-01-01

    Using 1128 protein-coding gene families from 11 completely sequenced cyanobacterial genomes, we attempt to quantify horizontal gene transfer events within cyanobacteria, as well as between cyanobacteria and other phyla. A novel method of detecting and enumerating potential horizontal gene transfer events within a group of organisms based on analyses of “embedded quartets” allows us to identify phylogenetic signal consistent with a plurality of gene families, as well as to delineate cases of c...

  16. Generalized event knowledge activation during online sentence comprehension

    Science.gov (United States)

    Metusalem, Ross; Kutas, Marta; Urbach, Thomas P.; Hare, Mary; McRae, Ken; Elman, Jeffrey L.

    2012-01-01

    Recent research has demonstrated that knowledge of real-world eventsplays an important role inguiding online language comprehension. The present study addresses the scope of event knowledge activation during the course of comprehension, specifically investigating whether activation is limited to those knowledge elements that align with the local linguistic context.The present study addresses this issue by analyzing event-related brain potentials (ERPs) recorded as participants read brief scenariosdescribing typical real-world events. Experiment 1 demonstratesthat a contextually anomalous word elicits a reduced N400 if it is generally related to the described event, even when controlling for the degree of association of this word with individual words in the preceding context and with the expected continuation. Experiment 2 shows that this effect disappears when the discourse context is removed.These findings demonstrate that during the course of incremental comprehension, comprehenders activate general knowledge about the described event, even at points at which this knowledge would constitute an anomalous continuation of the linguistic stream. Generalized event knowledge activationcontributes to mental representations of described events, is immediately available to influence language processing, and likely drives linguistic expectancy generation. PMID:22711976

  17. Online Event Segmentation in Active Perception using Adaptive Strong Anticipation

    CERN Document Server

    Nery, Bruno

    2010-01-01

    Most cognitive architectures rely on discrete representation, both in space (e.g., objects) and in time (e.g., events). However, a robot interaction with the world is inherently continuous, both in space and in time. The segmentation of the stream of perceptual inputs a robot receives into discrete and meaningful events poses as a challenge in bridging the gap between internal cognitive representations, and the external world. Event Segmentation Theory, recently proposed in the context of cognitive systems research, sustains that humans segment time into events based on matching perceptual input with predictions. In this work we propose a framework for online event segmentation, targeting robots endowed with active perception. Moreover, sensory processing systems have an intrinsic latency, resulting from many factors such as sampling rate, and computational processing, and which is seldom accounted for. This framework is founded on the theory of dynamical systems synchronization, where the system considered i...

  18. Early events in the evolution of spider silk genes.

    Directory of Open Access Journals (Sweden)

    James Starrett

    Full Text Available Silk spinning is essential to spider ecology and has had a key role in the expansive diversification of spiders. Silk is composed primarily of proteins called spidroins, which are encoded by a multi-gene family. Spidroins have been studied extensively in the derived clade, Orbiculariae (orb-weavers, from the suborder Araneomorphae ('true spiders'. Orbicularians produce a suite of different silks, and underlying this repertoire is a history of duplication and spidroin gene divergence. A second class of silk proteins, Egg Case Proteins (ECPs, is known only from the orbicularian species, Lactrodectus hesperus (Western black widow. In L. hesperus, ECPs bond with tubuliform spidroins to form egg case silk fibers. Because most of the phylogenetic diversity of spiders has not been sampled for their silk genes, there is limited understanding of spidroin gene family history and the prevalence of ECPs. Silk genes have not been reported from the suborder Mesothelae (segmented spiders, which diverged from all other spiders >380 million years ago, and sampling from Mygalomorphae (tarantulas, trapdoor spiders and basal araneomorph lineages is sparse. In comparison to orbicularians, mesotheles and mygalomorphs have a simpler silk biology and thus are hypothesized to have less diversity of silk genes. Here, we present cDNAs synthesized from the silk glands of six mygalomorph species, a mesothele, and a non-orbicularian araneomorph, and uncover a surprisingly rich silk gene diversity. In particular, we find ECP homologs in the mesothele, suggesting that ECPs were present in the common ancestor of extant spiders, and originally were not specialized to complex with tubuliform spidroins. Furthermore, gene-tree/species-tree reconciliation analysis reveals that numerous spidroin gene duplications occurred after the split between Mesothelae and Opisthothelae (Mygalomorphae plus Araneomorphae. We use the spidroin gene tree to reconstruct the evolution of amino acid

  19. Early events in the evolution of spider silk genes.

    Science.gov (United States)

    Starrett, James; Garb, Jessica E; Kuelbs, Amanda; Azubuike, Ugochi O; Hayashi, Cheryl Y

    2012-01-01

    Silk spinning is essential to spider ecology and has had a key role in the expansive diversification of spiders. Silk is composed primarily of proteins called spidroins, which are encoded by a multi-gene family. Spidroins have been studied extensively in the derived clade, Orbiculariae (orb-weavers), from the suborder Araneomorphae ('true spiders'). Orbicularians produce a suite of different silks, and underlying this repertoire is a history of duplication and spidroin gene divergence. A second class of silk proteins, Egg Case Proteins (ECPs), is known only from the orbicularian species, Lactrodectus hesperus (Western black widow). In L. hesperus, ECPs bond with tubuliform spidroins to form egg case silk fibers. Because most of the phylogenetic diversity of spiders has not been sampled for their silk genes, there is limited understanding of spidroin gene family history and the prevalence of ECPs. Silk genes have not been reported from the suborder Mesothelae (segmented spiders), which diverged from all other spiders >380 million years ago, and sampling from Mygalomorphae (tarantulas, trapdoor spiders) and basal araneomorph lineages is sparse. In comparison to orbicularians, mesotheles and mygalomorphs have a simpler silk biology and thus are hypothesized to have less diversity of silk genes. Here, we present cDNAs synthesized from the silk glands of six mygalomorph species, a mesothele, and a non-orbicularian araneomorph, and uncover a surprisingly rich silk gene diversity. In particular, we find ECP homologs in the mesothele, suggesting that ECPs were present in the common ancestor of extant spiders, and originally were not specialized to complex with tubuliform spidroins. Furthermore, gene-tree/species-tree reconciliation analysis reveals that numerous spidroin gene duplications occurred after the split between Mesothelae and Opisthothelae (Mygalomorphae plus Araneomorphae). We use the spidroin gene tree to reconstruct the evolution of amino acid compositions of

  20. Serial killers: ordering caspase activation events in apoptosis.

    Science.gov (United States)

    Slee, E A; Adrain, C; Martin, S J

    1999-11-01

    Caspases participate in the molecular control of apoptosis in several guises; as triggers of the death machinery, as regulatory elements within it, and ultimately as a subset of the effector elements of the machinery itself. The mammalian caspase family is steadily growing and currently contains 14 members. At present, it is unclear whether all of these proteases participate in apoptosis. Thus, current research in this area is focused upon establishing the repertoire and order of caspase activation events that occur during the signalling and demolition phases of cell death. Evidence is accumulating to suggest that proximal caspase activation events are typically initiated by molecules that promote caspase aggregation. As expected, distal caspase activation events are likely to be controlled by caspases activated earlier in the cascade. However, recent data has cast doubt upon the functional demarcation of caspases into signalling (upstream) and effector (downstream) roles based upon their prodomain lengths. In particular, caspase-3 may perform an important role in propagating the caspase cascade, in addition to its role as an effector caspase within the death programme. Here, we discuss the apoptosis-associated caspase cascade and the hierarchy of caspase activation events within it.

  1. Association between genes, stressful childhood events and processing bias in depression vulnerable individuals

    NARCIS (Netherlands)

    Vrijsen, J.N.; Oostrom, I.I.H. van; Arias-Vasquez, A.; Franke, B.; Becker, E.S.; Speckens, A.E.M.

    2014-01-01

    The brain-derived neurotrophic factor (BDNF) and catechol-O-methyltransferase (COMT) genes are relevant candidates for depression. Variation in these genes is associated with stress sensitivity and depressotypic cognitive biases. The interaction between genes and stressful events is considered as an

  2. Association between genes, stressful childhood events and processing bias in depression vulnerable individuals

    NARCIS (Netherlands)

    Vrijsen, J.N.; Oostrom, I.I.H. van; Arias-Vasquez, A.; Franke, B.; Becker, E.S.; Speckens, A.E.M.

    2014-01-01

    The brain-derived neurotrophic factor (BDNF) and catechol-O-methyltransferase (COMT) genes are relevant candidates for depression. Variation in these genes is associated with stress sensitivity and depressotypic cognitive biases. The interaction between genes and stressful events is considered as an

  3. Designing Technology for Active Spectator Experiences at Sporting Events

    DEFF Research Database (Denmark)

    Veerasawmy, Rune; Ludvigsen, Martin

    is not merely an experience of receiving and consuming entertainment. It is also heavily reliant on the active participation of the spectator in creating the atmosphere of the entire event. The BannerBattle experiment provides interactive technology in sport arenas with a form of interaction based on existing......This paper explores the active spectator experience at sporting events, by presenting and reflecting upon a design experiment carried out at a number of football1 events. The initial hypothesis of the design process, leading to the design experiment has been that the spectator experience...... behaviour in the context. The work presented also argues for a need to overcome the inclination to designing technological systems that imitate or compete with the experience of watching the television broadcast of the game. Experiments such as the presented BannerBattle are cornerstones in our exploratory...

  4. Creating Activating Events for Transformative Learning in a Prison Classroom

    Science.gov (United States)

    Keen, Cheryl H.; Woods, Robert

    2016-01-01

    In this article, we interpreted, in light of Mezirow's theory of transformative learning, interviews with 13 educators regarding their work with marginalized adult learners in prisons in the northeastern United States. Transformative learning may have been aided by the educators' response to unplanned activating events, humor, and respect, and…

  5. Mammalian BEX, WEX and GASP genes: Coding and non-coding chimaerism sustained by gene conversion events

    Directory of Open Access Journals (Sweden)

    Ponting Chris P

    2005-10-01

    Full Text Available Abstract Background The identification of sequence innovations in the genomes of mammals facilitates understanding of human gene function, as well as sheds light on the molecular mechanisms which underlie these changes. Although gene duplication plays a major role in genome evolution, studies regarding concerted evolution events among gene family members have been limited in scope and restricted to protein-coding regions, where high sequence similarity is easily detectable. Results We describe a mammalian-specific expansion of more than 20 rapidly-evolving genes on human chromosome Xq22.1. Many of these are highly divergent in their protein-coding regions yet contain a conserved sequence motif in their 5' UTRs which appears to have been maintained by multiple events of concerted evolution. These events have led to the generation of chimaeric genes, each with a 5' UTR and a protein-coding region that possess independent evolutionary histories. We suggest that concerted evolution has occurred via gene conversion independently in different mammalian lineages, and these events have resulted in elevated G+C levels in the encompassing genomic regions. These concerted evolution events occurred within and between genes from three separate protein families ('brain-expressed X-linked' [BEX], WWbp5-like X-linked [WEX] and G-protein-coupled receptor-associated sorting protein [GASP], which often are expressed in mammalian brains and associated with receptor mediated signalling and apoptosis. Conclusion Despite high protein-coding divergence among mammalian-specific genes, we identified a DNA motif common to these genes' 5' UTR exons. The motif has undergone concerted evolution events independently of its neighbouring protein-coding regions, leading to formation of evolutionary chimaeric genes. These findings have implications for the identification of non protein-coding regulatory elements and their lineage-specific evolution in mammals.

  6. DNA bar coding and pyrosequencing to analyze adverse events in therapeutic gene transfer.

    Science.gov (United States)

    Wang, Gary P; Garrigue, Alexandrine; Ciuffi, Angela; Ronen, Keshet; Leipzig, Jeremy; Berry, Charles; Lagresle-Peyrou, Chantal; Benjelloun, Fatine; Hacein-Bey-Abina, Salima; Fischer, Alain; Cavazzana-Calvo, Marina; Bushman, Frederic D

    2008-05-01

    Gene transfer has been used to correct inherited immunodeficiencies, but in several patients integration of therapeutic retroviral vectors activated proto-oncogenes and caused leukemia. Here, we describe improved methods for characterizing integration site populations from gene transfer studies using DNA bar coding and pyrosequencing. We characterized 160,232 integration site sequences in 28 tissue samples from eight mice, where Rag1 or Artemis deficiencies were corrected by introducing the missing gene with gamma-retroviral or lentiviral vectors. The integration sites were characterized for their genomic distributions, including proximity to proto-oncogenes. Several mice harbored abnormal lymphoproliferations following therapy--in these cases, comparison of the location and frequency of isolation of integration sites across multiple tissues helped clarify the contribution of specific proviruses to the adverse events. We also took advantage of the large number of pyrosequencing reads to show that recovery of integration sites can be highly biased by the use of restriction enzyme cleavage of genomic DNA, which is a limitation in all widely used methods, but describe improved approaches that take advantage of the power of pyrosequencing to overcome this problem. The methods described here should allow integration site populations from human gene therapy to be deeply characterized with spatial and temporal resolution.

  7. Planning and managing a corporate event : case: Event Activation Galaxy Studio Samsung S7/ S7 Edge

    OpenAIRE

    Bui, Quyen; Tran, Fa

    2017-01-01

    The thesis was written about the case: Event Activation Studio Galaxy Samsung S7/S7 Edge. Samsung is a global leading conglomerate company in the technology industry. This thesis discusses how to plan and manage an Event Activation for Samsung. The primary objective of this thesis was to provide a step-by-step guideline for planning and managing a corporate event. This objective was achieved by performing the following tasks: clarifying the influential role of corporate events in marketi...

  8. Designing Technology for Active Spectator Experiences at Sporting Events

    DEFF Research Database (Denmark)

    Veerasawmy, Rune; Ludvigsen, Martin

    2010-01-01

    behaviour in the context. The work presented also argues for a need to overcome the inclination to designing technological systems that imitate or compete with the experience of watching the television broadcast of the game. Experiments such as the presented BannerBattle are cornerstones in our exploratory......This paper explores the active spectator experience at sporting events, by presenting and reflecting upon a design experiment carried out at a number of football1 events. The initial hypothesis of the design process, leading to the design experiment has been that the spectator experience...... research-through-design approach to designing technologies for social experiences....

  9. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    Science.gov (United States)

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  10. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Observing Episodic Coronal Heating Events Rooted in Chromospheric Activity

    CERN Document Server

    McIntosh, Scott W

    2009-01-01

    We present results of a multi-wavelength study of episodic plasma injection into the corona of AR 10942. We exploit long-exposure images of the Hinode and Transition Region and Coronal Explorer (TRACE) spacecraft to study the properties of faint, episodic, "blobs" of plasma that are propelled upward along coronal loops that are rooted in the AR plage. We find that the source location and characteristic velocities of these episodic upflow events match those expected from recent spectroscopic observations of faint coronal upflows that are associated with upper chromospheric activity, in the form of highly dynamic spicules. The analysis presented ties together observations from coronal and chromospheric spectrographs and imagers, providing more evidence of the connection of discrete coronal mass heating and injection events with their source, dynamic spicules, in the chromosphere.

  12. Whisker encoding of mechanical events during active tactile exploration

    Science.gov (United States)

    Boubenec, Yves; Shulz, Daniel E.; Debrégeas, Georges

    2012-01-01

    Rats use their whiskers to extract a wealth of information about their immediate environment, such as the shape, position or texture of an object. The information is conveyed to mechanoreceptors located within the whisker follicle in the form of a sequence of whisker deflections induced by the whisker/object contact interaction. How the whiskers filter and shape the mechanical information and effectively participate in the coding of tactile features remains an open question to date. In the present article, a biomechanical model was developed that provides predictions of the whisker dynamics during active tactile exploration, amenable to quantitative experimental comparison. This model is based on a decomposition of the whisker profile into a slow, quasi-static sequence and rapid resonant small-scale vibrations. It was applied to the typical situation of a rat actively whisking across a solid object. Having derived the quasi-static sequence of whisker deformation, the resonant properties of the whisker were analyzed, taking into account the boundary conditions imposed by the whisker/surface contact. We then focused on two elementary mechanical events that are expected to trigger significant neural responses, namely (1) the whisker/object first contact and (2) the whisker detachment from the object. Both events were found to trigger a deflection wave propagating upward to the mystacial pad at constant velocity of ≈3–5 m/s. This yielded a characteristic mechanical signature at the whisker base, in the form of a large peak of negative curvature occurring ≈4 ms after the event has been triggered. The dependence in amplitude and lag of this mechanical signal with the main contextual parameters (such as radial or angular distance) was investigated. The model was validated experimentally by comparing its predictions to high-speed video recordings of shock-induced whisker deflections performed on anesthetized rats. The consequences of these results on possible tactile

  13. Events

    Directory of Open Access Journals (Sweden)

    Igor V. Karyakin

    2016-02-01

    Full Text Available The 9th ARRCN Symposium 2015 was held during 21st–25th October 2015 at the Novotel Hotel, Chumphon, Thailand, one of the most favored travel destinations in Asia. The 10th ARRCN Symposium 2017 will be held during October 2017 in the Davao, Philippines. International Symposium on the Montagu's Harrier (Circus pygargus «The Montagu's Harrier in Europe. Status. Threats. Protection», organized by the environmental organization «Landesbund für Vogelschutz in Bayern e.V.» (LBV was held on November 20-22, 2015 in Germany. The location of this event was the city of Wurzburg in Bavaria.

  14. Whisker encoding of mechanical events during active tactile exploration

    Directory of Open Access Journals (Sweden)

    Yves eBoubenec

    2012-11-01

    Full Text Available Rats use their whiskers to extract a wealth of information about their immediate environment, such as the shape, position or texture of an object. The information is conveyed to mechanoreceptors located within the whisker follicle in the form of a sequence of whisker deflections induced by the whisker/object contact interaction. How the whiskers filter and shape the mechanical information and effectively participate in the coding of tactile features remains an open question to date. In the present article, a biomechanical model was developed that provides predictions of the whisker dynamics during active tactile exploration, amenable to quantitative experimental comparison. This model is based on a decomposition of the whisker profile into a slow, quasi-static sequence and rapid resonant small-scale vibrations. It was applied to the typical situation of a rat whisking across an object. Having derived the quasi-static sequence of whisker deformation, the resonant properties of the whisker were analyzed, taking into account the boundary conditions imposed by the whisker/surface contact. We then focused on two elementary mechanical events that are expected to trigger neural responses, namely (i the whisker/object first contact and (ii the whisker detachment from the object. Both events were found to trigger a deflection wave propagating upward to the mystacial pad at constant velocity of 3-5m/s. This yielded a characteristic mechanical signature at the whisker base, in the form of a large peak of negative curvature occurring 4ms after the event was triggered. The dependence in amplitude and lag of this mechanical signal with the main contextual parameters (such as radial or angular distance was investigated. The model was validated experimentally by comparing its predictions to high-speed video recordings of shock-induced whisker deflections performed on anesthetized rats. The consequences of these results on possible tactile encoding schemes are

  15. Closely linked H2B genes in the marine copepod, Tigriopus californicus indicate a recent gene duplication or gene conversion event.

    Science.gov (United States)

    Brown, D; Cook, A; Wagner, M; Wells, D

    1992-01-01

    Two nonallelic histone gene clusters were characterized in the marine copepod, Tigriopus californicus. The DNA sequence of one of the clusters reveals six genes in the contiguous arrangement of H2B, H1, H3, H4, H2B and H2A. The order of genes within the second cluster is H3, H4, H2B and H2A. There is no evidence for the presence of an H1 gene in this cluster. Comparison of the three copepod H2B genes reveals a high degree of similarity between the 5' upstream regions and between the amino terminal halves of the two H2B genes found within the same cluster. From these data we infer that gene duplication and/or gene conversion events occurred within this cluster in the recent past.

  16. Effects of Solar Activities on the Transient Luminous Events

    Science.gov (United States)

    Wu, Y.; Williams, E.; Chou, J.; Lee, L.; Huang, S.; Chang, S.; Chen, A. B.; Kuo, C.; Su, H.; Hsu, R.; Frey, H. U.; Takahashi, Y.; Lee, L.

    2013-12-01

    The Imager of Sprite and Upper Atmosphere Lightning (ISUAL) onboard the Formosat-2 was launched in May 2004; since then, it has continuously observed transient luminous events (TLEs) within the +/-60 degree of latitude for nearly 10 years. Due to ISUAL's long-term observations, the possible correlation between the TLE and the solar activity can be explored. Among the ISUAL TLEs, elves, which occur at the mesospheric altitude ~90 km and are caused by the heating incurred by the lightning-launched electromagnetic pulse of the lower ionosphere boundary are the most numerous and are the most suitable for this type of study. In previous studies, the elve distribution has proved to be a good surrogate for the lightning with exceptional peak current globally. ISUAL records the occurrence time and the height and location of elves, and the spectral emission intensities at six different band pass including the FUV N2 Lyman-Birge-Hopfield (LBH) band, which is a dominant emission in elves. The LBH intensity not only reflects the peak current of parent lightning, but may also represent the solar-activity-driven-lighting's perturbation to the ionosphere. In this study, we first examine whether the 11-year solar cycle affects the elve activity and altitude by analyzing the elve occurrence rates and heights in different latitudinal regions. To avoid the climatological and instrumental biases in the elve observations, the effects arising from the ENSO and moonlight must be carefully eliminated. Besides, we will discuss the elve variation in shorter time scale due to strong and sudden change of solar activity. Since the ion density of the mesosphere at mid-latitude may be significantly altered during/after a strong corona mass ejection (CME).Furthermore, it has been proven that the changes in the solar X-ray flux dominate the variations in the conductivity profile within the upper characteristic ELF layer (the 90-100km portion of the E-region). we will compare the variation of

  17. A genome landscape of SRSF3-regulated splicing events and gene expression in human osteosarcoma U2OS cells.

    Science.gov (United States)

    Ajiro, Masahiko; Jia, Rong; Yang, Yanqin; Zhu, Jun; Zheng, Zhi-Ming

    2016-02-29

    Alternative RNA splicing is an essential process to yield proteomic diversity in eukaryotic cells, and aberrant splicing is often associated with numerous human diseases and cancers. We recently described serine/arginine-rich splicing factor 3 (SRSF3 or SRp20) being a proto-oncogene. However, the SRSF3-regulated splicing events responsible for its oncogenic activities remain largely unknown. By global profiling of the SRSF3-regulated splicing events in human osteosarcoma U2OS cells, we found that SRSF3 regulates the expression of 60 genes including ERRFI1, ANXA1 and TGFB2, and 182 splicing events in 164 genes, including EP300, PUS3, CLINT1, PKP4, KIF23, CHK1, SMC2, CKLF, MAP4, MBNL1, MELK, DDX5, PABPC1, MAP4K4, Sp1 and SRSF1, which are primarily associated with cell proliferation or cell cycle. Two SRSF3-binding motifs, CCAGC(G)C and A(G)CAGCA, are enriched to the alternative exons. An SRSF3-binding site in the EP300 exon 14 is essential for exon 14 inclusion. We found that the expression of SRSF1 and SRSF3 are mutually dependent and coexpressed in normal and tumor tissues/cells. SRSF3 also significantly regulates the expression of at least 20 miRNAs, including a subset of oncogenic or tumor suppressive miRNAs. These data indicate that SRSF3 affects a global change of gene expression to maintain cell homeostasis.

  18. Pinda: a web service for detection and analysis of intraspecies gene duplication events.

    Science.gov (United States)

    Kontopoulos, Dimitrios-Georgios; Glykos, Nicholas M

    2013-09-01

    We present Pinda, a Web service for the detection and analysis of possible duplications of a given protein or DNA sequence within a source species. Pinda fully automates the whole gene duplication detection procedure, from performing the initial similarity searches, to generating the multiple sequence alignments and the corresponding phylogenetic trees, to bootstrapping the trees and producing a Z-score-based list of duplication candidates for the input sequence. Pinda has been cross-validated using an extensive set of known and bibliographically characterized duplication events. The service facilitates the automatic and dependable identification of gene duplication events, using some of the most successful bioinformatics software to perform an extensive analysis protocol. Pinda will prove of use for the analysis of newly discovered genes and proteins, thus also assisting the study of recently sequenced genomes. The service's location is http://orion.mbg.duth.gr/Pinda. The source code is freely available via https://github.com/dgkontopoulos/Pinda/.

  19. 2008 LHC Open Days: Super(-conducting) events and activities

    CERN Multimedia

    2008-01-01

    Superconductivity will be one of the central themes of the programme of events and discovery activities of the forthcoming LHC Open Days on 5 and 6 April. Visitors will be invited to take part in a range of activities, experiments and exchanges all about this amazing aspect of the LHC project. Why superconductivity? Simply because it’s the principle on which the very operation of the LHC is based. At the heart of the LHC magnets lie 7000 kilometres of superconducting cables, each strand containing between 6000 and 9000 filaments of the superconducting alloy niobium-titanium in a copper coating. These cables, cooled to a temperature close to absolute zero, are able to conduct electricity without resistance. 12000 amp currents - an intensity some 30000 times greater than that of a 100 watt light bulb - pass through the cables of the LHC magnets.   Programme:   BLDG 163 (Saturday 5 and Sunday 6 April): See weird and wonderful experiments with your own eyes In the workshop where the 2...

  20. Diet Activity Characteristic of Large-scale Sports Events Based on HACCP Management Model

    Directory of Open Access Journals (Sweden)

    Xiao-Feng Su

    2015-01-01

    Full Text Available The study proposed major sports events dietary management based on "HACCP" management model. According to the characteristic of major sports events catering activities. Major sports events are not just showcase level of competitive sports activities which have become comprehensive special events including social, political, economic, cultural and other factors, complex. Sporting events conferred reach more diverse goals and objectives of economic, political, cultural, technological and other influence and impact.

  1. Events

    Directory of Open Access Journals (Sweden)

    Marina Tkacheva

    2010-12-01

    Full Text Available Baikal Economic ForumInternational Scientific and Practical Conference"Culture of Wood - Wood in Culture"Summer Ateliers of UrbanistsMemorandum of Understanding between UIA and Active House AllianceKorean Team Wins the First Prize in the VELUX AwardUIA Professional Practice Commission"Zodchestvo 2010" International FestivalRainbow of "Zodchestvo 2010" in ManezhThree Opinions on One Book about Gogol's Two"Soviet Modernism" BookV Plenum of the Board of the Union of Architects of RussiaXXX Meeting of Chief ArchitectsCompetition of Graduation ProjectsInternational Day of Architecture

  2. Gene polymorphisms in APOE, NOS3, and LIPC genes may be risk factors for cardiac adverse events after primary CABG

    Directory of Open Access Journals (Sweden)

    Nollert Georg

    2009-08-01

    Full Text Available Abstract Introduction Coronary artery disease progression after primary coronary artery bypass grafting may, beside classical atherosclerosis risk factors, be depending on genetic predisposition. Methods We investigated 192 CABG patients (18% female, age: 60.9 ± 7.4 years. Clinically cardiac adverse events were defined as need for reoperation (n = 88; 46%, reintervention (n = 58; 30%, or angina (n = 89; 46%. Mean follow-up time measured 10.1 ± 5.1 years. Gene polymorphisms (ApoE, NOS3, LIPC, CETP, SERPINE-1, Prothrombin were investigated separately and combined (gene risk profile. Results Among classical risk factors, arterial hypertension and hypercholesterinemia significantly influenced CAD progression. Single ApoE, NOS3 and LIPC polymorphisms provided limited information. Patients missing the most common ApoE ε3 allele (5,2%, showed recurrent symptoms (p = 0,077 and had more frequently reintervention (p = 0,001. NOS3 a allele was associated with a significant increase for reintervention (p = 0,041 and recurrent symptoms (p = 0,042. Homozygous LIPC patients had a higher reoperation rate (p = 0.049. A gene risk profile enabled us to discriminate between faster and slower occurrence of cardiac adverse events (p = 0.0012. Conclusion Single APOE, LIPC and NOS3 polymorphisms permitted limited prognosis of cardiac adverse events in patients after CABG. Risk profile, in contrast, allowed for risk stratification.

  3. Association between genes, stressful childhood events and processing bias in depression vulnerable individuals.

    Science.gov (United States)

    Vrijsen, J N; van Oostrom, I; Arias-Vásquez, A; Franke, B; Becker, E S; Speckens, A

    2014-06-01

    The brain-derived neurotrophic factor (BDNF) and catechol-O-methyltransferase (COMT) genes are relevant candidates for depression. Variation in these genes is associated with stress sensitivity and depressotypic cognitive biases. The interaction between genes and stressful events is considered as an important mechanism in the development of depression. This study examined the effects of the BDNF and COMT genes on biased processing and the interaction with childhood stress in vulnerable individuals. A total of 198 remitted depressed individuals performed an n-back task with emotional facial stimuli (happy and sad). Childhood events were measured with a questionnaire. Genotype by childhood events interactions were analyzed for happy and sad expressions for BDNF (Val66Met; rs6265) and COMT (Val158Met; rs4680), individually and combined. BDNF and COMT both interacted significantly (P = 0.006 and P = 0.014, respectively) with childhood trauma on reaction time for happy faces. For both genes, Met-carriers with childhood trauma showed less positive bias for happy faces than those without childhood trauma. Val-carriers did not show a differential bias. Individuals with childhood trauma and 3 or 4 risk alleles (BDNF and COMT combined) showed less positive bias than those without childhood trauma (P = 0.011). The BDNF × COMT × childhood trauma interaction yielded a P = 0.055, but had limited power. A potential weakness is the measurement method of the childhood events, as negative bias might have affected participants' recall. Our findings endorse the association of BDNF and COMT with stress and depression and provide a possible intermediate, i.e. biased processing of positive information. Tailoring treatment to specific risk profiles based on genetic susceptibility and childhood stress could be promising. © 2014 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  4. Events

    Directory of Open Access Journals (Sweden)

    Igor V. Karyakin

    2015-12-01

    Full Text Available On the April 8-10 of 2014 an International Conference “Birds of Prey in the North Caucasus and Adjacent Regions: distribution, ecology, population dynamics, protection” was held in Sochi National Park, Sochi, Russia. The Saker Falcon Falco cherrug Global Action Plan (SakerGAP has been presented at the 11th Meeting of the Parties of the Bonn Convention (CMS, which took place in Quito (Ecuador on 4-9 November 2014. On the December 17 of 2014 a meeting between inspectors of Nature Reserve “Khakasskiy”, police of Khakasia Republic and experts of Siberian Environmental Center was held in the Nature Reserve “Khakasskiy”. On the December 20 of 2014 an annual meeting of members of Siberian Environmental Center (SEC was held in Akademgorodok, Novosibirsk, Russia. Project leaders presented reports on the main activities and achievements gained in 2014. The Long-eared Owl (Asio otus became the Bird of the Year announced by the public organization "APB-BirdLife Belarus". The 9th ARRCN Symposium 2015 will be held during 21st–25th October 2015 at the Novotel Hotel, Chumphon, Thailand, one of the most favored travel destinations in Asia.

  5. Recognition events in AM symbiosis: analysis of fungal gene expression at the early appressorium stage.

    Science.gov (United States)

    Breuninger, Magadalene; Requena, Natalia

    2004-08-01

    Arbuscular mycorrhizal symbiosis is induced upon a series of recognition events involving the reorganization of both plant and fungal cellular programs culminating in the formation of appressoria on the epidermal root cells. In this work we monitored for the first time the genetic changes occurring in the fungal partner during early appressorium development. We established an in vitro system of Glomus mosseae and Petroselinum crispum for studying appressorium formation and found that after 120 h first appressoria developed in the root epidermis. We have constructed a fungal subtractive suppressive library enriched in genes up-regulated at this stage. Our aim was to identify early signaling events during plant recognition leading to appressoria formation. The library contains 375 clones with an average size of 500 bp. From these, 200 clones were sequenced and most of them represent gene fragments with no known homologues (63%) and therefore putative new genes specific to the mycorrhiza symbiosis. Reverse-Northern blot and RT-PCR analyses confirmed that ca. 30% of the genes present in the library were up-regulated upon plant induction after 120 h. Among the genes with homologues in other organisms we found several genes common to other plant-microbe interactions including some genes related to Ca2+-dependent signaling. The up-regulation of these genes opens the possibility that Ca2+ plays a role in the early stages of mycorrhiza formation as it has been found in other plant-microbe interactions such as the Rhizobium symbiosis or the Magnaporthe grisea/rice pathogenic interaction.

  6. Incorporating planned activities and events in a dynamic multi-day activity agenda generator

    NARCIS (Netherlands)

    Nijland, L.; Arentze, T.; Timmermans, H.J.P.

    2012-01-01

    Daily agenda formation is influenced by formal commitments, satisfaction of needs surpassing some threshold and the desire to conduct particular activities in anticipation of socially and religiously driven events such as birthdays, Christmas, etc. As part of a research program to develop a dynamic

  7. Evolutionarily diverged regulation of X-chromosomal genes as a primal event in mouse reproductive isolation.

    Science.gov (United States)

    Oka, Ayako; Takada, Toyoyuki; Fujisawa, Hironori; Shiroishi, Toshihiko

    2014-04-01

    Improper gene regulation is implicated in reproductive isolation, but its genetic and molecular bases are unknown. We previously reported that a mouse inter-subspecific X chromosome substitution strain shows reproductive isolation characterized by male-specific sterility due to disruption of meiotic entry in spermatogenesis. Here, we conducted comprehensive transcriptional profiling of the testicular cells of this strain by microarray. The results clearly revealed gross misregulation of gene expression in the substituted donor X chromosome. Such misregulation occurred prior to detectable spermatogenetic impairment, suggesting that it is a primal event in reproductive isolation. The misregulation of X-linked genes showed asymmetry; more genes were disproportionally downregulated rather than upregulated. Furthermore, this misregulation subsequently resulted in perturbation of global transcriptional regulation of autosomal genes, probably by cascading deleterious effects. Remarkably, this transcriptional misregulation was substantially restored by introduction of chromosome 1 from the same donor strain as the X chromosome. This finding implies that one of regulatory genes acting in trans for X-linked target genes is located on chromosome 1. This study collectively suggests that regulatory incompatibility is a major cause of reproductive isolation in the X chromosome substitution strain.

  8. The Relation between Extreme Weather Events and the Solar Activity

    Science.gov (United States)

    Battinelli, P.; di Fazio, A.; Torelli, M.

    The oscillating part of the solar irradiance drives the cyclic component of the variations of the terrestrial atmosphere's thermodynamic state. In particular, the average temperature, and thus the turbulent atmospheric fuxes, are influenced. Reliable temperature data exist from ~220,000 years, while accurate solar irradiance space measurements (not affected by the atmosphere's absorption) are available only since 1979. Actually, there is a rather long data-set regarding solar activity, indicated by the Wolf number, which is found to be well correlated with the total solar flux. Thus, we use the Wolf number as a quantitative proxy of the incident flux, even in the interval before the space-based measurements. The fraction of solar energy trapped in the atmosphere due to the re-absorption of the infrared radiation by the greenhouse gases is an increasing function of time (in the latter 150-160 years). Over this interval, we spectrally analyzed the time series of both the Wolf number and the frequencies of extreme meteorological events, isolating and removing in the latter the cyclic components due to the periodic part of the radiative forcing exherted by the Sun. We were thus able to determine the time trend in the data regarding the observed frequencies of the U.S. continental tornadoes (National Center for Atmospheric Research) and of the global cyclones (hurricanes and tropical storms on all ocean basins, National Ocean and Atmospheric Administration). We find, for both the data sets an exponential behaviour, with e-folding times: for the cyclones tau ~= 110 years, and for the tornadoes tau ~= 70 years. We are happy to have given --through this work-- a contribution to the interdisciplinary scientific process coordinated by the IPCC (Intergovernmental Panel on Climate Change) through the ICSU (International Council of Scientific Unions) which takes place a latere of the international negotiations under the United Nations Framework Convention on Climate Change.

  9. Catechol-o-methyltransferase gene polymorphism modifies the effect of coffee intake on incidence of acute coronary events.

    Directory of Open Access Journals (Sweden)

    Pertti Happonen

    Full Text Available BACKGROUND: The role of coffee intake as a risk factor for coronary heart disease (CHD has been debated for decades. We examined whether the relationship between coffee intake and incidence of CHD events is dependent on the metabolism of circulating catecholamines, as determined by functional polymorphism of the catechol-O-methyltransferase (COMT gene. METHODOLOGY/PRINCIPAL FINDINGS: In a cohort of 773 men who were 42 to 60 years old and free of symptomatic CHD at baseline in 1984-89, 78 participants experienced an acute coronary event during an average follow-up of 13 years. In logistic regression adjusting for age, smoking, family history of CHD, vitamin C deficiency, blood pressure, plasma cholesterol concentration, and diabetes, the odds ratio (90% confidence interval comparing heavy coffee drinkers with the low activity COMT genotype with those with the high activity or heterozygotic genotypes was 3.2 (1.2-8.4. Urinary adrenaline excretion increased with increasing coffee intake, being over two-fold in heavy drinkers compared with nondrinkers (p = 0.008 for trend. CONCLUSIONS/SIGNIFICANCE: Heavy coffee consumption increases the incidence of acute coronary events in men with low but not high COMT activity. Further studies are required to determine to which extent circulating catecholamines mediate the relationship between coffee intake and CHD.

  10. RELATIONSHIP BETWEEN CULTURAL/ARTISTIC EVENTS VISITATION AND OTHER ACTIVITY-BASED TOURISM SEGMENTS

    National Research Council Canada - National Science Library

    Ana Tezak; Darko Saftic; Zdravko Sergo

    2011-01-01

    .... One of these specific forms of tourism is event tourism. The aim of this research is to determine the relationship between cultural/artistic events visitation and other activity-based tourism segments...

  11. A new computational method for the detection of horizontal gene transfer events.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

  12. A Cre/loxP-mediated self-activating gene excision system to produce marker gene free transgenic soybean plants.

    Science.gov (United States)

    Li, Zhongsen; Xing, Aiqiu; Moon, Bryan P; Burgoyne, Susan A; Guida, Anthony D; Liang, Huiling; Lee, Catharina; Caster, Cheryl S; Barton, Joanne E; Klein, Theodore M; Falco, Saverio C

    2007-10-01

    Marker-gene-free transgenic soybean plants were produced by isolating a developmentally regulated embryo-specific gene promoter, app1, from Arabidopsis and developing a self-activating gene excision system using the P1 bacteriophage Cre/loxP recombination system. To accomplish this, the Cre recombinase gene was placed under control of the app1 promoter and, together with a selectable marker gene (hygromycin phosphotransferase), were cloned between two loxP recombination sites. This entire sequence was then placed between a constitutive promoter and a coding region for either beta-glucuronidase (Gus) or glyphosate acetyltransferase (Gat). Gene excision would remove the entire sequence between the two loxP sites and bring the coding region to the constitutive promoter for expression. Using this system marker gene excision occurred in over 30% of the stable transgenic events as indicated by the activation of the gus reporter gene or the gat gene in separate experiments. Transgenic plants with 1 or 2 copies of a functional excision-activated gat transgene and without any marker gene were obtained in T0 or T1 generation. This demonstrates the feasibility of using developmentally controlled promoters to mediate marker excision in soybean.

  13. Epigenetic genes and emotional reactivity to daily life events: a multi-step gene-environment interaction study.

    Directory of Open Access Journals (Sweden)

    Ehsan Pishva

    Full Text Available Recent human and animal studies suggest that epigenetic mechanisms mediate the impact of environment on development of mental disorders. Therefore, we hypothesized that polymorphisms in epigenetic-regulatory genes impact stress-induced emotional changes. A multi-step, multi-sample gene-environment interaction analysis was conducted to test whether 31 single nucleotide polymorphisms (SNPs in epigenetic-regulatory genes, i.e. three DNA methyltransferase genes DNMT1, DNMT3A, DNMT3B, and methylenetetrahydrofolate reductase (MTHFR, moderate emotional responses to stressful and pleasant stimuli in daily life as measured by Experience Sampling Methodology (ESM. In the first step, main and interactive effects were tested in a sample of 112 healthy individuals. Significant associations in this discovery sample were then investigated in a population-based sample of 434 individuals for replication. SNPs showing significant effects in both the discovery and replication samples were subsequently tested in three other samples of: (i 85 unaffected siblings of patients with psychosis, (ii 110 patients with psychotic disorders, and iii 126 patients with a history of major depressive disorder. Multilevel linear regression analyses showed no significant association between SNPs and negative affect or positive affect. No SNPs moderated the effect of pleasant stimuli on positive affect. Three SNPs of DNMT3A (rs11683424, rs1465764, rs1465825 and 1 SNP of MTHFR (rs1801131 moderated the effect of stressful events on negative affect. Only rs11683424 of DNMT3A showed consistent directions of effect in the majority of the 5 samples. These data provide the first evidence that emotional responses to daily life stressors may be moderated by genetic variation in the genes involved in the epigenetic machinery.

  14. YAP activation is an early event and a potential therapeutic target in liver cancer development.

    Science.gov (United States)

    Perra, Andrea; Kowalik, Marta Anna; Ghiso, Elena; Ledda-Columbano, Giovanna Maria; Di Tommaso, Luca; Angioni, Maria Maddalena; Raschioni, Carlotta; Testore, Elena; Roncalli, Massimo; Giordano, Silvia; Columbano, Amedeo

    2014-11-01

    Although the growth suppressing Hippo pathway has been implicated in hepatocellular carcinoma (HCC) pathogenesis, it is unknown at which stage of hepatocarcinogenesis its dysregulation occurs. We investigated in rat and human preneoplastic lesions whether overexpression of the transcriptional co-activator Yes-associated protein (YAP) is an early event. The experimental model used is the resistant-hepatocyte (R-H) rat model. Gene expression was determined by qRT-PCR or immunohistochemistry. Forward genetic experiments were performed in human HCC cells and in murine oval cells. All foci of preneoplastic hepatocytes, generated in rats 4weeks after diethylnitrosamine (DENA) treatment, displayed YAP accumulation. This was associated with down-regulation of the β-TRCP ligase, known to mediate YAP degradation, and of microRNA-375, targeting YAP. YAP accumulation was paralleled by the up-regulation of its target genes. Increased YAP expression was also observed in human early dysplastic nodules and adenomas. Animal treatment with verteporfin (VP), which disrupts the formation of the YAP-TEAD complex, significantly reduced preneoplastic foci and oval cell proliferation. In vitro experiments confirmed that VP-mediated YAP inhibition impaired cell growth in HCC and oval cells; notably, oval cell transduction with wild type or active YAP conferred tumorigenic properties in vitro and in vivo. These results suggest that (i) YAP overexpression is an early event in rat and human liver tumourigenesis; (ii) it is critical for the clonal expansion of carcinogen-initiated hepatocytes and oval cells, and (iii) VP-induced disruption of the YAP-TEAD interaction may provide an important approach for the treatment of YAP-overexpressing cancers. Copyright © 2014 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  15. Characterizing proteases in an Antarctic Janthinobacterium sp. isolate:Evidence of a protease horizontal gene transfer event

    Institute of Scientific and Technical Information of China (English)

    Cecilia Martinez-Rosales; Juan Jos Marizcurrena; Andrs Iriarte; Natalia Fullana; Hctor Musto; Susana Castro-Sowinski

    2015-01-01

    We report the isolation of a cold-adapted bacterium belonging to the genus Janthinobacterium (named AU11), from a water sample collected in Lake Uruguay (King George Island, South Shetlands). AU11 (growth between 4°C and 30°C) produces a single cold-active extracellular protease (ExPAU11), differentially expressed at low temperature. ExPAU11 was identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-ToF MS) as an alkaline metallo-protease (70% coverage with an extracellular protease of Janthinobacterium sp. PI12), and by protease-inhibitor screening identified as a serine-protease. To the best of our knowledge this is the first experimental evidence of a cold-active extracellular protease produced by Janthinobacterium. Furthermore, we identified a serine-protease gene (named JSP8A) showing 60% identity (98%query coverage) to subtilisin peptidases belonging to the S8 family (S8A subfamily) of many cyanobacteria. A phylogenetic analysis of the JSP8A protease, along with related bacterial protein sequences, confirms that JSP8A clusters with S8A subtilisin sequences from different cyanobacteria, and is clearly separated from S8A bacterial sequences of other phyla (including its own). An analysis of the genomic organization around JSP8A suggests that this protease gene was acquired in an event that duplicated a racemase gene involved in transforming L- to D-amino acids. Our results suggest that AU11 probably acquired this subtilisin-like protease gene by horizontal gene transfer (HGT) from a cyanobacterium. We discuss the relevance of a bacterial protease-HGT in the Antarctic environment in light of this hypothesis.

  16. Frequent gene conversion events between the X and Y homologous chromosomal regions in primates

    Directory of Open Access Journals (Sweden)

    Hirai Hirohisa

    2010-07-01

    Full Text Available Abstract Background Mammalian sex-chromosomes originated from a pair of autosomes. A step-wise cessation of recombination is necessary for the proper maintenance of sex-determination and, consequently, generates a four strata structure on the X chromosome. Each stratum shows a specific per-site nucleotide sequence difference (p-distance between the X and Y chromosomes, depending on the time of recombination arrest. Stratum 4 covers the distal half of the human X chromosome short arm and the p-distance of the stratum is ~10%, on average. However, a 100-kb region, which includes KALX and VCX, in the middle of stratum 4 shows a significantly lower p-distance (1-5%, suggesting frequent sequence exchanges or gene conversions between the X and Y chromosomes in humans. To examine the evolutionary mechanism for this low p-distance region, sequences of a corresponding region including KALX/Y from seven species of non-human primates were analyzed. Results Phylogenetic analysis of this low p-distance region in humans and non-human primate species revealed that gene conversion like events have taken place at least ten times after the divergence of New World monkeys and Catarrhini (i.e., Old World monkeys and hominoids. A KALY-converted KALX allele in white-handed gibbons also suggests a possible recent gene conversion between the X and Y chromosomes. In these primate sequences, the proximal boundary of this low p-distance region is located in a LINE element shared between the X and Y chromosomes, suggesting the involvement of this element in frequent gene conversions. Together with a palindrome on the Y chromosome, a segmental palindrome structure on the X chromosome at the distal boundary near VCX, in humans and chimpanzees, may mediate frequent sequence exchanges between X and Y chromosomes. Conclusion Gene conversion events between the X and Y homologous regions have been suggested, mainly in humans. Here, we found frequent gene conversions in the

  17. Horizontal gene transfer events reshape the global landscape of arm race between viruses and homo sapiens.

    Science.gov (United States)

    Chen, Dong-Sheng; Wu, Yi-Quan; Zhang, Wei; Jiang, San-Jie; Chen, Shan-Ze

    2016-06-07

    Horizontal gene transfer (HGT) drives the evolution of recipient organism particularly if it provides a novel function which enhances the fitness or its adaption to the environment. Virus-host co-evolution is attractive for studying co-evolutionary processes, since viruses strictly replicate inside of the host cells and thus their evolution is inexorably tangled with host biology. HGT, as a mechanism of co-evolution between human and viruses, has been widely documented, however, the roles HGT play during the interaction between human and viruses are still in their infancy. In this study, we performed a comprehensive analysis on the genes horizontally transferred between viruses and their corresponding human hosts. Our study suggests that the HGT genes in human are predominantly enriched in immune related GO terms while viral HGT genes are tend to be encoded by viruses which promote the invasion of immune system of hosts. Based on our results, it gives us a hint about the evolution trajectory of HGT events. Overall, our study suggests that the HGT between human and viruses are highly relevant to immune interaction and probably reshaped the arm race between hosts and viruses.

  18. Adverse events in families with hypertrophic or dilated cardiomyopathy and mutations in the MYBPC3 gene

    Directory of Open Access Journals (Sweden)

    Lehrke Stephanie

    2008-10-01

    Full Text Available Abstract Background Mutations in MYBPC3 encoding myosin binding protein C belong to the most frequent causes of hypertrophic cardiomyopathy (HCM and may also lead to dilated cardiomyopathy (DCM. MYBPC3 mutations initially were considered to cause a benign form of HCM. The aim of this study was to examine the clinical outcome of patients and their relatives with 18 different MYBPC3 mutations. Methods 87 patients with HCM and 71 patients with DCM were screened for MYBPC3 mutations by denaturing gradient gel electrophoresis and sequencing. Close relatives of mutation carriers were genotyped for the respective mutation. Relatives with mutation were then evaluated by echocardiography and magnetic resonance imaging. A detailed family history regarding adverse clinical events was recorded. Results In 16 HCM (18.4% and two DCM (2.8% index patients a mutation was detected. Seven mutations were novel. Mutation carriers exhibited no additional mutations in genes MYH7, TNNT2, TNNI3, ACTC and TPM1. Including relatives of twelve families, a total number of 42 mutation carriers was identified of which eleven (26.2% had at least one adverse event. Considering the twelve families and six single patients with mutations, 45 individuals with cardiomyopathy and nine with borderline phenotype were identified. Among the 45 patients, 23 (51.1% suffered from an adverse event. In eleven patients of seven families an unexplained sudden death was reported at the age between 13 and 67 years. Stroke or a transient ischemic attack occurred in six patients of five families. At least one adverse event occurred in eleven of twelve families. Conclusion MYBPC3 mutations can be associated with cardiac events such as progressive heart failure, stroke and sudden death even at younger age. Therefore, patients with MYBPC3 mutations require thorough clinical risk assessment.

  19. Cosmogenic activation of materials used in rare event search experiments

    Science.gov (United States)

    Zhang, C.; Mei, D.-M.; Kudryavtsev, V. A.; Fiorucci, S.

    2016-11-01

    We evaluate the cosmogenic production rates in some materials that are commonly used as targets and shielding/supporting components for detecting rare events. The results from Geant4 simulations and the calculations of ACTIVIA are compared with the available experimental data. We demonstrate that the production rates from the Geant4-based simulations agree with the available data reasonably well. As a result, we report that the cosmogenic production of several isotopes in various materials can generate potential backgrounds for direct detection of dark matter and neutrinoless double-beta decay.

  20. Cosmogenic Activation of Materials Used in Rare Event Search Experiments

    CERN Document Server

    Zhang, C; Kudryavtsev, V A; Fiorucci, S

    2016-01-01

    We evaluate the cosmogenic production rates in some materials that are commonly used as targets and shielding/supporting components for detecting rare events. The results from Geant4 simulations are compared with the calculations of ACTIVIA and the available experimental data. We demonstrate that the production rates from the Geant4-based simulations agree with the available data reasonably well. As a result, we report that the cosmogenic production of several isotopes in various materials can generate potential backgrounds for direct detection of dark matter and neutrinoless double-beta decay.

  1. Social exclusion in middle childhood: rejection events, slow-wave neural activity, and ostracism distress.

    Science.gov (United States)

    Crowley, Michael J; Wu, Jia; Molfese, Peter J; Mayes, Linda C

    2010-01-01

    This study examined neural activity with event-related potentials (ERPs) in middle childhood during a computer-simulated ball-toss game, Cyberball. After experiencing fair play initially, children were ultimately excluded by the other players. We focused specifically on “not my turn” events within fair play and rejection events within social exclusion. Dense-array ERPs revealed that rejection events are perceived rapidly. Condition differences (“not my turn” vs. rejection) were evident in a posterior ERP peaking at 420 ms consistent, with a larger P3 effect for rejection events indicating that in middle childhood rejection events are differentiated in ostracism, including subgenual cortex, ventral anterior cingulate cortex, and insula, was greater for rejection events vs. “not my turn” events.

  2. Correlation of a set of gene variants, life events and personality features on adult ADHD severity.

    Science.gov (United States)

    Müller, Daniel J; Chiesa, Alberto; Mandelli, Laura; De Luca, Vincenzo; De Ronchi, Diana; Jain, Umesh; Serretti, Alessandro; Kennedy, James L

    2010-07-01

    Increasing evidence suggests that symptoms of attention deficit hyperactivity disorder (ADHD) could persist into adult life in a substantial proportion of cases. The aim of the present study was to investigate the impact of (1) adverse events, (2) personality traits and (3) genetic variants chosen on the basis of previous findings and (4) their possible interactions on adult ADHD severity. One hundred and ten individuals diagnosed with adult ADHD were evaluated for occurrence of adverse events in childhood and adulthood, and personality traits by the Temperament and Character Inventory (TCI). Common polymorphisms within a set of nine important candidate genes (SLC6A3, DBH, DRD4, DRD5, HTR2A, CHRNA7, BDNF, PRKG1 and TAAR9) were genotyped for each subject. Life events, personality traits and genetic variations were analyzed in relationship to severity of current symptoms, according to the Brown Attention Deficit Disorder Scale (BADDS). Genetic variations were not significantly associated with severity of ADHD symptoms. Life stressors displayed only a minor effect as compared to personality traits. Indeed, symptoms' severity was significantly correlated with the temperamental trait of Harm avoidance and the character trait of Self directedness. The results of the present work are in line with previous evidence of a significant correlation between some personality traits and adult ADHD. However, several limitations such as the small sample size and the exclusion of patients with other severe comorbid psychiatric disorders could have influenced the significance of present findings.

  3. Identifying early events of gene expression in breast cancer with systems biology phylogenetics.

    Science.gov (United States)

    Abu-Asab, M S; Abu-Asab, N; Loffredo, C A; Clarke, R; Amri, H

    2013-01-01

    Advanced omics technologies such as deep sequencing and spectral karyotyping are revealing more of cancer heterogeneity at the genetic, genomic, gene expression, epigenetic, proteomic, and metabolomic levels. With this increasing body of emerging data, the task of data analysis becomes critical for mining and modeling to better understand the relevant underlying biological processes. However, the multiple levels of heterogeneity evident within and among populations, healthy and diseased, complicate the mining and interpretation of biological data, especially when dealing with hundreds to tens of thousands of variables. Heterogeneity occurs in many diseases, such as cancers, autism, macular degeneration, and others. In cancer, heterogeneity has hampered the search for validated biomarkers for early detection, and it has complicated the task of finding clonal (driver) and nonclonal (nonexpanded or passenger) aberrations. We show that subtyping of cancer (classification of specimens) should be an a priori step to the identification of early events of cancers. Studying early events in oncogenesis can be done on histologically normal tissues from diseased individuals (HNTDI), since they most likely have been exposed to the same mutagenic insults that caused the cancer in their neighboring tissues. Polarity assessment of HNTDI data variables by using healthy specimens as outgroup(s), followed by the application of parsimony phylogenetic analysis, produces a hierarchical classification of specimens that reveals the early events of the disease ontogeny within its subtypes as shared derived changes (abnormal changes) or synapomorphies in phylogenetic terminology. Copyright © 2013 S. Karger AG, Basel.

  4. Do mass participation sporting events have a role in making populations more active?

    OpenAIRE

    Lane, Aoife; Murphy, N M; Smith, Peter; Bauman, Adrian

    2010-01-01

    Mass sporting events are becoming increasingly popular worldwide and may have health benefits as they foster low intensity participation in a non competitive, fun environment. We know little, however, about their long term effect, if any, on physical activity levels. This report describes the initial impact of three women only mass events in Ireland as well as the effectiveness of a series of initiatives designed to boost activity among the least active participants. It also prese...

  5. Quantitative control of organ shape by combinatorial gene activity.

    Directory of Open Access Journals (Sweden)

    Min-Long Cui

    Full Text Available The development of organs with particular shapes, like wings or flowers, depends on regional activity of transcription factors and signalling molecules. However, the mechanisms that link these molecular activities to the morphogenetic events underlying shape are poorly understood. Here we describe a combination of experimental and computational approaches that address this problem, applying them to a group of genes controlling flower shape in the Snapdragon (Antirrhinum. Four transcription factors are known to play a key role in the control of floral shape and asymmetry in Snapdragon. We use quantitative shape analysis of mutants for these factors to define principal components underlying flower shape variation. We show that each transcription factor has a specific effect on the shape and size of regions within the flower, shifting the position of the flower in shape space. These shifts are further analysed by generating double mutants and lines that express some of the genes ectopically. By integrating these observations with known gene expression patterns and interactions, we arrive at a combinatorial scheme for how regional effects on shape are genetically controlled. We evaluate our scheme by incorporating the proposed interactions into a generative model, where the developing flower is treated as a material sheet that grows according to how genes modify local polarities and growth rates. The petal shapes generated by the model show a good quantitative match with those observed experimentally for each petal in numerous genotypes, thus validating the hypothesised scheme. This article therefore shows how complex shapes can be accounted for by combinatorial effects of transcription factors on regional growth properties. This finding has implications not only for how shapes develop but also for how they may have evolved through tinkering with transcription factors and their targets.

  6. Fibrinogen gene haplotypes in relation to risk of coronary events and coronary and extracoronary atherosclerosis: the Rotterdam Study.

    Science.gov (United States)

    Kardys, Isabella; Uitterlinden, André G; Hofman, Albert; Witteman, Jacqueline C M; de Maat, Moniek P M

    2007-02-01

    Fibrin network structure has been correlated with coronary disease. Fibrinogen gamma and alpha (FGG and FGA) gene haplotypes (chromosome 4q28) may be associated with fibrin network structure, and thereby with rigidity of the fibrin clot and sensitivity of the fibrin clot to the fibrinolytic system. Through these mechanisms they may influence risk of cardiovascular disease. We set out to investigate the relation between combined fibrinogen FGG and FGA gene haplotypes, representing the common variation of the fibrinogen FGG and FGA genes, coronary events and measures of coronary and extracoronary atherosclerosis. The study was embedded in the Rotterdam Study, a prospective population-based study among men and women aged >or=55 years. Common haplotypes were studied using seven tagging SNPs across a 30-kb region with the FGG and FGA genes. Incident coronary events were registered, and carotid intima-media thickness, carotid plaques, ankle-arm index, aortic calcification and coronary calcification were assessed. Seven haplotypes with frequencies >1% covered 97.5% of the genetic variation. In 5,667 participants without history of coronary heart disease (CHD), 733 CHD cases occurred during a median follow-up time of 11.9 years. Fibrinogen gene haplotypes were not associated with coronary events. Fibrinogen gene haplotypes did not show a consistent association with measures of coronary and extracoronary atherosclerosis. In conclusion, fibrinogen FGG and FGA gene haplotypes are not associated with coronary events, coronary atherosclerosis or extracoronary atherosclerosis. Confirmation of these findings by future population-based studies is warranted.

  7. Complete resequencing of 40 genomes reveals domestication events and genes in silkworm (Bombyx)

    DEFF Research Database (Denmark)

    Xia, Qingyou; Guo, Yiran; Zhang, Ze;

    2009-01-01

    A single-base pair resolution silkworm genetic variation map was constructed from 40 domesticated and wild silkworms, each sequenced to approximately threefold coverage, representing 99.88% of the genome. We identified ~16 million single-nucleotide polymorphisms, many indels, and structural...... variations. We find that the domesticated silkworms are clearly genetically differentiated from the wild ones, but they have maintained large levels of genetic variability, suggesting a short domestication event involving a large number of individuals. We also identified signals of selection at 354 candidate...... genes that may have been important during domestication, some of which have enriched expression in the silk gland, midgut, and testis. These data add to our understanding of the domestication processes and may have applications in devising pest control strategies and advancing the use of silkworms...

  8. Plant gene expression in the age of systems biology: integrating transcriptional and post-transcriptional events.

    Science.gov (United States)

    Belostotsky, Dmitry A; Rose, Alan B

    2005-07-01

    The extensive mechanistic and regulatory interconnections between the various events of mRNA biogenesis are now recognized as a fundamental principle of eukaryotic gene expression, yet the specific details of the coupling between the various steps of mRNA biogenesis do differ, and sometimes dramatically, between the different kingdoms. In this review, we emphasize examples where plants must differ in this respect from other eukaryotes, and highlight a recurring trend of recruiting the conserved, versatile functional modules, which have evolved to support the general mRNA biogenesis reactions, for plant-specific functions. We also argue that elucidating the inner workings of the plant 'mRNA factory' is essential for accomplishing the ambitious goal of building the 'virtual plant'.

  9. Motivation and intention to integrate physical activity into daily school life: the JAM World Record event.

    Science.gov (United States)

    Vazou, Spyridoula; Vlachopoulos, Symeon P

    2014-11-01

    Research on the motivation of stakeholders to integrate physical activity into daily school life is limited. The purpose was to examine the motivation of stakeholders to participate in a world record physical activity event and whether motivation was associated with future intention to use activity breaks during the daily school life and future participation in a similar event. After the 2012 JAM (Just-a-Minute) World Record event, 686 adults (591 women; 76.1% participated for children motivational regulations and future intention to (a) use the activity breaks and (b) participate in the event. High intrinsic motivation and low extrinsic motivation and amotivation for participation in the next event were reported. Hierarchical regression analysis, controlling for age, gender, and occupation, showed that intrinsic forms of motivation positively predicted, whereas amotivation negatively predicted, future intention to participate in the event and use the activity breaks. Multivariate analyses of variance revealed that school-related participants were more intrinsically motivated and intended to use the activity breaks and repeat the event more than those who were not affiliated with a school. Nonschool participants reported higher extrinsic motivation and amotivation than school-related participants. © 2014 Society for Public Health Education.

  10. Major electron events and coronal magnetic configurations of the related solar active regions

    CERN Document Server

    Li, C; Matthews, S A; Dai, Y; Tang, Y H

    2013-01-01

    A statistical survey of 26 major electron events during the period 2002 February through the end of solar cycle 23 is presented. We have obtained electron solar onset times and the peak flux spectra for each event by fitting to a powerlaw spectrum truncated by an exponential high-energy tail. We also derived the coronal magnetic configurations of the related solar active regions (ARs) from the potential-field source-surface model. It is found that (1) 10 of the 11 well-connected open field-line events are prompt events whose solar onset times coincide with the maxima of flare emission and 13 of the 14 closed field-line events are delayed events. (2) A not-wellconnected open field-line event and one of the closed field-line events are prompt events, they are both associated with large-scale coronal disturbances or dimming. (3)An averaged harder spectrum is found in open field-line events compared with the closed ones. Specifically, the averaged spectral index is of 1.6 +/- 0.3 in open field-line events and of ...

  11. 31 CFR 545.525 - Certain services relating to participation in various events and activities authorized.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Certain services relating to participation in various events and activities authorized. 545.525 Section 545.525 Money and Finance: Treasury... directly to, participation in a public conference, performance, exhibition or similar event, provided...

  12. Activities of Human Gene Nomenclature Committee

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-07-16

    The objective of this project, shared between NIH and DOE, has been and remains to enable the medical genetics communities to use common names for genes that are discovered by different gene hunting groups, in different species. This effort provides consistent gene nomenclature and approved gene symbols to the community at large. This contributes to a uniform and consistent understanding of genomes, particularly the human as well as functional genomics based on comparisons between homologous genes in related species (human and mice).

  13. Prevention of adverse events of interferon γ gene therapy by gene delivery of interferon γ-heparin-binding domain fusion protein in mice

    Directory of Open Access Journals (Sweden)

    Mitsuru Ando

    2014-01-01

    Full Text Available Sustained gene delivery of interferon (IFN γ can be an effective treatment, but our previous study showed high levels of IFNγ-induced adverse events, including the loss of body weight. These unwanted events could be reduced by target-specific delivery of IFNγ after in vivo gene transfer. To achieve this, we selected the heparin-binding domain (HBD of extracellular superoxide dismutase as a molecule to anchor IFNγ to the cell surface. We designed three IFNγ derivatives, IFNγ-HBD1, IFNγ-HBD2, and IFNγ-HBD3, each of which had 1, 2, or 3 HBDs, respectively. Each plasmid-encoding fusion proteins was delivered to the liver, a model target in this study, by hydrodynamic tail vein injection. The serum concentration of IFNγ-HBD2 and IFNγ-HBD3 after gene delivery was lower than that of IFNγ or IFNγ-HBD1. Gene delivery of IFNγ-HBD2, but not of IFNγ-HBD3, effectively increased the mRNA expression of IFNγ-inducible genes in the liver, suggesting liver-specific distribution of IFNγ-HBD2. Gene delivery of IFNγ-HBD2-suppressed tumor growth in the liver as efficiently as that of IFNγ with much less symptoms of adverse effects. These results indicate that the adverse events of IFNγ gene transfer can be prevented by gene delivery of IFNγ-HBD2, a fusion protein with high cell surface affinity.

  14. Aspirin exposure reveals novel genes associated with platelet function and cardiovascular events.

    Science.gov (United States)

    Voora, Deepak; Cyr, Derek; Lucas, Joseph; Chi, Jen-Tsan; Dungan, Jennifer; McCaffrey, Timothy A; Katz, Richard; Newby, L Kristin; Kraus, William E; Becker, Richard C; Ortel, Thomas L; Ginsburg, Geoffrey S

    2013-10-01

    The aim of this study was to develop ribonucleic acid (RNA) profiles that could serve as novel biomarkers for the response to aspirin. Aspirin reduces death and myocardial infarction (MI), suggesting that aspirin interacts with biological pathways that may underlie these events. Aspirin was administered, followed by whole-blood RNA microarray profiling, in a discovery cohort of healthy volunteers (HV1) (n = 50) and 2 validation cohorts of healthy volunteers (HV2) (n = 53) and outpatient cardiology patients (OPC) (n = 25). Platelet function was assessed using the platelet function score (PFS) in HV1 and HV2 and the VerifyNow Aspirin Test (Accumetrics, Inc., San Diego, California) in OPC. Bayesian sparse factor analysis identified sets of coexpressed transcripts, which were examined for associations with PFS in HV1 and validated in HV2 and OPC. Proteomic analysis confirmed the association of validated transcripts in platelet proteins. Validated gene sets were tested for association with death or MI in 2 patient cohorts (n = 587 total) from RNA samples collected at cardiac catheterization. A set of 60 coexpressed genes named the "aspirin response signature" (ARS) was associated with PFS in HV1 (r = -0.31, p = 0.03), HV2 (r = -0.34, Bonferroni p = 0.03), and OPC (p = 0.046). Corresponding proteins for the 17 ARS genes were identified in the platelet proteome, of which 6 were associated with PFS. The ARS was associated with death or MI in both patient cohorts (odds ratio: 1.2 [p = 0.01]; hazard ratio: 1.5 [p = 0.001]), independent of cardiovascular risk factors. Compared with traditional risk factors, reclassification (net reclassification index = 31% to 37%, p ≤ 0.0002) was improved by including the ARS or 1 of its genes, ITGA2B. RNA profiles of platelet-specific genes are novel biomarkers for identifying patients who do not respond adequately to aspirin and who are at risk for death or MI. Copyright © 2013 American College of Cardiology Foundation. Published by

  15. Reconciling gene and genome duplication events: using multiple nuclear gene families to infer the phylogeny of the aquatic plant family Pontederiaceae.

