WorldWideScience

Sample records for gene 11p13 integration

  1. A 1.7-Mb YAC contig around the human BDNF gene (11p13): integration of the physical, genetic, and cytogenetic maps in relation to WAGR syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Rosier, M.F.; Martin, A.; Houlgatte, R. [Genetique Moleculaire et Biologie du Development, Villejuif (France)] [and others

    1994-11-01

    WAGR (Wilms tumor, aniridia, genito-urinary abnormalities, mental retardation) syndrome in humans is associated with deletions of the 11p13 region. The brain-derived neurotrophic factor (BDNF) gene maps to this region, and its deletion seems to contribute to the severity of the patient`s mental retardation. Yeast artificial chromosomes (YACs) carrying the BDNF gene have been isolated and characterized. Localization of two known exons of this gene leads to a minimal estimation of its size of about 40 kb. Chimerism of the BDNF YACs has been investigated by fluorescence in situ hybridization and chromosome assignment on somatic cell hybrids. Using the BDNF gene, YAC end sequence tagged sites (STS), and Genethon microsatellite markers, the authors constructed a 1.7-Mb contig and refined the cytogenetic map at 11p13. The resulting integrated physical, genetic, and cytogenetic map constitutes a resource for the characterization of genes that may be involved in the WAGR syndrome. 42 refs., 2 figs., 3 tabs.

  2. HRAS1-selected chromosome transfer generates markers that colocalize aniridia- and genitourinary dysplasia-associated translocation breakpoints and the Wilms tumor gene within band 11p13.

    OpenAIRE

    Porteous, D J; Bickmore, W; Christie, S; Boyd, P A; Cranston, G; Fletcher, J M; Gosden, J R; Rout, D; Seawright, A; Simola, K O

    1987-01-01

    We show that chromosome-mediated gene transfer can provide an enriched source of DNA markers for predetermined, subchromosomal regions of the human genome. Forty-four human DNA recombinants isolated from a HRAS1-selected chromosome-mediated gene transformant map exclusively to chromosome 11, with several sublocalizing to the Wilms tumor region at 11p13. We present a detailed molecular map of the deletion chromosomes 11 from five WAGR (Wilms tumor/aniridia/genitourinary abnormalities/mental re...

  3. The distal region of 11p13 and associated genetic diseases

    NARCIS (Netherlands)

    Mannens, M.; Hoovers, J. M.; Bleeker-Wagemakers, E. M.; Redeker, E.; Bliek, J.; Overbeeke-Melkert, M.; Saunders, G.; Williams, B.; van Heyningen, V.; Junien, C.

    1991-01-01

    The distal region of human chromosome band 11p13 is believed to contain a cluster of genes involved in the development of the eye, kidney, urogenital tract, and possibly the nervous system. Genetic abnormalities of this region can lead to Wilms tumor, aniridia, urogenital abnormalities, and mental

  4. Pericentric intrachromosomal insertion responsible for recurrence of del(11)(p13p14) in a family

    NARCIS (Netherlands)

    Henry, I.; Hoovers, J.; Barichard, F.; Berthéas, M. F.; Puech, A.; Prieur, F.; Gessler, M.; Bruns, G.; Mannens, M.; Junien, C.

    1993-01-01

    The combined use of qualitative and quantitative analysis of 11p13 polymorphic markers together with chromosomal in situ suppression hybridization (CISS) with biotin labeled probes mapping to 11p allowed us to characterize a complex rearrangement segregating in a family. We detected a pericentric

  5. Pediatric acute myeloid leukemia with t(8;16)(p11;p13), a distinct clinical and biological entity: a collaborative study by the International-Berlin-Frankfurt-Münster AML-study group

    Science.gov (United States)

    Coenen, Eva A.; Zwaan, C. Michel; Reinhardt, Dirk; Harrison, Christine J.; Haas, Oskar A.; de Haas, Valerie; Mihál, Vladimir; De Moerloose, Barbara; Jeison, Marta; Rubnitz, Jeffrey E.; Tomizawa, Daisuke; Johnston, Donna; Alonzo, Todd A.; Hasle, Henrik; Auvrignon, Anne; Dworzak, Michael; Pession, Andrea; van der Velden, Vincent H. J.; Swansbury, John; Wong, Kit-fai; Terui, Kiminori; Savasan, Sureyya; Winstanley, Mark; Vaitkeviciene, Goda; Zimmermann, Martin; Pieters, Rob; van den Heuvel-Eibrink, Marry M.

    2013-01-01

    In pediatric acute myeloid leukemia (AML), cytogenetic abnormalities are strong indicators of prognosis. Some recurrent cytogenetic abnormalities, such as t(8;16)(p11;p13), are so rare that collaborative studies are required to define their prognostic impact. We collected the clinical characteristics, morphology, and immunophenotypes of 62 pediatric AML patients with t(8;16)(p11;p13) from 18 countries participating in the International Berlin-Frankfurt-Münster (I-BFM) AML study group. We used the AML-BFM cohort diagnosed from 1995-2005 (n = 543) as a reference cohort. Median age of the pediatric t(8;16)(p11;p13) AML patients was significantly lower (1.2 years). The majority (97%) had M4-M5 French-American-British type, significantly different from the reference cohort. Erythrophagocytosis (70%), leukemia cutis (58%), and disseminated intravascular coagulation (39%) occurred frequently. Strikingly, spontaneous remissions occurred in 7 neonates with t(8;16)(p11;p13), of whom 3 remain in continuous remission. The 5-year overall survival of patients diagnosed after 1993 was 59%, similar to the reference cohort (P = .14). Gene expression profiles of t(8;16)(p11;p13) pediatric AML cases clustered close to, but distinct from, MLL-rearranged AML. Highly expressed genes included HOXA11, HOXA10, RET, PERP, and GGA2. In conclusion, pediatric t(8;16)(p11;p13) AML is a rare entity defined by a unique gene expression signature and distinct clinical features in whom spontaneous remissions occur in a subset of neonatal cases. PMID:23974201

  6. Aniridia--Wilms′ tumour association--a case with 11p 13-14.1 deletion and ventricular septal defect.

    OpenAIRE

    Rao S; Athale U; Kadam P; Gladstone B; Nair C; Pai S; Kurkure P; Advani S

    1992-01-01

    A two year old female child with bilateral wilms tumor (WT) along with multiple congenital anomalies like bilateral aniridia with congenital cataracts and nystagmus, microcephaly, mental retardation and ventricular septal defect has been described. The karyotype analysis revealed 46 xx, del 11p 13-14.1. Association of ventricular septal defect with the classical features of ′Aniridia-Wilms′ tumor association′ is an unusual feature in this case.

  7. Tumor-specific loss of 11p15.5 alleles in del11p13 Wilms tumor and in familial adrenocortical carcinoma

    International Nuclear Information System (INIS)

    Henry, I.; Grandjouan, S.; Couillin, P.

    1989-01-01

    The authors have compared constitutional and tumor genotypes in nine cases of hereditary Wilms tumor (WT) and in three unrelated cases of familial adrenocortical carcinoma (ADCC). Since susceptibility to these tumors can be observed in malformation syndromes associated with a constitutional deletion of band 11p13 (WT) and with a constitutional duplication of band 11p15.5 (WT, ADCC), they investigated these two candidate regions by using 11p polymorphic markers. As expected, somatic chromosomal events, resulting in a loss of heterozygosity limited to region 11p15.5, were observed in the tumor of two familial cases of adrenocortical carcinoma. Surprisingly, however, analysis of the WT of two patients with a constitutional deletion of band 11p13, associated with aniridia, genitourinary abnormalities, and mental retardation (WAGR syndrome), revealed a loss of heterozygosity limited to region 11p15.5. These data therefore suggest that observation of a specific loss of heterozygosity may not necessarily point to the site of the initial germinal mutation. Together with previous similar observations of a loss of heterozygosity limited to 11p15.5 in breast cancer and in rhabdomyosarcoma, the data suggest that region 11p15.5 may carry a non-tissue-specific gene that could be involved in genetic predisposition, in tumor progression, or in both

  8. Loss of heterozygosity at 11p13 and 11p15 in Wilms tumor: a study of 22 cases from India.

    Science.gov (United States)

    Sigamani, Elanthenral; Wari, Mohammad Nahidul; Iyer, Venkateswaran K; Agarwala, Sandeep; Sharma, Arundhati; Bakhshi, Sameer; Dinda, Amit

    2013-03-01

    11p13 and 11p15 loss of heterozygosity (LOH) in Wilms tumor (WT), the commonest molecular pathogenetic event in WT, shows variation in different parts of the world. The present study looked for the presence of 11p13 and 11p15 LOH as well as nephrogenic rests in WT occurring in India. Twenty-two cases of WT were subjected to thorough pathological examination for presence of nephrogenic rests. Fresh frozen tissue was evaluated for LOH at 11p13 and 11p15, using PCR for microsatellite markers. Among twenty-two consecutive cases of WT, 20 were unilateral and 2 were bilateral. 6/22 showed LOH at 11p13 (27.7 %) and 1/22 showed LOH at 11p15 (4.54 %). 2/22 cases showed presence of nephrogenic rests. One of the cases with LOH at 11p13 had intralobar nephrogenic rest in the adjacent kidney. One specimen had perilobar nephrogenic rest in the adjacent kidney but did not show LOH for either 11p13 or 11p15 in the tumor. LOH at 11p13 is seen in 27.27 % of WT in India, which is similar to reports in the English language literature. LOH at 11p15 was seen in 4.54 % of WT, which is lower than that reported from Western subjects.

  9. A familial pericentric inversion of chromosome 11 associated with a microdeletion of 163 kb and microduplication of 288 kb at 11p13 and 11q22.3 without aniridia or eye anomalies.

    Science.gov (United States)

    Balay, Lara; Totten, Ellen; Okada, Luna; Zell, Sidney; Ticho, Benjamin; Israel, Jeannette; Kogan, Jillene

    2016-01-01

    Interstitial deletions of 11p13 involving MPPED2, DCDC5, DCDC1, DNAJC24, IMMP1L, and ELP4 are previously reported to have downstream transcriptional effects on the expression of PAX6, due to a downstream regulatory region (DRR). Currently, no clear genotype-phenotype correlations have been established allowing for conclusive information regarding the exact location of the PAX6 DRR, though its location has been approximated in mouse models to be within the Elp4 gene. Of the clinical reports currently published examining patients with intact PAX6 genes but harboring deletions identified in genes downstream of PAX6, 100% indicate phenotypes which include aniridia, whereas approximately half report additional eye deformities, autism, or intellectual disability. In this clinical report, we present a 12-year-old male patient, his brother, and mother with pericentric inversions of chromosome 11 associated with submicroscopic interstitial deletions of 11p13 and duplications of 11q22.3. The inversions were identified by standard cytogenetic analysis; microarray and FISH detected the chromosomal imbalance. The patient's phenotype includes intellectual disability, speech abnormalities, and autistic behaviors, but interestingly neither the patient, his brother, nor mother have aniridia or other eye anomalies. To the best of our knowledge, these findings in three family members represent the only reported cases with 11p13 deletions downstream of PAX6 not demonstrating phenotypic characteristics of aniridia or abnormal eye development. Although none of the deleted genes are obvious candidates for the patient's phenotype, the absence of aniridia in the presence of this deletion in all three family members further delineates the location of the DRR for PAX6. © 2015 Wiley Periodicals, Inc.

  10. Genome-wide association and linkage identify modifier loci of lung disease severity in cystic fibrosis at 11p13 and 20q13.2

    Science.gov (United States)

    Wright, Fred A.; Strug, Lisa J.; Doshi, Vishal K.; Commander, Clayton W.; Blackman, Scott M.; Sun, Lei; Berthiaume, Yves; Cutler, David; Cojocaru, Andreea; Collaco, J. Michael; Corey, Mary; Dorfman, Ruslan; Goddard, Katrina; Green, Deanna; Kent, Jack W.; Lange, Ethan M.; Lee, Seunggeun; Li, Weili; Luo, Jingchun; Mayhew, Gregory M.; Naughton, Kathleen M.; Pace, Rhonda G.; Paré, Peter; Rommens, Johanna M.; Sandford, Andrew; Stonebraker, Jaclyn R.; Sun, Wei; Taylor, Chelsea; Vanscoy, Lori L.; Zou, Fei; Blangero, John; Zielenski, Julian; O’Neal, Wanda K.; Drumm, Mitchell L.; Durie, Peter R.; Knowles, Michael R.; Cutting, Garry R.

    2012-01-01

    A combined genome-wide association and linkage study was used to identify loci causing variation in CF lung disease severity. A significant association (P=3. 34 × 10-8) near EHF and APIP (chr11p13) was identified in F508del homozygotes (n=1,978). The association replicated in F508del homozygotes (P=0.006) from a separate family-based study (n=557), with P=1.49 × 10-9 for the three-study joint meta-analysis. Linkage analysis of 486 sibling pairs from the family-based study identified a significant QTL on chromosome 20q13.2 (LOD=5.03). Our findings provide insight into the causes of variation in lung disease severity in CF and suggest new therapeutic targets for this life-limiting disorder. PMID:21602797

  11. Association of brain-derived neurotrophic factor (BDNF) haploinsufficiency with lower adaptive behaviour and reduced cognitive functioning in WAGR/11p13 deletion syndrome.

    Science.gov (United States)

    Han, Joan C; Thurm, Audrey; Golden Williams, Christine; Joseph, Lisa A; Zein, Wadih M; Brooks, Brian P; Butman, John A; Brady, Sheila M; Fuhr, Shannon R; Hicks, Melanie D; Huey, Amanda E; Hanish, Alyson E; Danley, Kristen M; Raygada, Margarita J; Rennert, Owen M; Martinowich, Keri; Sharp, Stephen J; Tsao, Jack W; Swedo, Susan E

    2013-01-01

    In animal studies, brain-derived neurotrophic factor (BDNF) is an important regulator of central nervous system development and synaptic plasticity. WAGR (Wilms tumour, Aniridia, Genitourinary anomalies, and mental Retardation) syndrome is caused by 11p13 deletions of variable size near the BDNF locus and can serve as a model for studying human BDNF haploinsufficiency (+/-). We hypothesized that BDNF+/- would be associated with more severe cognitive impairment in subjects with WAGR syndrome. Twenty-eight subjects with WAGR syndrome (6-28 years), 12 subjects with isolated aniridia due to PAX6 mutations/microdeletions (7-54 years), and 20 healthy controls (4-32 years) received neurocognitive assessments. Deletion boundaries for the subjects in the WAGR group were determined by high-resolution oligonucleotide array comparative genomic hybridization. Within the WAGR group, BDNF+/- subjects (n = 15), compared with BDNF intact (+/+) subjects (n = 13), had lower adaptive behaviour (p = .02), reduced cognitive functioning (p = .04), higher levels of reported historical (p = .02) and current (p = .02) social impairment, and higher percentage meeting cut-off score for autism (p = .047) on Autism Diagnostic Interview-Revised. These differences remained nominally significant after adjusting for visual acuity. Using diagnostic measures and clinical judgement, 3 subjects (2 BDNF+/- and 1 BDNF+/+) in the WAGR group (10.7%) were classified with autism spectrum disorder. A comparison group of visually impaired subjects with isolated aniridia had cognitive functioning comparable to that of healthy controls. In summary, among subjects with WAGR syndrome, BDNF+/- subjects had a mean Vineland Adaptive Behaviour Compose score that was 14-points lower and a mean intelligence quotient (IQ) that was 20-points lower than BDNF+/+ subjects. Our findings support the hypothesis that BDNF plays an important role in human neurocognitive development. Published by Elsevier Ltd.

  12. Establishment of a Conditionally Immortalized Wilms Tumor Cell Line with a Homozygous WT1 Deletion within a Heterozygous 11p13 Deletion and UPD Limited to 11p15.

    Directory of Open Access Journals (Sweden)

    Artur Brandt

    Full Text Available We describe a stromal predominant Wilms tumor with focal anaplasia and a complex, tumor specific chromosome 11 aberration: a homozygous deletion of the entire WT1 gene within a heterozygous 11p13 deletion and an additional region of uniparental disomy (UPD limited to 11p15.5-p15.2 including the IGF2 gene. The tumor carried a heterozygous p.T41A mutation in CTNNB1. Cells established from the tumor carried the same chromosome 11 aberration, but a different, homozygous p.S45Δ CTNNB1 mutation. Uniparental disomy (UPD 3p21.3pter lead to the homozygous CTNNB1 mutation. The tumor cell line was immortalized using the catalytic subunit of human telomerase (hTERT in conjunction with a novel thermolabile mutant (U19dl89-97tsA58 of SV40 large T antigen (LT. This cell line is cytogenetically stable and can be grown indefinitely representing a valuable tool to study the effect of a complete lack of WT1 in tumor cells. The origin/fate of Wilms tumors with WT1 mutations is currently poorly defined. Here we studied the expression of several genes expressed in early kidney development, e.g. FOXD1, PAX3, SIX1, OSR1, OSR2 and MEIS1 and show that these are expressed at similar levels in the parental and the immortalized Wilms10 cells. In addition the limited potential for muscle/ osteogenic/ adipogenic differentiation similar to all other WT1 mutant cell lines is also observed in the Wilms10 tumor cell line and this is retained in the immortalized cells. In summary these Wilms10 cells are a valuable model system for functional studies of WT1 mutant cells.

  13. Establishment of a Conditionally Immortalized Wilms Tumor Cell Line with a Homozygous WT1 Deletion within a Heterozygous 11p13 Deletion and UPD Limited to 11p15

    Science.gov (United States)

    Brandt, Artur; Löhers, Katharina; Beier, Manfred; Leube, Barbara; de Torres, Carmen; Mora, Jaume; Arora, Parineeta; Jat, Parmjit S.; Royer-Pokora, Brigitte

    2016-01-01

    We describe a stromal predominant Wilms tumor with focal anaplasia and a complex, tumor specific chromosome 11 aberration: a homozygous deletion of the entire WT1 gene within a heterozygous 11p13 deletion and an additional region of uniparental disomy (UPD) limited to 11p15.5-p15.2 including the IGF2 gene. The tumor carried a heterozygous p.T41A mutation in CTNNB1. Cells established from the tumor carried the same chromosome 11 aberration, but a different, homozygous p.S45Δ CTNNB1 mutation. Uniparental disomy (UPD) 3p21.3pter lead to the homozygous CTNNB1 mutation. The tumor cell line was immortalized using the catalytic subunit of human telomerase (hTERT) in conjunction with a novel thermolabile mutant (U19dl89-97tsA58) of SV40 large T antigen (LT). This cell line is cytogenetically stable and can be grown indefinitely representing a valuable tool to study the effect of a complete lack of WT1 in tumor cells. The origin/fate of Wilms tumors with WT1 mutations is currently poorly defined. Here we studied the expression of several genes expressed in early kidney development, e.g. FOXD1, PAX3, SIX1, OSR1, OSR2 and MEIS1 and show that these are expressed at similar levels in the parental and the immortalized Wilms10 cells. In addition the limited potential for muscle/ osteogenic/ adipogenic differentiation similar to all other WT1 mutant cell lines is also observed in the Wilms10 tumor cell line and this is retained in the immortalized cells. In summary these Wilms10 cells are a valuable model system for functional studies of WT1 mutant cells. PMID:27213811

  14. Pediatric acute myeloid leukemia with t(8;16)(p11;p13), a distinct clinical and biological entity: A collaborative study by the International-Berlin- Frankfurt-Münster AML-study group

    NARCIS (Netherlands)

    E.A. Coenen (Eva); C.M. Zwaan (Christian Michel); D. Reinhardt (Dirk); C.J. Harrison (Christine); O.A. Haas (Oskar); V. de Haas (Valerie); V. Mihál (Vladimir); B. de Moerloose (Barbara); M. Jeison (Marta); J.E. Rubnitz (Jeffrey); D. Tomizawa (Daisuke); D. Johnston (Donna); T.A. Alonzo (Todd); H. Hasle (Henrik); A. Auvrignon (Anne); M.N. Dworzak (Michael); A. Pession (Andrea); V.H.J. van der Velden (Vincent); J. Swansbury (John); K.-F. Wong (Kit-Fai); N. Terui (Nobuhiko); S. Savasan (Sureyya); M. Winstanley (Mark); G. Vaitkeviciene (Goda); M. Zimmermann (Martin); R. Pieters (Rob); M.M. van den Heuvel-Eibrink (Marry)

    2013-01-01

    textabstractIn pediatric acute myeloid leukemia (AML), cytogenetic abnormalities are strong indicators of prognosis. Some recurrent cytogenetic abnormalities, such as t(8;16)(p11;p13), are so rare that collaborative studies are required to define their prognostic impact. We collected the clinical

  15. Molecular analysis of aniridia patients for deletions involving the Wilms' tumor gene

    NARCIS (Netherlands)

    Drechsler, M.; Meijers-Heijboer, E. J.; Schneider, S.; Schurich, B.; Grond-Ginsbach, C.; Tariverdian, G.; Kantner, G.; Blankenagel, A.; Kaps, D.; Schroeder-Kurth, T.

    1994-01-01

    A human aniridia candidate (AN) gene on chromosome 11p13 has been cloned and characterized. The AN gene is the second cloned gene of the contiguous genes syndrome WAGR (Wilms' tumor, aniridia, genitourinary malformations, mental retardation) on chromosome 11p13, WT1 being the first gene cloned.

  16. Targeted integration of genes in Xenopus tropicalis

    DEFF Research Database (Denmark)

    Shi, Zhaoying; Tian, Dandan; Xin, Huhu

    2017-01-01

    With the successful establishment of both targeted gene disruption and integration methods in the true diploid frog Xenopus tropicalis, this excellent vertebrate genetic model now is making a unique contribution to modelling human diseases. Here, we summarize our efforts on establishing homologous...... recombination-mediated targeted integration in Xenopus tropicalis, the usefulness, and limitation of targeted integration via the homology-independent strategy, and future directions on how to further improve targeted gene integration in Xenopus tropicalis....