    Science.gov (United States)

    Ness, Rob W; Graham, Sean W; Barrett, Spencer C H

    2011-11-01

    Most plant phylogenetic inference has used DNA sequence data from the plastid genome. This genome represents a single genealogical sample with no recombination among genes, potentially limiting the resolution of evolutionary relationships in some contexts. In contrast, nuclear DNA is inherently more difficult to employ for phylogeny reconstruction because major mutational events in the genome, including polyploidization, gene duplication, and gene extinction can result in homologous gene copies that are difficult to identify as orthologs or paralogs. Gene tree parsimony (GTP) can be used to infer the rooted species tree by fitting gene genealogies to species trees while simultaneously minimizing the estimated number of duplications needed to reconcile conflicts among them. Here, we use GTP for five nuclear gene families and a previously published plastid data set to reconstruct the phylogenetic backbone of the aquatic plant family Pontederiaceae. Plastid-based phylogenetic studies strongly supported extensive paraphyly of Eichhornia (one of the four major genera) but also depicted considerable ambiguity concerning the true root placement for the family. Our results indicate that species trees inferred from the nuclear genes (alone and in combination with the plastid data) are highly congruent with gene trees inferred from plastid data alone. Consideration of optimal and suboptimal gene tree reconciliations place the root of the family at (or near) a branch leading to the rare and locally restricted E. meyeri. We also explore methods to incorporate uncertainty in individual gene trees during reconciliation by considering their individual bootstrap profiles and relate inferred excesses of gene duplication events on individual branches to whole-genome duplication events inferred for the same branches. Our study improves understanding of the phylogenetic history of Pontederiaceae and also demonstrates the utility of GTP for phylogenetic analysis.

  16. Low-dose gamma-rays and simulated solar particle event protons modify splenocyte gene and cytokine expression patterns.

    Science.gov (United States)

    Rizvi, Asma; Pecaut, Michael J; Gridley, Daila S

    2011-01-01

    The goal was to investigate the T helper (Th) response in splenocytes of mice exposed to low-dose/low-dose-rate (LDR) γ-rays, simulated solar particle event protons (sSPE), or combination of both. C57BL/6 mice were exposed to LDR γ-radiation ((57)Co) to a total dose of 0.05 Gray (Gy) at 0.024 cGy/h, either with or without subsequent exposure to 2 Gy sSPE protons. Expression of genes related to Th cells was evaluated immediately after exposure (day 0). On day 21, intra- and extracellular cytokine production was assessed after activation with anti-CD3 monoclonal antibodies (mAb) or phorbol 12-myristate 13-acetate/ionophore (PMA/I). Five genes were significantly modulated on day 0 in one or more of the irradiated groups compared to controls (p rays (p rays can in some cases modulate the response to sSPE.

  17. Cognitive tasks in information analysis: Use of event dwell time to characterize component activities

    Energy Technology Data Exchange (ETDEWEB)

    Sanquist, Thomas F.; Greitzer, Frank L.; Slavich, Antoinette L.; Littlefield, Rik J.; Littlefield, Janis S.; Cowley, Paula J.

    2004-09-28

    Technology-based enhancement of information analysis requires a detailed understanding of the cognitive tasks involved in the process. The information search and report production tasks of the information analysis process were investigated through evaluation of time-stamped workstation data gathered with custom software. Model tasks simulated the search and production activities, and a sample of actual analyst data were also evaluated. Task event durations were calculated on the basis of millisecond-level time stamps, and distributions were plotted for analysis. The data indicate that task event time shows a cyclic pattern of variation, with shorter event durations (< 2 sec) reflecting information search and filtering, and longer event durations (> 10 sec) reflecting information evaluation. Application of cognitive principles to the interpretation of task event time data provides a basis for developing “cognitive signatures” of complex activities, and can facilitate the development of technology aids for information intensive tasks.

  18. Transcriptomic events involved in melon mature-fruit abscission comprise the sequential induction of cell-wall degrading genes coupled to a stimulation of endo and exocytosis.

    Directory of Open Access Journals (Sweden)

    Jorge Corbacho

    Full Text Available BACKGROUND: Mature-fruit abscission (MFA in fleshy-fruit is a genetically controlled process with mechanisms that, contrary to immature-fruit abscission, has not been fully characterized. Here, we use pyrosequencing to characterize the transcriptomes of melon abscission zone (AZ at three stages during AZ-cell separation in order to understand MFA control at an early stage of AZ-activation. PRINCIPAL FINDINGS: The results show that by early induction of MFA, the melon AZ exhibits major gene induction, while by late induction of MFA, melon AZ shows major gene repression. Although some genes displayed similar regulation in both early and late induction of abscission, such as EXT1-EXT4, EGase1, IAA2, ERF1, AP2D15, FLC, MADS2, ERAF17, SAP5 and SCL13 genes, the majority had different expression patterns. This implies that time-specific events occur during MFA, and emphasizes the value of characterizing multiple time-specific abscission transcriptomes. Analysis of gene-expression from these AZs reveal that a sequential induction of cell-wall-degrading genes is associated with the upregulation of genes involved in endo and exocytosis, and a shift in plant-hormone metabolism and signaling genes during MFA. This is accompanied by transcriptional activity of small-GTPases and synthaxins together with tubulins, dynamins, V-type ATPases and kinesin-like proteins potentially involved in MFA signaling. Early events are potentially controlled by down-regulation of MADS-box, AP2/ERF and Aux/IAA transcription-factors, and up-regulation of homeobox, zinc finger, bZIP, and WRKY transcription-factors, while late events may be controlled by up-regulation of MYB transcription-factors. SIGNIFICANCE: Overall, the data provide a comprehensive view on MFA in fleshy-fruit, identifying candidate genes and pathways associated with early induction of MFA. Our comprehensive gene-expression profile will be very useful for elucidating gene regulatory networks of the MFA in

  19. Genesis of the vertebrate FoxP subfamily member genes occurred during two ancestral whole genome duplication events.

    Science.gov (United States)

    Song, Xiaowei; Tang, Yezhong; Wang, Yajun

    2016-08-22

    The vertebrate FoxP subfamily genes play important roles in the construction of essential functional modules involved in physiological and developmental processes. To explore the adaptive evolution of functional modules associated with the FoxP subfamily member genes, it is necessary to study the gene duplication process. We detected four member genes of the FoxP subfamily in sea lampreys (a representative species of jawless vertebrates) through genome screenings and phylogenetic analyses. Reliable paralogons (i.e. paralogous chromosome segments) have rarely been detected in scaffolds of FoxP subfamily member genes in sea lampreys due to the considerable existence of HTH_Tnp_Tc3_2 transposases. However, these transposases did not alter gene numbers of the FoxP subfamily in sea lampreys. The coincidence between the "1-4" gene duplication pattern of FoxP subfamily genes from invertebrates to vertebrates and two rounds of ancestral whole genome duplication (1R- and 2R-WGD) events reveal that the FoxP subfamily of vertebrates was quadruplicated in the 1R- and 2R-WGD events. Furthermore, we deduced that a synchronous gene duplication process occurred for the FoxP subfamily and for three linked gene families/subfamilies (i.e. MIT family, mGluR group III and PLXNA subfamily) in the 1R- and 2R-WGD events using phylogenetic analyses and mirror-dendrogram methods (i.e. algorithms to test protein-protein interactions). Specifically, the ancestor of FoxP1 and FoxP3 and the ancestor of FoxP2 and FoxP4 were generated in 1R-WGD event. In the subsequent 2R-WGD event, these two ancestral genes were changed into FoxP1, FoxP2, FoxP3 and FoxP4. The elucidation of these gene duplication processes shed light on the phylogenetic relationships between functional modules of the FoxP subfamily member genes.

  20. Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression.

    Science.gov (United States)

    Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression Exposure to many drugs and environmentally-relevant chemicals can cause adverse outcomes. These adverse outcomes, such as cancer, have been linked to mol...

  1. Effects related to gene-gene interactions of peroxisome proliferator-activated receptor on essential hypertension

    Institute of Scientific and Technical Information of China (English)

    俞浩

    2013-01-01

    Objective To explore the impact of the gene-gene interaction among the single nucleotide polymorphisms(SNPs) of peroxisome proliferator-activated receptorα/δ/γ on essential hypertension(EH).Methods

  2. Exploring eating and activity behaviors with parent-child dyads using event history calendars.

    Science.gov (United States)

    Danford, Cynthia A; Martyn, Kristy K

    2013-08-01

    Despite advances in science, the prevalence of childhood obesity persists and outcomes remain inconsistent. An event history calendar (EHC) is a tool to facilitate understanding of family life dynamics influencing eating and activity choices. This tool uses reflection to assess temporally linked behavior in the context of life events so that choices related to eating and activity are more explicit. Fourteen parent-child (6-14 years) dyads completed an EHC and interview 2 months following a healthy eating/activity intervention. Phenomenological analysis revealed themes including "awareness" of activity/eating behaviors, "healthy lessons," "family time," and "barriers" to change. The EHC facilitated participant communication and understanding by making connections between behaviors, habits, and events in family context, so that eating and activity behaviors could be realistically reviewed. This tool has potential to guide development of individualized interventions through barrier identification and goal establishment in research and clinical settings to help counteract childhood obesity over time.

  3. [Mutations of APOC3 gene, metabolism of triglycerides and reduction of ischemic cardiovascular events].

    Science.gov (United States)

    Pirillo, Angela; Catapano, Alberico Luigi

    2015-05-01

    A direct relationship between high plasma triglyceride (TG) levels and increased risk of cardiovascular disease has been shown in several studies. TG are present in the blood associated with different lipoprotein classes, including hepatically-derived very low density lipoproteins (VLDL) and intestinally-derived chylomicrons. Lipoprotein lipase (LPL) is a key enzyme that hydrolyzes TG, releasing free fatty acids that accumulate in peripheral tissues and remnant lipoproteins, that are then cleared by the liver. LPL activity is finely modulated by several cofactors, including apolipoprotein C-III (apoC-III) which acts as a LPL inhibitor. The key role of apoCIII has been established in several studies: animal models lacking APOC3 gene exhibit reduced plasma TG levels, whereas the overexpression of APOC3 gene led to increased TG levels. In humans, several mutations in APOC3 gene have been identified, leading to lower apoC-III levels and associated with reduced plasma TG levels. Recently, these mutations were found to be associated with a reduced risk for cardiovascular ischemia and coronary heart disease, thus confirming the negative role of apoC-III in TG metabolism and suggesting apoC-III as possible therapeutic target for the management of hypertriglyceridemia.

  4. DNA methyl transferase (DNMT gene polymorphisms could be a primary event in epigenetic susceptibility to schizophrenia.

    Directory of Open Access Journals (Sweden)

    Koramannil Radha Saradalekshmi

    Full Text Available DNA methylation has been implicated in the etiopathology of various complex disorders. DNA methyltransferases are involved in maintaining and establishing new methylation patterns. The aim of the present study was to investigate the inherent genetic variations within DNA methyltransferase genes in predisposing to susceptibility to schizophrenia. We screened for polymorphisms in DNA methyltransferases, DNMT1, DNMT3A, DNMT3B and DNMT3L in 330 schizophrenia patients and 302 healthy controls for association with Schizophrenia in south Indian population. These polymorphisms were also tested for subgroup analysis with patient's gender, age of onset and family history. DNMT1 rs2114724 (genotype P = .004, allele P = 0.022 and rs2228611 (genotype P = 0.004, allele P = 0.022 were found to be significantly associated at genotypic and allelic level with Schizophrenia in South Indian population. DNMT3B rs2424932 genotype (P = 0.023 and allele (P = 0.0063 increased the risk of developing schizophrenia in males but not in females. DNMT3B rs1569686 (genotype P = 0.027, allele P = 0.033 was found to be associated with early onset of schizophrenia and also with family history and early onset (genotype P = 0.009. DNMT3L rs2070565 (genotype P = 0.007, allele P = 0.0026 confers an increased risk of developing schizophrenia at an early age in individuals with family history. In-silico prediction indicated functional relevance of these SNPs in regulating the gene. These observations might be crucial in addressing and understanding the genetic control of methylation level differences from ethnic viewpoint. Functional significance of genotype variations within the DNMTs indeed suggest that the genetic nature of methyltransferases should be considered while addressing epigenetic events mediated by methylation in Schizophrenia.

  5. Functional gene polymorphisms in the serotonin system and traumatic life events modulate the neural basis of fear acquisition and extinction.

    Directory of Open Access Journals (Sweden)

    Andrea Hermann

    Full Text Available Fear acquisition and extinction are crucial mechanisms in the etiology and maintenance of anxiety disorders. Moreover, they might play a pivotal role in conveying the influence of genetic and environmental factors on the development of a (more or less stronger proneness for, or resilience against psychopathology. There are only few insights in the neurobiology of genetically and environmentally based individual differences in fear learning and extinction. In this functional magnetic resonance imaging study, 74 healthy subjects were investigated. These were invited according to 5-HTTLPR/rs25531 (S+ vs. L(AL(A; triallelic classification and TPH2 (G(-703T (T+ vs. T- genotype. The aim was to investigate the influence of genetic factors and traumatic life events on skin conductance responses (SCRs and neural responses (amygdala, insula, dorsal anterior cingulate cortex (dACC and ventromedial prefrontal cortex (vmPFC during acquisition and extinction learning in a differential fear conditioning paradigm. Fear acquisition was characterized by stronger late conditioned and unconditioned responses in the right insula in 5-HTTLPR S-allele carriers. During extinction traumatic life events were associated with reduced amygdala activation in S-allele carriers vs. non-carriers. Beyond that, T-allele carriers of the TPH2 (G(-703T polymorphism with a higher number of traumatic life events showed enhanced responsiveness in the amygdala during acquisition and in the vmPFC during extinction learning compared with non-carriers. Finally, a combined effect of the two polymorphisms with higher responses in S- and T-allele carriers was found in the dACC during extinction. The results indicate an increased expression of conditioned, but also unconditioned fear responses in the insula in 5-HTTLPR S-allele carriers. A combined effect of the two polymorphisms on dACC activation during extinction might be associated with prolonged fear expression. Gene

  6. Opossum carboxylesterases: sequences, phylogeny and evidence for CES gene duplication events predating the marsupial-eutherian common ancestor

    Directory of Open Access Journals (Sweden)

    Chan Jeannie

    2008-02-01

    Full Text Available Abstract Background Carboxylesterases (CES perform diverse metabolic roles in mammalian organisms in the detoxification of a broad range of drugs and xenobiotics and may also serve in specific roles in lipid, cholesterol, pheromone and lung surfactant metabolism. Five CES families have been reported in mammals with human CES1 and CES2 the most extensively studied. Here we describe the genetics, expression and phylogeny of CES isozymes in the opossum and report on the sequences and locations of CES1, CES2 and CES6 'like' genes within two gene clusters on chromosome one. We also discuss the likely sequence of gene duplication events generating multiple CES genes during vertebrate evolution. Results We report a cDNA sequence for an opossum CES and present evidence for CES1 and CES2 like genes expressed in opossum liver and intestine and for distinct gene locations of five opossum CES genes,CES1, CES2.1, CES2.2, CES2.3 and CES6, on chromosome 1. Phylogenetic and sequence alignment studies compared the predicted amino acid sequences for opossum CES with those for human, mouse, chicken, frog, salmon and Drosophila CES gene products. Phylogenetic analyses produced congruent phylogenetic trees depicting a rapid early diversification into at least five distinct CES gene family clusters: CES2, CES1, CES7, CES3, and CES6. Molecular divergence estimates based on a Bayesian relaxed clock approach revealed an origin for the five mammalian CES gene families between 328–378 MYA. Conclusion The deduced amino acid sequence for an opossum cDNA was consistent with its identity as a mammalian CES2 gene product (designated CES2.1. Distinct gene locations for opossum CES1 (1: 446,222,550–446,274,850, three CES2 genes (1: 677,773,395–677,927,030 and a CES6 gene (1: 677,585,520–677,730,419 were observed on chromosome 1. Opossum CES1 and multiple CES2 genes were expressed in liver and intestine. Amino acid sequences for opossum CES1 and three CES2 gene products

  7. Processing data communications events by awakening threads in parallel active messaging interface of a parallel computer

    Energy Technology Data Exchange (ETDEWEB)

    Archer, Charles J.; Blocksome, Michael A.; Ratterman, Joseph D.; Smith, Brian E.

    2016-03-15

    Processing data communications events in a parallel active messaging interface (`PAMI`) of a parallel computer that includes compute nodes that execute a parallel application, with the PAMI including data communications endpoints, and the endpoints are coupled for data communications through the PAMI and through other data communications resources, including determining by an advance function that there are no actionable data communications events pending for its context, placing by the advance function its thread of execution into a wait state, waiting for a subsequent data communications event for the context; responsive to occurrence of a subsequent data communications event for the context, awakening by the thread from the wait state; and processing by the advance function the subsequent data communications event now pending for the context.

  8. Low ABCB1 gene expression is an early event in colorectal carcinogenesis.

    Directory of Open Access Journals (Sweden)

    Vibeke Andersen

    Full Text Available The ABCB1/MDR1 gene product ABCB1/P-glycoprotein is implicated in the development of colorectal cancer (CRC. NFKB1 encodes transcription factors regulating expression of a number of genes including ABCB1. We have previously found association between the ABCB1 C-rs3789243-T polymorphism and CRC risk and interactions between the ABCB1 C-rs3789243-T and C3435T polymorphisms and meat intake in relation to CRC risk (Andersen, BMC Cancer, 2009, 9, 407. ABCB1 and NFKB1 mRNA levels were assessed in intestinal tissue from 122 CRC cases, 101 adenoma cases (12 with severe dysplasia, 89 with mild-moderate dysplasia and from 18 healthy individuals, together with gene polymorphisms in ABCB1 and NFKB1. ABCB1 mRNA levels were highest in the healthy individuals and significantly lower in mild/moderate and severe dysplasia tissue (P<0.05 for both, morphologically normal tissues close to the tumour (P<0.05, morphologically normal tissue at a distance from the tumour (P<0.05 and CRC tissue (P<0.001. Furthermore, ABCB1 mRNA levels were lower in adenomas and carcinomas compared to morphologically normal tissue from the same individuals (P<0.01. The ABCB1 C-rs3789243-T and NFKB1 -94ins/del homozygous variant genotypes were associated with low ABCB1 mRNA levels in morphologically normal sigmoid tissue from adenoma cases (P<0.05 for both. NFKB1 mRNA levels were lower in both tumour and normal tissue from cancer patients (P<0.001 as compared to healthy individuals but we were unable to show association between NFKB1 -94ins/del genotype and NFKB1 mRNA levels. This study suggests that low ABCB1 mRNA levels are an early event in CRC development and that the two polymorphisms affect ABCB1 mRNA levels whereas low NFKB1 mRNA levels occur later in carcinogenesis. Low ABCB1 protein levels may promote colorectal carcinogenesis through increasing intracellular exposure to carcinogenic ABCB1 substrates.

  9. Active and break events of Indian summer monsoon during 1901-2014

    Digital Repository Service at National Institute of Oceanography (India)

    Pai, D.S.; Sridhar, L.; RameshKumar, M.R.

    The study lists active and break monsoon events over India over a very long period (1901-2014) identified using criteria based on a rainfall index derived over a critical high rainfall region called core monsoon zone. The break and active spells...

  10. Recombination activating activity of XRCC1 analogous genes in X-ray sensitive and resistant CHO cell lines

    Science.gov (United States)

    Golubnitchaya-Labudová, O.; Portele, A.; Vaçata, V.; Lubec, G.; Rink, H.; Höfer, M.

    1997-10-01

    The XRCC1 gene (X-ray repair cross complementing) complements the DNA repair deficiency of the radiation sensitive Chinese hamster ovary (CHO) mutant cell line EM9 but the mechanism of the correction is not elucidated yet. XRCC1 shows substantial homology to the RAG2 gene (recombination activating gene) and we therefore tried to answer question, whether structural similarities (sequence of a putative recombination activating domain, aa 332-362 for XRCC1 and aa 286-316 in RAG2) would reflect similar functions of the homologous, putative recombination activating domain. PCR experiments revealed that no sequence homologous to the structural part of human XRCC1 was present in cDNA of CHO. Differential display demonstrated two putative recombination activating domains in the parental CHO line AA8 and one in the radiosensitive mutant EM9. Southern blot experiments showed the presence of several genes with partial homology to human XRCC1. Recombination studies consisted of expressing amplified target domains within chimeric proteins in recA - bacteria and subsequent detection of recombination events by sequencing the recombinant plasmids. Recombination experiments demonstrated recombination activating activity of all putative recombination activating domains amplified from AA8 and EM9 genomes as reflected by deletions within the insert of the recombinant plasmids. The recombination activating activity of XRCC1 analogues could explain a mechanism responsible for the correction of the DNA repair defect in EM9.

  11. Insights into the coupling of duplication events and macroevolution from an age profile of animal transmembrane gene families.

    Directory of Open Access Journals (Sweden)

    Guohui Ding

    2006-08-01

    Full Text Available The evolution of new gene families subsequent to gene duplication may be coupled to the fluctuation of population and environment variables. Based upon that, we presented a systematic analysis of the animal transmembrane gene duplication events on a macroevolutionary scale by integrating the palaeontology repository. The age of duplication events was calculated by maximum likelihood method, and the age distribution was estimated by density histogram and normal kernel density estimation. We showed that the density of the duplicates displays a positive correlation with the estimates of maximum number of cell types of common ancestors, and the oxidation events played a key role in the major transitions of this density trace. Next, we focused on the Phanerozoic phase, during which more macroevolution data are available. The pulse mass extinction timepoints coincide with the local peaks of the age distribution, suggesting that the transmembrane gene duplicates fixed frequently when the environment changed dramatically. Moreover, a 61-million-year cycle is the most possible cycle in this phase by spectral analysis, which is consistent with the cycles recently detected in biodiversity. Our data thus elucidate a strong coupling of duplication events and macroevolution; furthermore, our method also provides a new way to address these questions.

  12. Characteristics of upstream energetic (E>=50keV) ion events during intense geomagnetic activity

    Science.gov (United States)

    Anagnostopoulos, G. C.; Rigas, A. G.; Sarris, E. T.; Krimigis, S. M.

    1998-05-01

    In this work we examine the statistical presence of some important features of upstream energetic (>=50 keV) ion events under some special conditions in the upstream region and the magnetosphere. The 125 ion events considered in the statistic were observed by the IMP 7 and IMP 8 spacecraft, at ~35RE from the Earth, during nine long time intervals of a total of 153 hours. The time intervals analyzed were selected under the following restrictions: existence of high proton flux (i.e., >=900 pcm-2s-1sr-1) and of a great number of events (an occurrence frequency of ~10 events per 12 hours in the whole statistics) in the energy range 50-220 keV. The most striking findings are the following: (1) The upstream events were observed during times with high values of the geomagnetic activity index Kp(>=3-) (2) all of the upstream events (100%) have energy spectra extending up to energies E>=290keV (3) 86% of these events are accompanied by relativistic (E>=220keV) electrons; and (4) the majority of the upstream ion events (82%) showed noninverse velocity dispersion during their onset phase (22% of the events showed forward velocity dispersion, and 60% showed no velocity dispersion at all when 5.5-min averaged observations were analyzed). Further statistical analysis of this sample of upstream particle events shows that the 50- to 220-keV proton flux shows a positive correlation with the following parameters: the Kp index of geomagnetic activity and the flux of the high-energy (290-500 keV) protons and (>=220 keV) electrons. More specific findings are the following: (1) The spectral index γ for a power law distribution of ions detected by the National Oceanic and Atmospheric Administration Energetic Particle Experiment (EPE) instrument (50=220-keV electrons increases with the time duration of upstream events. We infer that the vast majority of the upstream ion events considered in this study (under conditions of intense particle activity in the upstream region and enhanced

  13. Characteristics of active regions associated to large solar energetic proton events

    Science.gov (United States)

    Bronarska, K.; Michalek, G.

    2017-01-01

    The relationship between properties of active regions (ARs) and solar energetic particles (SEP events, protons with energy ⩾10 MeV) is examined. For this purpose we study 84 SEP events recorded during the SOHO era (1996-2014). We compare properties of these SEP events with associated ARs, flares and CMEs. The ARs are characterized by McIntosh classification. Statistical analysis demonstrates that SEP events are more likely to be associated to the ARs having complex magnetic structures and the most energetic SEPs are ejected only from the associated ARs having a large and asymmetric penumbra. This tendency is used to estimate intensities of potential SEP events. For this purpose we express a probability of occurrence of an SEP event from a given AR which is correlated with fluxes of associated SEPs. We find that SEP events associated with ARs from eastern longitudes have to be more complex to produce SEP events at Earth. On the other hand, SEP particles originating from mid-longitudes (30 ° forecasting of space weather.

  14. Stressful life events and psychosocial correlates of pediatric inflammatory bowel disease activity

    Science.gov (United States)

    Giannakopoulos, George; Chouliaras, George; Margoni, Daphne; Korlou, Sophia; Hantzara, Vassiliki; Panayotou, Ioanna; Roma, Eleftheria; Liakopoulou, Magda; Anagnostopoulos, Dimitris C

    2016-01-01

    AIM To investigate the association of psychiatric and psychosocial correlates with inflammatory bowel disease (IBD) activity in children and adolescents. METHODS A total of 85 pediatric IBD patients (in remission or active state of the disease) and their parents completed a series of questionnaires and semi-structured interviews measuring life events, depression, anxiety, family dysfunction, and parent mental health. Differences between the remission and the IBD active group and the association of any significant variable with the disease activity state were examined. RESULTS Parents of children being in active state of the disease reported more life events (P = 0.005) and stressful life events (P = 0.048) during the past year and more mental health symptoms (P < 0.001), while the children themselves reported higher levels of anxiety symptoms (P = 0.017) compared to the remission group. In the logistic regression multivariate analysis, the only predictor which had a significant positive effect on the probability of the patients being in active state was parent mental health symptoms (OR = 4.8; 95%CI: 1.2-25.8). CONCLUSION Life events, child anxiety and parent mental health symptoms may be important correlates of pediatric IBD activity and targets of thorough assessment and treatment. PMID:27679771

  15. Gene program-specific regulation of PGC-1{alpha} activity

    DEFF Research Database (Denmark)

    Schmidt, Søren F; Mandrup, Susanne

    2011-01-01

    Peroxisome proliferator-activated receptor γ (PPARγ) coactivator 1 α (PGC-1α) activation coordinates induction of the hepatic fasting response through coactivation of numerous transcription factors and gene programs. In the June 15, 2011, issue of Genes & Development, Lustig and colleagues (pp...

  16. Antecedent occipital alpha band activity predicts the impact of oculomotor events in perceptual switching

    Directory of Open Access Journals (Sweden)

    Hironori eNakatani

    2013-05-01

    Full Text Available Oculomotor events such as blinks and saccades transiently interrupt the visual input and, even though this mostly goes undetected, these brief interruptions could still influence the percept. In particular, both blinking and saccades facilitate switching in ambiguous figures such as the Necker cube. To investigate the neural state antecedent to these oculomotor events during the perception of an ambiguous figure, we measured the human scalp electroencephalogram (EEG. When blinking led to perceptual switching, antecedent occipital alpha band activity exhibited a transient increase in amplitude. When a saccade led to switching, a series of transient increases and decreases in amplitude was observed in the antecedent occipital alpha band activity. Our results suggest that the state of occipital alpha band activity predicts the impact of oculomotor events on the percept.

  17. Profiling gene expression induced by protease-activated receptor 2 (PAR2 activation in human kidney cells.

    Directory of Open Access Journals (Sweden)

    Jacky Y Suen

    Full Text Available Protease-Activated Receptor-2 (PAR2 has been implicated through genetic knockout mice with cytokine regulation and arthritis development. Many studies have associated PAR2 with inflammatory conditions (arthritis, airways inflammation, IBD and key events in tumor progression (angiogenesis, metastasis, but they have relied heavily on the use of single agonists to identify physiological roles for PAR2. However such probes are now known not to be highly selective for PAR2, and thus precisely what PAR2 does and what mechanisms of downstream regulation are truly affected remain obscure. Effects of PAR2 activation on gene expression in Human Embryonic Kidney cells (HEK293, a commonly studied cell line in PAR2 research, were investigated here by comparing 19,000 human genes for intersecting up- or down-regulation by both trypsin (an endogenous protease that activates PAR2 and a PAR2 activating hexapeptide (2f-LIGRLO-NH(2. Among 2,500 human genes regulated similarly by both agonists, there were clear associations between PAR2 activation and cellular metabolism (1,000 genes, the cell cycle, the MAPK pathway, HDAC and sirtuin enzymes, inflammatory cytokines, and anti-complement function. PAR-2 activation up-regulated four genes more than 5 fold (DUSP6, WWOX, AREG, SERPINB2 and down-regulated another six genes more than 3 fold (TXNIP, RARG, ITGB4, CTSD, MSC and TM4SF15. Both PAR2 and PAR1 activation resulted in up-regulated expression of several genes (CD44, FOSL1, TNFRSF12A, RAB3A, COPEB, CORO1C, THBS1, SDC4 known to be important in cancer. This is the first widespread profiling of specific activation of PAR2 and provides a valuable platform for better understanding key mechanistic roles of PAR2 in human physiology. Results clearly support the development of both antagonists and agonists of human PAR2 as potential disease modifying therapeutic agents.

  18. Organization of immunoglobulin genes.

    Science.gov (United States)

    Tonegawa, S; Brack, C; Hozumi, N; Pirrotta, V

    1978-01-01

    The nucleotide-sequence determination of a cloned, embryonic Vlambda gene directly demonstrated that V genes are separate from a corresponding C gene in embryonic cells. Analysis by restriction enzymes of total cellular DNA from various sources strongly suggested that the two separate immunoglobulin genes become continuous during differentiation of B lymphocytes. There seems to be a strict correlation between the joining event and activation of the joined genes. Cloning of more immunoglobulin genes from embryo and plasma cells will not only provide direct demonstration of such a gene-joining event but also help in the elucidation of a possible relationship of the event to gene activation mechanisms.

  19. Genome analysis and gene nblA identification of Microcystis aeruginosa myovirus (MaMV-DC) reveal the evidence for horizontal gene transfer events between cyanomyovirus and host.

    Science.gov (United States)

    Ou, Tong; Gao, Xiao-Chan; Li, San-Hua; Zhang, Qi-Ya

    2015-12-01

    The genome sequence, genetic characterization and nblA gene function of Microcystis aeruginosa myovirus isolated from Lake Dianchi in China (MaMV-DC) have been analysed. The genome DNA is 169 223 bp long, with 170 predicted protein-coding genes (001L–170L) and a tRNA gene. About one-sixth of these genes have homologues in the host cyanobacteria M. aeruginosa. The genome carries a gene homologous to host nblA, which encodes a protein involved in the degradation of cyanobacterial phycobilisome. Its expression during MaMV-DC infection was confirmed by reverse transcriptase PCR and Western blot detection and abundant expression was companied by the significant decline of phycocyanin content and massive release of progeny MaMV-DC. In addition, expressing MaMV-DC nblA reduced the phycocyanin peak and the phycocyanin to chlorophyll ratio in model cyanobacteria. These results confirm that horizontal gene transfer events have occurred between cyanobacterial host and cyanomyovirus and suggest that MaMV-DC carrying host-derived genes (such as 005L, that codes for NblA) is responsible for more efficient expression of cyanophage genes and release of progeny cyanophage. This study provides novel insight into the horizontal gene transfer in cyanophage and the interactions between cyanophage and their host.

  20. Composite Event Specification and Detection for Supporting Active Capability in an OODBMS: Semantics Architecture and Implementation.

    Science.gov (United States)

    1995-03-01

    For all outgoing edges i from ’n’ propagate parameters in node ’n’ to the nodei connected by edge i activate-operator-node( nodej ); Delete propagated...El E2 Figure 6: Detection of X in recent mode PROCEDURE activate-operator-node( nodej ) /* Recent Context */ CASE nodei is of type a primitive or...composite event has been signalled to nodej */ AND(E1, E2): if left event el is signalled if E2’s list is not empty Pass <e2, el> to the parent Replace el in

  1. The Effect of Local Events to Rural Tourism as a Recreational Activity

    Directory of Open Access Journals (Sweden)

    Elif Zeynep ÖZER

    2014-08-01

    Full Text Available Recreation is the activities that person attends voluntarily in his/her spare time to refreshing, relaxing and motivation. Activities that are made in rural area are option for recreational activities. There is an increase in consumer demand for rural tour ism as an alternative tourism option. Participants get a chance to know different cultural structures and chance to see natural beauties by attending rural activities. Events that are performed with attendees form different destinations are support area fr om economy, development and advertising point of view. Objective of this work is making contribution to development rural tourism and recreational activities by defining the effect of local events to rural tourism as a recreational activity. In this work, the effect of participation of recreational tourism activities to rural tourism is investigated. Data that is required is gathered by semi structured interview technique. The result of this work has a potential to use a resource to lead event managers. Thi s work also has a potential to use a resource for studies that are related to recreation tourism, local activities and rural tourism.

  2. Peroxisome proliferator-activated receptor subtype- and cell-type-specific activation of genomic target genes upon adenoviral transgene delivery

    DEFF Research Database (Denmark)

    Nielsen, Ronni; Grøntved, Lars; Stunnenberg, Hendrik G

    2006-01-01

    Investigations of the molecular events involved in activation of genomic target genes by peroxisome proliferator-activated receptors (PPARs) have been hampered by the inability to establish a clean on/off state of the receptor in living cells. Here we show that the combination of adenoviral...... delivery and chromatin immunoprecipitation (ChIP) is ideal for dissecting these mechanisms. Adenoviral delivery of PPARs leads to a rapid and synchronous expression of the PPAR subtypes, establishment of transcriptional active complexes at genomic loci, and immediate activation of even silent target genes....... We demonstrate that PPARgamma2 possesses considerable ligand-dependent as well as independent transactivation potential and that agonists increase the occupancy of PPARgamma2/retinoid X receptor at PPAR response elements. Intriguingly, by direct comparison of the PPARs (alpha, gamma, and beta...

  3. Epigenetic Genes and Emotional Reactivity to Daily Life Events : A Multi-Step Gene-Environment Interaction Study

    NARCIS (Netherlands)

    Pishva, Ehsan; Drukker, Marjan; Viechtbauer, Wolfgang; Decoster, Jeroen; Collip, Dina; van Winkel, Ruud; Wichers, Marieke; Jacobs, Nele; Thiery, Evert; Derom, Catherine; Geschwind, Nicole; van den Hove, Daniel; Lataster, Tineke; Myin-Germeys, Inez; van Os, Jim; Rutten, Bart P. F.; Kenis, Gunter

    2014-01-01

    Recent human and animal studies suggest that epigenetic mechanisms mediate the impact of environment on development of mental disorders. Therefore, we hypothesized that polymorphisms in epigenetic-regulatory genes impact stress-induced emotional changes. A multi-step, multi-sample gene-environment i

  4. Using Active Learning to Identify Health Information Technology Related Patient Safety Events.

    Science.gov (United States)

    Fong, Allan; Howe, Jessica L; Adams, Katharine T; Ratwani, Raj M

    2017-01-18

    The widespread adoption of health information technology (HIT) has led to new patient safety hazards that are often difficult to identify. Patient safety event reports, which are self-reported descriptions of safety hazards, provide one view of potential HIT-related safety events. However, identifying HIT-related reports can be challenging as they are often categorized under other more predominate clinical categories. This challenge of identifying HIT-related reports is exacerbated by the increasing number and complexity of reports which pose challenges to human annotators that must manually review reports. In this paper, we apply active learning techniques to support classification of patient safety event reports as HIT-related. We evaluated different strategies and demonstrated a 30% increase in average precision of a confirmatory sampling strategy over a baseline no active learning approach after 10 learning iterations.

  5. 2013 volcanic activity in Alaska: summary of events and response of the Alaska Volcano Observatory

    Science.gov (United States)

    Dixon, James P.; Cameron, Cheryl; McGimsey, Robert G.; Neal, Christina A.; Waythomas, Chris

    2015-08-14

    The Alaska Volcano Observatory (AVO) responded to eruptions, volcanic unrest or suspected unrest, and seismic events at 18 volcanic centers in Alaska during 2013. Beginning with the 2013 AVO Summary of Events, the annual description of the AVO seismograph network and activity, once a stand-alone publication, is now part of this report. Because of this change, the annual summary now contains an expanded description of seismic activity at Alaskan volcanoes. Eruptions occurred at three volcanic centers in 2013: Pavlof Volcano in May and June, Mount Veniaminof Volcano in June through December, and Cleveland Volcano throughout the year. None of these three eruptive events resulted in 24-hour staffing at AVO facilities in Anchorage or Fairbanks.

  6. Sexually Active Adolescent Women: Assessing Family and Peer Relationships Using Event History Calendars

    Science.gov (United States)

    Saftner, Melissa Ann; Martyn, Kristy Kiel; Lori, Jody Rae

    2011-01-01

    The purpose of this qualitative study is to explore family and peer relationships (including support and influence on risk behavior) among sexually active European American and African American adolescent girls in the context of risk behaviors documented on retrospective event history calendars (EHCs) and in interviews. The EHCs were completed by…

  7. Modeling the Activity of Single Genes

    Science.gov (United States)

    Mjolsness, Eric; Gibson, Michael

    1999-01-01

    The central dogma of molecular biology states that information is stored in DNA, transcribed to messenger RNA (mRNA) and then translated into proteins. This picture is significantly augmentated when we consider the action of certain proteins in regulating transcription. These transcription factors provide a feedback pathway by which genes can regulate one another's expression as mRNA and then as protein. To review: DNA, RNA and proteins have different functions. DNA is the molecular storehouse of genetic information. When cells divide, the DNA is replicated, so that each daughter cell maintains the same genetic information as the mother cell. RNA acts as a go-between from DNA to proteins. Only a single copy of DNA is present, but multiple copies of the same piece of RNA may be present, allowing cells to make huge amounts of protein. In eukaryotes (organisms with a nucleus), DNA is found in the nucleus only. RNA is copied in the nucleus then translocates(moves) outside the nucleus, where it is transcribed into proteins. Along the way, the RNA may be spliced, i.e., may have pieces cut out. RNA then attaches to ribosomes and is translated to proteins. Proteins are the machinery of the cell other than DNA and RNA, all the complex molecules of the cell are proteins. Proteins are specialized machines, each of which fulfills its own task, which may be transporting oxygen, catalyzing reactions, or responding to extracellular signals, just to name a few. One of the more interesting functions a protein may have is binding directly or indirectly to DNA to perform transcriptional regulation, thus forming a closed feedback loop of gene regulation. The structure of DNA and the central dogma were understood in the 50s; in the early 80s it became possible to make arbitrary modifications to DNA and use cellular machinery to transcribe and translate the resulting genes; more recently, genomes (i.e., the complete DNA sequence) of many organisms have been sequenced. This large

  8. Multi-Day Activity Scheduling Reactions to Planned Activities and Future Events in a Dynamic Model of Activity-Travel Behavior

    NARCIS (Netherlands)

    Nijland, L.; Arentze, T.; Timmermans, H.

    2014-01-01

    Modeling multi-day planning has received scarce attention in activity-based transport demand modeling so far. However, new dynamic activity-based approaches are being developed at the current moment. The frequency and inflexibility of planned activities and events in activity schedules of individual

  9. Event Management

    OpenAIRE

    Havlenová, Tereza

    2016-01-01

    Event is an experience that is perceived by all the senses. Event management is a process involving the various activities that are assigned to staffers. Organizing special events became an individual field. If the manager understand the events as a communication platform gets into the hands of a modern, multifunctional and very impressive tool. The procedure to implement a successful event in a particular area is part of this work. The first part explains the issues of event management on th...

  10. Cheetahs have 4 serum amyloid a genes evolved through repeated duplication events.

    Science.gov (United States)

    Chen, Lei; Une, Yumi; Higuchi, Keiichi; Mori, Masayuki

    2012-01-01

    Amyloid A (AA) amyloidosis is a leading cause of mortality in captive cheetahs (Acinonyx jubatus). We performed genome walking and PCR cloning and revealed that cheetahs have 4 SAA genes (provisionally named SAA1A, SAA1B, SAA3A, and SAA3B). In addition, we identified multiple nucleotide polymorphisms in the 4 SAA genes by screening 51 cheetahs. The polymorphisms defined 4, 7, 6, and 4 alleles for SAA1A, SAA3A, SAA1B, and SAA3B, respectively. Pedigree analysis of the inheritance of genotypes for the SAA genes revealed that specific combinations of alleles for the 4 SAA genes cosegregated as a unit (haplotype) in pedigrees, indicating that the 4 genes were linked on the same chromosome. Notably, cheetah SAA1A and SAA1B were highly homologous in their nucleotide sequences. Likewise, SAA3A and SAA3B genes were homologous. These observations suggested a model for the evolution of the 4 SAA genes in cheetahs in which duplication of an ancestral SAA gene first gave rise to SAA1 and SAA3. Subsequently, each gene duplicated one more time, uniquely making 4 genes in the cheetah genome. The monomorphism of the cheetah SAA1A protein might be one of the factors responsible for the high incidence of AA amyloidosis in this species.

  11. Precursory Activity Before Larger Events in Greece Revealed by Aggregated Seismicity Data

    Science.gov (United States)

    Adamaki, Angeliki K.; Roberts, Roland G.

    2017-03-01

    We investigate the seismicity rate behaviour in and around Greece during 2009, seeking significant changes in rate preceding larger events. For individual larger events it is difficult to clearly distinguish precursory rate changes from other, possibly unrelated, variations in seismicity. However, when we aggregate seismicity data occurring within a radius of 10 km and in a 50-day window prior to earthquakes with, e.g. magnitude ≥3.5, the resulting aggregated time series show a clearly increasing trend starting 2-3 weeks prior to the "mainshock" time. We apply statistical tests to investigate if the observed behaviour may be simply consistent with random (poissonian) variations, or, as some earlier studies suggest, with clustering in the sense that high activity rates at some time may imply increased rates later, and thus (randomly) greater probability of larger coming events than for periods of lower seismicity. In this case, rate increases have little useful predictive power. Using data from the entire catalogue, the aggregated rate changes before larger events are clearly and strongly statistically significant and cannot be explained by such clustering. To test this we choose events at random from the catalogue as potential "mainshocks". The events preceding the randomly chosen earthquakes show less pronounced rate increases compared to the observed rate changes prior to larger events. Similar behaviour is observed in data sub-sets. However, statistical confidence decreases for geographical subsets containing few "mainshocks" as it does when data are weighted such that "mainshocks" with many preceding events are strongly downweighted relative to those with fewer. The analyses suggest that genuine changes in aggregated rate do occur prior to larger events and that this behaviour is not due to a small number of mainshocks with many preceding events dominating the analysis. It does not automatically follow that it will be possible to routinely observe precursory

  12. Dietary methanol regulates human gene activity.

    Directory of Open Access Journals (Sweden)

    Anastasia V Shindyapina

    Full Text Available Methanol (MeOH is considered to be a poison in humans because of the alcohol dehydrogenase (ADH-mediated conversion of MeOH to formaldehyde (FA, which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD. There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling.

  13. Tandem Duplication Events in the Expansion of the Small Heat Shock Protein Gene Family in Solanum lycopersicum (cv. Heinz 1706)

    Science.gov (United States)

    Krsticevic, Flavia J.; Arce, Débora P.; Ezpeleta, Joaquín; Tapia, Elizabeth

    2016-01-01

    In plants, fruit maturation and oxidative stress can induce small heat shock protein (sHSP) synthesis to maintain cellular homeostasis. Although the tomato reference genome was published in 2012, the actual number and functionality of sHSP genes remain unknown. Using a transcriptomic (RNA-seq) and evolutionary genomic approach, putative sHSP genes in the Solanum lycopersicum (cv. Heinz 1706) genome were investigated. A sHSP gene family of 33 members was established. Remarkably, roughly half of the members of this family can be explained by nine independent tandem duplication events that determined, evolutionarily, their functional fates. Within a mitochondrial class subfamily, only one duplicated member, Solyc08g078700, retained its ancestral chaperone function, while the others, Solyc08g078710 and Solyc08g078720, likely degenerated under neutrality and lack ancestral chaperone function. Functional conservation occurred within a cytosolic class I subfamily, whose four members, Solyc06g076570, Solyc06g076560, Solyc06g076540, and Solyc06g076520, support ∼57% of the total sHSP RNAm in the red ripe fruit. Subfunctionalization occurred within a new subfamily, whose two members, Solyc04g082720 and Solyc04g082740, show heterogeneous differential expression profiles during fruit ripening. These findings, involving the birth/death of some genes or the preferential/plastic expression of some others during fruit ripening, highlight the importance of tandem duplication events in the expansion of the sHSP gene family in the tomato genome. Despite its evolutionary diversity, the sHSP gene family in the tomato genome seems to be endowed with a core set of four homeostasis genes: Solyc05g014280, Solyc03g082420, Solyc11g020330, and Solyc06g076560, which appear to provide a baseline protection during both fruit ripening and heat shock stress in different tomato tissues. PMID:27565886

  14. Tandem Duplication Events in the Expansion of the Small Heat Shock Protein Gene Family in Solanum lycopersicum (cv. Heinz 1706

    Directory of Open Access Journals (Sweden)

    Flavia J. Krsticevic

    2016-10-01

    Full Text Available In plants, fruit maturation and oxidative stress can induce small heat shock protein (sHSP synthesis to maintain cellular homeostasis. Although the tomato reference genome was published in 2012, the actual number and functionality of sHSP genes remain unknown. Using a transcriptomic (RNA-seq and evolutionary genomic approach, putative sHSP genes in the Solanum lycopersicum (cv. Heinz 1706 genome were investigated. A sHSP gene family of 33 members was established. Remarkably, roughly half of the members of this family can be explained by nine independent tandem duplication events that determined, evolutionarily, their functional fates. Within a mitochondrial class subfamily, only one duplicated member, Solyc08g078700, retained its ancestral chaperone function, while the others, Solyc08g078710 and Solyc08g078720, likely degenerated under neutrality and lack ancestral chaperone function. Functional conservation occurred within a cytosolic class I subfamily, whose four members, Solyc06g076570, Solyc06g076560, Solyc06g076540, and Solyc06g076520, support ∼57% of the total sHSP RNAm in the red ripe fruit. Subfunctionalization occurred within a new subfamily, whose two members, Solyc04g082720 and Solyc04g082740, show heterogeneous differential expression profiles during fruit ripening. These findings, involving the birth/death of some genes or the preferential/plastic expression of some others during fruit ripening, highlight the importance of tandem duplication events in the expansion of the sHSP gene family in the tomato genome. Despite its evolutionary diversity, the sHSP gene family in the tomato genome seems to be endowed with a core set of four homeostasis genes: Solyc05g014280, Solyc03g082420, Solyc11g020330, and Solyc06g076560, which appear to provide a baseline protection during both fruit ripening and heat shock stress in different tomato tissues.

  15. Robust, synergistic regulation of human gene expression using TALE activators.

    Science.gov (United States)

    Maeder, Morgan L; Linder, Samantha J; Reyon, Deepak; Angstman, James F; Fu, Yanfang; Sander, Jeffry D; Joung, J Keith

    2013-03-01

    Artificial activators designed using transcription activator-like effector (TALE) technology have broad utility, but previous studies suggest that these monomeric proteins often exhibit low activities. Here we demonstrate that TALE activators can robustly function individually or in synergistic combinations to increase expression of endogenous human genes over wide dynamic ranges. These findings will encourage applications of TALE activators for research and therapy, and guide design of monomeric TALE-based fusion proteins.

  16. Gene × physical activity interactions in obesity

    DEFF Research Database (Denmark)

    Ahmad, Shafqat; Rukh, Gull; Varga, Tibor V

    2013-01-01

    -administered questionnaires. Multiplicative interactions between the GRS and physical activity on BMI were tested in linear and logistic regression models in each cohort, with adjustment for age, age(2), sex, study center (for multicenter studies), and the marginal terms for physical activity and the GRS. These results were......Numerous obesity loci have been identified using genome-wide association studies. A UK study indicated that physical activity may attenuate the cumulative effect of 12 of these loci, but replication studies are lacking. Therefore, we tested whether the aggregate effect of these loci is diminished...... in adults of European ancestry reporting high levels of physical activity. Twelve obesity-susceptibility loci were genotyped or imputed in 111,421 participants. A genetic risk score (GRS) was calculated by summing the BMI-associated alleles of each genetic variant. Physical activity was assessed using self...

  17. Endogenous methanol regulates mammalian gene activity.

    Directory of Open Access Journals (Sweden)

    Tatiana V Komarova

    Full Text Available We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis.

  18. Brain Network Activation Analysis Utilizing Spatiotemporal Features for Event Related Potentials Classification

    Directory of Open Access Journals (Sweden)

    Yaki Stern

    2016-12-01

    Full Text Available The purpose of this study was to introduce an improved tool for automated classification of event-related potentials (ERPs using spatiotemporally parcellated events incorporated into a functional brain network activation (BNA analysis. The auditory oddball ERP paradigm was selected to demonstrate and evaluate the improved tool. Methods: The ERPs of each subject were decomposed into major dynamic spatiotemporal events. Then, a set of spatiotemporal events representing the group was generated by aligning and clustering the spatiotemporal events of all individual subjects. The temporal relationship between the common group events generated a network, which is the spatiotemporal reference BNA model. Scores were derived by comparing each subject’s spatiotemporal events to the reference BNA model and were then entered into a support vector machine classifier to classify subjects into relevant subgroups. The reliability of the BNA scores (test-retest repeatability using intraclass correlation and their utility as a classification tool were examined in the context of Target-Novel classification. Results: BNA intraclass correlation values of repeatability ranged between 0.51 and 0.82 for the known ERP components N100, P200 and P300. Classification accuracy was high when the trained data were validated on the same subjects for different visits (AUCs 0.93 and 0.95. The classification accuracy remained high for a test group recorded at a different clinical center with a different recording system (AUCs 0.81, 0.85 for 2 visits. Conclusion: The improved spatiotemporal BNA analysis demonstrates high classification accuracy. The BNA analysis method holds promise as a tool for diagnosis, follow-up and drug development associated with different neurological conditions.

  19. Stereotype activation is unintentional: Behavioural and event-related potenials evidence.

    Science.gov (United States)

    Wang, Pei; Yang, Ya-Ping; Tan, Chen-Hao; Zhao, Xiang-Xia; Liu, Yong-He; Lin, Chong-De

    2016-04-01

    In this study, a priming Stroop paradigm was used to determine whether stereotype activation is unintentional. Priming conditions (priming/no-priming) and the relationship between priming and target (consistent/inconsistent/no-relation) were the independent variables; accuracy, reaction time and N400 amplitude were used as dependent variables. The reaction time revealed that stereotype activation is, to some extent, unintentional. Furthermore, the event-related potenial (ERP) results showed that N400 amplitude was larger for inconsistent conditions than for consistent conditions. This result supported the notion that stereotype activation is an unintentional and automatic process.

  20. Synergistic activation of cardiac genes by myocardin and Tbx5.

    Directory of Open Access Journals (Sweden)

    Chunbo Wang

    Full Text Available Myocardial differentiation is associated with the activation and expression of an array of cardiac specific genes. However, the transcriptional networks that control cardiac gene expression are not completely understood. Myocardin is a cardiac and smooth muscle-specific expressed transcriptional coactivator of Serum Response Factor (SRF and is able to potently activate cardiac and smooth muscle gene expression during development. We hypothesize that myocardin discriminates between cardiac and smooth muscle specific genes by associating with distinct co-factors. Here, we show that myocardin directly interacts with Tbx5, a member of the T-box family of transcription factors involved in the Holt-Oram syndrome. Tbx5 synergizes with myocardin to activate expression of the cardiac specific genes atrial natriuretic factor (ANF and alpha myosin heavy chain (α-MHC, but not that of smooth muscle specific genes SM22 or smooth muscle myosin heavy chain (SM-MHC. We found that this synergistic activation of shared target genes is dependent on the binding sites for Tbx5, T-box factor-Binding Elements (TBEs. Myocardin and Tbx5 physically interact and their interaction domains were mapped to the basic domain and the coil domain of myocardin and Tbx5, respectively. Our analysis demonstrates that the Tbx5G80R mutation, which leads to the Holt-Oram syndrome in humans, failed to synergize with myocardin to activate cardiac gene expression. These data uncover a key role for Tbx5 and myocardin in establishing the transcriptional foundation for cardiac gene activation and suggest that the interaction of myocardin and Tbx5 maybe involved in cardiac development and diseases.

  1. Evolutionary history of mitogen-activated protein kinase (MAPK) genes in Lotus, Medicago, and Phaseolus.

    Science.gov (United States)

    Neupane, Achal; Nepal, Madhav P; Benson, Benjamin V; Macarthur, Kenton J; Piya, Sarbottam

    2013-11-01

    Mitogen-Activated Protein Kinase (MAPK) genes encode proteins that mediate various signaling pathways associated with biotic and abiotic stress responses in eukaryotes. The MAPK genes form a 3-tier signal transduction cascade between cellular stimuli and physiological responses. Recent identification of soybean MAPKs and availability of genome sequences from other legume species allowed us to identify their MAPK genes. The main objectives of this study were to identify MAPKs in 3 legume species, Lotus japonicus, Medicago truncatula, and Phaseolus vulgaris, and to assess their phylogenetic relationships. We used approaches in comparative genomics for MAPK gene identification and named the newly identified genes following Arabidopsis MAPK nomenclature model. We identified 19, 18, and 15 MAPKs and 7, 4, and 9 MAPKKs in the genome of Lotus japonicus, Medicago truncatula, and Phaseolus vulgaris, respectively. Within clade placement of MAPKs and MAPKKs in the 3 legume species were consistent with those in soybean and Arabidopsis. Among 5 clades of MAPKs, 4 founder clades were consistent to MAPKs of other plant species and orthologs of MAPK genes in the fifth clade-"Clade E" were consistent with those in soybean. Our results also indicated that some gene duplication events might have occurred prior to eudicot-monocot divergence. Highly diversified MAPKs in soybean relative to those in 3 other legume species are attributable to the polyploidization events in soybean. The identification of the MAPK genes in the legume species is important for the legume crop improvement; and evolutionary relationships and functional divergence of these gene members provide insights into plant genome evolution.

  2. Gene-physical activity interactions and their impact on diabetes

    DEFF Research Database (Denmark)

    Oskari Kilpeläinen, Tuomas; Franks, Paul W

    2014-01-01

    mechanisms of how type 2 diabetes develops, which could open up new avenues for the development of novel treatments. It has also been postulated that knowledge of interactions could improve the prevention and treatment of type 2 diabetes by enabling targeted interventions. The present chapter will introduce...... to an equal bout of physical activity. Individuals with specific genetic profiles are also expected to be more responsive to the beneficial effects of physical activity in the prevention of type 2 diabetes. Identification of such gene-physical activity interactions could give new insights into the biological...... the reader to the recent advances in the genetics of type 2 diabetes, summarize the current evidence on gene-physical activity interactions in relation to type 2 diabetes, and outline how information on gene-physical activity interactions might help improve the prevention and treatment of type 2 diabetes...

  3. Peroxisome proliferator-activated receptor alpha target genes.

    Science.gov (United States)

    Rakhshandehroo, Maryam; Knoch, Bianca; Müller, Michael; Kersten, Sander

    2010-01-01

    The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well.

  4. Peroxisome Proliferator-Activated Receptor Alpha Target Genes

    Directory of Open Access Journals (Sweden)

    Maryam Rakhshandehroo

    2010-01-01

    Full Text Available The peroxisome proliferator-activated receptor alpha (PPARα is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well.

  5. Recombination events near the immunoglobulin Cmu gene join variable and constant region genes, switch heavy-chain expression, or inactivate the locus.

    Science.gov (United States)

    Cory, S; Webb, E; Gough, J; Adams, J M

    1981-04-28

    Immunoglobulin heavy-chain expression is initiated by recombination between a variable region (VH) gene and one of several joining region (JH) genes located near the mu constant region (Cmu) gene, and the active VH gene can subsequently switch to another CH gene. That the general mechanism for CH switching involves recombination between sites within the JH-Cmu intervening sequence and the 5' flanking region of another CH gene is supported here by Southern blot hybridization analysis of eight IgG- and IgA-secreting plasmacytomas. An alternative model requiring successive VH linkage to similar JH clusters near each CH gene is shown to be very unlikely since the mouse genome appears to contain only one complement of the JH locus and no JH gene was detectable within large cloned sequences flanking germline C gamma 3 and C gamma 1 genes. Thus, VH-JH joining and CH switching are mediated by separate regions of "the joining-switch" or J-S element. In each plasmacytoma examined, the J-S element had undergone recombination within both the JH locus and the switch region and was shown to be linked to the functional CH gene in an IgG3, and IgG1, and three IgA secretors. Both JH joining and CH switching occurred by deletion of DNA. Switch recombination occurred at more than one site within the J-S element in different lines, even for recombination with the same CH gene. Significantly, although heavy-chain expression is restricted to one allele ("allelic exclusion"), all rearranged in each plasmacytoma. Some rearrangements were aberrant, involving, for example, deletion of all JH genes from the allele. Hence, an error-prone recombination machinery may account for allelic exclusion in many plasmacytomas.

  6. Evolution of GHF5 endoglucanase gene structure in plant-parasitic nematodes: no evidence for an early domain shuffling event

    Directory of Open Access Journals (Sweden)

    Gheysen Godelieve

    2008-11-01

    PPN GHF5 endoglucanase gene most probably consisted of the whole gene cassette, i.e. the GHF5 catalytic domain and the CBM2, rather than that it evolved by domain shuffling. Our evolutionary model for the gene structure in PPN GHF5 endoglucanases implies the occurrence of an early duplication event, and more recent gene duplications at genus or species level.

  7. BEACHES: an observational system for assessing children's eating and physical activity behaviors and associated events.

    Science.gov (United States)

    McKenzie, T L; Sallis, J F; Nader, P R; Patterson, T L; Elder, J P; Berry, C C; Rupp, J W; Atkins, C J; Buono, M J; Nelson, J A

    1991-01-01

    An integrated system for coding direct observations of children's dietary and physical activity behaviors was developed. Associated environmental events were also coded, including physical location, antecedents, and consequences. To assess the instrument's reliability and validity, 42 children, aged 4 to 8 years, were observed for 8 consecutive weeks at home and at school. Results indicated that four 60-min observations at home produced relatively stable estimates for most of the 10 dimensions. Interobserver reliabilities during live and videotaped observations were high, with the exception of "consequences" categories that occurred in less than 1% of observed intervals. Evidence of validity was provided by findings that antecedents were associated with respective dietary and physical activity behaviors. The five physical activity categories were validated by heartrate monitoring in a second study. The Behaviors of Eating and Activity for Children's Health Evaluation System is appropriate for studying influences on diet and physical activity in children in a variety of settings.

  8. Self-reported physical activity and major adverse events in patients with atrial fibrillation

    DEFF Research Database (Denmark)

    Proietti, Marco; Boriani, Giuseppe; Laroche, Cécile;

    2016-01-01

    patients taking regular exercise were associated with a lower risk of all-cause death, even when we considered various subgroups, including gender, elderly age, symptomatic status, and stroke risk class. Efforts to increase physical activity among AF patients may improve outcomes in these patients.......AIMS: Physical activity is protective against cardiovascular (CV) events, both in general population and in high-risk CV cohorts. However, the relationship between physical activity with major adverse outcomes in atrial fibrillation (AF) is not well-established. Our aim was to analyse...... this relationship in a 'real-world' AF population. Second, we investigated the influence of physical activity on arrhythmia progression. METHODS AND RESULTS: We studied all patients enrolled in the EURObservational Research Programme on AF (EORP-AF) Pilot Survey. Physical activity was defined as 'none', 'occasional...

  9. Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus.

    Science.gov (United States)

    Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

    2015-03-18

    Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer-promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them.

  10. Ionospheric response to sudden stratospheric warming events at low and high solar activity

    Science.gov (United States)

    Fang, Tzu-Wei; Fuller-Rowell, Tim; Wang, Houjun; Akmaev, Rashid; Wu, Fei

    2014-09-01

    The sensitivity of the ionospheric response to a sudden stratospheric warming (SSW) event has been examined under conditions of low and high solar activity through simulations using the whole atmosphere model (WAM) and the global ionosphere plasmasphere model (GIP). During non-SSW conditions, simulated daytime mean vertical drifts at the magnetic equator show similar solar activity dependence as an empirical model. Model results of ionospheric total electron content (TEC) and equatorial vertical drift for the January 2009 major SSW, which occurred at very low solar activity conditions, show reasonable agreement with observations. The simulations demonstrate that the E region dynamo is capable of creating the semidiurnal variation of vertical drift. WAM and GIP were also run at high solar activity conditions, using the same lower atmosphere conditions as present in the January 2009 SSW event. The simulations indicate that the amplitude and phase of migrating tides in the dynamo region during the event have similar magnitudes for both solar flux conditions. However, comparing the ionospheric responses to a major SSW under low and high solar activity periods, it was found that the changes in the ionospheric vertical drifts and relative changes in TEC decreased with increasing solar activity. The simulations indicate that the F region dynamo becomes more important throughout the daytime and contributes to the upward drift in the afternoon during the event when the solar activity is higher. Our test simulations also confirm that the increase of the ionospheric conductivity associated with increasing solar activity is responsible for the decrease of vertical drift changes during an SSW. In particular, first, the increase in F region conductivity allows the closure of E region currents through the F region, reducing the polarization electric field before noon. Second, the F region dynamo contributes an upward drift postnoon, maintaining upward drifts till after sunset

  11. The Influence of Major Life Events on Economic Attitudes in a World of Gene-Environment Interplay

    Science.gov (United States)

    Hatemi, Peter K.

    2014-01-01

    The role of “genes” on political attitudes has gained attention across disciplines. However, person-specific experiences have yet to be incorporated into models that consider genetic influences. Relying on a gene-environment interplay approach, this study explicates how life-events, such as losing one’s job or suffering a financial loss, influence economic policy attitudes. The results indicate genetic and environmental variance on support for unions, immigration, capitalism, socialism and property tax is moderated by financial risks. Changes in the magnitude of genetic influences, however, are temporary. After two years, the phenotypic effects of the life events remain on most attitudes, but changes in the sources of individual differences do not. Univariate twin models that estimate the independent contributions of genes and environment on the variation of attitudes appear to provide robust baseline indicators of sources of individual differences. These estimates, however, are not event or day specific. In this way, genetic influences add stability, while environment cues change, and this process is continually updated. PMID:24860199

  12. POP-ART: thermodynamically correct activated event sampling in complex materials

    Science.gov (United States)

    Chubynsky, M. V.; Vocks, Henk; Mousseau, Normand; Barkema, G. T.

    2006-03-01

    Dynamics of complex systems with a rugged energy landscape can be represented as a sequence of rare activated events during which the system jumps between different potential energy minima. The activation-relaxation technique (ART) [1] is an efficient method of sampling such events; however, because of an unknown bias in selecting these events it cannot easily provide thermodynamical information. We present a modification of ART, the properly obeying probability ART (POP-ART) [2]. POP-ART combines short molecular dynamics runs with ART-like activated moves, with an additional accept/reject step designed to satisfy detailed balance and thus reproduce correct thermodynamics. Both correctness and efficiency of the method have been tested using a variety of systems. We mention briefly some ways of extending the approach to obtain correct dynamics as well.[1] G.T. Barkema and N. Mousseau, Phys. Rev. Lett. 77, 4358 (1996)[2] H. Vocks, M.V. Chubynsky, G.T. Barkema and N. Mousseau, J. Chem. Phys., accepted

  13. Oncogenic mutations mimic and enhance dynamic events in the natural activation of phosphoinositide 3-kinase p110α (PIK3CA)

    Science.gov (United States)

    Burke, John E.; Perisic, Olga; Masson, Glenn R.; Vadas, Oscar; Williams, Roger L.

    2012-01-01

    The p110α catalytic subunit (PIK3CA) is one of the most frequently mutated genes in cancer. We have examined the activation of the wild-type p110α/p85α and a spectrum of oncogenic mutants using hydrogen/deuterium exchange mass spectrometry (HDX-MS). We find that for the wild-type enzyme, the natural transition from an inactive cytosolic conformation to an activated form on membranes entails four distinct events. Analysis of oncogenic mutations shows that all up-regulate the enzyme by enhancing one or more of these dynamic events. We provide the first insight into the activation mechanism by mutations in the linker between the adapter-binding domain (ABD) and the Ras-binding domain (RBD) (G106V and G118D). These mutations, which are common in endometrial cancers, enhance two of the natural activation events: movement of the ABD and ABD–RBD linker relative to the rest of the catalytic subunit and breaking the C2–iSH2 interface on binding membranes. C2 domain mutants (N345K and C420R) also mimic these events, even in the absence of membranes. A third event is breaking the nSH2–helical domain contact caused by phosphotyrosine-containing peptides binding to the enzyme, which is mimicked by a helical domain mutation (E545K). Interaction of the C lobe of the kinase domain with membranes is the fourth activation event, and is potentiated by kinase domain mutations (e.g., H1047R). All mutations increased lipid binding and basal activity, even mutants distant from the membrane surface. Our results elucidate a unifying mechanism in which diverse PIK3CA mutations stimulate lipid kinase activity by facilitating allosteric motions required for catalysis on membranes. PMID:22949682

  14. Event marketing

    OpenAIRE

    Novotná, Michaela

    2008-01-01

    This study aims to analyze event-marketing activities of the small firm and propose new events. At first the theoretical part describes marketing and communication mix and then especially planning and development of event marketing campaign. Research data were collected by the method of survey to propose the new events. Randomly selected customers were asked to fill the questionnaire. Its results were integrated into the proposal of the new events. The interview was realized with the owner of...

  15. 2014 volcanic activity in Alaska: Summary of events and response of the Alaska Volcano Observatory

    Science.gov (United States)

    Cameron, Cheryl E.; Dixon, James P.; Neal, Christina A.; Waythomas, Christopher F.; Schaefer, Janet R.; McGimsey, Robert G.

    2017-09-07

    The Alaska Volcano Observatory (AVO) responded to eruptions, possible eruptions, volcanic unrest or suspected unrest, and seismic events at 18 volcanic centers in Alaska during 2014. The most notable volcanic activity consisted of intermittent ash eruptions from long-active Cleveland and Shishaldin Volcanoes in the Aleutian Islands, and two eruptive episodes at Pavlof Volcano on the Alaska Peninsula. Semisopochnoi and Akutan volcanoes had seismic swarms, both likely the result of magmatic intrusion. The AVO also installed seismometers and infrasound instruments at Mount Cleveland during 2014.

  16. Absence of canonical active chromatin marks in developmentally regulated genes

    Science.gov (United States)

    Ruiz-Romero, Marina; Corominas, Montserrat; Guigó, Roderic

    2015-01-01

    The interplay of active and repressive histone modifications is assumed to play a key role in the regulation of gene expression. In contrast to this generally accepted view, we show that transcription of genes temporally regulated during fly and worm development occurs in the absence of canonically active histone modifications. Conversely, strong chromatin marking is related to transcriptional and post-transcriptional stability, an association that we also observe in mammals. Our results support a model in which chromatin marking is associated to stable production of RNA, while unmarked chromatin would permit rapid gene activation and de-activation during development. In this case, regulation by transcription factors would play a comparatively more important regulatory role. PMID:26280901

  17. Gene conversion-like events cause steroid 21-hydroxylase deficiency in congenital adrenal hyperplasia

    Energy Technology Data Exchange (ETDEWEB)

    Harada, F.; Kimura, A.; Iwanaga, T.; Shimozawa, K.; Yata, J.; Sasazuki,T.

    1987-11-01

    Genomic DNAs from twelve Japanese patients with steroid 21-hydroxylase deficiency were analyzed by Southern blot hybridization. A 3.7-kilobase (kb) Taq I and a 1.7-kb Pvu II restriction endonuclease fragment that correspond to a 21-OHase B gene were absent from the DNA of two unrelated patients with the salt-wasting form of the disease. However, a 10.5-kb Bgl II fragment corresponding to the region encompassing the 21-OHase B gene was still present in these two patients. The genes encoding 21-OHase were cloned from one of these two patients, who was homozygous by descent for HLA-A26;B39;C4A3;C4B1;DR4. Restriction endonuclease mapping as well as partial nucleotide sequencing analysis revealed that the 21-OHase B gene of the patient has been converted to the pseudogene, 21-OHase A, as far as the critical 0.5-kb sequence was concerned. Thus, the defect was due to both chromosomes each carrying two copies of 21-OHase A pseudogene and lacking functional 21-OHase B gene.

  18. Experimental evidence validating the computational inference of functional associations from gene fusion events: a critical survey.

    Science.gov (United States)

    Promponas, Vasilis J; Ouzounis, Christos A; Iliopoulos, Ioannis

    2014-05-01

    More than a decade ago, a number of methods were proposed for the inference of protein interactions, using whole-genome information from gene clusters, gene fusions and phylogenetic profiles. This structural and evolutionary view of entire genomes has provided a valuable approach for the functional characterization of proteins, especially those without sequence similarity to proteins of known function. Furthermore, this view has raised the real possibility to detect functional associations of genes and their corresponding proteins for any entire genome sequence. Yet, despite these exciting developments, there have been relatively few cases of real use of these methods outside the computational biology field, as reflected from citation analysis. These methods have the potential to be used in high-throughput experimental settings in functional genomics and proteomics to validate results with very high accuracy and good coverage. In this critical survey, we provide a comprehensive overview of 30 most prominent examples of single pairwise protein interaction cases in small-scale studies, where protein interactions have either been detected by gene fusion or yielded additional, corroborating evidence from biochemical observations. Our conclusion is that with the derivation of a validated gold-standard corpus and better data integration with big experiments, gene fusion detection can truly become a valuable tool for large-scale experimental biology.

  19. What Are Special About Ground-Level Events? Flares, CMEs, Active Regions And Magnetic Field Connection

    CERN Document Server

    Nitta, N V; DeRosa, M L; Nightingale, R W

    2012-01-01

    Ground level events (GLEs) occupy the high-energy end of gradual solar energetic particle (SEP) events. They are associated with coronal mass ejections (CMEs) and solar flares, but we still do not clearly understand the special conditions that produce these rare events. During Solar Cycle 23, a total of 16 GLEs were registered, using ground-based neutron monitor data. We first ask if these GLEs are clearly distinguishable from other SEP events observed from space. Setting aside possible difficulties in identifying all GLEs consistently, we then try to find observables which may unmistakably isolate these GLEs by studying the basic properties of the associated eruptions and the active regions (ARs) that produced them. It is found that neither the magnitudes of the CMEs and flares nor the complexities of the ARs give sufficient conditions for GLEs. It is possible to find CMEs, flares or ARs that are not associated with GLEs but that have more extreme properties than those associated with GLEs. We also try to ev...

  20. Low ABCB1 gene expression is an early event in colorectal carcinogenesis

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Vogel, Ulla Birgitte; Godiksen, Sine

    2013-01-01

    The ABCB1/MDR1 gene product ABCB1/P-glycoprotein is implicated in the development of colorectal cancer (CRC). NFKB1 encodes transcription factors regulating expression of a number of genes including ABCB1. We have previously found association between the ABCB1 C-rs3789243-T polymorphism and CRC...... risk and interactions between the ABCB1 C-rs3789243-T and C3435T polymorphisms and meat intake in relation to CRC risk (Andersen, BMC Cancer, 2009, 9, 407). ABCB1 and NFKB1 mRNA levels were assessed in intestinal tissue from 122 CRC cases, 101 adenoma cases (12 with severe dysplasia, 89 with mild......-moderate dysplasia) and from 18 healthy individuals, together with gene polymorphisms in ABCB1 and NFKB1. ABCB1 mRNA levels were highest in the healthy individuals and significantly lower in mild/moderate and severe dysplasia tissue (P...

  1. Comparative genomics study of polyhydroxyalkanoates (PHA and ectoine relevant genes from Halomonas sp. TD01 revealed extensive horizontal gene transfer events and co-evolutionary relationships

    Directory of Open Access Journals (Sweden)

    Cai Lei

    2011-11-01

    Full Text Available Abstract Background Halophilic bacteria have shown their significance in industrial production of polyhydroxyalkanoates (PHA and are gaining more attention for genetic engineering modification. Yet, little information on the genomics and PHA related genes from halophilic bacteria have been disclosed so far. Results The draft genome of moderately halophilic bacterium, Halomonas sp. TD01, a strain of great potential for industrial production of short-chain-length polyhydroxyalkanoates (PHA, was analyzed through computational methods to reveal the osmoregulation mechanism and the evolutionary relationship of the enzymes relevant to PHA and ectoine syntheses. Genes involved in the metabolism of PHA and osmolytes were annotated and studied in silico. Although PHA synthase, depolymerase, regulator/repressor and phasin were all involved in PHA metabolic pathways, they demonstrated different horizontal gene transfer (HGT events between the genomes of different strains. In contrast, co-occurrence of ectoine genes in the same genome was more frequently observed, and ectoine genes were more likely under coincidental horizontal gene transfer than PHA related genes. In addition, the adjacent organization of the homologues of PHA synthase phaC1 and PHA granule binding protein phaP was conserved in the strain TD01, which was also observed in some halophiles and non-halophiles exclusively from γ-proteobacteria. In contrast to haloarchaea, the proteome of Halomonas sp. TD01 did not show obvious inclination towards acidity relative to non-halophilic Escherichia coli MG1655, which signified that Halomonas sp. TD01 preferred the accumulation of organic osmolytes to ions in order to balance the intracellular osmotic pressure with the environment. Conclusions The accessibility of genome information would facilitate research on the genetic engineering of halophilic bacteria including Halomonas sp. TD01.

  2. Caspase-like activities accompany programmed cell death events in developing barley grains.

    Directory of Open Access Journals (Sweden)

    Van Tran

    Full Text Available Programmed cell death is essential part of development and cell homeostasis of any multicellular organism. We have analyzed programmed cell death in developing barley caryopsis at histological, biochemical and molecular level. Caspase-1, -3, -4, -6 and -8-like activities increased with aging of pericarp coinciding with abundance of TUNEL positive nuclei and expression of HvVPE4 and HvPhS2 genes in the tissue. TUNEL-positive nuclei were also detected in nucellus and nucellar projection as well as in embryo surrounding region during early caryopsis development. Quantitative RT-PCR analysis of micro-dissected grain tissues revealed the expression of HvVPE2a, HvVPE2b, HvVPE2d, HvPhS2 and HvPhS3 genes exclusively in the nucellus/nucellar projection. The first increase in cascade of caspase-1, -3, -4, -6 and -8-like activities in the endosperm fraction may be related to programmed cell death in the nucellus and nucellar projection. The second increase of all above caspase-like activities including of caspase-9-like was detected in the maturating endosperm and coincided with expression of HvVPE1 and HvPhS1 genes as well as with degeneration of nuclei in starchy endosperm and transfer cells. The distribution of the TUNEL-positive nuclei, tissues-specific expression of genes encoding proteases with potential caspase activities and cascades of caspase-like activities suggest that each seed tissue follows individual pattern of development and disintegration, which however harmonizes with growth of the other tissues in order to achieve proper caryopsis development.

  3. Analysis of the relationship between longitudinal gene expressions and ordered categorical event data

    OpenAIRE

    Rajicic, Natasa; Finkelstein, Dianne M; Schoenfeld, David A.

    2009-01-01

    The NIH project ”Inflammatory and Host Response to Injury” (Glue) is being conducted to study the changes in the body over time in response to trauma and burn. Patients are monitored for changes in their clinical status, such as the onset of and recovery from organ failure. Blood samples are drawn over the first days and weeks after the injury to obtain gene expression levels over time. Our goal was to develop a method of selecting genes that differentially expressed in pati...

  4. Evolutionary relationships between miRNA genes and their activity.

    Science.gov (United States)

    Zhu, Yan; Skogerbø, Geir; Ning, Qianqian; Wang, Zhen; Li, Biqing; Yang, Shuang; Sun, Hong; Li, Yixue

    2012-12-22

    The emergence of vertebrates is characterized by a strong increase in miRNA families. MicroRNAs interact broadly with many transcripts, and the evolution of such a system is intriguing. However, evolutionary questions concerning the origin of miRNA genes and their subsequent evolution remain unexplained. In order to systematically understand the evolutionary relationship between miRNAs gene and their function, we classified human known miRNAs into eight groups based on their evolutionary ages estimated by maximum parsimony method. New miRNA genes with new functional sequences accumulated more dynamically in vertebrates than that observed in Drosophila. Different levels of evolutionary selection were observed over miRNA gene sequences with different time of origin. Most genic miRNAs differ from their host genes in time of origin, there is no particular relationship between the age of a miRNA and the age of its host genes, genic miRNAs are mostly younger than the corresponding host genes. MicroRNAs originated over different time-scales are often predicted/verified to target the same or overlapping sets of genes, opening the possibility of substantial functional redundancy among miRNAs of different ages. Higher degree of tissue specificity and lower expression level was found in young miRNAs. Our data showed that compared with protein coding genes, miRNA genes are more dynamic in terms of emergence and decay. Evolution patterns are quite different between miRNAs of different ages. MicroRNAs activity is under tight control with well-regulated expression increased and targeting decreased over time. Our work calls attention to the study of miRNA activity with a consideration of their origin time.

  5. TNF gene expression in macrophage activation and endotoxin tolerance

    OpenAIRE

    Chow, Nancy Ann-Marie

    2013-01-01

    TNF is an inflammatory cytokine that plays a critical role in the acute phase response to infection, and its dysregulation has been implicated in the pathology of several inflammatory and autoimmune disorders. TNF gene expression is regulated in a cell type- and inducer-specific manner that involves chromatin alterations at both the TNF promoter and distal DNase I hypersensitive (DH) sites within the TNF/LT locus. While the mechanisms underlying TNF gene activation in monocytes/macrophages an...

  6. Human DJ-1-specific Transcriptional Activation of Tyrosine Hydroxylase Gene*

    Science.gov (United States)

    Ishikawa, Shizuma; Taira, Takahiro; Takahashi-Niki, Kazuko; Niki, Takeshi; Ariga, Hiroyoshi; Iguchi-Ariga, Sanae M. M.

    2010-01-01

    Loss-of-function mutation in the DJ-1 gene causes a subset of familial Parkinson disease. The mechanism underlying DJ-1-related selective vulnerability in the dopaminergic pathway is, however, not known. DJ-1 has multiple functions, including transcriptional regulation, and one of transcriptional target genes for DJ-1 is the tyrosine hydroxylase (TH) gene, the product of which is a key enzyme for dopamine biosynthesis. It has been reported that DJ-1 is a neuroprotective transcriptional co-activator that sequesters a transcriptional co-repressor polypyrimidine tract-binding protein-associated splicing factor (PSF) from the TH gene promoter. In this study, we found that knockdown of human DJ-1 by small interference RNA in human dopaminergic cell lines attenuated TH gene expression and 4-dihydroxy-l-phenylalanine production but that knockdown or knock-out of mouse DJ-1 in mouse cell lines or in mice did not affect such expression and TH activity. In reporter assays using the human TH gene promoter linked to the luciferase gene, stimulation of TH promoter activity was observed in human cells, but not mouse cells, that had been transfected with DJ-1. Although human DJ-1 and mouse DJ-1 were associated either with human or with mouse PSF, TH promoter activity inhibited by PSF was restored by human DJ-1 but not by mouse DJ-1. Chromatin immunoprecipitation assays revealed that the complex of PSF with DJ-1 bound to the human but not the mouse TH gene promoter. These results suggest a novel species-specific transcriptional regulation of the TH promoter by DJ-1 and one of the mechanisms for no reduction of TH in DJ-1-knock-out mice. PMID:20938049

  7. Whiting events: biogenic origin due to the photosynthetic activity of cyanobacterial picoplankton

    Science.gov (United States)

    Thompson, J. B.; Schultze-Lam, S.; Beveridge, T. J.; Des Marais, D. J.

    1997-01-01

    An annual whiting event occurs each year in late May to early June in Fayetteville Green Lake, New York. The initiation of this event correlates with exponential growth of the Synechococcus population within the lake. Synechococcus is the dominant (by approximately 4 orders of magnitude) autotrophic organism owing to the oligotrophic condition of the lake. The delta 13C values of the dissolved inorganic C range seasonally from -9.5% in winter to -6.2% in summer due to photosynthetic activity. Calcite precipitates principally in the microenvironment surrounding Synechococcus because of a photosynthetically driven alkalization process and the availability of the cells as nucleation sites. This calcite has a heavier delta 13C value (>4%) than does the dissolved inorganic C of the lake water owing to the cells' preferential uptake of 12C. A conceptual model suggests that photosynthetic activity and cell surface chemistry, together with the substantial surface area that arises from the great abundance of micron-sized cells, allow Synechococcus to dominate the annual whiting events in Fayetteville Green Lake.

  8. Active and break events of Indian summer monsoon during 1901-2014

    Science.gov (United States)

    Pai, D. S.; Sridhar, Latha; Ramesh Kumar, M. R.

    2016-06-01

    The study lists active and break monsoon events over India over a very long period (1901-2014) identified using criteria based on a rainfall index derived over a critical high rainfall region called core monsoon zone. The break and active spells identified in this study were mostly comparable with that identified in the earlier studies based on similar rainfall criteria during the common data period (1951-2007). However, some noticeable differences were observed in the rainfall anomaly pattern associated with the break monsoon spells identified in this study and that identified based on the synoptic criteria in the earlier studies. The stringent rainfall criteria used in this study seems to be better criteria for identifying the breaks. During the study period, both the active and break spells of short duration were more frequent than the long duration with about 63.4 % of the break spells and 94.3 % of the active spells falling in the range of 3-6 days. There were no active spells of duration ≥13 days. Whereas, about 8 % of the break spells were of duration ≥13 days. During both the halves of the data period (1901-1957 and 1958-2014), there was no change in the distribution of the break events. However, the number of active spells showed an increase of about 12 % in the in the second half, which was mainly in the short duration (3-6 days) spells. During the data period, decadal variations of break days showed an out phase of relationship with the number of days of monsoon depression (MD). Relatively stronger in phase relationship was observed between the decadal variation of MD days and that of the active days till around early 1980s which reversed later due to sudden decrease in the MD days. During the same period, both the active and break days were in the increasing phase. This was also coincided with the sudden and significant increase in the number of days of monsoon lows (LOW). The LOWs, which generally have short life helped in the occurrence of active

  9. Genome-wide study of gene variants associated with differential cardiovascular event reduction by pravastatin therapy.

    Directory of Open Access Journals (Sweden)

    Dov Shiffman

    Full Text Available Statin therapy reduces the risk of coronary heart disease (CHD, however, the person-to-person variability in response to statin therapy is not well understood. We have investigated the effect of genetic variation on the reduction of CHD events by pravastatin. First, we conducted a genome-wide association study of 682 CHD cases from the Cholesterol and Recurrent Events (CARE trial and 383 CHD cases from the West of Scotland Coronary Prevention Study (WOSCOPS, two randomized, placebo-controlled studies of pravastatin. In a combined case-only analysis, 79 single nucleotide polymorphisms (SNPs were associated with differential CHD event reduction by pravastatin according to genotype (P<0.0001, and these SNPs were analyzed in a second stage that included cases as well as non-cases from CARE and WOSCOPS and patients from the PROspective Study of Pravastatin in the Elderly at Risk/PHArmacogenomic study of Statins in the Elderly at risk for cardiovascular disease (PROSPER/PHASE, a randomized placebo controlled study of pravastatin in the elderly. We found that one of these SNPs (rs13279522 was associated with differential CHD event reduction by pravastatin therapy in all 3 studies: P = 0.002 in CARE, P = 0.01 in WOSCOPS, P = 0.002 in PROSPER/PHASE. In a combined analysis of CARE, WOSCOPS, and PROSPER/PHASE, the hazard ratio for CHD when comparing pravastatin with placebo decreased by a factor of 0.63 (95% CI: 0.52 to 0.75 for each extra copy of the minor allele (P = 4.8 × 10(-7. This SNP is located in DnaJ homolog subfamily C member 5B (DNAJC5B and merits investigation in additional randomized studies of pravastatin and other statins.

  10. Temporal variations in the gene expression levels of cyanobacterial anti-oxidant enzymes through geological history: implications for biological evolution during the Great Oxidation Event

    Science.gov (United States)

    Harada, M.; Furukawa, R.; Yokobori, S. I.; Tajika, E.; Yamagishi, A.

    2016-12-01

    A significant rise in atmospheric O2 levels during the GOE (Great Oxidation Event), ca. 2.45-2.0 Ga, must have caused a great stress to biosphere, enforcing life to adapt to oxic conditions. Cyanobacteria, oxygenic photosynthetic bacteria that had been responsible for the GOE, are at the same time one of the organisms that would have been greatly affected by the rise of O2 level in the surface environments. Knowledge on the evolution of cyanobacteria is not only important to elucidate the cause of the GOE, but also helps us to better understand the adaptive evolution of life in response to the GOE. Here we performed phylogenetic analysis of an anti-oxidant enzyme Fe-SOD (iron superoxide dismutase) of cyanobacteria, to assess the adaptive evolution of life under the GOE. The rise of O2 level must have increased the level of toxic reactive oxygen species in cyanobacterial cells, thus forced them to change activities or the gene expression levels of Fe-SOD. In the present study, we focus on the change in the gene expression levels of the enzyme, which can be estimated from the promoter sequences of the gene. Promoters are DNA sequences found upstream of protein encoding regions, where RNA polymerase binds and initiates transcription. "Strong" promoters that efficiently interact with RNA polymerase induce high rates of transcription, leading to high levels of gene expression. Thus, from the temporal changes in the promoter sequences, we can estimate the variations in the gene expression levels during the geological time. Promoter sequences of Fe-SOD at each ancestral node of cyanobacteria were predicted from phylogenetic analysis, and the ancestral promoter sequences were compared to the promoters of known highly expressed genes. The similarity was low at the time of the emergence of cyanobacteria; however, increased at the branching nodes diverged 2.4 billon years ago. This roughly coincided with the onset of the GOE, implying that the transition from low to high gene

  11. System-Events Toolbox--Activating Urban Places for Social Cohesion through Designing a System of Events That Relies on Local Resources

    Science.gov (United States)

    Fassi, Davide; Motter, Roberta

    2014-01-01

    This paper is a reflection on the use of public spaces in towns and the development of a system-events toolbox to activate them towards social cohesion. It is the result of a 1 year action research developed together with POLIMI DESIS Lab of the Department of Design to develop design solutions to open up the public spaces of the campus to the…

  12. Postnatal events in intestinal gene expression and splenic cell composition is altered in NOD mice

    DEFF Research Database (Denmark)

    Damlund, Dina Silke Malling; Metzdorff, Stine Broeng; Kristensen, Matilde Bylov

    2013-01-01

    , cellular composition in spleen and liver. At PND1 and 2, the number of Ly-6G and CD11b positive cells in NOD mice was significantly (p=0.05) higher as compared to C57/bl6. Furthermore, gene expression analyses of liver, spleen and intestine showed differences between the two mouse strains in the early...

  13. Targeted DNA demethylation and activation of endogenous genes using programmable TALE-TET1 fusion proteins.

    Science.gov (United States)

    Maeder, Morgan L; Angstman, James F; Richardson, Marcy E; Linder, Samantha J; Cascio, Vincent M; Tsai, Shengdar Q; Ho, Quan H; Sander, Jeffry D; Reyon, Deepak; Bernstein, Bradley E; Costello, Joseph F; Wilkinson, Miles F; Joung, J Keith

    2013-12-01

    Genome-wide studies have defined cell type-specific patterns of DNA methylation that are important for regulating gene expression in both normal development and disease. However, determining the functional significance of specific methylation events remains challenging, owing to the lack of methods for removing such modifications in a targeted manner. Here we describe an approach for efficient targeted demethylation of specific CpGs in human cells using fusions of engineered transcription activator-like effector (TALE) repeat arrays and the TET1 hydroxylase catalytic domain. Using these TALE-TET1 fusions, we demonstrate that modification of critical methylated promoter CpG positions can lead to substantial increases in the expression of endogenous human genes. Our results delineate a strategy for understanding the functional significance of specific CpG methylation marks in the context of endogenous gene loci and validate programmable DNA demethylation reagents with potential utility for research and therapeutic applications.

  14. Allelic loss of the ING gene family loci is a frequent event in ameloblastoma.

    Science.gov (United States)

    Borkosky, Silvia S; Gunduz, Mehmet; Beder, Levent; Tsujigiwa, Hidetsugu; Tamamura, Ryo; Gunduz, Esra; Katase, Naoki; Rodriguez, Andrea P; Sasaki, Akira; Nagai, Noriyuki; Nagatsuka, Hitoshi

    2010-01-01

    Ameloblastoma is the most frequently encountered odontogenic tumor, characterized by a locally invasive behavior, frequent recurrences, and, although rare, metastatic capacity. Loss or inactivation of tumor suppressor genes (TSGs) allows cells to acquire neoplastic growth. The ING family proteins are tumor suppressors that physically and functionally interact with p53 to perform important roles in apoptosis, DNA repair, cell cycle regulation, and senescence. TP53 genetic alterations were reported to infrequently occur in ameloblastoma. Considering that other TSGs related to TP53 could be altered in this tumor, we focused our study on the ING family genes. We analyzed the loss of heterozygosity (LOH) status of the ING family (ING1-ING5) chromosomal loci in a group of ameloblastomas by microsatellite analysis, and correlated the ING LOH status with clinicopathological characteristics. By using specific microsatellite markers, high frequency of LOH was found at the loci of each ING gene family member (33.3-72.2%). A significant relationship was shown between LOH of D2S 140 (ING5 locus) and solid tumor type (p = 0.02). LOH of ING3MS (ING3 locus) was also high in solid type tumors, showing a near significant association. In addition, a notable tendency toward higher LOH for half of the markers was observed in recurrent cases. LOH of ING family genes appears as a common genetic alteration in solid ameloblastoma. The current study provides interesting novel information regarding the potential prognostic significance of the allelic loss of the ING gene family loci in ameloblastoma tumorigenesis.

  15. Activated α2-Macroglobulin Regulates Transcriptional Activation of c-MYC Target Genes through Cell Surface GRP78 Protein.

    Science.gov (United States)

    Gopal, Udhayakumar; Gonzalez-Gronow, Mario; Pizzo, Salvatore Vincent

    2016-05-13

    Activated α2-macroglobulin (α2M*) signals predominantly through cell surface GRP78 (CS-GRP78) to promote proliferation and survival of cancer cells; however, the molecular mechanism remains obscure. c-MYC is an essential transcriptional regulator that controls cell proliferation. We hypothesize that α2M*/CS-GRP78-evoked key signaling events are required for transcriptional activation of c-MYC target genes. Activation of CS-GRP78 by α2M* requires ligation of the GRP78 primary amino acid sequence (Leu(98)-Leu(115)). After stimulation with α2M*, CS-GRP78 signaling activates 3-phosphoinositide-dependent protein kinase-1 (PDK1) to induce phosphorylation of PLK1, which in turn induces c-MYC transcription. We demonstrate that PLK1 binds directly to c-MYC and promotes its transcriptional activity by phosphorylating Ser(62) Moreover, activated c-MYC is recruited to the E-boxes of target genes FOSL1 and ID2 by phosphorylating histone H3 at Ser(10) In addition, targeting the carboxyl-terminal domain of CS-GRP78 with a mAb suppresses transcriptional activation of c-MYC target genes and impairs cell proliferation. This work demonstrates that α2M*/CS-GRP78 acts as an upstream regulator of the PDK1/PLK1 signaling axis to modulate c-MYC transcription and its target genes, suggesting a therapeutic strategy for targeting c-MYC-associated malignant progression. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Activated α2-Macroglobulin Regulates Transcriptional Activation of c-MYC Target Genes through Cell Surface GRP78 Protein*

    Science.gov (United States)

    Gopal, Udhayakumar; Gonzalez-Gronow, Mario; Pizzo, Salvatore Vincent

    2016-01-01

    Activated α2-macroglobulin (α2M*) signals predominantly through cell surface GRP78 (CS-GRP78) to promote proliferation and survival of cancer cells; however, the molecular mechanism remains obscure. c-MYC is an essential transcriptional regulator that controls cell proliferation. We hypothesize that α2M*/CS-GRP78-evoked key signaling events are required for transcriptional activation of c-MYC target genes. Activation of CS-GRP78 by α2M* requires ligation of the GRP78 primary amino acid sequence (Leu98–Leu115). After stimulation with α2M*, CS-GRP78 signaling activates 3-phosphoinositide-dependent protein kinase-1 (PDK1) to induce phosphorylation of PLK1, which in turn induces c-MYC transcription. We demonstrate that PLK1 binds directly to c-MYC and promotes its transcriptional activity by phosphorylating Ser62. Moreover, activated c-MYC is recruited to the E-boxes of target genes FOSL1 and ID2 by phosphorylating histone H3 at Ser10. In addition, targeting the carboxyl-terminal domain of CS-GRP78 with a mAb suppresses transcriptional activation of c-MYC target genes and impairs cell proliferation. This work demonstrates that α2M*/CS-GRP78 acts as an upstream regulator of the PDK1/PLK1 signaling axis to modulate c-MYC transcription and its target genes, suggesting a therapeutic strategy for targeting c-MYC-associated malignant progression. PMID:27002159

  17. Explosive events in active region observed by IRIS and SST/CRISP

    Science.gov (United States)

    Huang, Z.; Madjarska, M. S.; Scullion, E. M.; Xia, L.-D.; Doyle, J. G.; Ray, T.

    2017-01-01

    Transition-region explosive events (EEs) are characterized by non-Gaussian line profiles with enhanced wings at Doppler velocities of 50-150 km s-1. They are believed to be the signature of solar phenomena that are one of the main contributors to coronal heating. The aim of this study is to investigate the link of EEs to dynamic phenomena in the transition region and chromosphere in an active region. We analyse observations simultaneously taken by the Interface Region Imaging Spectrograph (IRIS) in the Si IV 1394 Å line and the slit-jaw (SJ) 1400 Å images, and the Swedish 1-m Solar Telescope in the Hα line. In total 24 events were found. They are associated with small-scale loop brightenings in SJ 1400 Å images. Only four events show a counterpart in the Hα-35 km s-1 and Hα+35 km s-1 images. Two of them represent brightenings in the conjunction region of several loops that are also related to a bright region (granular lane) in the Hα-35 km s-1 and Hα+35 km s-1 images. 16 are general loop brightenings that do not show any discernible response in the Hα images. Six EEs appear as propagating loop brightenings, from which two are associated with dark jet-like features clearly seen in the Hα-35 km s-1 images. We found that chromospheric events with jet-like appearance seen in the wings of the Hα line can trigger EEs in the transition region and in this case the IRIS Si IV 1394 Å line profiles are seeded with absorption components resulting from Fe II and Ni II. Our study indicates that EEs occurring in active regions have mostly upper-chromosphere/transition-region origin. We suggest that magnetic reconnection resulting from the braidings of small-scale transition region loops is one of the possible mechanisms of energy release that are responsible for the EEs reported in this paper.

  18. Prevalence of enterococcus species and their virulence genes in fresh water prior to and after storm events.

    Science.gov (United States)

    Sidhu, J P S; Skelly, E; Hodgers, L; Ahmed, W; Li, Y; Toze, S

    2014-01-01

    Enterococcus spp. isolates (n = 286) collected from six surface water bodies in subtropical Brisbane, Australia, prior to and after storm events, were identified to species level and tested for the presence of seven clinically important virulence genes (VGs). Enterococcus faecalis (48%), Enterococcus faecium (14%), Enterococcus mundtii (13%), and Enterococcus casseliflavus (13%) were frequently detected at all sites. The frequency of E. faecium occurrence increased from 6% in the dry period to 18% after the wet period. The endocarditis antigen (efaA), gelatinase (gelE), collagen-binding protein (ace), and aggregation substance (asa1) were detected in 61%, 43%, 43%, and 23% of Enterococcus isolates, respectively. The chances of occurrence of ace, gelE, efaA, and asa1 genes in E. faecalis were found to be much higher compared to the other Enterococcus spp. The observed odds ratio of occurrence of ace and gelE genes in E. faecalis was much higher at 7.96 and 6.40 times, respectively. The hyl gene was 3.84 times more likely to be detected in E. casseliflavus. The presence of multiple VGs in most of the E. faecalis isolates underscores the importance of E. faecalis as a reservoir of VGs in the fresh water aquatic environment. Consequently, if contaminated surface water is to be used for production of potable and nonpotable water some degree of treatment depending upon intended use such as detention in basins prior to use or chlorination is required.

  19. Drug-resistant gene based genotyping for Acinetobacter baumannii in tracing epidemiological events and for clinical treatment within nosocomial settings

    Institute of Scientific and Technical Information of China (English)

    JIN Hui; XU Xiao-min; MI Zu-huang; MOU Yi; LIU Pei

    2009-01-01

    Background Acinetobacter baumannfi has emerged as an important pathogen related to serious infections and nosocomial outbreaks around the world. However, of the frequently used methods, pulsed-field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) in Acinetobacter baumannii genotyping lack the direct molecular proof of drug resistance. This study was conducted to establish a typing method based on drug resistant gene identification in contrast to traditional PFGE and AFLP in the period of nosocomial epidemic or outbreak.Methods From January 2005 to October 2005, twenty-seven strains of Acinetobacter species from Intensive Care Units, the Second Affiliated Hospital in Ningbo were isolated, including both epidemic and sporadic events. Susceptibility test, PFGE, AFLP and drug resistance gene typing (DRGT) were carded out to confirm the drug resistance and analyze the genotyping, respectively. PFGE was used as a reference to evaluate the typeability of DRGT and AFLP.Results Twenty-seven strains of Acinetobacter displayed multiple antibiotic resistance and drug resistant genes, and β-lactamase genes were detected in 85.2% strains. The result of DRGT was comparable to PFGE in Acinetobacter strains with different drug resistance though a little difference existed, and even suggested a molecular evolution course of different drug-resistant strains. AFLP showed great polymorphism between strains and had weak ability in distinguishing the drug resistance.Conclusion Compared to AFLP and PFGE, DRGT is useful to analyze localized molecular epidemiology of nosocomial infections and outbreaks, which would benefit clinical diagnosis and therapy.

  20. Aberrant rel/nfkb genes and activity in human cancer.

    Science.gov (United States)

    Rayet, B; Gélinas, C

    1999-11-22

    Rel/NF-kappaB transcription factors are key regulators of immune, inflammatory and acute phase responses and are also implicated in the control of cell proliferation and apoptosis. Remarkable progress has been made in understanding the signal transduction pathways that lead to the activation of Rel/NF-kappaB factors and the consequent induction of gene expression. Evidence linking deregulated Rel/NF-kappaB activity to oncogenesis in mammalian systems has emerged in recent years, consistent with the acute oncogenicity of the viral oncoprotein v-Rel in animal models. Chromosomal amplification, overexpression and rearrangement of genes coding for Rel/NF-kappaB factors have been noted in many human hematopoietic and solid tumors. Persistent nuclear NF-kappaB activity was also described in several human cancer cell types, as a result of constitutive activation of upstream signaling kinases or mutations inactivating inhibitory IkappaB subunits. Studies point to a correlation between the activation of cellular gene expression by Rel/NF-kappaB factors and their participation in the malignant process. Experiments implicating NF-kappaB in the control of the apoptotic response also support a role in oncogenesis and in the resistance of tumor cells to chemotherapy. This review focuses on the status of the rel, nfkb and ikb genes and their activity in human tumors and their association with the onset or progression of malignancies.

  1. Transcriptional Activation of Virulence Genes of Rhizobium etli.

    Science.gov (United States)

    Wang, Luyao; Lacroix, Benoît; Guo, Jianhua; Citovsky, Vitaly

    2017-03-15

    Recently, Rhizobium etli, in addition to Agrobacterium spp., has emerged as a prokaryotic species whose genome encodes a functional machinery for DNA transfer to plant cells. To understand this R. etli-mediated genetic transformation, it would be useful to define how its vir genes respond to the host plants. Here, we explored the transcriptional activation of the vir genes contained on the R. etli p42a plasmid. Using a reporter construct harboring lacZ under the control of the R. etli virE promoter, we show that the signal phenolic molecule acetosyringone (AS) induces R. etli vir gene expression both in an R. etli background and in an Agrobacterium tumefaciens background. Furthermore, in both bacterial backgrounds, the p42a plasmid also promoted plant genetic transformation with a reporter transfer DNA (T-DNA). Importantly, the R. etli vir genes were transcriptionally activated by AS in a bacterial species-specific fashion in regard to the VirA/VirG signal sensor system, and this activation was induced by signals from the natural host species of this bacterium but not from nonhost plants. The early kinetics of transcriptional activation of the major vir genes of R. etli also revealed several features distinct from those known for A. tumefaciens: the expression of the virG gene reached saturation relatively quickly, and virB2, which in R. etli is located outside the virB operon, was expressed only at low levels and did not respond to AS. These differences in vir gene transcription may contribute to the lower efficiency of T-DNA transfer of R. etli p42a than of T-DNA transfer of pTiC58 of A. tumefaciensIMPORTANCE The region encoding homologs of Agrobacterium tumefaciens virulence genes in the Rhizobium etli CE3 p42a plasmid was the first endogenous virulence system encoded by the genome of a non-Agrobacterium species demonstrated to be functional in DNA transfer and stable integration into the plant cell genome. In this study, we explored the transcriptional

  2. Genome-wide analysis of immune activation in human T and B cells reveals distinct classes of alternatively spliced genes.

    Directory of Open Access Journals (Sweden)

    Yevgeniy A Grigoryev

    Full Text Available Alternative splicing of pre-mRNA is a mechanism that increases the protein diversity of a single gene by differential exon inclusion/exclusion during post-transcriptional processing. While alternative splicing is established to occur during lymphocyte activation, little is known about the role it plays during the immune response. Our study is among the first reports of a systematic genome-wide analysis of activated human T and B lymphocytes using whole exon DNA microarrays integrating alternative splicing and differential gene expression. Purified human CD2(+ T or CD19(+ B cells were activated using protocols to model the early events in post-transplant allograft immunity and sampled as a function of time during the process of immune activation. Here we show that 3 distinct classes of alternatively spliced and/or differentially expressed genes change in an ordered manner as a function of immune activation. We mapped our results to function-based canonical pathways and demonstrated that some are populated by only one class of genes, like integrin signaling, while other pathways, such as purine metabolism and T cell receptor signaling, are populated by all three classes of genes. Our studies augment the current view of T and B cell activation in immunity that has been based exclusively upon differential gene expression by providing evidence for a large number of molecular networks populated as a function of time and activation by alternatively spliced genes, many of which are constitutively expressed.

  3. SWI/SNF enzymes promote SOX10- mediated activation of myelin gene expression.

    Directory of Open Access Journals (Sweden)

    Himangi G Marathe

    Full Text Available SOX10 is a Sry-related high mobility (HMG-box transcriptional regulator that promotes differentiation of neural crest precursors into Schwann cells, oligodendrocytes, and melanocytes. Myelin, formed by Schwann cells in the peripheral nervous system, is essential for propagation of nerve impulses. SWI/SNF complexes are ATP dependent chromatin remodeling enzymes that are critical for cellular differentiation. It was recently demonstrated that the BRG1 subunit of SWI/SNF complexes activates SOX10 expression and also interacts with SOX10 to activate expression of OCT6 and KROX20, two transcriptional regulators of Schwann cell differentiation. To determine the requirement for SWI/SNF enzymes in the regulation of genes that encode components of myelin, which are downstream of these transcriptional regulators, we introduced SOX10 into fibroblasts that inducibly express dominant negative versions of the SWI/SNF ATPases, BRM or BRG1. Dominant negative BRM and BRG1 have mutations in the ATP binding site and inhibit gene activation events that require SWI/SNF function. Ectopic expression of SOX10 in cells derived from NIH 3T3 fibroblasts led to the activation of the endogenous Schwann cell specific gene, myelin protein zero (MPZ and the gene that encodes myelin basic protein (MBP. Thus, SOX10 reprogrammed these cells into myelin gene expressing cells. Ectopic expression of KROX20 was not sufficient for activation of these myelin genes. However, KROX20 together with SOX10 synergistically activated MPZ and MBP expression. Dominant negative BRM and BRG1 abrogated SOX10 mediated activation of MPZ and MBP and synergistic activation of these genes by SOX10 and KROX20. SOX10 was required to recruit BRG1 to the MPZ locus. Similarly, in immortalized Schwann cells, BRG1 recruitment to SOX10 binding sites at the MPZ locus was dependent on SOX10 and expression of dominant negative BRG1 inhibited expression of MPZ and MBP in these cells. Thus, SWI/SNF enzymes cooperate

  4. SWI/SNF enzymes promote SOX10- mediated activation of myelin gene expression.

    Science.gov (United States)

    Marathe, Himangi G; Mehta, Gaurav; Zhang, Xiaolu; Datar, Ila; Mehrotra, Aanchal; Yeung, Kam C; de la Serna, Ivana L

    2013-01-01

    SOX10 is a Sry-related high mobility (HMG)-box transcriptional regulator that promotes differentiation of neural crest precursors into Schwann cells, oligodendrocytes, and melanocytes. Myelin, formed by Schwann cells in the peripheral nervous system, is essential for propagation of nerve impulses. SWI/SNF complexes are ATP dependent chromatin remodeling enzymes that are critical for cellular differentiation. It was recently demonstrated that the BRG1 subunit of SWI/SNF complexes activates SOX10 expression and also interacts with SOX10 to activate expression of OCT6 and KROX20, two transcriptional regulators of Schwann cell differentiation. To determine the requirement for SWI/SNF enzymes in the regulation of genes that encode components of myelin, which are downstream of these transcriptional regulators, we introduced SOX10 into fibroblasts that inducibly express dominant negative versions of the SWI/SNF ATPases, BRM or BRG1. Dominant negative BRM and BRG1 have mutations in the ATP binding site and inhibit gene activation events that require SWI/SNF function. Ectopic expression of SOX10 in cells derived from NIH 3T3 fibroblasts led to the activation of the endogenous Schwann cell specific gene, myelin protein zero (MPZ) and the gene that encodes myelin basic protein (MBP). Thus, SOX10 reprogrammed these cells into myelin gene expressing cells. Ectopic expression of KROX20 was not sufficient for activation of these myelin genes. However, KROX20 together with SOX10 synergistically activated MPZ and MBP expression. Dominant negative BRM and BRG1 abrogated SOX10 mediated activation of MPZ and MBP and synergistic activation of these genes by SOX10 and KROX20. SOX10 was required to recruit BRG1 to the MPZ locus. Similarly, in immortalized Schwann cells, BRG1 recruitment to SOX10 binding sites at the MPZ locus was dependent on SOX10 and expression of dominant negative BRG1 inhibited expression of MPZ and MBP in these cells. Thus, SWI/SNF enzymes cooperate with SOX10 to

  5. Prediction of Increasing Production Activities using Combination of Query Aggregation on Complex Events Processing and Neural Network

    Directory of Open Access Journals (Sweden)

    Achmad Arwan

    2016-07-01

    Full Text Available AbstrakProduksi, order, penjualan, dan pengiriman adalah serangkaian event yang saling terkait dalam industri manufaktur. Selanjutnya hasil dari event tersebut dicatat dalam event log. Complex Event Processing adalah metode yang digunakan untuk menganalisis apakah terdapat pola kombinasi peristiwa tertentu (peluang/ancaman yang terjadi pada sebuah sistem, sehingga dapat ditangani secara cepat dan tepat. Jaringan saraf tiruan adalah metode yang digunakan untuk mengklasifikasi data peningkatan proses produksi. Hasil pencatatan rangkaian proses yang menyebabkan peningkatan produksi digunakan sebagai data latih untuk mendapatkan fungsi aktivasi dari jaringan saraf tiruan. Penjumlahan hasil catatan event log dimasukkan ke input jaringan saraf tiruan untuk perhitungan nilai aktivasi. Ketika nilai aktivasi lebih dari batas yang ditentukan, maka sistem mengeluarkan sinyal untuk meningkatkan produksi, jika tidak, sistem tetap memantau kejadian. Hasil percobaan menunjukkan bahwa akurasi dari metode ini adalah 77% dari 39 rangkaian aliran event.Kata kunci: complex event processing, event, jaringan saraf tiruan, prediksi peningkatan produksi, proses. AbstractProductions, orders, sales, and shipments are series of interrelated events within manufacturing industry. Further these events were recorded in the event log. Complex event processing is a method that used to analyze whether there are patterns of combinations of certain events (opportunities / threats that occur in a system, so it can be addressed quickly and appropriately. Artificial neural network is a method that we used to classify production increase activities. The series of events that cause the increase of the production used as a dataset to train the weight of neural network which result activation value. An aggregate stream of events inserted into the neural network input to compute the value of activation. When the value is over a certain threshold (the activation value results

  6. Acupuncture inhibits microglial activation and inflammatory events in the MPTP-induced mouse model.

    Science.gov (United States)

    Kang, Jun Mo; Park, Hi Joon; Choi, Yeong Gon; Choe, Il Hwan; Park, Jae Hyun; Kim, Yong Sik; Lim, Sabina

    2007-02-02

    Using a mouse model of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced Parkinson's disease (PD), this study investigated on the neuroprotective effects of acupuncture by examining whether acupuncture contributed to inhibiting microglial activation and inflammatory events. C57BL/6 mice were treated with MPTP (30 mg/kg, i.p.) for 5 consecutive days. Acupuncture was then applied to acupoints Yanglingquan (GB34) and Taichong (LR3) starting 2 h after the first MPTP administration and then at 48 h intervals until the mice were sacrificed for analyses at 1, 3, and 7 days after the last MPTP injection. These experiments demonstrated that acupuncture inhibited the decreased of the tyrosine hydroxylase (TH) immunoreactivity (IR) and generated a neuroprotective effects in the striatum (ST) and the substantia nigra (SN) on days 1, 3, and 7 post-MPTP injections. Acupuncture attenuated the increase of macrophage antigen complex-1 (MAC-1), a marker of microglial activation, at 1 and 3 days and reduced the increases in cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) expression on days 1, 3, and 7. In MPTP group, striatal dopamine (DA) was measured by 46% at 7 days, whereas DA in the acupuncture group was 78%. On the basis of these results, we suggest that acupuncture could be used as a neuroprotective intervention for the purpose of inhibiting microglial activation and inflammatory events in PD.

  7. Gene expression in IFN-g-activated murine macrophages

    Directory of Open Access Journals (Sweden)

    Pereira C.A.

    2004-01-01

    Full Text Available Macrophages are critical for natural immunity and play a central role in specific acquired immunity. The IFN-gamma activation of macrophages derived from A/J or BALB/c mice yielded two different patterns of antiviral state in murine hepatitis virus 3 infection, which were related to a down-regulation of the main virus receptor. Using cDNA hybridization to evaluate mRNA accumulation in the cells, we were able to identify several genes that are differently up- or down-regulated by IFN-gamma in A/J (267 and 266 genes, respectively, up- and down-regulated or BALB/c (297 and 58 genes, respectively, up- and down-regulated mouse macrophages. Macrophages from mice with different genetic backgrounds behave differently at the molecular level and comparison of the patterns of non-activated and IFN-gamma-activated A/J or BALB/c mouse macrophages revealed, for instance, an up-regulation and a down-regulation of genes coding for biological functions such as enzymatic reactions, nucleic acid synthesis and transport, protein synthesis, transport and metabolism, cytoskeleton arrangement and extracellular matrix, phagocytosis, resistance and susceptibility to infection and tumors, inflammation, and cell differentiation or activation. The present data are reported in order to facilitate future correlation of proteomic/transcriptomic findings as well as of results obtained from a classical approach for the understanding of biological phenomena. The possible implication of the role of some of the gene products relevant to macrophage biology can now be further scrutinized. In this respect, a down-regulation of the main murine hepatitis virus 3 receptor gene was detected only in IFN-gamma-activated macrophages of resistant mice.

  8. Observing—and Imaging—Active Galactic Nuclei with the Event Horizon Telescope

    Directory of Open Access Journals (Sweden)

    Vincent L. Fish

    2016-10-01

    Full Text Available Originally developed to image the shadow region of the central black hole in Sagittarius A* and in the nearby galaxy M87, the Event Horizon Telescope (EHT provides deep, very high angular resolution data on other active galactic nucleus (AGN sources too. The challenges of working with EHT data have spurred the development of new image reconstruction algorithms. This work briefly reviews the status of the EHT and its utility for observing AGN sources, with emphasis on novel imaging techniques that offer the promise of better reconstructions at 1.3 mm and other wavelengths.

  9. 2015 Volcanic activity in Alaska—Summary of events and response of the Alaska Volcano Observatory

    Science.gov (United States)

    Dixon, James P.; Cameron, Cheryl E.; Iezzi, Alexandra M.; Wallace, Kristi

    2017-09-28

    The Alaska Volcano Observatory (AVO) responded to eruptions, volcanic unrest or suspected unrest, and seismic events at 14 volcanic centers in Alaska during 2015. The most notable volcanic activity consisted of continuing intermittent ash eruptions from Cleveland and Shishaldin volcanoes in the Aleutian Islands. Two eruptive episodes, at Veniaminof and Pavlof, on the Alaska Peninsula ended in 2015. During 2015, AVO re-established the seismograph network at Aniakchak, installed six new broadband seismometers throughout the Aleutian Islands, and added a Multiple component Gas Analyzer System (MultiGAS) station on Augustine.

  10. Detecting consciousness in a total Locked-in syndrome: an active event related paradigm

    OpenAIRE

    Schnakers, Caroline; Perrin, Fabien; Schabus, Manuel; Hustinx, Roland; Majerus, Steve; Moonen, Gustave; Boly, Mélanie; Vanhaudenhuyse, Audrey; Bruno, Marie-Aurélie; Laureys, Steven

    2009-01-01

    Total locked-in syndrome is characterized by tetraplegia, anarthria and paralysis of eye motility. In this study, consciousness was detected in a 21-year-old woman who presented a total locked-in syndrome after a basilar artery thrombosis (49 days post-injury) using an active event-related paradigm. The patient was presented sequences of names containing the patient's own name and other names. The patient was instructed to count her own name or to count another target name. Similar to 4 age- ...

  11. Explosive events in active region observed by IRIS and SST/CRISP

    CERN Document Server

    Huang, Z; Scullion, E M; Xia, L -D; Doyle, J G; Ray, T

    2016-01-01

    Transition-region explosive events (EEs) are characterized by non-Gaussian line profiles with enhanced wings at Doppler velocities of 50-150 km/s. They are believed to be the signature of solar phenomena that are one of the main contributors to coronal heating. The aim of this study is to investigate the link of EEs to dynamic phenomena in the transition region and chromosphere in an active region. We analyze observations simultaneously taken by the Interface Region Imaging Spectrograph (IRIS) in the Si IV 1394\\AA\\ line and the slit-jaw (SJ) 1400\\AA\\ images, and the Swedish 1-m Solar Telescope (SST) in the H$\\alpha$ line. In total 24 events were found. They are associated with small-scale loop brightenings in SJ 1400\\AA\\ images. Only four events show a counterpart in the H$\\alpha$-35 km/s and H$\\alpha$+35 km/s images. Two of them represent brightenings in the conjunction region of several loops that are also related to a bright region (granular lane) in the H$\\alpha$-35km/s and H$\\alpha$+35 km/s images. Sixte...

  12. Multi-day activity scheduling reactions to planned activities and future events in a dynamic model of activity-travel behavior

    Science.gov (United States)

    Nijland, Linda; Arentze, Theo; Timmermans, Harry

    2014-01-01

    Modeling multi-day planning has received scarce attention in activity-based transport demand modeling so far. However, new dynamic activity-based approaches are being developed at the current moment. The frequency and inflexibility of planned activities and events in activity schedules of individuals indicate the importance of incorporating those pre-planned activities in the new generation of dynamic travel demand models. Elaborating and combining previous work on event-driven activity generation, the aim of this paper is to develop and illustrate an extension of a need-based model of activity generation that takes into account possible influences of pre-planned activities and events. This paper describes the theory and shows the results of simulations of the extension. The simulation was conducted for six different activities, and the parameter values used were consistent with an earlier estimation study. The results show that the model works well and that the influences of the parameters are consistent, logical, and have clear interpretations. These findings offer further evidence of face and construct validity to the suggested modeling approach.

  13. Search for supersymmetry in events with at least one photon, missing transverse momentum, and large transverse event activity in proton-proton collisions at 13 TeV

    CERN Document Server

    CMS Collaboration

    2017-01-01

    A search for physics beyond the standard model in final states with at least one photon, large transverse momentum imbalance, and large total transverse event activity is presented. This event selection provides good sensitivity for gauge mediated supersymmetry models in which pair-produced gluinos or squarks decay via short-living neutralinos to photons and gravitinos. The data sample corresponds to an integrated luminosity of $35.9~\\mathrm{fb}^{-1}$ of proton-proton collisions recorded by the CMS experiment at the LHC in 2016. No excess of events above the standard model background is observed. The data is interpreted in simplified models of gluino- and squark pair production, in which gluinos and squarks decay via gauginos to photons. Gluino masses of up to $2~\\mathrm{TeV}$ masses up to $1.6~\\mathrm{TeV}$ are excluded.

  14. Gene Expression Patterns Define Key Transcriptional Events InCell-Cycle Regulation By cAMP And Protein Kinase A

    Energy Technology Data Exchange (ETDEWEB)

    Zambon, Alexander C.; Zhang, Lingzhi; Minovitsky, Simon; Kanter, Joan R.; Prabhakar, Shyam; Salomonis, Nathan; Vranizan, Karen; Dubchak Inna,; Conklin, Bruce R.; Insel, Paul A.

    2005-06-01

    Although a substantial number of hormones and drugs increase cellular cAMP levels, the global impact of cAMP and its major effector mechanism, protein kinase A (PKA), on gene expression is not known. Here we show that treatment of murine wild-type S49 lymphoma cells for 24 h with 8-(4-chlorophenylthio)-cAMP (8-CPTcAMP), a PKA-selective cAMP analog, alters the expression of approx equal to 4,500 of approx. equal to 13,600 unique genes. By contrast, gene expression was unaltered in Kin- S49 cells (that lack PKA) incubated with 8-CPTcAMP. Changes in mRNA and protein expression of several cell cycle regulators accompanied cAMP-induced G1-phase cell-cycle arrest of wild-type S49 cells. Within 2h, 8-CPT-cAMP altered expression of 152 genes that contain evolutionarily conserved cAMP-response elements within 5 kb of transcriptional start sites, including the circadian clock gene Per1. Thus, cAMP through its activation of PKA produces extensive transcriptional regulation in eukaryotic cells. These transcriptional networks include a primary group of cAMP-response element-containing genes and secondary networks that include the circadian clock.

  15. The Truth Before and After: Brain Potentials Reveal Automatic Activation of Event Knowledge during Sentence Comprehension.

    Science.gov (United States)

    Nieuwland, Mante S

    2015-11-01

    How does knowledge of real-world events shape our understanding of incoming language? Do temporal terms like "before" and "after" impact the online recruitment of real-world event knowledge? These questions were addressed in two ERP experiments, wherein participants read sentences that started with "before" or "after" and contained a critical word that rendered each sentence true or false (e.g., "Before/After the global economic crisis, securing a mortgage was easy/harder"). The critical words were matched on predictability, rated truth value, and semantic relatedness to the words in the sentence. Regardless of whether participants explicitly verified the sentences or not, false-after-sentences elicited larger N400s than true-after-sentences, consistent with the well-established finding that semantic retrieval of concepts is facilitated when they are consistent with real-world knowledge. However, although the truth judgments did not differ between before- and after-sentences, no such sentence N400 truth value effect occurred in before-sentences, whereas false-before-sentences elicited an enhanced subsequent positive ERPs. The temporal term "before" itself elicited more negative ERPs at central electrode channels than "after." These patterns of results show that, irrespective of ultimate sentence truth value judgments, semantic retrieval of concepts is momentarily facilitated when they are consistent with the known event outcome compared to when they are not. However, this inappropriate facilitation incurs later processing costs as reflected in the subsequent positive ERP deflections. The results suggest that automatic activation of event knowledge can impede the incremental semantic processes required to establish sentence truth value.

  16. Specific Genes Associated with Adverse Events of Methylphenidate Use in the Pediatric Population

    DEFF Research Database (Denmark)

    Joensen, Beinta; Meyer, Morten; Aagaard, Lise

    2017-01-01

    were significantly associated with the following genes: appetite reduction (CES1*G); buccal-lingual movements (T1065G); diastolic blood pressure (ADRA2A Mspl C/C-GC); emotionality (DAT1*9/9); irritability (SNAP25 T1065G); picking (DRD4*7/DRD4*4); social withdrawal (DRD4*7/DRD4*4); somatic complaints....... They included small patient samples, poorly standardized treatment regimens, and limited outcome assessments. In the future, more pharmacogenomic studies in ADHD are needed, preferably using randomized, controlled study designs and of longer duration (more than 6 months)....

  17. Interleukin-1-induced activation of the small GTPase Rac1 depends on receptor internalization and regulates gene expression.

    Science.gov (United States)

    Windheim, Mark; Hansen, Benjamin

    2014-01-01

    Interleukin 1 (IL-1) triggers the internalization of its cognate receptor from the plasma membrane. We recently demonstrated that this internalization is of critical importance for the IL-1-induced gene expression. In this study we report that the IL-1-induced activation of the small GTPase Rac1 requires receptor endocytosis. We further show that the depletion of Rac1 reduces the IL-1-dependent gene expression without affecting signaling events that are initiated at the plasma membrane. Collectively, we provide evidence for a key role of Rac1 in a pathway that regulates IL-1-induced gene expression depending on receptor endocytosis.

  18. Discrete gene replication events drive coupling between the cell cycle and circadian clocks.

    Science.gov (United States)

    Paijmans, Joris; Bosman, Mark; Ten Wolde, Pieter Rein; Lubensky, David K

    2016-04-12

    Many organisms possess both a cell cycle to control DNA replication and a circadian clock to anticipate changes between day and night. In some cases, these two rhythmic systems are known to be coupled by specific, cross-regulatory interactions. Here, we use mathematical modeling to show that, additionally, the cell cycle generically influences circadian clocks in a nonspecific fashion: The regular, discrete jumps in gene-copy number arising from DNA replication during the cell cycle cause a periodic driving of the circadian clock, which can dramatically alter its behavior and impair its function. A clock built on negative transcriptional feedback either phase-locks to the cell cycle, so that the clock period tracks the cell division time, or exhibits erratic behavior. We argue that the cyanobacterium Synechococcus elongatus has evolved two features that protect its clock from such disturbances, both of which are needed to fully insulate it from the cell cycle and give it its observed robustness: a phosphorylation-based protein modification oscillator, together with its accompanying push-pull read-out circuit that responds primarily to the ratios of different phosphoform concentrations, makes the clock less susceptible to perturbations in protein synthesis; the presence of multiple, asynchronously replicating copies of the same chromosome diminishes the effect of replicating any single copy of a gene.

  19. Valsartan Decreases Platelet Activity and Arterial Thrombotic Events in Elderly Patients with Hypertension

    Institute of Scientific and Technical Information of China (English)

    Fang Wu; Hong-Yan Wang; Fan Cai; Ling-Jie Wang; Feng-Ru Zhang; Xiao-Nan Chen; Qian Yang

    2015-01-01

    Background:Angiotensin type 1 receptor (AT1R) antagonists are extensively used for blood pressure control in elderly patients with hypertension.This study aimed to investigate the inhibitory effects of AT1R antagonist valsartan on platelet aggregation and the occurrence of cardio-cerebral thrombotic events in elderly patients with hypertension.Methods:Two-hundred and ten patients with hypertension and aged > 60 years were randomized to valsartan (n =140) or amlodipine (n =70) on admission.The primary endpoint was platelet aggregation rate (PAR) induced by arachidonic acid at discharge,and the secondary endpoint was the rate of thrombotic events including brain infarction and myocardial infarction during follow-up.Human aortic endothelial cells (HAECs) were stimulated by angiotensin Ⅱ (Ang Ⅱ,100 nmol/L) with or without pretreatment of valsartan (100 nmol/L),and relative expression of cyclooxygenase-2 (COX-2) and thromboxane B2 (TXB2) and both p38 mitogen-activated protein kinase (p38MAPK) and nuclear factor-kB (NF-kB) activities were assessed.Statistical analyses were performed by GraphPad Prism 5.0 software (GraphPad Software,Inc.,California,USA).Results:PAR was lower after treatment with valsartan (1 1.49 ± 0.69% vs.18.71 ± 2.47%,P < 0.001),associated with more reduced plasmalevels of COX-2 (76.94 ± 7.07 U/L vs.116.4 ± 15.89 U/L,P < 0.001) and TXB2 (1667 ± 56.50 pg/ml vs.2207 ± 180.20 pg/ml) (all P < 0.001).Plasma COX-2 and TXB2 levels correlated significantly with PAR in overall patients (r =0.109,P < 0.001).During follow-up (median,18 months),there was a significantly lower thrombotic event rate in patients treated with valsartan (14.3% vs.32.8%,P =0.002).Relative expression of COX-2 and secretion of TXB2 with concordant phosphorylation ofp38MAPK and NF-kB were increased in HAECs when stimulated by Ang Ⅱ (100 nmol/L) but were significantly decreased by valsartan pretreatment (100 nmol/L).Conclusions:AT1R antagonist valsartan

  20. Estimating time-correlation functions by sampling and unbiasing dynamically activated events

    CERN Document Server

    Athènes, Manuel; Jourdan, Thomas; 10.1063/1.4766458

    2012-01-01

    Transition path sampling is a rare-event method that estimates state-to-state timecorrelation functions in many-body systems from samples of short trajectories. In this framework, it is proposed to bias the importance function using the lowest Jacobian eigenvalue moduli along the dynamical trajectory. A lowest eigenvalue modulus is related to the lowest eigenvalue of the Hessian matrix and is evaluated here using the Lanczos algorithm as in activation-relaxation techniques. This results in favoring the sampling of activated trajectories and enhancing the occurrence of the rare reactive trajectories of interest, those corresponding to transitions between locally stable states. Estimating the time-correlation functions involves unbiasing the sample of simulated trajectories which is done using the multi-state Bennett acceptance ratio (MBAR) method. To assess the performance of our procedure, we compute the time-correlation function associated with the migration of a vacancy in {\\alpha}-iron. The derivative of t...

  1. Repetitive mixing events and Holocene pyroclastic activity at Pico de Orizaba and Popocatepetl, Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Cantagrel, J.M.; Gourgaud, A.; Robin, C.

    1984-01-01

    The Holocene volcanic activity which built up the present terminal cones of Pico de Orizaba and Popocatepetl in eastern Mexico, was characterized by repeated pyroclastic Saint-Vincent type eruptions. Radiocarbon data show that these paroxysmal events occurred at more or less regular intervals, and were followed by moderate activity producing ash and pumice falls and andesitic lava flows from the summit craters. Typical ash and scoria pyroclastic flows exhibit a heterogeneous composition given by the interaction of a dacitic component with a more basic andesitic one. Scoria bombs are characterized by banded to emulsified textures, mineralogical disequilibrium assemblages and linear chemical variations on element-element plots as exemplified by the Loma Grande flow at Pico. Periodic replenishments of the magmatic reservoir could be the major phenomenon that started mixing and consequently triggered the pyroclastic eruptions. 22 references.

  2. Repetitive mixing events and holocene pyroclastic activity at Pico de Orizaba and Popocatepetl (Mexico)

    Science.gov (United States)

    Cantagrel, J. M.; Gourgaud, A.; Robin, C.

    1984-12-01

    The Holocene volcanic activity which built up the present terminal cones of Pico de Orizaba and Popocatepetl in eastern Mexico, was characterized by repeated pyroclastic Saint-Vincent type eruptions. Radiocarbon data show that these paroxysmal events occurred at more or less regular intervals, and were followed by moderate activity producing ash and pumice falls and andesitic lava flows from the summit craters. Typical ash and scoria pyroclastic flows exhibit a heterogeneous composition given by the interaction of a dacitic component with a more basic andesitic one. Scoria bombs are characterized by banded to emulsified textures, mineralogical desequilibrium assemblages and linear chemical variations on element-element plots as exemplified by the Loma Grande flow at Pico. Periodic replenishments of the magmatic reservoir could be the major phenomenon that started mixing and consequently triggered the pyroclastic eruptions.

  3. Relationships between event-related potentials (P300) and activities of daily living in Parkinson's disease.

    Science.gov (United States)

    Maeshima, Shinichiro; Itakura, Toru; Komai, Norihiko; Matsumoto, Tomoko; Ueyoshi, Akitaka

    2002-01-01

    The correlation between event-related potentials (P300) and activities of daily living was studied in Parkinson's disease. The P300 of 30 patients with Parkinson's disease and 118 normal subjects were recorded. All patients were evaluated by the Mini-Mental State, Kana-hiroi Test, word fluency, Raven's Coloured Progressive Matrices, Osaka Memory Scale, revised Wechsler Adult Intelligence Scale, self-rating depression scale, state-trait anxiety inventory, and Functional Independence Measure. Eight patients showed prolonged P300 latencies. P300 latency showed relationships to the Mini-Mental State (p Raven's Coloured Progressive Matrices (p < 0.01) and motor items of the Functional Independence Measure (p < 0.05). It was concluded that P300 should be useful in predicting difficulties with activities of daily living in patients with Parkinson's disease.

  4. Low ADAMTS-13 activity during hemorrhagic events with disseminated intravascular coagulation.

    Science.gov (United States)

    Chinen, Yoshiaki; Kuroda, Junya; Ohshiro, Muneo; Shimura, Yuji; Mizutani, Shinsuke; Nagoshi, Hisao; Sasaki, Nana; Nakayama, Ryuko; Kiyota, Miki; Yamamoto-Sugitani, Mio; Kobayashi, Tsutomu; Matsumoto, Yosuke; Horiike, Shigeo; Taniwaki, Masafumi

    2013-04-01

    Disseminated intravascular coagulation (DIC) is a life-threatening complication, and its control is essential for therapeutic success. Recombinant human soluble thrombomodulin alfa (rTM) is a novel therapeutic agent for DIC. The efficacy of rTM in the treatment of DIC is reportedly superior to that of conventional anti-DIC treatments, such as unfractionated heparin or low molecular weight heparin, but hemorrhagic events occasionally interfere with the therapeutic benefits of rTM. We assessed the clinical features of 20 consecutive patients who were given rTM for DIC associated with various hematologic disorders. Eight patients achieved remission of both primary disease and DIC, eight died due to progression of the primary disease, and four died of various hemorrhagic complications. Assessment of 16 biomarkers for coagulation showed that the four patients who died of hemorrhagic complications despite remission of their primary disease showed lower ADAMTS-13 (a disintegrin and metalloproteinase with a thrombospondin Type 1 motif, member 13) plasma activity than other patients (P = 0.016). The optimal cut-off level of ADAMTS-13 for predicting risk of hemorrhagic complications was 42 % (P = 0.007). Plasma ADAMTS-13 activity determined at diagnosis of DIC may help predict the risk of hemorrhagic events during and/or following DIC treatment with hematologic disorders.

  5. Infants Actively Construct and Update Their Representations of Physical Events: Evidence from Change Detection by 12-Month-Olds

    Directory of Open Access Journals (Sweden)

    Su-hua Wang

    2016-01-01

    Full Text Available The present research investigates the effects of top-down information on 12-month-olds’ representations of physical events, focusing on their ability to detect an object change across different events. Infants this age typically fail to detect height changes in events with tubes even though they successfully do so in events with covers. In Experiment  1, infants who saw a tube event in which objects did not interact successfully detected a change in an object’s height, suggesting that object interaction affects infants’ categorization of physical events. Experiments 2 and 3 examined the fine-grained process of event representation. In Experiment  2, infants detected the change in the tube event if they were led by pretest exposure to believe that the event was conducted with a cover. In Experiment  3, infants who initially believed so updated their representation if shown a tube before object interaction occurred (but not after. Together, these findings provide new evidence that infants, like older children and adults, actively construct physical events. Whether they notice a change depends on their existing knowledge and the current representation of the event.