  17. Biomarker Gene Signature Discovery Integrating Network Knowledge

    Directory of Open Access Journals (Sweden)

    Holger Fröhlich

    2012-02-01

    Full Text Available Discovery of prognostic and diagnostic biomarker gene signatures for diseases, such as cancer, is seen as a major step towards a better personalized medicine. During the last decade various methods, mainly coming from the machine learning or statistical domain, have been proposed for that purpose. However, one important obstacle for making gene signatures a standard tool in clinical diagnosis is the typical low reproducibility of these signatures combined with the difficulty to achieve a clear biological interpretation. For that purpose in the last years there has been a growing interest in approaches that try to integrate information from molecular interaction networks. Here we review the current state of research in this field by giving an overview about so-far proposed approaches.

  18. Gene prioritization for livestock diseases by data integration

    DEFF Research Database (Denmark)

    Jiang, Li; Sørensen, Peter; Thomsen, Bo Stjerne

    2012-01-01

    in bovine mastitis. Gene-associated phenome profile and transcriptome profile in response to Escherichia coli infection in the mammary gland were integrated to make a global inference of bovine genes involved in mastitis. The top ranked genes were highly enriched for pathways and biological processes...... underlying inflammation and immune responses, which supports the validity of our approach for identifying genes that are relevant to animal health and disease. These gene-associated phenotypes were used for a local prioritization of candidate genes located in a QTL affecting the susceptibility to mastitis...

  19. DR-Integrator: a new analytic tool for integrating DNA copy number and gene expression data.

    Science.gov (United States)

    Salari, Keyan; Tibshirani, Robert; Pollack, Jonathan R

    2010-02-01

    DNA copy number alterations (CNA) frequently underlie gene expression changes by increasing or decreasing gene dosage. However, only a subset of genes with altered dosage exhibit concordant changes in gene expression. This subset is likely to be enriched for oncogenes and tumor suppressor genes, and can be identified by integrating these two layers of genome-scale data. We introduce DNA/RNA-Integrator (DR-Integrator), a statistical software tool to perform integrative analyses on paired DNA copy number and gene expression data. DR-Integrator identifies genes with significant correlations between DNA copy number and gene expression, and implements a supervised analysis that captures genes with significant alterations in both DNA copy number and gene expression between two sample classes. DR-Integrator is freely available for non-commercial use from the Pollack Lab at http://pollacklab.stanford.edu/ and can be downloaded as a plug-in application to Microsoft Excel and as a package for the R statistical computing environment. The R package is available under the name 'DRI' at http://cran.r-project.org/. An example analysis using DR-Integrator is included as supplemental material. Supplementary data are available at Bioinformatics online.

  20. Integrating Ontological Knowledge and Textual Evidence in Estimating Gene and Gene Product Similarity

    Energy Technology Data Exchange (ETDEWEB)

    Sanfilippo, Antonio P.; Posse, Christian; Gopalan, Banu; Tratz, Stephen C.; Gregory, Michelle L.

    2006-06-08

    With the rising influence of the Gene On-tology, new approaches have emerged where the similarity between genes or gene products is obtained by comparing Gene Ontology code annotations associ-ated with them. So far, these approaches have solely relied on the knowledge en-coded in the Gene Ontology and the gene annotations associated with the Gene On-tology database. The goal of this paper is to demonstrate that improvements to these approaches can be obtained by integrating textual evidence extracted from relevant biomedical literature.

  1. Construction of functional linkage gene networks by data integration.

    Science.gov (United States)

    Linghu, Bolan; Franzosa, Eric A; Xia, Yu

    2013-01-01

    Networks of functional associations between genes have recently been successfully used for gene function and disease-related research. A typical approach for constructing such functional linkage gene networks (FLNs) is based on the integration of diverse high-throughput functional genomics datasets. Data integration is a nontrivial task due to the heterogeneous nature of the different data sources and their variable accuracy and completeness. The presence of correlations between data sources also adds another layer of complexity to the integration process. In this chapter we discuss an approach for constructing a human FLN from data integration and a subsequent application of the FLN to novel disease gene discovery. Similar approaches can be applied to nonhuman species and other discovery tasks.

  2. Localizing genes using linkage disequilibrium in plants: integrating ...

    African Journals Online (AJOL)

    GREGO

    2007-03-19

    Mar 19, 2007 ... Localizing genes using linkage disequilibrium in plants: integrating lessons ... reduce that association as a function of the marker distance from the QTL. ..... the gene locus enhanced the resolution power of asso- ciation tests .... agents, such as insects, birds, water and wind, so mating is determined by a ...

  3. An integrative approach to inferring biologically meaningful gene modules

    Directory of Open Access Journals (Sweden)

    Wang Kai

    2011-07-01

    Full Text Available Abstract Background The ability to construct biologically meaningful gene networks and modules is critical for contemporary systems biology. Though recent studies have demonstrated the power of using gene modules to shed light on the functioning of complex biological systems, most modules in these networks have shown little association with meaningful biological function. We have devised a method which directly incorporates gene ontology (GO annotation in construction of gene modules in order to gain better functional association. Results We have devised a method, Semantic Similarity-Integrated approach for Modularization (SSIM that integrates various gene-gene pairwise similarity values, including information obtained from gene expression, protein-protein interactions and GO annotations, in the construction of modules using affinity propagation clustering. We demonstrated the performance of the proposed method using data from two complex biological responses: 1. the osmotic shock response in Saccharomyces cerevisiae, and 2. the prion-induced pathogenic mouse model. In comparison with two previously reported algorithms, modules identified by SSIM showed significantly stronger association with biological functions. Conclusions The incorporation of semantic similarity based on GO annotation with gene expression and protein-protein interaction data can greatly enhance the functional relevance of inferred gene modules. In addition, the SSIM approach can also reveal the hierarchical structure of gene modules to gain a broader functional view of the biological system. Hence, the proposed method can facilitate comprehensive and in-depth analysis of high throughput experimental data at the gene network level.

  4. Integration of biological networks and gene expression data using Cytoscape

    DEFF Research Database (Denmark)

    Cline, M.S.; Smoot, M.; Cerami, E.

    2007-01-01

    of an interaction network obtained for genes of interest. Five major steps are described: (i) obtaining a gene or protein network, (ii) displaying the network using layout algorithms, (iii) integrating with gene expression and other functional attributes, (iv) identifying putative complexes and functional modules......Cytoscape is a free software package for visualizing, modeling and analyzing molecular and genetic interaction networks. This protocol explains how to use Cytoscape to analyze the results of mRNA expression profiling, and other functional genomics and proteomics experiments, in the context...... and (v) identifying enriched Gene Ontology annotations in the network. These steps provide a broad sample of the types of analyses performed by Cytoscape....

  5. Gastric Cancer Associated Genes Identified by an Integrative Analysis of Gene Expression Data

    Directory of Open Access Journals (Sweden)

    Bing Jiang

    2017-01-01

    Full Text Available Gastric cancer is one of the most severe complex diseases with high morbidity and mortality in the world. The molecular mechanisms and risk factors for this disease are still not clear since the cancer heterogeneity caused by different genetic and environmental factors. With more and more expression data accumulated nowadays, we can perform integrative analysis for these data to understand the complexity of gastric cancer and to identify consensus players for the heterogeneous cancer. In the present work, we screened the published gene expression data and analyzed them with integrative tool, combined with pathway and gene ontology enrichment investigation. We identified several consensus differentially expressed genes and these genes were further confirmed with literature mining; at last, two genes, that is, immunoglobulin J chain and C-X-C motif chemokine ligand 17, were screened as novel gastric cancer associated genes. Experimental validation is proposed to further confirm this finding.

  6. Gene2Function: An Integrated Online Resource for Gene Function Discovery

    Directory of Open Access Journals (Sweden)

    Yanhui Hu

    2017-08-01

    Full Text Available One of the most powerful ways to develop hypotheses regarding the biological functions of conserved genes in a given species, such as humans, is to first look at what is known about their function in another species. Model organism databases and other resources are rich with functional information but difficult to mine. Gene2Function addresses a broad need by integrating information about conserved genes in a single online resource.

  7. Mining disease genes using integrated protein-protein interaction and gene-gene co-regulation information.

    Science.gov (United States)

    Li, Jin; Wang, Limei; Guo, Maozu; Zhang, Ruijie; Dai, Qiguo; Liu, Xiaoyan; Wang, Chunyu; Teng, Zhixia; Xuan, Ping; Zhang, Mingming

    2015-01-01

    In humans, despite the rapid increase in disease-associated gene discovery, a large proportion of disease-associated genes are still unknown. Many network-based approaches have been used to prioritize disease genes. Many networks, such as the protein-protein interaction (PPI), KEGG, and gene co-expression networks, have been used. Expression quantitative trait loci (eQTLs) have been successfully applied for the determination of genes associated with several diseases. In this study, we constructed an eQTL-based gene-gene co-regulation network (GGCRN) and used it to mine for disease genes. We adopted the random walk with restart (RWR) algorithm to mine for genes associated with Alzheimer disease. Compared to the Human Protein Reference Database (HPRD) PPI network alone, the integrated HPRD PPI and GGCRN networks provided faster convergence and revealed new disease-related genes. Therefore, using the RWR algorithm for integrated PPI and GGCRN is an effective method for disease-associated gene mining.

  8. Integrated olfactory receptor and microarray gene expression databases

    Directory of Open Access Journals (Sweden)

    Crasto Chiquito J

    2007-06-01

    Full Text Available Abstract Background Gene expression patterns of olfactory receptors (ORs are an important component of the signal encoding mechanism in the olfactory system since they determine the interactions between odorant ligands and sensory neurons. We have developed the Olfactory Receptor Microarray Database (ORMD to house OR gene expression data. ORMD is integrated with the Olfactory Receptor Database (ORDB, which is a key repository of OR gene information. Both databases aim to aid experimental research related to olfaction. Description ORMD is a Web-accessible database that provides a secure data repository for OR microarray experiments. It contains both publicly available and private data; accessing the latter requires authenticated login. The ORMD is designed to allow users to not only deposit gene expression data but also manage their projects/experiments. For example, contributors can choose whether to make their datasets public. For each experiment, users can download the raw data files and view and export the gene expression data. For each OR gene being probed in a microarray experiment, a hyperlink to that gene in ORDB provides access to genomic and proteomic information related to the corresponding olfactory receptor. Individual ORs archived in ORDB are also linked to ORMD, allowing users access to the related microarray gene expression data. Conclusion ORMD serves as a data repository and project management system. It facilitates the study of microarray experiments of gene expression in the olfactory system. In conjunction with ORDB, ORMD integrates gene expression data with the genomic and functional data of ORs, and is thus a useful resource for both olfactory researchers and the public.

  9. Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library

    Directory of Open Access Journals (Sweden)

    Eddy Edward M

    2007-07-01

    Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.

  10. Constructing an integrated gene similarity network for the identification of disease genes.

    Science.gov (United States)

    Tian, Zhen; Guo, Maozu; Wang, Chunyu; Xing, LinLin; Wang, Lei; Zhang, Yin

    2017-09-20

    Discovering novel genes that are involved human diseases is a challenging task in biomedical research. In recent years, several computational approaches have been proposed to prioritize candidate disease genes. Most of these methods are mainly based on protein-protein interaction (PPI) networks. However, since these PPI networks contain false positives and only cover less half of known human genes, their reliability and coverage are very low. Therefore, it is highly necessary to fuse multiple genomic data to construct a credible gene similarity network and then infer disease genes on the whole genomic scale. We proposed a novel method, named RWRB, to infer causal genes of interested diseases. First, we construct five individual gene (protein) similarity networks based on multiple genomic data of human genes. Then, an integrated gene similarity network (IGSN) is reconstructed based on similarity network fusion (SNF) method. Finally, we employee the random walk with restart algorithm on the phenotype-gene bilayer network, which combines phenotype similarity network, IGSN as well as phenotype-gene association network, to prioritize candidate disease genes. We investigate the effectiveness of RWRB through leave-one-out cross-validation methods in inferring phenotype-gene relationships. Results show that RWRB is more accurate than state-of-the-art methods on most evaluation metrics. Further analysis shows that the success of RWRB is benefited from IGSN which has a wider coverage and higher reliability comparing with current PPI networks. Moreover, we conduct a comprehensive case study for Alzheimer's disease and predict some novel disease genes that supported by literature. RWRB is an effective and reliable algorithm in prioritizing candidate disease genes on the genomic scale. Software and supplementary information are available at http://nclab.hit.edu.cn/~tianzhen/RWRB/ .

  11. Expression profiles of variation integration genes in bladder urothelial carcinoma.

    Science.gov (United States)

    Wang, J M; Wang, Y Q; Gao, Z L; Wu, J T; Shi, B K; Yu, C C

    2014-04-30

    Bladder cancer is a common cancer worldwide and its incidence continues to increase. There are approximately 261,000 cases of bladder cancer resulting in 115,000 deaths annually. This study aimed to integrate bladder cancer genome copy number variation information and bladder cancer gene transcription level expression data to construct a causal-target module network of the range of bladder cancer-related genomes. Here, we explored the control mechanism underlying bladder cancer phenotype expression regulation by the major bladder cancer genes. We selected 22 modules as the initial module network to expand the search to screen more networks. After bootstrapping 100 times, we obtained 16 key regulators. These 16 key candidate regulatory genes were further expanded to identify the expression changes of 11,676 genes in 275 modules, which may all have the same regulation. In conclusion, a series of modules associated with the terms 'cancer' or 'bladder' were considered to constitute a potential network.

  12. Annotating novel genes by integrating synthetic lethals and genomic information

    Directory of Open Access Journals (Sweden)

    Faty Mahamadou

    2008-01-01

    Full Text Available Abstract Background Large scale screening for synthetic lethality serves as a common tool in yeast genetics to systematically search for genes that play a role in specific biological processes. Often the amounts of data resulting from a single large scale screen far exceed the capacities of experimental characterization of every identified target. Thus, there is need for computational tools that select promising candidate genes in order to reduce the number of follow-up experiments to a manageable size. Results We analyze synthetic lethality data for arp1 and jnm1, two spindle migration genes, in order to identify novel members in this process. To this end, we use an unsupervised statistical method that integrates additional information from biological data sources, such as gene expression, phenotypic profiling, RNA degradation and sequence similarity. Different from existing methods that require large amounts of synthetic lethal data, our method merely relies on synthetic lethality information from two single screens. Using a Multivariate Gaussian Mixture Model, we determine the best subset of features that assign the target genes to two groups. The approach identifies a small group of genes as candidates involved in spindle migration. Experimental testing confirms the majority of our candidates and we present she1 (YBL031W as a novel gene involved in spindle migration. We applied the statistical methodology also to TOR2 signaling as another example. Conclusion We demonstrate the general use of Multivariate Gaussian Mixture Modeling for selecting candidate genes for experimental characterization from synthetic lethality data sets. For the given example, integration of different data sources contributes to the identification of genetic interaction partners of arp1 and jnm1 that play a role in the same biological process.

  13. Data Integration for Microarrays: Enhanced Inference for Gene Regulatory Networks

    Directory of Open Access Journals (Sweden)

    Alina Sîrbu

    2015-05-01

    Full Text Available Microarray technologies have been the basis of numerous important findings regarding gene expression in the few last decades. Studies have generated large amounts of data describing various processes, which, due to the existence of public databases, are widely available for further analysis. Given their lower cost and higher maturity compared to newer sequencing technologies, these data continue to be produced, even though data quality has been the subject of some debate. However, given the large volume of data generated, integration can help overcome some issues related, e.g., to noise or reduced time resolution, while providing additional insight on features not directly addressed by sequencing methods. Here, we present an integration test case based on public Drosophila melanogaster datasets (gene expression, binding site affinities, known interactions. Using an evolutionary computation framework, we show how integration can enhance the ability to recover transcriptional gene regulatory networks from these data, as well as indicating which data types are more important for quantitative and qualitative network inference. Our results show a clear improvement in performance when multiple datasets are integrated, indicating that microarray data will remain a valuable and viable resource for some time to come.

  14. Data Integration for Microarrays: Enhanced Inference for Gene Regulatory Networks.

    Science.gov (United States)

    Sîrbu, Alina; Crane, Martin; Ruskin, Heather J

    2015-05-14

    Microarray technologies have been the basis of numerous important findings regarding gene expression in the few last decades. Studies have generated large amounts of data describing various processes, which, due to the existence of public databases, are widely available for further analysis. Given their lower cost and higher maturity compared to newer sequencing technologies, these data continue to be produced, even though data quality has been the subject of some debate. However, given the large volume of data generated, integration can help overcome some issues related, e.g., to noise or reduced time resolution, while providing additional insight on features not directly addressed by sequencing methods. Here, we present an integration test case based on public Drosophila melanogaster datasets (gene expression, binding site affinities, known interactions). Using an evolutionary computation framework, we show how integration can enhance the ability to recover transcriptional gene regulatory networks from these data, as well as indicating which data types are more important for quantitative and qualitative network inference. Our results show a clear improvement in performance when multiple datasets are integrated, indicating that microarray data will remain a valuable and viable resource for some time to come.

  15. Integrating mean and variance heterogeneities to identify differentially expressed genes.

    Science.gov (United States)

    Ouyang, Weiwei; An, Qiang; Zhao, Jinying; Qin, Huaizhen

    2016-12-06

    In functional genomics studies, tests on mean heterogeneity have been widely employed to identify differentially expressed genes with distinct mean expression levels under different experimental conditions. Variance heterogeneity (aka, the difference between condition-specific variances) of gene expression levels is simply neglected or calibrated for as an impediment. The mean heterogeneity in the expression level of a gene reflects one aspect of its distribution alteration; and variance heterogeneity induced by condition change may reflect another aspect. Change in condition may alter both mean and some higher-order characteristics of the distributions of expression levels of susceptible genes. In this report, we put forth a conception of mean-variance differentially expressed (MVDE) genes, whose expression means and variances are sensitive to the change in experimental condition. We mathematically proved the null independence of existent mean heterogeneity tests and variance heterogeneity tests. Based on the independence, we proposed an integrative mean-variance test (IMVT) to combine gene-wise mean heterogeneity and variance heterogeneity induced by condition change. The IMVT outperformed its competitors under comprehensive simulations of normality and Laplace settings. For moderate samples, the IMVT well controlled type I error rates, and so did existent mean heterogeneity test (i.e., the Welch t test (WT), the moderated Welch t test (MWT)) and the procedure of separate tests on mean and variance heterogeneities (SMVT), but the likelihood ratio test (LRT) severely inflated type I error rates. In presence of variance heterogeneity, the IMVT appeared noticeably more powerful than all the valid mean heterogeneity tests. Application to the gene profiles of peripheral circulating B raised solid evidence of informative variance heterogeneity. After adjusting for background data structure, the IMVT replicated previous discoveries and identified novel experiment

  16. DAVID Knowledgebase: a gene-centered database integrating heterogeneous gene annotation resources to facilitate high-throughput gene functional analysis

    Directory of Open Access Journals (Sweden)

    Baseler Michael W

    2007-11-01

    Full Text Available Abstract Background Due to the complex and distributed nature of biological research, our current biological knowledge is spread over many redundant annotation databases maintained by many independent groups. Analysts usually need to visit many of these bioinformatics databases in order to integrate comprehensive annotation information for their genes, which becomes one of the bottlenecks, particularly for the analytic task associated with a large gene list. Thus, a highly centralized and ready-to-use gene-annotation knowledgebase is in demand for high throughput gene functional analysis. Description The DAVID Knowledgebase is built around the DAVID Gene Concept, a single-linkage method to agglomerate tens of millions of gene/protein identifiers from a variety of public genomic resources into DAVID gene clusters. The grouping of such identifiers improves the cross-reference capability, particularly across NCBI and UniProt systems, enabling more than 40 publicly available functional annotation sources to be comprehensively integrated and centralized by the DAVID gene clusters. The simple, pair-wise, text format files which make up the DAVID Knowledgebase are freely downloadable for various data analysis uses. In addition, a well organized web interface allows users to query different types of heterogeneous annotations in a high-throughput manner. Conclusion The DAVID Knowledgebase is designed to facilitate high throughput gene functional analysis. For a given gene list, it not only provides the quick accessibility to a wide range of heterogeneous annotation data in a centralized location, but also enriches the level of biological information for an individual gene. Moreover, the entire DAVID Knowledgebase is freely downloadable or searchable at http://david.abcc.ncifcrf.gov/knowledgebase/.

  17. Identifying candidate driver genes by integrative ovarian cancer genomics data

    Science.gov (United States)

    Lu, Xinguo; Lu, Jibo

    2017-08-01

    Integrative analysis of molecular mechanics underlying cancer can distinguish interactions that cannot be revealed based on one kind of data for the appropriate diagnosis and treatment of cancer patients. Tumor samples exhibit heterogeneity in omics data, such as somatic mutations, Copy Number Variations CNVs), gene expression profiles and so on. In this paper we combined gene co-expression modules and mutation modulators separately in tumor patients to obtain the candidate driver genes for resistant and sensitive tumor from the heterogeneous data. The final list of modulators identified are well known in biological processes associated with ovarian cancer, such as CCL17, CACTIN, CCL16, CCL22, APOB, KDF1, CCL11, HNF1B, LRG1, MED1 and so on, which can help to facilitate the discovery of biomarkers, molecular diagnostics, and drug discovery.

  18. Hepatitis B virus DNA integration and transactivation of cellular genes

    Directory of Open Access Journals (Sweden)

    Vijay Kumar

    2007-02-01

    Full Text Available

    Chronic hepatitis B virus (HBV infection is etiologically related to human hepatocellular carcinoma (HCC. Most HCCs contain integrated HBV DNA in hepatocyte, suggesting that the integration may be involved in carcinogenesis. Available data on the integrants from human hepatocellular carcinomas seem to represent primary integrants as well as the products of secondary rearrangements. By means of structural analyses of the possible primary integrants, it has been observed that the replication intermediates of the viral genome are the preferred substrates for integration. The integrated HBV DNA and the target cellular DNA are invariably associated with deletions, possibly reflecting the substrate for, and the mechanism of, the integration reaction. The host DNA sequences as well as the target site of integration in chromosomes are selected randomly suggesting that HBV DNA integration should bring about random mutagenic effects. Analysis of the samples recovered from hepatocellular carcinomas show that the integrated HBV DNA can mediate secondary rearrangements of chromosomes, such as translocations, inversions, deletions and (possibly amplifications. The integration of HBV DNA into the host genome occurs at early steps of clonal tumor expansion. The integration has been shown in a number of cases to affect a variety of cancer-related genes and to exert insertional mutagenesis. However, in contrast to the woodchuck model, in which specific HBV-DNA integration is detectable in most cases, insertional activation or inactivation of cellular genes appears to be a rare event in man. The discovery of transactivating functions exerted by HBx and truncated HBs(urface proteins supports the notion that these could be relevant to hepatocarcinogenesis as these transactivator sequences have been found in a large number of HCC tumors or hepatoma-derived cell lines. The HBx

  19. Interspecific gene flow and maintenance of species integrity in oaks

    Directory of Open Access Journals (Sweden)

    Oliver Gailing

    2014-07-01

    Full Text Available Oak species show a wide variation in morphological and physiological characters, and species boundaries between closely related species are often not clear-cut. Still, despite frequent interspecific gene flow, oaks maintain distinct morphological and physiological adaptations. In sympatric stands, spatial distribution of species with different ecological requirements is not random but constrained by soil and other microenvironmental factors. Pre-zygotic isolation (e.g. cross incompatibilities, asynchrony in flowering, pollen competition and post-zygotic isolation (divergent selection contribute to the maintenance of species integrity in sympatric oak stands. The antagonistic effects of interspecific gene flow and divergent selection are reflected in the low genetic differentiation between hybridizing oak species at most genomic regions interspersed by regions with signatures of divergent selection (outlier regions. In the near future, the availability of high-density genetic linkage maps anchored to scaffolds of a sequenced Q. robur genome will allow to characterize the underlying genes in these outlier regions and their putative role in reproductive isolation between species. Reciprocal transplant experiments of seedlings between parental environments can be used to characterize selection on outlier genes. High transferability of gene-based markers will enable comparative outlier screens in different oak species.

  20. Integrative sparse principal component analysis of gene expression data.

    Science.gov (United States)

    Liu, Mengque; Fan, Xinyan; Fang, Kuangnan; Zhang, Qingzhao; Ma, Shuangge

    2017-12-01

    In the analysis of gene expression data, dimension reduction techniques have been extensively adopted. The most popular one is perhaps the PCA (principal component analysis). To generate more reliable and more interpretable results, the SPCA (sparse PCA) technique has been developed. With the "small sample size, high dimensionality" characteristic of gene expression data, the analysis results generated from a single dataset are often unsatisfactory. Under contexts other than dimension reduction, integrative analysis techniques, which jointly analyze the raw data of multiple independent datasets, have been developed and shown to outperform "classic" meta-analysis and other multidatasets techniques and single-dataset analysis. In this study, we conduct integrative analysis by developing the iSPCA (integrative SPCA) method. iSPCA achieves the selection and estimation of sparse loadings using a group penalty. To take advantage of the similarity across datasets and generate more accurate results, we further impose contrasted penalties. Different penalties are proposed to accommodate different data conditions. Extensive simulations show that iSPCA outperforms the alternatives under a wide spectrum of settings. The analysis of breast cancer and pancreatic cancer data further shows iSPCA's satisfactory performance. © 2017 WILEY PERIODICALS, INC.

  1. Developing integrated crop knowledge networks to advance candidate gene discovery.

    Science.gov (United States)

    Hassani-Pak, Keywan; Castellote, Martin; Esch, Maria; Hindle, Matthew; Lysenko, Artem; Taubert, Jan; Rawlings, Christopher

    2016-12-01

    The chances of raising crop productivity to enhance global food security would be greatly improved if we had a complete understanding of all the biological mechanisms that underpinned traits such as crop yield, disease resistance or nutrient and water use efficiency. With more crop genomes emerging all the time, we are nearer having the basic information, at the gene-level, to begin assembling crop gene catalogues and using data from other plant species to understand how the genes function and how their interactions govern crop development and physiology. Unfortunately, the task of creating such a complete knowledge base of gene functions, interaction networks and trait biology is technically challenging because the relevant data are dispersed in myriad databases in a variety of data formats with variable quality and coverage. In this paper we present a general approach for building genome-scale knowledge networks that provide a unified representation of heterogeneous but interconnected datasets to enable effective knowledge mining and gene discovery. We describe the datasets and outline the methods, workflows and tools that we have developed for creating and visualising these networks for the major crop species, wheat and barley. We present the global characteristics of such knowledge networks and with an example linking a seed size phenotype to a barley WRKY transcription factor orthologous to TTG2 from Arabidopsis, we illustrate the value of integrated data in biological knowledge discovery. The software we have developed (www.ondex.org) and the knowledge resources (http://knetminer.rothamsted.ac.uk) we have created are all open-source and provide a first step towards systematic and evidence-based gene discovery in order to facilitate crop improvement.

  2. Functional Module Analysis for Gene Coexpression Networks with Network Integration.

    Science.gov (United States)

    Zhang, Shuqin; Zhao, Hongyu; Ng, Michael K

    2015-01-01

    Network has been a general tool for studying the complex interactions between different genes, proteins, and other small molecules. Module as a fundamental property of many biological networks has been widely studied and many computational methods have been proposed to identify the modules in an individual network. However, in many cases, a single network is insufficient for module analysis due to the noise in the data or the tuning of parameters when building the biological network. The availability of a large amount of biological networks makes network integration study possible. By integrating such networks, more informative modules for some specific disease can be derived from the networks constructed from different tissues, and consistent factors for different diseases can be inferred. In this paper, we have developed an effective method for module identification from multiple networks under different conditions. The problem is formulated as an optimization model, which combines the module identification in each individual network and alignment of the modules from different networks together. An approximation algorithm based on eigenvector computation is proposed. Our method outperforms the existing methods, especially when the underlying modules in multiple networks are different in simulation studies. We also applied our method to two groups of gene coexpression networks for humans, which include one for three different cancers, and one for three tissues from the morbidly obese patients. We identified 13 modules with three complete subgraphs, and 11 modules with two complete subgraphs, respectively. The modules were validated through Gene Ontology enrichment and KEGG pathway enrichment analysis. We also showed that the main functions of most modules for the corresponding disease have been addressed by other researchers, which may provide the theoretical basis for further studying the modules experimentally.

  3. An extensive analysis of disease-gene associations using network integration and fast kernel-based gene prioritization methods.

    Science.gov (United States)

    Valentini, Giorgio; Paccanaro, Alberto; Caniza, Horacio; Romero, Alfonso E; Re, Matteo

    2014-06-01

    In the context of "network medicine", gene prioritization methods represent one of the main tools to discover candidate disease genes by exploiting the large amount of data covering different types of functional relationships between genes. Several works proposed to integrate multiple sources of data to improve disease gene prioritization, but to our knowledge no systematic studies focused on the quantitative evaluation of the impact of network integration on gene prioritization. In this paper, we aim at providing an extensive analysis of gene-disease associations not limited to genetic disorders, and a systematic comparison of different network integration methods for gene prioritization. We collected nine different functional networks representing different functional relationships between genes, and we combined them through both unweighted and weighted network integration methods. We then prioritized genes with respect to each of the considered 708 medical subject headings (MeSH) diseases by applying classical guilt-by-association, random walk and random walk with restart algorithms, and the recently proposed kernelized score functions. The results obtained with classical random walk algorithms and the best single network achieved an average area under the curve (AUC) across the 708 MeSH diseases of about 0.82, while kernelized score functions and network integration boosted the average AUC to about 0.89. Weighted integration, by exploiting the different "informativeness" embedded in different functional networks, outperforms unweighted integration at 0.01 significance level, according to the Wilcoxon signed rank sum test. For each MeSH disease we provide the top-ranked unannotated candidate genes, available for further bio-medical investigation. Network integration is necessary to boost the performances of gene prioritization methods. Moreover the methods based on kernelized score functions can further enhance disease gene ranking results, by adopting both

  4. An extensive analysis of disease-gene associations using network integration and fast kernel-based gene prioritization methods

    Science.gov (United States)

    Valentini, Giorgio; Paccanaro, Alberto; Caniza, Horacio; Romero, Alfonso E.; Re, Matteo

    2014-01-01

    Objective In the context of “network medicine”, gene prioritization methods represent one of the main tools to discover candidate disease genes by exploiting the large amount of data covering different types of functional relationships between genes. Several works proposed to integrate multiple sources of data to improve disease gene prioritization, but to our knowledge no systematic studies focused on the quantitative evaluation of the impact of network integration on gene prioritization. In this paper, we aim at providing an extensive analysis of gene-disease associations not limited to genetic disorders, and a systematic comparison of different network integration methods for gene prioritization. Materials and methods We collected nine different functional networks representing different functional relationships between genes, and we combined them through both unweighted and weighted network integration methods. We then prioritized genes with respect to each of the considered 708 medical subject headings (MeSH) diseases by applying classical guilt-by-association, random walk and random walk with restart algorithms, and the recently proposed kernelized score functions. Results The results obtained with classical random walk algorithms and the best single network achieved an average area under the curve (AUC) across the 708 MeSH diseases of about 0.82, while kernelized score functions and network integration boosted the average AUC to about 0.89. Weighted integration, by exploiting the different “informativeness” embedded in different functional networks, outperforms unweighted integration at 0.01 significance level, according to the Wilcoxon signed rank sum test. For each MeSH disease we provide the top-ranked unannotated candidate genes, available for further bio-medical investigation. Conclusions Network integration is necessary to boost the performances of gene prioritization methods. Moreover the methods based on kernelized score functions can further

  5. Identification of pathogenic genes related to rheumatoid arthritis through integrated analysis of DNA methylation and gene expression profiling.

    Science.gov (United States)

    Zhang, Lei; Ma, Shiyun; Wang, Huailiang; Su, Hang; Su, Ke; Li, Longjie

    2017-11-15

    The purpose of our study was to identify new pathogenic genes used for exploring the pathogenesis of rheumatoid arthritis (RA). To screen pathogenic genes of RA, an integrated analysis was performed by using the microarray datasets in RA derived from the Gene Expression Omnibus (GEO) database. The functional annotation and potential pathways of differentially expressed genes (DEGs) were further discovered by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. Afterwards, the integrated analysis of DNA methylation and gene expression profiling was used to screen crucial genes. In addition, we used RT-PCR and MSP to verify the expression levels and methylation status of these crucial genes in 20 synovial biopsy samples obtained from 10 RA model mice and 10 normal mice. BCL11B, CCDC88C, FCRLA and APOL6 were both up-regulated and hypomethylated in RA according to integrated analysis, RT-PCR and MSP verification. Four crucial genes (BCL11B, CCDC88C, FCRLA and APOL6) identified and analyzed in this study might be closely connected with the pathogenesis of RA. Copyright © 2017. Published by Elsevier B.V.

  6. The Integrative Method Based on the Module-Network for Identifying Driver Genes in Cancer Subtypes

    Directory of Open Access Journals (Sweden)

    Xinguo Lu

    2018-01-01

    Full Text Available With advances in next-generation sequencing(NGS technologies, a large number of multiple types of high-throughput genomics data are available. A great challenge in exploring cancer progression is to identify the driver genes from the variant genes by analyzing and integrating multi-types genomics data. Breast cancer is known as a heterogeneous disease. The identification of subtype-specific driver genes is critical to guide the diagnosis, assessment of prognosis and treatment of breast cancer. We developed an integrated frame based on gene expression profiles and copy number variation (CNV data to identify breast cancer subtype-specific driver genes. In this frame, we employed statistical machine-learning method to select gene subsets and utilized an module-network analysis method to identify potential candidate driver genes. The final subtype-specific driver genes were acquired by paired-wise comparison in subtypes. To validate specificity of the driver genes, the gene expression data of these genes were applied to classify the patient samples with 10-fold cross validation and the enrichment analysis were also conducted on the identified driver genes. The experimental results show that the proposed integrative method can identify the potential driver genes and the classifier with these genes acquired better performance than with genes identified by other methods.

  7. Molecular Assemblies, Genes and Genomics Integrated Efficiently (MAGGIE)

    Energy Technology Data Exchange (ETDEWEB)

    Baliga, Nitin S

    2011-05-26

    when applied to the manually curated training set. Applying this method to the data representing around a quarter of the fraction space for water soluble proteins in D. vulgaris, we obtained 854 reliable pair wise interactions. Further, we have developed algorithms to analyze and assign significance to protein interaction data from bait pull-down experiments and integrate these data with other systems biology data through associative biclustering in a parallel computing environment. We will 'fill-in' missing information in these interaction data using a 'Transitive Closure' algorithm and subsequently use 'Between Commonality Decomposition' algorithm to discover complexes within these large graphs of protein interactions. To characterize the metabolic activities of proteins and their complexes we are developing algorithms to deconvolute pure mass spectra, estimate chemical formula for m/z values, and fit isotopic fine structure to metabolomics data. We have discovered that in comparison to isotopic pattern fitting methods restricting the chemical formula by these two dimensions actually facilitates unique solutions for chemical formula generators. To understand how microbial functions are regulated we have developed complementary algorithms for reconstructing gene regulatory networks (GRNs). Whereas the network inference algorithms cMonkey and Inferelator developed enable de novo reconstruction of predictive models for GRNs from diverse systems biology data, the RegPrecise and RegPredict framework developed uses evolutionary comparisons of genomes from closely related organisms to reconstruct conserved regulons. We have integrated the two complementary algorithms to rapidly generate comprehensive models for gene regulation of understudied organisms. Our preliminary analyses of these reconstructed GRNs have revealed novel regulatory mechanisms and cis-regulatory motifs, as well asothers that are conserved across species. Finally, we are

  8. Markerless gene knockout and integration to express heterologous biosynthetic gene clusters in Pseudomonas putida

    DEFF Research Database (Denmark)

    Choi, Kyeong Rok; Cho, Jae Sung; Cho, In Jin

    2018-01-01

    Pseudomonas putida has gained much interest among metabolic engineers as a workhorse for producing valuable natural products. While a few gene knockout tools for P. putida have been reported, integration of heterologous genes into the chromosome of P. putida, an essential strategy to develop stable...... plasmid curing systems, generating final strains free of antibiotic markers and plasmids. This markerless recombineering system for efficient gene knockout and integration will expedite metabolic engineering of P. putida, a bacterial host strain of increasing academic and industrial interest....

  9. The integration of weighted gene association networks based on information entropy.

    Science.gov (United States)

    Yang, Fan; Wu, Duzhi; Lin, Limei; Yang, Jian; Yang, Tinghong; Zhao, Jing

    2017-01-01

    Constructing genome scale weighted gene association networks (WGAN) from multiple data sources is one of research hot spots in systems biology. In this paper, we employ information entropy to describe the uncertain degree of gene-gene links and propose a strategy for data integration of weighted networks. We use this method to integrate four existing human weighted gene association networks and construct a much larger WGAN, which includes richer biology information while still keeps high functional relevance between linked gene pairs. The new WGAN shows satisfactory performance in disease gene prediction, which suggests the reliability of our integration strategy. Compared with existing integration methods, our method takes the advantage of the inherent characteristics of the component networks and pays less attention to the biology background of the data. It can make full use of existing biological networks with low computational effort.

  10. Floral pathway integrator gene expression mediates gradual transmission of environmental and endogenous cues to flowering time.

    Science.gov (United States)

    van Dijk, Aalt D J; Molenaar, Jaap

    2017-01-01

    The appropriate timing of flowering is crucial for the reproductive success of plants. Hence, intricate genetic networks integrate various environmental and endogenous cues such as temperature or hormonal statues. These signals integrate into a network of floral pathway integrator genes. At a quantitative level, it is currently unclear how the impact of genetic variation in signaling pathways on flowering time is mediated by floral pathway integrator genes. Here, using datasets available from literature, we connect Arabidopsis thaliana flowering time in genetic backgrounds varying in upstream signalling components with the expression levels of floral pathway integrator genes in these genetic backgrounds. Our modelling results indicate that flowering time depends in a quite linear way on expression levels of floral pathway integrator genes. This gradual, proportional response of flowering time to upstream changes enables a gradual adaptation to changing environmental factors such as temperature and light.

  11. Floral pathway integrator gene expression mediates gradual transmission of environmental and endogenous cues to flowering time

    Directory of Open Access Journals (Sweden)

    Aalt D.J. van Dijk

    2017-04-01

    Full Text Available The appropriate timing of flowering is crucial for the reproductive success of plants. Hence, intricate genetic networks integrate various environmental and endogenous cues such as temperature or hormonal statues. These signals integrate into a network of floral pathway integrator genes. At a quantitative level, it is currently unclear how the impact of genetic variation in signaling pathways on flowering time is mediated by floral pathway integrator genes. Here, using datasets available from literature, we connect Arabidopsis thaliana flowering time in genetic backgrounds varying in upstream signalling components with the expression levels of floral pathway integrator genes in these genetic backgrounds. Our modelling results indicate that flowering time depends in a quite linear way on expression levels of floral pathway integrator genes. This gradual, proportional response of flowering time to upstream changes enables a gradual adaptation to changing environmental factors such as temperature and light.

  12. Dual CRISPR-Cas9 Cleavage Mediated Gene Excision and Targeted Integration in Yarrowia lipolytica.

    Science.gov (United States)

    Gao, Difeng; Smith, Spencer; Spagnuolo, Michael; Rodriguez, Gabriel; Blenner, Mark

    2018-05-29

    CRISPR-Cas9 technology has been successfully applied in Yarrowia lipolytica for targeted genomic editing including gene disruption and integration; however, disruptions by existing methods typically result from small frameshift mutations caused by indels within the coding region, which usually resulted in unnatural protein. In this study, a dual cleavage strategy directed by paired sgRNAs is developed for gene knockout. This method allows fast and robust gene excision, demonstrated on six genes of interest. The targeted regions for excision vary in length from 0.3 kb up to 3.5 kb and contain both non-coding and coding regions. The majority of the gene excisions are repaired by perfect nonhomologous end-joining without indel. Based on this dual cleavage system, two targeted markerless integration methods are developed by providing repair templates. While both strategies are effective, homology mediated end joining (HMEJ) based method are twice as efficient as homology recombination (HR) based method. In both cases, dual cleavage leads to similar or improved gene integration efficiencies compared to gene excision without integration. This dual cleavage strategy will be useful for not only generating more predictable and robust gene knockout, but also for efficient targeted markerless integration, and simultaneous knockout and integration in Y. lipolytica. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  14. Integrative analysis of RUNX1 downstream pathways and target genes

    Directory of Open Access Journals (Sweden)

    Liu Marjorie

    2008-07-01

    Full Text Available Abstract Background The RUNX1 transcription factor gene is frequently mutated in sporadic myeloid and lymphoid leukemia through translocation, point mutation or amplification. It is also responsible for a familial platelet disorder with predisposition to acute myeloid leukemia (FPD-AML. The disruption of the largely unknown biological pathways controlled by RUNX1 is likely to be responsible for the development of leukemia. We have used multiple microarray platforms and bioinformatic techniques to help identify these biological pathways to aid in the understanding of why RUNX1 mutations lead to leukemia. Results Here we report genes regulated either directly or indirectly by RUNX1 based on the study of gene expression profiles generated from 3 different human and mouse platforms. The platforms used were global gene expression profiling of: 1 cell lines with RUNX1 mutations from FPD-AML patients, 2 over-expression of RUNX1 and CBFβ, and 3 Runx1 knockout mouse embryos using either cDNA or Affymetrix microarrays. We observe that our datasets (lists of differentially expressed genes significantly correlate with published microarray data from sporadic AML patients with mutations in either RUNX1 or its cofactor, CBFβ. A number of biological processes were identified among the differentially expressed genes and functional assays suggest that heterozygous RUNX1 point mutations in patients with FPD-AML impair cell proliferation, microtubule dynamics and possibly genetic stability. In addition, analysis of the regulatory regions of the differentially expressed genes has for the first time systematically identified numerous potential novel RUNX1 target genes. Conclusion This work is the first large-scale study attempting to identify the genetic networks regulated by RUNX1, a master regulator in the development of the hematopoietic system and leukemia. The biological pathways and target genes controlled by RUNX1 will have considerable importance in disease

  15. The integration of weighted human gene association networks based on link prediction.

    Science.gov (United States)

    Yang, Jian; Yang, Tinghong; Wu, Duzhi; Lin, Limei; Yang, Fan; Zhao, Jing

    2017-01-31

    Physical and functional interplays between genes or proteins have important biological meaning for cellular functions. Some efforts have been made to construct weighted gene association meta-networks by integrating multiple biological resources, where the weight indicates the confidence of the interaction. However, it is found that these existing human gene association networks share only quite limited overlapped interactions, suggesting their incompleteness and noise. Here we proposed a workflow to construct a weighted human gene association network using information of six existing networks, including two weighted specific PPI networks and four gene association meta-networks. We applied link prediction algorithm to predict possible missing links of the networks, cross-validation approach to refine each network and finally integrated the refined networks to get the final integrated network. The common information among the refined networks increases notably, suggesting their higher reliability. Our final integrated network owns much more links than most of the original networks, meanwhile its links still keep high functional relevance. Being used as background network in a case study of disease gene prediction, the final integrated network presents good performance, implying its reliability and application significance. Our workflow could be insightful for integrating and refining existing gene association data.