  6. Systematic analysis of human kinase genes: a large number of genes and alternative splicing events result in functional and structural diversity

    Science.gov (United States)

    Milanesi, Luciano; Petrillo, Mauro; Sepe, Leandra; Boccia, Angelo; D'Agostino, Nunzio; Passamano, Myriam; Di Nardo, Salvatore; Tasco, Gianluca; Casadio, Rita; Paolella, Giovanni

    2005-01-01

    Background Protein kinases are a well defined family of proteins, characterized by the presence of a common kinase catalytic domain and playing a significant role in many important cellular processes, such as proliferation, maintenance of cell shape, apoptosys. In many members of the family, additional non-kinase domains contribute further specialization, resulting in subcellular localization, protein binding and regulation of activity, among others. About 500 genes encode members of the kinase family in the human genome, and although many of them represent well known genes, a larger number of genes code for proteins of more recent identification, or for unknown proteins identified as kinase only after computational studies. Results A systematic in silico study performed on the human genome, led to the identification of 5 genes, on chromosome 1, 11, 13, 15 and 16 respectively, and 1 pseudogene on chromosome X; some of these genes are reported as kinases from NCBI but are absent in other databases, such as KinBase. Comparative analysis of 483 gene regions and subsequent computational analysis, aimed at identifying unannotated exons, indicates that a large number of kinase may code for alternately spliced forms or be incorrectly annotated. An InterProScan automated analysis was perfomed to study domain distribution and combination in the various families. At the same time, other structural features were also added to the annotation process, including the putative presence of transmembrane alpha helices, and the cystein propensity to participate into a disulfide bridge. Conclusion The predicted human kinome was extended by identifiying both additional genes and potential splice variants, resulting in a varied panorama where functionality may be searched at the gene and protein level. Structural analysis of kinase proteins domains as defined in multiple sources together with transmembrane alpha helices and signal peptide prediction provides hints to function assignment

  7. Caspase-1 activation and mature interleukin-1β release are uncoupled events in monocytes

    Institute of Scientific and Technical Information of China (English)

    Amy; J; Galliher-Beckley; Li-Qiong; Lan; Shelly; Aono; Lei; Wang; Jishu; Shi

    2013-01-01

    AIM:To investigate whether caspase-1 activation/intracellular processing of pro-interleukin-1β(pro-IL-1β) and extracellular release of mature IL-1β from activated monocytes are separable events.METHODS:All experiments were performed on fresh or overnight cultured human peripheral blood monocytes(PBMCs) that were isolated from healthy donors.PBMCs were activated by lipopolysaccharide(LPS) stimulation before being treated with Adenosine triphosphate(ATP,1 mmol/L),human α-defensin-5(HD-5,50 μg/mL),and/or nigericin(Nig,30 μmol/L).For each experiment,the culture supernatants were collected separately from the cells.Cell lysates and supernatants were both subject to immunoprecipitation with anti-IL1β antibodies followed by western blot analysis with anti-caspase-1 and anti-IL-1β antibodies.RESULTS:We found that pro-IL-1β was processed to mature IL-1β in LPS-activated fresh and overnight cultured human monocytes in response to ATP stimulation.In the presence of HD-5,this release of IL-1β,but not the processing of pro-IL-1β to IL-1β,was completely inhibited.Similarly,in the presence of HD-5,the release of IL-1β,but not the processing of IL-1β,was significantly inhibited from LPS-activated monocytes stimulated with Nig.Finally,we treated LPS-activated monocytes with ATP and Nig and collected the supernatants.We found that both ATP and Nig stimulation could activate and release cleaved caspase-1 from the monocytes.Interestingly,and contrary to IL-1β processing and release,caspase-1 cleavage and release was not blocked by HD-5.All images are representative of three independent experiments.CONCLUSION:These data suggest that caspase-1 activation/processing of pro-IL-1β by caspase-1 and the release of mature IL-1β from human monocytes are distinct and separable events.

  8. Dynamical regimes underlying epileptiform events: role of instabilities and bifurcations in brain activity

    Science.gov (United States)

    Perez Velazquez, Jose L.; Cortez, Miguel A.; Snead, O. Carter; Wennberg, Richard

    2003-12-01

    Epileptic seizures represent a sudden and transient change in the synchronised firing of neuronal brain ensembles. While the transition of the collective neuronal activity towards the ictal event is not well understood, some progress has been made using nonlinear time series analysis methods. We present here an analysis of the dynamical regimes of the epileptic activity in three patients suffering from intractable (drug-resistant) seizures, and compare these with the dynamics in rodent epilepsy models. We used the time interval between spikes found in the electroencephalographic recordings as our variable to construct interpeak interval (IPI) time delay plots to study the neuronal interictal (activity between seizures), preictal, and seizure activity. A one-dimensional mapping function was obtained by approximation of the IPI plots with a polynomial. Two main dynamical regimes are obtained from the analysis of the mapping function, derived from the subharmonic bifurcation present in the map: period doubling and intermittency, both of which are observed in human and rat seizures. Hence, our simple model obtained from experimental data captures essential phenomena for the collective dynamics of brain networks, that are found in recordings from human and animal epilepsies. The description of the neuronal dynamics based on one-dimensional maps, widely used in other systems, may prove useful for the understanding of the collective population dynamics of brain activity.

  9. A cholinergic receptor gene (CHRM2) affects event-related oscillations.

    Science.gov (United States)

    Jones, Kevin A; Porjesz, Bernice; Almasy, Laura; Bierut, Laura; Dick, Danielle; Goate, Alison; Hinrichs, Anthony; Rice, John P; Wang, Jen C; Bauer, Lance O; Crowe, Raymond; Foroud, Tatiana; Hesselbrock, Victor; Kuperman, Samuel; Nurnberger, John; O'Connor, Sean J; Rohrbaugh, John; Schuckit, Marc A; Tischfield, Jay; Edenberg, Howard J; Begleiter, Henri

    2006-09-01

    We report genetic linkage and association findings which implicate the gene encoding the muscarinic acetylcholine receptor M2 (CHRM2) in the modulation of a scalp-recorded electrophysiological phenotype. The P3 (P300) response was evoked using a three-stimulus visual oddball paradigm and a phenotype that relates to the energy in the theta band (4-5 Hz) was analyzed. Studies have shown that similar electrophysiological measures represent cognitive correlates of attention, working memory, and response selection; a role has been suggested for the ascending cholinergic pathway in the same functions. The results of our genetic association tests, combined with knowledge regarding the presence of presynaptic cholinergic M2 autoreceptors in the basal forebrain, indicate that the cognitive processes required by the experiment may in part be mediated by inhibitory neural networks. These findings underscore the utility of electrophysiology and neurogenetics in the understanding of cognitive function and the study of brain-related disorders.

  10. CRAC channels drive digital activation and provide analog control and synergy to Ca(2+)-dependent gene regulation.

    Science.gov (United States)

    Kar, Pulak; Nelson, Charmaine; Parekh, Anant B

    2012-02-07

    Ca(2+)-dependent gene expression is critical for cell growth, proliferation, plasticity, and adaptation [1-3]. Because a common mechanism in vertebrates linking cytoplasmic Ca(2+) signals with activation of protein synthesis involves the nuclear factor of activated T cells (NFAT) family of transcription factors [4, 5], we have quantified protein expression in single cells following physiological Ca(2+) signals by using NFAT-driven expression of a genetically encoded fluorescent protein. We find that gene expression following CRAC channel activation is an all-or-nothing event over a range of stimulus intensities. Increasing agonist concentration recruits more cells but each responding cell does so in an essentially digital manner. Furthermore, Ca(2+)-dependent gene expression shows both short-term memory and strong synergy, where two pulses of agonist, which are ineffectual individually, robustly activate gene expression provided that the time interval between them is short. Such temporal filtering imparts coincidence detection to Ca(2+)-dependent gene activation. The underlying molecular basis mapped to time-dependent, nonlinear accumulation of nuclear NFAT. Local Ca(2+) near CRAC channels has to rise above a threshold level to drive gene expression, providing analog control to the digital activation process and a means to filter out fluctuations in background noise from activating transcription while ensuring robustness and high fidelity in the excitation-transcription coupling mechanism. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Gene expression profiling of preovulatory follicle in the buffalo cow: effects of increased IGF-I concentration on periovulatory events.

    Directory of Open Access Journals (Sweden)

    Jyotsna U Rao

    Full Text Available The preovulatory follicle in response to gonadotropin surge undergoes dramatic biochemical, and morphological changes orchestrated by expression changes in hundreds of genes. Employing well characterized bovine preovulatory follicle model, granulosa cells (GCs and follicle wall were collected from the preovulatory follicle before, 1, 10 and 22 h post peak LH surge. Microarray analysis performed on GCs revealed that 450 and 111 genes were differentially expressed at 1 and 22 h post peak LH surge, respectively. For validation, qPCR and immunocytochemistry analyses were carried out for some of the differentially expressed genes. Expression analysis of many of these genes showed distinct expression patterns in GCs and the follicle wall. To study molecular functions and genetic networks, microarray data was analyzed using Ingenuity Pathway Analysis which revealed majority of the differentially expressed genes to cluster within processes like steroidogenesis, cell survival and cell differentiation. In the ovarian follicle, IGF-I is established to be an important regulator of the above mentioned molecular functions. Thus, further experiments were conducted to verify the effects of increased intrafollicular IGF-I levels on the expression of genes associated with the above mentioned processes. For this purpose, buffalo cows were administered with exogenous bGH to transiently increase circulating and intrafollicular concentrations of IGF-I. The results indicated that increased intrafollicular concentrations of IGF-I caused changes in expression of genes associated with steroidogenesis (StAR, SRF and apoptosis (BCL-2, FKHR, PAWR. These results taken together suggest that onset of gonadotropin surge triggers activation of various biological pathways and that the effects of growth factors and peptides on gonadotropin actions could be examined during preovulatory follicle development.

  12. Kinetic proofreading of chromatin remodeling: from gene activation to gene repression and back

    Directory of Open Access Journals (Sweden)

    Raghvendra P Singh

    2015-08-01

    Full Text Available ATP-dependent chromatin remodeling is the active displacement of nucleosomes along or off DNA induced by chromatin remodeling complexes. This key process of gene regulation in eukaryote organisms has recently been argued to be controlled by a kinetic proofreading mechanism. In this paper we present a discussion of the current understanding of this process. We review the case of gene repression via heterochromatin formation by remodelers from the ISWI family and then discuss the activation of the IFN-β gene, where the displacement of the nucleosome is initiated by histone tail acetylations by the enzyme GCN5 which are required for the recruitment of SWI-SNF remodelers. We quantify the speci city of the acetylation step in the remodeling process by peptide docking simulations.

  13. Gene Transfer in Eukaryotic Cells Using Activated Dendrimers

    Science.gov (United States)

    Dennig, Jörg

    Gene transfer into eukaryotic cells plays an important role in cell biology. Over the last 30 years a number of transfection methods have been developed to mediate gene transfer into eukaryotic cells. Classical methods include co-precipitation of DNA with calcium phosphate, charge-dependent precipitation of DNA with DEAE-dextran, electroporation of nucleic acids, and formation of transfection complexes between DNA and cationic liposomes. Gene transfer technologies based on activated PAMAM-dendrimers provide another class of transfection reagents. PAMAM-dendrimers are highly branched, spherical molecules. Activation of newly synthesized dendrimers involves hydrolytic removal of some of the branches, and results in a molecule with a higher degree of flexibility. Activated dendrimers assemble DNA into compact structures via charge interactions. Activated dendrimer - DNA complexes bind to the cell membrane of eukaryotic cells, and are transported into the cell by non-specific endocytosis. A structural model of the activated dendrimer - DNA complex and a potential mechanism for its uptake into cells will be discussed.

  14. Binding of TFIIIC to sine elements controls the relocation of activity-dependent neuronal genes to transcription factories.

    Directory of Open Access Journals (Sweden)

    Luca Crepaldi

    Full Text Available In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE conditions. We discovered that Short Interspersed Elements (SINEs located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs, and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes.

  15. Binding of TFIIIC to sine elements controls the relocation of activity-dependent neuronal genes to transcription factories.

    Science.gov (United States)

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T; Jongbloets, Bart C; Down, Thomas A; Riccio, Antonella

    2013-01-01

    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes.

  16. Development and Event-specific Detection of Transgenic Glyphosate-resistant Rice Expressing the G2-EPSPS Gene.

    Science.gov (United States)

    Dong, Yufeng; Jin, Xi; Tang, Qiaoling; Zhang, Xin; Yang, Jiangtao; Liu, Xiaojing; Cai, Junfeng; Zhang, Xiaobing; Wang, Xujing; Wang, Zhixing

    2017-01-01

    Glyphosate is a widely used herbicide, due to its broad spectrum, low cost, low toxicity, high efficiency, and non-selective characteristics. Rice farmers rarely use glyphosate as a herbicide, because the crop is sensitive to this chemical. The development of transgenic glyphosate-tolerant rice could greatly improve the economics of rice production. Here, we transformed the Pseudomonas fluorescens G2 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS) gene G2-EPSPS, which conferred tolerance to glyphosate herbicide into a widely used japonica rice cultivar, Zhonghua 11 (ZH11), to develop two highly glyphosate-tolerant transgenic rice lines, G2-6 and G2-7, with one exogenous gene integration. Seed germination tests and glyphosate-tolerance assays of plants grown in a greenhouse showed that the two transgenic lines could greatly improve glyphosate-tolerance compared with the wild-type; The glyphosate-tolerance field test indicated that both transgenic lines could grow at concentrations of 20,000 ppm glyphosate, which is more than 20-times the recommended concentration in the field. Isolation of the flanking sequence of transgenic rice G2-6 indicated that the 5'-terminal of T-DNA was inserted into chromosome 8 of the rice genome. An event-specific PCR test system was established and the limit of detection of the primers reached five copies. Overall, the G2-EPSPS gene significantly improved glyphosate-tolerance in transgenic rice; furthermore, it is a useful candidate gene for the future development of commercial transgenic rice.

  17. COOH-terminal deletion of HBx gene is a frequent event in HBV-associated hepatocellular carcinoma

    Institute of Scientific and Technical Information of China (English)

    Xiao-Hong Liu; Jing Lin; Shu-Hui Zhang; Shun-Min Zhang; Mark A Feitelson; Heng-Jun Gao; Ming-Hua Zhu

    2008-01-01

    AIM:To investigate the hepatitis B virus (HBV) x gene (HBx) state in the tissues of HBV-related hepatocellular carcinoma (HCC) in Chinese patients and whether there were particular HBx mutations.METHODS:HBx gene was amplified and direct sequencing was used in genomic DNA samples from 20HCC and corresponding non-cancerous liver tissues from HBsAg-positive patients.HBV DNA integration and HBx deleted mutation were validated in 45 HCC patients at different stages by Southern blot analysis and polymerase chain reaction methods.RESULTS:The frequencies of HBx point mutations were significantly lower in HCC than their corresponding non-cancerous liver tissues (11/19 vs 18/19,P = 0.019).In contrast,deletions in HBx gene were significantly higher in HCC than their non-cancerous liver tissues (16/19 vs 4/19,P<0.001).The deletion of HBx COOH-terminal was detected in 14 HCC tissues.A specific integration of HBx at 17p13 locus was also found in 8 of 16 HCC,and all of them also exhibited full-length HBx deletions.Integrated or integrated coexistence with replicated pattern was obtained in 45.5% (20145)-56.8% (25145)tumors and 40.9% (18/45)-52.3% (23/45) non-tumor tissues.CONCLUSION:HBx deletion,especially the COOH-terminal deletion of HBx is a frequent event in HBV-associated HCC tissues in China.HBV integration had also taken place in partial HCC tissues.This supporting the hypothesis that deletion and probably integrated forms of the HBx gene may be implicated in liver carcinogenesis.

  18. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang;

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory...... element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...

  19. Depletion of Key Meiotic Genes and Transcriptome-Wide Abiotic Stress Reprogramming Mark Early Preparatory Events Ahead of Apomeiotic Transition

    Science.gov (United States)

    Shah, Jubin N.; Kirioukhova, Olga; Pawar, Pallavi; Tayyab, Muhammad; Mateo, Juan L.; Johnston, Amal J.

    2016-01-01

    Molecular dissection of apomixis – an asexual reproductive mode – is anticipated to solve the enigma of loss of meiotic sex, and to help fixing elite agronomic traits. The Brassicaceae genus Boechera comprises of both sexual and apomictic species, permitting comparative analyses of meiotic circumvention (apomeiosis) and parthenogenesis. Whereas previous studies reported local transcriptome changes during these events, it remained unclear whether global changes associated with hybridization, polyploidy and environmental adaptation that arose during evolution of Boechera might serve as (epi)genetic regulators of early development prior apomictic initiation. To identify these signatures during vegetative stages, we compared seedling RNA-seq transcriptomes of an obligate triploid apomict and a diploid sexual, both isolated from a drought-prone habitat. Uncovered were several genes differentially expressed between sexual and apomictic seedlings, including homologs of meiotic genes ASYNAPTIC 1 (ASY1) and MULTIPOLAR SPINDLE 1 (MPS1) that were down-regulated in apomicts. An intriguing class of apomict-specific deregulated genes included several NAC transcription factors, homologs of which are known to be transcriptionally reprogrammed during abiotic stress in other plants. Deregulation of both meiotic and stress-response genes during seedling stages might possibly be important in preparation for meiotic circumvention, as similar transcriptional alteration was discernible in apomeiotic floral buds too. Furthermore, we noted that the apomict showed better tolerance to osmotic stress in vitro than the sexual, in conjunction with significant upregulation of a subset of NAC genes. In support of the current model that DNA methylation epigenetically regulates stress, ploidy, hybridization and apomixis, we noted that ASY1, MPS1 and NAC019 homologs were deregulated in Boechera seedlings upon DNA demethylation, and ASY1 in particular seems to be repressed by global DNA

  20. Permian to late Cenozoic evolution of northern Patagonia: Main tectonic events, magmatic activity, and depositional trends

    Science.gov (United States)

    Uliana, M. A.; Biddle, K. T.

    The late Paleozoic to late Cenozoic evolution of northern Patagonia was influenced significantly by events that occurred while the area was part of the South American sector of Gondwanaland. Late Paleozoic to Middle Triassic subduction along the edge of the supercontinent formed a broad convergent-margin system that is the underpinning of northern Patagonia. Deformation (Gondwanidian orogeny) associated with the subduction is recognized in both the forearc and the convergent backarc areas. Regional extension, accompanied by bimodal volcanism, began in the Late Triassic and led to the formation of a number of north-northwest trending rift basins in Patagonia, which generally followed the Gondwanidian basement grain. Continued extension in the Jurassic and Early Cretaceous led to the opening of the Rocas Verdes marginal basin in southern Chile and, ultimately, to the opening of the South Atlantic Ocean. Once oceanic crust began to form, faulting and volcanism declined in Patagonia. During the late Early Cretaceous to the Late Cretaceous, sags over the rift basins coalesced to form a broad backarc basin behind the volcanic arc to the west. These sags are suggestive of thermally driven subsidence. Subsidence of the evolving Atlantic margin allowed extensive marine transgressions to take place from the east. The stratigraphic record of northern Patagonia reflects these events. The upper Paleozoic to upper Mesozoic sedimentary sequences were deposited in basins directly associated with convergent activity along the margin of Gondwanaland or in rift basins created during its breakup. Even though the Tertiary evolution of Patagonia was dominated by events along the western margin of South America, the patterns of sediment transport, thickness, and general shoreline position were still influenced by the locations of the Mesozoic rifts formed during the breakup of Gondwanaland.

  1. Disrupting pre-SMA activity impairs facial happiness recognition: an event-related TMS study.

    Science.gov (United States)

    Rochas, Vincent; Gelmini, Lauriane; Krolak-Salmon, Pierre; Poulet, Emmanuel; Saoud, Mohamed; Brunelin, Jerome; Bediou, Benoit

    2013-07-01

    It has been suggested that the left pre-supplementary motor area (pre-SMA) could be implicated in facial emotion expression and recognition, especially for laughter/happiness. To test this hypothesis, in a single-blind, randomized crossover study, we investigated the impact of transcranial magnetic stimulation (TMS) on performances of 18 healthy participants during a facial emotion recognition task. Using a neuronavigation system based on T1-weighted magnetic resonance imaging of each participant, TMS (5 pulses, 10 Hz) was delivered over the pre-SMA or the vertex (control condition) in an event-related fashion after the presentation of happy, fear, and angry faces. Compared with performances during vertex stimulation, we observed that TMS applied over the left pre-SMA specifically disrupted facial happiness recognition (FHR). No difference was observed between the 2 conditions neither for fear and anger recognition nor for reaction times (RT). Thus, interfering with pre-SMA activity with event-related TMS after stimulus presentation produced a selective impairment in the recognition of happy faces. These findings provide new insights into the functional implication of the pre-SMA in FHR, which may rely on the mirror properties of pre-SMA neurons.

  2. Mild blast events alter anxiety, memory, and neural activity patterns in the anterior cingulate cortex.

    Science.gov (United States)

    Xie, Kun; Kuang, Hui; Tsien, Joe Z

    2013-01-01

    There is a general interest in understanding of whether and how exposure to emotionally traumatizing events can alter memory function and anxiety behaviors. Here we have developed a novel laboratory-version of mild blast exposure comprised of high decibel bomb explosion sound coupled with strong air blast to mice. This model allows us to isolate the effects of emotionally fearful components from those of traumatic brain injury or bodily injury typical associated with bomb blasts. We demonstrate that this mild blast exposure is capable of impairing object recognition memory, increasing anxiety in elevated O-maze test, and resulting contextual generalization. Our in vivo neural ensemble recording reveal that such mild blast exposures produced diverse firing changes in the anterior cingulate cortex, a region processing emotional memory and inhibitory control. Moreover, we show that these real-time neural ensemble patterns underwent post-event reverberations, indicating rapid consolidation of those fearful experiences. Identification of blast-induced neural activity changes in the frontal brain may allow us to better understand how mild blast experiences result in abnormal changes in memory functions and excessive fear generalization related to post-traumatic stress disorder.

  3. Mild blast events alter anxiety, memory, and neural activity patterns in the anterior cingulate cortex.

    Directory of Open Access Journals (Sweden)

    Kun Xie

    Full Text Available There is a general interest in understanding of whether and how exposure to emotionally traumatizing events can alter memory function and anxiety behaviors. Here we have developed a novel laboratory-version of mild blast exposure comprised of high decibel bomb explosion sound coupled with strong air blast to mice. This model allows us to isolate the effects of emotionally fearful components from those of traumatic brain injury or bodily injury typical associated with bomb blasts. We demonstrate that this mild blast exposure is capable of impairing object recognition memory, increasing anxiety in elevated O-maze test, and resulting contextual generalization. Our in vivo neural ensemble recording reveal that such mild blast exposures produced diverse firing changes in the anterior cingulate cortex, a region processing emotional memory and inhibitory control. Moreover, we show that these real-time neural ensemble patterns underwent post-event reverberations, indicating rapid consolidation of those fearful experiences. Identification of blast-induced neural activity changes in the frontal brain may allow us to better understand how mild blast experiences result in abnormal changes in memory functions and excessive fear generalization related to post-traumatic stress disorder.

  4. Augmented supraorbital skin sympathetic nerve activity responses to symptom trigger events in rosacea patients.

    Science.gov (United States)

    Metzler-Wilson, Kristen; Toma, Kumika; Sammons, Dawn L; Mann, Sarah; Jurovcik, Andrew J; Demidova, Olga; Wilson, Thad E

    2015-09-01

    Facial flushing in rosacea is often induced by trigger events. However, trigger causation mechanisms are currently unclear. This study tested the central hypothesis that rosacea causes sympathetic and axon reflex-mediated alterations resulting in trigger-induced symptomatology. Twenty rosacea patients and age/sex-matched controls participated in one or a combination of symptom triggering stressors. In protocol 1, forehead skin sympathetic nerve activity (SSNA; supraorbital microneurography) was measured during sympathoexcitatory mental (2-min serial subtraction of novel numbers) and physical (2-min isometric handgrip) stress. In protocol 2, forehead skin blood flow (laser-Doppler flowmetry) and transepithelial water loss/sweat rate (capacitance hygrometry) were measured during sympathoexcitatory heat stress (whole body heating by perfusing 50°C water through a tube-lined suit). In protocol 3, cheek, forehead, forearm, and palm skin blood flow were measured during nonpainful local heating to induce axon reflex vasodilation. Heart rate (HR) and mean arterial pressure (MAP) were recorded via finger photoplethysmography to calculate cutaneous vascular conductance (CVC; flux·100/MAP). Higher patient transepithelial water loss was observed (rosacea 0.20 ± 0.02 vs. control 0.10 ± 0.01 mg·cm(-2)·min(-1), P rosacea and controls, respectively) stress was augmented in rosacea (both P rosacea compared with controls. No axon reflex vasodilation differences were observed between groups. These data indicate that rosacea affects SSNA and that hyperresponsiveness to trigger events appears to have a sympathetic component.

  5. Hybrid Markov-mass action law for cell activation by rare binding events

    CERN Document Server

    Holcman, C Guerrier D

    2016-01-01

    The binding of molecules, ions or proteins to specific target sites is a generic step for cell activation. However, this step relies on rare events where stochastic particles located in a large bulk are searching for small and often hidden targets and thus remains difficult to study. We present here a hybrid discrete-continuum model where the large ensemble of particles is described by mass-action laws. The rare discrete binding events are modeled by a Markov chain for the encounter of a finite number of small targets by few Brownian particles, for which the arrival time is Poissonian. This model is applied for predicting the time distribution of vesicular release at neuronal synapses that remains elusive. This release is triggered by the binding of few calcium ions that can originate either from the synaptic bulk or from the transient entry through calcium channels. We report that the distribution of release time is bimodal although triggered by a single fast action potential: while the first peak follows a ...

  6. Application of gene expression programming and neural networks to predict adverse events of radical hysterectomy in cervical cancer patients.

    Science.gov (United States)

    Kusy, Maciej; Obrzut, Bogdan; Kluska, Jacek

    2013-12-01

    The aim of this article was to compare gene expression programming (GEP) method with three types of neural networks in the prediction of adverse events of radical hysterectomy in cervical cancer patients. One-hundred and seven patients treated by radical hysterectomy were analyzed. Each record representing a single patient consisted of 10 parameters. The occurrence and lack of perioperative complications imposed a two-class classification problem. In the simulations, GEP algorithm was compared to a multilayer perceptron (MLP), a radial basis function network neural, and a probabilistic neural network. The generalization ability of the models was assessed on the basis of their accuracy, the sensitivity, the specificity, and the area under the receiver operating characteristic curve (AUROC). The GEP classifier provided best results in the prediction of the adverse events with the accuracy of 71.96 %. Comparable but slightly worse outcomes were obtained using MLP, i.e., 71.87 %. For each of measured indices: accuracy, sensitivity, specificity, and the AUROC, the standard deviation was the smallest for the models generated by GEP classifier.

  7. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Directory of Open Access Journals (Sweden)

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  8. Event oriented representation for collaborative activities (EORCA). A method for describing medical activities in severely-injured patient management.

    Science.gov (United States)

    Pellegrin, L; Bonnardel, N; Antonini, F; Albanese, J; Martin, C; Chaudet, H

    2007-01-01

    In this paper, we introduce a method that aims at describing components of medical activities that are performed by a medical team, including physicians and nurses, during patients' management in an ICU (intensive care unit). This method is based on formal task analyses developed in cognitive ergonomics. Our ultimate aim is to build a method covering the observation and the representation of collective activities during patients' management, which should be re-usable by the team members in order to prepare themselves for accreditation. This method comprises two main steps:--the formal observations of medical staff's activities that occur during patient management,--a representation of the findings with regard to an ontology and a temporal flowchart, which describes actors and events related to patient management. This paper describes field studies performed in ICUs. This method has been used for analyzing the management of 24 cases of neurological and multiple traumas. We have represented the different actions of the medical team members (clinicians, nurses and outside medical consultants). The results allow us to identify the specific features of these complex and time-constrained situations, especially about the strong collaborative activities between members of the patient-care teams, especially the interaction between information management and medical actions.

  9. Insulators target active genes to transcription factories and polycomb-repressed genes to polycomb bodies.

    Directory of Open Access Journals (Sweden)

    Hua-Bing Li

    2013-04-01

    Full Text Available Polycomb bodies are foci of Polycomb proteins in which different Polycomb target genes are thought to co-localize in the nucleus, looping out from their chromosomal context. We have shown previously that insulators, not Polycomb response elements (PREs, mediate associations among Polycomb Group (PcG targets to form Polycomb bodies. Here we use live imaging and 3C interactions to show that transgenes containing PREs and endogenous PcG-regulated genes are targeted by insulator proteins to different nuclear structures depending on their state of activity. When two genes are repressed, they co-localize in Polycomb bodies. When both are active, they are targeted to transcription factories in a fashion dependent on Trithorax and enhancer specificity as well as the insulator protein CTCF. In the absence of CTCF, assembly of Polycomb bodies is essentially reduced to those representing genomic clusters of Polycomb target genes. The critical role of Trithorax suggests that stable association with a specialized transcription factory underlies the cellular memory of the active state.

  10. Spatiotemporal cortical activation underlies mental preparation for successful riddle solving: an event-related potential study.

    Science.gov (United States)

    Qiu, Jiang; Li, Hong; Jou, Jerwen; Wu, Zhenzhen; Zhang, Qinglin

    2008-04-01

    Recently, Kounios J, Frymiare JL, Bowden EM, Fleck JI, Subramaniam K, Parrish TB et al. (2006) found that the mental preparation leading to insight involves heightened activity in medial frontal areas and temporal areas. In the present study, the electrophysiological correlates of successful and unsuccessful Chinese logogriph solving (riddles in which writing characters undergo several changes brought about by the addition, subtraction, omission or substitution of strokes or components of the characters) were studied in 18 healthy subjects using high-density event-related potentials (ERPs). Results show that the mental preparation for successful logogriphs elicited a more positive ERP deflection than unsuccessful logogriphs from -1,000 to -800 ms before onset of the target logogriphs. Dipole analysis localized the generators of the positive component primarily in the anterior cingulate cortex (ACC). This result is consistent with Kounios' view that general mental preparatory mechanisms modulate problem-solving strategy.

  11. Mosaicism for FMR1 gene full mutation and intermediate allele in a female foetus: a postzygotic retraction event.

    Science.gov (United States)

    Ferreira, Susana Isabel; Pires, Luís Miguel; Ferrão, José; Sá, Joaquim; Serra, Armando; Carreira, Isabel Marques

    2013-09-15

    Fragile X syndrome is caused by the expansion of an unstable CGG repeat in the 5'UTR of FMR1 gene. The occurrence of mosaicism is not uncommon, especially in male patients, whereas in females it is not so often reported. Here we report a female foetus that was subject to prenatal diagnosis, because of her mother being a premutation carrier. The foetus was identified as being a mosaic for an intermediate allele and a full mutation of FMR1 gene, in the presence of a normal allele. The mosaic status was confirmed in three different tissues of the foetus--amniotic fluid, skin biopsy and blood--the last two obtained after pregnancy termination. Karyotype analysis and X-chromosome STR markers analysis do not support the mosaicism as inheritance of both maternal alleles. Oligonucleotide array-CGH excluded an imbalance that could contain the primer binding site with a different repeat size. The obtained results give compelling evidence for a postzygotic expansion mechanism where the foetus mosaic pattern originated from expansion of the mother's premutation into a full mutation and consequent regression to an intermediate allele in a proportion of cells. These events occurred in early embryogenesis before the commitment of cells into the different tissues, as the three tested tissues of the foetus have the same mosaic pattern. The couple has a son with Fragile X mental retardation syndrome and choose to terminate this pregnancy after genetic counselling.

  12. Evolution of High Cellulolytic Activity in Symbiotic Streptomyces through Selection of Expanded Gene Content and Coordinated Gene Expression.

    Directory of Open Access Journals (Sweden)

    Adam J Book

    2016-06-01

    Full Text Available The evolution of cellulose degradation was a defining event in the history of life. Without efficient decomposition and recycling, dead plant biomass would quickly accumulate and become inaccessible to terrestrial food webs and the global carbon cycle. On land, the primary drivers of plant biomass deconstruction are fungi and bacteria in the soil or associated with herbivorous eukaryotes. While the ecological importance of plant-decomposing microbes is well established, little is known about the distribution or evolution of cellulolytic activity in any bacterial genus. Here we show that in Streptomyces, a genus of Actinobacteria abundant in soil and symbiotic niches, the ability to rapidly degrade cellulose is largely restricted to two clades of host-associated strains and is not a conserved characteristic of the Streptomyces genus or host-associated strains. Our comparative genomics identify that while plant biomass degrading genes (CAZy are widespread in Streptomyces, key enzyme families are enriched in highly cellulolytic strains. Transcriptomic analyses demonstrate that cellulolytic strains express a suite of multi-domain CAZy enzymes that are coregulated by the CebR transcriptional regulator. Using targeted gene deletions, we verify the importance of a highly expressed cellulase (GH6 family cellobiohydrolase and the CebR transcriptional repressor to the cellulolytic phenotype. Evolutionary analyses identify complex genomic modifications that drive plant biomass deconstruction in Streptomyces, including acquisition and selective retention of CAZy genes and transcriptional regulators. Our results suggest that host-associated niches have selected some symbiotic Streptomyces for increased cellulose degrading activity and that symbiotic bacteria are a rich biochemical and enzymatic resource for biotechnology.

  13. Evolution of High Cellulolytic Activity in Symbiotic Streptomyces through Selection of Expanded Gene Content and Coordinated Gene Expression.

    Science.gov (United States)

    Book, Adam J; Lewin, Gina R; McDonald, Bradon R; Takasuka, Taichi E; Wendt-Pienkowski, Evelyn; Doering, Drew T; Suh, Steven; Raffa, Kenneth F; Fox, Brian G; Currie, Cameron R

    2016-06-01

    The evolution of cellulose degradation was a defining event in the history of life. Without efficient decomposition and recycling, dead plant biomass would quickly accumulate and become inaccessible to terrestrial food webs and the global carbon cycle. On land, the primary drivers of plant biomass deconstruction are fungi and bacteria in the soil or associated with herbivorous eukaryotes. While the ecological importance of plant-decomposing microbes is well established, little is known about the distribution or evolution of cellulolytic activity in any bacterial genus. Here we show that in Streptomyces, a genus of Actinobacteria abundant in soil and symbiotic niches, the ability to rapidly degrade cellulose is largely restricted to two clades of host-associated strains and is not a conserved characteristic of the Streptomyces genus or host-associated strains. Our comparative genomics identify that while plant biomass degrading genes (CAZy) are widespread in Streptomyces, key enzyme families are enriched in highly cellulolytic strains. Transcriptomic analyses demonstrate that cellulolytic strains express a suite of multi-domain CAZy enzymes that are coregulated by the CebR transcriptional regulator. Using targeted gene deletions, we verify the importance of a highly expressed cellulase (GH6 family cellobiohydrolase) and the CebR transcriptional repressor to the cellulolytic phenotype. Evolutionary analyses identify complex genomic modifications that drive plant biomass deconstruction in Streptomyces, including acquisition and selective retention of CAZy genes and transcriptional regulators. Our results suggest that host-associated niches have selected some symbiotic Streptomyces for increased cellulose degrading activity and that symbiotic bacteria are a rich biochemical and enzymatic resource for biotechnology.

  14. Effect of variable number of tandem repeats polymorphism in the human dopamine transporter gene on conflict information processing according to event-related potential

    Institute of Scientific and Technical Information of China (English)

    Chunyu Han; Yuping Wang; Xin Wang; Ying Liu

    2010-01-01

    The dopamine transporter(DAT)is responsible for dopamine reuptake from the synaptic cleft.A variable number of tandem repeats polymorphism in the DAT gene is related to DAT availability and has been associated with cognition.With the advantage of high-time resolution,event-related potential is an important method to study the time course of human information processing.Previous results have suggested that dopamine exhibits a close relationship with conflicting information processing.Therefore,the present study assumed that conflicting information processing could be influenced by DAT variable number of tandem repeats polymorphism.To confirm this,the present study analyzed the influence of DAT genotypes on N270,which is presumed to reflect neural activity of conflict information processing in young healthy adults.A S1-S2 matching task was performed in healthy adults with 10/10 genotype(n = 14)and 10/9genotypes(n = 14),respectively,when event-related potentials were recorded.Results demonstrated that subjects with the 10/10 genotype exhibited shorter N270 latency and quicker reaction times compared with subjects with the 10/9 genotype.There were no differences in N270amplitude between the two genotypes.These results suggested that 10/10 genotype subjects more efficiently processed conflict information.

  15. Radiocaesium activity in rape oil and in rape cake after a wet deposition event

    Energy Technology Data Exchange (ETDEWEB)

    Chaiko, Y.; Rappe-George, M.; Bengtsson, S. [Department of Soil and Environment (Sweden)

    2014-07-01

    After a release of radionuclides in agricultural areas there can be concerns on the levels of radionuclides in food products produced. The uptake of radionuclides via the above ground plant parts is a very important transport route into the food chain for humans as caesium is relatively mobile inside plants. In the production of rape oil the use of a processing factor (Pf) is used to estimate the activity concentration of radioactivity in the final oil product based on the activity concentration in rape seeds. The processing factor has been estimated to be 0.004 for caesium in rape oil by IAEA, and is based on a limited numbers of studies (1). In this project we analysed the activity concentration of radiocaesium ({sup 134}Cs) in rape oil and in rape cake from rape seeds contaminated after a wet deposition event with {sup 134}Cs. With the information of activity concentration of {sup 134}Cs in rape oil and in rape cake, we calculated the Pf-value and confirm or suggest new enhanced Pf-value. We analysed the activity concentration of {sup 134}Cs in rape oil and in rape cake from spring oilseed rape seeds (Brassica napus L.) that had been contaminated experimentally by wet deposited {sup 134}Cs in an earlier experiment by Bengtsson et al. (2013). The estimation of activity concentration of {sup 134}Cs in rape oil and in rape cake was achieved by performing extraction of the oil (and other extractable compounds) from the seeds based on the Randall extraction method (Randall, 1974) using petroleum ether as extraction chemical. The extracted oil and the rape cake samples were weighed and the activity concentration was measured with High-Purity Germanium (HPGe) detectors. Pf-values were calculated by dividing the measured activity concentration in rape oil after extraction by the activity concentration in oilseed rape seeds before extraction. Results from the present study will be presented at the international conference on radioecology and environmental radioactivity

  16. Adaptation of muscle gene expression to changes in contractile activity

    Science.gov (United States)

    Booth, F. W.; Babij, P.; Thomason, D. B.; Wong, T. S.; Morrison, P. R.

    1987-01-01

    A review of the existing literature regarding the effects of different types of physical activities on the gene expression of adult skeletal muscles leads us to conclude that each type of exercise training program has, as a result, a different phenotype, which means that there are multiple mechanisms, each producing a unique phenotype. A portion of the facts which support this position is presented and interpreted here. [Abstract translated from the original French by NASA].

  17. Event-Associated Oxygen Consumption Rate Increases ca. Five-Fold When Interictal Activity Transforms into Seizure-Like Events In Vitro

    Directory of Open Access Journals (Sweden)

    Karl Schoknecht

    2017-09-01

    Full Text Available Neuronal injury due to seizures may result from a mismatch of energy demand and adenosine triphosphate (ATP synthesis. However, ATP demand and oxygen consumption rates have not been accurately determined, yet, for different patterns of epileptic activity, such as interictal and ictal events. We studied interictal-like and seizure-like epileptiform activity induced by the GABAA antagonist bicuculline alone, and with co-application of the M-current blocker XE-991, in rat hippocampal slices. Metabolic changes were investigated based on recording partial oxygen pressure, extracellular potassium concentration, and intracellular flavine adenine dinucleotide (FAD redox potential. Recorded data were used to calculate oxygen consumption and relative ATP consumption rates, cellular ATP depletion, and changes in FAD/FADH2 ratio by applying a reactive-diffusion and a two compartment metabolic model. Oxygen-consumption rates were ca. five times higher during seizure activity than interictal activity. Additionally, ATP consumption was higher during seizure activity (~94% above control than interictal activity (~15% above control. Modeling of FAD transients based on partial pressure of oxygen recordings confirmed increased energy demand during both seizure and interictal activity and predicted actual FAD autofluorescence recordings, thereby validating the model. Quantifying metabolic alterations during epileptiform activity has translational relevance as it may help to understand the contribution of energy supply and demand mismatches to seizure-induced injury.

  18. Event-Associated Oxygen Consumption Rate Increases ca. Five-Fold When Interictal Activity Transforms into Seizure-Like Events In Vitro.

    Science.gov (United States)

    Schoknecht, Karl; Berndt, Nikolaus; Rösner, Jörg; Heinemann, Uwe; Dreier, Jens P; Kovács, Richard; Friedman, Alon; Liotta, Agustin

    2017-09-07

    Neuronal injury due to seizures may result from a mismatch of energy demand and adenosine triphosphate (ATP) synthesis. However, ATP demand and oxygen consumption rates have not been accurately determined, yet, for different patterns of epileptic activity, such as interictal and ictal events. We studied interictal-like and seizure-like epileptiform activity induced by the GABAA antagonist bicuculline alone, and with co-application of the M-current blocker XE-991, in rat hippocampal slices. Metabolic changes were investigated based on recording partial oxygen pressure, extracellular potassium concentration, and intracellular flavine adenine dinucleotide (FAD) redox potential. Recorded data were used to calculate oxygen consumption and relative ATP consumption rates, cellular ATP depletion, and changes in FAD/FADH₂ ratio by applying a reactive-diffusion and a two compartment metabolic model. Oxygen-consumption rates were ca. five times higher during seizure activity than interictal activity. Additionally, ATP consumption was higher during seizure activity (~94% above control) than interictal activity (~15% above control). Modeling of FAD transients based on partial pressure of oxygen recordings confirmed increased energy demand during both seizure and interictal activity and predicted actual FAD autofluorescence recordings, thereby validating the model. Quantifying metabolic alterations during epileptiform activity has translational relevance as it may help to understand the contribution of energy supply and demand mismatches to seizure-induced injury.

  19. Control of gene expression during T cell activation: alternate regulation of mRNA transcription and mRNA stability

    Directory of Open Access Journals (Sweden)

    Gorospe Myriam

    2005-05-01

    Full Text Available Abstract Background Microarray technology has become highly valuable for identifying complex global changes in gene expression patterns. The effective correlation of observed changes in gene expression with shared transcription regulatory elements remains difficult to demonstrate convincingly. One reason for this difficulty may result from the intricate convergence of both transcriptional and mRNA turnover events which, together, directly influence steady-state mRNA levels. Results In order to investigate the relative contribution of gene transcription and changes in mRNA stability regulation to standard analyses of gene expression, we used two distinct microarray methods which individually measure nuclear gene transcription and changes in polyA mRNA gene expression. Gene expression profiles were obtained from both polyA mRNA (whole-cell and nuclear run-on (newly transcribed RNA across a time course of one hour following the activation of human Jurkat T cells with PMA plus ionomycin. Comparative analysis revealed that regulation of mRNA stability may account for as much as 50% of all measurements of changes in polyA mRNA in this system, as inferred by the absence of any corresponding regulation of nuclear gene transcription activity for these groups of genes. Genes which displayed dramatic elevations in both mRNA and nuclear run-on RNA were shown to be inhibited by Actinomycin D (ActD pre-treatment of cells while large numbers of genes regulated only through altered mRNA turnover (both up and down were ActD-resistant. Consistent patterns across the time course were observed for both transcribed and stability-regulated genes. Conclusion We propose that regulation of mRNA stability contributes significantly to the observed changes in gene expression in response to external stimuli, as measured by high throughput systems.

  20. Coordination activities of human planners during rescheduling : case analysis and event handling procedure

    NARCIS (Netherlands)

    de Snoo, C.; van Wezel, W.M.C.; Wortmann, J.C.; Gaalman, G.J.C.

    2011-01-01

    This paper addresses the process of event handling and rescheduling in manufacturing practice. Firms are confronted with many diverse events, such as new or changed orders, machine breakdowns, and material shortages. These events influence the feasibility and optimality of schedules, and thus induce

  1. 78 FR 71620 - Agency Information Collection Activities; Proposed Collection; Comment Request; Adverse Event...

    Science.gov (United States)

    2013-11-29

    ... Collection; Comment Request; Adverse Event Program for Medical Products AGENCY: Food and Drug Administration... solicits comments on the collection of information regarding the Adverse Event Program for medical devices... techniques, when appropriate, and other forms of information technology. Adverse Event Program for Medical...

  2. Differentially expressed genes in embryonic cardiac tissues of mice lacking Folr1 gene activity

    Directory of Open Access Journals (Sweden)

    Schwartz Robert J

    2007-11-01

    motility as well as cellular redox status, which may contribute to cardiovascular abnormalities in mouse embryos lacking Folr1 gene activity.

  3. How activation, entanglement, and searching a semantic network contribute to event memory.

    Science.gov (United States)

    Nelson, Douglas L; Kitto, Kirsty; Galea, David; McEvoy, Cathy L; Bruza, Peter D

    2013-08-01

    Free-association norms indicate that words are organized into semantic/associative neighborhoods within a larger network of words and links that bind the net together. We present evidence indicating that memory for a recent word event can depend on implicitly and simultaneously activating related words in its neighborhood. Processing a word during encoding primes its network representation as a function of the density of the links in its neighborhood. Such priming increases recall and recognition and can have long-lasting effects when the word is processed in working memory. Evidence for this phenomenon is reviewed in extralist-cuing, primed free-association, intralist-cuing, and single-item recognition tasks. The findings also show that when a related word is presented in order to cue the recall of a studied word, the cue activates the target in an array of related words that distract and reduce the probability of the target's selection. The activation of the semantic network produces priming benefits during encoding, and search costs during retrieval. In extralist cuing, recall is a negative function of cue-to-distractor strength, and a positive function of neighborhood density, cue-to-target strength, and target-to-cue strength. We show how these four measures derived from the network can be combined and used to predict memory performance. These measures play different roles in different tasks, indicating that the contribution of the semantic network varies with the context provided by the task. Finally, we evaluate spreading-activation and quantum-like entanglement explanations for the priming effects produced by neighborhood density.

  4. Wavelet based automated postural event detection and activity classification with single imu - biomed 2013.

    Science.gov (United States)

    Lockhart, Thurmon E; Soangra, Rahul; Zhang, Jian; Wu, Xuefan

    2013-01-01

    Mobility characteristics associated with activity of daily living such as sitting down, lying down, rising up, and walking are considered to be important in maintaining functional independence and healthy life style especially for the growing elderly population. Characteristics of postural transitions such as sit-to-stand are widely used by clinicians as a physical indicator of health, and walking is used as an important mobility assessment tool. Many tools have been developed to assist in the assessment of functional levels and to detect a person’s activities during daily life. These include questionnaires, observation, diaries, kinetic and kinematic systems, and validated functional tests. These measures are costly and time consuming, rely on subjective patient recall and may not accurately reflect functional ability in the patient’s home. In order to provide a low-cost, objective assessment of functional ability, inertial measurement unit (IMU) using MEMS technology has been employed to ascertain ADLs. These measures facilitate long-term monitoring of activity of daily living using wearable sensors. IMU system are desirable in monitoring human postures since they respond to both frequency and the intensity of movements and measure both dc (gravitational acceleration vector) and ac (acceleration due to body movement) components at a low cost. This has enabled the development of a small, lightweight, portable system that can be worn by a free-living subject without motion impediment – TEMPO (Technology Enabled Medical Precision Observation). Using this IMU system, we acquired indirect measures of biomechanical variables that can be used as an assessment of individual mobility characteristics with accuracy and recognition rates that are comparable to the modern motion capture systems. In this study, five subjects performed various ADLs and mobility measures such as posture transitions and gait characteristics were obtained. We developed postural event detection

  5. Attribution of extreme events in the western US to human activities

    Science.gov (United States)

    Mera, R. J.

    2015-12-01

    A project to investigate the role of human activities on the changing nature of extreme events in the western US began as part of a CLIVAR-sponsored Postdocs Applying Climate Expertise (PACE) project. The climate institution was the Oregon State University and the application partner was the Oregon Department of Land Conservation and Development (DLCD). DLCD was interested in the changes in weather extremes in the Pacific Northwest, specifically extreme rainfall, flooding, and droughts. The project employs very large ensembles of regional model simulations through volunteer computing resources and allows for probabilistic event attribution (PEA), an important climate research technique. The model was found to have good representation of atmospheric rivers, a major source of extreme precipitation in the Pacific Northwest. The model domain also encompasses California and Nevada. One of the studies focused on attribution of extreme heat in relation to vulnerable populations in California's Central Valley, where heat waves have become progressively more severe due to increasing nighttime temperatures. Specifically, we found that that (1) simulations of the hottest summer days during the 2000s were twice as likely to occur using observed levels of greenhouse gases than in a counterfactual world without major human activities, (2) detrimental impacts of heat on public health-relevant variables, such as the number of days above 40°C, can be quantified and attributed to human activities using PEA, and (3) PEA can serve as a tool for addressing climate justice concerns of populations within developed nations. The research conducted through the PACE program has also provided a framework for a pioneering climate attribution study at the Union of Concerned Scientists (UCS). The UCS project takes advantage of new research that shows that nearly two-thirds of carbon pollution released into the atmosphere, reported as carbon dioxide equivalent with hundred-year global warming

  6. Computational inference of replication and transcription activator regulator activity in herpesvirus from gene expression data

    OpenAIRE

    Recchia, A; Wit, E; Vinciotti, V; Kellam, P

    2008-01-01

    One of the main aims of system biology is to understand the structure and dynamics of genomic systems. A computational approach, facilitated by new technologies for high-throughput quantitative experimental data, is put forward to investigate the regulatory system of dynamic interaction among genes in Kaposi's sarcoma-associated herpesvirus network after induction of lytic replication. A reconstruction of transcription factor activity and gene-regulatory kinetics using data from a time-course...

  7. Immune Activities of Polycationic Vectors for Gene Delivery

    Directory of Open Access Journals (Sweden)

    Xiaotian Zhao

    2017-08-01

    Full Text Available Polycationic vectors are used widely in the field of gene delivery, while currently their immune activities in vivo are poorly understood. In this comprehensive review, we aim to present an overview of existing mechanisms of adverse immune responses induced by the polycation/gene complexes, which includes the polycations themselves, the gene sequences and the ROS produced by them. These causes can induce pro-inflammatory cytokines, hypersensitivity as well as the activation of toll-like receptors, and finally the immunostimulation occur. In addition, we introduce some different opinions and research results on the immunogenicity of classical polycations such as polylysine (PLL, polyethyleneimine (PEI, polyamidoamine dendrimers (PAMAM, chitosan and gelatin, most of which have immunogenicity and can induce immunoreactions in vivo. The methods now used to adjust their immunogenicity are shown in the final part of this review. Nowadays, there is still no accurate conclusion on immunogenicity of polycations, which confuses researchers seriously in in vivo test. We conclude that further research is needed in order to skillfully utilize or inhibit the immunogenicity of these polycationic vectors.

  8. Nuclear localisation sequence templated nonviral gene delivery vectors: investigation of intracellular trafficking events of LMD and LD vector systems.

    Science.gov (United States)

    Keller, Michael; Harbottle, Richard P; Perouzel, Eric; Colin, Morvane; Shah, Imran; Rahim, Ahad; Vaysse, Laurence; Bergau, Anna; Moritz, Sylviane; Brahimi-Horn, Christiane; Coutelle, Charles; Miller, Andrew D

    2003-04-04

    The impact of a peptide that contains a nuclear localisation sequence (NLS) on intracellular DNA trafficking was studied. We used the adenoviral core peptide mu and an SV40 NLS peptide to condense plasmid DNA (pDNA) prior to formulation with 3beta-[N-(N', N'-dimethylaminoethane)carbamoyl]cholesterol/dioleoyl-L-alpha-phosphatidyl ethanolamine (DC-Chol/DOPE) liposomes to give LMD and LND vectors, respectively. Fluorescent-labelled lipid and peptides plus dye-labelled pDNA components were used to investigate gene delivery in dividing and S-phase growth-arrested cells. Confocal microscopic analyses reveal little difference in intracellular trafficking events. Strikingly, mu peptide associates with nuclei and nucleoli of cells within less than 15 mins incubation of LMD with cells, which suggests that mu peptide has an NLS function. These NLS properties were confirmed by cloning of a mu-beta-galactosidase fusion protein that localises in the nuclei of cells after cytosolic translation. In dividing cells both LMD and LND deliver pDNA(Cy3) to nuclei within 30-45 min incubation with cells. By contrast, pDNA is detected only in the cytoplasm in growth-arrested cells over the period of time investigated, and not in the nuclei. LD systems prepared from DC-Chol/DOPE cationic liposomes and pDNA(Cy3) behave similarly to LMD systems, which suggests that mu peptide is unable to influence trafficking events in this current LMD formulation, in spite of its strong NLS capacity. We further describe the effect of polyethyleneglycol (PEG) on cellular uptake. "Stealth" systems obtained by post-coating LMD particles with fluorescent-labelled PEG molecules (0.5, 5 and 10 mol % fluorescein-PEG(5000)-N-hydroxysuccinimide) were prepared and shown to be internalised rapidly (mins) by cells, without detectable transgene expression. This result indicates that PEG blocks intracellular trafficking of pDNA.

  9. Increased anion channel activity is an unavoidable event in ozone-induced programmed cell death.

    Directory of Open Access Journals (Sweden)

    Takashi Kadono

    Full Text Available BACKGROUND: Ozone is a major secondary air pollutant often reaching high concentrations in urban areas under strong daylight, high temperature and stagnant high-pressure systems. Ozone in the troposphere is a pollutant that is harmful to the plant. PRINCIPAL FINDINGS: By exposing cells to a strong pulse of ozonized air, an acute cell death was observed in suspension cells of Arabidopsis thaliana used as a model. We demonstrated that O(3 treatment induced the activation of a plasma membrane anion channel that is an early prerequisite of O(3-induced cell death in A. thaliana. Our data further suggest interplay of anion channel activation with well known plant responses to O(3, Ca(2+ influx and NADPH-oxidase generated reactive oxygen species (ROS in mediating the oxidative cell death. This interplay might be fuelled by several mechanisms in addition to the direct ROS generation by O(3; namely, H(2O(2 generation by salicylic and abscisic acids. Anion channel activation was also shown to promote the accumulation of transcripts encoding vacuolar processing enzymes, a family of proteases previously reported to contribute to the disruption of vacuole integrity observed during programmed cell death. SIGNIFICANCE: Collectively, our data indicate that anion efflux is an early key component of morphological and biochemical events leading to O(3-induced programmed cell death. Because ion channels and more specifically anion channels assume a crucial position in cells, an understanding about the underlying role(s for ion channels in the signalling pathway leading to programmed cell death is a subject that warrants future investigation.

  10. CNR1 gene is associated with high neuroticism and low agreeableness and interacts with recent negative life events to predict current depressive symptoms.

    Science.gov (United States)

    Juhasz, Gabriella; Chase, Diana; Pegg, Emma; Downey, Darragh; Toth, Zoltan G; Stones, Kathryn; Platt, Hazel; Mekli, Krisztina; Payton, Antony; Elliott, Rebecca; Anderson, Ian M; Deakin, J F William

    2009-07-01

    Cannabinoid receptor 1 (CB1) gene (CNR1) knockout mice are prone to develop anhedonic and helpless behavior after chronic mild stress. In humans, the CB1 antagonist rimonabant increases the risk of depressed mood disorders and anxiety. These studies suggest the hypothesis that genetic variation in CB1 receptor function influences the risk of depression in humans in response to stressful life events. In a population sample (n=1269), we obtained questionnaire measures of personality (Big Five Inventory), depression and anxiety (Brief Symptom Inventory), and life events. The CNR1 gene was covered by 10 SNPs located throughout the gene to determine haplotypic association. Variations in the CNR1 gene were significantly associated with a high neuroticism and low agreeableness phenotype (explained variance 1.5 and 2.5%, respectively). Epistasis analysis of the SNPs showed that the previously reported functional 5' end of the CNR1 gene significantly interacts with the 3' end in these phenotypes. Furthermore, current depression scores significantly associated with CNR1 haplotypes but this effect diminished after covariation for recent life events, suggesting a gene x environment interaction. Indeed, rs7766029 showed highly significant interaction between recent negative life events and depression scores. The results represent the first evidence in humans that the CNR1 gene is a risk factor for depression--and probably also for co-morbid psychiatric conditions such as substance use disorders--through a high neuroticism and low agreeableness phenotype. This study also suggests that the CNR1 gene influences vulnerability to recent psychosocial adversity to produce current symptoms of depression.

  11. Accuracy and Adoption of Wearable Technology Used by Active Citizens: A Marathon Event Field Study

    Science.gov (United States)

    Suleder, Julian; Zowalla, Richard

    2017-01-01

    Background Today, runners use wearable technology such as global positioning system (GPS)–enabled sport watches to track and optimize their training activities, for example, when participating in a road race event. For this purpose, an increasing amount of low-priced, consumer-oriented wearable devices are available. However, the variety of such devices is overwhelming. It is unclear which devices are used by active, healthy citizens and whether they can provide accurate tracking results in a diverse study population. No published literature has yet assessed the dissemination of wearable technology in such a cohort and related influencing factors. Objective The aim of this study was 2-fold: (1) to determine the adoption of wearable technology by runners, especially “smart” devices and (2) to investigate on the accuracy of tracked distances as recorded by such devices. Methods A pre-race survey was applied to assess which wearable technology was predominantly used by runners of different age, sex, and fitness level. A post-race survey was conducted to determine the accuracy of the devices that tracked the running course. Logistic regression analysis was used to investigate whether age, sex, fitness level, or track distance were influencing factors. Recorded distances of different device categories were tested with a 2-sample t test against each other. Results A total of 898 pre-race and 262 post-race surveys were completed. Most of the participants (approximately 75%) used wearable technology for training optimization and distance recording. Females (P=.02) and runners in higher age groups (50-59 years: P=.03; 60-69 years: Pphones with combined app (mean absolute error, MAE=0.35 km) and GPS-enabled sport watches (MAE=0.12 km) was significantly different (P=.002) for the half-marathon event. Conclusions A great variety of vendors (n=36) and devices (n=156) were identified. Under real-world conditions, GPS-enabled devices, especially sport watches and mobile

  12. Three faces of recombination activating gene 1 (RAG1) mutations.

    Science.gov (United States)

    Patiroglu, Turkan; Akar, Himmet Haluk; Van Der Burg, Mirjam

    2015-12-01

    Severe combined immune deficiency (SCID) is a group of genetic disorder associated with development of T- and/or B-lymphocytes. Recombination-activating genes (RAG1/2) play a critical role on VDJ recombination process that leads to the production of a broad T-cell receptor (TCR) and B-cell receptor (BCR) repertoire in the development of T and B cells. RAG1/2 genes mutations result in various forms of primary immunodeficiency, ranging from classic SCID to Omenn syndrome (OS) to atypical SCID with such as granuloma formation and autoimmunity. Herein, we reported 4 patients with RAG1 deficiency: classic SCID was seen in two patients who presented with recurrent pneumonia and chronic diarrhoea, and failure to thrive. OS was observed in one patient who presented with chronic diarrhoea, skin rash, recurrent lower respiratory infections, and atypical SCID was seen in one patient who presented with Pyoderma gangrenosum (PG) and had novel RAG1 mutation.

  13. Ultrastructural localization of active genes in Allium cepa cells

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    By using the anti-RNA/DNA hybrid antibody as the probe, we labeled and analyzed the precise transcriptional sites of active genes in Allium cepa cells in situ. The results showed that the location of labeled signals appeared in mitochondrion was the same as that in chloroplast, generally concentrated at the central matrix space where there were no cristae and thylakoids. In the extranucleolar regions of nucleus, the labeled signals of transcriptional sites were situated at the perichromatin fibrils, which decondensed and stretched out from the chromosome territories. Our results also displayed the concentrations of labeled signals in a cer-tain region of nucleus, and this means that the gene tran-scription rich region actually existed in Allium cepa cells. In nucleolus, the synthetic sites of rRNA were localized not only to the periphery of fibrillar centers but also to the DFC near FC.

  14. Drosophila Hox and sex-determination genes control segment elimination through EGFR and extramacrochetae activity.

    Directory of Open Access Journals (Sweden)

    David Foronda

    Full Text Available The formation or suppression of particular structures is a major change occurring in development and evolution. One example of such change is the absence of the seventh abdominal segment (A7 in Drosophila males. We show here that there is a down-regulation of EGFR activity and fewer histoblasts in the male A7 in early pupae. If this activity is elevated, cell number increases and a small segment develops in the adult. At later pupal stages, the remaining precursors of the A7 are extruded under the epithelium. This extrusion requires the up-regulation of the HLH protein Extramacrochetae and correlates with high levels of spaghetti-squash, the gene encoding the regulatory light chain of the non-muscle myosin II. The Hox gene Abdominal-B controls both the down-regulation of spitz, a ligand of the EGFR pathway, and the up-regulation of extramacrochetae, and also regulates the transcription of the sex-determining gene doublesex. The male Doublesex protein, in turn, controls extramacrochetae and spaghetti-squash expression. In females, the EGFR pathway is also down-regulated in the A7 but extramacrochetae and spaghetti-squash are not up-regulated and extrusion of precursor cells is almost absent. Our results show the complex orchestration of cellular and genetic events that lead to this important sexually dimorphic character change.

  15. Determination of Activation Energy of Relaxation Events in Composite Solid Propellants by Dynamic Mechanical Analysis

    Directory of Open Access Journals (Sweden)

    B. K Bihari

    2014-03-01

    Full Text Available The shelf life of a composite solid propellant is one of the critical aspects for the usage of solid propellants. To assess the ageing behavior of the composite solid propellant, the activation energy is a key parameter. The activation energy is determined by analysis of visco-elastic response of the composite solid propellant when subjected to sinusoidal excitation. In the present study, dynamic mechanical analyzer was used to characterize six different types of propellants based on hydroxyl terminated polybutadiene, aluminium, ammonium perchlorate cured with toluene diisocyanate having burning rates varying from 5 mm/s to 25 mm/s at 7000 kPa. Each propellant sample was given a multi-frequency strain of 0.01 percent at three discrete frequencies (3.5 Hz, 11 Hz, 35 Hz in the temperature range -80 °C to + 80 °C. It was observed that all the propellants have shown two relaxation events (α- and β- transition in the temperature range -80 °C to +80 °C. The α-transition was observed between -66 °C and -51 °C and β-transition between 7 °C and 44 °C for the propellants studied. The activation energy for both transitions was determined by Arrhenius plot from dynamic properties measured at different frequencies and also by time temperature superposition principle using Williams-Landel-Ferry and Arrhenius temperature dependence equations. The data reveal that the activation energy corresponding to α-transition varies from 90 kJ/mol to 125 kJ/mol for R-value between 0.7 to 0.9 while for β-transition the values are from 75 kJ/mol to 92 kJ/mol. The activation energy corresponding to β-transition may be used to predict the useful life of solid propellant.Defence Science Journal, 2014, 64(2, pp. 173-178. DOI: http://dx.doi.org/10.14429/dsj.64.3818

  16. Regulator of complement activation (RCA) gene cluster in Xenopus tropicalis.

    Science.gov (United States)

    Oshiumi, Hiroyuki; Suzuki, Yuzuru; Matsumoto, Misako; Seya, Tsukasa

    2009-05-01

    Genome and expressed sequence tag information of Xenopus tropicalis suggested that short-consensus repeat (SCR)-containing proteins are encoded by three genes that are mapped within a 300-kb downstream of PFKFB2, which is a marker gene for the regulator of complement activation (RCA) loci in human and chicken. Based on this observation, we cloned the three cDNAs of these proteins using 3'- or 5'-RACE technique. Since their primary structures and locations of the proximity to the PFKFB2 locus, we named them amphibian RCA protein (ARC) 1, 2, and 3. Expression in human HEK293 or CHO cells suggested that ARC1 is a soluble protein of Mr approximately 67 kDa, ARC2 is a membrane protein with Mr 44 kDa, and ARC3 a secretary protein with a putative transmembrane region. They were N-glycosylated during maturation. In human and chicken RCA clusters, the order in which genes for soluble, GPI-anchored, and membrane forms of SCR proteins are arranged is from the distant to proximity to the PFKFB2 gene. However, the amphibian ARC1, 2, and 3 resembled one another and did not reflect the same order found in human and chicken RCA genes. This may be due to self-duplication of ARCs to form a family, and it evolved after the amphibia separated from the ancestor of the amniotes, which possessed soluble, GPI-anchored, and membrane forms of SCR protein members. Taken together, frog possesses a RCA locus, but the constitution of the ARC proteins differs from that of the amniotes with a unique self-resemblance.

  17. Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression

    Directory of Open Access Journals (Sweden)

    E. Teodorov

    2012-10-01

    Full Text Available The periaqueductal gray (PAG has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc or 0.9% saline (up to 1 mL/kg and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05 because a lower percentage of kappa group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR. A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05 and lactating female rats (P < 0.01, with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in

  18. Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Teodorov, E. [Centro de Matemática, Computação e Cognição, Universidade Federal do ABC, São Paulo, SP (Brazil); Ferrari, M.F.R. [Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Fior-Chadi, D.R. [Departamento de Fisiologia, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Camarini, R. [Departamento de Farmacologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, SP (Brazil); Felício, L.F. [Departamento de Patologia, Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo, São Paulo, SP (Brazil)

    2012-06-01

    The periaqueductal gray (PAG) has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc) or 0.9% saline (up to 1 mL/kg) and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05) because a lower percentage of U69593 group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR). A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05) and lactating female rats (P < 0.01), with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in female

  19. Mechanisms guiding Polycomb activities during gene silencing in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Chongsheng eHe

    2013-11-01

    Full Text Available Polycomb group (PcG proteins act in an evolutionarily conserved epigenetic pathway that regulates chromatin structures in plants and animals, repressing many developmentally important genes by modifying histones. PcG proteins can form at least two multiprotein complexes: Polycomb repressive complexes 1 and 2 (PRC1 and PRC2, respectively. The functions of Arabidopsis thaliana PRCs have been characterized in multiple stages of development and have diverse roles in response to environmental stimuli. Recently, the mechanism that precisely regulates Arabidopsis PcG activity was extensively studied. In this review, we summarize recent discoveries in the regulations of PcG at the three different layers: the recruitment of PRCs to specific target loci, the polyubiquitination and degradation of PRC2, and the antagonism of PRC2 activity by the Trithorax group proteins. Current knowledge indicates that the powerful activity of the PcG pathway is strictly controlled for specific silencing of target genes during plant development and in response to environmental stimuli.

  20. Combating oncogene activation associated with retrovirus-mediated gene therapy of X-linked severe combined immunodeficiency

    Directory of Open Access Journals (Sweden)

    B.E. Strauss

    2007-05-01

    Full Text Available A successful gene therapy clinical trial that also encountered serious adverse effects has sparked extensive study and debate about the future directions for retrovirus-mediated interventions. Treatment of X-linked severe combined immunodeficiency with an oncoretrovirus harboring a normal copy of the gc gene was applied in two clinical trials, essentially curing 13 of 16 infants, restoring a normal immune system without the need for additional immune-related therapies. Approximately 3 years after their gene therapy, tragically, 3 of these children, all from the same trial, developed leukemia as a result of this experimental treatment. The current understanding of the mechanism behind this leukemogenesis involves three critical and cooperating factors, i.e., viral integration, oncogene activation, and the function of the therapeutic gene. In this review, we will explore the causes of this unwanted event and some of the possibilities for reducing the risk of its reoccurrence.