  16. Integrative Functional Genomics for Systems Genetics in GeneWeaver.org.

    Science.gov (United States)

    Bubier, Jason A; Langston, Michael A; Baker, Erich J; Chesler, Elissa J

    2017-01-01

    The abundance of existing functional genomics studies permits an integrative approach to interpreting and resolving the results of diverse systems genetics studies. However, a major challenge lies in assembling and harmonizing heterogeneous data sets across species for facile comparison to the positional candidate genes and coexpression networks that come from systems genetic studies. GeneWeaver is an online database and suite of tools at www.geneweaver.org that allows for fast aggregation and analysis of gene set-centric data. GeneWeaver contains curated experimental data together with resource-level data such as GO annotations, MP annotations, and KEGG pathways, along with persistent stores of user entered data sets. These can be entered directly into GeneWeaver or transferred from widely used resources such as GeneNetwork.org. Data are analyzed using statistical tools and advanced graph algorithms to discover new relations, prioritize candidate genes, and generate function hypotheses. Here we use GeneWeaver to find genes common to multiple gene sets, prioritize candidate genes from a quantitative trait locus, and characterize a set of differentially expressed genes. Coupling a large multispecies repository curated and empirical functional genomics data to fast computational tools allows for the rapid integrative analysis of heterogeneous data for interpreting and extrapolating systems genetics results.

  17. Integration of multiple networks and pathways identifies cancer driver genes in pan-cancer analysis.

    Science.gov (United States)

    Cava, Claudia; Bertoli, Gloria; Colaprico, Antonio; Olsen, Catharina; Bontempi, Gianluca; Castiglioni, Isabella

    2018-01-06

    Modern high-throughput genomic technologies represent a comprehensive hallmark of molecular changes in pan-cancer studies. Although different cancer gene signatures have been revealed, the mechanism of tumourigenesis has yet to be completely understood. Pathways and networks are important tools to explain the role of genes in functional genomic studies. However, few methods consider the functional non-equal roles of genes in pathways and the complex gene-gene interactions in a network. We present a novel method in pan-cancer analysis that identifies de-regulated genes with a functional role by integrating pathway and network data. A pan-cancer analysis of 7158 tumour/normal samples from 16 cancer types identified 895 genes with a central role in pathways and de-regulated in cancer. Comparing our approach with 15 current tools that identify cancer driver genes, we found that 35.6% of the 895 genes identified by our method have been found as cancer driver genes with at least 2/15 tools. Finally, we applied a machine learning algorithm on 16 independent GEO cancer datasets to validate the diagnostic role of cancer driver genes for each cancer. We obtained a list of the top-ten cancer driver genes for each cancer considered in this study. Our analysis 1) confirmed that there are several known cancer driver genes in common among different types of cancer, 2) highlighted that cancer driver genes are able to regulate crucial pathways.

  18. Integrative mining of traditional Chinese medicine literature and MEDLINE for functional gene networks.

    Science.gov (United States)

    Zhou, Xuezhong; Liu, Baoyan; Wu, Zhaohui; Feng, Yi

    2007-10-01

    The amount of biomedical data in different disciplines is growing at an exponential rate. Integrating these significant knowledge sources to generate novel hypotheses for systems biology research is difficult. Traditional Chinese medicine (TCM) is a completely different discipline, and is a complementary knowledge system to modern biomedical science. This paper uses a significant TCM bibliographic literature database in China, together with MEDLINE, to help discover novel gene functional knowledge. We present an integrative mining approach to uncover the functional gene relationships from MEDLINE and TCM bibliographic literature. This paper introduces TCM literature (about 50,000 records) as one knowledge source for constructing literature-based gene networks. We use the TCM diagnosis, TCM syndrome, to automatically congregate the related genes. The syndrome-gene relationships are discovered based on the syndrome-disease relationships extracted from TCM literature and the disease-gene relationships in MEDLINE. Based on the bubble-bootstrapping and relation weight computing methods, we have developed a prototype system called MeDisco/3S, which has name entity and relation extraction, and online analytical processing (OLAP) capabilities, to perform the integrative mining process. We have got about 200,000 syndrome-gene relations, which could help generate syndrome-based gene networks, and help analyze the functional knowledge of genes from syndrome perspective. We take the gene network of Kidney-Yang Deficiency syndrome (KYD syndrome) and the functional analysis of some genes, such as CRH (corticotropin releasing hormone), PTH (parathyroid hormone), PRL (prolactin), BRCA1 (breast cancer 1, early onset) and BRCA2 (breast cancer 2, early onset), to demonstrate the preliminary results. The underlying hypothesis is that the related genes of the same syndrome will have some biological functional relationships, and will constitute a functional network. This paper presents

  19. Semantic integration of gene expression analysis tools and data sources using software connectors

    Science.gov (United States)

    2013-01-01

    Background The study and analysis of gene expression measurements is the primary focus of functional genomics. Once expression data is available, biologists are faced with the task of extracting (new) knowledge associated to the underlying biological phenomenon. Most often, in order to perform this task, biologists execute a number of analysis activities on the available gene expression dataset rather than a single analysis activity. The integration of heteregeneous tools and data sources to create an integrated analysis environment represents a challenging and error-prone task. Semantic integration enables the assignment of unambiguous meanings to data shared among different applications in an integrated environment, allowing the exchange of data in a semantically consistent and meaningful way. This work aims at developing an ontology-based methodology for the semantic integration of gene expression analysis tools and data sources. The proposed methodology relies on software connectors to support not only the access to heterogeneous data sources but also the definition of transformation rules on exchanged data. Results We have studied the different challenges involved in the integration of computer systems and the role software connectors play in this task. We have also studied a number of gene expression technologies, analysis tools and related ontologies in order to devise basic integration scenarios and propose a reference ontology for the gene expression domain. Then, we have defined a number of activities and associated guidelines to prescribe how the development of connectors should be carried out. Finally, we have applied the proposed methodology in the construction of three different integration scenarios involving the use of different tools for the analysis of different types of gene expression data. Conclusions The proposed methodology facilitates the development of connectors capable of semantically integrating different gene expression analysis tools

  20. Monitoring single-cell gene regulation under dynamically controllable conditions with integrated microfluidics and software

    NARCIS (Netherlands)

    Kaiser, Matthias; Jug, Florian; Julou, Thomas; Deshpande, S.R.; Pfohl, Thomas; Silander, Olin K.; Myers, Gene; Van Nimwegen, Erik

    2018-01-01

    Much is still not understood about how gene regulatory interactions control cell fate decisions in single cells, in part due to the difficulty of directly observing gene regulatory processes in vivo. We introduce here a novel integrated setup consisting of a microfluidic chip and accompanying

  1. ICan: an integrated co-alteration network to identify ovarian cancer-related genes.

    Science.gov (United States)

    Zhou, Yuanshuai; Liu, Yongjing; Li, Kening; Zhang, Rui; Qiu, Fujun; Zhao, Ning; Xu, Yan

    2015-01-01

    Over the last decade, an increasing number of integrative studies on cancer-related genes have been published. Integrative analyses aim to overcome the limitation of a single data type, and provide a more complete view of carcinogenesis. The vast majority of these studies used sample-matched data of gene expression and copy number to investigate the impact of copy number alteration on gene expression, and to predict and prioritize candidate oncogenes and tumor suppressor genes. However, correlations between genes were neglected in these studies. Our work aimed to evaluate the co-alteration of copy number, methylation and expression, allowing us to identify cancer-related genes and essential functional modules in cancer. We built the Integrated Co-alteration network (ICan) based on multi-omics data, and analyzed the network to uncover cancer-related genes. After comparison with random networks, we identified 155 ovarian cancer-related genes, including well-known (TP53, BRCA1, RB1 and PTEN) and also novel cancer-related genes, such as PDPN and EphA2. We compared the results with a conventional method: CNAmet, and obtained a significantly better area under the curve value (ICan: 0.8179, CNAmet: 0.5183). In this paper, we describe a framework to find cancer-related genes based on an Integrated Co-alteration network. Our results proved that ICan could precisely identify candidate cancer genes and provide increased mechanistic understanding of carcinogenesis. This work suggested a new research direction for biological network analyses involving multi-omics data.

  2. EasyClone: method for iterative chromosomal integration of multiple genes in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Jensen, Niels Bjerg; Strucko, Tomas; Kildegaard, Kanchana Rueksomtawin

    2014-01-01

    of multiple genes with an option of recycling selection markers. The vectors combine the advantage of efficient uracil excision reaction-based cloning and Cre-LoxP-mediated marker recycling system. The episomal and integrative vector sets were tested by inserting genes encoding cyan, yellow, and red...... fluorescent proteins into separate vectors and analyzing for co-expression of proteins by flow cytometry. Cells expressing genes encoding for the three fluorescent proteins from three integrations exhibited a much higher level of simultaneous expression than cells producing fluorescent proteins encoded...... on episomal plasmids, where correspondingly 95% and 6% of the cells were within a fluorescence interval of Log10 mean ± 15% for all three colors. We demonstrate that selective markers can be simultaneously removed using Cre-mediated recombination and all the integrated heterologous genes remain...

  3. Systematic identification and integrative analysis of novel genes expressed specifically or predominantly in mouse epididymis

    Directory of Open Access Journals (Sweden)

    Lee Hoyong

    2006-12-01

    Full Text Available Abstract Background Maturation of spermatozoa, including development of motility and the ability to fertilize the oocyte, occurs during transit through the microenvironment of the epididymis. Comprehensive understanding of sperm maturation requires identification and characterization of unique genes expressed in the epididymis. Results We systematically identified 32 novel genes with epididymis-specific or -predominant expression in the mouse epididymis UniGene library, containing 1505 gene-oriented transcript clusters, by in silico and in vitro analyses. The Northern blot analysis revealed various characteristics of the genes at the transcript level, such as expression level, size and the presence of isoform. We found that expression of the half of the genes is regulated by androgens. Further expression analyses demonstrated that the novel genes are region-specific and developmentally regulated. Computational analysis showed that 15 of the genes lack human orthologues, suggesting their implication in male reproduction unique to the mouse. A number of the novel genes are putative epididymal protease inhibitors or β-defensins. We also found that six of the genes have secretory activity, indicating that they may interact with sperm and have functional roles in sperm maturation. Conclusion We identified and characterized 32 novel epididymis-specific or -predominant genes by an integrative approach. Our study is unique in the aspect of systematic identification of novel epididymal genes and should be a firm basis for future investigation into molecular mechanisms underlying sperm maturation in the epididymis.

  4. Integrative Analysis of Gene Expression Data Including an Assessment of Pathway Enrichment for Predicting Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Pingzhao Hu

    2006-01-01

    Full Text Available Background: Microarray technology has been previously used to identify genes that are differentially expressed between tumour and normal samples in a single study, as well as in syntheses involving multiple studies. When integrating results from several Affymetrix microarray datasets, previous studies summarized probeset-level data, which may potentially lead to a loss of information available at the probe-level. In this paper, we present an approach for integrating results across studies while taking probe-level data into account. Additionally, we follow a new direction in the analysis of microarray expression data, namely to focus on the variation of expression phenotypes in predefined gene sets, such as pathways. This targeted approach can be helpful for revealing information that is not easily visible from the changes in the individual genes. Results: We used a recently developed method to integrate Affymetrix expression data across studies. The idea is based on a probe-level based test statistic developed for testing for differentially expressed genes in individual studies. We incorporated this test statistic into a classic random-effects model for integrating data across studies. Subsequently, we used a gene set enrichment test to evaluate the significance of enriched biological pathways in the differentially expressed genes identified from the integrative analysis. We compared statistical and biological significance of the prognostic gene expression signatures and pathways identified in the probe-level model (PLM with those in the probeset-level model (PSLM. Our integrative analysis of Affymetrix microarray data from 110 prostate cancer samples obtained from three studies reveals thousands of genes significantly correlated with tumour cell differentiation. The bioinformatics analysis, mapping these genes to the publicly available KEGG database, reveals evidence that tumour cell differentiation is significantly associated with many

  5. Data Integration for Spatio-Temporal Patterns of Gene Expression of Zebrafish development: the GEMS database

    Directory of Open Access Journals (Sweden)

    Belmamoune Mounia

    2008-06-01

    Full Text Available The Gene Expression Management System (GEMS is a database system for patterns of gene expression. These patterns result from systematic whole-mount fluorescent in situ hybridization studies on zebrafish embryos. GEMS is an integrative platform that addresses one of the important challenges of developmental biology: how to integrate genetic data that underpin morphological changes during embryogenesis. Our motivation to build this system was by the need to be able to organize and compare multiple patterns of gene expression at tissue level. Integration with other developmental and biomolecular databases will further support our understanding of development. The GEMS operates in concert with a database containing a digital atlas of zebrafish embryo; this digital atlas of zebrafish development has been conceived prior to the expansion of the GEMS. The atlas contains 3D volume models of canonical stages of zebrafish development in which in each volume model element is annotated with an anatomical term. These terms are extracted from a formal anatomical ontology, i.e. the Developmental Anatomy Ontology of Zebrafish (DAOZ. In the GEMS, anatomical terms from this ontology together with terms from the Gene Ontology (GO are also used to annotate patterns of gene expression and in this manner providing mechanisms for integration and retrieval . The annotations are the glue for integration of patterns of gene expression in GEMS as well as in other biomolecular databases. At the one hand, zebrafish anatomy terminology allows gene expression data within GEMS to be integrated with phenotypical data in the 3D atlas of zebrafish development. At the other hand, GO terms extend GEMS expression patterns integration to a wide range of bioinformatics resources.

  6. Systematic Prioritization and Integrative Analysis of Copy Number Variations in Schizophrenia Reveal Key Schizophrenia Susceptibility Genes

    Science.gov (United States)

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

    2014-01-01

    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  7. Integrating Diverse Types of Genomic Data to Identify Genes that Underlie Adverse Pregnancy Phenotypes.

    Directory of Open Access Journals (Sweden)

    Jibril Hirbo

    Full Text Available Progress in understanding complex genetic diseases has been bolstered by synthetic approaches that overlay diverse data types and analyses to identify functionally important genes. Pre-term birth (PTB, a major complication of pregnancy, is a leading cause of infant mortality worldwide. A major obstacle in addressing PTB is that the mechanisms controlling parturition and birth timing remain poorly understood. Integrative approaches that overlay datasets derived from comparative genomics with function-derived ones have potential to advance our understanding of the genetics of birth timing, and thus provide insights into the genes that may contribute to PTB. We intersected data from fast evolving coding and non-coding gene regions in the human and primate lineage with data from genes expressed in the placenta, from genes that show enriched expression only in the placenta, as well as from genes that are differentially expressed in four distinct PTB clinical subtypes. A large fraction of genes that are expressed in placenta, and differentially expressed in PTB clinical subtypes (23-34% are fast evolving, and are associated with functions that include adhesion neurodevelopmental and immune processes. Functional categories of genes that express fast evolution in coding regions differ from those linked to fast evolution in non-coding regions. Finally, there is a surprising lack of overlap between fast evolving genes that are differentially expressed in four PTB clinical subtypes. Integrative approaches, especially those that incorporate evolutionary perspectives, can be successful in identifying potential genetic contributions to complex genetic diseases, such as PTB.

  8. Integrative analysis of copy number alteration and gene expression profiling in ovarian clear cell adenocarcinoma.

    Science.gov (United States)

    Sung, Chang Ohk; Choi, Chel Hun; Ko, Young-Hyeh; Ju, Hyunjeong; Choi, Yoon-La; Kim, Nyunsu; Kang, So Young; Ha, Sang Yun; Choi, Kyusam; Bae, Duk-Soo; Lee, Jeong-Won; Kim, Tae-Joong; Song, Sang Yong; Kim, Byoung-Gie

    2013-05-01

    Ovarian clear cell adenocarcinoma (Ov-CCA) is a distinctive subtype of ovarian epithelial carcinoma. In this study, we performed array comparative genomic hybridization (aCGH) and paired gene expression microarray of 19 fresh-frozen samples and conducted integrative analysis. For the copy number alterations, significantly amplified regions (false discovery rate [FDR] q genes demonstrating frequent copy number alterations (>25% of samples) that correlated with gene expression (FDR genes were mainly located on 8p11.21, 8p21.2-p21.3, 8q22.1, 8q24.3, 17q23.2-q23.3, 19p13.3, and 19p13.11. Among the regions, 8q24.3 was found to contain the most genes (30 of 94 genes) including PTK2. The 8q24.3 region was indicated as the most significant region, as supported by copy number, GISTIC, and integrative analysis. Pathway analysis using differentially expressed genes on 8q24.3 revealed several major nodes, including PTK2. In conclusion, we identified a set of 94 candidate genes with frequent copy number alterations that correlated with gene expression. Specific chromosomal alterations, such as the 8q24.3 gain containing PTK2, could be a therapeutic target in a subset of Ov-CCAs. Copyright © 2013. Published by Elsevier Inc.

  9. An integrated approach for finding overlooked genes in Shigella.

    Directory of Open Access Journals (Sweden)

    Junping Peng

    Full Text Available BACKGROUND: The completion of numerous genome sequences introduced an era of whole-genome study. However, many genes are missed during genome annotation, including small RNAs (sRNAs and small open reading frames (sORFs. In order to improve genome annotation, we aimed to identify novel sRNAs and sORFs in Shigella, the principal etiologic agents of bacillary dysentery. METHODOLOGY/PRINCIPAL FINDINGS: We identified 64 sRNAs in Shigella, which were experimentally validated in other bacteria based on sequence conservation. We employed computer-based and tiling array-based methods to search for sRNAs, followed by RT-PCR and northern blots, to identify nine sRNAs in Shigella flexneri strain 301 (Sf301 and 256 regions containing possible sRNA genes. We found 29 candidate sORFs using bioinformatic prediction, array hybridization and RT-PCR verification. We experimentally validated 557 (57.9% DOOR operon predictions in the chromosomes of Sf301 and 46 (76.7% in virulence plasmid.We found 40 additional co-expressed gene pairs that were not predicted by DOOR. CONCLUSIONS/SIGNIFICANCE: We provide an updated and comprehensive annotation of the Shigella genome. Our study increased the expected numbers of sORFs and sRNAs, which will impact on future functional genomics and proteomics studies. Our method can be used for large scale reannotation of sRNAs and sORFs in any microbe with a known genome sequence.

  10. Identification of functionally related genes using data mining and data integration: a breast cancer case study

    Directory of Open Access Journals (Sweden)

    Zucchi Ileana

    2009-10-01

    Full Text Available Abstract Background The identification of the organisation and dynamics of molecular pathways is crucial for the understanding of cell function. In order to reconstruct the molecular pathways in which a gene of interest is involved in regulating a cell, it is important to identify the set of genes to which it interacts with to determine cell function. In this context, the mining and the integration of a large amount of publicly available data, regarding the transcriptome and the proteome states of a cell, are a useful resource to complement biological research. Results We describe an approach for the identification of genes that interact with each other to regulate cell function. The strategy relies on the analysis of gene expression profile similarity, considering large datasets of expression data. During the similarity evaluation, the methodology determines the most significant subset of samples in which the evaluated genes are highly correlated. Hence, the strategy enables the exclusion of samples that are not relevant for each gene pair analysed. This feature is important when considering a large set of samples characterised by heterogeneous experimental conditions where different pools of biological processes can be active across the samples. The putative partners of the studied gene are then further characterised, analysing the distribution of the Gene Ontology terms and integrating the protein-protein interaction (PPI data. The strategy was applied for the analysis of the functional relationships of a gene of known function, Pyruvate Kinase, and for the prediction of functional partners of the human transcription factor TBX3. In both cases the analysis was done on a dataset composed by breast primary tumour expression data derived from the literature. Integration and analysis of PPI data confirmed the prediction of the methodology, since the genes identified to be functionally related were associated to proteins close in the PPI network

  11. Integrating chromosomal aberrations and gene expression profiles to dissect rectal tumorigenesis

    Directory of Open Access Journals (Sweden)

    Eilers Paul HC

    2008-10-01

    Full Text Available Abstract Background Accurate staging of rectal tumors is essential for making the correct treatment choice. In a previous study, we found that loss of 17p, 18q and gain of 8q, 13q and 20q could distinguish adenoma from carcinoma tissue and that gain of 1q was related to lymph node metastasis. In order to find markers for tumor staging, we searched for candidate genes on these specific chromosomes. Methods We performed gene expression microarray analysis on 79 rectal tumors and integrated these data with genomic data from the same sample series. We performed supervised analysis to find candidate genes on affected chromosomes and validated the results with qRT-PCR and immunohistochemistry. Results Integration of gene expression and chromosomal instability data revealed similarity between these two data types. Supervised analysis identified up-regulation of EFNA1 in cases with 1q gain, and EFNA1 expression was correlated with the expression of a target gene (VEGF. The BOP1 gene, involved in ribosome biogenesis and related to chromosomal instability, was over-expressed in cases with 8q gain. SMAD2 was the most down-regulated gene on 18q, and on 20q, STMN3 and TGIF2 were highly up-regulated. Immunohistochemistry for SMAD4 correlated with SMAD2 gene expression and 18q loss. Conclusion On basis of integrative analysis this study identified one well known CRC gene (SMAD2 and several other genes (EFNA1, BOP1, TGIF2 and STMN3 that possibly could be used for rectal cancer characterization.

  12. Predictive networks: a flexible, open source, web application for integration and analysis of human gene networks.

    Science.gov (United States)

    Haibe-Kains, Benjamin; Olsen, Catharina; Djebbari, Amira; Bontempi, Gianluca; Correll, Mick; Bouton, Christopher; Quackenbush, John

    2012-01-01

    Genomics provided us with an unprecedented quantity of data on the genes that are activated or repressed in a wide range of phenotypes. We have increasingly come to recognize that defining the networks and pathways underlying these phenotypes requires both the integration of multiple data types and the development of advanced computational methods to infer relationships between the genes and to estimate the predictive power of the networks through which they interact. To address these issues we have developed Predictive Networks (PN), a flexible, open-source, web-based application and data services framework that enables the integration, navigation, visualization and analysis of gene interaction networks. The primary goal of PN is to allow biomedical researchers to evaluate experimentally derived gene lists in the context of large-scale gene interaction networks. The PN analytical pipeline involves two key steps. The first is the collection of a comprehensive set of known gene interactions derived from a variety of publicly available sources. The second is to use these 'known' interactions together with gene expression data to infer robust gene networks. The PN web application is accessible from http://predictivenetworks.org. The PN code base is freely available at https://sourceforge.net/projects/predictivenets/.