  1. Renal Primordia Activate Kidney Regenerative Events in a Rat Model of Progressive Renal Disease

    Science.gov (United States)

    Imberti, Barbara; Corna, Daniela; Rizzo, Paola; Xinaris, Christodoulos; Abbate, Mauro; Longaretti, Lorena; Cassis, Paola; Benedetti, Valentina; Benigni, Ariela; Zoja, Carlamaria; Remuzzi, Giuseppe; Morigi, Marina

    2015-01-01

    New intervention tools for severely damaged kidneys are in great demand to provide patients with a valid alternative to whole organ replacement. For repairing or replacing injured tissues, emerging approaches focus on using stem and progenitor cells. Embryonic kidneys represent an interesting option because, when transplanted to sites such as the renal capsule of healthy animals, they originate new renal structures. Here, we studied whether metanephroi possess developmental capacity when transplanted under the kidney capsule of MWF male rats, a model of spontaneous nephropathy. We found that six weeks post-transplantation, renal primordia developed glomeruli and tubuli able to filter blood and to produce urine in cyst-like structures. Newly developed metanephroi were able to initiate a regenerative-like process in host renal tissues adjacent to the graft in MWF male rats as indicated by an increase in cell proliferation and vascular density, accompanied by mRNA and protein upregulation of VEGF, FGF2, HGF, IGF-1 and Pax-2. The expression of SMP30 and NCAM was induced in tubular cells. Oxidative stress and apoptosis markedly decreased. Our study shows that embryonic kidneys generate functional nephrons when transplanted into animals with severe renal disease and at the same time activate events at least partly mimicking those observed in kidney tissues during renal regeneration. PMID:25811887

  2. Event based neutron activation spectroscopy and analysis algorithm using MLE and metaheuristics

    Directory of Open Access Journals (Sweden)

    Wallace Barton

    2014-03-01

    Full Text Available Techniques used in neutron activation analysis are often dependent on the experimental setup. In the context of developing a portable and high efficiency detection array, good energy resolution and half-life discrimination are difficult to obtain with traditional methods [1] given the logistic and financial constraints. An approach different from that of spectrum addition and standard spectroscopy analysis [2] was needed. The use of multiple detectors prompts the need for a flexible storage of acquisition data to enable sophisticated post processing of information. Analogously to what is done in heavy ion physics, gamma detection counts are stored as two-dimensional events. This enables post-selection of energies and time frames without the need to modify the experimental setup. This method of storage also permits the use of more complex analysis tools. Given the nature of the problem at hand, a light and efficient analysis code had to be devised. A thorough understanding of the physical and statistical processes [3] involved was used to create a statistical model. Maximum likelihood estimation was combined with metaheuristics to produce a sophisticated curve-fitting algorithm. Simulated and experimental data were fed into the analysis code prompting positive results in terms of half-life discrimination, peak identification and noise reduction. The code was also adapted to other fields of research such as heavy ion identification of the quasi-target (QT and quasi-particle (QP. The approach used seems to be able to translate well into other fields of research.

  3. Life-threatening event reduces subjective well-being through activating avoidance motivation: a longitudinal study.

    Science.gov (United States)

    Van Dijk, Dina; Seger-Guttmann, Tali; Heller, Daniel

    2013-04-01

    Drawing on the approach-avoidance theory, we have examined the role of avoidance motivation in explaining the negative effects of a life-threatening event on subjective well-being (SWB). Residents of the south of Israel were surveyed during heavy missile attacks in January 2009 (T1; n = 283), and again after 6 months (T2; n = 212) and 1 year (T3; n = 154). During the missile attacks, we also surveyed a group from the center of the country (T1; n = 102), not exposed to the attacks. The results indicate that avoidance motivation was activated by the life threat and further mediated its detrimental influence on SWB measures (positive/negative affects, anxiety, and subjective health). Moreover, within the southern sample, the drop in avoidance motivation over time mediated the parallel drop in SWB. In contrast to avoidance motivation, approach motivation remained stable over time and was related to positive emotions. The role of avoidance and approach motivations in life-threatening situations is further discussed. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  4. Altered gene expression in T-cell receptor signalling in peripheral blood leucocytes in acute coronary syndrome predicts secondary coronary events

    Science.gov (United States)

    Takashima, Shin-ichiro; Usui, Soichiro; Kurokawa, Keisuke; Kitano, Teppei; Kato, Takeshi; Murai, Hisayoshi; Furusho, Hiroshi; Oda, Hiroyuki; Maruyama, Michiro; Nagata, Yoshiki; Usuda, Kazuo; Kubota, Koji; Takeshita, Yumie; Sakai, Yoshio; Honda, Masao; Kaneko, Shuichi; Takamura, Masayuki

    2016-01-01

    Objective Comprehensive profiling of gene expression in peripheral blood leucocytes (PBLs) in patients with acute coronary syndrome (ACS) as a prognosticator is needed. We explored the specific profile of gene expression in PBLs in ACS for long-term risk stratification. Methods 30 patients with ACS who underwent primary percutaneous coronary intervention (PCI) and 15 age-matched adults who participated in medical check-ups were enrolled from three centres. Peripheral blood samples were collected to extract RNA for microarray analyses. Results During the 5-year follow-up, 36% of this cohort developed the expected non-fatal coronary events (NFEs) of target lesion revascularisation (TLR) and PCI for a de novo lesion. Class comparison analysis (p<0.005) demonstrated that 83 genes among 7785 prefiltered genes (41 upregulated vs 42 downregulated genes) were extracted to classify the patients according to the occurrence of NFE. Pathway analysis based on gene ontology revealed that the NFEs were associated with altered gene expression regarding the T-cell receptor signalling pathway in ACS. Univariate t test showed that the expression level of death-associated protein kinase1 (DAPK1), known to regulate inflammation, was the most significantly negatively regulated gene in the event group (0.61-fold, p<0.0005). Kaplan-Meier curve analysis and multivariate analysis adjusted for baseline characteristics or clinical biomarkers demonstrated that lower DAPK1 expression in PBL emerged as an independent risk factor for the NFEs (HR: 8.73; CI 1.05 to 72.8, p=0.045). Conclusions Altered gene expression in T-cell receptor signalling in PBL in ACS could be a prognosticator for secondary coronary events. Trial registration number UMIN000001932; Results. PMID:27403330

  5. WRKY Transcription Factors Involved in Activation of SA Biosynthesis Genes

    Directory of Open Access Journals (Sweden)

    Bol John F

    2011-05-01

    Full Text Available Abstract Background Increased defense against a variety of pathogens in plants is achieved through activation of a mechanism known as systemic acquired resistance (SAR. The broad-spectrum resistance brought about by SAR is mediated through salicylic acid (SA. An important step in SA biosynthesis in Arabidopsis is the conversion of chorismate to isochorismate through the action of isochorismate synthase, encoded by the ICS1 gene. Also AVRPPHB SUSCEPTIBLE 3 (PBS3 plays an important role in SA metabolism, as pbs3 mutants accumulate drastically reduced levels of SA-glucoside, a putative storage form of SA. Bioinformatics analysis previously performed by us identified WRKY28 and WRKY46 as possible regulators of ICS1 and PBS3. Results Expression studies with ICS1 promoter::β-glucuronidase (GUS genes in Arabidopsis thaliana protoplasts cotransfected with 35S::WRKY28 showed that over expression of WRKY28 resulted in a strong increase in GUS expression. Moreover, qRT-PCR analyses indicated that the endogenous ICS1 and PBS3 genes were highly expressed in protoplasts overexpressing WRKY28 or WRKY46, respectively. Electrophoretic mobility shift assays indentified potential WRKY28 binding sites in the ICS1 promoter, positioned -445 and -460 base pairs upstream of the transcription start site. Mutation of these sites in protoplast transactivation assays showed that these binding sites are functionally important for activation of the ICS1 promoter. Chromatin immunoprecipitation assays with haemagglutinin-epitope-tagged WRKY28 showed that the region of the ICS1 promoter containing the binding sites at -445 and -460 was highly enriched in the immunoprecipitated DNA. Conclusions The results obtained here confirm results from our multiple microarray co-expression analyses indicating that WRKY28 and WRKY46 are transcriptional activators of ICS1 and PBS3, respectively, and support this in silico screening as a powerful tool for identifying new components of stress

  6. Laser measurement of respiration activity in preterm infants: Monitoring of peculiar events

    Science.gov (United States)

    Scalise, L.; Marchionni, P.; Ercoli, I.; Tomasini, E. P.

    2012-09-01

    The Neonatal Intensive Care Unit (NICU) is a part of a pediatric hospital dedicated to the care of ill or pre-term patients . NICU's patients are underweight and most of the time they need cardiac and respiratory support therapies; they are placed in incubators or in cribs maintaining target environmental and body temperatures and protecting patients from bacteria and virus. Patients are continuously monitored for long period of time (days or weeks) due to their possible several health conditions. the most common vital signs monitored are: respiration rate, heart rate, body temperature, blood saturation, etc. Most of the devices used for transducing such quantities in electronic signals - like spirometer or electrocardiogram (ECG) - are in direct contact with the patient and results, also in consideration of the specific patient, largely invasive. In this paper, we propose a novel measurement system for non-contact and non-invasive assessment of the respiration activity, with particular reference to the detection of peculiar respiration events of extreme interest in intensive care units, such as: irregular inspiration/expiration acts, hiccups and apneas. The sensing device proposed is the Laser Doppler Vibrometer (LDVi) which is an non contact, optical measurement system for the assessment of a surface velocity and displacement. In the past it has been demonstrated to be suitable to measure heart rate (HR) and respiration rate (RR) in adult and in preterm infant trough chest-wall displacements. The measurement system is composed by a LDVi system and a data acquisition board installed on a PC, with no direct contact with the patient. Tests have been conducted on 20 NICU patients, for a total of 7219 data sampled. Results show very high correlation (R=0.99) with the reference instrument used for the patient monitoring (mechanical ventilator), with an uncertainty < ±7 ms (k=2). Moreover, during the tests, some peculiar respiration events, have been recorded on 6 of

  7. Gene-Regulatory Activity of α-Tocopherol

    Directory of Open Access Journals (Sweden)

    John K. Lodge

    2010-03-01

    Full Text Available Vitamin E is an essential vitamin and a lipid soluble antioxidant, at least, under in vitro conditions. The antioxidant properties of vitamin E are exerted through its phenolic hydroxyl group, which donates hydrogen to peroxyl radicals, resulting in the formation of stable lipid species. Beside an antioxidant role, important cell signalling properties of vitamin E have been described. By using gene chip technology we have identified α-tocopherol sensitive molecular targets in vivo including christmas factor (involved in the blood coagulation and 5α-steroid reductase type 1 (catalyzes the conversion of testosterone to 5α-dihydrotestosterone being upregulated and γ-glutamyl-cysteinyl synthetase (the rate limiting enzyme in GSH synthesis being downregulated due to a-tocopherol deficiency. α-Tocopherol regulates signal transduction cascades not only at the mRNA but also at the miRNA level since miRNA 122a (involved in lipid metabolism and miRNA 125b (involved in inflammation are downregulated by α-tocopherol. Genetic polymorphisms may determine the biological and gene-regulatory activity of a-tocopherol. In this context we have recently shown that genes encoding for proteins involved in peripheral α-tocopherol transport and degradation are significantly affected by the apoE genotype.

  8. Latitudinal Responses of F2 Peak Parameters to High-intensity Long-duration Continuous AE Activity (HILDCAA) Events

    Science.gov (United States)

    Spraggs, M. E.

    2015-12-01

    The ionospheric responses to geomagnetic storms form an important part of the space weather study. The ionospheric perturbations may be described as enhancements and depletions compared to the quiet time variations, known as positive and negative phases of the ionospheric storms, respectively. In spite of a significant volume of studies on the ionospheric responses to the geomagnetic storms, understanding of ionospheric storm has not reached a level where it is possible to predict it. Geomagnetic activity may be divided into three categories: substorms, storms of different intensity, and high-intensity long-duration continuous AE activity (HILDCAA) events. This work presents specifically the latitudinal responses of the noontime F region peak parameters (hmF2 and foF2) to HILDCAA events. For this, digisonde data from 51 stations around the world was selected from the Digital Ionogram Data Base (DIDbase) from 2004 to 2012. For the same period 19 HILDCAA events were detected. Preliminary results show a positive effect in the peak parameters of the southern hemisphere and a negative effect in those of the northern hemisphere, suggesting that there is a predominantly northward component of the meridional winds. Additionally, it seems that the events occurring around the summer solstice have meridional wind components that are exclusively northward, while two of the six winter time events have southward components. Wintertime events are also the only ones with a very prominent eastward component of the zonal winds.

  9. Early adverse events, HPA activity and rostral anterior cingulate volume in MDD.

    Directory of Open Access Journals (Sweden)

    Michael T Treadway

    Full Text Available BACKGROUND: Prior studies have independently reported associations between major depressive disorder (MDD, elevated cortisol concentrations, early adverse events and region-specific decreases in grey matter volume, but the relationships among these variables are unclear. In the present study, we sought to evaluate the relationships between grey matter volume, early adverse events and cortisol levels in MDD. METHODS/RESULTS: Grey matter volume was compared between 19 controls and 19 individuals with MDD using voxel-based morphometry. A history of early adverse events was assessed using the Childhood Trauma Questionnaire. Subjects also provided salivary cortisol samples. Depressed patients showed decreased grey matter volume in the rostral ACC as compared to controls. Rostral ACC volume was inversely correlated with both cortisol and early adverse events. CONCLUSIONS: These findings suggest a key relationship between ACC morphology, a history of early adverse events and circulating cortisol in the pathophysiology of MDD.

  10. Decoding fMRI events in sensorimotor motor network using sparse paradigm free mapping and activation likelihood estimates.

    Science.gov (United States)

    Tan, Francisca M; Caballero-Gaudes, César; Mullinger, Karen J; Cho, Siu-Yeung; Zhang, Yaping; Dryden, Ian L; Francis, Susan T; Gowland, Penny A

    2017-08-16

    Most functional MRI (fMRI) studies map task-driven brain activity using a block or event-related paradigm. Sparse paradigm free mapping (SPFM) can detect the onset and spatial distribution of BOLD events in the brain without prior timing information, but relating the detected events to brain function remains a challenge. In this study, we developed a decoding method for SPFM using a coordinate-based meta-analysis method of activation likelihood estimation (ALE). We defined meta-maps of statistically significant ALE values that correspond to types of events and calculated a summation overlap between the normalized meta-maps and SPFM maps. As a proof of concept, this framework was applied to relate SPFM-detected events in the sensorimotor network (SMN) to six motor functions (left/right fingers, left/right toes, swallowing, and eye blinks). We validated the framework using simultaneous electromyography (EMG)-fMRI experiments and motor tasks with short and long duration, and random interstimulus interval. The decoding scores were considerably lower for eye movements relative to other movement types tested. The average successful rate for short and long motor events were 77 ± 13% and 74 ± 16%, respectively, excluding eye movements. We found good agreement between the decoding results and EMG for most events and subjects, with a range in sensitivity between 55% and 100%, excluding eye movements. The proposed method was then used to classify the movement types of spontaneous single-trial events in the SMN during resting state, which produced an average successful rate of 22 ± 12%. Finally, this article discusses methodological implications and improvements to increase the decoding performance. Hum Brain Mapp, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  11. Activation of the human beta interferon gene by the adenovirus type 12 E1B gene

    Energy Technology Data Exchange (ETDEWEB)

    Shiroki, K.; Toth, M.

    1988-01-01

    The transcription of endogenous beta interferon mRNA was activated in human embryo kidney (HEK) cells infected with adenovirus 12 (Ad12) but was activated only inefficiently or not at all in HEK cells infected with Ad5 and rc-1 (Ad5 dl312 containing the Ad12 E1A region). The analysis with Ad12 mutants showed that Ad12 E1B products, especially the 19K protein, were important for the expression of the endogenous beta interferon gene and Ad12 E1A products were not involved in the expression. The expression of exogeneously transfected pIFN-CAT (a hybrid plasmid having the human beta interferon promoter fused with the CAT gene) was activated in HEK and chicken embryo fibroblast (CEF) cells infected with either Ad12 or Ad5. The analysis of cotransfection of CEF cells with pIFN-CAT and plasmids containing fragments of Ad12 or Ad5 DNA showed that Ad12 or Ad5 E1B (possibly the 19K protein) was and E1A was not involved in the expression of the exogenous pIFN-CAT.

  12. Enhanced Synaptic Activity and Epileptiform Events in the Embryonic KCC2 Deficient Hippocampus.

    Science.gov (United States)

    Khalilov, Ilgam; Chazal, Geneviève; Chudotvorova, Ilona; Pellegrino, Christophe; Corby, Séverine; Ferrand, Nadine; Gubkina, Olena; Nardou, Romain; Tyzio, Roman; Yamamoto, Sumii; Jentsch, Thomas J; Hübner, Christian A; Gaiarsa, Jean-Luc; Ben-Ari, Yehezkel; Medina, Igor

    2011-01-01

    The neuronal potassium-chloride co-transporter 2 [indicated thereafter as KCC2 (for protein) and Kcc2 (for gene)] is thought to play an important role in the post natal excitatory to inhibitory switch of GABA actions in the rodent hippocampus. Here, by studying hippocampi of wild-type (Kcc2(+/+)) and Kcc2 deficient (Kcc2(-/-)) mouse embryos, we unexpectedly found increased spontaneous neuronal network activity at E18.5, a developmental stage when KCC2 is thought not to be functional in the hippocampus. Embryonic Kcc2(-/-) hippocampi have also an augmented synapse density and a higher frequency of spontaneous glutamatergic and GABA-ergic postsynaptic currents than naïve age matched neurons. However, intracellular chloride concentration ([Cl(-)](i)) and the reversal potential of GABA-mediated currents (E(GABA)) were similar in embryonic Kcc2(+/+) and Kcc2(-/-) CA3 neurons. In addition, KCC2 immunolabeling was cytoplasmic in the majority of neurons suggesting that the molecule is not functional as a plasma membrane chloride co-transporter. Collectively, our results show that already at an embryonic stage, KCC2 controls the formation of synapses and, when deleted, the hippocampus has a higher density of GABA-ergic and glutamatergic synapses and generates spontaneous and evoked epileptiform activities. These results may be explained either by a small population of orchestrating neurons in which KCC2 operates early as a chloride exporter or by transporter independent actions of KCC2 that are instrumental in synapse formation and networks construction.

  13. The design and implementation of EPL: An event pattern language for active databases

    Science.gov (United States)

    Giuffrida, G.; Zaniolo, C.

    1994-01-01

    The growing demand for intelligent information systems requires closer coupling of rule-based reasoning engines, such as CLIPS, with advanced data base management systems (DBMS). For instance, several commercial DBMS now support the notion of triggers that monitor events and transactions occurring in the database and fire induced actions, which perform a variety of critical functions, including safeguarding the integrity of data, monitoring access, and recording volatile information needed by administrators, analysts, and expert systems to perform assorted tasks; examples of these tasks include security enforcement, market studies, knowledge discovery, and link analysis. At UCLA, we designed and implemented the event pattern language (EPL) which is capable of detecting and acting upon complex patterns of events which are temporally related to each other. For instance, a plant manager should be notified when a certain pattern of overheating repeats itself over time in a chemical process; likewise, proper notification is required when a suspicious sequence of bank transactions is executed within a certain time limit. The EPL prototype is built in CLIPS to operate on top of Sybase, a commercial relational DBMS, where actions can be triggered by events such as simple database updates, insertions, and deletions. The rule-based syntax of EPL allows the sequences of goals in rules to be interpreted as sequences of temporal events; each goal can correspond to either (1) a simple event, or (2) a (possibly negated) event/condition predicate, or (3) a complex event defined as the disjunction and repetition of other events. Various extensions have been added to CLIPS in order to tailor the interface with Sybase and its open client/server architecture.

  14. Physical activity, life events stress, cortisol, and DHEA: preliminary findings that physical activity may buffer against the negative effects of stress.

    Science.gov (United States)

    Heaney, Jennifer L J; Carroll, Douglas; Phillips, Anna C

    2014-10-01

    The present study examined the relationship between habitual physical activity, life events stress, the diurnal rhythms of cortisol and DHEA, and the cortisol:dehydroepiandrosterone (DHEA) ratio in older adults. Thirty-six participants aged ≥ 65 reported their habitual physical activity, and indicated if a particular event happened to them in the past year (stress incidence) and how stressful they perceived the event to be (stress severity). Older adults with higher stress severity demonstrated a significantly higher cortisol:DHEA ratio. Individuals with higher stress incidence scores and who did not participate in aerobic exercise had a significantly higher cortisol:DHEA ratio and flatter DHEA diurnal rhythm compared with those who regularly participated in aerobic exercise. In conclusion, life events stress may have a negative impact on the cortisol:DHEA ratio in older adults. Under conditions of high stress exposure, exercise may protect older adults from an increased cortisol:DHEA ratio and flatter DHEA diurnal rhythm.

  15. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Science.gov (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

    2013-01-01

    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  16. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  17. Extending the evaluation of Genia Event task toward knowledge base construction and comparison to Gene Regulation Ontology task.

    Science.gov (United States)

    Kim, Jin-Dong; Kim, Jung-Jae; Han, Xu; Rebholz-Schuhmann, Dietrich

    2015-01-01

    The third edition of the BioNLP Shared Task was held with the grand theme "knowledge base construction (KB)". The Genia Event (GE) task was re-designed and implemented in light of this theme. For its final report, the participating systems were evaluated from a perspective of annotation. To further explore the grand theme, we extended the evaluation from a perspective of KB construction. Also, the Gene Regulation Ontology (GRO) task was newly introduced in the third edition. The final evaluation of the participating systems resulted in relatively low performance. The reason was attributed to the large size and complex semantic representation of the ontology. To investigate potential benefits of resource exchange between the presumably similar tasks, we measured the overlap between the datasets of the two tasks, and tested whether the dataset for one task can be used to enhance performance on the other. We report an extended evaluation on all the participating systems in the GE task, incoporating a KB perspective. For the evaluation, the final submission of each participant was converted to RDF statements, and evaluated using 8 queries that were formulated in SPARQL. The results suggest that the evaluation may be concluded differently between the two different perspectives, annotation vs. KB. We also provide a comparison of the GE and GRO tasks by converting their datasets into each other's format. More than 90% of the GE data could be converted into the GRO task format, while only half of the GRO data could be mapped to the GE task format. The imbalance in conversion indicates that the GRO is a comprehensive extension of the GE task ontology. We further used the converted GRO data as additional training data for the GE task, which helped improve GE task participant system performance. However, the converted GE data did not help GRO task participants, due to overfitting and the ontology gap.

  18. The Impact of Media Sport Events on the Active Participation of Young People and Some Implications for PE Pedagogy

    Science.gov (United States)

    Lines, Gill

    2007-01-01

    This article addresses the impact of selected sports media events on the active participation of a group of young people aged 14/15. Its particular focus is on an intense period of media sport coverage during the European Soccer Championships (Euro '96), the Wimbledon Lawn Tennis Championships and the Atlanta Olympics and on how a group of British…

  19. Activation of silenced cytokine gene promoters by the synergistic effect of TBP-TALE and VP64-TALE activators.

    Directory of Open Access Journals (Sweden)

    Kim Anthony

    Full Text Available Recent work has shown that the combinatorial use of multiple TALE activators can selectively activate certain cellular genes in inaccessible chromatin regions. In this study, we aimed to interrogate the activation potential of TALEs upon transcriptionally silenced immune genes in the context of non-immune cells. We designed a unique strategy, in which a single TALE fused to the TATA-box binding protein (TBP-TALE is coupled with multiple VP64-TALE activators. We found that our strategy is significantly more potent than multiple TALE activators alone in activating expression of IL-2 and GM-CSF in diverse cell origins in which both genes are otherwise completely silenced. Chromatin analysis revealed that the gene activation was due in part to displacement of a distinctly positioned nucleosome. These studies provide a novel epigenetic mechanism for artificial gene induction and have important implications for targeted cancer immunotherapy, DNA vaccine development, as well as rational design of TALE activators.

  20. Activation of silenced cytokine gene promoters by the synergistic effect of TBP-TALE and VP64-TALE activators.

    Science.gov (United States)

    Anthony, Kim; More, Abhijit; Zhang, Xiaoliu

    2014-01-01

    Recent work has shown that the combinatorial use of multiple TALE activators can selectively activate certain cellular genes in inaccessible chromatin regions. In this study, we aimed to interrogate the activation potential of TALEs upon transcriptionally silenced immune genes in the context of non-immune cells. We designed a unique strategy, in which a single TALE fused to the TATA-box binding protein (TBP-TALE) is coupled with multiple VP64-TALE activators. We found that our strategy is significantly more potent than multiple TALE activators alone in activating expression of IL-2 and GM-CSF in diverse cell origins in which both genes are otherwise completely silenced. Chromatin analysis revealed that the gene activation was due in part to displacement of a distinctly positioned nucleosome. These studies provide a novel epigenetic mechanism for artificial gene induction and have important implications for targeted cancer immunotherapy, DNA vaccine development, as well as rational design of TALE activators.

  1. MBD3 localizes at promoters, gene bodies and enhancers of active genes.

    Science.gov (United States)

    Shimbo, Takashi; Du, Ying; Grimm, Sara A; Dhasarathy, Archana; Mav, Deepak; Shah, Ruchir R; Shi, Huidong; Wade, Paul A

    2013-01-01

    The Mi-2/nucleosome remodeling and histone deacetylase (NuRD) complex is a multiprotein machine proposed to regulate chromatin structure by nucleosome remodeling and histone deacetylation activities. Recent reports describing localization of NuRD provide new insights that question previous models on NuRD action, but are not in complete agreement. Here, we provide location analysis of endogenous MBD3, a component of NuRD complex, in two human breast cancer cell lines (MCF-7 and MDA-MB-231) using two independent genomic techniques: DNA adenine methyltransferase identification (DamID) and ChIP-seq. We observed concordance of the resulting genomic localization, suggesting that these studies are converging on a robust map for NuRD in the cancer cell genome. MBD3 preferentially associated with CpG rich promoters marked by H3K4me3 and showed cell-type specific localization across gene bodies, peaking around the transcription start site. A subset of sites bound by MBD3 was enriched in H3K27ac and was in physical proximity to promoters in three-dimensional space, suggesting function as enhancers. MBD3 enrichment was also noted at promoters modified by H3K27me3. Functional analysis of chromatin indicated that MBD3 regulates nucleosome occupancy near promoters and in gene bodies. These data suggest that MBD3, and by extension the NuRD complex, may have multiple roles in fine tuning expression for both active and silent genes, representing an important step in defining regulatory mechanisms by which NuRD complex controls chromatin structure and modification status.

  2. Temperature and water loss affect ADH activity and gene expression in grape berry during postharvest dehydration.

    Science.gov (United States)

    Cirilli, Marco; Bellincontro, Andrea; De Santis, Diana; Botondi, Rinaldo; Colao, Maria Chiara; Muleo, Rosario; Mencarelli, Fabio

    2012-05-01

    Clusters of Aleatico wine grape were picked at 18°Brix and placed at 10, 20, or 30°C, 45% relative humidity (RH) and 1.5m/s of air flow to dehydrate the berries up to 40% of loss of initial fresh weight. Sampling was done at 0%, 10%, 20%, 30%, and 40% weight loss (wl). ADH (alcohol dehydrogenase) gene expression, enzyme activity, and related metabolites were analysed. At 10°C, acetaldehyde increased rapidly and then declined, while ethanol continued to rise. At 20°C, acetaldehyde and ethanol increased significantly with the same pattern and declined at 40%wl. At 30°C, acetaldehyde did not increase but ethanol increased rapidly already at 10%wl. At the latter temperature, a significant increase in acetic acid and ethyl acetate occurred, while at 10°C their values were low. At 30°C, the ADH activity (ethanol to acetaldehyde direction), increased rapidly but acetaldehyde did not rise because of its oxidation to acetic acid, which increased together with ethyl acetate. At 10°C, the ADH activity increased at 20%wl and continued to rise even at 40%wl, meaning that ethanol oxidation was delayed. At 20°C, the behaviour was intermediate to the other temperatures. The relative expression of the VvAdh2 gene was the highest at 10°C already at 10%wl in a synchrony with the ADH activity, indicating a rapid response likely due to low temperature. The expression subsequently declined. At 20 and 30°C, the expression was lower and increased slightly during dehydration in combination with the ADH activity. This imbalance between gene expression and ADH activity at 10°C, as well as the unexpected expression of the carotenoid cleavage dioxygenase 1 (CCD1) gene, opens the discussion on the stress sensitivity and transcription event during postharvest dehydration, and the importance of carefully monitoring temperature during dehydration.

  3. GCN5 is essential for IRF-4 gene expression followed by transcriptional activation of Blimp-1 in immature B cells.

    Science.gov (United States)

    Kikuchi, Hidehiko; Nakayama, Masami; Kuribayashi, Futoshi; Imajoh-Ohmi, Shinobu; Nishitoh, Hideki; Takami, Yasunari; Nakayama, Tatsuo

    2014-03-01

    During B-cell differentiation, the gene expression of B-cell differentiation-related transcription factors must be strictly controlled by epigenetic mechanisms including histone acetylation and deacetylation, to complete the differentiation pathway. GCN5, one of the most important histone acetyltransferases, is involved in epigenetic events for transcriptional regulation through alterations in the chromatin structure. In this study, by analyzing the homozygous DT40 mutants GCN5(-/-), generated with gene targeting techniques, we found that GCN5 was necessary for transcriptional activation of IRF-4, an essential transcription factor for plasma cell differentiation. GCN5 deficiency caused drastic decreases in both the mRNA and the protein levels of Blimp-1 and IRF-4. The ectopic expression of Blimp-1 and IRF-4 suggests that IRF-4, but not Blimp-1, is the target gene of GCN5 in immature B cells. Moreover, a chromatin immunoprecipitation assay showed that GCN5 bound to the IRF-4 gene around its 5'-flanking region and acetylated H3K9 residues within chromatin surrounding the region in vivo, suggesting that gene expression of IRF-4 is certainly regulated by GCN5. These results reveal that GCN5 is essential for IRF-4 gene expression, followed by transcriptional activation of Blimp-1, and plays a key role in epigenetic regulation of B-cell differentiation.

  4. mRNA Noise Reveals that Activators Induce a Biphasic Response in the Promoter Kinetics of Highly Regulated Genes

    Science.gov (United States)

    Quinn, Katie; To, Tsz-Leung; Maheshri, Narendra

    2012-02-01

    A dominant source of fluctuations in gene expression is thought to be the process of transcription. The statistics of these fluctuations arise from the kinetics of transcription. Multiple studies suggest the bulk of fluctuations can be understood by a simple process where genes are inactive for exponentially distributed times punctuated by geometric bursts of mRNA. Yet it's largely unknown how cis and trans factors affect the two lumped kinetic parameters, burst size and burst frequency, that describe this process. Importantly, how these parameters are regulated in a single gene can qualitatively affect the dynamical behavior of the network it is embedded within. Here, we ask whether transcriptional activators increase gene expression by increasing the burst size or burst frequency. We do so by deducing these parameters from steady-state mRNA distributions measured in individual yeast cells using single molecule mRNA FISH. We find that for both a synthetic and natural promoter, activators appear to first increase burst size, then burst frequency. We suggest this biphasic response may be common to all highly regulated genes and was previously unappreciated because of measurement techniques. Furthermore, its origins appear to relate to cis events at the promoter, and may arise from combinations of basal and activator-dependent bursts. Our measurements shed new light on transcriptional mechanisms and should assist in building synthetic promoters with tunable statistics.

  5. Does erotic stimulus presentation design affect brain activation patterns? Event-related vs. blocked fMRI designs

    Directory of Open Access Journals (Sweden)

    Klemen Jane

    2008-07-01

    Full Text Available Abstract Background Existing brain imaging studies, investigating sexual arousal via the presentation of erotic pictures or film excerpts, have mainly used blocked designs with long stimulus presentation times. Methods To clarify how experimental functional magnetic resonance imaging (fMRI design affects stimulus-induced brain activity, we compared brief event-related presentation of erotic vs. neutral stimuli with blocked presentation in 10 male volunteers. Results Brain activation differed depending on design type in only 10% of the voxels showing task related brain activity. Differences between blocked and event-related stimulus presentation were found in occipitotemporal and temporal regions (Brodmann Area (BA 19, 37, 48, parietal areas (BA 7, 40 and areas in the frontal lobe (BA 6, 44. Conclusion Our results suggest that event-related designs might be a potential alternative when the core interest is the detection of networks associated with immediate processing of erotic stimuli. Additionally, blocked, compared to event-related, stimulus presentation allows the emergence and detection of non-specific secondary processes, such as sustained attention, motor imagery and inhibition of sexual arousal.

  6. Does erotic stimulus presentation design affect brain activation patterns? Event-related vs. blocked fMRI designs.

    Science.gov (United States)

    Bühler, Mira; Vollstädt-Klein, Sabine; Klemen, Jane; Smolka, Michael N

    2008-07-22

    Existing brain imaging studies, investigating sexual arousal via the presentation of erotic pictures or film excerpts, have mainly used blocked designs with long stimulus presentation times. To clarify how experimental functional magnetic resonance imaging (fMRI) design affects stimulus-induced brain activity, we compared brief event-related presentation of erotic vs. neutral stimuli with blocked presentation in 10 male volunteers. Brain activation differed depending on design type in only 10% of the voxels showing task related brain activity. Differences between blocked and event-related stimulus presentation were found in occipitotemporal and temporal regions (Brodmann Area (BA) 19, 37, 48), parietal areas (BA 7, 40) and areas in the frontal lobe (BA 6, 44). Our results suggest that event-related designs might be a potential alternative when the core interest is the detection of networks associated with immediate processing of erotic stimuli.Additionally, blocked, compared to event-related, stimulus presentation allows the emergence and detection of non-specific secondary processes, such as sustained attention, motor imagery and inhibition of sexual arousal.

  7. Communication activity in a social network: relation between long-term correlations and inter-event clustering.

    Science.gov (United States)

    Rybski, Diego; Buldyrev, Sergey V; Havlin, Shlomo; Liljeros, Fredrik; Makse, Hernán A

    2012-01-01

    Human communication in social networks is dominated by emergent statistical laws such as non-trivial correlations and temporal clustering. Recently, we found long-term correlations in the user's activity in social communities. Here, we extend this work to study the collective behavior of the whole community with the goal of understanding the origin of clustering and long-term persistence. At the individual level, we find that the correlations in activity are a byproduct of the clustering expressed in the power-law distribution of inter-event times of single users, i.e. short periods of many events are separated by long periods of no events. On the contrary, the activity of the whole community presents long-term correlations that are a true emergent property of the system, i.e. they are not related to the distribution of inter-event times. This result suggests the existence of collective behavior, possibly arising from nontrivial communication patterns through the embedding social network.

  8. Resistance to dual-gene Bt maize in Spodoptera frugiperda: selection, inheritance, and cross-resistance to other transgenic events

    Science.gov (United States)

    Santos-Amaya, Oscar F.; Rodrigues, João V. C.; Souza, Thadeu C.; Tavares, Clébson S.; Campos, Silverio O.; Guedes, Raul N.C.; Pereira, Eliseu J.G.

    2015-01-01

    Transgenic crop “pyramids” producing two or more Bacillus thuringiensis (Bt) toxins active against the same pest are used to delay evolution of resistance in insect pest populations. Laboratory and greenhouse experiments were performed with fall armyworm, Spodoptera frugiperda, to characterize resistance to Bt maize producing Cry1A.105 and Cry2Ab and test some assumptions of the “pyramid” resistance management strategy. Selection of a field-derived strain of S. frugiperda already resistant to Cry1F maize with Cry1A.105 + Cry2Ab maize for ten generations produced resistance that allowed the larvae to colonize and complete the life cycle on these Bt maize plants. Greenhouse experiments revealed that the resistance was completely recessive (Dx = 0), incomplete, autosomal, and without maternal effects or cross-resistance to the Vip3Aa20 toxin produced in other Bt maize events. This profile of resistance supports some of the assumptions of the pyramid strategy for resistance management. However, laboratory experiments with purified Bt toxin and plant leaf tissue showed that resistance to Cry1A.105 + Cry2Ab2 maize further increased resistance to Cry1Fa, which indicates that populations of fall armyworm have high potential for developing resistance to some currently available pyramided maize used against this pest, especially where resistance to Cry1Fa was reported in the field. PMID:26675246

  9. Resistance to dual-gene Bt maize in Spodoptera frugiperda: selection, inheritance, and cross-resistance to other transgenic events.

    Science.gov (United States)

    Santos-Amaya, Oscar F; Rodrigues, João V C; Souza, Thadeu C; Tavares, Clébson S; Campos, Silverio O; Guedes, Raul N C; Pereira, Eliseu J G

    2015-12-17

    Transgenic crop "pyramids" producing two or more Bacillus thuringiensis (Bt) toxins active against the same pest are used to delay evolution of resistance in insect pest populations. Laboratory and greenhouse experiments were performed with fall armyworm, Spodoptera frugiperda, to characterize resistance to Bt maize producing Cry1A.105 and Cry2Ab and test some assumptions of the "pyramid" resistance management strategy. Selection of a field-derived strain of S. frugiperda already resistant to Cry1F maize with Cry1A.105 + Cry2Ab maize for ten generations produced resistance that allowed the larvae to colonize and complete the life cycle on these Bt maize plants. Greenhouse experiments revealed that the resistance was completely recessive (Dx = 0), incomplete, autosomal, and without maternal effects or cross-resistance to the Vip3Aa20 toxin produced in other Bt maize events. This profile of resistance supports some of the assumptions of the pyramid strategy for resistance management. However, laboratory experiments with purified Bt toxin and plant leaf tissue showed that resistance to Cry1A.105 + Cry2Ab2 maize further increased resistance to Cry1Fa, which indicates that populations of fall armyworm have high potential for developing resistance to some currently available pyramided maize used against this pest, especially where resistance to Cry1Fa was reported in the field.

  10. Communication activity in a social network: relation between long-term correlations and inter-event clustering

    CERN Document Server

    Rybski, Diego; Havlin, Shlomo; Liljeros, Fredrik; Makse, Hernan A

    2012-01-01

    The timing patterns of human communication in social networks is not random. On the contrary, communication is dominated by emergent statistical laws such as non-trivial correlations and clustering. Recently, we found long-term correlations in the user's activity in social communities. Here, we extend this work to study collective behavior of the whole community. The goal is to understand the origin of clustering and long-term persistence. At the individual level, we find that the correlations in activity are a byproduct of the clustering expressed in the power-law distribution of inter-event times of single users. On the contrary, the activity of the whole community presents long-term correlations that are a true emergent property of the system, i.e. they are not related to the distribution of inter-event times. This result suggests the existence of collective behavior, possible arising from nontrivial communication patterns through the embedding social network.

  11. Diversification of genes encoding granule-bound starch synthase in monocots and dicots is marked by multiple genome-wide duplication events.

    Directory of Open Access Journals (Sweden)

    Jun Cheng

    Full Text Available Starch is one of the major components of cereals, tubers, and fruits. Genes encoding granule-bound starch synthase (GBSS, which is responsible for amylose synthesis, have been extensively studied in cereals but little is known about them in fruits. Due to their low copy gene number, GBSS genes have been used to study plant phylogenetic and evolutionary relationships. In this study, GBSS genes have been isolated and characterized in three fruit trees, including apple, peach, and orange. Moreover, a comprehensive evolutionary study of GBSS genes has also been conducted between both monocots and eudicots. Results have revealed that genomic structures of GBSS genes in plants are conserved, suggesting they all have evolved from a common ancestor. In addition, the GBSS gene in an ancestral angiosperm must have undergone genome duplication ∼251 million years ago (MYA to generate two families, GBSSI and GBSSII. Both GBSSI and GBSSII are found in monocots; however, GBSSI is absent in eudicots. The ancestral GBSSII must have undergone further divergence when monocots and eudicots split ∼165 MYA. This is consistent with expression profiles of GBSS genes, wherein these profiles are more similar to those of GBSSII in eudicots than to those of GBSSI genes in monocots. In dicots, GBSSII must have undergone further divergence when rosids and asterids split from each other ∼126 MYA. Taken together, these findings suggest that it is GBSSII rather than GBSSI of monocots that have orthologous relationships with GBSS genes of eudicots. Moreover, diversification of GBSS genes is mainly associated with genome-wide duplication events throughout the evolutionary course of history of monocots and eudicots.

  12. Tumor-produced, active Interleukin-1 {beta} regulates gene expression in carcinoma-associated fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Dudas, Jozsef, E-mail: Jozsef.Dudas@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Fullar, Alexandra, E-mail: fullarsz@gmail.com [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); 1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Bitsche, Mario, E-mail: Mario.Bitsche@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Schartinger, Volker, E-mail: Volker.Schartinger@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Kovalszky, Ilona, E-mail: koval@korb1.sote.hu [1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Sprinzl, Georg Mathias, E-mail: Georg.Sprinzl@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Riechelmann, Herbert, E-mail: Herbert.Riechelmann@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria)

    2011-09-10

    Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1{beta} (IL1-{beta}) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-{beta} expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-{beta} processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-{beta}. IL1-{beta} signaling was investigated by western blot and immunocytochemistry. IL1-{beta}-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-{beta}, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NF{kappa}B{alpha}. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-{beta} reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-{beta}-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-{beta} in the tumor cells leads to IL1-{beta}-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-{beta}. PDL fibroblasts possess receptor for IL1-{beta}, and its expression is increased 4.56-times in the

  13. Identification of transcriptional activators for thienamycin and cephamycin C biosynthetic genes within the thienamycin gene cluster from Streptomyces cattleya.

    Science.gov (United States)

    Rodríguez, Miriam; Núñez, Luz Elena; Braña, Alfredo F; Méndez, Carmen; Salas, José A; Blanco, Gloria

    2008-08-01

    Two regulatory genes, thnI and thnU, were identified in the thienamycin (thn) gene cluster from Streptomyces cattleya. ThnI resembles LysR-type transcriptional activators and ThnU belongs to the SARP family of transcriptional activators. Their functional role was established after independent inactivation by gene replacement together with transcriptional analysis involving reverse transcription polymerase chain reaction (RT-PCR). Deletion of thnI abolished thienamycin production showing its involvement in thienamycin biosynthesis. Gene expression analysis applied to the thn gene cluster demonstrated that ThnI is a transcriptional activator essential for thienamycin biosynthesis that regulates the expression of nine genes involved in thienamycin assembly and export (thnH, thnJ, thnK, thnL, thnM, thnN, thnO, thnP and thnQ). Unexpectedly, the thnU disrupted mutant was not affected in thienamycin production but turned out to be essential for cephamycin C biosynthesis. Transcript analysis applied to early and late structural genes for cephamycin C biosynthesis (pcbAB and cmcI), revealed that ThnU is the transcriptional activator of these cephamycin C genes although they are not physically linked to the thn cluster. In addition, it was shown that deletion of thnI has an upregulatory effect on pcbAB and cmcI transcription consistent with a significant increase in cephamycin C biosynthesis in this mutant.

  14. Do major life events influence physical activity among older adults: the longitudinal aging study Amsterdam

    NARCIS (Netherlands)

    Koeneman, M.A.; Chinapaw, M.J.M.; Verheijden, M.W.; Tilburg, T.G. van; Visser, M.; Deeg, D.J.H.; Hopman-Rock, M.

    2012-01-01

    Abstract for the International Society for Aging and Physical activity's 8th World Congress on Aging and Physical Activity: A celebration of Diversity and Inclusion in Active Ageing, August 13-17 2012.

  15. Late Holocene environmental reconstructions and the implications on flood events, typhoon patterns, and agriculture activities in NE Taiwan

    Science.gov (United States)

    Wang, L.-C.; Behling, H.; Lee, T.-Q.; Li, H.-C.; Huh, C.-A.; Shiau, L.-J.; Chang, Y.-P.

    2014-05-01

    In this study, we reconstructed the paleoenvironmental changes from a sediment archive of the floodplain lake in Ilan Plain of NE Taiwan on multi-decadal resolution for the last ca. 1900 years. On the basis of pollen and diatom records, we evaluated the record of past vegetation, floods, typhoons and agriculture activities of this area, which is sensitive to the hydrological conditions of the West Pacific. High sedimentation rates with low microfossil preservations reflected multiple flood events and humid climatic conditions during 100-1400 AD. A shortly interrupted dry phase can be found during 940-1010 AD. The driest phase corresponds to the Little Ice Age phase 1 (LIA1, 1400-1620 AD) with less disturbance by flood events, which enhanced the occurrence of wetlands (Cyperaceae) and diatom depositions. Humid phases with frequent typhoons are inferred by high percentages of Lagerstroemia and high ratios of planktonic/benthic diatoms, respectively, during 500-700 AD and Little Ice Age phase 2 (LIA2, 1630-1850 AD). The occurrences of cultivated Poaceae (Oryza) during 1250-1300 AD and the last ~400 years, reflect agriculture activities, which seems to implicate strongly with the environmental stability. Finally, we found flood events which dominated during the El Niño-like stage, but dry events as well as frequent typhoon events happened during the La Niña-like stage. After comparing our results with the reconstructed proxy for tropical hydrological conditions, we suggested that the local hydrology in coastal East Asia were strongly affected by the typhoon-triggered heavy rainfalls which were influenced by the variation of global temperature, expansion of the Pacific warm pool and intensification of ENSO events.

  16. 77 FR 32573 - Takes of Marine Mammals Incidental to Specified Activities; Construction and Race Event...

    Science.gov (United States)

    2012-06-01

    ... pesticides, have decreased over recent years due to cleanup efforts and natural attenuation (SFEI, 2010; Bay... other obstructions that could possibly damage or impede fair play. Although unlikely, in the event that... typically a loud environment. A number of sources of sound are likely to occur within San Francisco Bay...

  17. Identification of novel gene targets and functions of p21-activated kinase 1 during DNA damage by gene expression profiling.

    Directory of Open Access Journals (Sweden)

    Mona Motwani

    Full Text Available P21-activated kinase 1 (PAK1, a serine/threonine protein kinase, modulates many cellular processes by phosphorylating its downstream substrates. In addition to its role in the cytoplasm, PAK1 also affects gene transcription due to its nuclear localization and association with chromatin. It is now recognized that PAK1 kinase activity and its nuclear translocation are rapidly stimulated by ionizing radiation (IR, and that PAK1 activation is a component of the DNA damage response. Owing to the role of PAK1 in the cell survival, its association with the chromatin, and now, stimulation by ionizing radiation, we hypothesize that PAK1 may be contributing to modulation of genes with roles in cellular processes that might be important in the DNA damage response. The purpose of this study was to identify new PAK1 targets in response to ionizing radiation with putative role in the DNA damage response. We examined the effect of IR on the gene expression patterns in the murine embryonic fibroblasts with or without Pak1 using microarray technology. Differentially expressed transcripts were identified using Gene Spring GX 10.0.2. Pathway, network, functional analyses and gene family classification were carried out using Kyoto Encyclopedia of Genes and Genomes (KEGG, Ingenuity Pathway, Gene Ontology and PANTHER respectively. Selective targets of PAK1 were validated by RT-qPCR. For the first time, we provide a genome-wide analysis of PAK1 and identify its targets with potential roles in the DNA damage response. Gene Ontology analysis identified genes in the IR-stimulated cells that were involved in cell cycle arrest and cell death. Pathway analysis revealed p53 pathway being most influenced by IR responsive, PAK1 targets. Gene family of transcription factors was over represented and gene networks involved in DNA replication, repair and cellular signaling were identified. In brief, this study identifies novel PAK1 dependent IR responsive genes which reveal new

  18. Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

    Science.gov (United States)

    Boulila, Moncef

    2010-06-01

    To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

  19. Root-Knot and Cyst Nematodes Activate Procambium-Associated Genes in Arabidopsis Roots

    Science.gov (United States)

    Yamaguchi, Yasuka L.; Suzuki, Reira; Cabrera, Javier; Nakagami, Satoru; Sagara, Tomomi; Ejima, Chika; Sano, Ryosuke; Aoki, Yuichi; Olmo, Rocio; Kurata, Tetsuya; Obayashi, Takeshi; Demura, Taku; Ishida, Takashi; Escobar, Carolina; Sawa, Shinichiro

    2017-01-01

    Developmental plasticity is one of the most striking features of plant morphogenesis, as plants are able to vary their shapes in response to environmental cues. Biotic or abiotic stimuli often promote organogenesis events in plants not observed under normal growth conditions. Root-knot nematodes (RKNs) are known to parasitize multiple species of rooting plants and to induce characteristic tissue expansion called galls or root-knots on the roots of their hosts by perturbing the plant cellular machinery. Galls contain giant cells (GCs) and neighboring cells, and the GCs are a source of nutrients for the parasitizing nematode. Highly active cell proliferation was observed in galls. However, the underlying mechanisms that regulate the symptoms triggered by the plant-nematode interaction have not yet been elucidated. In this study, we deciphered the molecular mechanism of gall formation with an in vitro infection assay system using RKN Meloidogyne incognita, and the model plant Arabidopsis thaliana. By taking advantages of this system, we performed next-generation sequencing-based transcriptome profiling, and found that the expression of procambium identity-associated genes were enriched during gall formation. Clustering analyses with artificial xylogenic systems, together with the results of expression analyses of the candidate genes, showed a significant correlation between the induction of gall cells and procambium-associated cells. Furthermore, the promoters of several procambial marker genes such as ATHB8, TDR and WOX4 were activated not only in M. incognita-induced galls, but similarly in M. javanica induced-galls and Heterodera schachtii-induced syncytia. Our findings suggest that phytoparasitic nematodes modulate the host’s developmental regulation of the vascular stem cells during gall formation. PMID:28747918

  20. Epigenetic signature and enhancer activity of the human APOE gene

    Science.gov (United States)

    Yu, Chang-En; Cudaback, Eiron; Foraker, Jessica; Thomson, Zachary; Leong, Lesley; Lutz, Franziska; Gill, James Anthony; Saxton, Aleen; Kraemer, Brian; Navas, Patrick; Keene, C. Dirk; Montine, Thomas; Bekris, Lynn M.

    2013-01-01

    The human apolipoprotein E (APOE) gene plays an important role in lipid metabolism. It has three common genetic variants, alleles ɛ2/ɛ3/ɛ4, which translate into three protein isoforms of apoE2, E3 and E4. These isoforms can differentially influence total serum cholesterol levels; therefore, APOE has been linked with cardiovascular disease. Additionally, its ɛ4 allele is strongly associated with the risk of Alzheimer's disease (AD), whereas the ɛ2 allele appears to have a modest protective effect for AD. Despite decades of research having illuminated multiple functional differences among the three apoE isoforms, the precise mechanisms through which different APOE alleles modify diseases risk remain incompletely understood. In this study, we examined the genomic structure of APOE in search for properties that may contribute novel biological consequences to the risk of disease. We identify one such element in the ɛ2/ɛ3/ɛ4 allele-carrying 3′-exon of APOE. We show that this exon is imbedded in a well-defined CpG island (CGI) that is highly methylated in the human postmortem brain. We demonstrate that this APOE CGI exhibits transcriptional enhancer/silencer activity. We provide evidence that this APOE CGI differentially modulates expression of genes at the APOE locus in a cell type-, DNA methylation- and ɛ2/ɛ3/ɛ4 allele-specific manner. These findings implicate a novel functional role for a 3′-exon CGI and support a modified mechanism of action for APOE in disease risk, involving not only the protein isoforms but also an epigenetically regulated transcriptional program at the APOE locus driven by the APOE CGI. PMID:23892237

  1. Cryptic splicing events in the iron transporter ABCB7 and other key target genes in SF3B1-mutant myelodysplastic syndromes.

    Science.gov (United States)

    Dolatshad, H; Pellagatti, A; Liberante, F G; Llorian, M; Repapi, E; Steeples, V; Roy, S; Scifo, L; Armstrong, R N; Shaw, J; Yip, B H; Killick, S; Kušec, R; Taylor, S; Mills, K I; Savage, K I; Smith, C W J; Boultwood, J

    2016-12-01

    The splicing factor SF3B1 is the most frequently mutated gene in myelodysplastic syndromes (MDS), and is strongly associated with the presence of ring sideroblasts (RS). We have performed a systematic analysis of cryptic splicing abnormalities from RNA sequencing data on hematopoietic stem cells (HSCs) of SF3B1-mutant MDS cases with RS. Aberrant splicing events in many downstream target genes were identified and cryptic 3' splice site usage was a frequent event in SF3B1-mutant MDS. The iron transporter ABCB7 is a well-recognized candidate gene showing marked downregulation in MDS with RS. Our analysis unveiled aberrant ABCB7 splicing, due to usage of an alternative 3' splice site in MDS patient samples, giving rise to a premature termination codon in the ABCB7 mRNA. Treatment of cultured SF3B1-mutant MDS erythroblasts and a CRISPR/Cas9-generated SF3B1-mutant cell line with the nonsense-mediated decay (NMD) inhibitor cycloheximide showed that the aberrantly spliced ABCB7 transcript is targeted by NMD. We describe cryptic splicing events in the HSCs of SF3B1-mutant MDS, and our data support a model in which NMD-induced downregulation of the iron exporter ABCB7 mRNA transcript resulting from aberrant splicing caused by mutant SF3B1 underlies the increased mitochondrial iron accumulation found in MDS patients with RS.

  2. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  3. Interaction of FKBP5 Gene Variants and Adverse Life Events in Predicting Depression Onset: Results From a 10-Year Prospective Community Study

    Science.gov (United States)

    Zimmermann, Petra; Brückl, Tanja; Nocon, Agnes; Pfister, Hildegard; Binder, Elisabeth B.; Uhr, Manfred; Lieb, Roselind; Moffitt, Terrie E.; Caspi, Avshalom; Holsboer, Florian; Ising, Marcus

    2013-01-01

    Objective The binding protein FKBP5 is an important modulator of the function of the glucocorticoid receptor, the main receptor of the stress horm one system. This turns the FKBP5 gene into a key candidate for gene-environment interactions, which are considered critical for pathogenesis of stress-related disorders. The authors explored gene-environment interactions between FKBP5 gene variants and adverse life events in predicting the first occurrence of a major depressive episode. Method The analyses were based on 884 Caucasians in a 10-year prospective community study. At baseline, they were 14–24 years old and did not fulfill criteria for a major depressive episode. The DSM-IV-based Munich Composite International Diagnostic Interview was used to assess adverse life events preceding baseline and major depressive episodes during follow-up. On the basis of previous findings, five single-nucleotide polymorphisms (SNPs) within the FKBP5 gene were selected for genotyping. Results While the authors did not observe genetic main effects, they found interactions between the five SNPs and traumatic (but not separation) events, with the strongest effect for severe trauma. The effect of trauma on incident major depressive episodes was evident among subjects homozygous for the minor alleles but not subjects with other genotypes. The findings were replicated in the U.K. Environmental Risk Longitudinal Twin Study. Conclusions These hypothesis-driven results suggest that an interaction between FKBP5 genotype and trauma is involved in the onset of depression. Subjects homozygous for the minor alleles of the investigated FKBP5 SNPs seem to be particularly sensitive to effects of trauma exposure in terms of triggering depression onset. PMID:21865530

  4. Correlating Inferred Data Plane IPV6 Reboot Events With Control Plane BGP Activity

    Science.gov (United States)

    2016-03-01

    the network at the time of our analysis . There are changes to routing throughout the Internet for many reasons, and tracking changes between each...of border routers and global routing events pertaining to the prefixes announced by those routers. We provide our results and analysis in this chapter...traceroute data used to build the AS graph and determine border routers are from a single snapshot in time. In our analysis , we use the RIB and traceroute

  5. Comparison of the X-ray emission from Tidal Disruption Events with those of Active Galactic Nuclei

    OpenAIRE

    Auchettl, Katie; Ramirez-Ruiz, Enrico; Guillochon, James

    2017-01-01

    One of the main challenges of current tidal disruption events (TDEs) studies is that emission arising from AGN activity may potentially mimic the expected X-ray emission of TDEs. This makes it difficult to cleanly disentangle these two components without significant multiwavelength follow up. Here we compare the X-ray properties of TDEs with those of AGN to determine a set of characteristics which would allow us to discriminate between flares arising from these two objects. We find that at pe...

  6. Differential Effects of Active Attention and Age on Event-related Potentials to Visual and Olfactory Stimuli

    Science.gov (United States)

    Morgan, Charlie D.; Murphy, Claire

    2011-01-01

    Normal aging impairs olfactory functioning both centrally and peripherally. The P3 peak of the event related potential (ERP), evoked by active response to a target stimulus, is considered a reflection of central cognitive processing. It can also be evoked in a passive task to both auditory and visual stimuli. Our goal was to investigate whether age influences amplitude and latency of the ERP differentially in active and passive tasks to olfactory stimuli. Olfactory and visual event-related potentials were elicited with a single-stimulus paradigm in separate active and passive task response conditions. Participants included 30 healthy individuals from three age groups, young, middle age, and older adults. Results indicated that P3 ERP latency increased with age in both sensory modalities. P3 latencies for active versus passive tasks were similar across age groups for visual ERPs, but in the olfactory modality, older adults demonstrated significantly longer latencies in the passive task compared to the active task. Future directions should include research on specific clinical populations utilizing active versus passive task conditions. PMID:20688110

  7. Interlinked DNA nano-circles for measuring topoisomerase II activity at the level of single decatenation events

    DEFF Research Database (Denmark)

    Kristoffersen, Emil L; Jørgensen, Asger Givskov; Jørgensen, Line A

    2017-01-01

    DNA nano-structures present appealing new means for monitoring different molecules. Here, we demonstrate the assembly and utilization of a surface-attached double-stranded DNA catenane composed of two intact interlinked DNA nano-circles for specific and sensitive measurements of the life essential...... topoisomerase II (Topo II) enzyme activity. Topo II activity was detected via the numeric release of DNA nano-circles, which were visualized at the single-molecule level in a fluorescence microscope upon isothermal amplification and fluorescence labeling. The transition of each enzymatic reaction...... to a micrometer sized labeled product enabled quantitative detection of Topo II activity at the single decatenation event level rendering activity measurements in extracts from as few as five cells possible. Topo II activity is a suggested predictive marker in cancer therapy and, consequently, the described...

  8. Amplification of hTERT and hTERC genes in leukemic cells with high expression and activity of telomerase.

    Science.gov (United States)

    Nowak, Tomasz; Januszkiewicz, Danuta; Zawada, Mariola; Pernak, Monika; Lewandowski, Krzysztof; Rembowska, Jolanta; Nowicka, Karina; Mankowski, Przemyslaw; Nowak, Jerzy

    2006-08-01

    Reactivation of telomerase plays an important role in carcinogenesis. Malignant cells almost always possess high activity and expression of telomerase. The aim of this study was to see whether there is any relationship between telomerase activity and expression and hTERT and hTERC gene amplification in acute lymphoblastic leukemia (ALL) and non-lymphoblastic leukemia (ANLL) cells. In addition telomere length was tested in leukemic cells at the time of diagnosis and during remission. Expression of the three components of telomerase (hTERT, hTERC and TP1) as well as telomerase activity was found both in ALL and ANLL cells. Telomerase activity was diminished in patients in remission. The leukemic cells showed considerable heterogeneity of terminal restriction fragments, that is telomere length. ALL cells showed a variable pattern of telomere length in contrast to ANLL cells which produced a predominantly short telomere pattern. Telomere length in the lymphocytes of leukemia patients was shorter in remission as compared to the time of diagnosis. FISH analysis revealed amplification of hTERT and hTERC genes in ALL and ANLL cells. Quantitative analysis showed that leukemic cells possess higher number of hTERT and hTERC copies than the normal PBL. Our results suggest that the activation of telomerase in leukemic cells is connected with amplification of hTERT and hTERC genes. The high expression and activity of telomerase found in leukemic cells may be partially explained by amplified hTERT and hTERC genes. Amplification of the telomerase genes seems to be a common event in carcinogenesis and may play a role in telomerase reactivation leading to cell immortalization.

  9. Activity changes of the cat paraventricular hypothalamus during phasic respiratory events

    DEFF Research Database (Denmark)

    Kristensen, Morten Pilgaard; Poe, G R; Rector, D M;

    1997-01-01

    We monitored the spatiotemporal organization of cellular activity in the medial paraventricular hypothalamus during spontaneously-occurring periods of increased inspiratory effort followed by prolonged respiratory pauses (sigh/apnea) in the freely-behaving cat. Paraventricular hypothalamic activity...

  10. The Risk Assessment of Adverse Events of Nursing Activities as the Element of Quality Management in Healhcare

    Directory of Open Access Journals (Sweden)

    Wiśniewska Malgorzata Z.

    2015-02-01

    Full Text Available The purpose of the paper is to present MedCARVER+Shock method and Pareto analysis and its usability for the risk assessment of adverse events of nursing activities. 888 activities carried out by all 190 nurses working at the District Hospital X located in Poland were taken into account. During the research the qualitative approach was used. As the result sixteen groups of nursing activities causing the highest risk of adverse events were selected. Special attention required in: admission of a patient to the ward, sterilization, verbal communication with the patient, using of intravenous cannulas, needles, syringes, devices for transfusion of infusion liquids, servicing of hospital rooms, first aid in life-threatening situations, using medical devices and equipment. Ten basic causes of the risk of adverse events were identified, among others: lack of trainings, of modern equipment, of staff, failure to comply with procedures, lack of staff supervision, poor quality of ancillary materials, lack of management commitment. Finally MedCARVER+Shock method and Pareto analysis usability has been confirmed but it appeared that it is time-consuming and requires support from skilled professionals. Several suggestions have been put forward to improve the utility of MedCARVER+Shock.

  11. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    Science.gov (United States)

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  12. Building gene expression signatures indicative of transcription factor activation to predict AOP modulation

    Science.gov (United States)

    Building gene expression signatures indicative of transcription factor activation to predict AOP modulation Adverse outcome pathways (AOPs) are a framework for predicting quantitative relationships between molecular initiatin...

  13. Capturing the biological impact of CDKN2A and MC1R genes as an early predisposing event in melanoma and non melanoma skin cancer

    Science.gov (United States)

    Puig-Butille, Joan Anton; Escámez, María José; Garcia-Garcia, Francisco; Tell-Marti, Gemma; Fabra, Àngels; Martínez-Santamaría, Lucía; Badenas, Celia; Aguilera, Paula; Pevida, Marta; Dopazo, Joaquín; del Río, Marcela; Puig, Susana

    2014-01-01

    Germline mutations in CDKN2A and/or red hair color variants in MC1R genes are associated with an increased susceptibility to develop cutaneous melanoma or non melanoma skin cancer. We studied the impact of the CDKN2A germinal mutation p.G101W and MC1R variants on gene expression and transcription profiles associated with skin cancer. To this end we set-up primary skin cell co-cultures from siblings of melanoma prone-families that were later analyzed using the expression array approach. As a result, we found that 1535 transcripts were deregulated in CDKN2A mutated cells, with over-expression of immunity-related genes (HLA-DPB1, CLEC2B, IFI44, IFI44L, IFI27, IFIT1, IFIT2, SP110 and IFNK) and down-regulation of genes playing a role in the Notch signaling pathway. 3570 transcripts were deregulated in MC1R variant carriers. In particular, genes related to oxidative stress and DNA damage pathways were up-regulated as well as genes associated with neurodegenerative diseases such as Parkinson’s, Alzheimer and Huntington. Finally, we observed that the expression signatures indentified in phenotypically normal cells carrying CDKN2A mutations or MC1R variants are maintained in skin cancer tumors (melanoma and squamous cell carcinoma). These results indicate that transcriptome deregulation represents an early event critical for skin cancer development. PMID:24742402

  14. Variation in key genes of serotonin and norepinephrine function predicts gamma-band activity during goal-directed attention.

    Science.gov (United States)

    Enge, Sören; Fleischhauer, Monika; Lesch, Klaus-Peter; Reif, Andreas; Strobel, Alexander

    2014-05-01

    Recent evidence shows that genetic variations in key regulators of serotonergic (5-HT) signaling explain variance in executive tasks, which suggests modulatory actions of 5-HT on goal-directed selective attention as one possible underlying mechanism. To investigate this link, 130 volunteers were genotyped for the 5-HT transporter gene-linked polymorphic region (5-HTTLPR) and for a variation (TPH2-703 G/T) of the TPH2 gene coding for the rate-limiting enzyme of 5-HT synthesis in the brain. Additionally, a functional polymorphism of the norepinephrine transporter gene (NET -3081 A/T) was considered, which was recently found to predict attention and working memory processes in interaction with serotonergic genes. The flanker-based Attention Network Test was used to assess goal-directed attention and the efficiency of attentional networks. Event-related gamma-band activity served to indicate selective attention at the intermediate phenotype level. The main findings were that 5-HTTLPR s allele and TPH2 G-allele homozygotes showed increased induced gamma-band activity during target processing when combined with the NET A/A genotype compared with other genotype combinations, and that gamma activity mediates the genotype-specific effects on task performance. The results further support a modulatory role of 5-HT and NE function in the top-down attentional selection of motivationally relevant over competing or irrelevant sensory input.

  15. Xenoestrogenic gene expression: structural features of active polycyclic aromatic hydrocarbons.

    Science.gov (United States)

    Schultz, T Wayne; Sinks, Glendon D

    2002-04-01

    Estrogenicity was assessed using the Saccharomyces cerevisiae-based Lac-Z reporter assay and was reported as the logarithm of the inverse of the 50% molar beta-galactosidase activity (log[EC50(-1)]). In an effort to quantify the relationship between molecular structure of polycyclic aromatic hydrocarbons (PAHs) and estrogenic gene expression, a series of PAHs were evaluated. With noted exceptions, the results of these studies indicate that the initial two-dimensional structural warning for estrogenicity, the superpositioning of a hydroxylated aromatic system on the phenolic A-ring of 17-beta-estradiol, can be extended to the PAHs. This two-dimensional-alignment criterion correctly identified estrogenicity of 22 of the 29 PAHs evaluated. Moreover, the estrogenic potency of these compounds was directly related to the size of the hydrophobic backbone. The seven compounds classified incorrectly by this structural feature were either dihydroxylated naphthalenes or aromatic nitrogen-heterocyclic compounds; all such compounds were false positives. Results with dihydroxylated naphthalenes reveal derivatives that were nonestrogenic when superimposed on the phenolic A-ring of 17-beta-estradiol had the second hydroxyl group in the position of the C-ring or were catechol-like in structure. Structural alerts for nitrogen-heterocyclic compounds must take into account the position of the hydroxyl group and the in-ring nitrogen atom; compounds with the hydroxyl group and nitrogen atom involved with the same ring were observed to be nonactive.

  16. Reconstruction of fire spread within wildland fire events in Northern Eurasia from the MODIS active fire product

    Science.gov (United States)

    Loboda, T. V.; Csiszar, I. A.

    2007-04-01

    Russian boreal forests have been reshaped by wildland fire for millennia. While fire is a natural component of boreal ecosystems, it impacts various aspects of the environment and affects human well-being. Often fires occur over large remote areas with limited access, which makes their ground-based observation difficult. A significant progress has been made in mapping burned area from satellite imagery, which provides consistent and fairly unbiased estimates of fire impact on areas of interest at multiple scales. Although the information provided by burned area products is highly important, the spatio-temporal dynamics of individual fire events and their impact are less known. In high northern latitudes of Northern Eurasia, MODIS (Moderate Resolution Imaging Spectroradiometer) makes up to four daily observations from each of the Terra and Aqua satellites providing consistent data on fire development with high temporal frequency. Here we introduce an approach to reconstruct the development of fire events based on active fire detections from MODIS. Fire Spread Reconstruction (FSR) provides a means for characterization of fire occurrence over large territories from remotely sensed data. Individual fire detections are clustered within a GIS environment based on a set of rules determining proximity between fire observations in space and time. FSR determines the number of fire events, their approximate size, duration, and fire spread rate and allows for the analysis of fire occurrence and spread as a function of vegetation, fire season, fire weather and other parameters. FSR clusters were compared to burned scars mapped from Landsat7/ETM+ imagery over Yakutia (Russia). While some smaller burn scars were found to be formed through a continuous burning of a single fire event, large burned areas in Siberia were created by a constellation of fire events incorporating over 100 individual fire clusters. Geographic regions were found to have a stronger influence on the rates of

  17. Comparison of gene activation by two TAL effectors from Xanthomonas axonopodis pv. manihotis reveals candidate host susceptibility genes in cassava.

    Science.gov (United States)

    Cohn, Megan; Morbitzer, Robert; Lahaye, Thomas; Staskawicz, Brian J

    2016-08-01

    Xanthomonas axonopodis pv. manihotis (Xam) employs transcription activator-like (TAL) effectors to promote bacterial growth and symptom formation during infection of cassava. TAL effectors are secreted via the bacterial type III secretion system into plant cells, where they are directed to the nucleus, bind DNA in plant promoters and activate the expression of downstream genes. The DNA-binding activity of TAL effectors is carried out by a central domain which contains a series of repeat variable diresidues (RVDs) that dictate the sequence of bound nucleotides. TAL14Xam668 promotes virulence in Xam strain Xam668 and has been shown to activate multiple cassava genes. In this study, we used RNA sequencing to identify the full target repertoire of TAL14Xam668 in cassava, which includes over 50 genes. A subset of highly up-regulated genes was tested for activation by TAL14CIO151 from Xam strain CIO151. Although TAL14CIO151 and TAL14Xam668 differ by only a single RVD, they display differential activation of gene targets. TAL14CIO151 complements the TAL14Xam668 mutant defect, implying that shared target genes are important for TAL14Xam668 -mediated disease susceptibility. Complementation with closely related TAL effectors is a novel approach to the narrowing down of biologically relevant susceptibility genes of TAL effectors with multiple targets. This study provides an example of how TAL effector target activation by two strains within a single species of Xanthomonas can be dramatically affected by a small change in RVD-nucleotide affinity at a single site, and reflects the parameters of RVD-nucleotide interaction determined using designer TAL effectors in transient systems.

  18. Disease activity and lifestyle influence comorbidities and cardiovascular events in patients with acromegaly.

    Science.gov (United States)

    Sardella, Chiara; Cappellani, Daniele; Urbani, Claudio; Manetti, Luca; Marconcini, Giulia; Tomisti, Luca; Lupi, Isabella; Rossi, Giuseppe; Scattina, Ilaria; Lombardi, Martina; Di Bello, Vitantonio; Marcocci, Claudio; Martino, Enio; Bogazzi, Fausto

    2016-11-01

    The primary objective of this study is to identify the predictors of comorbidities and major adverse cardiovascular events (MACE) that can develop after diagnosis of acromegaly. The role of therapy for acromegaly in the event of such complications was also evaluated. Retrospective cohort study was conducted on 200 consecutive acromegalic patients in a tertiary referral center. The following outcomes were evaluated: diabetes, hypertension and MACE. Each patient was included in the analysis of a specific outcome, unless they were affected when acromegaly was diagnosed, and further classified as follows: (i) in remission after adenomectomy (Hx), (ii) controlled by somatostatin analogues (SSA) (SSAc) or (iii) not controlled by SSA (SSAnc). Data were evaluated using Cox regression analysis. After diagnosis of acromegaly, diabetes occurred in 40.8% of patients. The SSAnc group had a three-fold higher risk of diabetes (HR: 3.32, P = 0.006), whereas the SSAc group had a 1.4-fold higher risk of diabetes (HR: 1.43, P = 0.38) compared with the Hx group. Hypertension occurred in 35.5% of patients, after diagnosis. The determinants of hypertension were age (HR: 1.06, P = 0.01) and BMI (HR: 1.05, P = 0.01). MACE occurred in 11.8% of patients, after diagnosis. Age (HR: 1.09, P = 0.005) and smoking habit (HR: 5.95, P = 0.01) were predictors of MACE. Conversely, therapy for acromegaly did not influence hypertension or MACE. After diagnosis of acromegaly, control of the disease (irrespective of the type of treatment) and lifestyle are predictors of comorbidities and major adverse cardiovascular events. © 2016 European Society of Endocrinology.

  19. Analysis of the interferon gamma (rs2430561, +874T/A functional gene variant in relation to the presence of cardiovascular events in rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Mercedes García-Bermúdez

    Full Text Available OBJECTIVE: Rheumatoid arthritis (RA is a chronic inflammatory disease associated with increased cardiovascular (CV morbidity and mortality. Since interferon-gamma (IFN-γ has a direct effect on inflammation, in this study we assessed the potential association of the IFNG functional gene variant rs2430561 with CV disease in patients with RA. METHODS: One thousand six hundred and thirty-five patients fulfilling the 1987 American College of Rheumatology classification criteria for RA were genotyped for the IFNG (rs2430561, +874T/A gene polymorphism using TaqMan genotyping assay. Patients were stratified according to the presence of CV events or not. Logistic regression models to explain the presence of CV disease according to the IFNG rs2430561 allele distribution were performed. The potential influence of this variant in the development of subclinical atherosclerosis was also analyzed in a subgroup of patients with no history of CV events to determine carotid artery intima-media thickness (IMT (n = 286 and presence of carotid plaques. Levels of the cytokine were determined in a subgroup of patients by ELISA. RESULTS: Adjusted logistic regression model disclosed that presence of the minor allele A was not associated with increased risk of suffering CV events in RA patients. Besides, differences did not achieve statistical significance regarding carotid IMT and presence of carotid plaques in RA patients carrying IFNG rs2430561 variant allele. Levels of IFN-γ were higher in patients who had suffered CV events compared to patients who did not. CONCLUSION: Our results do not support a role of IFNG rs2430561 (+874T/A functional gene variant in the development of CV disease in RA patients.

  20. Stand Alone Sensor for Air Bag and Restraint System Activation in an Underbody Blast Event

    Science.gov (United States)

    2014-03-07

    Figure 5-1 – Varying B field with Velocity held constant Theory, not developed until the 60’s, holds that a phase reversal occurs at MACH1. That is...below: A ballistic pendulum model was used where the center of pressure of the event is defined as a longitudinal radius arm of 8’ from the rotation...point. This rotation point was defined as the front axial Figures 2-3 Ballistic Pendulum with Center of Pressure at 8’Longitudinally from the

  1. Observing---and Imaging---Active Galactic Nuclei with the Event Horizon Telescope

    CERN Document Server

    Fish, Vincent L; Bouman, Katherine L; Chael, Andrew A; Johnson, Michael D; Doeleman, Sheperd S; Blackburn, Lindy; Wardle, John F C; Freeman, William T

    2016-01-01

    Originally developed to image the shadow region of the central black hole in Sagittarius A* and in the nearby galaxy M87, the Event Horizon Telescope (EHT) provides deep, very high angular resolution data on other AGN sources too. The challenges of working with EHT data have spurred the development of new image reconstruction algorithms. This work briefly reviews the status of the EHT and its utility for observing AGN sources, with emphasis on novel imaging techniques that offer the promise of better reconstructions at 1.3 mm and other wavelengths.

  2. Coastal Wind Analysis Based on Active Radar in Qingdao for Olympic Sailing Event

    Science.gov (United States)

    Cartalis, C.; Stathopoulou, M.; Iacovides, S.; Stratoulias, D.; Karvounis, G.; Helmi, A.

    2008-04-01

    The impact of a major sporting event, such as the Olympic Games, is assessed for the city of Athens which hosted the Olympic Games in 2004. A special indicator depicting the quality of life in an urban environment is defined and applied so as to assess changes prior and after the Olympic Games for Athens. The estimation of the indicator is based to satellite and ground data. It is found that several areas of the overall urban agglomeration of Athens enjoy an improvement in the quality of life indicator. This is mostly due to the hosting of sporting and non sporting Olympic venues as well as due to urban regeneration and transport projects.

  3. Characterization of high-intensity, long-duration continuous auroral activity (HILDCAA) events using recurrence quantification analysis

    Science.gov (United States)

    Mendes, Odim; Oliveira Domingues, Margarete; Echer, Ezequiel; Hajra, Rajkumar; Everton Menconi, Varlei

    2017-08-01

    Considering the magnetic reconnection and the viscous interaction as the fundamental mechanisms for transfer particles and energy into the magnetosphere, we study the dynamical characteristics of auroral electrojet (AE) index during high-intensity, long-duration continuous auroral activity (HILDCAA) events, using a long-term geomagnetic database (1975-2012), and other distinct interplanetary conditions (geomagnetically quiet intervals, co-rotating interaction regions (CIRs)/high-speed streams (HSSs) not followed by HILDCAAs, and events of AE comprised in global intense geomagnetic disturbances). It is worth noting that we also study active but non-HILDCAA intervals. Examining the geomagnetic AE index, we apply a dynamics analysis composed of the phase space, the recurrence plot (RP), and the recurrence quantification analysis (RQA) methods. As a result, the quantification finds two distinct clusterings of the dynamical behaviours occurring in the interplanetary medium: one regarding a geomagnetically quiet condition regime and the other regarding an interplanetary activity regime. Furthermore, the HILDCAAs seem unique events regarding a visible, intense manifestations of interplanetary Alfvénic waves; however, they are similar to the other kinds of conditions regarding a dynamical signature (based on RQA), because it is involved in the same complex mechanism of generating geomagnetic disturbances. Also, by characterizing the proper conditions of transitions from quiescent conditions to weaker geomagnetic disturbances inside the magnetosphere and ionosphere system, the RQA method indicates clearly the two fundamental dynamics (geomagnetically quiet intervals and HILDCAA events) to be evaluated with magneto-hydrodynamics simulations to understand better the critical processes related to energy and particle transfer into the magnetosphere-ionosphere system. Finally, with this work, we have also reinforced the potential applicability of the RQA method for

  4. OVERVIEW OF THE ACTIVITIES OF THE NUCLEAR ENERGY AGENCY WORKING GROUP ON EXTERNAL EVENTS

    Energy Technology Data Exchange (ETDEWEB)

    Nakoski, John A.; Smith, Curtis L.; Kim, Min Kyu

    2016-10-01

    The Orgranisation for Economic Cooperation and Development (OECD) Nuclear Energy Agency (NEA) has established a Working Group on External Events (WGEV) that provides a forum for subject matter experts from the nuclear industry and regulators to improve the understanding and treatment of external hazards that would support the continued safety performance of nuclear installations, and improve the effectiveness of regulatory practices, in NEA member countries. This report provides a description of the ongoing work of the WGEV. The work of the WGEV includes the collection of information and conducting a workshop on severe weather and storm surge that brought together a diverse group of subject matter experts to identify commendable practices related to the treatment of severe weather and storm surge consideration in regulatory and operational decision-making. Other work of the WGEV includes looking at science-based screening of external events that are factored into decisions on the safe operation of nuclear facilities; and identification of commendable practices and knowledge gaps on riverine flooding.

  5. MYRF is a membrane-associated transcription factor that autoproteolytically cleaves to directly activate myelin genes.

    Directory of Open Access Journals (Sweden)

    Helena Bujalka

    Full Text Available The myelination of axons is a crucial step during vertebrate central nervous system (CNS development, allowing for rapid and energy efficient saltatory conduction of nerve impulses. Accordingly, the differentiation of oligodendrocytes, the myelinating cells of the CNS, and their expression of myelin genes are under tight transcriptional control. We previously identified a putative transcription factor, Myelin Regulatory Factor (Myrf, as being vital for CNS myelination. Myrf is required for the generation of CNS myelination during development and also for its maintenance in the adult. It has been controversial, however, whether Myrf directly regulates transcription, with reports of a transmembrane domain and lack of nuclear localization. Here we show that Myrf is a membrane-associated transcription factor that undergoes an activating proteolytic cleavage to separate its transmembrane domain-containing C-terminal region from a nuclear-targeted N-terminal region. Unexpectedly, this cleavage event occurs via a protein domain related to the autoproteolytic intramolecular chaperone domain of the bacteriophage tail spike proteins, the first time this domain has been found to play a role in eukaryotic proteins. Using ChIP-Seq we show that the N-terminal cleavage product directly binds the enhancer regions of oligodendrocyte-specific and myelin genes. This binding occurs via a defined DNA-binding consensus sequence and strongly promotes the expression of target genes. These findings identify Myrf as a novel example of a membrane-associated transcription factor and provide a direct molecular mechanism for its regulation of oligodendrocyte differentiation and CNS myelination.

  6. Phagocytic activity of monocytes, their subpopulations and granulocytes during post-transplant adverse events after hematopoietic stem cell transplantation.

    Science.gov (United States)

    Döring, Michaela; Cabanillas Stanchi, Karin Melanie; Erbacher, Annika; Haufe, Susanne; Schwarze, Carl Philipp; Handgretinger, Rupert; Hofbeck, Michael; Kerst, Gunter

    2015-05-01

    Phagocytosis of granulocytes and monocytes presents a major mechanism that contributes to the clearance of pathogens and cell debris. We analyzed the phagocytic activity of the peripheral blood cell monocytes, three monocyte subpopulations and granulocytes before and up to one year after hematopoietic stem cell transplantation, as well as during transplant-related adverse events. 25 pediatric patients and young adults (median age of 11.0 years) with hemato-oncological malignancies and non malignancies were enrolled in the prospective study. Ingestion of fluorescence-labeled Escherichia coli bacteria was used to assess the phagocytic activity of monocytes and their subpopulations and granulocytes by means of flow cytometry in the patient group as well as in a control group (n=36). During sepsis, a significant increase of phagocytic activity of monocytes (P=0.0003) and a significant decrease of the phagocytic activity of granulocytes (P=0.0003) and the CD14+ CD16++ monocyte subpopulation (P=0.0020) occurred. At the onset of a veno-occlusive disease, a significant increase of phagocytic activity in the CD14++ CD16+ monocyte subpopulation (P=0.001) and a significant decrease in the phagocytic activity of the CD14++ CD16- monocyte subpopulation (P=0.0048) were observed. In conclusion, the phagocytic activity of monocytes, their subpopulations and granulocytes might be a useful and easy determinable parameter that enables identification of post-transplant complications after hematopoietic stem cell transplantation. The alterations of phagocytic activity contribute to the altered immune response that accompanies adverse events after hematopoietic stem cell transplantation.

  7. Late Quaternary climatic events and sea-level changes recorded by turbidite activity, Dakar Canyon, NW Africa

    Science.gov (United States)

    Pierau, Roberto; Hanebuth, Till J. J.; Krastel, Sebastian; Henrich, Rüdiger

    2010-03-01

    The relationship of sea-level changes and short-term climatic changes with turbidite deposition is poorly documented, although the mechanisms of gravity-driven sediment transport in submarine canyons during sea-level changes have been reported from many regions. This study focuses on the activity of the Dakar Canyon off southern Senegal in response to major glacial/interglacial sea-level shifts and variability in the NW-African continental climate. The sedimentary record from the canyon allows us to determine the timing of turbidite events and, on the basis of XRF-scanning element data, we have identified the climate signal at a sub-millennial time scale from the surrounding hemipelagic sediments. Over the late Quaternary the highest frequency in turbidite activity in the Dakar Canyon is confined to major climatic terminations when remobilisation of sediments from the shelf was triggered by the eustatic sea-level rise. However, episodic turbidite events coincide with the timing of Heinrich events in the North Atlantic. During these times continental climate has changed rapidly, with evidence for higher dust supply over NW Africa which has fed turbidity currents. Increased aridity and enhanced wind strength in the southern Saharan-Sahelian zone may have provided a source for this dust.

  8. Response of Extreme Precipitation to Solar Activity and El Nino Events in Typical Regions of the Loess Plateau

    Directory of Open Access Journals (Sweden)

    H. J. Li

    2017-01-01

    Full Text Available Extreme climatic oscillation has been the subject of global attention. The purpose of this study is to explore the response of extreme precipitation to solar activity and El Nino events in typical regions of the Loess Plateau—a case study in the Yan’an area. The precipitation data was from nine weather stations in Yan’an and the sunspot number and the Southern Oscillation Index (SOI were from 1951 to 2015. The results show that maximum precipitation occurred mainly at the peak sunspot number or 2a near it and the sunspot number minimum and valley values were not significantly correlated. The results of Morlet wavelet showed that a 41-year period of precipitation was the most obvious within the 64-year scale. Similarly, sunspot number showed a 16-year periodic variability. Correlation analyses of the 16-year and 41-year scales demonstrated that the relationships between precipitation and sunspot number were close. In addition, extreme precipitation often occurred in the year following El Nino events. According to 10-year moving average curves, precipitation generally showed a downward trend when SOI was negative. The results indicate that solar activity and El Nino events had significant impacts on precipitation in typical regions of the Loess Plateau.

  9. Physical Activity and Vascular Events and Mortality in Patients with Vascular Disease

    NARCIS (Netherlands)

    Boss, H. Myrthe; Kappelle, L. Jaap; Van der Graaf, Yolanda; Kooistra, Minke; Visseren, Frank L. J.; Geerlings, Mirjam I.

    2015-01-01

    Introduction: In patients with CAD, moderate levels of leisure time physical activity are associated with lower risk of mortality. However, less is known about the effects in patients with vascular disease other than CAD. In this study, we examined the association between physical activity and risk

  10. Evaluation of an active multi-body human model for braking and frontal crash events

    NARCIS (Netherlands)

    Meijer, R.; Elrofai, H.B.H.; Broos, W.J.C.; Hassel, E. van

    2013-01-01

    Active safety systems that start to act moments before the crash might be capable of anticipating the occupant’s position, either by correcting it, or by taking the out-of-position into account. For the development and evaluation of such active safety systems, recently a run-time efficient

  11. Developing Clinical Competency in Crisis Event Management: An Integrated Simulation Problem-Based Learning Activity

    Science.gov (United States)

    Liaw, S. Y.; Chen, F. G.; Klainin, P.; Brammer, J.; O'Brien, A.; Samarasekera, D. D.

    2010-01-01

    This study aimed to evaluate the integration of a simulation based learning activity on nursing students' clinical crisis management performance in a problem-based learning (PBL) curriculum. It was hypothesized that the clinical performance of first year nursing students who participated in a simulated learning activity during the PBL session…

  12. Developing Clinical Competency in Crisis Event Management: An Integrated Simulation Problem-Based Learning Activity

    Science.gov (United States)

    Liaw, S. Y.; Chen, F. G.; Klainin, P.; Brammer, J.; O'Brien, A.; Samarasekera, D. D.

    2010-01-01

    This study aimed to evaluate the integration of a simulation based learning activity on nursing students' clinical crisis management performance in a problem-based learning (PBL) curriculum. It was hypothesized that the clinical performance of first year nursing students who participated in a simulated learning activity during the PBL session…

  13. Detecting microRNA activity from gene expression data.

    LENUS (Irish Health Repository)

    Madden, Stephen F

    2010-01-01

    BACKGROUND: MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. RESULTS: Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. CONCLUSIONS: We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  14. Detecting microRNA activity from gene expression data

    LENUS (Irish Health Repository)

    Madden, Stephen F

    2010-05-18

    Abstract Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  15. Genetic and physiological activation of osmosensitive gene expression mimics transcriptional signatures of pathogen infection in C. elegans.

    Directory of Open Access Journals (Sweden)

    Anne-Katrin Rohlfing

    Full Text Available The soil-dwelling nematode C. elegans is a powerful system for comparative molecular analyses of environmental stress response mechanisms. Infection of worms with bacterial and fungal pathogens causes the activation of well-characterized innate immune transcriptional programs in pathogen-exposed hypodermal and intestinal tissues. However, the pathophysiological events that drive such transcriptional responses are not understood. Here, we show that infection-activated transcriptional responses are, in large part, recapitulated by either physiological or genetic activation of the osmotic stress response. Microarray profiling of wild type worms exposed to non-lethal hypertonicity identified a suite of genes that were also regulated by infection. Expression profiles of five different osmotic stress resistant (osr mutants under isotonic conditions reiterated the wild type transcriptional response to osmotic stress and also showed substantial similarity to infection-induced gene expression under isotonic conditions. Computational, transgenic, and functional approaches revealed that two GATA transcription factors previously implicated in infection-induced transcriptional responses, elt-2 and elt-3, are also essential for coordinated tissue-specific activation of osmosensitive gene expression and promote survival under osmotically stressful conditions. Together, our data suggest infection and osmotic adaptation share previously unappreciated transcriptional similarities which might be controlled via regulation of tissue-specific GATA transcription factors.

  16. [Analysis of policies in activating the Infectious Disease Specialist Network (IDSN) for bioterrorism events].

    Science.gov (United States)

    Kim, Yang Soo

    2008-07-01

    Bioterrorism events have worldwide impacts, not only in terms of security and public health policy, but also in other related sectors. Many countries, including Korea, have set up new administrative and operational structures and adapted their preparedness and response plans in order to deal with new kinds of threats. Korea has dual surveillance systems for the early detection of bioterrorism. The first is syndromic surveillance that typically monitors non-specific clinical information that may indicate possible bioterrorism-associated diseases before specific diagnoses are made. The other is infectious disease specialist network that diagnoses and responds to specific illnesses caused by intentional release of biologic agents. Infectious disease physicians, clinical microbiologists, and infection control professionals play critical and complementary roles in these networks. Infectious disease specialists should develop practical and realistic response plans for their institutions in partnership with local and state health departments, in preparation for a real or suspected bioterrorism attack.

  17. 2012 volcanic activity in Alaska: summary of events and response of the Alaska Volcano Observatory

    Science.gov (United States)

    Herrick, Julie A.; Neal, Christina A.; Cameron, Cheryl E.; Dixon, James P.; McGimsey, Robert G.

    2014-01-01

    The Alaska Volcano Observatory (AVO) responded to eruptions, possible eruptions, volcanic unrest, or suspected unrest at 11 volcanic centers in Alaska during 2012. Of the two verified eruptions, one (Cleveland) was clearly magmatic and the other (Kanaga) was most likely a single phreatic explosion. Two other volcanoes had notable seismic swarms that probably were caused by magmatic intrusions (Iliamna and Little Sitkin). For each period of clear volcanic unrest, AVO staff increased monitoring vigilance as needed, reviewed eruptive histories of the volcanoes in question to help evaluate likely outcomes, and shared observations and interpretations with the public. 2012 also was the 100th anniversary of Alaska’s Katmai-Novarupta eruption of 1912, the largest eruption on Earth in the 20th century and one of the most important volcanic eruptions in modern times. AVO marked this occasion with several public events.

  18. Continuous active surveillance of adverse events following immunisation using SMS technology.

    Science.gov (United States)

    Westphal, Darren W; Williams, Stephanie A; Leeb, Alan; Effler, Paul V

    2016-06-17

    On-going post-licensure surveillance of adverse events following immunisation (AEFI) is critical to detecting and responding to potentially serious adverse events in a timely manner. SmartVax is a vaccine safety monitoring tool that uses automated data extraction from existing practice management software and short message service (SMS) technology to follow-up vaccinees in real-time. We report on childhood vaccine safety surveillance using SmartVax at a medical practice in Perth, Western Australia. Parents of all children under age five years who were vaccinated according to the Australian National Immunisation Schedule between November 2011 and June 2015 were sent an SMS three days post administration to enquire whether the child had experienced a suspected vaccine reaction. Affirmative replies triggered a follow-up SMS requesting details of the reaction(s) via a link to a survey that could be completed using a smartphone or the web. Rates of reported AEFI including fever, headache, fatigue, rash, vomiting, diarrhoea, rigours, seizures, and local reactions were calculated by vaccination time point. Overall, 239 (8.2%; 95% CI 7.2-9.2%) possible vaccine reactions were reported for 2897 vaccination visits over the 44 month time period. The proportion of children experiencing a possible AEFI, mostly local reactions, was significantly greater following administration of diphtheria-tetanus-pertussis-poliomyelitis vaccine at 4 years of age (77/441; 17.5%; 95% CI 13.9-21.0%) compared to the vaccinations given at 2-18 months (p<0.001). Across all time points, local reactions and fatigue were the most frequently reported AEFI. Automated SMS-based reporting can facilitate sustainable, real-time, monitoring of adverse reactions and contribute to early identification of potential vaccine safety issues. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Association of β-adrenergic receptor genes polymorphisms with incidence of subsequent cardiovascular events in Han Chinese patients with coronary artery disease

    Institute of Scientific and Technical Information of China (English)

    LI Zhi-gen; WU Hong; ZHOU Ying-ling; CHEN Zhu-jun; MENG Jin-xiu; YANG Jun-qing; CHEN Ji-yan

    2013-01-01

    Background Sequence variants in the β-adrenergic receptor (ADRB) genes have a close relationship with the development of coronary artery disease (CAD) and the patient's prognosis.However,there is a lack of data on the role of the variants in ADRBs genes in Han Chinese patients with CAD.We aimed to investigate the association of genetic variants in the ADRB1 and ADRB2 genes with the incidence of major adverse cardiac event (MACE) in Han Chinese patients with CAD.Methods A total of 545 Han Chinese patients with CAD undergoing percutaneous coronary intervention (PCI) were recruited to the study and followed for one year.Three variant sites in ADRB1 (rs1801253) and ADRB2 (rs1042713 and rs1042714) were genotyped.The effect of the ADRB1 and ADRB2 genotypes on MACE within one year was assessed.Results There were 47 cases of MACE during follow-up.There was no significant difference in the incidence of MACE among patients carrying different genotypes of the three variants in ADRB1 and ADRB2 (Log-rank,all P >0.05).Cox regression analysis showed no association between three variants in ADRB1 and ADRB2 genes and the incidence of MACE during one-year follow-up,the adjusted hazard ratios (95% confidence interval) for rs1801253,rs1042713 and rs1042714 were 1.05 (0.54-2.02),1.24 (0.58-2.64) and 1.66 (0.81-3.42),respectively.Conclusion Our data did not support a relationship between the three polymorphisms of ADRB1 (rs1801253) and ADRB2 (rs1042713 and rs1042714) genes and risk of subsequent cardiovascular events after PCI in Han Chinese patients with CAD.

  20. Algorithms for the analysis of ensemble neural spiking activity using simultaneous-event multivariate point-process models.

    Science.gov (United States)

    Ba, Demba; Temereanca, Simona; Brown, Emery N

    2014-01-01

    Understanding how ensembles of neurons represent and transmit information in the patterns of their joint spiking activity is a fundamental question in computational neuroscience. At present, analyses of spiking activity from neuronal ensembles are limited because multivariate point process (MPP) models cannot represent simultaneous occurrences of spike events at an arbitrarily small time resolution. Solo recently reported a simultaneous-event multivariate point process (SEMPP) model to correct this key limitation. In this paper, we show how Solo's discrete-time formulation of the SEMPP model can be efficiently fit to ensemble neural spiking activity using a multinomial generalized linear model (mGLM). Unlike existing approximate procedures for fitting the discrete-time SEMPP model, the mGLM is an exact algorithm. The MPP time-rescaling theorem can be used to assess model goodness-of-fit. We also derive a new marked point-process (MkPP) representation of the SEMPP model that leads to new thinning and time-rescaling algorithms for simulating an SEMPP stochastic process. These algorithms are much simpler than multivariate extensions of algorithms for simulating a univariate point process, and could not be arrived at without the MkPP representation. We illustrate the versatility of the SEMPP model by analyzing neural spiking activity from pairs of simultaneously-recorded rat thalamic neurons stimulated by periodic whisker deflections, and by simulating SEMPP data. In the data analysis example, the SEMPP model demonstrates that whisker motion significantly modulates simultaneous spiking activity at the 1 ms time scale and that the stimulus effect is more than one order of magnitude greater for simultaneous activity compared with non-simultaneous activity. Together, the mGLM, the MPP time-rescaling theorem and the MkPP representation of the SEMPP model offer a theoretically sound, practical tool for measuring joint spiking propensity in a neuronal ensemble.

  1. TALE activators regulate gene expression in a position- and strand-dependent manner in mammalian cells.

    Science.gov (United States)

    Uhde-Stone, Claudia; Cheung, Edna; Lu, Biao

    2014-01-24

    Transcription activator-like effectors (TALEs) are a class of transcription factors that are readily programmable to regulate gene expression. Despite their growing popularity, little is known about binding site parameters that influence TALE-mediated gene activation in mammalian cells. We demonstrate that TALE activators modulate gene expression in mammalian cells in a position- and strand-dependent manner. To study the effects of binding site location, we engineered TALEs customized to recognize specific DNA sequences located in either the promoter or the transcribed region of reporter genes. We found that TALE activators robustly activated reporter genes when their binding sites were located within the promoter region. In contrast, TALE activators inhibited the expression of reporter genes when their binding sites were located on the sense strand of the transcribed region. Notably, this repression was independent of the effector domain utilized, suggesting a simple blockage mechanism. We conclude that TALE activators in mammalian cells regulate genes in a position- and strand-dependent manner that is substantially different from gene activation by native TALEs in plants. These findings have implications for optimizing the design of custom TALEs for genetic manipulation in mammalian cells.

  2. Up-stream and Down-stream Events in the NF-kB Activation Cascade in Response to Sparsely and Densely Ionizing Radiation

    Science.gov (United States)

    Langen, Britta; Hellweg, Christine; Baumstark-Khan, Christa; Ruscher, Roland; Schmitz, Claudia; Arenz, Andrea; Lau, Patrick; Meier, Matthias M.; Testard, Isabelle; Reitz, Guenther

    Radiation is a potentially limiting factor for long term orbital and interplanetary missions. Long-term exposure to galactic cosmic rays may shorten the healthy life-span after return to Earth due to cancer induction. During the mission, a solar flare can be life threatening. For better risk estimation and development of appropriate countermeasures, the study of the cellular radiation response is necessary. As an antiapoptotic factor, if activated in human cells by exposure to components of cosmic rays, the transcription factor nuclear factor κB (NF- κB) could influence the cancer risk of astronauts exposed to cosmic radiation and improve cellular survival after exposure to high radiation doses. In previous studies using a screening assay for the detection of NF-κB-dependent gene induction (HEK-pNF-κB-d2EGFP/Neo cells), the activation of this transcription factor by heavy ions was shown (Radiat. Res. 164: 527- 530, 2005). In this work, the events upstream of NF-κB attachment to its promoter and enhancer binding sites, and downstream expression of target genes were analysed. It is supposed that the ATM kinase mediates the signal from damaged DNA in the nucleus to kinases in the cytoplasm, such as NF-κB essential modulator (NEMO). For liberation of NF-κB and its nuclear translocation, the inhibitor of NF-κB (IκB) has to be degraded in the proteasom. In order to evaluate a role of NEMO in the radiation response, the survival of murine embryonic fibroblasts expressing wildtype NEMO and lacking NEMO in response to ionizing radiation was analyzed. Lack of NEMO impairs survival after X-ray exposure. The inhibition of ATM by KU-55933 suppresses the X-ray and heavy ion (13C, 35 MeV/u, LET 70 keV/µm) induced activation of NF-κB dependent gene expression, indicating the central position of ATM in radiation induced NF-κB activation. Short-term incubation with the proteasome inhibitor MG-132 also blocks NF-κB activation by radiation. These results suggest a role of

  3. A taurine-supplemented vegan diet may blunt the contribution of neutrophil activation to acute coronary events.

    Science.gov (United States)

    McCarty, Mark F

    2004-01-01

    Neutrophils are activated in the coronary circulation during acute coronary events (unstable angina and myocardial infarction), often prior to the onset of ischemic damage. Moreover, neutrophils infiltrate coronary plaque in these circumstances, and may contribute to the rupture or erosion of this plaque, triggering thrombosis. Activated neutrophils secrete proteolytic enzymes in latent forms which are activated by the hypochlorous acid (HOCl) generated by myeloperoxidase. These phenomena may help to explain why an elevated white cell count has been found to be an independent coronary risk factor. Low-fat vegan diets can decrease circulating leukocytes--neutrophils and monocytes--possibly owing to down-regulation of systemic IGF-I activity. Thus, a relative neutropenia may contribute to the coronary protection afforded by such diets. However, vegetarian diets are devoid of taurine - the physiological antagonist of HOCl--and tissue levels of this nutrient are relatively low in vegetarians. Taurine has anti-atherosclerotic activity in animal models, possibly reflecting a role for macrophage-derived myeloperoxidase in the atherogenic process. Taurine also has platelet-stabilizing and anti-hypertensive effects that presumably could reduce coronary risk. Thus, it is proposed that a taurine-supplemented low-fat vegan diet represents a rational strategy for diminishing the contribution of activated neutrophils to acute coronary events; moreover, such a regimen would work in a number of other complementary ways to promote cardiovascular health. Moderate alcohol consumption, the well-tolerated drug pentoxifylline, and 5-lipoxygenase inhibitors--zileuton, boswellic acids, fish oil--may also have potential in this regard. Copyright 2004 Elsevier Ltd.

  4. Poised transcription factories prime silent uPA gene prior to activation.

    Directory of Open Access Journals (Sweden)

    Carmelo Ferrai

    2010-01-01

    Full Text Available The position of genes in the interphase nucleus and their association with functional landmarks correlate with active and/or silent states of expression. Gene activation can induce chromatin looping from chromosome territories (CTs and is thought to require de novo association with transcription factories. We identify two types of factory: "poised transcription factories," containing RNA polymerase II phosphorylated on Ser5, but not Ser2, residues, which differ from "active factories" associated with phosphorylation on both residues. Using the urokinase-type plasminogen activator (uPA gene as a model system, we find that this inducible gene is predominantly associated with poised (S5p(+S2p(- factories prior to activation and localized at the CT interior. Shortly after induction, the uPA locus is found associated with active (S5p(+S2p(+ factories and loops out from its CT. However, the levels of gene association with poised or active transcription factories, before and after activation, are independent of locus positioning relative to its CT. RNA-FISH analyses show that, after activation, the uPA gene is transcribed with the same frequency at each CT position. Unexpectedly, prior to activation, the uPA loci internal to the CT are seldom transcriptionally active, while the smaller number of uPA loci found outside their CT are transcribed as frequently as after induction. The association of inducible genes with poised transcription factories prior to activation is likely to contribute to the rapid and robust induction of gene expression in response to external stimuli, whereas gene positioning at the CT interior may be important to reinforce silencing mechanisms prior to induction.

  5. Targeted Editing of Myostatin Gene in Sheep by Transcription Activator-like Effector Nucleases.

    Science.gov (United States)

    Zhao, Xinxia; Ni, Wei; Chen, Chuangfu; Sai, Wujiafu; Qiao, Jun; Sheng, Jingliang; Zhang, Hui; Li, Guozhong; Wang, Dawei; Hu, Shengwei

    2016-03-01

    Myostatin (MSTN) is a secreted growth factor expressed in skeletal muscle and adipose tissue that negatively regulates skeletal muscle mass. Gene knockout of MSTN can result in increasing muscle mass in sheep. The objectives were to investigate whether myostatin gene can be edited in sheep by transcription activator-like effector nucleases (TALENs) in tandem with single-stranded DNA oligonucleotides (ssODNs). We designed a pair of TALENs to target a highly conserved sequence in the coding region of the sheep MSTN gene. The activity of the TALENs was verified by using luciferase single-strand annealing reporter assay in HEK 293T cell line. Co-transfection of TALENs and ssODNs oligonucleotides induced precise gene editing of myostatin gene in sheep primary fibroblasts. MSTN gene-edited cells were successfully used as nuclear donors for generating cloned embryos. TALENs combined with ssDNA oligonucleotides provide a useful approach for precise gene modification in livestock animals.

  6. Late Holocene environmental reconstructions and their implications on flood events, typhoon, and agricultural activities in NE Taiwan

    Science.gov (United States)

    Wang, L.-C.; Behling, H.; Lee, T.-Q.; Li, H.-C.; Huh, C.-A.; Shiau, L.-J.; Chang, Y.-P.

    2014-10-01

    We reconstructed paleoenvironmental changes from a sediment archive of a lake in the floodplain of the Ilan Plain of NE Taiwan on multi-decadal resolution for the last ca. 1900 years. On the basis of pollen and diatom records, we evaluated past floods, typhoons, and agricultural activities in this area which are sensitive to the hydrological conditions in the western Pacific. Considering the high sedimentation rates with low microfossil preservations in our sedimentary record, multiple flood events were. identified during the period AD 100-1400. During the Little Ice Age phase 1 (LIA 1 - AD 1400-1620), the abundant occurrences of wetland plant (Cyperaceae) and diatom frustules imply less flood events under stable climate conditions in this period. Between AD 500 and 700 and the Little Ice Age phase 2 (LIA 2 - AD 1630-1850), the frequent typhoons were inferred by coarse sediments and planktonic diatoms, which represented more dynamical climate conditions than in the LIA 1. By comparing our results with the reconstructed changes in tropical hydrological conditions, we suggested that the local hydrology in NE Taiwan is strongly influenced by typhoon-triggered heavy rainfalls, which could be influenced by the variation of global temperature, the expansion of the Pacific warm pool, and the intensification of El Niño-Southern Oscillation (ENSO) events.

  7. Hippocampal activity during transient respiratory events in the freely behaving cat

    DEFF Research Database (Denmark)

    Poe, G R; Kristensen, Morten Pilgaard; Rector, D M;

    1996-01-01

    We measured dorsal hippocampal activity accompanying sighs and apnea using reflectance imaging and electrophysiologic measures in freely behaving cats. Reflected 660-nm light from a 1-mm2 area of CA1 was captured during sighs and apnea at 25 Hz through a coherent image conduit coupled to a charge...

  8. Fantasy Activity and the Televiewing Event: Considerations for an Information Processing Construct of Involvement.

    Science.gov (United States)

    Lindlof, Thomas R.

    The similarities between television viewing and fantasy activity (daydreaming, reverie, mind-wandering, internal dialogue) more than warrant the building of a theoretical construct, especially in the context of recent empirical research on television viewing consequences. A construct of the television viewing process, based on cognitive theories…

  9. Fracture events in rusk roll and the effect of changing water activity

    NARCIS (Netherlands)

    Castro Prada, E.M.; Luyten, J.M.J.G.; Vliet, van T.

    2006-01-01

    Crispness is a desired sensorial property of many foods, like bread. Both fracture properties and sound emission play an important role in crispness. With aging, bread crusts become less crispy. This is often ascribed to an increase in water activity of the crusts altering the mobility of the differ

  10. A Drosophila Adh gene can be activated in trans by an enhancer.

    Science.gov (United States)

    Rothberg, I; Hotaling, E; Sofer, W

    1991-01-01

    The ability of a segment of the Drosophila Adh gene to produce ADH activity in larvae is dependent upon the presence of a 53 bp sequence (called NS1) located between 289 and 341 bp upstream of the larval transcription start site. This sequence behaves like an enhancer in that it can stimulate gene activity when it is placed at various distances from, or on either side of, an Adh gene. Like a typical enhancer, NS1 does not ordinarily function in trans. However, when an Adh gene lacking NS1 is placed on one plasmid, and a second gene carrying NS1 is placed on another, and the two plasmids are interlocked in a catenane, both genes are active. This finding supports the mechanism of loop-mediated enhancer action. Images PMID:1945848

  11. Low TLR7 gene expression in atherosclerotic plaques is associated with major adverse cardio- and cerebrovascular events

    DEFF Research Database (Denmark)

    Karadimou, Glykeria; Folkersen, Lasse; Berg, Martin;

    2016-01-01

    Aims: Processes in the development of atherosclerotic lesions can lead to plaque rupture or erosion, which can in turn elicit myocardial infarction or ischaemic stroke. The aims of this study were to determine whether Toll-like receptor 7 (TLR7) gene expression levels influence patient outcome an...

  12. DMPD: Activation of lymphokine genes in T cells: role of cis-acting DNA elements thatrespond to T cell activation signals. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 1492121 Activation of lymphokine genes in T cells: role of cis-acting DNA elements ...html) (.csml) Show Activation of lymphokine genes in T cells: role of cis-acting ...DNA elements thatrespond to T cell activation signals. PubmedID 1492121 Title Activation of lymphokine genes in T cells: role

  13. Gyrase activity and number of copies of the gyrase B subunit gene in Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Cabrera-Juarez, E.; Setlow, J.K.

    1985-11-01

    Gyrase activities in extracts of various strains of Haemophilus influenzae can differ by more than an order of magnitude. Measurements of in vitro activity and copy number indicated that most of these differences arose from variations in the number of copies of the gene for the gyrase B subunit, with some strains containing multicopy plasmids coding for that subunit. The quantitative relationship between gyrase and copy number depended on the mutations in the plasmids and in the host. The possibility that the in vivo gyrase activity did not reflect the in vitro data was explored by measurement of alkaline phosphatase and ATPase activity in the extracts. Alkaline phosphatase activity increased with increasing gyrase activity measured in vitro, but ATPase activity did not. The authors conclude that extra supercoiling enhanced transcription of the alkaline phosphatase gene but not the ATPase gene and that it is unlikely that there is much discrepancy between gyrase activity assayed in vitro and the activity in the cell.

  14. Combined passive detection and ultrafast active imaging of cavitation events induced by short pulses of high-intensity ultrasound.

    Science.gov (United States)

    Gateau, Jérôme; Aubry, Jean-François; Pernot, Mathieu; Fink, Mathias; Tanter, Mickaël

    2011-03-01

    The activation of natural gas nuclei to induce larger bubbles is possible using short ultrasonic excitations of high amplitude, and is required for ultrasound cavitation therapies. However, little is known about the distribution of nuclei in tissues. Therefore, the acoustic pressure level necessary to generate bubbles in a targeted zone and their exact location are currently difficult to predict. To monitor the initiation of cavitation activity, a novel all-ultrasound technique sensitive to single nucleation events is presented here. It is based on combined passive detection and ultrafast active imaging over a large volume using the same multi-element probe. Bubble nucleation was induced using a focused transducer (660 kHz, f-number = 1) driven by a high-power electric burst (up to 300 W) of one to two cycles. Detection was performed with a linear array (4 to 7 MHz) aligned with the single-element focal point. In vitro experiments in gelatin gel and muscular tissue are presented. The synchronized passive detection enabled radio-frequency data to be recorded, comprising high-frequency coherent wave fronts as signatures of the acoustic emissions linked to the activation of the nuclei. Active change detection images were obtained by subtracting echoes collected in the unnucleated medium. These indicated the appearance of stable cavitating regions. Because of the ultrafast frame rate, active detection occurred as quickly as 330 μs after the high-amplitude excitation and the dynamics of the induced regions were studied individually.

  15. Spatiotemporal cortical activation underlies the Müller-Lyer illusion: an event-related potentials study.

    Science.gov (United States)

    Zhang, Songyan; Du, Xue; Wu, Xin; Wei, Dongtao; Zhang, Meng; Qiu, Jiang

    2013-12-04

    Event-related brain potentials (ERPs) were used to examine the electrophysiological correlates of the visual illusion effect in the Müller-Lyer illusion tasks. The participants were presented with the context of a horizontal line with two symmetric inward-pointing arrowheads or outward-pointing arrowheads, and then, they were asked to indicate whether they perceived an increase or a decrease in the line length. The behavioral results showed that there were significant differences among the four types of tasks, which meant that participants could understand different mean illusion magnitudes. The ERP results showed that both the illusion-45 and the illusion-135 elicited a more negative ERP deflection (N180-280) than did the illusion-225 and illusion-315 between 180 and 280 ms. In addition, the strong illusion stimuli elicited a more positive ERP deflection (P280-450) than did the weak illusion stimuli between 280 and 450 ms after the onset of the stimuli. Dipole source analysis of the difference wave (illusion-135-illusion-225) indicated that one generator localized in the left lateral occipital cortex and the difference wave (illusion-45-illusion-135) indicated that one generator localized in the left lingual gyrus. Our results led us to conclude that the ERP deflection in the different illusory strength might be related to the theory of attention resource distribution or because of the inverse optics problem. Then, the early visual areas lateral occipital cortex and the lingual gyrus near to the visual cortex could contribute to integrated processing in the illusory contours and top-down control processing because of the visual experiences.

  16. Activating human genes with zinc finger proteins, transcription activator-like effectors and CRISPR/Cas9 for gene therapy and regenerative medicine.

    Science.gov (United States)

    Gersbach, Charles A; Perez-Pinera, Pablo

    2014-08-01

    New technologies have recently been developed to control the expression of human genes in their native genomic context by engineering synthetic transcription factors that can be targeted to any DNA sequence. The ability to precisely regulate any gene as it occurs naturally in the genome provides a means to address a variety of diseases and disorders. This approach also circumvents some of the traditional challenges of gene therapy. In this editorial, we review the technologies that have enabled targeted human gene activation, including the engineering of transcription factors based on zinc finger proteins, transcription activator-like effectors and the CRISPR/Cas9 system. Additionally, we highlight examples in which these methods have been developed for therapeutic applications and discuss challenges and opportunities.

  17. Type III events, flares and CMEs, in the extremely active period October-November 2003

    CERN Document Server

    Mitsakou, E; Preka-Papadema, P; Moussas, X; Hillaris, A; Caroubalos, C; Alissandrakis, C E; Tsitsipis, P; Kontogeorgos, A; Bougeret, J -L; Dumas, G; 10.1063/1.2347984

    2010-01-01

    The type III observations trace the propagation of energetic electron populations through the Solar Corona which, more often than not, precede or are associated with energy release on the Sun. A sample of Type III bursts in the range 20-650 MHz during the period of extraordinary solar activity (20 October to 4 November 2003) recorded by the ARTEMIS-IV1 radio spectrograph is analysed; its parameters are compared with characteristics of associated flares (Ha and GOES SXR) and CMEs, observed in the same period and reported in the SGR and the LASCO archives respectively. In this report we attempt to establish a correlation between energetic particles and major manifestations of solar activity such as flares and CMEs.

  18. Event based neutron activation spectroscopy and analysis algorithm using MLE and metaheuristics

    OpenAIRE

    Wallace Barton

    2014-01-01

    Techniques used in neutron activation analysis are often dependent on the experimental setup. In the context of developing a portable and high efficiency detection array, good energy resolution and half-life discrimination are difficult to obtain with traditional methods [1] given the logistic and financial constraints. An approach different from that of spectrum addition and standard spectroscopy analysis [2] was needed. The use of multiple detectors prompts the need for a flexible storage o...

  19. Protein phosphatases decrease their activity during capacitation: a new requirement for this event.

    Directory of Open Access Journals (Sweden)

    Janetti R Signorelli

    Full Text Available There are few reports on the role of protein phosphatases during capacitation. Here, we report on the role of PP2B, PP1, and PP2A during human sperm capacitation. Motile sperm were resuspended in non-capacitating medium (NCM, Tyrode's medium, albumin- and bicarbonate-free or in reconstituted medium (RCM, NCM plus 2.6% albumin/25 mM bicarbonate. The presence of the phosphatases was evaluated by western blotting and the subcellular localization by indirect immunofluorescence. The function of these phosphatases was analyzed by incubating the sperm with specific inhibitors: okadaic acid, I2, endothall, and deltamethrin. Different aliquots were incubated in the following media: 1 NCM; 2 NCM plus inhibitors; 3 RCM; and 4 RCM plus inhibitors. The percent capacitated sperm and phosphatase activities were evaluated using the chlortetracycline assay and a phosphatase assay kit, respectively. The results confirm the presence of PP2B and PP1 in human sperm. We also report the presence of PP2A, specifically, the catalytic subunit and the regulatory subunits PR65 and B. PP2B and PP2A were present in the tail, neck, and postacrosomal region, and PP1 was present in the postacrosomal region, neck, middle, and principal piece of human sperm. Treatment with phosphatase inhibitors rapidly (≤1 min increased the percent of sperm depicting the pattern B, reaching a maximum of ∼40% that was maintained throughout incubation; after 3 h, the percent of capacitated sperm was similar to that of the control. The enzymatic activity of the phosphatases decreased during capacitation without changes in their expression. The pattern of phosphorylation on threonine residues showed a sharp increase upon treatment with the inhibitors. In conclusion, human sperm express PP1, PP2B, and PP2A, and the activity of these phosphatases decreases during capacitation. This decline in phosphatase activities and the subsequent increase in threonine phosphorylation may be an important

  20. Cerebral activity to opposite-sex voices reflected by event-related potentials.

    Directory of Open Access Journals (Sweden)

    Ya Li

    Full Text Available Human voice is a gender discriminating cue and is important to mate selection. This study employed electrophysiological recordings to examine whether there is specific cerebral activity when presented with opposite-sex voices as compared to same-sex voices. Male voices and female voices were pseudo-randomly presented to male and female participants. In Experiment 1, participants were instructed to determine the gender of each voice. A late positivity (LP response around 750 ms after voice onset was elicited by opposite-sex voices, as reflected by a positive deflection of the ERP to opposite-sex voices than that to same-sex voices. This LP response was prominent around parieto-occipital recording sites, and it suggests an opposite-sex specific process, which may reflect emotion- and/or reward-related cerebral activity. In Experiment 2, participants were instructed to press a key when hearing a non-voice pure tone and not give any response when they heard voice stimuli. In this task, no difference were found between the ERP to same-sex voices and that to opposite-sex voices, suggesting that the cerebral activity to opposite-sex voices may disappear without gender-related attention. These results provide significant implications on cognitive mechanisms with regard to opposite-sex specific voice processing.

  1. Antisense long noncoding RNAs regulate var gene activation in the malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Amit-Avraham, Inbar; Pozner, Guy; Eshar, Shiri; Fastman, Yair; Kolevzon, Netanel; Yavin, Eylon; Dzikowski, Ron

    2015-03-03

    The virulence of Plasmodium falciparum, the causative agent of the deadliest form of human malaria, is attributed to its ability to evade human immunity through antigenic variation. These parasites alternate between expression of variable antigens, encoded by members of a multicopy gene family named var. Immune evasion through antigenic variation depends on tight regulation of var gene expression, ensuring that only a single var gene is expressed at a time while the rest of the family is maintained transcriptionally silent. Understanding how a single gene is chosen for activation is critical for understanding mutually exclusive expression but remains a mystery. Here, we show that antisense long noncoding RNAs (lncRNAs) initiating from var introns are associated with the single active var gene at the time in the cell cycle when the single var upstream promoter is active. We demonstrate that these antisense transcripts are incorporated into chromatin, and that expression of these antisense lncRNAs in trans triggers activation of a silent var gene in a sequence- and dose-dependent manner. On the other hand, interference with these lncRNAs using complement peptide nucleic acid molecules down-regulated the active var gene, erased the epigenetic memory, and induced expression switching. Altogether, our data provide evidence that these antisense lncRNAs play a key role in regulating var gene activation and mutually exclusive expression.

  2. Gene expression profiling in cells with enhanced gamma-secretase activity.

    Directory of Open Access Journals (Sweden)

    Alexandra I Magold

    Full Text Available BACKGROUND: Processing by gamma-secretase of many type-I membrane protein substrates triggers signaling cascades by releasing intracellular domains (ICDs that, following nuclear translocation, modulate the transcription of different genes regulating a diverse array of cellular and biological processes. Because the list of gamma-secretase substrates is growing quickly and this enzyme is a cancer and Alzheimer's disease therapeutic target, the mapping of gamma-secretase activity susceptible gene transcription is important for sharpening our view of specific affected genes, molecular functions and biological pathways. METHODOLOGY/PRINCIPAL FINDINGS: To identify genes and molecular functions transcriptionally affected by gamma-secretase activity, the cellular transcriptomes of Chinese hamster ovary (CHO cells with enhanced and inhibited gamma-secretase activity were analyzed and compared by cDNA microarray. The functional clustering by FatiGO of the 1,981 identified genes revealed over- and under-represented groups with multiple activities and functions. Single genes with the most pronounced transcriptional susceptibility to gamma-secretase activity were evaluated by real-time PCR. Among the 21 validated genes, the strikingly decreased transcription of PTPRG and AMN1 and increased transcription of UPP1 potentially support data on cell cycle disturbances relevant to cancer, stem cell and neurodegenerative diseases' research. The mapping of interactions of proteins encoded by the validated genes exclusively relied on evidence-based data and revealed broad effects on Wnt pathway members, including WNT3A and DVL3. Intriguingly, the transcription of TERA, a gene of unknown function, is affected by gamma-secretase activity and was significantly altered in the analyzed human Alzheimer's disease brain cortices. CONCLUSIONS/SIGNIFICANCE: Investigating the effects of gamma-secretase activity on gene transcription has revealed several affected clusters of

  3. Identification of chemical modulators of the constitutive activated receptor (CAR) in a gene expression compendium

    OpenAIRE

    Oshida, Keiyu; Vasani, Naresh; Jones, Carlton; Moore, Tanya; Hester, Susan; Nesnow, Stephen; Auerbach, Scott; Geter, David R.; Aleksunes, Lauren M; Thomas, Russell S.; Applegate, Dawn; Klaassen, Curtis D.; Corton, J. Christopher

    2015-01-01

    The nuclear receptor family member constitutive activated receptor (CAR) is activated by structurally diverse drugs and environmentally-relevant chemicals leading to transcriptional regulation of genes involved in xenobiotic metabolism and transport. Chronic activation of CAR increases liver cancer incidence in rodents, whereas suppression of CAR can lead to steatosis and insulin insensitivity. Here, analytical methods were developed to screen for chemical treatments in a gene expression comp...

  4. Change and Stability in Active and Passive Social Influence Dynamics during Natural Drinking Events: A Longitudinal Measurement-Burst Study.

    Science.gov (United States)

    Cullum, Jerry; O'Grady, Megan; Armeli, Stephen; Tennen, Howard

    2012-01-01

    We examined the link between social norms and active social influences occurring during natural social drinking contexts. Across 4 yearly measurement-bursts, college students (N = 523) reported daily for 30-day periods on drinking norms, drinking offers, how many drinks they accepted, and personal drinking levels during social drinking events. In contexts where drinking norms were higher, students were more likely to both receive and comply with drinking offers. These acute social influences were highly stable throughout college, but affected men and women differently across time: Women received more drinking offers than men, especially at the beginning of college and when norms were higher, but men complied with more drinking offers per occasion. These effects were not attributable to between-person differences in social drinking motives or drinking levels, nor to within-person patterns of situation-selection. The present work suggests that context-specific drinking norms catalyze active social influence attempts, and further promote compliance drinking.

  5. Integration of the Pleasant Events (PE) and Activity Restriction (AR) Models: Development and Validation of a “PEAR” Model of Negative Outcomes in Alzheimer’s Caregivers

    Science.gov (United States)

    Mausbach, Brent T; Roepke, Susan K; Depp, Colin A.; Moore, Raeanne; Patterson, Thomas L; Grant, Igor

    2011-01-01

    This study examined an activity restriction/pleasurable activities mismatch model for psychosocial and health-related outcomes. A total of 108 spousal caregivers of patients with Alzheimer’s Disease (AD) were assessed for their experience of social and recreational activities over the past month as well as their perception of how restricted they were for engaging in social and recreational activities. Participants were divided into three groups based on their reported activities and activity restriction: HPLR = High Pleasant Events + Low Activity Restriction (i.e., reference group; N = 28); HPHR/LPLR = Either High Pleasant Events + High Activity Restriction or Low Pleasant Events + Low Activity Restriction (N = 43); LPHR = Low Pleasant Events + High Activity Restriction (N = 37). We hypothesized that participants reporting low pleasant events combined with high activity restriction (LPHR) would demonstrate greater disturbance relative to other two groups in multiple outcome domains including: a) greater mood disturbance, b) greater use of negative coping factors, c) reduced use of positive coping strategies, d) reduced report of psychological resource factors (e.g., personal mastery, self-efficacy), and increased report of subjective health difficulties (e.g., sleep disturbance). Results generally supported our hypotheses, suggesting that assessment of both constructs is important for best predicting quality of well-being in AD caregivers, and potentially for establishing maximal effect in behavior therapy for caregivers. PMID:21292054

  6. Resolving Early Signaling Events in T-Cell Activation Leading to IL-2 and FOXP3 Transcription

    Directory of Open Access Journals (Sweden)

    Jeffrey P. Perley

    2014-11-01

    Full Text Available Signal intensity and feedback regulation are known to be major factors in the signaling events stemming from the T-cell receptor (TCR and its various coreceptors, but the exact nature of these relationships remains in question. We present a mathematical model of the complex signaling network involved in T-cell activation with cross-talk between the Erk, calcium, PKC and mTOR signaling pathways. The model parameters are adjusted to fit new and published data on TCR trafficking, Zap70, calcium, Erk and Isignaling. The regulation of the early signaling events by phosphatases, CD45 and SHP1, and the TCR dynamics are critical to determining the behavior of the model. Additional model corroboration is provided through quantitative and qualitative agreement with experimental data collected under different stimulating and knockout conditions. The resulting model is analyzed to investigate how signal intensity and feedback regulation affect TCR- and coreceptor-mediated signal transduction and their downstream transcriptional profiles to predict the outcome for a variety of stimulatory and knockdown experiments. Analysis of the model shows that: (1 SHP1 negative feedback is necessary for preventing hyperactivity in TCR signaling; (2 CD45 is required for TCR signaling, but also partially suppresses it at high expression levels; and (3 elevated FOXP3 and reduced IL-2 signaling, an expression profile often associated with T regulatory cells (Tregs, is observed when the system is subjected to weak TCR and CD28 costimulation or a severe reduction in CD45 activity.

  7. Major mutation events in structural genes of peste des petits ruminants virus through serial passages in vitro.

    Science.gov (United States)

    Wu, Xiaodong; Liu, Fuxiao; Li, Lin; Zou, Yanli; Liu, Shan; Wang, Zhiliang

    2016-06-01

    Peste des petits ruminants (PPR) is an highly contagious disease of small ruminants, and caused by peste des petits ruminants virus (PPRV), a member of the genus Morbillivirus in the family Paramyxoviridae. The first outbreak of PPR in China was officially reported in July 2007, when a PPRV strain was successfully isolated from a sick goat in Tibet, followed by sequencing at a full-genome level (China/Tibet/Geg/07-30, GenBank: FJ905304.1). To date, this isolate has been virulently attenuated by more than 90 serial passages in Vero-Dog-SLAM cells at our laboratory. In this study, a total of nine strains by serial passages (namely the 10th, 20th, 30th, 40th, 50th, 60th, 70th, 80th, and 90th passages) were chosen for sequencing of six structural genes in PPRV. The sequence analysis showed that mutation rates in all viral genes were relatively low, and only a few identical mutations within certain genes were stably maintained after an earlier passage, perhaps indicating a predominance of mutants after such a passage.

  8. How To Select an Event Management System: A Guide to Selecting the Most Effective Resource Management System for College Union and Student Activities Professionals.

    Science.gov (United States)

    Anderson, Scott; Raasch, Kevin

    2002-01-01

    Provides an evaluation template for student activities professionals charged with evaluating competitive event scheduling software. Guides staff in making an informed decision on whether to retain event management technology provided through an existing vendor or choose "best-of-breed" scheduling software. (EV)

  9. Towards the measurement of event-related EEG activity in real-life working environments.

    Science.gov (United States)

    Wascher, Edmund; Heppner, Holger; Hoffmann, Sven

    2014-01-01

    In applied contexts, psychophysiological measures have a long tradition to evaluate the user state. EEG correlates that indicate mechanisms of information processing, however, are hardly accessible since discrete time stamps that are necessary for this approach are commonly not available in natural situations. However, eye blinks may close this gap. Eye blinks are assumed to mark distinct points in information processing, necessary to segment the incoming data stream. By using mobile EEG in a simulated working situation we demonstrate that eye-blink-related potentials provide reliable information about cognitive processing in distinct working environments. During cognitive tasks, an increase in the fronto-central N2 component as well as evoked theta activity can be shown, both indices of enhanced cognitive control. The posterior P3 is reduced during physical tasks (sorting of boxes), probably reflecting the more continuous nature of this task. The data are discussed within a model of dopaminergic modulation of blink activity that involves both task specific aspects like executive control and modulating influences of motivation or fatigue.

  10. Design and Test of an Event Detector and Locator for the ReflectoActive Seals System

    Energy Technology Data Exchange (ETDEWEB)

    Stinson, Brad J [ORNL

    2006-06-01

    The purpose of this work was to research, design, develop and test a novel instrument for detecting fiber optic loop continuity and spatially locating fiber optic breaches. The work is for an active seal system called ReflectoActive{trademark} Seals whose purpose is to provide real time container tamper indication. A Field Programmable Gate Array was used to implement a loop continuity detector and a spatial breach locator based on a high acquisition speed single photon counting optical time domain reflectometer. Communication and other control features were added in order to create a usable instrument that met defined requirements. A host graphical user interface was developed to illustrate system use and performance. The resulting device meets performance specifications by exhibiting a dynamic range of 27dB and a spatial resolution of 1.5 ft. The communication scheme used expands installation options and allows the device to communicate to a central host via existing Local Area Networks and/or the Internet.

  11. Design and Test of an Event Detector for the ReflectoActive Seals System

    Energy Technology Data Exchange (ETDEWEB)

    Stinson, Brad J [ORNL

    2006-05-01

    The purpose of this thesis was to research, design, develop and test a novel instrument for detecting fiber optic loop continuity and spatially locating fiber optic breaches. The work is for an active seal system called ReflectoActive Seals whose purpose is to provide real time container tamper indication. A Field Programmable Gate Array was used to implement a loop continuity detector and a spatial breach locator based on a high acquisition speed single photon counting optical time domain reflectometer. Communication and other control features were added in order to create a usable instrument that met defined requirements. A host graphical user interface was developed to illustrate system use and performance. The resulting device meets performance specifications by exhibiting a dynamic range of 27dB and a spatial resolution of 1.5 ft. The communication scheme used expands installation options and allows the device to communicate to a central host via existing Local Area Networks and/or the Internet.

  12. Shortened activated partial thromboplastin time, a hemostatic marker for hypercoagulable state during acute coronary event.

    Science.gov (United States)

    Abdullah, Wan Zaidah; Moufak, Shaimaa K; Yusof, Zurkurnai; Mohamad, Mohd Sapawi; Kamarul, I M

    2010-06-01

    Various factors may contribute to a hypercoagulable state and acute vascular thrombosis. A prospective study was conducted involving 165 coronary heart disease (CHD) patients from the Cardiology Unit, Hospital Universiti Sains Malaysia. The purpose of this study was to investigate the relationship among factor VIII (FVIII), prothrombin time (PT), activated partial thromboplastin time (APTT), and activated protein C resistance (APC-R) state among CHD patients and to look for potential clinical applications from these laboratory findings. There were 110 cases diagnosed as acute coronary syndrome (ACS), whereas another 55 were stable coronary artery disease (SCAD) patients. PT, APTT, FVIII, and APC-R assays were performed on all subjects. There was a significant difference between the FVIII level and the APTT results (P value < 0.0001). A negative relationship was found between the FVIII level and the APTT from linear regression analysis (R(2) = 10%, P value < 0.0001). For each 1% increase in the FVIII level, the APTT was reduced by 0.013 s (95% confidence interval (CI) between -0.019 and -0.007). Interestingly, none of the SCAD patients had abnormally short APTT. Approximately 68.4% of cases with a positive APC-R assay were found to have a high FVIII level. In conclusion, the APTT test is a potential hemostatic marker for hypercoagulable state including in arterial thrombosis.

  13. Fur-mediated activation of gene transcription in the human pathogen Neisseria gonorrhoeae.

    Science.gov (United States)

    Yu, Chunxiao; Genco, Caroline Attardo

    2012-04-01

    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms.

  14. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity.

    Science.gov (United States)

    Ahmed, Afsar U; Williams, Bryan R G; Hannigan, Gregory E

    2015-11-11

    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding.

  15. Impact of physical activity and doping on epigenetic gene regulation.

    Science.gov (United States)

    Schwarzenbach, Heidi

    2011-10-01

    To achieve success in sports, many athletes consume doping substances, such as anabolic androgenic steroids and growth hormones, and ignore the negative influence of these drugs on their health. Apart from the unethical aspect of doping in sports, it is essential to consider the tremendous risk it represents to their physical condition. The abuse of pharmaceuticals which improve athletic performance may alter the expression of specific genes involved in muscle and bone metabolism by epigenetic mechanisms, such as DNA methylation and histone modifications. Moreover, excessive and relentless training to increase the muscle mass, may also have an influence on the health of the athletes. This stress releases neurotransmitters and growth factors, and may affect the expression of endogenous genes by DNA methylation, too. This paper focuses on the relationship between epigenetic mechanisms and sports, highlights the potential consequences of abuse of doping drugs on gene expression, and describes methods to molecularly detect epigenetic changes of gene markers reflecting the physiological or metabolic effects of doping agents.

  16. Ranking the importance of nuclear reactions for activation and transmutation events

    CERN Document Server

    Arter, Wayne; Relton, Samuel D; Higham, Nicholas J

    2015-01-01

    Pathways-reduced analysis is one of the techniques used by the Fispact-II nuclear activation and transmutation software to study the sensitivity of the computed inventories to uncertainties in reaction cross-sections. Although deciding which pathways are most important is very helpful in for example determining which nuclear data would benefit from further refinement, pathways-reduced analysis need not necessarily define the most critical reaction, since one reaction may contribute to several different pathways. This work examines three different techniques for ranking reactions in their order of importance in determining the final inventory, viz. a pathways based metric (PBM), the direct method and one based on the Pearson correlation coefficient. Reasons why the PBM is to be preferred are presented.

  17. Horizontal gene transfer and functional diversification of plant cell wall degrading polygalacturonases: Key events in the evolution of herbivory in beetles.

    Science.gov (United States)

    Kirsch, Roy; Gramzow, Lydia; Theißen, Günter; Siegfried, Blair D; Ffrench-Constant, Richard H; Heckel, David G; Pauchet, Yannick

    2014-09-01

    Plant cell walls are the largest reservoir of organic carbon on earth. To breach and utilize this carbohydrate-rich protective barrier, microbes secrete plant cell wall degrading enzymes (PCWDEs) targeting pectin, cellulose and hemicelluloses. There is a growing body of evidence that genomes of some herbivorous insects also encode PCWDEs, raising questions about their evolutionary origins and functions. Among herbivorous beetles, pectin-degrading polygalacturonases (PGs) are found in the diverse superfamilies Chrysomeloidea (leaf beetles, long-horn beetles) and Curculionoidea (weevils). Here our aim was to test whether these arose from a common ancestor of beetles or via horizontal gene transfer (HGT), and whether PGs kept their ancestral function in degrading pectin or evolved novel functions. Transcriptome data derived from 10 beetle species were screened for PG-encoding sequences and used for phylogenetic comparisons with their bacterial, fungal and plant counterparts. These analyses revealed a large family of PG-encoding genes of Chrysomeloidea and Curculionoidea sharing a common ancestor, most similar to PG genes of ascomycete fungi. In addition, 50 PGs from beetle digestive systems were heterologously expressed and functionally characterized, showing a set of lineage-specific consecutively pectin-degrading enzymes, as well as conserved but enzymatically inactive PG proteins. The evidence indicates that a PG gene was horizontally transferred ∼200 million years ago from an ascomycete fungus to a common ancestor of Chrysomeloidea and Curculionoidea. This has been followed by independent duplications in these two lineages, as well as independent replacement in two sublineages of Chrysomeloidea by two other subsequent HGTs. This origin, leading to subsequent functional diversification of the PG gene family within its new hosts, was a key event promoting the evolution of herbivory in these beetles. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Multiple GCD genes required for repression of GCN4, a transcriptional activator of amino acid biosynthetic genes in Saccharomyces cerevisiae.