  13. Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish

    Directory of Open Access Journals (Sweden)

    Atsuo Kawahara

    2016-05-01

    Full Text Available The zebrafish (Danio rerio is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs and the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR associated protein 9 (Cas9 system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.

  14. Horizontal Acquisition and Transcriptional Integration of Novel Genes in Mosquito-Associated Spiroplasma.

    Science.gov (United States)

    Lo, Wen-Sui; Kuo, Chih-Horng

    2017-12-01

    Genetic differentiation among symbiotic bacteria is important in shaping biodiversity. The genus Spiroplasma contains species occupying diverse niches and is a model system for symbiont evolution. Previous studies have established that two mosquito-associated species have diverged extensively in their carbohydrate metabolism genes despite having a close phylogenetic relationship. Notably, although the commensal Spiroplasma diminutum lacks identifiable pathogenicity factors, the pathogenic Spiroplasma taiwanense was found to have acquired a virulence factor glpO and its associated genes through horizontal transfer. However, it is unclear if these acquired genes have been integrated into the regulatory network. In this study, we inferred the gene content evolution in these bacteria, as well as examined their transcriptomes in response to glucose availability. The results indicated that both species have many more gene acquisitions from the Mycoides-Entomoplasmataceae clade, which contains several important pathogens of ruminants, than previously thought. Moreover, several acquired genes have higher expression levels than the vertically inherited homologs, indicating possible functional replacement. Finally, the virulence factor and its functionally linked genes in S. taiwanense were up-regulated in response to glucose starvation, suggesting that these acquired genes are under expression regulation and the pathogenicity may be a stress response. In summary, although differential gene losses are a major process for symbiont divergence, gene gains are critical in counteracting genome degradation and driving diversification among facultative symbionts. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. The RNAPII-CTD Maintains Genome Integrity through Inhibition of Retrotransposon Gene Expression and Transposition.

    Directory of Open Access Journals (Sweden)

    Maria J Aristizabal

    2015-10-01

    Full Text Available RNA polymerase II (RNAPII contains a unique C-terminal domain that is composed of heptapeptide repeats and which plays important regulatory roles during gene expression. RNAPII is responsible for the transcription of most protein-coding genes, a subset of non-coding genes, and retrotransposons. Retrotransposon transcription is the first step in their multiplication cycle, given that the RNA intermediate is required for the synthesis of cDNA, the material that is ultimately incorporated into a new genomic location. Retrotransposition can have grave consequences to genome integrity, as integration events can change the gene expression landscape or lead to alteration or loss of genetic information. Given that RNAPII transcribes retrotransposons, we sought to investigate if the RNAPII-CTD played a role in the regulation of retrotransposon gene expression. Importantly, we found that the RNAPII-CTD functioned to maintaining genome integrity through inhibition of retrotransposon gene expression, as reducing CTD length significantly increased expression and transposition rates of Ty1 elements. Mechanistically, the increased Ty1 mRNA levels in the rpb1-CTD11 mutant were partly due to Cdk8-dependent alterations to the RNAPII-CTD phosphorylation status. In addition, Cdk8 alone contributed to Ty1 gene expression regulation by altering the occupancy of the gene-specific transcription factor Ste12. Loss of STE12 and TEC1 suppressed growth phenotypes of the RNAPII-CTD truncation mutant. Collectively, our results implicate Ste12 and Tec1 as general and important contributors to the Cdk8, RNAPII-CTD regulatory circuitry as it relates to the maintenance of genome integrity.

  16. Inter-replicon Gene Flow Contributes to Transcriptional Integration in the Sinorhizobium meliloti Multipartite Genome

    Directory of Open Access Journals (Sweden)

    George C. diCenzo

    2018-05-01

    Full Text Available Integration of newly acquired genes into existing regulatory networks is necessary for successful horizontal gene transfer (HGT. Ten percent of bacterial species contain at least two DNA replicons over 300 kilobases in size, with the secondary replicons derived predominately through HGT. The Sinorhizobium meliloti genome is split between a 3.7 Mb chromosome, a 1.7 Mb chromid consisting largely of genes acquired through ancient HGT, and a 1.4 Mb megaplasmid consisting primarily of recently acquired genes. Here, RNA-sequencing is used to examine the transcriptional consequences of massive, synthetic genome reduction produced through the removal of the megaplasmid and/or the chromid. Removal of the pSymA megaplasmid influenced the transcription of only six genes. In contrast, removal of the chromid influenced expression of ∼8% of chromosomal genes and ∼4% of megaplasmid genes. This was mediated in part by the loss of the ETR DNA region whose presence on pSymB is due to a translocation from the chromosome. No obvious functional bias among the up-regulated genes was detected, although genes with putative homologs on the chromid were enriched. Down-regulated genes were enriched in motility and sensory transduction pathways. Four transcripts were examined further, and in each case the transcriptional change could be traced to loss of specific pSymB regions. In particularly, a chromosomal transporter was induced due to deletion of bdhA likely mediated through 3-hydroxybutyrate accumulation. These data provide new insights into the evolution of the multipartite bacterial genome, and more generally into the integration of horizontally acquired genes into the transcriptome.

  17. Inter-replicon Gene Flow Contributes to Transcriptional Integration in the Sinorhizobium meliloti Multipartite Genome.

    Science.gov (United States)

    diCenzo, George C; Wellappili, Deelaka; Golding, G Brian; Finan, Turlough M

    2018-05-04

    Integration of newly acquired genes into existing regulatory networks is necessary for successful horizontal gene transfer (HGT). Ten percent of bacterial species contain at least two DNA replicons over 300 kilobases in size, with the secondary replicons derived predominately through HGT. The Sinorhizobium meliloti genome is split between a 3.7 Mb chromosome, a 1.7 Mb chromid consisting largely of genes acquired through ancient HGT, and a 1.4 Mb megaplasmid consisting primarily of recently acquired genes. Here, RNA-sequencing is used to examine the transcriptional consequences of massive, synthetic genome reduction produced through the removal of the megaplasmid and/or the chromid. Removal of the pSymA megaplasmid influenced the transcription of only six genes. In contrast, removal of the chromid influenced expression of ∼8% of chromosomal genes and ∼4% of megaplasmid genes. This was mediated in part by the loss of the ETR DNA region whose presence on pSymB is due to a translocation from the chromosome. No obvious functional bias among the up-regulated genes was detected, although genes with putative homologs on the chromid were enriched. Down-regulated genes were enriched in motility and sensory transduction pathways. Four transcripts were examined further, and in each case the transcriptional change could be traced to loss of specific pSymB regions. In particularly, a chromosomal transporter was induced due to deletion of bdhA likely mediated through 3-hydroxybutyrate accumulation. These data provide new insights into the evolution of the multipartite bacterial genome, and more generally into the integration of horizontally acquired genes into the transcriptome. Copyright © 2018 diCenzo, et al.

  18. An Integrative Analysis to Identify Driver Genes in Esophageal Squamous Cell Carcinoma.

    Directory of Open Access Journals (Sweden)

    Genta Sawada

    Full Text Available Few driver genes have been well established in esophageal squamous cell carcinoma (ESCC. Identification of the genomic aberrations that contribute to changes in gene expression profiles can be used to predict driver genes.We searched for driver genes in ESCC by integrative analysis of gene expression microarray profiles and copy number data. To narrow down candidate genes, we performed survival analysis on expression data and tested the genetic vulnerability of each genes using public RNAi screening data. We confirmed the results by performing RNAi experiments and evaluating the clinical relevance of candidate genes in an independent ESCC cohort.We found 10 significantly recurrent copy number alterations accompanying gene expression changes, including loci 11q13.2, 7p11.2, 3q26.33, and 17q12, which harbored CCND1, EGFR, SOX2, and ERBB2, respectively. Analysis of survival data and RNAi screening data suggested that GRB7, located on 17q12, was a driver gene in ESCC. In ESCC cell lines harboring 17q12 amplification, knockdown of GRB7 reduced the proliferation, migration, and invasion capacities of cells. Moreover, siRNA targeting GRB7 had a synergistic inhibitory effect when combined with trastuzumab, an anti-ERBB2 antibody. Survival analysis of the independent cohort also showed that high GRB7 expression was associated with poor prognosis in ESCC.Our integrative analysis provided important insights into ESCC pathogenesis. We identified GRB7 as a novel ESCC driver gene and potential new therapeutic target.

  19. Integrative analysis for finding genes and networks involved in diabetes and other complex diseases

    DEFF Research Database (Denmark)

    Bergholdt, R.; Størling, Zenia, Marian; Hansen, Kasper Lage

    2007-01-01

    We have developed an integrative analysis method combining genetic interactions, identified using type 1 diabetes genome scan data, and a high-confidence human protein interaction network. Resulting networks were ranked by the significance of the enrichment of proteins from interacting regions. We...... identified a number of new protein network modules and novel candidate genes/proteins for type 1 diabetes. We propose this type of integrative analysis as a general method for the elucidation of genes and networks involved in diabetes and other complex diseases....

  20. Integration of gene expression and methylation to unravel biological networks in glioblastoma patients.

    Science.gov (United States)

    Gadaleta, Francesco; Bessonov, Kyrylo; Van Steen, Kristel

    2017-02-01

    The vast amount of heterogeneous omics data, encompassing a broad range of biomolecular information, requires novel methods of analysis, including those that integrate the available levels of information. In this work, we describe Regression2Net, a computational approach that is able to integrate gene expression and genomic or methylation data in two steps. First, penalized regressions are used to build Expression-Expression (EEnet) and Expression-Genomic or Expression-Methylation (EMnet) networks. Second, network theory is used to highlight important communities of genes. When applying our approach, Regression2Net to gene expression and methylation profiles for individuals with glioblastoma multiforme, we identified, respectively, 284 and 447 potentially interesting genes in relation to glioblastoma pathology. These genes showed at least one connection in the integrated networks ANDnet and XORnet derived from aforementioned EEnet and EMnet networks. Although the edges in ANDnet occur in both EEnet and EMnet, the edges in XORnet occur in EMnet but not in EEnet. In-depth biological analysis of connected genes in ANDnet and XORnet revealed genes that are related to energy metabolism, cell cycle control (AATF), immune system response, and several cancer types. Importantly, we observed significant overrepresentation of cancer-related pathways including glioma, especially in the XORnet network, suggesting a nonignorable role of methylation in glioblastoma multiforma. In the ANDnet, we furthermore identified potential glioma suppressor genes ACCN3 and ACCN4 linked to the NBPF1 neuroblastoma breakpoint family, as well as numerous ABC transporter genes (ABCA1, ABCB1) suggesting drug resistance of glioblastoma tumors. © 2016 WILEY PERIODICALS, INC.

  1. Integration of human adipocyte chromosomal interactions with adipose gene expression prioritizes obesity-related genes from GWAS.

    Science.gov (United States)

    Pan, David Z; Garske, Kristina M; Alvarez, Marcus; Bhagat, Yash V; Boocock, James; Nikkola, Elina; Miao, Zong; Raulerson, Chelsea K; Cantor, Rita M; Civelek, Mete; Glastonbury, Craig A; Small, Kerrin S; Boehnke, Michael; Lusis, Aldons J; Sinsheimer, Janet S; Mohlke, Karen L; Laakso, Markku; Pajukanta, Päivi; Ko, Arthur

    2018-04-17

    Increased adiposity is a hallmark of obesity and overweight, which affect 2.2 billion people world-wide. Understanding the genetic and molecular mechanisms that underlie obesity-related phenotypes can help to improve treatment options and drug development. Here we perform promoter Capture Hi-C in human adipocytes to investigate interactions between gene promoters and distal elements as a transcription-regulating mechanism contributing to these phenotypes. We find that promoter-interacting elements in human adipocytes are enriched for adipose-related transcription factor motifs, such as PPARG and CEBPB, and contribute to heritability of cis-regulated gene expression. We further intersect these data with published genome-wide association studies for BMI and BMI-related metabolic traits to identify the genes that are under genetic cis regulation in human adipocytes via chromosomal interactions. This integrative genomics approach identifies four cis-eQTL-eGene relationships associated with BMI or obesity-related traits, including rs4776984 and MAP2K5, which we further confirm by EMSA, and highlights 38 additional candidate genes.

  2. Large-scale modeling of condition-specific gene regulatory networks by information integration and inference.

    Science.gov (United States)

    Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner

    2014-12-01

    Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Network Based Integrated Analysis of Phenotype-Genotype Data for Prioritization of Candidate Symptom Genes

    Directory of Open Access Journals (Sweden)

    Xing Li

    2014-01-01

    Full Text Available Background. Symptoms and signs (symptoms in brief are the essential clinical manifestations for individualized diagnosis and treatment in traditional Chinese medicine (TCM. To gain insights into the molecular mechanism of symptoms, we develop a computational approach to identify the candidate genes of symptoms. Methods. This paper presents a network-based approach for the integrated analysis of multiple phenotype-genotype data sources and the prediction of the prioritizing genes for the associated symptoms. The method first calculates the similarities between symptoms and diseases based on the symptom-disease relationships retrieved from the PubMed bibliographic database. Then the disease-gene associations and protein-protein interactions are utilized to construct a phenotype-genotype network. The PRINCE algorithm is finally used to rank the potential genes for the associated symptoms. Results. The proposed method gets reliable gene rank list with AUC (area under curve 0.616 in classification. Some novel genes like CALCA, ESR1, and MTHFR were predicted to be associated with headache symptoms, which are not recorded in the benchmark data set, but have been reported in recent published literatures. Conclusions. Our study demonstrated that by integrating phenotype-genotype relationships into a complex network framework it provides an effective approach to identify candidate genes of symptoms.

  4. OAHG: an integrated resource for annotating human genes with multi-level ontologies.

    Science.gov (United States)

    Cheng, Liang; Sun, Jie; Xu, Wanying; Dong, Lixiang; Hu, Yang; Zhou, Meng

    2016-10-05

    OAHG, an integrated resource, aims to establish a comprehensive functional annotation resource for human protein-coding genes (PCGs), miRNAs, and lncRNAs by multi-level ontologies involving Gene Ontology (GO), Disease Ontology (DO), and Human Phenotype Ontology (HPO). Many previous studies have focused on inferring putative properties and biological functions of PCGs and non-coding RNA genes from different perspectives. During the past several decades, a few of databases have been designed to annotate the functions of PCGs, miRNAs, and lncRNAs, respectively. A part of functional descriptions in these databases were mapped to standardize terminologies, such as GO, which could be helpful to do further analysis. Despite these developments, there is no comprehensive resource recording the function of these three important types of genes. The current version of OAHG, release 1.0 (Jun 2016), integrates three ontologies involving GO, DO, and HPO, six gene functional databases and two interaction databases. Currently, OAHG contains 1,434,694 entries involving 16,929 PCGs, 637 miRNAs, 193 lncRNAs, and 24,894 terms of ontologies. During the performance evaluation, OAHG shows the consistencies with existing gene interactions and the structure of ontology. For example, terms with more similar structure could be associated with more associated genes (Pearson correlation γ 2  = 0.2428, p < 2.2e-16).

  5. RGmatch: matching genomic regions to proximal genes in omics data integration

    Directory of Open Access Journals (Sweden)

    Pedro Furió-Tarí

    2016-11-01

    Full Text Available Abstract Background The integrative analysis of multiple genomics data often requires that genome coordinates-based signals have to be associated with proximal genes. The relative location of a genomic region with respect to the gene (gene area is important for functional data interpretation; hence algorithms that match regions to genes should be able to deliver insight into this information. Results In this work we review the tools that are publicly available for making region-to-gene associations. We also present a novel method, RGmatch, a flexible and easy-to-use Python tool that computes associations either at the gene, transcript, or exon level, applying a set of rules to annotate each region-gene association with the region location within the gene. RGmatch can be applied to any organism as long as genome annotation is available. Furthermore, we qualitatively and quantitatively compare RGmatch to other tools. Conclusions RGmatch simplifies the association of a genomic region with its closest gene. At the same time, it is a powerful tool because the rules used to annotate these associations are very easy to modify according to the researcher’s specific interests. Some important differences between RGmatch and other similar tools already in existence are RGmatch’s flexibility, its wide range of user options, compatibility with any annotatable organism, and its comprehensive and user-friendly output.

  6. General theory for integrated analysis of growth, gene, and protein expression in biofilms.

    Science.gov (United States)

    Zhang, Tianyu; Pabst, Breana; Klapper, Isaac; Stewart, Philip S

    2013-01-01

    A theory for analysis and prediction of spatial and temporal patterns of gene and protein expression within microbial biofilms is derived. The theory integrates phenomena of solute reaction and diffusion, microbial growth, mRNA or protein synthesis, biomass advection, and gene transcript or protein turnover. Case studies illustrate the capacity of the theory to simulate heterogeneous spatial patterns and predict microbial activities in biofilms that are qualitatively different from those of planktonic cells. Specific scenarios analyzed include an inducible GFP or fluorescent protein reporter, a denitrification gene repressed by oxygen, an acid stress response gene, and a quorum sensing circuit. It is shown that the patterns of activity revealed by inducible stable fluorescent proteins or reporter unstable proteins overestimate the region of activity. This is due to advective spreading and finite protein turnover rates. In the cases of a gene induced by either limitation for a metabolic substrate or accumulation of a metabolic product, maximal expression is predicted in an internal stratum of the biofilm. A quorum sensing system that includes an oxygen-responsive negative regulator exhibits behavior that is distinct from any stage of a batch planktonic culture. Though here the analyses have been limited to simultaneous interactions of up to two substrates and two genes, the framework applies to arbitrarily large networks of genes and metabolites. Extension of reaction-diffusion modeling in biofilms to the analysis of individual genes and gene networks is an important advance that dovetails with the growing toolkit of molecular and genetic experimental techniques.

  7. Gene ARMADA: an integrated multi-analysis platform for microarray data implemented in MATLAB.

    Science.gov (United States)

    Chatziioannou, Aristotelis; Moulos, Panagiotis; Kolisis, Fragiskos N

    2009-10-27

    The microarray data analysis realm is ever growing through the development of various tools, open source and commercial. However there is absence of predefined rational algorithmic analysis workflows or batch standardized processing to incorporate all steps, from raw data import up to the derivation of significantly differentially expressed gene lists. This absence obfuscates the analytical procedure and obstructs the massive comparative processing of genomic microarray datasets. Moreover, the solutions provided, heavily depend on the programming skills of the user, whereas in the case of GUI embedded solutions, they do not provide direct support of various raw image analysis formats or a versatile and simultaneously flexible combination of signal processing methods. We describe here Gene ARMADA (Automated Robust MicroArray Data Analysis), a MATLAB implemented platform with a Graphical User Interface. This suite integrates all steps of microarray data analysis including automated data import, noise correction and filtering, normalization, statistical selection of differentially expressed genes, clustering, classification and annotation. In its current version, Gene ARMADA fully supports 2 coloured cDNA and Affymetrix oligonucleotide arrays, plus custom arrays for which experimental details are given in tabular form (Excel spreadsheet, comma separated values, tab-delimited text formats). It also supports the analysis of already processed results through its versatile import editor. Besides being fully automated, Gene ARMADA incorporates numerous functionalities of the Statistics and Bioinformatics Toolboxes of MATLAB. In addition, it provides numerous visualization and exploration tools plus customizable export data formats for seamless integration by other analysis tools or MATLAB, for further processing. Gene ARMADA requires MATLAB 7.4 (R2007a) or higher and is also distributed as a stand-alone application with MATLAB Component Runtime. Gene ARMADA provides a

  8. Social Integration and Sleep Disturbance: A Gene-Environment Interaction Study

    Directory of Open Access Journals (Sweden)

    David A. Sbarra

    2016-03-01

    Full Text Available Objective: Low levels of perceived social integration, or loneliness, are associated with increased risk for a range of poor health outcomes. Sleep disturbance plays a central role in the evolutionary theory of loneliness, which provides a mechanistic account of how low levels of social integration may negatively impact health. No studies, however, have examined whether the association between social integration and sleep disturbance is consistent with a causal effect after accounting for genes that are common to both variables.  Method: Using twin data ('N' = 905 twin pairs from the nationally-representative Midlife in the United States (MIDUS survey, I evaluated a series of bivariate twin models exploring whether the phenotypic association between low social integration and sleep disturbance can be explained by shared genetics. In addition, the current study specified a series of quantitative models for studying gene x environment (G X E interactions to determine whether the genetic and environmental influences on sleep disturbance differ as a function of social integration. Results: The phenotypic association between social integration and sleep disturbance was fully accounted for by genes that are common between the two variables, suggesting that within-twin pair differences in social integration do not exert a causal influence on sleep disturbance. Social integration, however, moderated the non-shared environmental influence on sleep disturbances, with the greatest environmental influences observed at the lowest levels of social integration. Conclusions: The results of this study suggest that an essential feature of the evolutionary model of loneliness may need refinement or elaboration. The moderation findings are discussed in terms of the fit with a stress-buffering model of social support in which environmental influences on sleep disturbance are strongest when social resources are low.

  9. Sensitivity and fidelity of DNA microarray improved with integration of Amplified Differential Gene Expression (ADGE

    Directory of Open Access Journals (Sweden)

    Ile Kristina E

    2003-07-01

    Full Text Available Abstract Background The ADGE technique is a method designed to magnify the ratios of gene expression before detection. It improves the detection sensitivity to small change of gene expression and requires small amount of starting material. However, the throughput of ADGE is low. We integrated ADGE with DNA microarray (ADGE microarray and compared it with regular microarray. Results When ADGE was integrated with DNA microarray, a quantitative relationship of a power function between detected and input ratios was found. Because of ratio magnification, ADGE microarray was better able to detect small changes in gene expression in a drug resistant model cell line system. The PCR amplification of templates and efficient labeling reduced the requirement of starting material to as little as 125 ng of total RNA for one slide hybridization and enhanced the signal intensity. Integration of ratio magnification, template amplification and efficient labeling in ADGE microarray reduced artifacts in microarray data and improved detection fidelity. The results of ADGE microarray were less variable and more reproducible than those of regular microarray. A gene expression profile generated with ADGE microarray characterized the drug resistant phenotype, particularly with reference to glutathione, proliferation and kinase pathways. Conclusion ADGE microarray magnified the ratios of differential gene expression in a power function, improved the detection sensitivity and fidelity and reduced the requirement for starting material while maintaining high throughput. ADGE microarray generated a more informative expression pattern than regular microarray.

  10. Integration Site and Clonal Expansion in Human Chronic Retroviral Infection and Gene Therapy

    Science.gov (United States)

    Niederer, Heather A.; Bangham, Charles R. M.

    2014-01-01

    Retroviral vectors have been successfully used therapeutically to restore expression of genes in a range of single-gene diseases, including several primary immunodeficiency disorders. Although clinical trials have shown remarkable results, there have also been a number of severe adverse events involving malignant outgrowth of a transformed clonal population. This clonal expansion is influenced by the integration site profile of the viral integrase, the transgene expressed, and the effect of the viral promoters on the neighbouring host genome. Infection with the pathogenic human retrovirus HTLV-1 also causes clonal expansion of cells containing an integrated HTLV-1 provirus. Although the majority of HTLV-1-infected people remain asymptomatic, up to 5% develop an aggressive T cell malignancy. In this review we discuss recent findings on the role of the genomic integration site in determining the clonality and the potential for malignant transformation of cells carrying integrated HTLV-1 or gene therapy vectors, and how these results have contributed to the understanding of HTLV-1 pathogenesis and to improvements in gene therapy vector safety. PMID:25365582

  11. Allopatric integrations selectively change host transcriptomes, leading to varied expression efficiencies of exotic genes in Myxococcus xanthus.

    Science.gov (United States)

    Zhu, Li-Ping; Yue, Xin-Jing; Han, Kui; Li, Zhi-Feng; Zheng, Lian-Shuai; Yi, Xiu-Nan; Wang, Hai-Long; Zhang, You-Ming; Li, Yue-Zhong

    2015-07-22

    Exotic genes, especially clustered multiple-genes for a complex pathway, are normally integrated into chromosome for heterologous expression. The influences of insertion sites on heterologous expression and allotropic expressions of exotic genes on host remain mostly unclear. We compared the integration and expression efficiencies of single and multiple exotic genes that were inserted into Myxococcus xanthus genome by transposition and attB-site-directed recombination. While the site-directed integration had a rather stable chloramphenicol acetyl transferase (CAT) activity, the transposition produced varied CAT enzyme activities. We attempted to integrate the 56-kb gene cluster for the biosynthesis of antitumor polyketides epothilones into M. xanthus genome by site-direction but failed, which was determined to be due to the insertion size limitation at the attB site. The transposition technique produced many recombinants with varied production capabilities of epothilones, which, however, were not paralleled to the transcriptional characteristics of the local sites where the genes were integrated. Comparative transcriptomics analysis demonstrated that the allopatric integrations caused selective changes of host transcriptomes, leading to varied expressions of epothilone genes in different mutants. With the increase of insertion fragment size, transposition is a more practicable integration method for the expression of exotic genes. Allopatric integrations selectively change host transcriptomes, which lead to varied expression efficiencies of exotic genes.

  12. IntPath--an integrated pathway gene relationship database for model organisms and important pathogens.

    Science.gov (United States)

    Zhou, Hufeng; Jin, Jingjing; Zhang, Haojun; Yi, Bo; Wozniak, Michal; Wong, Limsoon

    2012-01-01

    Pathway data are important for understanding the relationship between genes, proteins and many other molecules in living organisms. Pathway gene relationships are crucial information for guidance, prediction, reference and assessment in biochemistry, computational biology, and medicine. Many well-established databases--e.g., KEGG, WikiPathways, and BioCyc--are dedicated to collecting pathway data for public access. However, the effectiveness of these databases is hindered by issues such as incompatible data formats, inconsistent molecular representations, inconsistent molecular relationship representations, inconsistent referrals to pathway names, and incomprehensive data from different databases. In this paper, we overcome these issues through extraction, normalization and integration of pathway data from several major public databases (KEGG, WikiPathways, BioCyc, etc). We build a database that not only hosts our integrated pathway gene relationship data for public access but also maintains the necessary updates in the long run. This public repository is named IntPath (Integrated Pathway gene relationship database for model organisms and important pathogens). Four organisms--S. cerevisiae, M. tuberculosis H37Rv, H. Sapiens and M. musculus--are included in this version (V2.0) of IntPath. IntPath uses the "full unification" approach to ensure no deletion and no introduced noise in this process. Therefore, IntPath contains much richer pathway-gene and pathway-gene pair relationships and much larger number of non-redundant genes and gene pairs than any of the single-source databases. The gene relationships of each gene (measured by average node degree) per pathway are significantly richer. The gene relationships in each pathway (measured by average number of gene pairs per pathway) are also considerably richer in the integrated pathways. Moderate manual curation are involved to get rid of errors and noises from source data (e.g., the gene ID errors in WikiPathways and

  13. TargetMine, an integrated data warehouse for candidate gene prioritisation and target discovery.

    Directory of Open Access Journals (Sweden)

    Yi-An Chen

    Full Text Available Prioritising candidate genes for further experimental characterisation is a non-trivial challenge in drug discovery and biomedical research in general. An integrated approach that combines results from multiple data types is best suited for optimal target selection. We developed TargetMine, a data warehouse for efficient target prioritisation. TargetMine utilises the InterMine framework, with new data models such as protein-DNA interactions integrated in a novel way. It enables complicated searches that are difficult to perform with existing tools and it also offers integration of custom annotations and in-house experimental data. We proposed an objective protocol for target prioritisation using TargetMine and set up a benchmarking procedure to evaluate its performance. The results show that the protocol can identify known disease-associated genes with high precision and coverage. A demonstration version of TargetMine is available at http://targetmine.nibio.go.jp/.

  14. Gene expression prediction by soft integration and the elastic net-best performance of the DREAM3 gene expression challenge.

    Directory of Open Access Journals (Sweden)

    Mika Gustafsson

    Full Text Available BACKGROUND: To predict gene expressions is an important endeavour within computational systems biology. It can both be a way to explore how drugs affect the system, as well as providing a framework for finding which genes are interrelated in a certain process. A practical problem, however, is how to assess and discriminate among the various algorithms which have been developed for this purpose. Therefore, the DREAM project invited the year 2008 to a challenge for predicting gene expression values, and here we present the algorithm with best performance. METHODOLOGY/PRINCIPAL FINDINGS: We develop an algorithm by exploring various regression schemes with different model selection procedures. It turns out that the most effective scheme is based on least squares, with a penalty term of a recently developed form called the "elastic net". Key components in the algorithm are the integration of expression data from other experimental conditions than those presented for the challenge and the utilization of transcription factor binding data for guiding the inference process towards known interactions. Of importance is also a cross-validation procedure where each form of external data is used only to the extent it increases the expected performance. CONCLUSIONS/SIGNIFICANCE: Our algorithm proves both the possibility to extract information from large-scale expression data concerning prediction of gene levels, as well as the benefits of integrating different data sources for improving the inference. We believe the former is an important message to those still hesitating on the possibilities for computational approaches, while the latter is part of an important way forward for the future development of the field of computational systems biology.

  15. Identification of Differentially Expressed Genes through Integrated Study of Alzheimer's Disease Affected Brain Regions.

    Directory of Open Access Journals (Sweden)

    Nisha Puthiyedth

    Full Text Available Alzheimer's disease (AD is the most common form of dementia in older adults that damages the brain and results in impaired memory, thinking and behaviour. The identification of differentially expressed genes and related pathways among affected brain regions can provide more information on the mechanisms of AD. In the past decade, several studies have reported many genes that are associated with AD. This wealth of information has become difficult to follow and interpret as most of the results are conflicting. In that case, it is worth doing an integrated study of multiple datasets that helps to increase the total number of samples and the statistical power in detecting biomarkers. In this study, we present an integrated analysis of five different brain region datasets and introduce new genes that warrant further investigation.The aim of our study is to apply a novel combinatorial optimisation based meta-analysis approach to identify differentially expressed genes that are associated to AD across brain regions. In this study, microarray gene expression data from 161 samples (74 non-demented controls, 87 AD from the Entorhinal Cortex (EC, Hippocampus (HIP, Middle temporal gyrus (MTG, Posterior cingulate cortex (PC, Superior frontal gyrus (SFG and visual cortex (VCX brain regions were integrated and analysed using our method. The results are then compared to two popular meta-analysis methods, RankProd and GeneMeta, and to what can be obtained by analysing the individual datasets.We find genes related with AD that are consistent with existing studies, and new candidate genes not previously related with AD. Our study confirms the up-regualtion of INFAR2 and PTMA along with the down regulation of GPHN, RAB2A, PSMD14 and FGF. Novel genes PSMB2, WNK1, RPL15, SEMA4C, RWDD2A and LARGE are found to be differentially expressed across all brain regions. Further investigation on these genes may provide new insights into the development of AD. In addition, we

  16. Precise integration of inducible transcriptional elements (PrIITE) enables absolute control of gene expression

    DEFF Research Database (Denmark)

    Pinto, Rita; Hansen, Lars; Hintze, John

    2017-01-01

    to be a limitation. Here, we report that the combined use of genome editing tools and last generation Tet-On systems can resolve these issues. Our principle is based on precise integration of inducible transcriptional elements (coined PrIITE) targeted to: (i) exons of an endogenous gene of interest (GOI) and (ii......Tetracycline-based inducible systems provide powerful methods for functional studies where gene expression can be controlled. However, the lack of tight control of the inducible system, leading to leakiness and adverse effects caused by undesirable tetracycline dosage requirements, has proven......) a safe harbor locus. Using PrIITE cells harboring a GFP reporter or CDX2 transcription factor, we demonstrate discrete inducibility of gene expression with complete abrogation of leakiness. CDX2 PrIITE cells generated by this approach uncovered novel CDX2 downstream effector genes. Our results provide...

  17. Examining the process of de novo gene birth: an educational primer on "integration of new genes into cellular networks, and their structural maturation".

    Science.gov (United States)

    Frietze, Seth; Leatherman, Judith

    2014-03-01

    New genes that arise from modification of the noncoding portion of a genome rather than being duplicated from parent genes are called de novo genes. These genes, identified by their brief evolution and lack of parent genes, provide an opportunity to study the timeframe in which emerging genes integrate into cellular networks, and how the characteristics of these genes change as they mature into bona fide genes. An article by G. Abrusán provides an opportunity to introduce students to fundamental concepts in evolutionary and comparative genetics and to provide a technical background by which to discuss systems biology approaches when studying the evolutionary process of gene birth. Basic background needed to understand the Abrusán study and details on comparative genomic concepts tailored for a classroom discussion are provided, including discussion questions and a supplemental exercise on navigating a genome database.

  18. Identification of differentially expressed genes and signaling pathways in ovarian cancer by integrated bioinformatics analysis

    Directory of Open Access Journals (Sweden)

    Yang X

    2018-03-01

    Full Text Available Xiao Yang,1 Shaoming Zhu,2 Li Li,3 Li Zhang,1 Shu Xian,1 Yanqing Wang,1 Yanxiang Cheng1 1Department of Obstetrics and Gynecology, 2Department of Urology, Renmin Hospital of Wuhan University, 3Department of Pharmacology, Wuhan University Health Science Center, Wuhan, Hubei, People’s Republic of China Background: The mortality rate associated with ovarian cancer ranks the highest among gynecological malignancies. However, the cause and underlying molecular events of ovarian cancer are not clear. Here, we applied integrated bioinformatics to identify key pathogenic genes involved in ovarian cancer and reveal potential molecular mechanisms. Results: The expression profiles of GDS3592, GSE54388, and GSE66957 were downloaded from the Gene Expression Omnibus (GEO database, which contained 115 samples, including 85 cases of ovarian cancer samples and 30 cases of normal ovarian samples. The three microarray datasets were integrated to obtain differentially expressed genes (DEGs and were deeply analyzed by bioinformatics methods. The gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG pathway enrichments of DEGs were performed by DAVID and KOBAS online analyses, respectively. The protein–protein interaction (PPI networks of the DEGs were constructed from the STRING database. A total of 190 DEGs were identified in the three GEO datasets, of which 99 genes were upregulated and 91 genes were downregulated. GO analysis showed that the biological functions of DEGs focused primarily on regulating cell proliferation, adhesion, and differentiation and intracellular signal cascades. The main cellular components include cell membranes, exosomes, the cytoskeleton, and the extracellular matrix. The molecular functions include growth factor activity, protein kinase regulation, DNA binding, and oxygen transport activity. KEGG pathway analysis showed that these DEGs were mainly involved in the Wnt signaling pathway, amino acid metabolism, and the

  19. iGC-an integrated analysis package of gene expression and copy number alteration.

    Science.gov (United States)

    Lai, Yi-Pin; Wang, Liang-Bo; Wang, Wei-An; Lai, Liang-Chuan; Tsai, Mong-Hsun; Lu, Tzu-Pin; Chuang, Eric Y

    2017-01-14

    With the advancement in high-throughput technologies, researchers can simultaneously investigate gene expression and copy number alteration (CNA) data from individual patients at a lower cost. Traditional analysis methods analyze each type of data individually and integrate their results using Venn diagrams. Challenges arise, however, when the results are irreproducible and inconsistent across multiple platforms. To address these issues, one possible approach is to concurrently analyze both gene expression profiling and CNAs in the same individual. We have developed an open-source R/Bioconductor package (iGC). Multiple input formats are supported and users can define their own criteria for identifying differentially expressed genes driven by CNAs. The analysis of two real microarray datasets demonstrated that the CNA-driven genes identified by the iGC package showed significantly higher Pearson correlation coefficients with their gene expression levels and copy numbers than those genes located in a genomic region with CNA. Compared with the Venn diagram approach, the iGC package showed better performance. The iGC package is effective and useful for identifying CNA-driven genes. By simultaneously considering both comparative genomic and transcriptomic data, it can provide better understanding of biological and medical questions. The iGC package's source code and manual are freely available at https://www.bioconductor.org/packages/release/bioc/html/iGC.html .

  20. Integrative gene network construction to analyze cancer recurrence using semi-supervised learning.

    Science.gov (United States)

    Park, Chihyun; Ahn, Jaegyoon; Kim, Hyunjin; Park, Sanghyun

    2014-01-01

    The prognosis of cancer recurrence is an important research area in bioinformatics and is challenging due to the small sample sizes compared to the vast number of genes. There have been several attempts to predict cancer recurrence. Most studies employed a supervised approach, which uses only a few labeled samples. Semi-supervised learning can be a great alternative to solve this problem. There have been few attempts based on manifold assumptions to reveal the detailed roles of identified cancer genes in recurrence. In order to predict cancer recurrence, we proposed a novel semi-supervised learning algorithm based on a graph regularization approach. We transformed the gene expression data into a graph structure for semi-supervised learning and integrated protein interaction data with the gene expression data to select functionally-related gene pairs. Then, we predicted the recurrence of cancer by applying a regularization approach to the constructed graph containing both labeled and unlabeled nodes. The average improvement rate of accuracy for three different cancer datasets was 24.9% compared to existing supervised and semi-supervised methods. We performed functional enrichment on the gene networks used for learning. We identified that those gene networks are significantly associated with cancer-recurrence-related biological functions. Our algorithm was developed with standard C++ and is available in Linux and MS Windows formats in the STL library. The executable program is freely available at: http://embio.yonsei.ac.kr/~Park/ssl.php.

  1. Integrative gene network construction to analyze cancer recurrence using semi-supervised learning.

    Directory of Open Access Journals (Sweden)

    Chihyun Park

    Full Text Available BACKGROUND: The prognosis of cancer recurrence is an important research area in bioinformatics and is challenging due to the small sample sizes compared to the vast number of genes. There have been several attempts to predict cancer recurrence. Most studies employed a supervised approach, which uses only a few labeled samples. Semi-supervised learning can be a great alternative to solve this problem. There have been few attempts based on manifold assumptions to reveal the detailed roles of identified cancer genes in recurrence. RESULTS: In order to predict cancer recurrence, we proposed a novel semi-supervised learning algorithm based on a graph regularization approach. We transformed the gene expression data into a graph structure for semi-supervised learning and integrated protein interaction data with the gene expression data to select functionally-related gene pairs. Then, we predicted the recurrence of cancer by applying a regularization approach to the constructed graph containing both labeled and unlabeled nodes. CONCLUSIONS: The average improvement rate of accuracy for three different cancer datasets was 24.9% compared to existing supervised and semi-supervised methods. We performed functional enrichment on the gene networks used for learning. We identified that those gene networks are significantly associated with cancer-recurrence-related biological functions. Our algorithm was developed with standard C++ and is available in Linux and MS Windows formats in the STL library. The executable program is freely available at: http://embio.yonsei.ac.kr/~Park/ssl.php.

  2. Integrative analyses of leprosy susceptibility genes indicate a common autoimmune profile.

    Science.gov (United States)

    Zhang, Deng-Feng; Wang, Dong; Li, Yu-Ye; Yao, Yong-Gang

    2016-04-01

    Leprosy is an ancient chronic infection in the skin and peripheral nerves caused by Mycobacterium leprae. The development of leprosy depends on genetic background and the immune status of the host. However, there is no systematic view focusing on the biological pathways, interaction networks and overall expression pattern of leprosy-related immune and genetic factors. To identify the hub genes in the center of leprosy genetic network and to provide an insight into immune and genetic factors contributing to leprosy. We retrieved all reported leprosy-related genes and performed integrative analyses covering gene expression profiling, pathway analysis, protein-protein interaction network, and evolutionary analyses. A list of 123 differentially expressed leprosy related genes, which were enriched in activation and regulation of immune response, was obtained in our analyses. Cross-disorder analysis showed that the list of leprosy susceptibility genes was largely shared by typical autoimmune diseases such as lupus erythematosus and arthritis, suggesting that similar pathways might be affected in leprosy and autoimmune diseases. Protein-protein interaction (PPI) and positive selection analyses revealed a co-evolution network of leprosy risk genes. Our analyses showed that leprosy associated genes constituted a co-evolution network and might undergo positive selection driven by M. leprae. We suggested that leprosy may be a kind of autoimmune disease and the development of leprosy is a matter of defect or over-activation of body immunity. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  3. ACE-it: a tool for genome-wide integration of gene dosage and RNA expression data

    NARCIS (Netherlands)

    van Wieringen, W.N.; Belien, J.A.M.; Vosse, S.; Achame, E.M.; Ylstra, B.

    2006-01-01

    Summary: We describe a tool, called ACE-it (Array CGH Expression integration tool). ACE-it links the chromosomal position of the gene dosage measured by array CGH to the genes measured by the expression array. ACE-it uses this link to statistically test whether gene dosage affects RNA expression. ©

  4. An evolvable oestrogen receptor activity sensor: development of a modular system for integrating multiple genes into the yeast genome

    NARCIS (Netherlands)

    Fox, J.E.; Bridgham, J.T.; Bovee, T.F.H.; Thornton, J.W.

    2007-01-01

    To study a gene interaction network, we developed a gene-targeting strategy that allows efficient and stable genomic integration of multiple genetic constructs at distinct target loci in the yeast genome. This gene-targeting strategy uses a modular plasmid with a recyclable selectable marker and a

  5. Integrating Data Clustering and Visualization for the Analysis of 3D Gene Expression Data

    Energy Technology Data Exchange (ETDEWEB)

    Data Analysis and Visualization (IDAV) and the Department of Computer Science, University of California, Davis, One Shields Avenue, Davis CA 95616, USA,; nternational Research Training Group ``Visualization of Large and Unstructured Data Sets,' ' University of Kaiserslautern, Germany; Computational Research Division, Lawrence Berkeley National Laboratory, One Cyclotron Road, Berkeley, CA 94720, USA; Genomics Division, Lawrence Berkeley National Laboratory, One Cyclotron Road, Berkeley CA 94720, USA; Life Sciences Division, Lawrence Berkeley National Laboratory, One Cyclotron Road, Berkeley CA 94720, USA,; Computer Science Division,University of California, Berkeley, CA, USA,; Computer Science Department, University of California, Irvine, CA, USA,; All authors are with the Berkeley Drosophila Transcription Network Project, Lawrence Berkeley National Laboratory,; Rubel, Oliver; Weber, Gunther H.; Huang, Min-Yu; Bethel, E. Wes; Biggin, Mark D.; Fowlkes, Charless C.; Hendriks, Cris L. Luengo; Keranen, Soile V. E.; Eisen, Michael B.; Knowles, David W.; Malik, Jitendra; Hagen, Hans; Hamann, Bernd

    2008-05-12

    The recent development of methods for extracting precise measurements of spatial gene expression patterns from three-dimensional (3D) image data opens the way for new analyses of the complex gene regulatory networks controlling animal development. We present an integrated visualization and analysis framework that supports user-guided data clustering to aid exploration of these new complex datasets. The interplay of data visualization and clustering-based data classification leads to improved visualization and enables a more detailed analysis than previously possible. We discuss (i) integration of data clustering and visualization into one framework; (ii) application of data clustering to 3D gene expression data; (iii) evaluation of the number of clusters k in the context of 3D gene expression clustering; and (iv) improvement of overall analysis quality via dedicated post-processing of clustering results based on visualization. We discuss the use of this framework to objectively define spatial pattern boundaries and temporal profiles of genes and to analyze how mRNA patterns are controlled by their regulatory transcription factors.