    Science.gov (United States)

    Harashima, S; Hinnebusch, A G

    1986-11-01

    GCN4 encodes a positive regulator of multiple unlinked genes encoding amino acid biosynthetic enzymes in Saccharomyces cerevisiae. Expression of GCN4 is coupled to amino acid availability by a control mechanism involving GCD1 as a negative effector and GCN1, GCN2, and GCN3 as positive effectors of GCN4 expression. We used reversion of a gcn2 gcn3 double mutation to isolate new alleles of GCD1 and mutations in four additional GCD genes which we designate GCD10, GCD11, GCD12, and GCD13. All of the mutations lead to constitutive derepression of HIS4 transcription in the absence of the GCN2+ and GCN3+ alleles. By contrast, the gcd mutations require the wild-type GCN4 allele for their derepressing effect, suggesting that each acts by influencing the level of GCN4 activity in the cell. Consistent with this interpretation, mutations in each GCD gene lead to constitutive derepression of a GCN4::lacZ gene fusion. Thus, at least five gene products are required to maintain the normal repressed level of GCN4 expression in nonstarvation conditions. Interestingly, the gcd mutations are pleiotropic and also affect growth rate in nonstarvation conditions. In addition, certain alleles lead to a loss of M double-stranded RNA required for the killer phenotype. This pleiotropy suggests that the GCD gene products contribute to an essential cellular function, in addition to, or in conjunction with, their role in GCN4 regulation.

  19. Sp3 controls fibroblast growth factor receptor 4 gene activity during myogenic differentiation.

    Science.gov (United States)

    Cavanaugh, Eric; DiMario, Joseph X

    2017-03-27

    Fibroblast growth factor/fibroblast growth factor receptor (FGF/FGFR) signaling is a critical component in the regulation of myoblast proliferation and differentiation. The transient FGFR4 gene expression during the transition from proliferating myoblasts to differentiated myotubes indicates that FGFR4 regulates this critical phase of myogenesis. The Specificity Protein (SP) family of transcription factors controls FGFR family member gene activity. We sought to determine if members of the Sp family regulate mouse FGFR4 gene activity during myogenic differentiation. RT-PCR and western blot analysis of FGFR4 mRNA and protein revealed transient expression over 72h, with peak expression between 24 and 36h after addition of differentiation medium to C2C12 myogenic cultures. Sp3 also displayed a transient expression pattern with peak expression occurring after 6h of differentiation. We cloned a 1527bp fragment of the mouse FGFR4 promoter into a luciferase reporter. This FGFR4 promoter contains eight putative Sp binding sites and directed luciferase gene activity comparable to native FGFR4 expression. Overexpression of Sp1 and Sp3 showed that Sp1 repressed FGFR4 gene activity, and Sp3 activated FGFR4 gene activity during myogenic differentiation. Mutational analyses of multiple Sp binding sites within the FGFR4 promoter revealed that three of these sites were transcriptionally active. Electromobility shift assays and chromatin immunoprecipitation of the area containing the activator sites showed that Sp3 bound to this promoter location.

  20. In situ detection of the hypermethylation-induced inactivation of the p16 gene as an early event in oncogenesis

    OpenAIRE

    Nuovo,Gerard J; Plaia, Todd W.; Steven A Belinsky; Baylin, Stephen B.; Herman, James G.

    1999-01-01

    We have developed a technique, methylation-specific PCR in situ hybridization (MSP-ISH), which allows for the methylation status of specific DNA sequences to be visualized in individual cells. We use MSP-ISH to monitor the timing and consequences of aberrant hypermethylation of the p16 tumor suppresser gene during the progression of cancers of the lung and cervix. Hypermethylation of p16 was localized only to the neoplastic cells in both in situ lesions and invasive cancers, and was associate...

  1. Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution

    Directory of Open Access Journals (Sweden)

    Tartar Aurélien

    2010-06-01

    Full Text Available Abstract Background Glutamine synthetase (GS is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae, and additional green algal (Chlorophyceae and Prasinophytae and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB and eukaryotic (GSIIE GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT. Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida. However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting

  2. Process and genes for expression and overexpression of active [FeFe] hydrogenases

    Science.gov (United States)

    Seibert, Michael; King, Paul W; Ghirardi, Maria Lucia; Posewitz, Matthew C; Smolinski, Sharon L

    2014-09-16

    A process for expression of active [FeFe]-hydrogenase in a host organism that does not contain either the structural gene(s) for [FeFe]-hydrogenases and/or homologues for the maturation genes HydE, HydF and HyG, comprising: cloning the structural hydrogenase gene(s) and/or the maturation genes HydE, HydF and HydG from an organisms that contains these genes into expression plasmids; transferring the plasmids into an organism that lacks a native [FeFe]-hydrogenase or that has a disrupted [FeFe]-hydrogenase and culturing it aerobically; and inducing anaerobiosis to provide [FeFe] hydrogenase biosynthesis and H?2#191 production.

  3. Process and genes for expression and overexpression of active [FeFe] hydrogenases

    Energy Technology Data Exchange (ETDEWEB)

    Seibert, Michael; King, Paul W; Ghirardi, Maria Lucia; Posewitz, Matthew C; Smolinski, Sharon L

    2014-09-16

    A process for expression of active [FeFe]-hydrogenase in a host organism that does not contain either the structural gene(s) for [FeFe]-hydrogenases and/or homologues for the maturation genes HydE, HydF and HyG, comprising: cloning the structural hydrogenase gene(s) and/or the maturation genes HydE, HydF and HydG from an organisms that contains these genes into expression plasmids; transferring the plasmids into an organism that lacks a native [FeFe]-hydrogenase or that has a disrupted [FeFe]-hydrogenase and culturing it aerobically; and inducing anaerobiosis to provide [FeFe] hydrogenase biosynthesis and H?2#191 production.

  4. Generation of gene disruptions by transcription activator-like effector nucleases (TALENs) in Xenopus tropicalis embryos

    OpenAIRE

    Lei, Yong; Guo, Xiaogang; Deng, Yi; Chen, Yonglong; Zhao, Hui

    2013-01-01

    Transcription activator-like effector nucleases (TALENs) are novel engineered DNA nucleases, and have been proven to be effective for gene specific targeting in various species. Recently we reported gene disruptions in Xenopus embryos by using TALENs. Here we summarize the protocol that is used in our studies for gene disruption. This protocol covers selection of TALEN targeting sites, TALEN assembly with a modified Golden Gate method, and injection of TALEN mRNAs into Xenopus tropicalis embr...

  5. A Cbx8-containing polycomb complex facilitates the transition to gene activation during ES cell differentiation.

    Directory of Open Access Journals (Sweden)

    Catherine Creppe

    2014-12-01

    Full Text Available Polycomb proteins play an essential role in maintaining the repression of developmental genes in self-renewing embryonic stem cells. The exact mechanism allowing the derepression of polycomb target genes during cell differentiation remains unclear. Our project aimed to identify Cbx8 binding sites in differentiating mouse embryonic stem cells. Therefore, we used a genome-wide chromatin immunoprecipitation of endogenous Cbx8 coupled to direct massive parallel sequencing (ChIP-Seq. Our analysis identified 171 high confidence peaks. By crossing our data with previously published microarray analysis, we show that several differentiation genes transiently recruit Cbx8 during their early activation. Depletion of Cbx8 partially impairs the transcriptional activation of these genes. Both interaction analysis, as well as chromatin immunoprecipitation experiments support the idea that activating Cbx8 acts in the context of an intact PRC1 complex. Prolonged gene activation results in eviction of PRC1 despite persisting H3K27me3 and H2A ubiquitination. The composition of PRC1 is highly modular and changes when embryonic stem cells commit to differentiation. We further demonstrate that the exchange of Cbx7 for Cbx8 is required for the effective activation of differentiation genes. Taken together, our results establish a function for a Cbx8-containing complex in facilitating the transition from a Polycomb-repressed chromatin state to an active state. As this affects several key regulatory differentiation genes this mechanism is likely to contribute to the robust execution of differentiation programs.

  6. High ABCC2 and Low ABCG2 Gene Expression Are Early Events in the Colorectal Adenoma-Carcinoma Sequence

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Vogel, Lotte K.; Kopp, Tine Iskov

    2015-01-01

    Development of colorectal cancer (CRC) may result from a dysfunctional interplay between diet, gut microbes and the immune system. The ABC transport proteins ABCB1 (P-glycoprotein, Multidrug resistance protein 1, MDR1), ABCC2 (MRP2) and ABCG2 (BCRP) are involved in transport of various compounds...... across the epithelial barrier. Low mRNA level of ABCB1 has previously been identified as an early event in colorectal carcinogenesis (Andersen et al., PLoS One. 2013 Aug 19; 8(8): e72119). ABCC2 and ABCG2 mRNA levels were assessed in intestinal tissue from 122 CRC cases, 106 adenoma cases (12 with severe...... in carcinogenesis suggesting that these ABC transporters are involved in the early steps of carcinogenesis as previously reported for ABCB1. These results suggest that dysfunctional transport across the epithelial barrier may contribute to colorectal carcinogenesis....

  7. The Interacting Effect of the BDNF Val66Met Polymorphism and Stressful Life Events on Adolescent Depression Is Not an Artifact of Gene-Environment Correlation: Evidence from a Longitudinal Twin Study

    Science.gov (United States)

    Chen, Jie; Li, Xinying; McGue, Matt

    2013-01-01

    Background: Confounding introduced by gene-environment correlation (rGE) may prevent one from observing a true gene-environment interaction (G × E) effect on psychopathology. The present study investigated the interacting effect of the BDNF Val66Met polymorphism and stressful life events (SLEs) on adolescent depression while controlling for the…

  8. Effects of different activity and inactivity paradigms on myosin heavy chain gene expression in striated muscle

    Science.gov (United States)

    Baldwin, K. M.; Haddad, F.

    2001-01-01

    The goal of this mini-review is to summarize findings concerning the role that different models of muscular activity and inactivity play in altering gene expression of the myosin heavy chain (MHC) family of motor proteins in mammalian cardiac and skeletal muscle. This was done in the context of examining parallel findings concerning the role that thyroid hormone (T(3), 3,5,3'-triiodothyronine) plays in MHC expression. Findings show that both cardiac and skeletal muscles of experimental animals are initially undifferentiated at birth and then undergo a marked level of growth and differentiation in attaining the adult MHC phenotype in a T(3)/activity level-dependent fashion. Cardiac MHC expression in small mammals is highly sensitive to thyroid deficiency, diabetes, energy deprivation, and hypertension; each of these interventions induces upregulation of the beta-MHC isoform, which functions to economize circulatory function in the face of altered energy demand. In skeletal muscle, hyperthyroidism, as well as interventions that unload or reduce the weight-bearing activity of the muscle, causes slow to fast MHC conversions. Fast to slow conversions, however, are seen under hypothyroidism or when the muscles either become chronically overloaded or subjected to intermittent loading as occurs during resistance training and endurance exercise. The regulation of MHC gene expression by T(3) or mechanical stimuli appears to be strongly regulated by transcriptional events, based on recent findings on transgenic models and animals transfected with promoter-reporter constructs. However, the mechanisms by which T(3) and mechanical stimuli exert their control on transcriptional processes appear to be different. Additional findings show that individual skeletal muscle fibers have the genetic machinery to express simultaneously all of the adult MHCs, e.g., slow type I and fast IIa, IIx, and IIb, in unique combinations under certain experimental conditions. This degree of

  9. Inhibition of PID1/NYGGF4/PCLI1 gene expression highlights its role in the early events of the cell cycle in NIH3T3 fibroblasts.

    Science.gov (United States)

    Monteleone, Francesca; Vitale, Monica; Caratù, Ginevra; D'Ambrosio, Chiara; Di Giovanni, Stefano; Gorrese, Marisa; Napolitano, Francesco; Romano, Maria Fiammetta; Del Vecchio, Luigi; Succoio, Mariangela; Scaloni, Andrea; Zambrano, Nicola

    2016-01-01

    The PID1/NYGGF4/PCLI1 gene encodes for a protein with a phosphotyrosine-binding domain, which interacts with the lipoprotein receptor-related protein 1. Previous work by us and others suggested a function of the gene in cell proliferation of NIH3T3 fibroblasts and 3T3-L1 pre-adipocytes. The molecular characterization of PCLI1 protein, ectopically expressed in NIH3T3 fibroblasts, revealed two phosphorylation sites at Ser154 and Ser165. In order to clarify the functions of this gene, we analyzed the effects of its downregulation on cellular proliferation and cell cycle progression in NIH3T3 cell cultures. Downregulation of PID1/NYGGF4/PCLI1 mRNA levels by short hairpin RNAs (shRNAs) elicited decreased proliferation rate in mammalian cell lines; cell cycle analysis of serum-starved, synchronized NIH3T3 fibroblasts showed an increased accumulation of shRNA-interfered cells in the G1 phase. Decreased levels of FOS and MYC mRNAs were accordingly associated with these events. The molecular scenario emerging from our data suggests that PID1/NYGGF4/PCLI1 controls cellular proliferation and cell cycle progression in NIH3T3 cells.

  10. Identification of two peanut germin-like genes and the potential superoxide dismutase activity

    Science.gov (United States)

    Germin and germin-like protein (GLP) genes are members of large multigene families. These genes have been reported to play a role directly or indirectly in plant defense response. A number of GLPs have been demonstrated to have superoxidase dismutase (SOD) or oxalate oxidase (OxO) activity, leading ...

  11. Transcriptional activation of the mouse obese (ob) gene by CCAAT/enhancer binding protein alpha

    DEFF Research Database (Denmark)

    Hwang, C S; Mandrup, S; MacDougald, O A

    1996-01-01

    Like other adipocyte genes that are transcriptionally activated by CCAAT/enhancer binding protein alpha (C/EBP alpha) during preadipocyte differentiation, expression of the mouse obese (ob) gene is immediately preceded by the expression of C/EBP alpha. While the 5' flanking region of the mouse ob...

  12. Two Polymorphisms in the Epithelial Cell-Derived Neutrophil-Activating Peptide (ENA-78 Gene

    Directory of Open Access Journals (Sweden)

    Mahsa M. Amoli

    2005-01-01

    Full Text Available Increased expression of epithelial cell-derived neutrophil-activating peptide (ENA-78 has been reported in several immune and inflammatory conditions suggesting its role in inflammatory response. We have identified two single nucleotide polymorphisms in the promoter and exon 2 of the ENA-78 gene by scanning the full length gene using DHPLC DNA fragment analysis and DNA sequencing.

  13. Signal transducer and activator of transcription 6 gene G2964A polymorphism and inflammatory bowel disease.

    NARCIS (Netherlands)

    Xia, B; Crusius, J.B.A.; Wu, J; Zwiers, A.; Bodegraven, van A.A.; Pena, A.S.

    2003-01-01

    Signal transducer and activator of transcription 6 (STAT6) is a key transcription factor involved in interleukin 4 (IL-4) and IL-13-mediated Th2 response. The STAT6 gene is located on chromosome 12q13.3-14.1 (IBD2 region) and is therefore a positional and functional candidate gene for study in infla

  14. Influence of Serotonin Transporter Gene Polymorphisms and Adverse Life Events on Depressive Symptoms in the Elderly: A Population-Based Study

    Science.gov (United States)

    Davin, Annalisa; Monti, Maria Cristina; Polito, Letizia; Vaccaro, Roberta; Abbondanza, Simona; Gnesi, Marco; Villani, Simona; Guaita, Antonio

    2015-01-01

    Background Depression is common in the elderly. The role of genetic and environmental factors in modulating depressive symptoms is not clear. Methods We evaluated the influence of serotonin transporter gene polymorphisms and recent adverse life events on depressive symptoms in an elderly Italian population. We used data from “InveCe.Ab”, a population-based study of 1321 subjects aged 70–74 years. We used the 15-item Geriatric Depression Scale (GDS) to assess depressive symptoms–a GDS score ≥5 points (GDS≥5) indicated the presence of clinically relevant symptoms–and performed 5-HTTLPR and rs25531 genotyping to obtain the triallelic polymorphism of the serotonin transporter. We used the Geriatric Adverse Life Events Scale to measure adverse life events, and logistic regression models to evaluate the role of genotype and recent adverse life events in depressive symptoms, controlling for potential confounders and independent predictors. Results Two hundred subjects (15.76%) had a GDS≥5. The 5-HTTLPR triallelic polymorphism was significantly associated with GDS≥5. Only S′S′ carriers showed an increased risk of depressive symptoms (ORadj = 1.81, p = .022); one extra adverse life event increased this risk by 14% (p = .061) independently of genotype. Other factors significantly related to GDS≥5 were: female gender (ORadj = 2.49, p depression (ORadj = 4.73, p depressive symptoms by 57% (p = .005) only in the L′L′ carriers, while antidepressant intake was directly related to GDS≥5 in the L′S′ carriers (ORadj = 2.46, p = .036) and borderline significant in the S′S′ carriers (ORadj = 2.41, p = .081). Discussion The S′S′ genotype and recent exposure to adverse life events were independently associated with depressive symptoms. The S′S′ genotype, compared with the environment, exerted a predominant effect on depressive symptoms, suggesting that it reduces the efficacy of antidepressant therapy. We conclude that genetics may be an

  15. The costs associated with adverse event procedures for an international HIV clinical trial determined by activity-based costing.

    Science.gov (United States)

    Chou, Victoria B; Omer, Saad B; Hussain, Hamidah; Mugasha, Christine; Musisi, Maria; Mmiro, Francis; Musoke, Philippa; Jackson, J Brooks; Guay, Laura A

    2007-12-01

    To determine costs for adverse event (AE) procedures for a large HIV perinatal trial by analyzing actual resource consumption using activity-based costing (ABC) in an international research setting. The AE system for an ongoing clinical trial in Uganda was evaluated using ABC techniques to determine costs from the perspective of the study. Resources were organized into cost categories (eg, personnel, patient care expenses, laboratory testing, equipment). Cost drivers were quantified, and unit cost per AE was calculated. A subset of time and motion studies was performed prospectively to observe clinic personnel time required for AE identification. In 18 months, there were 9028 AEs, with 970 (11%) reported as serious adverse events. Unit cost per AE was $101.97. Overall, AE-related costs represented 32% ($920,581 of $2,834,692) of all study expenses. Personnel ($79.30) and patient care ($11.96) contributed the greatest proportion of component costs. Reported AEs were predominantly nonserious (mild or moderate severity) and unrelated to study drug(s) delivery. Intensive identification and management of AEs to conduct clinical trials ethically and protect human subjects require expenditure of substantial human and financial resources. Better understanding of these resource requirements should improve planning and funding of international HIV-related clinical trials.

  16. Impacts of Two Types of El Niño and La Niña Events on Typhoon Activity

    Directory of Open Access Journals (Sweden)

    Po-Chun Hsu

    2013-01-01

    Full Text Available The HadISST (Hadley Centre Sea Ice and Sea Surface Temperature dataset is used to define the years of El Niño, El Niño Modoki, and La Niña events and to find out the impacts of these events on typhoon activity. The results show that the formation positions of typhoon are farther eastward moving in El Niño years than in La Niña years and much further eastward in El Niño Modoki years. The lifetime and the distance of movement are longer, and the intensity of typhoons is stronger in El Niño and in El Niño Modoki years than in La Niña years. The Accumulated Cyclone Energy of typhoon is highly correlated with the Oceanic Niño Index with a correlation coefficient of 0.79. We also find that the typhoons anomalously decrease during El Niño years but increase during El Niño Modoki years. Besides, there are two types of El Niño Modoki, I and II. The intensity of typhoon in El Niño Modoki I years is stronger than in El Niño Modoki II years. Furthermore, the centroid position of the Western Pacific Warm Pool is strongly related to the area of typhoon formation with a correlation coefficient of 0.95.

  17. Exercise induces transient transcriptional activation of the PGC-1a gene in human skeletal muscle

    DEFF Research Database (Denmark)

    Pilegaard, Henriette; Saltin, Bengt; Neufer, P. Darrell

    2003-01-01

    Endurance exercise training induces mitochondrial biogenesis in skeletal muscle. The peroxisome proliferator activated receptor co-activator 1a (PGC-1a) has recently been identified as a nuclear factor critical for coordinating the activation of genes required for mitochondrial biogenesis in cell...

  18. Origin of the CMS gene locus in rapeseed cybrid mitochondria: active and inactive recombination produces the complex CMS gene region in the mitochondrial genomes of Brassicaceae.

    Science.gov (United States)

    Oshima, Masao; Kikuchi, Rie; Imamura, Jun; Handa, Hirokazu

    2010-01-01

    CMS (cytoplasmic male sterile) rapeseed is produced by asymmetrical somatic cell fusion between the Brassica napus cv. Westar and the Raphanus sativus Kosena CMS line (Kosena radish). The CMS rapeseed contains a CMS gene, orf125, which is derived from Kosena radish. Our sequence analyses revealed that the orf125 region in CMS rapeseed originated from recombination between the orf125/orfB region and the nad1C/ccmFN1 region by way of a 63 bp repeat. A precise sequence comparison among the related sequences in CMS rapeseed, Kosena radish and normal rapeseed showed that the orf125 region in CMS rapeseed consisted of the Kosena orf125/orfB region and the rapeseed nad1C/ccmFN1 region, even though Kosena radish had both the orf125/orfB region and the nad1C/ccmFN1 region in its mitochondrial genome. We also identified three tandem repeat sequences in the regions surrounding orf125, including a 63 bp repeat, which were involved in several recombination events. Interestingly, differences in the recombination activity for each repeat sequence were observed, even though these sequences were located adjacent to each other in the mitochondrial genome. We report results indicating that recombination events within the mitochondrial genomes are regulated at the level of specific repeat sequences depending on the cellular environment.

  19. Peroxisome Proliferator-Activated Receptor Alpha Target Genes

    OpenAIRE

    Maryam Rakhshandehroo; Bianca Knoch; Michael Müller; Sander Kersten

    2010-01-01

    The peroxisome proliferator-activated receptor alpha (PPAR alpha) is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPAR alpha serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPAR alpha binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPAR alpha governs biologi...

  20. Regulation of Neuronal Gene Expression and Survival by Basal NMDA Receptor Activity: A Role for Histone Deacetylase 4

    OpenAIRE

    Chen, Yelin; Wang, Yuanyuan; Modrusan, Zora; Sheng, Morgan; Kaminker, Joshua S.

    2014-01-01

    Neuronal gene expression is modulated by activity via calcium-permeable receptors such as NMDA receptors (NMDARs). While gene expression changes downstream of evoked NMDAR activity have been well studied, much less is known about gene expression changes that occur under conditions of basal neuronal activity. In mouse dissociated hippocampal neuronal cultures, we found that a broad NMDAR antagonist, AP5, induced robust gene expression changes under basal activity, but subtype-specific antagoni...

  1. Nuclear factor kappa B activation occurs in the amnion prior to labour onset and modulates the expression of numerous labour associated genes.

    Directory of Open Access Journals (Sweden)

    Sheri Lim

    Full Text Available BACKGROUND: Prior to the onset of human labour there is an increase in the synthesis of prostaglandins, cytokines and chemokines in the fetal membranes, particular the amnion. This is associated with activation of the transcription factor nuclear factor kappa B (NFκB. In this study we characterised the level of NFκB activity in amnion epithelial cells as a measure of amnion activation in samples collected from women undergoing caesarean section at 39 weeks gestation prior to the onset of labour. METHODOLOGY/PRINCIPAL FINDINGS: We found that a proportion of women exhibit low or moderate NFκB activity while other women exhibit high levels of NFκB activity (n = 12. This activation process does not appear to involve classical pathways of NFκB activation but rather is correlated with an increase in nuclear p65-Rel-B dimers. To identify the full range of genes upregulated in association with amnion activation, microarray analysis was performed on carefully characterised non-activated amnion (n = 3 samples and compared to activated samples (n = 3. A total of 919 genes were upregulated in response to amnion activation including numerous inflammatory genes such cyclooxygenase-2 (COX-2, 44-fold, interleukin 8 (IL-8, 6-fold, IL-1 receptor accessory protein (IL-1RAP, 4.5-fold, thrombospondin 1 (TSP-1, 3-fold and, unexpectedly, oxytocin receptor (OTR, 24-fold. Ingenuity Pathway Analysis of the microarray data reveal the two main gene networks activated concurrently with amnion activation are i cell death, cancer and morphology and ii cell cycle, embryonic development and tissue development. CONCLUSIONS/SIGNIFICANCE: Our results indicate that assessment of amnion NFκB activation is critical for accurate sample classification and subsequent interpretation of data. Collectively, our data suggest amnion activation is largely an inflammatory event that occurs in the amnion epithelial layer as a prelude to the onset of labour.

  2. Nuclear factor kappa B activation occurs in the amnion prior to labour onset and modulates the expression of numerous labour associated genes.

    Science.gov (United States)

    Lim, Sheri; MacIntyre, David A; Lee, Yun S; Khanjani, Shirin; Terzidou, Vasso; Teoh, T G; Bennett, Phillip R

    2012-01-01

    Prior to the onset of human labour there is an increase in the synthesis of prostaglandins, cytokines and chemokines in the fetal membranes, particular the amnion. This is associated with activation of the transcription factor nuclear factor kappa B (NFκB). In this study we characterised the level of NFκB activity in amnion epithelial cells as a measure of amnion activation in samples collected from women undergoing caesarean section at 39 weeks gestation prior to the onset of labour. We found that a proportion of women exhibit low or moderate NFκB activity while other women exhibit high levels of NFκB activity (n = 12). This activation process does not appear to involve classical pathways of NFκB activation but rather is correlated with an increase in nuclear p65-Rel-B dimers. To identify the full range of genes upregulated in association with amnion activation, microarray analysis was performed on carefully characterised non-activated amnion (n = 3) samples and compared to activated samples (n = 3). A total of 919 genes were upregulated in response to amnion activation including numerous inflammatory genes such cyclooxygenase-2 (COX-2, 44-fold), interleukin 8 (IL-8, 6-fold), IL-1 receptor accessory protein (IL-1RAP, 4.5-fold), thrombospondin 1 (TSP-1, 3-fold) and, unexpectedly, oxytocin receptor (OTR, 24-fold). Ingenuity Pathway Analysis of the microarray data reveal the two main gene networks activated concurrently with amnion activation are i) cell death, cancer and morphology and ii) cell cycle, embryonic development and tissue development. Our results indicate that assessment of amnion NFκB activation is critical for accurate sample classification and subsequent interpretation of data. Collectively, our data suggest amnion activation is largely an inflammatory event that occurs in the amnion epithelial layer as a prelude to the onset of labour.

  3. In situ detection of the hypermethylation-induced inactivation of the p16 gene as an early event in oncogenesis.

    Science.gov (United States)

    Nuovo, G J; Plaia, T W; Belinsky, S A; Baylin, S B; Herman, J G

    1999-10-26

    We have developed a technique, methylation-specific PCR in situ hybridization (MSP-ISH), which allows for the methylation status of specific DNA sequences to be visualized in individual cells. We use MSP-ISH to monitor the timing and consequences of aberrant hypermethylation of the p16 tumor suppresser gene during the progression of cancers of the lung and cervix. Hypermethylation of p16 was localized only to the neoplastic cells in both in situ lesions and invasive cancers, and was associated with loss of p16 protein expression. MSP-ISH allowed us to dissect the surprising finding that p16 hypermethylation occurs in cervical carcinoma. This tumor is associated with infection of the oncogenic human papillomavirus, which expresses a protein, E7, that inactivates the retinoblastoma (Rb) protein. Thus, simultaneous Rb and p16 inactivation would not be needed to abrogate the critical cyclin D-Rb pathway. MSP-ISH reveals that p16 hypermethylation occurs heterogeneously within early cervical tumor cell populations that are separate from those expressing viral E7 transcripts. In advanced cervical cancers, the majority of cells have a hypermethylated p16, lack p16 protein, but no longer express E7. These data suggest that p16 inactivation is selected as the most effective mechanism of blocking the cyclin D-Rb pathway during the evolution of an invasive cancer from precursor lesions. These studies demonstrate that MSP-ISH is a powerful approach for studying the dynamics of aberrant methylation of critical tumor suppressor genes during tumor evolution.

  4. Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts.

    Science.gov (United States)

    Pandian, Ganesh N; Taniguchi, Junichi; Junetha, Syed; Sato, Shinsuke; Han, Le; Saha, Abhijit; AnandhaKumar, Chandran; Bando, Toshikazu; Nagase, Hiroki; Vaijayanthi, Thangavel; Taylor, Rhys D; Sugiyama, Hiroshi

    2014-01-24

    The influential role of the epigenome in orchestrating genome-wide transcriptional activation instigates the demand for the artificial genetic switches with distinct DNA sequence recognition. Recently, we developed a novel class of epigenetically active small molecules called SAHA-PIPs by conjugating selective DNA binding pyrrole-imidazole polyamides (PIPs) with the histone deacetylase inhibitor SAHA. Screening studies revealed that certain SAHA-PIPs trigger targeted transcriptional activation of pluripotency and germ cell genes in mouse and human fibroblasts, respectively. Through microarray studies and functional analysis, here we demonstrate for the first time the remarkable ability of thirty-two different SAHA-PIPs to trigger the transcriptional activation of exclusive clusters of genes and noncoding RNAs. QRT-PCR validated the microarray data, and some SAHA-PIPs activated therapeutically significant genes like KSR2. Based on the aforementioned results, we propose the potential use of SAHA-PIPs as reagents capable of targeted transcriptional activation.

  5. Peroxisome Proliferator-Activated Receptor Alpha Target Genes

    NARCIS (Netherlands)

    Rakhshandehroo, M.; Knoch, B.; Müller, M.R.; Kersten, A.H.

    2010-01-01

    The peroxisome proliferator-activated receptor alpha (PPAR alpha) is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPAR alpha serves as a molecular target for hypolip

  6. RNA-Guided Activation of Pluripotency Genes in Human Fibroblasts

    DEFF Research Database (Denmark)

    Xiong, Kai; Zhou, Yan; Blichfeld, Kristian Aabo

    2017-01-01

    fibroblasts. This SAM-mediated activation of LOS can be stably maintained for over 20 days in fibroblasts cultured in either fibroblasts or stem cell medium. However, when attempting to use the SAM-LOS activation as an approach for induced pluripotent stem cells-reprogramming, no embryonic stem-like colonies...

  7. Peroxisome Proliferator-Activated Receptor Alpha Target Genes

    NARCIS (Netherlands)

    Rakhshandehroo, M.; Knoch, B.; Müller, M.R.; Kersten, A.H.

    2010-01-01

    The peroxisome proliferator-activated receptor alpha (PPAR alpha) is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPAR alpha serves as a molecular target for

  8. Antifungal activity and gene expression of lipopeptide antibiotics in strains of genus Bacillus

    OpenAIRE

    Grabova A. Yu.; Dragovoz I. V.; Zelena L. B.; Tkachuk D. M.; Avdeeva L. V.

    2016-01-01

    Aim. To research the antifungal activity and gene expression of lipopeptide antibiotics in strains of genus Bacillus. Methods. Deferred antagonism method, PCR, qRT-PCR, MALDI-TOF mass spectrometry. Results. It was revealed that Bacillus sp. strains C6 and Lg37s out of five tested strains had the highest antifungal activity. Based on the molecular genetic methods, it was shown that the expression of genes of lipopeptide antibiotics, related to the fengycin family, occurred in all these strains...

  9. Connexin36 Gap Junction Blockade Is Ineffective at Reducing Seizure-Like Event Activity in Neocortical Mouse Slices

    Directory of Open Access Journals (Sweden)

    Logan J. Voss

    2010-01-01

    Full Text Available Despite much research, there remains controversy over the role of gap junctions in seizure processes. Many studies report anticonvulsant effects of gap junction blockade, but contradictory results have also been reported. The aim of this study was to clarify the role of connexin36 (Cx36 gap junctions in neocortical seizures. We used the mouse neocortical slice preparation to investigate the effect of pharmacological (mefloquine and genetic (Cx36 knockout mice (Cx36KO manipulation of Cx36 gap junctions on two seizure models: low-magnesium artificial cerebrospinal fluid (ACSF and aconitine perfusion in low-magnesium ACSF. Low-magnesium- (nominally zero and aconitine- (230 nM induced seizure-like event (SLE population activity was recorded extracellularly. The results were consistent in showing that neither mefloquine (25 μM nor genetic knockdown of Cx36 expression had anticonvulsant effects on SLE activity generated by either method. These findings call into question the widely held idea that open Cx36 gap junctions promote seizure activity.

  10. Event-related fMRI studies of false memory: An Activation Likelihood Estimation meta-analysis.

    Science.gov (United States)

    Kurkela, Kyle A; Dennis, Nancy A

    2016-01-29

    Over the last two decades, a wealth of research in the domain of episodic memory has focused on understanding the neural correlates mediating false memories, or memories for events that never happened. While several recent qualitative reviews have attempted to synthesize this literature, methodological differences amongst the empirical studies and a focus on only a sub-set of the findings has limited broader conclusions regarding the neural mechanisms underlying false memories. The current study performed a voxel-wise quantitative meta-analysis using activation likelihood estimation to investigate commonalities within the functional magnetic resonance imaging (fMRI) literature studying false memory. The results were broken down by memory phase (encoding, retrieval), as well as sub-analyses looking at differences in baseline (hit, correct rejection), memoranda (verbal, semantic), and experimental paradigm (e.g., semantic relatedness and perceptual relatedness) within retrieval. Concordance maps identified significant overlap across studies for each analysis. Several regions were identified in the general false retrieval analysis as well as multiple sub-analyses, indicating their ubiquitous, yet critical role in false retrieval (medial superior frontal gyrus, left precentral gyrus, left inferior parietal cortex). Additionally, several regions showed baseline- and paradigm-specific effects (hit/perceptual relatedness: inferior and middle occipital gyrus; CRs: bilateral inferior parietal cortex, precuneus, left caudate). With respect to encoding, analyses showed common activity in the left middle temporal gyrus and anterior cingulate cortex. No analysis identified a common cluster of activation in the medial temporal lobe.

  11. Expression activity of the CpTI gene in transgenic rice plants

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    @@Plant harboured protease inhibitor is a part of the natural plant defense system against insect predation. Plants transformed with foreign plant protease inhibitor genes can enhance resistance to insect pests. So far, at least 20 kinds of plants, including tobacco, rice, tomato, cotton et al., have been transformed with various plant protease inhibitor genes. We have transformed rice with CpTI (cowpea trypsin inhibitor) gene. To assess the range and stability of expression of the CpTI gene, CpTI protein activities were determined in various tissues and at different development stages of transgenic inbred lines.

  12. Transcriptomic Analysis of Musca domestica to Reveal Key Genes of the Prophenoloxidase-Activating System.

    Science.gov (United States)

    Li, Dianxiang; Liang, Yongli; Wang, Xianwei; Wang, Lei; Qi, Mei; Yu, Yang; Luan, Yuanyuan

    2015-09-01

    The proPO system regulates melanization in arthropods. However, the genes that are involved in the proPO system in housefly Musca domestica remain unclear. Thus, this study analyzed the combined transcriptome obtained from M. domestica larvae, pupae, and adults that were either normal or bacteria-challenged by an Escherichia coli and Staphylococcus aureus mixture. A total of 54,821,138 clean reads (4.93 Gb) were yielded by Illumina sequencing, which were de novo assembled into 89,842 unigenes. Of the 89,842 unigenes, based on a similarity search with known genes in other insects, 24 putative genes related to the proPO system were identified. Eight of the identified genes encoded for peptidoglycan recognition receptors, two encoded for prophenoloxidases, three encoded for prophenoloxidase-activating enzymes, and 11 encoded for serine proteinase inhibitors. The expression levels of these identified genes were investigated by qRT-PCR assay, which were consistent with expected activation process of the proPO system, and their activation functions were confirmed by the measurement of phenoloxidase activity in bacteria-infected larvae after proPO antibody blockage, suggesting these candidate genes might have potentially different roles in the activation of proPO system. Collectively, this study has provided the comprehensive transcriptomic data of an insect and some fundamental basis toward achieving understanding of the activation mechanisms and immune functions of the proPO system in M. domestica.

  13. Targeting c-Myc-activated genes with a correlation method: Detection of global changes in large gene expression network dynamics

    Science.gov (United States)

    Remondini, D.; O'Connell, B.; Intrator, N.; Sedivy, J. M.; Neretti, N.; Castellani, G. C.; Cooper, L. N.

    2005-01-01

    This work studies the dynamics of a gene expression time series network. The network, which is obtained from the correlation of gene expressions, exhibits global dynamic properties that emerge after a cell state perturbation. The main features of this network appear to be more robust when compared with those obtained with a network obtained from a linear Markov model. In particular, the network properties strongly depend on the exact time sequence relationships between genes and are destroyed by random temporal data shuffling. We discuss in detail the problem of finding targets of the c-myc protooncogene, which encodes a transcriptional regulator whose inappropriate expression has been correlated with a wide array of malignancies. The data used for network construction are a time series of gene expression, collected by microarray analysis of a rat fibroblast cell line expressing a conditional Myc-estrogen receptor oncoprotein. We show that the correlation-based model can establish a clear relationship between network structure and the cascade of c-myc-activated genes. PMID:15867157

  14. Altered gene expression in highly purified enterocytes from patients with active coeliac disease

    Directory of Open Access Journals (Sweden)

    Jackson John

    2008-08-01

    Full Text Available Abstract Background Coeliac disease is a multifactorial inflammatory disorder of the intestine caused by ingestion of gluten in genetically susceptible individuals. Genes within the HLA-DQ locus are considered to contribute some 40% of the genetic influence on this disease. However, information on other disease causing genes is sparse. Since enterocytes are considered to play a central role in coeliac pathology, the aim of this study was to examine gene expression in a highly purified isolate of these cells taken from patients with active disease. Epithelial cells were isolated from duodenal biopsies taken from five coeliac patients with active disease and five non-coeliac control subjects. Contaminating T cells were removed by magnetic sorting. The gene expression profile of the cells was examined using microarray analysis. Validation of significantly altered genes was performed by real-time RT-PCR and immunohistochemistry. Results Enterocyte suspensions of high purity (98–99% were isolated from intestinal biopsies. Of the 3,800 genes investigated, 102 genes were found to have significantly altered expression between coeliac disease patients and controls (p Conclusion This study provides a profile of the molecular changes that occur in the intestinal epithelium of coeliac patients with active disease. Novel candidate genes were revealed which highlight the contribution of the epithelial cell to the pathogenesis of coeliac disease.

  15. Epigenomic modifications predict active promoters and gene structure in Toxoplasma gondii.

    Directory of Open Access Journals (Sweden)

    Mathieu Gissot

    2007-06-01

    Full Text Available Mechanisms of gene regulation are poorly understood in Apicomplexa, a phylum that encompasses deadly human pathogens like Plasmodium and Toxoplasma. Initial studies suggest that epigenetic phenomena, including histone modifications and chromatin remodeling, have a profound effect upon gene expression and expression of virulence traits. Using the model organism Toxoplasma gondii, we characterized the epigenetic organization and transcription patterns of a contiguous 1% of the T. gondii genome using custom oligonucleotide microarrays. We show that methylation and acetylation of histones H3 and H4 are landmarks of active promoters in T. gondii that allow us to deduce the position and directionality of gene promoters with >95% accuracy. These histone methylation and acetylation "activation" marks are strongly associated with gene expression. We also demonstrate that the pattern of histone H3 arginine methylation distinguishes certain promoters, illustrating the complexity of the histone modification machinery in Toxoplasma. By integrating epigenetic data, gene prediction analysis, and gene expression data from the tachyzoite stage, we illustrate feasibility of creating an epigenomic map of T. gondii tachyzoite gene expression. Further, we illustrate the utility of the epigenomic map to empirically and biologically annotate the genome and show that this approach enables identification of previously unknown genes. Thus, our epigenomics approach provides novel insights into regulation of gene expression in the Apicomplexa. In addition, with its compact genome, genetic tractability, and discrete life cycle stages, T. gondii provides an important new model to study the evolutionarily conserved components of the histone code.

  16. Early impact event and fluid activity on H chondrite parent body registered in the Pułtusk meteorite

    Science.gov (United States)

    Krzesinska, Agata

    2015-04-01

    Impact is one of the most important processes affecting asteroids, but it is neglected as a source for heat of these bodies. Recent modeling work show, however, that impact into warm planetesimals is able to cause global-scale temperature increase to the point of melting of silicates [1]. An obvious consequence of this fact is that the impact activity in early evolution of asteroids may promote formation of melt and its differentiation. H chondrites provide some lines of evidence for an early, 4.4 Ga impact event on their parent body. The event resulted in formation of heavily shocked and melted H chondrites with old gas retention ages [2, 3], including Portales Valley, an unique metal-rich breccia [e.g. 4]. The impact led also, very likely, to unmixing of silicate and metal-sulfide melts and to formation of silicate-iron non-magmatic IIE meteorites [5]. Additional evidence for this event, and for melting it caused, may come from highly equilibrated and recrystallized fragments of the Pułtusk meteorite containing vein-like metal accumulations [6]. In the Pułtusk, vein-like metal accumulations are kamacite-rich, and basically depleted in sulfides. They form many tendrils into the equilibrated, well recrystallized chondritic rock. Marked feature of the chondritic rock at the contact with accumulations is presence of unusually large phosphate and feldspar grains. The minerals bear record of crystallization from melt. Both vein-like metal accumulations and chondritic rock record, however, slow cooling rate. Phopshates are in the meteorite represented by merrillite and apatite, predominantly intergrown with each other. Merrillite poikilitically encloses silicate grains. It is probably of magmatic origin, since it contains detectable amount of potassium and high content of sodium. Apatite contains varying concentrations of chlorine, fluorine and missing structural component. Content of Cl and F are negatively correlated and both elements are heterogeneously distributed

  17. Phylogenetic analysis of eukaryotic NEET proteins uncovers a link between a key gene duplication event and the evolution of vertebrates

    Science.gov (United States)

    Inupakutika, Madhuri A.; Sengupta, Soham; Nechushtai, Rachel; Jennings, Patricia A.; Onuchic, Jose’ N.; Azad, Rajeev K.; Padilla, Pamela; Mittler, Ron

    2017-02-01

    NEET proteins belong to a unique family of iron-sulfur proteins in which the 2Fe-2S cluster is coordinated by a CDGSH domain that is followed by the “NEET” motif. They are involved in the regulation of iron and reactive oxygen metabolism, and have been associated with the progression of diabetes, cancer, aging and neurodegenerative diseases. Despite their important biological functions, the evolution and diversification of eukaryotic NEET proteins are largely unknown. Here we used the three members of the human NEET protein family (CISD1, mitoNEET; CISD2, NAF-1 or Miner 1; and CISD3, Miner2) as our guides to conduct a phylogenetic analysis of eukaryotic NEET proteins and their evolution. Our findings identified the slime mold Dictyostelium discoideum’s CISD proteins as the closest to the ancient archetype of eukaryotic NEET proteins. We further identified CISD3 homologs in fungi that were previously reported not to contain any NEET proteins, and revealed that plants lack homolog(s) of CISD3. Furthermore, our study suggests that the mammalian NEET proteins, mitoNEET (CISD1) and NAF-1 (CISD2), emerged via gene duplication around the origin of vertebrates. Our findings provide new insights into the classification and expansion of the NEET protein family, as well as offer clues to the diverged functions of the human mitoNEET and NAF-1 proteins.

  18. NF-Y activates genes of metabolic pathways altered in cancer cells.

    Science.gov (United States)

    Benatti, Paolo; Chiaramonte, Maria Luisa; Lorenzo, Mariangela; Hartley, John A; Hochhauser, Daniel; Gnesutta, Nerina; Mantovani, Roberto; Imbriano, Carol; Dolfini, Diletta

    2016-01-12

    The trimeric transcription factor NF-Y binds to the CCAAT box, an element enriched in promoters of genes overexpressed in tumors. Previous studies on the NF-Y regulome identified the general term metabolism as significantly enriched. We dissect here in detail the targeting of metabolic genes by integrating analysis of NF-Y genomic binding and profilings after inactivation of NF-Y subunits in different cell types. NF-Y controls de novo biosynthetic pathways of lipids, teaming up with the master SREBPs regulators. It activates glycolytic genes, but, surprisingly, is neutral or represses mitochondrial respiratory genes. NF-Y targets the SOCG (Serine, One Carbon, Glycine) and Glutamine pathways, as well as genes involved in the biosynthesis of polyamines and purines. Specific cancer-driving nodes are generally under NF-Y control. Altogether, these data delineate a coherent strategy to promote expression of metabolic genes fuelling anaerobic energy production and other anabolic pathways commonly altered in cancer cells.

  19. IL-4 dependent alternatively-activated macrophages have a distinctive in vivo gene expression phenotype

    Directory of Open Access Journals (Sweden)

    Guiliano David

    2002-07-01

    Full Text Available Abstract Background "Alternatively-activated" macrophages are found in Th2-mediated inflammatory settings such as nematode infection and allergic pulmonary inflammation. Due in part to a lack of markers, these cells have not been well characterized in vivo and their function remains unknown. Results We have used murine macrophages elicited by nematode infection (NeMφ as a source of in vivo derived alternatively activated macrophages. Using three distinct yet complementary molecular approaches we have established a gene expression profile of alternatively activated macrophages and identified macrophage genes that are regulated in vivo by IL-4. First, genes abundantly expressed were identified by an expressed sequence tag strategy. Second, an array of 1176 known mouse genes was screened for differential expression between NeMφ from wild type or IL-4 deficient mice. Third, a subtractive library was screened to identify novel IL-4 dependent macrophage genes. Differential expression was confirmed by real time RT-PCR analysis. Conclusions Our data demonstrate that alternatively activated macrophages generated in vivo have a gene expression profile distinct from any macrophage population described to date. Several of the genes we identified, including those most abundantly expressed, have not previously been associated with macrophages and thus this study provides unique new information regarding the phenotype of macrophages found in Th2-mediated, chronic inflammatory settings. Our data also provide additional in vivo evidence for parallels between the inflammatory processes involved in nematode infection and allergy.

  20. Transcriptional activation of plant defense genes by fungal elicitor, wounding, and infection.

    Science.gov (United States)

    Lawton, M A; Lamb, C J

    1987-01-01

    Activation of plant defense genes was investigated by analysis of transcripts completed in vitro by isolated nuclei. Elicitor treatment of suspension-cultured bean (Phaseolus vulgaris L.) cells caused marked transient stimulation of transcription of genes encoding apoproteins of cell wall hydroxyproline-rich glycoproteins (HRGP) and the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL) and chalcone synthase (CHS), concomitant with the onset of rapid accumulation of the respective mRNAs and hence expression of the phytoalexin (PAL, CHS), lignin (PAL), and HRGP defense responses. While there was a lag of 2 h prior to stimulation of HRGP gene transcription, induction of the transcription of PAL and CHS genes occurred within 5 min of elicitor treatment. Induction of transcription of PAL, CHS, and HRGP genes was also observed in wounded hypocotyls and in infected hypocotyls during race-cultivar-specific interactions with the fungus Colletotrichum lindemuthianum, the causal agent of anthracnose. Transcriptional activation occurred not only in directly infected tissue but also in distant, hitherto uninfected tissue, indicating intercellular transmission of an endogenous signal for defense gene activation. It is concluded that transcriptional activation of defense genes characteristically underlies induction of the corresponding defense responses and expression of disease resistance.

  1. A gene encoding a new cold-active lipase from an Antarctic isolate of Penicillium expansum.

    Science.gov (United States)

    Mohammed, Suja; Te'o, Junior; Nevalainen, Helena

    2013-08-01

    Cold-active lipases are of significant interest as biocatalysts in industrial processes. We have identified a lipase that displayed activity towards long carbon-chain-p-nitrophenyl substrates (C12-C18) at 25 °C from the culture supernatant of an Antarctic Penicillium expansum strain assigned P. expansum SM3. Zymography revealed a protein band of around 30 kDa with activity towards olive oil. DNA fragments of a lipase gene designated as lipPE were isolated from the genomic DNA of P. expansum SM3 by genomic walking PCR. Subsequently, the complete genomic lipPE gene was amplified using gene-specific primers designed from the 5'- and 3'-regions. Reverse transcription PCR was used to amplify the lipPE cDNA. The deduced amino acid sequence consisted of 285 residues that included a predicted signal peptide. Three peptides identified by LC/MS/MS analysis of the proteins in the culture supernatant of P. expansum were also present in the deduced amino acid sequence of the lipPE gene suggesting that this gene encoded the lipase identified by initial zymogram activity analysis. Full analysis of the nucleotide and the deduced amino acid sequences indicated that the lipPE gene encodes a novel P. expansum lipase. The lipPE gene was expressed in E. coli for further characterization of the enzyme with a view of assessing its suitability for industrial applications.

  2. Event Segmentation Ability Uniquely Predicts Event Memory

    Science.gov (United States)

    Sargent, Jesse Q.; Zacks, Jeffrey M.; Hambrick, David Z.; Zacks, Rose T.; Kurby, Christopher A.; Bailey, Heather R.; Eisenberg, Michelle L.; Beck, Taylor M.

    2013-01-01

    Memory for everyday events plays a central role in tasks of daily living, autobiographical memory, and planning. Event memory depends in part on segmenting ongoing activity into meaningful units. This study examined the relationship between event segmentation and memory in a lifespan sample to answer the following question: Is the ability to segment activity into meaningful events a unique predictor of subsequent memory, or is the relationship between event perception and memory accounted for by general cognitive abilities? Two hundred and eight adults ranging from 20 to 79 years old segmented movies of everyday events and attempted to remember the events afterwards. They also completed psychometric ability tests and tests measuring script knowledge for everyday events. Event segmentation and script knowledge both explained unique variance in event memory above and beyond the psychometric measures, and did so as strongly in older as in younger adults. These results suggest that event segmentation is a basic cognitive mechanism, important for memory across the lifespan. PMID:23942350

  3. The coupling between enhancer activity and hypomethylation of kappa immunoglobulin genes is developmentally regulated

    Energy Technology Data Exchange (ETDEWEB)

    Kelley, D.E.; Pollok, B.A.; Atchison, M.L.; Perry, R.P.

    1988-02-01

    Previous studies have indicated that immunoglobulin enhancers are essential for establishing transcriptional competence but not for maintaining the activity of constitutively transcribed genes. To understand the basis for this developmental shift away from dependence on enhancer function, the authors investigated the relationship between transcriptional activity and methylation status of the immunoglobulin kappa-light-chain genes (kappa genes) in mouse cell lines representing different stages of B-cell maturation. Using pre-B-cell lines in which the level of a critical kappa enhancer-binding factor, NF-kappaB, was controlled by the administration of withdrawal of lipopolysaccharide and plasmacytoma lines that either contain or lack this factor, they studied the properties of endogenous kappa genes and of transfected kappa genes which were stably integrated into the genomes of these cells. In the pre-B cells, the exogenous (originally unmethylated) kappa genes, as well as the endogenous kappa genes, were fully methylated and persistently dependent on enhancer function, even after more than 30 generations in a transcriptionally active state. In plasmacytoma cells, the endogenous kappa genes were invariably hypomethylated, whereas exogenous kappa genes were hypomethylated only in cells that contain NF-kappaB and are thus permissive for kappa enhancer function. These results indicate that the linkage of hypomethylation to enhancer-dependent activation of kappa transcription occurs after the pre-B-cell stage of development. The change in methylation status, together with associated changes in chromatin structure, may suffice to eliminate or lessen the importance of the enhancer for the maintenance of the transcriptionally active state.

  4. Regulation of myelin genes implicated in psychiatric disorders by functional activity in axons

    Directory of Open Access Journals (Sweden)

    Philip R Lee

    2009-06-01

    Full Text Available Myelination is a highly dynamic process that continues well into adulthood in humans. Several recent gene expression studies have found abnormal expression of genes involved in myelination in the prefrontal cortex of brains from patients with schizophrenia and other psychiatric illnesses. Defects in myelination could contribute to the pathophysiology of psychiatric illness by impairing information processing as a consequence of altered impulse conduction velocity and synchrony between cortical regions carrying out higher level cognitive functions. Myelination can be altered by impulse activity in axons and by environmental experience. Psychiatric illness is treated by psychotherapy, behavioral modification, and drugs affecting neurotransmission, raising the possibility that myelinating glia may not only contribute to such disorders, but that activity-dependent effects on myelinating glia could provide one of the cellular mechanisms contributing to the therapeutic effects of these treatments. This review examines evidence showing that genes and gene networks important for myelination can be regulated by functional activity in axons.

  5. Nonimmunoglobulin target loci of activation-induced cytidine deaminase (AID) share unique features with immunoglobulin genes.

    Science.gov (United States)

    Kato, Lucia; Begum, Nasim A; Burroughs, A Maxwell; Doi, Tomomitsu; Kawai, Jun; Daub, Carsten O; Kawaguchi, Takahisa; Matsuda, Fumihiko; Hayashizaki, Yoshihide; Honjo, Tasuku

    2012-02-14

    Activation-induced cytidine deaminase (AID) is required for both somatic hypermutation and class-switch recombination in activated B cells. AID is also known to target nonimmunoglobulin genes and introduce mutations or chromosomal translocations, eventually causing tumors. To identify as-yet-unknown AID targets, we screened early AID-induced DNA breaks by using two independent genome-wide approaches. Along with known AID targets, this screen identified a set of unique genes (SNHG3, MALAT1, BCL7A, and CUX1) and confirmed that these loci accumulated mutations as frequently as Ig locus after AID activation. Moreover, these genes share three important characteristics with the Ig gene: translocations in tumors, repetitive sequences, and the epigenetic modification of chromatin by H3K4 trimethylation in the vicinity of cleavage sites.

  6. A tool for empirical forecasting of major flares, coronal mass ejections, and solar particle events from a proxy of active-region free magnetic energy

    Science.gov (United States)

    Falconer, David; Barghouty, Abdulnasser F.; Khazanov, Igor; Moore, Ron

    2011-04-01

    This paper describes a new forecasting tool developed for and currently being tested by NASA's Space Radiation Analysis Group (SRAG) at Johnson Space Center, which is responsible for the monitoring and forecasting of radiation exposure levels of astronauts. The new software tool is designed for the empirical forecasting of M- and X-class flares, coronal mass ejections, and solar energetic particle events. For each type of event, the algorithm is based on the empirical relationship between the event rate and a proxy of the active region's free magnetic energy. Each empirical relationship is determined from a data set of ˜40,000 active-region magnetograms from ˜1300 active regions observed by SOHO/Michelson Doppler Imager (MDI) that have known histories of flare, coronal mass ejection, and solar energetic particle event production. The new tool automatically extracts each strong-field magnetic area from an MDI full-disk magnetogram, identifies each as a NOAA active region, and measures the proxy of the active region's free magnetic energy from the extracted magnetogram. For each active region, the empirical relationship is then used to convert the free-magnetic-energy proxy into an expected event rate. The expected event rate in turn can be readily converted into the probability that the active region will produce such an event in a given forward time window. Descriptions of the data sets, algorithm, and software in addition to sample applications and a validation test are presented. Further development and transition of the new tool in anticipation of SDO/HMI are briefly discussed.

  7. Reduced frequency of two activating KIR genes in patients with sepsis.

    Science.gov (United States)

    Oliveira, Luciana M; Portela, Pamela; Merzoni, Joice; Lindenau, Juliana D; Dias, Fernando S; Beppler, Jaqueline; Graebin, Pietra; Alho, Clarice S; Schwartsmann, Gilberto; Dal-Pizzol, Felipe; Jobim, Luiz Fernando; Jobim, Mariana; Roesler, Rafael

    2017-04-01

    Natural killer (NK) cell activity is regulated by activating and inhibitory signals transduced by killer cell immunoglobulin-like receptors (KIR). Diversity in KIR gene repertoire among individuals may affect disease outcome. Sepsis development and severity may be influenced by genetic factors affecting the immune response. Here, we examined sixteen KIR genes and their human leucocyte antigen (HLA) class I ligands in critical patients, aiming to identify patterns that could be associated with sepsis. Male and female patients (ages ranging between 14 and 94years-old) were included. DNA samples from 211 patients with sepsis and 60 controls (critical care patients with no sepsis) collected between 2004 and 2010 were included and genotyped for KIR genes using the polymerase chain reaction method with sequence-specific oligonucleotide (PCR-SSO), and for HLA genes using the polymerase chain reaction method with sequence-specific primers (PCR-SSP). The frequencies of activating KIR2DS1 and KIR3DS1 in sepsis patients when compared to controls were 41.23% versus 55.00% and 36.49% versus 51.67% (p=0.077 and 0.037 respectively before Bonferroni correction). These results indicate that activating KIR genes 2DS1 and 3DS1 may more prevalent in critical patients without sepsis than in patients with sepsis, suggesting a potential protective role of activating KIR genes in sepsis. Copyright © 2017 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  8. Pain modulation in waking and hypnosis in women: event-related potentials and sources of cortical activity.

    Science.gov (United States)

    De Pascalis, Vilfredo; Varriale, Vincenzo; Cacace, Immacolata

    2015-01-01

    Using a strict subject selection procedure, we tested in High and Low Hypnotizable subjects (HHs and LHs) whether treatments of hypoalgesia and hyperalgesia, as compared to a relaxation-control, differentially affected subjective pain ratings and somatosensory event-related potentials (SERPs) during painful electric stimulation. Treatments were administered in waking and hypnosis conditions. LHs showed little differentiation in pain and distress ratings between hypoalgesia and hyperalgesia treatments, whereas HHs showed a greater spread in the instructed direction. HHs had larger prefrontal N140 and P200 waves of the SERPs during hypnotic hyperalgesia as compared to relaxation-control treatment. Importantly, HHs showed significant smaller frontocentral N140 and frontotemporal P200 waves during hypnotic hypoalgesia. LHs did not show significant differences for these SERP waves among treatments in both waking and hypnosis conditions. Source localization (sLORETA) method revealed significant activations of the bilateral primary somatosensory (BA3), middle frontal gyrus (BA6) and anterior cingulate cortices (BA24). Activity of these contralateral regions significantly correlated with subjective numerical pain scores for control treatment in waking condition. Moreover, multivariate regression analyses distinguished the contralateral BA3 as the only region reflecting a stable pattern of pain coding changes across all treatments in waking and hypnosis conditions. More direct testing showed that hypnosis reduced the strength of the association of pain modulation and brain activity changes at BA3. sLORETA in HHs revealed, for the N140 wave, that during hypnotic hyperalgesia, there was an increased activity within medial, supramarginal and superior frontal gyri, and cingulated gyrus (BA32), while for the P200 wave, activity was increased in the superior (BA22), middle (BA37), inferior temporal (BA19) gyri and superior parietal lobule (BA7). Hypnotic hypoalgesia in HHs, for N

  9. Pain modulation in waking and hypnosis in women: event-related potentials and sources of cortical activity.

    Directory of Open Access Journals (Sweden)

    Vilfredo De Pascalis

    Full Text Available Using a strict subject selection procedure, we tested in High and Low Hypnotizable subjects (HHs and LHs whether treatments of hypoalgesia and hyperalgesia, as compared to a relaxation-control, differentially affected subjective pain ratings and somatosensory event-related potentials (SERPs during painful electric stimulation. Treatments were administered in waking and hypnosis conditions. LHs showed little differentiation in pain and distress ratings between hypoalgesia and hyperalgesia treatments, whereas HHs showed a greater spread in the instructed direction. HHs had larger prefrontal N140 and P200 waves of the SERPs during hypnotic hyperalgesia as compared to relaxation-control treatment. Importantly, HHs showed significant smaller frontocentral N140 and frontotemporal P200 waves during hypnotic hypoalgesia. LHs did not show significant differences for these SERP waves among treatments in both waking and hypnosis conditions. Source localization (sLORETA method revealed significant activations of the bilateral primary somatosensory (BA3, middle frontal gyrus (BA6 and anterior cingulate cortices (BA24. Activity of these contralateral regions significantly correlated with subjective numerical pain scores for control treatment in waking condition. Moreover, multivariate regression analyses distinguished the contralateral BA3 as the only region reflecting a stable pattern of pain coding changes across all treatments in waking and hypnosis conditions. More direct testing showed that hypnosis reduced the strength of the association of pain modulation and brain activity changes at BA3. sLORETA in HHs revealed, for the N140 wave, that during hypnotic hyperalgesia, there was an increased activity within medial, supramarginal and superior frontal gyri, and cingulated gyrus (BA32, while for the P200 wave, activity was increased in the superior (BA22, middle (BA37, inferior temporal (BA19 gyri and superior parietal lobule (BA7. Hypnotic hypoalgesia in

  10. Assessing the spatiotemporal evolution of neuronal activation with single-trial event-related potentials and functional MRI.

    Science.gov (United States)

    Eichele, Tom; Specht, Karsten; Moosmann, Matthias; Jongsma, Marijtje L A; Quiroga, Rodrigo Quian; Nordby, Helge; Hugdahl, Kenneth

    2005-12-06

    The brain acts as an integrated information processing system, which methods in cognitive neuroscience have so far depicted in a fragmented fashion. Here, we propose a simple and robust way to integrate functional MRI (fMRI) with single trial event-related potentials (ERP) to provide a more complete spatiotemporal characterization of evoked responses in the human brain. The idea behind the approach is to find brain regions whose fMRI responses can be predicted by paradigm-induced amplitude modulations of simultaneously acquired single trial ERPs. The method was used to study a variant of a two-stimulus auditory target detection (odd-ball) paradigm that manipulated predictability through alternations of stimulus sequences with random or regular target-to-target intervals. In addition to electrophysiologic and hemodynamic evoked responses to auditory targets per se, single-trial modulations were expressed during the latencies of the P2 (170-ms), N2 (200-ms), and P3 (320-ms) components and predicted spatially separated fMRI activation patterns. These spatiotemporal matches, i.e., the prediction of hemodynamic activation by time-variant information from single trial ERPs, permit inferences about regional responses using fMRI with the temporal resolution provided by electrophysiology.

  11. Effects of musical training and absolute pitch ability on event-related activity in response to sine tones.

    Science.gov (United States)

    Wayman, J W; Frisina, R D; Walton, J P; Hantz, E C; Crummer, G C

    1992-06-01

    The neural correlates of music perception have received relatively little scientific attention. The neural activity of listeners without musical training (N = 11), highly trained musicians (N = 14), and musicians possessing "absolute pitch" (AP) ability (N = 10) have been measured. Major differences were observed in the P3, an endogenous event-related potential (ERP), which is thought to be a neurophysiological manifestation of working memory processing. The P3 was elicited using the classical "oddball" paradigm with a sine-tone series. Subjects' musical backgrounds were evaluated with a survey questionnaire. AP ability was verified with an objective pitch identification test. The P3 amplitude, latency and wave shape were evaluated along with each subjects' performance score and musical background. The AP subjects showed a significantly smaller P3 amplitude than either the musicians or nonmusicians, which were nearly identical. The P3 latency was shortest for the AP subjects, and was longer for the nonmusicians. Performance scores were uniformly high in all three groups. It is concluded that AP subjects do indeed exhibit P3 ERPs, albeit with smaller amplitudes and shorter latencies. The differences in neural activity between the musicians and AP subjects were not due to musical training, as the AP subjects had similar musical backgrounds to the musician group. It is also concluded that persons with the AP ability may have superior auditory sensitivity at cortical levels and/or use unique neuropsychological strategies when processing tones.

  12. Antifungal activity of a virally encoded gene in transgenic wheat.

    Science.gov (United States)

    Clausen, M; Kräuter, R; Schachermayr, G; Potrykus, I; Sautter, C

    2000-04-01

    The cDNA encoding the antifungal protein KP4 from Ustilago maydis-infecting virus was inserted behind the ubiquitin promoter of maize and genetically transferred to wheat varieties particularly susceptible to stinking smut (Tilletia tritici) disease. The transgene was integrated and inherited over several generations. Of seven transgenic lines, three showed antifungal activity against U. maydis. The antifungal activity correlated with the presence of the KP4 transgene. KP4-transgenic, soil-grown wheat plants exhibit increased endogenous resistance against stinking smut.

  13. Expression of recombination-activating genes and T cell receptor gene recombination in the human T cell leukemia cell line.

    Science.gov (United States)

    Zou, Hong-yun; Ma, Li; Meng, Min-jie; Yao, Xin-sheng; Lin, Ying; Wu, Zhen-qiang; He, Xiao-wei; Wang, Ju-fang; Wang, Xiao-ning

    2007-03-05

    Recent studies have suggested that mature T cells can change their specificity through reexpression of recombination-activating genes (RAG) and RAG-mediated V(D)J recombination. This process is named receptor revision and has been observed in mature peripheral T cells from transgenic mice and human donors. However, whether thebreceptor revision in mature T cells is a random or orientated process remains poorly understood. Here we used the Jurkathuman T cell line, which represents a mature stage of T cell development, as a model to investigate the regulation of Tcell receptor (TCR) gene recombination. TCR Dbeta-Jbeta signal joint T cell receptor excision DNA circles (sjTRECs) were determined by nested and seminested PCR. Double-strand DNA breaks at recombination signal sequences (RSSs) in the TCRVbeta chain locus were detected by ligation-mediated-PCR. Further analysis of the complementarity-determining region 3 (CDR3) size of the TCRVbeta chain was examined by the TCR GeneScan technique. RAG1, RAG2, and three crucial components of the nonhomologous DNA end-joining (NHEJ) pathway were readily detected in Jurkat. Characteristics of junctional diversity of Dbeta2-Jbeta2 signal joints and ds RSS breaks associated with the Dbeta2 5' and Dbeta 2 3' sites were detected in DNA from Jurkat cells. CDR3 size and the gene sequences of the TCRVbeta chain did not change during cell proliferation. RAG1 and RAG2 and ongoing TCR gene recombination are coexpressed in Jurkat cells, but the ongoing recombination process may not play a role in modification of the TCR repertoire.However, the results suggest that Jurkat could be used as a model for studying the regulation of RAGs and V(D)J recombination and as a "special" model of the coexistence of TCR gene rearrangements and "negative" receptor revision.