  6. Integration of transcript expression, copy number and LOH analysis of infiltrating ductal carcinoma of the breast

    Directory of Open Access Journals (Sweden)

    Hawthorn Lesleyann

    2010-08-01

    Full Text Available Abstract Background A major challenge in the interpretation of genomic profiling data generated from breast cancer samples is the identification of driver genes as distinct from bystander genes which do not impact tumorigenesis. One way to assess the relative importance of alterations in the transcriptome profile is to combine parallel analyses that assess changes in the copy number alterations (CNAs. This integrated analysis permits the identification of genes with altered expression that map within specific chromosomal regions which demonstrate copy number alterations, providing a mechanistic approach to identify the 'driver genes'. Methods We have performed whole genome analysis of CNAs using the Affymetrix 250K Mapping array on 22 infiltrating ductal carcinoma samples (IDCs. Analysis of transcript expression alterations was performed using the Affymetrix U133 Plus2.0 array on 16 IDC samples. Fourteen IDC samples were analyzed using both platforms and the data integrated. We also incorporated data from loss of heterozygosity (LOH analysis to identify genes showing altered expression in LOH regions. Results Common chromosome gains and amplifications were identified at 1q21.3, 6p21.3, 7p11.2-p12.1, 8q21.11 and 8q24.3. A novel amplicon was identified at 5p15.33. Frequent losses were found at 1p36.22, 8q23.3, 11p13, 11q23, and 22q13. Over 130 genes were identified with concurrent increases or decreases in expression that mapped to these regions of copy number alterations. LOH analysis revealed three tumors with whole chromosome or p arm allelic loss of chromosome 17. Genes were identified that mapped to copy neutral LOH regions. LOH with accompanying copy loss was detected on Xp24 and Xp25 and genes mapping to these regions with decreased expression were identified. Gene expression data highlighted the PPARα/RXRα Activation Pathway as down-regulated in the tumor samples. Conclusion We have demonstrated the utility of the application of

  7. Integration of Genome Scale Metabolic Networks and Gene Regulation of Metabolic Enzymes With Physiologically Based Pharmacokinetics.

    Science.gov (United States)

    Maldonado, Elaina M; Leoncikas, Vytautas; Fisher, Ciarán P; Moore, J Bernadette; Plant, Nick J; Kierzek, Andrzej M

    2017-11-01

    The scope of physiologically based pharmacokinetic (PBPK) modeling can be expanded by assimilation of the mechanistic models of intracellular processes from systems biology field. The genome scale metabolic networks (GSMNs) represent a whole set of metabolic enzymes expressed in human tissues. Dynamic models of the gene regulation of key drug metabolism enzymes are available. Here, we introduce GSMNs and review ongoing work on integration of PBPK, GSMNs, and metabolic gene regulation. We demonstrate example models. © 2017 The Authors CPT: Pharmacometrics & Systems Pharmacology published by Wiley Periodicals, Inc. on behalf of American Society for Clinical Pharmacology and Therapeutics.

  8. Prognostic Biomarker Identification Through Integrating the Gene Signatures of Hepatocellular Carcinoma Properties

    Directory of Open Access Journals (Sweden)

    Jialin Cai

    2017-05-01

    Full Text Available Many molecular classification and prognostic gene signatures for hepatocellular carcinoma (HCC patients have been established based on genome-wide gene expression profiling; however, their generalizability is unclear. Herein, we systematically assessed the prognostic effects of these gene signatures and identified valuable prognostic biomarkers by integrating these gene signatures. With two independent HCC datasets (GSE14520, N = 242 and GSE54236, N = 78, 30 published gene signatures were evaluated, and 11 were significantly associated with the overall survival (OS of postoperative HCC patients in both datasets. The random survival forest models suggested that the gene signatures were superior to clinical characteristics for predicting the prognosis of the patients. Based on the 11 gene signatures, a functional protein-protein interaction (PPI network with 1406 nodes and 10,135 edges was established. With tissue microarrays of HCC patients (N = 60, we determined the prognostic values of the core genes in the network and found that RAD21, CDK1, and HDAC2 expression levels were negatively associated with OS for HCC patients. The multivariate Cox regression analyses suggested that CDK1 was an independent prognostic factor, which was validated in an independent case cohort (N = 78. In cellular models, inhibition of CDK1 by siRNA or a specific inhibitor, RO-3306, reduced cellular proliferation and viability for HCC cells. These results suggest that the prognostic predictive capacities of these gene signatures are reproducible and that CDK1 is a potential prognostic biomarker or therapeutic target for HCC patients.

  9. A computational method based on the integration of heterogeneous networks for predicting disease-gene associations.

    Directory of Open Access Journals (Sweden)

    Xingli Guo

    Full Text Available The identification of disease-causing genes is a fundamental challenge in human health and of great importance in improving medical care, and provides a better understanding of gene functions. Recent computational approaches based on the interactions among human proteins and disease similarities have shown their power in tackling the issue. In this paper, a novel systematic and global method that integrates two heterogeneous networks for prioritizing candidate disease-causing genes is provided, based on the observation that genes causing the same or similar diseases tend to lie close to one another in a network of protein-protein interactions. In this method, the association score function between a query disease and a candidate gene is defined as the weighted sum of all the association scores between similar diseases and neighbouring genes. Moreover, the topological correlation of these two heterogeneous networks can be incorporated into the definition of the score function, and finally an iterative algorithm is designed for this issue. This method was tested with 10-fold cross-validation on all 1,126 diseases that have at least a known causal gene, and it ranked the correct gene as one of the top ten in 622 of all the 1,428 cases, significantly outperforming a state-of-the-art method called PRINCE. The results brought about by this method were applied to study three multi-factorial disorders: breast cancer, Alzheimer disease and diabetes mellitus type 2, and some suggestions of novel causal genes and candidate disease-causing subnetworks were provided for further investigation.

  10. Integrating high dimensional bi-directional parsing models for gene mention tagging.

    Science.gov (United States)

    Hsu, Chun-Nan; Chang, Yu-Ming; Kuo, Cheng-Ju; Lin, Yu-Shi; Huang, Han-Shen; Chung, I-Fang

    2008-07-01

    Tagging gene and gene product mentions in scientific text is an important initial step of literature mining. In this article, we describe in detail our gene mention tagger participated in BioCreative 2 challenge and analyze what contributes to its good performance. Our tagger is based on the conditional random fields model (CRF), the most prevailing method for the gene mention tagging task in BioCreative 2. Our tagger is interesting because it accomplished the highest F-scores among CRF-based methods and second over all. Moreover, we obtained our results by mostly applying open source packages, making it easy to duplicate our results. We first describe in detail how we developed our CRF-based tagger. We designed a very high dimensional feature set that includes most of information that may be relevant. We trained bi-directional CRF models with the same set of features, one applies forward parsing and the other backward, and integrated two models based on the output scores and dictionary filtering. One of the most prominent factors that contributes to the good performance of our tagger is the integration of an additional backward parsing model. However, from the definition of CRF, it appears that a CRF model is symmetric and bi-directional parsing models will produce the same results. We show that due to different feature settings, a CRF model can be asymmetric and the feature setting for our tagger in BioCreative 2 not only produces different results but also gives backward parsing models slight but constant advantage over forward parsing model. To fully explore the potential of integrating bi-directional parsing models, we applied different asymmetric feature settings to generate many bi-directional parsing models and integrate them based on the output scores. Experimental results show that this integrated model can achieve even higher F-score solely based on the training corpus for gene mention tagging. Data sets, programs and an on-line service of our gene

  11. Integrated pathway-based transcription regulation network mining and visualization based on gene expression profiles.

    Science.gov (United States)

    Kibinge, Nelson; Ono, Naoaki; Horie, Masafumi; Sato, Tetsuo; Sugiura, Tadao; Altaf-Ul-Amin, Md; Saito, Akira; Kanaya, Shigehiko

    2016-06-01

    Conventionally, workflows examining transcription regulation networks from gene expression data involve distinct analytical steps. There is a need for pipelines that unify data mining and inference deduction into a singular framework to enhance interpretation and hypotheses generation. We propose a workflow that merges network construction with gene expression data mining focusing on regulation processes in the context of transcription factor driven gene regulation. The pipeline implements pathway-based modularization of expression profiles into functional units to improve biological interpretation. The integrated workflow was implemented as a web application software (TransReguloNet) with functions that enable pathway visualization and comparison of transcription factor activity between sample conditions defined in the experimental design. The pipeline merges differential expression, network construction, pathway-based abstraction, clustering and visualization. The framework was applied in analysis of actual expression datasets related to lung, breast and prostrate cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Exogenous Gene Integration for Microalgal Cell Transformation Using a Nanowire-Incorporated Microdevice.

    Science.gov (United States)

    Bae, Sunwoong; Park, Seunghye; Kim, Jung; Choi, Jong Seob; Kim, Kyung Hoon; Kwon, Donguk; Jin, EonSeon; Park, Inkyu; Kim, Do Hyun; Seo, Tae Seok

    2015-12-16

    Superior green algal cells showing high lipid production and rapid growth rate are considered as an alternative for the next generation green energy resources. To achieve the biomass based energy generation, transformed microalgae with superlative properties should be developed through genetic engineering. Contrary to the normal cells, microalgae have rigid cell walls, so that target gene delivery into cells is challengeable. In this study, we report a ZnO nanowire-incorporated microdevice for a high throughput microalgal transformation. The proposed microdevice was equipped with not only a ZnO nanowire in the microchannel for gene delivery into cells but also a pneumatic polydimethylsiloxane (PDMS) microvalve to modulate the cellular attachment and detachment from the nanowire. As a model, hygromycin B resistance gene cassette (Hyg3) was functionalized on the hydrothermally grown ZnO nanowires through a disulfide bond and released into green algal cells, Chlamydomonas reinhardtii, by reductive cleavage. During Hyg3 gene delivery, a monolithic PDMS membrane was bent down, so that algal cells were pushed down toward ZnO nanowires. The supply of vacuum in the pneumatic line made the PDMS membrane bend up, enabling the gene delivered algal cells to be recovered from the outlet of the microchannel. We successfully confirmed Hyg3 gene integrated in microalgae by amplifying the inserted gene through polymerase chain reaction (PCR) and DNA sequencing. The efficiency of the gene delivery to algal cells using the ZnO nanowire-incorporated microdevice was 6.52 × 10(4)- and 9.66 × 10(4)-fold higher than that of a traditional glass bead beating and electroporation.

  13. Unveiling network-based functional features through integration of gene expression into protein networks.

    Science.gov (United States)

    Jalili, Mahdi; Gebhardt, Tom; Wolkenhauer, Olaf; Salehzadeh-Yazdi, Ali

    2018-06-01

    Decoding health and disease phenotypes is one of the fundamental objectives in biomedicine. Whereas high-throughput omics approaches are available, it is evident that any single omics approach might not be adequate to capture the complexity of phenotypes. Therefore, integrated multi-omics approaches have been used to unravel genotype-phenotype relationships such as global regulatory mechanisms and complex metabolic networks in different eukaryotic organisms. Some of the progress and challenges associated with integrated omics studies have been reviewed previously in comprehensive studies. In this work, we highlight and review the progress, challenges and advantages associated with emerging approaches, integrating gene expression and protein-protein interaction networks to unravel network-based functional features. This includes identifying disease related genes, gene prioritization, clustering protein interactions, developing the modules, extract active subnetworks and static protein complexes or dynamic/temporal protein complexes. We also discuss how these approaches contribute to our understanding of the biology of complex traits and diseases. This article is part of a Special Issue entitled: Cardiac adaptations to obesity, diabetes and insulin resistance, edited by Professors Jan F.C. Glatz, Jason R.B. Dyck and Christine Des Rosiers. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Integration of the Gene Ontology into an object-oriented architecture

    Directory of Open Access Journals (Sweden)

    Zheng W Jim

    2005-05-01

    Full Text Available Abstract Background To standardize gene product descriptions, a formal vocabulary defined as the Gene Ontology (GO has been developed. GO terms have been categorized into biological processes, molecular functions, and cellular components. However, there is no single representation that integrates all the terms into one cohesive model. Furthermore, GO definitions have little information explaining the underlying architecture that forms these terms, such as the dynamic and static events occurring in a process. In contrast, object-oriented models have been developed to show dynamic and static events. A portion of the TGF-beta signaling pathway, which is involved in numerous cellular events including cancer, differentiation and development, was used to demonstrate the feasibility of integrating the Gene Ontology into an object-oriented model. Results Using object-oriented models we have captured the static and dynamic events that occur during a representative GO process, "transforming growth factor-beta (TGF-beta receptor complex assembly" (GO:0007181. Conclusion We demonstrate that the utility of GO terms can be enhanced by object-oriented technology, and that the GO terms can be integrated into an object-oriented model by serving as a basis for the generation of object functions and attributes.

  15. Integrated database for identifying candidate genes for Aspergillus flavus resistance in maize.

    Science.gov (United States)

    Kelley, Rowena Y; Gresham, Cathy; Harper, Jonathan; Bridges, Susan M; Warburton, Marilyn L; Hawkins, Leigh K; Pechanova, Olga; Peethambaran, Bela; Pechan, Tibor; Luthe, Dawn S; Mylroie, J E; Ankala, Arunkanth; Ozkan, Seval; Henry, W B; Williams, W P

    2010-10-07

    Aspergillus flavus Link:Fr, an opportunistic fungus that produces aflatoxin, is pathogenic to maize and other oilseed crops. Aflatoxin is a potent carcinogen, and its presence markedly reduces the value of grain. Understanding and enhancing host resistance to A. flavus infection and/or subsequent aflatoxin accumulation is generally considered an efficient means of reducing grain losses to aflatoxin. Different proteomic, genomic and genetic studies of maize (Zea mays L.) have generated large data sets with the goal of identifying genes responsible for conferring resistance to A. flavus, or aflatoxin. In order to maximize the usage of different data sets in new studies, including association mapping, we have constructed a relational database with web interface integrating the results of gene expression, proteomic (both gel-based and shotgun), Quantitative Trait Loci (QTL) genetic mapping studies, and sequence data from the literature to facilitate selection of candidate genes for continued investigation. The Corn Fungal Resistance Associated Sequences Database (CFRAS-DB) (http://agbase.msstate.edu/) was created with the main goal of identifying genes important to aflatoxin resistance. CFRAS-DB is implemented using MySQL as the relational database management system running on a Linux server, using an Apache web server, and Perl CGI scripts as the web interface. The database and the associated web-based interface allow researchers to examine many lines of evidence (e.g. microarray, proteomics, QTL studies, SNP data) to assess the potential role of a gene or group of genes in the response of different maize lines to A. flavus infection and subsequent production of aflatoxin by the fungus. CFRAS-DB provides the first opportunity to integrate data pertaining to the problem of A. flavus and aflatoxin resistance in maize in one resource and to support queries across different datasets. The web-based interface gives researchers different query options for mining the database

  16. Integration of Genome-Wide TF Binding and Gene Expression Data to Characterize Gene Regulatory Networks in Plant Development.

    Science.gov (United States)

    Chen, Dijun; Kaufmann, Kerstin

    2017-01-01

    Key transcription factors (TFs) controlling the morphogenesis of flowers and leaves have been identified in the model plant Arabidopsis thaliana. Recent genome-wide approaches based on chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) enable systematic identification of genome-wide TF binding sites (TFBSs) of these regulators. Here, we describe a computational pipeline for analyzing ChIP-seq data to identify TFBSs and to characterize gene regulatory networks (GRNs) with applications to the regulatory studies of flower development. In particular, we provide step-by-step instructions on how to download, analyze, visualize, and integrate genome-wide data in order to construct GRNs for beginners of bioinformatics. The practical guide presented here is ready to apply to other similar ChIP-seq datasets to characterize GRNs of interest.

  17. Multiclass classification for skin cancer profiling based on the integration of heterogeneous gene expression series.

    Science.gov (United States)

    Gálvez, Juan Manuel; Castillo, Daniel; Herrera, Luis Javier; San Román, Belén; Valenzuela, Olga; Ortuño, Francisco Manuel; Rojas, Ignacio

    2018-01-01

    Most of the research studies developed applying microarray technology to the characterization of different pathological states of any disease may fail in reaching statistically significant results. This is largely due to the small repertoire of analysed samples, and to the limitation in the number of states or pathologies usually addressed. Moreover, the influence of potential deviations on the gene expression quantification is usually disregarded. In spite of the continuous changes in omic sciences, reflected for instance in the emergence of new Next-Generation Sequencing-related technologies, the existing availability of a vast amount of gene expression microarray datasets should be properly exploited. Therefore, this work proposes a novel methodological approach involving the integration of several heterogeneous skin cancer series, and a later multiclass classifier design. This approach is thus a way to provide the clinicians with an intelligent diagnosis support tool based on the use of a robust set of selected biomarkers, which simultaneously distinguishes among different cancer-related skin states. To achieve this, a multi-platform combination of microarray datasets from Affymetrix and Illumina manufacturers was carried out. This integration is expected to strengthen the statistical robustness of the study as well as the finding of highly-reliable skin cancer biomarkers. Specifically, the designed operation pipeline has allowed the identification of a small subset of 17 differentially expressed genes (DEGs) from which to distinguish among 7 involved skin states. These genes were obtained from the assessment of a number of potential batch effects on the gene expression data. The biological interpretation of these genes was inspected in the specific literature to understand their underlying information in relation to skin cancer. Finally, in order to assess their possible effectiveness in cancer diagnosis, a cross-validation Support Vector Machines (SVM

  18. Integrative Expression of Glucoamylase Gene in a Brewer’s Yeast Saccharomyces pastorianus Strain

    Directory of Open Access Journals (Sweden)

    Guangyi Zhang

    2008-01-01

    Full Text Available The recombinant brewer’s yeast Saccharomyces pastorianus strain was constructed byintroducing the ilv2:GLA fragment released from pMGI6, carrying glucoamylase gene (GLA and using the yeast α-acetolactate synthase gene (ILV2 as the recombination sequence. The strain was able to utilise starch as the sole carbon source, its glucoamylase activity was 6.3 U/mL and its α-acetolactate synthase activity was lowered by 33.3 %. The introduced GLA gene was integrated at the recipient genomic ILV2 gene, one copy of ILV2 gene was disrupted and the other copy remained intact. Primary wort fermentation test confirmed that the diacetyl and residual sugar concentration in the wort fermented by the recombinant strain were reduced by 65.6 and 34.2 % respectively, compared to that of the recipient strain. Under industrial operating conditions, the maturation time of beer fermented by the recombinant strain was reduced from 7 to 4 days, there were no significant differences in the appearance and mouthfeel, and the beer satisfied the high quality demands. That is why the strain could be used in beer production safely.

  19. Integrative analysis of gene expression and DNA methylation using unsupervised feature extraction for detecting candidate cancer biomarkers.

    Science.gov (United States)

    Moon, Myungjin; Nakai, Kenta

    2018-04-01

    Currently, cancer biomarker discovery is one of the important research topics worldwide. In particular, detecting significant genes related to cancer is an important task for early diagnosis and treatment of cancer. Conventional studies mostly focus on genes that are differentially expressed in different states of cancer; however, noise in gene expression datasets and insufficient information in limited datasets impede precise analysis of novel candidate biomarkers. In this study, we propose an integrative analysis of gene expression and DNA methylation using normalization and unsupervised feature extractions to identify candidate biomarkers of cancer using renal cell carcinoma RNA-seq datasets. Gene expression and DNA methylation datasets are normalized by Box-Cox transformation and integrated into a one-dimensional dataset that retains the major characteristics of the original datasets by unsupervised feature extraction methods, and differentially expressed genes are selected from the integrated dataset. Use of the integrated dataset demonstrated improved performance as compared with conventional approaches that utilize gene expression or DNA methylation datasets alone. Validation based on the literature showed that a considerable number of top-ranked genes from the integrated dataset have known relationships with cancer, implying that novel candidate biomarkers can also be acquired from the proposed analysis method. Furthermore, we expect that the proposed method can be expanded for applications involving various types of multi-omics datasets.

  20. Inferring dynamic gene regulatory networks in cardiac differentiation through the integration of multi-dimensional data.

    Science.gov (United States)

    Gong, Wuming; Koyano-Nakagawa, Naoko; Li, Tongbin; Garry, Daniel J

    2015-03-07

    Decoding the temporal control of gene expression patterns is key to the understanding of the complex mechanisms that govern developmental decisions during heart development. High-throughput methods have been employed to systematically study the dynamic and coordinated nature of cardiac differentiation at the global level with multiple dimensions. Therefore, there is a pressing need to develop a systems approach to integrate these data from individual studies and infer the dynamic regulatory networks in an unbiased fashion. We developed a two-step strategy to integrate data from (1) temporal RNA-seq, (2) temporal histone modification ChIP-seq, (3) transcription factor (TF) ChIP-seq and (4) gene perturbation experiments to reconstruct the dynamic network during heart development. First, we trained a logistic regression model to predict the probability (LR score) of any base being bound by 543 TFs with known positional weight matrices. Second, four dimensions of data were combined using a time-varying dynamic Bayesian network model to infer the dynamic networks at four developmental stages in the mouse [mouse embryonic stem cells (ESCs), mesoderm (MES), cardiac progenitors (CP) and cardiomyocytes (CM)]. Our method not only infers the time-varying networks between different stages of heart development, but it also identifies the TF binding sites associated with promoter or enhancers of downstream genes. The LR scores of experimentally verified ESCs and heart enhancers were significantly higher than random regions (p network inference model identified a region with an elevated LR score approximately -9400 bp upstream of the transcriptional start site of Nkx2-5, which overlapped with a previously reported enhancer region (-9435 to -8922 bp). TFs such as Tead1, Gata4, Msx2, and Tgif1 were predicted to bind to this region and participate in the regulation of Nkx2-5 gene expression. Our model also predicted the key regulatory networks for the ESC-MES, MES-CP and CP

  1. An integrated analysis of miRNA and gene copy numbers in xenografts of Ewing's sarcoma

    Directory of Open Access Journals (Sweden)

    Mosakhani Neda

    2012-03-01

    Full Text Available Abstract Background Xenografts have been shown to provide a suitable source of tumor tissue for molecular analysis in the absence of primary tumor material. We utilized ES xenograft series for integrated microarray analyses to identify novel biomarkers. Method Microarray technology (array comparative genomic hybridization (aCGH and micro RNA arrays was used to screen and identify copy number changes and differentially expressed miRNAs of 34 and 14 passages, respectively. Incubated cells used for xenografting (Passage 0 were considered to represent the primary tumor. Four important differentially expressed miRNAs (miR-31, miR-31*, miR-145, miR-106 were selected for further validation by real time polymerase chain reaction (RT-PCR. Integrated analysis of aCGH and miRNA data was performed on 14 xenograft passages by bioinformatic methods. Results The most frequent losses and gains of DNA copy number were detected at 9p21.3, 16q and at 8, 15, 17q21.32-qter, 1q21.1-qter, respectively. The presence of these alterations was consistent in all tumor passages. aCGH profiles of xenograft passages of each series resembled their corresponding primary tumors (passage 0. MiR-21, miR-31, miR-31*, miR-106b, miR-145, miR-150*, miR-371-5p, miR-557 and miR-598 showed recurrently altered expression. These miRNAS were predicted to regulate many ES-associated genes, such as genes of the IGF1 pathway, EWSR1, FLI1 and their fusion gene (EWS-FLI1. Twenty differentially expressed miRNAs were pinpointed in regions carrying altered copy numbers. Conclusion In the present study, ES xenografts were successfully applied for integrated microarray analyses. Our findings showed expression changes of miRNAs that were predicted to regulate many ES associated genes, such as IGF1 pathway genes, FLI1, EWSR1, and the EWS-FLI1 fusion genes.