  14. Expression of recombination-activating genes and T cell receptor gene recombination in the human T cell leukemia cell line

    Institute of Scientific and Technical Information of China (English)

    ZOU Hong-yun; MA Li; MENG Min-jie; YAO Xin-sheng; LIN Ying; WU Zhen-qiang; HE Xiao-wei; WANG Ju-fang; WANG Xiao-ning

    2007-01-01

    Background Recent studies have suggested that mature T cells can change their specificity through reexpression of recombination-activating genes (RAG) and RAG-mediated V(D)J recombination. This process is named receptor revision and has been observed in mature peripheral T cells from transgenic mice and human donors. However, whether the receptor revision in mature T cells is a random or orientated process remains poorly understood. Here we used the Jurkat human T cell line, which represents a mature stage of T cell development, as a model to investigate the regulation of T cell receptor (TCR) gene recombination.Methods TCR Dβ-Jβ signal joint T cell receptor excision DNA circles (sjTRECs) were determined by nested and seminested PCR. Double-strand DNA breaks at recombination signal sequences (RSSs) in the TCRVβ chain locus were detected by ligation-mediated-PCR. Further analysis of the complementarity-determining region 3 (CDR3) size of the TCRVβ chain was examined by the TCR GeneScan technique.Results RAG1, RAG2, and three crucial components of the nonhomologous DNA end-joining (NHEJ) pathway were readily detected in Jurkat. Characteristics of junctional diversity of Dβ2-Jβ2 signal joints and ds RSS breaks associated with the Dβ25' and Dβ 23' sites were detected in DNA from Jurkat cells. CDR3 size and the gene sequences of the TCRVβ chain did not change during cell proliferation.Conclusions RAG1 and RAG2 and ongoing TCR gene recombination are coexpressed in Jurkat cells, but the ongoing recombination process may not play a role in modification of the TCR repertoire. However, the results suggest that Jurkat could be used as a model for studying the regulation of RAGs and V(D)J recombination and as a "special" model of the coexistence of TCR gene rearrangements and "negative" receptor revision.

  15. Janus Kinase 2: An Epigenetic 'Writer' that Activates Leukemogenic Genes

    Institute of Scientific and Technical Information of China (English)

    Jin He; Yi Zhang

    2010-01-01

    @@ Activation of Janus kinase 2 (JAK2) plays a critical role in normal hematopoiesis and leukemogenesis. Dawson et al. (2009; JAK2 phosphorylates histone H3Y41 and excludes Hplalpha from chromatin. Nature 461, 819-822) report that JAK2 performs this function by displacing the heterochromatin protein HP1α from chromatin through phosphorylation of histone H3.

  16. MED1 independent activation of endogenous target genes by PPARα

    DEFF Research Database (Denmark)

    Grøntved, Lars; Bugge, Anne K.; Roeder, Robert G.;

    The mediator complex serves as a transcriptional co-activator complex by acting as a bridge between promoter-bound transcription factors and the preinitiation complex. Genetic and biochemical studies indicate that nuclear receptors recruit the mediator complex through direct interaction...

  17. Amplification of the Insulin-Like Growth Factor 1 Receptor Gene Is a Rare Event in Adrenocortical Adenocarcinomas: Searching for Potential Mechanisms of Overexpression

    Directory of Open Access Journals (Sweden)

    Tamaya Castro Ribeiro

    2014-01-01

    Full Text Available Context. IGF1R overexpression appears to be a prognostic biomarker of metastatic pediatric adrenocortical tumors. However, the molecular mechanisms that are implicated in its upregulation remain unknown. Aim. To investigate the potential mechanisms involved in IGF1R overexpression. Patients and Methods. We studied 64 adrenocortical tumors. IGF1R copy number variation was determined in all patients using MLPA and confirmed using real time PCR. In a subgroup of 32 patients, automatic sequencing was used to identify IGF1R allelic variants and the expression of microRNAs involved in IGF1R regulation by real time PCR. Results. IGF1R amplification was detected in an adrenocortical carcinoma that was diagnosed in a 46-year-old woman with Cushing’s syndrome and virilization. IGF1R overexpression was demonstrated in this case. In addition, gene amplification of other loci was identified in this adrenocortical malignant tumor, but no IGF1R copy number variation was evidenced in the remaining cases. Automatic sequencing revealed three known polymorphisms but they did not correlate with its expression. Expression of miR-100, miR-145, miR-375, and miR-126 did not correlate with IGF1R expression. Conclusion. We demonstrated amplification and overexpression of IGF1R gene in only one adrenocortical carcinoma, suggesting that these combined events are uncommon. In addition, IGF1R polymorphisms and abnormal microRNA expression did not correlate with IGF1R upregulation in adrenocortical tumors.

  18. LimTox: a web tool for applied text mining of adverse event and toxicity associations of compounds, drugs and genes.

    Science.gov (United States)

    Cañada, Andres; Capella-Gutierrez, Salvador; Rabal, Obdulia; Oyarzabal, Julen; Valencia, Alfonso; Krallinger, Martin

    2017-05-22

    A considerable effort has been devoted to retrieve systematically information for genes and proteins as well as relationships between them. Despite the importance of chemical compounds and drugs as a central bio-entity in pharmacological and biological research, only a limited number of freely available chemical text-mining/search engine technologies are currently accessible. Here we present LimTox (Literature Mining for Toxicology), a web-based online biomedical search tool with special focus on adverse hepatobiliary reactions. It integrates a range of text mining, named entity recognition and information extraction components. LimTox relies on machine-learning, rule-based, pattern-based and term lookup strategies. This system processes scientific abstracts, a set of full text articles and medical agency assessment reports. Although the main focus of LimTox is on adverse liver events, it enables also basic searches for other organ level toxicity associations (nephrotoxicity, cardiotoxicity, thyrotoxicity and phospholipidosis). This tool supports specialized search queries for: chemical compounds/drugs, genes (with additional emphasis on key enzymes in drug metabolism, namely P450 cytochromes-CYPs) and biochemical liver markers. The LimTox website is free and open to all users and there is no login requirement. LimTox can be accessed at: http://limtox.bioinfo.cnio.es. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Role of peroxisome proliferator-activated receptors gene polymorphisms in type 2 diabetes and metabolic syndrome.

    Science.gov (United States)

    Dong, Chen; Zhou, Hui; Shen, Chong; Yu, Lu-Gang; Ding, Yi; Zhang, Yong-Hong; Guo, Zhi-Rong

    2015-05-15

    Metabolic syndrome (MetS) and type 2 diabetes mellitus (T2DM) are the serious public health problems worldwide. Moreover, it is estimated that MetS patients have about five-fold greater risk of the T2DM development compared with people without the syndrome. Peroxisome proliferator-activated receptors are a subgroup of the nuclear hormone receptor superfamily of ligand-activated transcription factors which play an important role in the pathogenesis of MetS and T2DM. All three members of the peroxisome proliferator-activated receptor (PPAR) nuclear receptor subfamily, PPARα, PPARβ/δ and PPARγ are critical in regulating insulin sensitivity, adipogenesis, lipid metabolism, and blood pressure. Recently, more and more studies indicated that the gene polymorphism of PPARs, such as Leu(162)Val and Val(227)Ala of PPARα, +294T > C of PPARβ/δ, Pro(12)Ala and C1431T of PPARγ, are significantly associated with the onset and progressing of MetS and T2DM in different population worldwide. Furthermore, a large body of evidence demonstrated that the glucose metabolism and lipid metabolism were influenced by gene-gene interaction among PPARs genes. However, given the complexity pathogenesis of metabolic disease, it is unlikely that genetic variation of a single locus would provide an adequate explanation of inter-individual differences which results in diverse clinical syndromes. Thus, gene-gene interactions and gene-environment interactions associated with T2DM and MetS need future comprehensive studies.

  20. Gene expression analyses implicate an alternative splicing program in regulating contractile gene expression and serum response factor activity in mice.

    Directory of Open Access Journals (Sweden)

    Twishasri Dasgupta

    Full Text Available Members of the CUG-BP, Elav-like family (CELF regulate alternative splicing in the heart. In MHC-CELFΔ transgenic mice, CELF splicing activity is inhibited postnatally in heart muscle via expression of a nuclear dominant negative CELF protein under an α-myosin heavy chain promoter. MHC-CELFΔ mice develop dilated cardiomyopathy characterized by alternative splicing defects, enlarged hearts, and severe contractile dysfunction. In this study, gene expression profiles in the hearts of wild type, high- and low-expressing lines of MHC-CELFΔ mice were compared using microarrays. Gene ontology and pathway analyses identified contraction and calcium signaling as the most affected processes. Network analysis revealed that the serum response factor (SRF network is highly affected. Downstream targets of SRF were up-regulated in MHC-CELFΔ mice compared to the wild type, suggesting an increase in SRF activity. Although SRF levels remained unchanged, known inhibitors of SRF activity were down-regulated. Conversely, we found that these inhibitors are up-regulated and downstream SRF targets are down-regulated in the hearts of MCKCUG-BP1 mice, which mildly over-express CELF1 in heart and skeletal muscle. This suggests that changes in SRF activity are a consequence of changes in CELF-mediated regulation rather than a secondary result of compensatory pathways in heart failure. In MHC-CELFΔ males, where the phenotype is only partially penetrant, both alternative splicing changes and down-regulation of inhibitors of SRF correlate with the development of cardiomyopathy. Together, these results strongly support a role for CELF-mediated alternative splicing in the regulation of contractile gene expression, achieved in part through modulating the activity of SRF, a key cardiac transcription factor.

  1. Development of a Systems Computational Model to Investigate Early Biological Events in Hepatic Activation of Constitutive Androstane Receptor (CAR) by Phenobarbital

    Science.gov (United States)

    Activation of the nuclear receptor CAR (constitutive active/androstane receptor) is implicated in the control several key biological events such as metabolic pathways. Here, we combined data from literature with information obtained from in vitro assays in the US EPA ToxCast dat...

  2. Physical activity-associated gene expression signature in nonhuman primate motor cortex.

    Science.gov (United States)

    Mitchell, Amanda C; Leak, Rehana K; Garbett, Krassimira; Zigmond, Michael J; Cameron, Judy L; Mirnics, Károly

    2012-03-01

    It has been established that weight gain and weight loss are heavily influenced by activity level. In this study, we hypothesized that the motor cortex exhibits a distinct physical activity-associated gene expression profile, which may underlie changes in weight associated with movement. Using DNA microarrays we profiled gene expression in the motor cortex of a group of 14 female rhesus monkeys (Macaca mulatta) with a wide range of stable physical activity levels. We found that neuronal growth factor signaling and nutrient sensing transcripts in the brain were highly correlated with physical activity. A follow-up of AKT3 expression changes (a gene at the apex of neuronal survival and nutrient sensing) revealed increased protein levels of total AKT, phosphorylated AKT, and forkhead box O3 (FOXO3), one of AKT's main downstream effectors. In addition, we successfully validated three other genes via quantitative polymerase chain reaction (qPCR) (cereblon (CRBN), origin recognition complex subunit 4-like, and pyruvate dehydrogenase 4 (PDK4)). We conclude that these genes are important in the physical activity-associated pathway in the motor cortex, and may be critical for physical activity-associated changes in body weight and neuroprotection.

  3. ALK1 signalling analysis identifies angiogenesis related genes and reveals disparity between TGF-β and constitutively active receptor induced gene expression

    Directory of Open Access Journals (Sweden)

    Hafner Mathias

    2006-04-01

    Full Text Available Abstract Background TGF-β1 is an important angiogenic factor involved in the different aspects of angiogenesis and vessel maintenance. TGF-β signalling is mediated by the TβRII/ALK5 receptor complex activating the Smad2/Smad3 pathway. In endothelial cells TGF-β utilizes a second type I receptor, ALK1, activating the Smad1/Smad5 pathway. Consequently, a perturbance of ALK1, ALK5 or TβRII activity leads to vascular defects. Mutations in ALK1 cause the vascular disorder hereditary hemorrhagic telangiectasia (HHT. Methods The identification of ALK1 and not ALK5 regulated genes in endothelial cells, might help to better understand the development of HHT. Therefore, the human microvascular endothelial cell line HMEC-1 was infected with a recombinant constitutively active ALK1 adenovirus, and gene expression was studied by using gene arrays and quantitative real-time PCR analysis. Results After 24 hours, 34 genes were identified to be up-regulated by ALK1 signalling. Analysing ALK1 regulated gene expression after 4 hours revealed 13 genes to be up- and 2 to be down-regulated. Several of these genes, including IL-8, ET-1, ID1, HPTPη and TEAD4 are reported to be involved in angiogenesis. Evaluation of ALK1 regulated gene expression in different human endothelial cell types was not in complete agreement. Further on, disparity between constitutively active ALK1 and TGF-β1 induced gene expression in HMEC-1 cells and primary HUVECs was observed. Conclusion Gene array analysis identified 49 genes to be regulated by ALK1 signalling and at least 14 genes are reported to be involved in angiogenesis. There was substantial agreement between the gene array and quantitative real-time PCR data. The angiogenesis related genes might be potential HHT modifier genes. In addition, the results suggest endothelial cell type specific ALK1 and TGF-β signalling.

  4. Mutation analysis of mitogen activated protein kinase 1 gene in Indian cases of 46,XY disorder of sex development

    Directory of Open Access Journals (Sweden)

    Dhanjit Kumar Das

    2013-01-01

    Full Text Available Background: Determination of sex is the result of cascade of molecular events that cause undifferentiated bipotential gonad to develop as a testis or an ovary. A series of genes such as SRY, steroidogenic factor-1 (SF1, AR, SRD5 α, Desert hedgehog (DHH etc., have been reported to have a significant role in development of sex in the fetus and secondary sexual characteristics at the time of puberty. Recently, mitogen activated protein kinase kinase kinase 1 (MAP3K1 gene was found to be associated with 46, XY disorders of sex development (DSD. Aim: The present study is focused to identify mutations in MAP3K1 gene in the cohort of 10 Indian patients with 46,XY DSD including one family with two affected sisters. These patients were already screened for SRY, SF1 and DHH gene, but no mutation was observed in any of these genes. Materials and Methods: The entire coding regions of MAP3K1 were amplified and sequenced using the gene specific primers. Results and Discussions: Sequence analysis of MAP3K1 gene has revealed four variants including one missense, two silent and one deletion mutation. The missense mutation p.D806N was observed in four patients with hypospadias. Two patients showed the presence of silent mutation p.Q1028Q present in exon 14. Another silent mutation p.T428T was observed in a patient with gonadal dysgenesis. We have also observed one deletion mutation p. 942insT present in two patients. The pathogenicity of the missense mutation p.D806N was carried out using in-silico approach. Sequence homology analysis has revealed that the aspartate at 806 was found to be well-conserved across species, indicated the importance of this residue. The score for polyphen analysis of this mutation was found to be 0.999 indicating to be pathogenic mutation. Since, p.D806N mutation was found to be important residue; it might contribute to sexual development. We have reported the presence of mutations/polymorphism in MAP3K1 gene. All the mutations were

  5. Influence of nitrous oxide anesthesia, B-vitamins, and MTHFR gene polymorphisms on perioperative cardiac events: the vitamins in nitrous oxide (VINO) randomized trial.

    Science.gov (United States)

    Nagele, Peter; Brown, Frank; Francis, Amber; Scott, Mitchell G; Gage, Brian F; Miller, J Philip

    2013-07-01

    Nitrous oxide causes an acute increase in plasma homocysteine that is more pronounced in patients with the methylenetetrahydrofolate reductase (MTHFR) C677T or A1298C gene variant. In this randomized controlled trial, the authors sought to determine whether patients carrying the MTHFR C677T or A1298C variant had a higher risk for perioperative cardiac events after nitrous oxide anesthesia and whether this risk could be mitigated by B-vitamins. The authors randomized adult patients with cardiac risk factors undergoing noncardiac surgery, to receive nitrous oxide plus intravenous B-vitamins before and after surgery, or to nitrous oxide and placebo. Serial cardiac biomarkers and 12-lead electrocardiograms were obtained. The primary study endpoint was the incidence of myocardial injury, as defined by cardiac troponin I increase within the first 72 h after surgery. A total of 500 patients completed the trial. Patients who were homozygous for either MTHFR C677T, or A1298C gene variant (n=98; 19.6%) had no increased rate of postoperative cardiac troponin I increase compared with wild-type and heterozygous patients (11.2 vs. 14.0%; relative risk 0.96; 95% CI, 0.85-1.07; P=0.48). B-vitamins blunted the rise in homocysteine, but had no effect on cardiac troponin I increase compared with patients receiving placebo (13.2 vs. 13.6%; relative risk 1.02; 95% CI 0.78 to 1.32; P=0.91). Neither MTHFR C677T and A1298C gene variant, nor acute homocysteine increase are associated with perioperative cardiac troponin increase after nitrous oxide anesthesia. B-vitamins blunt nitrous oxide-induced homocysteine increase but have no effect on cardiac troponin I increase.

  6. Reinstatement of individual past events revealed by the similarity of distributed activation patterns during encoding and retrieval.

    Science.gov (United States)

    Wing, Erik A; Ritchey, Maureen; Cabeza, Roberto

    2015-04-01

    Neurobiological memory models assume memory traces are stored in neocortex, with pointers in the hippocampus, and are then reactivated during retrieval, yielding the experience of remembering. Whereas most prior neuroimaging studies on reactivation have focused on the reactivation of sets or categories of items, the current study sought to identify cortical patterns pertaining to memory for individual scenes. During encoding, participants viewed pictures of scenes paired with matching labels (e.g., "barn," "tunnel"), and, during retrieval, they recalled the scenes in response to the labels and rated the quality of their visual memories. Using representational similarity analyses, we interrogated the similarity between activation patterns during encoding and retrieval both at the item level (individual scenes) and the set level (all scenes). The study yielded four main findings. First, in occipitotemporal cortex, memory success increased with encoding-retrieval similarity (ERS) at the item level but not at the set level, indicating the reactivation of individual scenes. Second, in ventrolateral pFC, memory increased with ERS for both item and set levels, indicating the recapitulation of memory processes that benefit encoding and retrieval of all scenes. Third, in retrosplenial/posterior cingulate cortex, ERS was sensitive to individual scene information irrespective of memory success, suggesting automatic activation of scene contexts. Finally, consistent with neurobiological models, hippocampal activity during encoding predicted the subsequent reactivation of individual items. These findings show the promise of studying memory with greater specificity by isolating individual mnemonic representations and determining their relationship to factors like the detail with which past events are remembered.

  7. Effects of alpha-AMPK knockout on exercise-induced gene activation in mouse skeletal muscle

    DEFF Research Database (Denmark)

    Jørgensen, Sebastian Beck; Wojtaszewski, Jørgen; Viollet, Benoit

    2005-01-01

    We tested the hypothesis that 5'AMP-activated protein kinase (AMPK) plays an important role in regulating the acute, exercise-induced activation of metabolic genes in skeletal muscle, which were dissected from whole-body a2- and a1-AMPK knockout (KO) and wild-type (WT) mice at rest, after treadmi...

  8. [Comparative analysis of activity of different promoters for NIS gene expression in melanoma cells].

    Science.gov (United States)

    Kuz'mich, A I; Kopantsev, E P; Vinogradova, T V; Sverdlov, E D

    2014-01-01

    Development of targeted drug delivery system is key problem of cancer gene therapy. To ensure specific delivery of these therapeutic compounds to the tumor it is preferable for therapeutic gene expression to occur predominantly in cancer cells. Therefore, when testing drug in vivo, it is necessary to study distribution of therapeutic gene expression products in different tissues of the organism. Sodium iodide symporter (NIS) is attractive reporter because its tissue level is easily quantitatively detected by noninvasive imaging methods. Different promoters are used to direct expression of therapeutic genes in tumor cells: strong nonspecific, moderate tissue-specific and tumor-specific. Tumor-specific promoters function in wide range of tumor cells, however they are relatively weak. Relationship between promoter and sodium iodide symporter activity is unclear to date. In this report we examined activity of different promoters in two melanoma cell lines, functional activity of NIS driven by these promoters, also we compared promoter strength and NIS activity. We demonstrated that in spite of strong differences in promoter activity functional activity of NIS directed by these promoters varies weakly. Relatively weak melanoma-specific promoter directs high NIS activity in melanoma cell, however weaker cancer-specific promoters drive high NIS activity only in certain melanoma cell line.

  9. Evaluating Transcription Factor Activity Changes by Scoring Unexplained Target Genes in Expression Data

    Science.gov (United States)

    Berchtold, Evi; Csaba, Gergely; Zimmer, Ralf

    2016-01-01

    Several methods predict activity changes of transcription factors (TFs) from a given regulatory network and measured expression data. But available gene regulatory networks are incomplete and contain many condition-dependent regulations that are not relevant for the specific expression measurement. It is not known which combination of active TFs is needed to cause a change in the expression of a target gene. A method to systematically evaluate the inferred activity changes is missing. We present such an evaluation strategy that indicates for how many target genes the observed expression changes can be explained by a given set of active TFs. To overcome the problem that the exact combination of active TFs needed to activate a gene is typically not known, we assume a gene to be explained if there exists any combination for which the predicted active TFs can possibly explain the observed change of the gene. We introduce the i-score (inconsistency score), which quantifies how many genes could not be explained by the set of activity changes of TFs. We observe that, even for these minimal requirements, published methods yield many unexplained target genes, i.e. large i-scores. This holds for all methods and all expression datasets we evaluated. We provide new optimization methods to calculate the best possible (minimal) i-score given the network and measured expression data. The evaluation of this optimized i-score on a large data compendium yields many unexplained target genes for almost every case. This indicates that currently available regulatory networks are still far from being complete. Both the presented Act-SAT and Act-A* methods produce optimal sets of TF activity changes, which can be used to investigate the difficult interplay of expression and network data. A web server and a command line tool to calculate our i-score and to find the active TFs associated with the minimal i-score is available from https://services.bio.ifi.lmu.de/i-score. PMID:27723775

  10. Assessment of Anaerobic Toluene Biodegradation Activity by bssA Transcript/Gene Ratios

    Science.gov (United States)

    Brow, Christina N.; O'Brien Johnson, Reid; Johnson, Richard L.

    2013-01-01

    Benzylsuccinate synthase (bssA) genes associated with toluene degradation were profiled across a groundwater contaminant plume under nitrate-reducing conditions and were detected in significant numbers throughout the plume. However, differences between groundwater and core sediment samples suggested that microbial transport, rather than local activity, was the underlying cause of the high copy numbers within the downgradient plume. Both gene transcript and reactant concentrations were consistent with this hypothesis. Expression of bssA genes from denitrifying toluene degraders was induced by toluene but only in the presence of nitrate, and transcript abundance dropped rapidly following the removal of either toluene or nitrate. The drop in bssA transcripts following the removal of toluene could be described by an exponential decay function with a half-life on the order of 1 h. Interestingly, bssA transcripts never disappeared completely but were always detected at some level if either inducer was present. Therefore, the detection of transcripts alone may not be sufficient evidence for contaminant degradation. To avoid mistakenly associating basal-level gene expression with actively degrading microbial populations, an integrated approach using the ratio of functional gene transcripts to gene copies is recommended. This approach minimizes the impact of microbial transport on activity assessment and allows reliable assessments of microbial activity to be obtained from water samples. PMID:23811506

  11. Growth enhancement and gene expression of Arabidopsis thaliana irradiated with active oxygen species

    Science.gov (United States)

    Watanabe, Satoshi; Ono, Reoto; Hayashi, Nobuya; Shiratani, Masaharu; Tashiro, Kosuke; Kuhara, Satoru; Inoue, Asami; Yasuda, Kaori; Hagiwara, Hiroko

    2016-07-01

    The characteristics of plant growth enhancement effect and the mechanism of the enhancement induced by plasma irradiation are investigated using various active species in plasma. Active oxygen species in oxygen plasma are effective for growth enhancement of plants. DNA microarray analysis of Arabidopsis thaliana indicates that the genes coding proteins that counter oxidative stresses by eliminating active oxygen species are expressed at significantly high levels. The size of plant cells increases owing to oxygen plasma irradiation. The increases in gene expression levels and cell size suggest that the increase in the expression level of the expansin protein is essential for plant growth enhancement phenomena.

  12. Gene-carried hepatoma targeting complex induced high gene transfection efficiency with low toxicity and significant antitumor activity

    Directory of Open Access Journals (Sweden)

    Zhao QQ

    2012-06-01

    Full Text Available Qing-Qing Zhao,1,2 Yu-Lan Hu,1 Yang Zhou,3 Ni Li,1 Min Han,1 Gu-Ping Tang,4 Feng Qiu,2 Yasuhiko Tabata,5 Jian-Qing Gao,11Institute of Pharmaceutics, Zhejiang University, Hangzhou, China; 2Department of Pharmacy, The First Affiliated Hospital of Chongqing Medical University, Chongqing, China; 3Institute of Biochemistry, Iowa State University, Ames, IA, USA; 4Institute of Chemical Biology and Pharmaceutical Chemistry, Zhejiang University, Hangzhou, China; 5Institute for Frontier Medical Sciences, Kyoto University, Kyoto, JapanBackground: The success of gene transfection is largely dependent on the development of a vehicle or vector that can efficiently deliver a gene to cells with minimal toxicity.Methods: A liver cancer-targeted specific peptide (FQHPSF sequence was successfully synthesized and linked with chitosan-linked polyethylenimine (CP to form a new targeted gene delivery vector called CPT (CP/peptide. The structure of CPT was confirmed by 1H nuclear magnetic resonance spectroscopy and ultraviolet spectrophotometry. The particle size of CPT/DNA complexes was measured using laser diffraction spectrometry and the cytotoxicity of the copolymer was evaluated by methylthiazol tetrazolium method. The transfection efficiency evaluation of the CP copolymer was performed using luciferase activity assay. Cellular internalization of the CP/DNA complex was observed under confocal laser scanning microscopy. The targeting specificity of the polymer coupled to peptide was measured by competitive inhibition transfection study. The liver targeting specificity of the CPT copolymer in vivo was demonstrated by combining the copolymer with a therapeutic gene, interleukin-12, and assessed by its abilities in suppressing the growth of ascites tumor in mouse model.Results: The results showed that the liver cancer-targeted specific peptide was successfully synthesized and linked with CP to form a new targeted gene delivery vector called CPT. The composition of CPT

  13. Identification of chemical modulators of the constitutive activated receptor (CAR) in a gene expression compendium.

    Science.gov (United States)

    Oshida, Keiyu; Vasani, Naresh; Jones, Carlton; Moore, Tanya; Hester, Susan; Nesnow, Stephen; Auerbach, Scott; Geter, David R; Aleksunes, Lauren M; Thomas, Russell S; Applegate, Dawn; Klaassen, Curtis D; Corton, J Christopher

    2015-01-01

    The nuclear receptor family member constitutive activated receptor (CAR) is activated by structurally diverse drugs and environmentally-relevant chemicals leading to transcriptional regulation of genes involved in xenobiotic metabolism and transport. Chronic activation of CAR increases liver cancer incidence in rodents, whereas suppression of CAR can lead to steatosis and insulin insensitivity. Here, analytical methods were developed to screen for chemical treatments in a gene expression compendium that lead to alteration of CAR activity. A gene expression biomarker signature of 83 CAR-dependent genes was identified using microarray profiles from the livers of wild-type and CAR-null mice after exposure to three structurally-diverse CAR activators (CITCO, phenobarbital, TCPOBOP). A rank-based algorithm (Running Fisher's algorithm (p-value ≤ 10(-4))) was used to evaluate the similarity between the CAR biomarker signature and a test set of 28 and 32 comparisons positive or negative, respectively, for CAR activation; the test resulted in a balanced accuracy of 97%. The biomarker signature was used to identify chemicals that activate or suppress CAR in an annotated mouse liver/primary hepatocyte gene expression database of ~1850 comparisons. CAR was activated by 1) activators of the aryl hydrocarbon receptor (AhR) in wild-type but not AhR-null mice, 2) pregnane X receptor (PXR) activators in wild-type and to lesser extents in PXR-null mice, and 3) activators of PPARα in wild-type and PPARα-null mice. CAR was consistently activated by five conazole fungicides and four perfluorinated compounds. Comparison of effects in wild-type and CAR-null mice showed that the fungicide propiconazole increased liver weight and hepatocyte proliferation in a CAR-dependent manner, whereas the perfluorinated compound perfluorooctanoic acid (PFOA) increased these endpoints in a CAR-independent manner. A number of compounds suppressed CAR coincident with increases in markers of

  14. Genome-wide analysis of antiviral signature genes in porcine macrophages at different activation statuses.

    Directory of Open Access Journals (Sweden)

    Yongming Sang

    Full Text Available Macrophages (MФs can be polarized to various activation statuses, including classical (M1, alternative (M2, and antiviral states. To study the antiviral activation status of porcine MФs during porcine reproductive and respiratory syndrome virus (PRRSV infection, we used RNA Sequencing (RNA-Seq for transcriptomic analysis of differentially expressed genes (DEGs. Sequencing assessment and quality evaluation showed that our RNA-Seq data met the criteria for genome-wide transcriptomic analysis. Comparisons of any two activation statuses revealed more than 20,000 DEGs that were normalized to filter out 153-5,303 significant DEGs [false discovery rate (FDR ≤0.001, fold change ≥2] in each comparison. The highest 5,303 significant DEGs were found between lipopolysaccharide- (LPS and interferon (IFNγ-stimulated M1 cells, whereas only 153 significant DEGs were detected between interleukin (IL-10-polarized M2 cells and control mock-activated cells. To identify signature genes for antiviral regulation pertaining to each activation status, we identified a set of DEGs that showed significant up-regulation in only one activation state. In addition, pathway analyses defined the top 20-50 significantly regulated pathways at each activation status, and we further analyzed DEGs pertinent to pathways mediated by AMP kinase (AMPK and epigenetic mechanisms. For the first time in porcine macrophages, our transcriptomic analyses not only compared family-wide differential expression of most known immune genes at different activation statuses, but also revealed transcription evidence of multiple gene families. These findings show that using RNA-Seq transcriptomic analyses in virus-infected and status-synchronized macrophages effectively profiled signature genes and gene response pathways for antiviral regulation, which may provide a framework for optimizing antiviral immunity and immune homeostasis.

  15. Activation of innate immune-response genes in little brown bats (Myotis lucifugus infected with the fungus Pseudogymnoascus destructans.

    Directory of Open Access Journals (Sweden)

    Noreen Rapin

    Full Text Available Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes.

  16. Multiple horizontal gene transfer events and domain fusions have created novel regulatory and metabolic networks in the oomycete genome.

    Directory of Open Access Journals (Sweden)

    Paul Francis Morris

    Full Text Available Complex enzymes with multiple catalytic activities are hypothesized to have evolved from more primitive precursors. Global analysis of the Phytophthora sojae genome using conservative criteria for evaluation of complex proteins identified 273 novel multifunctional proteins that were also conserved in P. ramorum. Each of these proteins contains combinations of protein motifs that are not present in bacterial, plant, animal, or fungal genomes. A subset of these proteins were also identified in the two diatom genomes, but the majority of these proteins have formed after the split between diatoms and oomycetes. Documentation of multiple cases of domain fusions that are common to both oomycetes and diatom genomes lends additional support for the hypothesis that oomycetes and diatoms are monophyletic. Bifunctional proteins that catalyze two steps in a metabolic pathway can be used to infer the interaction of orthologous proteins that exist as separate entities in other genomes. We postulated that the novel multifunctional proteins of oomycetes could function as potential Rosetta Stones to identify interacting proteins of conserved metabolic and regulatory networks in other eukaryotic genomes. However ortholog analysis of each domain within our set of 273 multifunctional proteins against 39 sequenced bacterial and eukaryotic genomes, identified only 18 candidate Rosetta Stone proteins. Thus the majority of multifunctional proteins are not Rosetta Stones, but they may nonetheless be useful in identifying novel metabolic and regulatory networks in oomycetes. Phylogenetic analysis of all the enzymes in three pathways with one or more novel multifunctional proteins was conducted to determine the probable origins of individual enzymes. These analyses revealed multiple examples of horizontal transfer from both bacterial genomes and the photosynthetic endosymbiont in the ancestral genome of Stramenopiles. The complexity of the phylogenetic origins of these

  17. Advertising Effectiveness In Events

    OpenAIRE

    Jain, Sushilkumar

    2012-01-01

    Confronted with decreasing effectiveness of the classic marketing communications, events have become an increasingly popular alternative for marketers. Events constitute one of the most exciting and fastest growing forms of leisure and business. With time, the decreasing effectiveness of classical marketing communications boosted the use of events for marketing and making brand awareness. Event marketing is seen as the unique opportunity to integrate the firm’s communication activities like p...

  18. A Tool for Empirical Forecasting of Major Flares, Coronal Mass Ejections, and Solar Particle Events from a Proxy of Active-Region Free Magnetic Energy

    Science.gov (United States)

    Barghouty, A. F.; Falconer, D. A.; Adams, J. H., Jr.

    2010-01-01

    This presentation describes a new forecasting tool developed for and is currently being tested by NASA s Space Radiation Analysis Group (SRAG) at JSC, which is responsible for the monitoring and forecasting of radiation exposure levels of astronauts. The new software tool is designed for the empirical forecasting of M and X-class flares, coronal mass ejections, as well as solar energetic particle events. Its algorithm is based on an empirical relationship between the various types of events rates and a proxy of the active region s free magnetic energy, determined from a data set of approx.40,000 active-region magnetograms from approx.1,300 active regions observed by SOHO/MDI that have known histories of flare, coronal mass ejection, and solar energetic particle event production. The new tool automatically extracts each strong-field magnetic areas from an MDI full-disk magnetogram, identifies each as an NOAA active region, and measures a proxy of the active region s free magnetic energy from the extracted magnetogram. For each active region, the empirical relationship is then used to convert the free magnetic energy proxy into an expected event rate. The expected event rate in turn can be readily converted into the probability that the active region will produce such an event in a given forward time window. Descriptions of the datasets, algorithm, and software in addition to sample applications and a validation test are presented. Further development and transition of the new tool in anticipation of SDO/HMI is briefly discussed.

  19. Trithorax group proteins: switching genes on and keeping them active.

    Science.gov (United States)

    Schuettengruber, Bernd; Martinez, Anne-Marie; Iovino, Nicola; Cavalli, Giacomo

    2011-11-23

    Cellular memory is provided by two counteracting groups of chromatin proteins termed Trithorax group (TrxG) and Polycomb group (PcG) proteins. TrxG proteins activate transcription and are perhaps best known because of the involvement of the TrxG protein MLL in leukaemia. However, in terms of molecular analysis, they have lived in the shadow of their more famous counterparts, the PcG proteins. Recent advances have improved our understanding of TrxG protein function and demonstrated that the heterogeneous group of TrxG proteins is of critical importance in the epigenetic regulation of the cell cycle, senescence, DNA damage and stem cell biology.

  20. Engaging Students in a Bioinformatics Activity to Introduce Gene Structure and Function

    Directory of Open Access Journals (Sweden)

    Barbara J. May

    2013-02-01

    Full Text Available Bioinformatics spans many fields of biological research and plays a vital role in mining and analyzing data. Therefore, there is an ever-increasing need for students to understand not only what can be learned from this data, but also how to use basic bioinformatics tools.  This activity is designed to provide secondary and undergraduate biology students to a hands-on activity meant to explore and understand gene structure with the use of basic bioinformatic tools.  Students are provided an “unknown” sequence from which they are asked to use a free online gene finder program to identify the gene. Students then predict the putative function of this gene with the use of additional online databases.

  1. Transcription activation of a UV-inducible Clostridium perfringens bacteriocin gene by a novel sigma factor.

    Science.gov (United States)

    Dupuy, Bruno; Mani, Nagraj; Katayama, Seiichi; Sonenshein, Abraham L

    2005-02-01

    Expression of the plasmid-encoded Clostridium perfringens gene for bacteriocin BCN5 was shown to depend in vivo and in vitro on the activity of UviA protein. UviA, also plasmid-encoded, proved to be an RNA polymerase sigma factor and was also partly autoregulatory. The uviA gene has two promoters; one provided a UviA-independent, basal level of gene expression while the stronger, UviA-dependent promoter was only utilized after the cell experienced DNA damage. As a result, BCN5 synthesis is induced by treatment with UV light or mitomycin C. UviA is related to a special class of sigma factors found to date only in Clostridium species and responsible for activating transcription of toxin genes in Clostridium difficile, Clostridium tetani, and Clostridium botulinum.

  2. Optimization of reporter gene assay: several factors influencing detection of promoter activity

    Institute of Scientific and Technical Information of China (English)

    XUE Li-xiang; WENG Mo; ZHANG Zong-yu; TONG Tan-jun

    2007-01-01

    Background Promoter analysis is currently applied to detect the expression of the targeted gene in studies of signal transduction and transcriptional regulation. As a reporter gene, luciferase plays an important role and has been used widely in the promoter assay.Methods Human embryonic lung fibroblast cells (2BS), HeLa cells and MCF-7 cells were transfected with various genes embedded by lipofectamine. This study determined various factors that affect promoter activity determination,such as the selection of the reporter genes and internal references, the dose and the type of the vectors carrying the transcription factors, the host cells and the instruments.Results The sensitivity of the luciferase assay was much higher than that of enhanced green fluorescence protein (EGFP). Moreover, promoter activity is increased in a dose-related manner only in certain ranges outside of which the results may be reversed and the promoter activity is related to the expression vector which is carrying the cDNA.Otherwise, the length of the promoter, internal references and the host cell can also influence the promoter activity.Conclusions To detect the promoter activity accurately, a few factors including dose, vector, length and host cell which influence reporter gene assay aforementioned should be considered.

  3. SCREENING OF ANTIMICROBIAL ACTIVITY AND GENES CODING POLYKETIDE SYNTHETASE AND NONRIBOSOMAL PEPTIDE SYNTHETASE OF ACTINOMYCETE ISOLATES

    Directory of Open Access Journals (Sweden)

    Silvia Kovácsová

    2013-12-01

    Full Text Available The aim of this study was to observe antimicrobial activity using agar plate diffusion method and screening genes coding polyketide synthetase (PKS-I and nonribosomal peptide synthetase (NRPS from actinomycetes. A total of 105 actinomycete strains were isolated from arable soil. Antimicrobial activity was demonstrated at 54 strains against at least 1 of total 12 indicator organisms. Antifungal properties were recorded more often than antibacterial properties. The presence of PKS-I and NRPS genes were founded at 61 of total 105 strains. The number of strains with mentioned biosynthetic enzyme gene fragments matching the anticipated length were 19 (18% and 50 (47% respectively. Overall, five actinomycete strains carried all the biosynthetical genes, yet no antimicrobial activity was found against any of tested pathogens. On the other hand, twenty-one strains showed antimicrobial activity even though we were not able to amplify any of the PKS or NRPS genes from them. Combination of the two methods showed broad-spectrum antimicrobial activity of actinomycetes isolated from arable soil, which indicate that actinomycetes are valuable reservoirs of novel bioactive compounds.

  4. SATB1 packages densely-looped, transciptionally-active chromatinfor coordinated expression of cytokine genes

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Shutao; Lee, Charles C.; Kohwi-Shigematsu, Terumi

    2006-05-23

    SATB1 is an important regulator of nuclear architecture that anchors specialized DNA sequences onto its cage-like network and recruits chromatin remodeling/modifying factors to control gene transcription. We studied the role of SATB1 in regulating the coordinated expression of Il5, Il4, and Il13 from the 200kb cytokine gene cluster region of mouse chromosome 11 during T-helper 2 (Th2)-cell activation. We show that upon cell activation, SATB1 is rapidly induced to form a unique transcriptionally-active chromatin structure that includes the cytokine gene region. Chromatin is folded into numerous small loops all anchored by SATB1, is histone H3 acetylated at lysine 9/14, and associated with Th2-specific factors, GATA3, STAT6, c-Maf, the chromatin-remodeling enzyme Brg-1, and RNA polymerase II across the 200kb region. Before activation, the chromatin displays some of these features, such as association with GATA3 and STAT6, but these were insufficient for cytokine gene expression. Using RNA interference (RNAi), we show that upon cell activation, SATB1 is not only required for chromatin folding into dense loops, but also for c-Maf induction and subsequently for Il4, Il5, and Il13 transcription. Our results show that SATB1 is an important determinant for chromatin architecture that constitutes a novel higher-order, transcriptionally-active chromatin structure upon Th2-cell activation.

  5. Targeted Editing of Myostatin Gene in Sheep by Transcription Activator-like Effector Nucleases

    OpenAIRE

    Zhao, Xinxia; Ni, Wei; Chen, Chuangfu; Sai, Wujiafu; Qiao, Jun; Sheng, Jingliang; Zhang, Hui; Li, Guozhong; Wang, Dawei; Hu, Shengwei

    2016-01-01

    Myostatin (MSTN) is a secreted growth factor expressed in skeletal muscle and adipose tissue that negatively regulates skeletal muscle mass. Gene knockout of MSTN can result in increasing muscle mass in sheep. The objectives were to investigate whether myostatin gene can be edited in sheep by transcription activator-like effector nucleases (TALENs) in tandem with single-stranded DNA oligonucleotides (ssODNs). We designed a pair of TALENs to target a highly conserved sequence in the coding reg...

  6. Transformation of Inhibitor of Meristem Activity (IMA) Gene into Jatropha curcas L.

    OpenAIRE

    Asri Pirade Paserang; Aris Tjahjoleksono; Utut Widyastuti; Suharsono Suharsono

    2015-01-01

    Jatropha is one of the many biodiesel plants developed in tropical countries. Efforts to increase its productivity can be done using various methods of breeding. One of the breeding methods is the introduction of genes into the Jatropha plant. The aim of this study is to assess the success of genetic transformation using the Inhibitor of Meristem Activity (IMA) gene in Jatropha curcas. The research procedures included inoculation of explants with Agrobacterium tumefaciens, callus induction, s...

  7. Recording event-related activity under hostile magnetic resonance environment: Is multimodal EEG/ERP-MRI recording possible?

    Science.gov (United States)

    Karakaş, H M; Karakaş, S; Ozkan Ceylan, A; Tali, E T

    2009-08-01

    Event-related potentials (ERPs) have high temporal resolution, but insufficient spatial resolution; the converse is true for the functional imaging techniques. The purpose of the study was to test the utility of a multimodal EEG/ERP-MRI technique which combines electroencephalography (EEG) and magnetic resonance imaging (MRI) for a simultaneously high temporal and spatial resolution. The sample consisted of 32 healthy young adults of both sexes. Auditory stimuli were delivered according to the active and passive oddball paradigms in the MRI environment (MRI-e) and in the standard conditions of the electrophysiology laboratory environment (Lab-e). Tasks were presented in a fixed order. Participants were exposed to the recording environments in a counterbalanced order. EEG data were preprocessed for MRI-related artifacts. Source localization was made using a current density reconstruction technique. The ERP waveforms for the MRI-e were morphologically similar to those for the Lab-e. The effect of the recording environment, experimental paradigm and electrode location were analyzed using a 2x2x3 analysis of variance for repeated measures. The ERP components in the two environments showed parametric variations and characteristic topographical distributions. The calculated sources were in line with the related literature. The findings indicated effortful cognitive processing in MRI-e. The study provided preliminary data on the feasibility of the multimodal EEG/ERP-MRI technique. It also indicated lines of research that are to be pursued for a decisive testing of this technique and its implementation to clinical practice.

  8. Motivation and semantic context affect brain error-monitoring activity: an event-related brain potentials study.

    Science.gov (United States)

    Ganushchak, Lesya Y; Schiller, Niels O

    2008-01-01

    During speech production, we continuously monitor what we say. In situations in which speech errors potentially have more severe consequences, e.g. during a public presentation, our verbal self-monitoring system may pay special attention to prevent errors than in situations in which speech errors are more acceptable, such as a casual conversation. In an event-related potential study, we investigated whether or not motivation affected participants' performance using a picture naming task in a semantic blocking paradigm. Semantic context of to-be-named pictures was manipulated; blocks were semantically related (e.g., cat, dog, horse, etc.) or semantically unrelated (e.g., cat, table, flute, etc.). Motivation was manipulated independently by monetary reward. The motivation manipulation did not affect error rate during picture naming. However, the high-motivation condition yielded increased amplitude and latency values of the error-related negativity (ERN) compared to the low-motivation condition, presumably indicating higher monitoring activity. Furthermore, participants showed semantic interference effects in reaction times and error rates. The ERN amplitude was also larger during semantically related than unrelated blocks, presumably indicating that semantic relatedness induces more conflict between possible verbal responses.

  9. Original article Coping with the events of daily life and quality of life of the socially active elderly

    Directory of Open Access Journals (Sweden)

    Anna Gamrowska

    2014-07-01

    Full Text Available Background Late adulthood is a period in which the number of stressors is increasing; therefore, strategies of coping with these situations may be significant in terms of the subjective evaluation of the quality of life and adaptation to old age. The objective of this paper was to examine the relationships between proactive coping and the quality of life in people in late adulthood. The quality of life was assessed using the Polish version of the CASP-19. Participants and procedure The research included 88 individuals (76 women and 12 men, aged from 60 to 85 years (M = 69.5, SD = 6.74. The following tools were used: The Proactive Coping Inventory, developed by Greenglass, Schwarzer and Taubert (Pasikowski’s adaptation, and the scale for the assessment of the quality of life, called CASP-19, of Higgs, Hyde, Wiggins and Blane (developed by the authors of this paper. Results The results of the research showed a positive relationship between the general level of proactive coping strategies, the proactive coping subscale and the general quality of life and addressing the needs of control and pleasure. People who are more proactive accomplish a higher general level of the quality of life, control and pleasure than people whose pro-activity level is lower. Conclusions Factors contributing to the quality of life and successful aging of elderly subjects are, first and foremost, skills connected with setting objectives autonomously, taking initiative, perseverance in activities and perceiving events in terms of opportunities of development and self-improvement. The CASP-19 seems to be a useful measure of the quality of life in old age.

  10. THE EFFECT OF PHYSICAL ACTIVITY ON INFLAMMATORY MARKERS.THE RISK OF NEW CORONARY EVENT IN CORONARY HEART DISEASE PATIENTS

    Directory of Open Access Journals (Sweden)

    Todorka Savic

    2007-12-01

    Full Text Available Inflammation is an important factor in the pathogenesis of atherosclerosis, and several markers of inflammation have been associated with an increased risk of cardiovascular events. Physical activity may lower the risk of coronary heart disease(CHD by mitigating inflammation. The aim of the study was to investigate the effects of aerobic exercise training on systemic inflammatory response in patients with stabile coronary artery disease participating in a cardiovascular rehabilitation exercise program. Male (n=29 and female (n=23 patients with stable coronary heart disease were recruited for this study. All patients were divided into two groups: group with regular aerobic physical training during cardiovascular rehabilitation program phase II along 3 weeks in rehabilitation center and 3 weeks after that in home of patients and sedentary lifestyle group. There were no significant differences in gender distribution among analyzed groups. Student’s t test showed no significant difference in mean age, waist circumference (OS and waist/hip ratio (WHR. Degree of obesity was measured by BMI, and there was a significant improvement in BMI in patients who underwent the six-week physical training compared to control group (p<0.05.Physical training during 6 weeks did not show any effects on leukocyte count and ICAM-1 levels compared to control group. The exercise training induced reduction in plasma CRP levels by 23.72%, p<0.001, and reduction in plasma VCAM-1 levels by Moderate aerobic exercise training resulted in a significant reduction of inflammatory state by decreasing CRP and VCAM-1 levels without significant body mass and visceral obesity reduction. The obtained results indicate that regular physical activity is clinically attractive in primary and secondary prevention of coronary heart diseases.

  11. Active fault mapping in Karonga-Malawi after the December 19, 2009 Ms 6.2 seismic event

    Science.gov (United States)

    Macheyeki, A. S.; Mdala, H.; Chapola, L. S.; Manhiça, V. J.; Chisambi, J.; Feitio, P.; Ayele, A.; Barongo, J.; Ferdinand, R. W.; Ogubazghi, G.; Goitom, B.; Hlatywayo, J. D.; Kianji, G. K.; Marobhe, I.; Mulowezi, A.; Mutamina, D.; Mwano, J. M.; Shumba, B.; Tumwikirize, I.

    2015-02-01

    The East African Rift System (EARS) has natural hazards - earthquakes, volcanic eruptions, and landslides along the faulted margins, and in response to ground shaking. Strong damaging earthquakes have been occurring in the region along the EARS throughout historical time, example being the 7.4 (Ms) of December 1910. The most recent damaging earthquake is the Karonga earthquake in Malawi, which occurred on 19th December, 2009 with a magnitude of 6.2 (Ms). The earthquake claimed four lives and destroyed over 5000 houses. In its effort to improve seismic hazard assessment in the region, Eastern and Southern Africa Seismological Working Group (ESARSWG) under the sponsorship of the International Program on Physical Sciences (IPPS) carried out a study on active fault mapping in the region. The fieldwork employed geological and geophysical techniques. The geophysical techniques employed are ground magnetic, seismic refraction and resistivity surveys but are reported elsewhere. This article gives findings from geological techniques. The geological techniques aimed primarily at mapping of active faults in the area in order to delineate presence or absence of fault segments. Results show that the Karonga fault (the Karonga fault here referred to as the fault that ruptured to the surface following the 6th-19th December 2009 earthquake events in the Karonga area) is about 9 km long and dominated by dip slip faulting with dextral and insignificant sinistral components and it is made up of 3-4 segments of length 2-3 km. The segments are characterized by both left and right steps. Although field mapping show only 9 km of surface rupture, maximum vertical offset of about 43 cm imply that the surface rupture was in little excess of 14 km that corresponds with Mw = 6.4. We recommend the use or integration of multidisciplinary techniques in order to better understand the fault history, mechanism and other behavior of the fault/s for better urban planning in the area.

  12. Expression profiles for macrophage alternative activation genes in AD and in mouse models of AD

    Directory of Open Access Journals (Sweden)

    Van Nostrand William E

    2006-09-01

    Full Text Available Abstract Background Microglia are associated with neuritic plaques in Alzheimer disease (AD and serve as a primary component of the innate immune response in the brain. Neuritic plaques are fibrous deposits composed of the amyloid beta-peptide fragments (Abeta of the amyloid precursor protein (APP. Numerous studies have shown that the immune cells in the vicinity of amyloid deposits in AD express mRNA and proteins for pro-inflammatory cytokines, leading to the hypothesis that microglia demonstrate classical (Th-1 immune activation in AD. Nonetheless, the complex role of microglial activation has yet to be fully explored since recent studies show that peripheral macrophages enter an "alternative" activation state. Methods To study alternative activation of microglia, we used quantitative RT-PCR to identify genes associated with alternative activation in microglia, including arginase I (AGI, mannose receptor (MRC1, found in inflammatory zone 1 (FIZZ1, and chitinase 3-like 3 (YM1. Results Our findings confirmed that treatment of microglia with anti-inflammatory cytokines such as IL-4 and IL-13 induces a gene profile typical of alternative activation similar to that previously observed in peripheral macrophages. We then used this gene expression profile to examine two mouse models of AD, the APPsw (Tg-2576 and Tg-SwDI, models for amyloid deposition and for cerebral amyloid angiopathy (CAA respectively. AGI, MRC1 and YM1 mRNA levels were significantly increased in the Tg-2576 mouse brains compared to age-matched controls while TNFα and NOS2 mRNA levels, genes commonly associated with classical activation, increased or did not change, respectively. Only TNFα mRNA increased in the Tg-SwDI mouse brain. Alternative activation genes were also identified in brain samples from individuals with AD and were compared to age-matched control individuals. In AD brain, mRNAs for TNFα, AGI, MRC1 and the chitinase-3 like 1 and 2 genes (CHI3L1; CHI3L2 were

  13. Conserved mechanism of PLAG1 activation in salivary gland tumors with and without chromosome 8q12 abnormalities: identification of SII as a new fusion partner gene.

    Science.gov (United States)

    Aström, A K; Voz, M L; Kas, K; Röijer, E; Wedell, B; Mandahl, N; Van de Ven, W; Mark, J; Stenman, G

    1999-02-15

    We have previously shown (K. Kas et al, Nat. Genet., 15: 170-174, 1997) that the developmentally regulated zinc finger gene pleomorphic adenoma gene 1 (PLAG1) is the target gene in 8q12 in pleomorphic adenomas of the salivary glands with t(3;8)(p21;q12) translocations. The t(3;8) results in promoter swapping between PLAG1 and the constitutively expressed gene for beta-catenin (CTNNB1), leading to activation of PLAG1 expression and reduced expression of CTNNB1. Here we have studied the expression of PLAG1 by Northern blot analysis in 47 primary benign and malignant human tumors with or without cytogenetic abnormalities of 8q12. Overexpression of PLAG1 was found in 23 tumors (49%). Thirteen of 17 pleomorphic adenomas with a normal karyotype and 5 of 10 with 12q13-15 abnormalities overexpressed PLAG1, which demonstrates that PLAG1 activation is a frequent event in adenomas irrespective of karyotype. In contrast, PLAG1 was overexpressed in only 2 of 11 malignant salivary gland tumors analyzed, which suggests that, at least in salivary gland tumors, PLAG1 activation preferentially occurs in benign tumors. PLAG1 over-expression was also found in three of nine mesenchymal tumors, i.e., in two uterine leiomyomas and one leiomyosarcoma. RNase protection, rapid amplification of 5'-cDNA ends (5'-RACE), and reverse transcription-PCR analyses of five adenomas with a normal karyotype revealed fusion transcripts in three tumors. Nucleotide sequence analysis of these showed that they contained fusions between PLAG1 and CTNNB1 (one case) or PLAG1 and a novel fusion partner gene, i.e., the gene encoding the transcription elongation factor SII (two cases). The fusions occurred in the 5' noncoding region of PLAG1, leading to exchange of regulatory control elements and, as a consequence, activation of PLAG1 gene expression. Because all of the cases had grossly normal karyotypes, the rearrangements must result from cryptic rearrangements. The results suggest that in addition to

  14. Identification of the nik Gene Cluster of Brucella suis: Regulation and Contribution to Urease Activity

    Science.gov (United States)

    Jubier-Maurin, Véronique; Rodrigue, Agnès; Ouahrani-Bettache, Safia; Layssac, Marion; Mandrand-Berthelot, Marie-Andrée; Köhler, Stephan; Liautard, Jean-Pierre

    2001-01-01

    Analysis of a Brucella suis 1330 gene fused to a gfp reporter, and identified as being induced in J774 murine macrophage-like cells, allowed the isolation of a gene homologous to nikA, the first gene of the Escherichia coli operon encoding the specific transport system for nickel. DNA sequence analysis of the corresponding B. suis nik locus showed that it was highly similar to that of E. coli except for localization of the nikR regulatory gene, which lies upstream from the structural nikABCDE genes and in the opposite orientation. Protein sequence comparisons suggested that the deduced nikABCDE gene products belong to a periplasmic binding protein-dependent transport system. The nikA promoter-gfp fusion was activated in vitro by low oxygen tension and metal ion deficiency and was repressed by NiCl2 excess. Insertional inactivation of nikA strongly reduced the activity of the nickel metalloenzyme urease, which was restored by addition of a nickel excess. Moreover, the nikA mutant of B. suis was functionally complemented with the E. coli nik gene cluster, leading to the recovery of urease activity. Reciprocally, an E. coli strain harboring a deleted nik operon recovered hydrogenase activity by heterologous complementation with the B. suis nik locus. Taking into account these results, we propose that the nik locus of B. suis encodes a nickel transport system. The results further suggest that nickel could enter B. suis via other transport systems. Intracellular growth rates of the B. suis wild-type and nikA mutant strains in human monocytes were similar, indicating that nikA was not essential for this step of infection. We discuss a possible role of nickel transport in maintaining enzymatic activities which could be crucial for survival of the bacteria under the environmental conditions encountered within the host. PMID:11133934

  15. Child dopamine active transporter 1 genotype and parenting: evidence for evocative gene-environment correlations.

    Science.gov (United States)

    Hayden, Elizabeth P; Hanna, Brigitte; Sheikh, Haroon I; Laptook, Rebecca S; Kim, Jiyon; Singh, Shiva M; Klein, Daniel N

    2013-02-01

    The dopamine active transporter 1 (DAT1) gene is implicated in psychopathology risk. Although the processes by which this gene exerts its effects on risk are poorly understood, a small body of research suggests that the DAT1 gene influences early emerging negative emotionality, a marker of children's psychopathology risk. As child negative emotionality evokes negative parenting practices, the DAT1 gene may also play a role in gene-environment correlations. To test this model, children (N = 365) were genotyped for the DAT1 gene and participated in standardized parent-child interaction tasks with their primary caregiver. The DAT1 gene 9-repeat variant was associated with child negative affect expressed toward the parent during parent-child interactions, and parents of children with a 9-repeat allele exhibited more hostility and lower guidance/engagement than parents of children without a 9-repeat allele. These gene-environment associations were partially mediated by child negative affect toward the parent. The findings implicate a specific polymorphism in eliciting negative parenting, suggesting that evocative associations play a role in elevating children's risk for emotional trajectories toward psychopathology risk.

  16. 酿酒酵母减数分裂的事件和特异性基因%Meiosis Events and Specific Genes Involved in Saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    李丽

    2006-01-01

    Meiosis is the most important reproduce and favoured by organisms. The key events of meiosis identified are pairing, synapsis, genetic recombination, segregation. In this article, the specific genes of meiosis and pathways are described in these events in Saccharomyces cerevisiae. Two pathways have been identified in homolog pairing and Dmc1,Hop2, Rad51 and Mnd1 have function in pairing. In synapsis Red1, Hop1 and Zip1 are the components of synaptonemal complex. Hop2 is required for synapsis. Genetic recombination is the most important event of meiosis and provides genetic diversity for organisms to adapt the environment change. The meiosis specific genes involved in gene recombination are Spo11, Rad52 epistasis group, Dmc1, Mnd1, Msh4, Msh5, Mek1, Red1, and Hop1. Rec8,Spo13 and Sgo1 are involved in segregation.%减数分裂是生物体重要的有性生殖方式,它提供来自母本和父本的基因信息,产生具有生物多样性的子代,使其能够适应环境的变化而不断进化.本文简述了现已阐明的酿酒酵母减数分裂的重要事件如同源染色体配对、联会、基因重组、染色体分裂和特异性基因.在同源染色体配对的过程中现已发现了2条途径,一条由Rad51独立完成,另一条有Dmc1、Hop2、Rad51和Mnd1参与,同时Rad51也可能参与.Red1、Hop1和Zip1是联会复合体的组成成分,而联会也要求其他减数分裂的特异性基因如Hop2的参与.基因重组是减数分裂中最重要的事件,它为子代提供了新的遗传信息,是生物多样性的基础之一.Spo11、Rad52组、Dmc1、Mnd1、Msh4、Msh5、Mek1、Red1和Hop1参与了基因重组.Spo11是发现和研究得最早的启动基因重组的基因之一;Rec8、Spo13和Sgo1参与了染色体分裂的过程.

  17. Absence of canonical marks of active chromatin in developmentally regulated genes.

    Science.gov (United States)

    Pérez-Lluch, Sílvia; Blanco, Enrique; Tilgner, Hagen; Curado, Joao; Ruiz-Romero, Marina; Corominas, Montserrat; Guigó, Roderic

    2015-10-01

    The interplay of active and repressive histone modifications is assumed to have a key role in the regulation of gene expression. In contrast to this generally accepted view, we show that the transcription of genes temporally regulated during fly and worm development occurs in the absence of canonically active histone modifications. Conversely, strong chromatin marking is related to transcriptional and post-transcriptional stability, an association that we also observe in mammals. Our results support a model in which chromatin marking is associated with the stable production of RNA, whereas unmarked chromatin would permit rapid gene activation and deactivation during development. In the latter case, regulation by transcription factors would have a comparatively more important regulatory role than chromatin marks.

  18. Isolation of genes (nif/hup cosmids) involved in hydrogenase and nitrogenase activities in Rhizobium japonicum.

    Science.gov (United States)

    Hom, S S; Graham, L A; Maier, R J

    1985-03-01

    Recombinant cosmids containing a Rhizobium japonicum gene involved in both hydrogenase (Hup) and nitrogenase (Nif) activities were isolated. An R. japonicum gene bank utilizing broad-host-range cosmid pLAFR1 was conjugated into Hup- Nif- R. japonicum strain SR139. Transconjugants containing the nif/hup cosmid were identified by their resistance to tetracycline (Tcr) and ability to grow chemoautotrophically (Aut+) with hydrogen. All Tcr Aut+ transconjugants possessed high levels of H2 uptake activity, as determined amperometrically. Moreover, all Hup+ transconjugants tested possessed the ability to reduce acetylene (Nif+) in soybean nodules. Cosmid DNAs from 19 Hup+ transconjugants were transferred to Escherichia coli by transformation. When the cosmids were restricted with EcoRI, 15 of the 19 cosmids had a restriction pattern with 13.2-, 4.0-, 3.0-, and 2.5-kilobase DNA fragments. Six E. coli transformants containing the nif/hup cosmids were conjugated with strain SR139. All strain SR139 transconjugants were Hup+ Nif+. Moreover, one nif/hup cosmid was transferred to 15 other R. japonicum Hup- mutants. Hup+ transconjugants of six of the Hup- mutants appeared at a frequency of 1.0, whereas the transconjugants of the other nine mutants remained Hup-. These results indicate that the nif/hup gene cosmids contain a gene involved in both nitrogenase and hydrogenase activities and at least one and perhaps other hup genes which are exclusively involved in H2 uptake activity.

  19. The amrG1 gene is involved in the activation of acetate in Corynebacterium glutamicum

    Institute of Scientific and Technical Information of China (English)

    RUAN; Hong; R.; Gerstmeir; S.; Schnicke; B.J.; Eikmanns

    2005-01-01

    During growth of Corynebacterium glutamicum on acetate as its carbon and energy source, the expression of the pta-ack operon is induced, coding for the acetate-activating enzymes, which are phosphotransacetylase (PTA) and acetate kinase (AK). By transposon rescue, we identified the two genes amrG1 and amrG2 found in the deregulated transposon mutant C. glutamicum G25. The amrG1 gene (NCBI-accession: AF532964) has a size of 732 bp, encoding a polypeptide of 243 amino acids and apparently is partially responsible for the regulation of acetate metabolism in C. glutamicum. We constructed an in-frame deletion mutant and an overexpressing strain of amrG1 in the C. glutamicum ATCC13032 wildtype. The strains were then analyzed with respect to their enzyme activities of PTA and AK during growth on glucose, acetate and glucose or acetate alone as carbon sources. Compared to the parental strain, the amrG1 deletion mutant showed higher specific AK and PTA activities during growth on glucose but showed the same high specific activities of AK and PTA on medium containing acetate plus glucose and on medium containing acetate. In contrast to the gene deletion, overexpression of the amrG1 gene in C. glutamicum 13032 had the adverse regulatory effect. These results indicate that the amrG1 gene encodes a repressor or co-repressor of the pta-ack operon.

  20. Absence of missense mutations in activated c-myc genes in avian leukosis virus-induced B-cell lymphomas

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, M.; Hayward, W.S.

    1988-06-01

    The authors determined the nucleotide sequences of two independent DNA clones which contained the activated c-myc genes from avian leukosis virus-induced B-cell lymphomas. Neither of these c-myce genes contained missense mutations. This strongly supports the notion that the c-myc photo-oncogene in avian leukosis virus-induced B-cell lymphomas can be oncogenically activated by altered expression of the gene without a change in the primary structure of the gene product.

  1. Lighting-induced Electron Precipitation (LEP) Events versus Geomagnetic Activity: A Probe Tool to Re-Evaluate the Electron Radiation Belt Loss Mechanisms (P16)

    Science.gov (United States)

    Fernandez, J. H.; Raulin, J.-P.; Correia, E.; Brum, C. G. M.

    2006-11-01

    We present the first results of an incipient attempt to re-model the Van Allen electron radiation belts equilibrium mechanisms. During the 23rd cycle solar minimum period (1995-1997) the Lightning- induced Electron Precipitation (LEP) events (electron precipitation from the geo-space to the upper Earth atmosphere) occurrence at the Antarctica Peninsula region was collected and studied. With statistical techniques we have reproduced the pattern of the events incidence during that period. The year 1998 was also analyzed and two well-defined geomagnetic storms (01-07 May and 26-31 Aug) were studied in association with the Trimpi events data. We have confirmed the narrow relationship between events occurrence rate and geomagnetic activity. The next step, in order to carry on the model, will be the modeling of the solar maximum LEP occurrence and to compute these results in the present radiation belts population models.

  2. Genome-wide association study of theta band event-related oscillations identifies serotonin receptor gene HTR7 influencing risk of alcohol dependence.

    Science.gov (United States)

    Zlojutro, Mark; Manz, Niklas; Rangaswamy, Madhavi; Xuei, Xiaoling; Flury-Wetherill, Leah; Koller, Daniel; Bierut, Laura J; Goate, Alison; Hesselbrock, Victor; Kuperman, Samuel; Nurnberger, John; Rice, John P; Schuckit, Marc A; Foroud, Tatiana; Edenberg, Howard J; Porjesz, Bernice; Almasy, Laura

    2011-01-01

    Event-related brain oscillations (EROs) represent highly heritable neuroelectrical correlates of human perception and cognitive performance that exhibit marked deficits in patients with various psychiatric disorders. We report the results of the first genome-wide association study (GWAS) of an ERO endophenotype-frontal theta ERO evoked by visual oddball targets during P300 response in 1,064 unrelated individuals drawn from a study of alcohol dependence. Forty-two SNPs of the Illumina HumanHap 1 M microarray were selected from the theta ERO GWAS for replication in family-based samples (N = 1,095), with four markers revealing nominally significant association. The most significant marker from the two-stage study is rs4907240 located within ARID protein 5A gene (ARID5A) on chromosome 2q11 (unadjusted, Fisher's combined P = 3.68 × 10⁻⁶). However, the most intriguing association to emerge is with rs7916403 in serotonin receptor gene HTR7 on chromosome 10q23 (combined P = 1.53 × 10⁻⁴), implicating the serotonergic system in the neurophysiological underpinnings of theta EROs. Moreover, promising SNPs were tested for association with diagnoses of alcohol dependence (DSM-IV), revealing a significant relationship with the HTR7 polymorphism among GWAS case-controls (P = 0.008). Significant recessive genetic effects were also detected for alcohol dependence in both case-control and family-based samples (P = 0.031 and 0.042, respectively), with the HTR7 risk allele corresponding to theta ERO reductions among homozygotes. These results suggest a role of the serotonergic system in the biological basis of alcohol dependence and underscore the utility of analyzing brain oscillations as a powerful approach to understanding complex genetic psychiatric disorders.

  3. Analysis of promoter activity in transgenic plants by normalizing expression with a reference gene: anomalies due to the influence of the test promoter on the reference promoter

    Indian Academy of Sciences (India)

    Simran Bhullar; Suma Chakravarthy; Deepak Pental; Pradeep Kumar Burma

    2009-12-01

    Variations in transgene expressio