  2. Dynamic changes in protein functional linkage networks revealed by integration with gene expression data.

    Directory of Open Access Journals (Sweden)

    Shubhada R Hegde

    2008-11-01

    Full Text Available Response of cells to changing environmental conditions is governed by the dynamics of intricate biomolecular interactions. It may be reasonable to assume, proteins being the dominant macromolecules that carry out routine cellular functions, that understanding the dynamics of protein:protein interactions might yield useful insights into the cellular responses. The large-scale protein interaction data sets are, however, unable to capture the changes in the profile of protein:protein interactions. In order to understand how these interactions change dynamically, we have constructed conditional protein linkages for Escherichia coli by integrating functional linkages and gene expression information. As a case study, we have chosen to analyze UV exposure in wild-type and SOS deficient E. coli at 20 minutes post irradiation. The conditional networks exhibit similar topological properties. Although the global topological properties of the networks are similar, many subtle local changes are observed, which are suggestive of the cellular response to the perturbations. Some such changes correspond to differences in the path lengths among the nodes of carbohydrate metabolism correlating with its loss in efficiency in the UV treated cells. Similarly, expression of hubs under unique conditions reflects the importance of these genes. Various centrality measures applied to the networks indicate increased importance for replication, repair, and other stress proteins for the cells under UV treatment, as anticipated. We thus propose a novel approach for studying an organism at the systems level by integrating genome-wide functional linkages and the gene expression data.

  3. High-throughput monitoring of integration site clonality in preclinical and clinical gene therapy studies

    Directory of Open Access Journals (Sweden)

    Frank A Giordano

    Full Text Available Gene transfer to hematopoietic stem cells with integrating vectors not only allows sustained correction of monogenic diseases but also tracking of individual clones in vivo. Quantitative real-time PCR (qPCR has been shown to be an accurate method to quantify individual stem cell clones, yet due to frequently limited amounts of target material (especially in clinical studies, it is not useful for large-scale analyses. To explore whether vector integration site (IS recovery techniques may be suitable to describe clonal contributions if combined with next-generation sequencing techniques, we designed artificial ISs of different sizes which were mixed to simulate defined clonal situations in clinical settings. We subjected all mixes to either linear amplification–mediated PCR (LAM-PCR or nonrestrictive LAM-PCR (nrLAM-PCR, both combined with 454 sequencing. We showed that nrLAM-PCR/454-detected clonality allows estimating qPCR-detected clonality in vitro. We then followed the kinetics of two clones detected in a patient enrolled in a clinical gene therapy trial using both, nrLAM-PCR/454 and qPCR and also saw nrLAM-PCR/454 to correlate to qPCR-measured clonal contributions. The method presented here displays a feasible high-throughput strategy to monitor clonality in clinical gene therapy trials is at hand.

  4. Construction of an integrated gene regulatory network link to stress-related immune system in cattle.

    Science.gov (United States)

    Behdani, Elham; Bakhtiarizadeh, Mohammad Reza

    2017-10-01

    The immune system is an important biological system that is negatively impacted by stress. This study constructed an integrated regulatory network to enhance our understanding of the regulatory gene network used in the stress-related immune system. Module inference was used to construct modules of co-expressed genes with bovine leukocyte RNA-Seq data. Transcription factors (TFs) were then assigned to these modules using Lemon-Tree algorithms. In addition, the TFs assigned to each module were confirmed using the promoter analysis and protein-protein interactions data. Therefore, our integrated method identified three TFs which include one TF that is previously known to be involved in immune response (MYBL2) and two TFs (E2F8 and FOXS1) that had not been recognized previously and were identified for the first time in this study as novel regulatory candidates in immune response. This study provides valuable insights on the regulatory programs of genes involved in the stress-related immune system.

  5. A Bayesian Framework That Integrates Heterogeneous Data for Inferring Gene Regulatory Networks

    Energy Technology Data Exchange (ETDEWEB)

    Santra, Tapesh, E-mail: tapesh.santra@ucd.ie [Systems Biology Ireland, University College Dublin, Dublin (Ireland)

    2014-05-20

    Reconstruction of gene regulatory networks (GRNs) from experimental data is a fundamental challenge in systems biology. A number of computational approaches have been developed to infer GRNs from mRNA expression profiles. However, expression profiles alone are proving to be insufficient for inferring GRN topologies with reasonable accuracy. Recently, it has been shown that integration of external data sources (such as gene and protein sequence information, gene ontology data, protein–protein interactions) with mRNA expression profiles may increase the reliability of the inference process. Here, I propose a new approach that incorporates transcription factor binding sites (TFBS) and physical protein interactions (PPI) among transcription factors (TFs) in a Bayesian variable selection (BVS) algorithm which can infer GRNs from mRNA expression profiles subjected to genetic perturbations. Using real experimental data, I show that the integration of TFBS and PPI data with mRNA expression profiles leads to significantly more accurate networks than those inferred from expression profiles alone. Additionally, the performance of the proposed algorithm is compared with a series of least absolute shrinkage and selection operator (LASSO) regression-based network inference methods that can also incorporate prior knowledge in the inference framework. The results of this comparison suggest that BVS can outperform LASSO regression-based method in some circumstances.

  6. A Bayesian Framework That Integrates Heterogeneous Data for Inferring Gene Regulatory Networks

    International Nuclear Information System (INIS)

    Santra, Tapesh

    2014-01-01

    Reconstruction of gene regulatory networks (GRNs) from experimental data is a fundamental challenge in systems biology. A number of computational approaches have been developed to infer GRNs from mRNA expression profiles. However, expression profiles alone are proving to be insufficient for inferring GRN topologies with reasonable accuracy. Recently, it has been shown that integration of external data sources (such as gene and protein sequence information, gene ontology data, protein–protein interactions) with mRNA expression profiles may increase the reliability of the inference process. Here, I propose a new approach that incorporates transcription factor binding sites (TFBS) and physical protein interactions (PPI) among transcription factors (TFs) in a Bayesian variable selection (BVS) algorithm which can infer GRNs from mRNA expression profiles subjected to genetic perturbations. Using real experimental data, I show that the integration of TFBS and PPI data with mRNA expression profiles leads to significantly more accurate networks than those inferred from expression profiles alone. Additionally, the performance of the proposed algorithm is compared with a series of least absolute shrinkage and selection operator (LASSO) regression-based network inference methods that can also incorporate prior knowledge in the inference framework. The results of this comparison suggest that BVS can outperform LASSO regression-based method in some circumstances.

  7. Integrating genome-wide association study and expression quantitative trait loci data identifies multiple genes and gene set associated with neuroticism.

    Science.gov (United States)

    Fan, Qianrui; Wang, Wenyu; Hao, Jingcan; He, Awen; Wen, Yan; Guo, Xiong; Wu, Cuiyan; Ning, Yujie; Wang, Xi; Wang, Sen; Zhang, Feng

    2017-08-01

    Neuroticism is a fundamental personality trait with significant genetic determinant. To identify novel susceptibility genes for neuroticism, we conducted an integrative analysis of genomic and transcriptomic data of genome wide association study (GWAS) and expression quantitative trait locus (eQTL) study. GWAS summary data was driven from published studies of neuroticism, totally involving 170,906 subjects. eQTL dataset containing 927,753 eQTLs were obtained from an eQTL meta-analysis of 5311 samples. Integrative analysis of GWAS and eQTL data was conducted by summary data-based Mendelian randomization (SMR) analysis software. To identify neuroticism associated gene sets, the SMR analysis results were further subjected to gene set enrichment analysis (GSEA). The gene set annotation dataset (containing 13,311 annotated gene sets) of GSEA Molecular Signatures Database was used. SMR single gene analysis identified 6 significant genes for neuroticism, including MSRA (p value=2.27×10 -10 ), MGC57346 (p value=6.92×10 -7 ), BLK (p value=1.01×10 -6 ), XKR6 (p value=1.11×10 -6 ), C17ORF69 (p value=1.12×10 -6 ) and KIAA1267 (p value=4.00×10 -6 ). Gene set enrichment analysis observed significant association for Chr8p23 gene set (false discovery rate=0.033). Our results provide novel clues for the genetic mechanism studies of neuroticism. Copyright © 2017. Published by Elsevier Inc.

  8. Dovetailing biology and chemistry: integrating the Gene Ontology with the ChEBI chemical ontology

    Science.gov (United States)

    2013-01-01

    Background The Gene Ontology (GO) facilitates the description of the action of gene products in a biological context. Many GO terms refer to chemical entities that participate in biological processes. To facilitate accurate and consistent systems-wide biological representation, it is necessary to integrate the chemical view of these entities with the biological view of GO functions and processes. We describe a collaborative effort between the GO and the Chemical Entities of Biological Interest (ChEBI) ontology developers to ensure that the representation of chemicals in the GO is both internally consistent and in alignment with the chemical expertise captured in ChEBI. Results We have examined and integrated the ChEBI structural hierarchy into the GO resource through computationally-assisted manual curation of both GO and ChEBI. Our work has resulted in the creation of computable definitions of GO terms that contain fully defined semantic relationships to corresponding chemical terms in ChEBI. Conclusions The set of logical definitions using both the GO and ChEBI has already been used to automate aspects of GO development and has the potential to allow the integration of data across the domains of biology and chemistry. These logical definitions are available as an extended version of the ontology from http://purl.obolibrary.org/obo/go/extensions/go-plus.owl. PMID:23895341

  9. Integrating network, sequence and functional features using machine learning approaches towards identification of novel Alzheimer genes.

    Science.gov (United States)

    Jamal, Salma; Goyal, Sukriti; Shanker, Asheesh; Grover, Abhinav

    2016-10-18

    Alzheimer's disease (AD) is a complex progressive neurodegenerative disorder commonly characterized by short term memory loss. Presently no effective therapeutic treatments exist that can completely cure this disease. The cause of Alzheimer's is still unclear, however one of the other major factors involved in AD pathogenesis are the genetic factors and around 70 % risk of the disease is assumed to be due to the large number of genes involved. Although genetic association studies have revealed a number of potential AD susceptibility genes, there still exists a need for identification of unidentified AD-associated genes and therapeutic targets to have better understanding of the disease-causing mechanisms of Alzheimer's towards development of effective AD therapeutics. In the present study, we have used machine learning approach to identify candidate AD associated genes by integrating topological properties of the genes from the protein-protein interaction networks, sequence features and functional annotations. We also used molecular docking approach and screened already known anti-Alzheimer drugs against the novel predicted probable targets of AD and observed that an investigational drug, AL-108, had high affinity for majority of the possible therapeutic targets. Furthermore, we performed molecular dynamics simulations and MM/GBSA calculations on the docked complexes to validate our preliminary findings. To the best of our knowledge, this is the first comprehensive study of its kind for identification of putative Alzheimer-associated genes using machine learning approaches and we propose that such computational studies can improve our understanding on the core etiology of AD which could lead to the development of effective anti-Alzheimer drugs.

  10. Changes in the topology of gene expression networks by human immunodeficiency virus type 1 (HIV-1) integration in macrophages.

    Science.gov (United States)

    Soto-Girón, María Juliana; García-Vallejo, Felipe

    2012-01-01

    One key step of human immunodeficiency virus type 1 (HIV-1) infection is the integration of its viral cDNA. This process is mediated through complex networks of host-virus interactions that alter several normal cell functions of the host. To study the complexity of disturbances in cell gene expression networks by HIV-1 integration, we constructed a network of human macrophage genes located close to chromatin regions rich in proviruses. To perform the network analysis, we selected 28 genes previously identified as the target of cDNA integration and their transcriptional profiles were obtained from GEO Profiles (NCBI). A total of 2770 interactions among the 28 genes located around the HIV-1 proviruses in human macrophages formed a highly dense main network connected to five sub-networks. The overall network was significantly enriched by genes associated with signal transduction, cellular communication and regulatory processes. To simulate the effects of HIV-1 integration in infected macrophages, five genes with the most number of interaction in the normal network were turned off by putting in zero the correspondent expression values. The HIV-1 infected network showed changes in its topology and alteration in the macrophage functions reflected in a re-programming of biosynthetic and general metabolic process. Understanding the complex virus-host interactions that occur during HIV-1 integration, may provided valuable genomic information to develop new antiviral treatments focusing on the management of some specific gene expression networks associated with viral integration. This is the first gene network which describes the human macrophages genes interactions related with HIV-1 integration. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Integration of transcriptome and whole genomic resequencing data to identify key genes affecting swine fat deposition.

    Directory of Open Access Journals (Sweden)

    Kai Xing

    Full Text Available Fat deposition is highly correlated with the growth, meat quality, reproductive performance and immunity of pigs. Fatty acid synthesis takes place mainly in the adipose tissue of pigs; therefore, in this study, a high-throughput massively parallel sequencing approach was used to generate adipose tissue transcriptomes from two groups of Songliao black pigs that had opposite backfat thickness phenotypes. The total number of paired-end reads produced for each sample was in the range of 39.29-49.36 millions. Approximately 188 genes were differentially expressed in adipose tissue and were enriched for metabolic processes, such as fatty acid biosynthesis, lipid synthesis, metabolism of fatty acids, etinol, caffeine and arachidonic acid and immunity. Additionally, many genetic variations were detected between the two groups through pooled whole-genome resequencing. Integration of transcriptome and whole-genome resequencing data revealed important genomic variations among the differentially expressed genes for fat deposition, for example, the lipogenic genes. Further studies are required to investigate the roles of candidate genes in fat deposition to improve pig breeding programs.

  12. Integrative analysis of copy number and gene expression data suggests novel pathogenetic mechanisms in primary myelofibrosis.

    Science.gov (United States)

    Salati, Simona; Zini, Roberta; Nuzzo, Simona; Guglielmelli, Paola; Pennucci, Valentina; Prudente, Zelia; Ruberti, Samantha; Rontauroli, Sebastiano; Norfo, Ruggiero; Bianchi, Elisa; Bogani, Costanza; Rotunno, Giada; Fanelli, Tiziana; Mannarelli, Carmela; Rosti, Vittorio; Salmoiraghi, Silvia; Pietra, Daniela; Ferrari, Sergio; Barosi, Giovanni; Rambaldi, Alessandro; Cazzola, Mario; Bicciato, Silvio; Tagliafico, Enrico; Vannucchi, Alessandro M; Manfredini, Rossella

    2016-04-01

    Primary myelofibrosis (PMF) is a Myeloproliferative Neoplasm (MPN) characterized by megakaryocyte hyperplasia, progressive bone marrow fibrosis, extramedullary hematopoiesis and transformation to Acute Myeloid Leukemia (AML). A number of phenotypic driver (JAK2, CALR, MPL) and additional subclonal mutations have been described in PMF, pointing to a complex genomic landscape. To discover novel genomic lesions that can contribute to disease phenotype and/or development, gene expression and copy number signals were integrated and several genomic abnormalities leading to a concordant alteration in gene expression levels were identified. In particular, copy number gain in the polyamine oxidase (PAOX) gene locus was accompanied by a coordinated transcriptional up-regulation in PMF patients. PAOX inhibition resulted in rapid cell death of PMF progenitor cells, while sparing normal cells, suggesting that PAOX inhibition could represent a therapeutic strategy to selectively target PMF cells without affecting normal hematopoietic cells' survival. Moreover, copy number loss in the chromatin modifier HMGXB4 gene correlates with a concomitant transcriptional down-regulation in PMF patients. Interestingly, silencing of HMGXB4 induces megakaryocyte differentiation, while inhibiting erythroid development, in human hematopoietic stem/progenitor cells. These results highlight a previously un-reported, yet potentially interesting role of HMGXB4 in the hematopoietic system and suggest that genomic and transcriptional imbalances of HMGXB4 could contribute to the aberrant expansion of the megakaryocytic lineage that characterizes PMF patients. © 2015 UICC.

  13. Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.

    Science.gov (United States)

    Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C

    2018-06-27

    Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.

  14. A Microchip for Integrated Single-Cell Gene Expression Profiling and Genotoxicity Detection

    Directory of Open Access Journals (Sweden)

    Hui Dong

    2016-09-01

    Full Text Available Microfluidics-based single-cell study is an emerging approach in personalized treatment or precision medicine studies. Single-cell gene expression holds a potential to provide treatment selections with maximized efficacy to help cancer patients based on a genetic understanding of their disease. This work presents a multi-layer microchip for single-cell multiplexed gene expression profiling and genotoxicity detection. Treated by three drug reagents (i.e., methyl methanesulfonate, docetaxel and colchicine with varied concentrations and time lengths, individual human cancer cells (MDA-MB-231 are lysed on-chip, and the released mRNA templates are captured and reversely transcribed into single strand DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, cyclin-dependent kinase inhibitor 1A (CDKN1A, and aurora kinase A (AURKA genes from single cells are amplified and real-time quantified through multiplex polymerase chain reaction. The microchip is capable of integrating all steps of single-cell multiplexed gene expression profiling, and providing precision detection of drug induced genotoxic stress. Throughput has been set to be 18, and can be further increased following the same approach. Numerical simulation of on-chip single cell trapping and heat transfer has been employed to evaluate the chip design and operation.

  15. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Science.gov (United States)

    Bershtein, Shimon; Serohijos, Adrian W R; Bhattacharyya, Sanchari; Manhart, Michael; Choi, Jeong-Mo; Mu, Wanmeng; Zhou, Jingwen; Shakhnovich, Eugene I

    2015-10-01

    Horizontal gene transfer (HGT) plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR), with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90%) in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM), correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the intracellular

  16. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Directory of Open Access Journals (Sweden)

    Shimon Bershtein

    2015-10-01

    Full Text Available Horizontal gene transfer (HGT plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR, with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90% in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM, correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the

  17. In vitro analysis of integrated global high-resolution DNA methylation profiling with genomic imbalance and gene expression in osteosarcoma.

    Directory of Open Access Journals (Sweden)

    Bekim Sadikovic

    Full Text Available Genetic and epigenetic changes contribute to deregulation of gene expression and development of human cancer. Changes in DNA methylation are key epigenetic factors regulating gene expression and genomic stability. Recent progress in microarray technologies resulted in developments of high resolution platforms for profiling of genetic, epigenetic and gene expression changes. OS is a pediatric bone tumor with characteristically high level of numerical and structural chromosomal changes. Furthermore, little is known about DNA methylation changes in OS. Our objective was to develop an integrative approach for analysis of high-resolution epigenomic, genomic, and gene expression profiles in order to identify functional epi/genomic differences between OS cell lines and normal human osteoblasts. A combination of Affymetrix Promoter Tilling Arrays for DNA methylation, Agilent array-CGH platform for genomic imbalance and Affymetrix Gene 1.0 platform for gene expression analysis was used. As a result, an integrative high-resolution approach for interrogation of genome-wide tumour-specific changes in DNA methylation was developed. This approach was used to provide the first genomic DNA methylation maps, and to identify and validate genes with aberrant DNA methylation in OS cell lines. This first integrative analysis of global cancer-related changes in DNA methylation, genomic imbalance, and gene expression has provided comprehensive evidence of the cumulative roles of epigenetic and genetic mechanisms in deregulation of gene expression networks.

  18. Integrated analysis of gene expression, CpG island methylation, and gene copy number in breast cancer cells by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Zhifu Sun

    Full Text Available We used deep sequencing technology to profile the transcriptome, gene copy number, and CpG island methylation status simultaneously in eight commonly used breast cell lines to develop a model for how these genomic features are integrated in estrogen receptor positive (ER+ and negative breast cancer. Total mRNA sequence, gene copy number, and genomic CpG island methylation were carried out using the Illumina Genome Analyzer. Sequences were mapped to the human genome to obtain digitized gene expression data, DNA copy number in reference to the non-tumor cell line (MCF10A, and methylation status of 21,570 CpG islands to identify differentially expressed genes that were correlated with methylation or copy number changes. These were evaluated in a dataset from 129 primary breast tumors. Gene expression in cell lines was dominated by ER-associated genes. ER+ and ER- cell lines formed two distinct, stable clusters, and 1,873 genes were differentially expressed in the two groups. Part of chromosome 8 was deleted in all ER- cells and part of chromosome 17 amplified in all ER+ cells. These loci encoded 30 genes that were overexpressed in ER+ cells; 9 of these genes were overexpressed in ER+ tumors. We identified 149 differentially expressed genes that exhibited differential methylation of one or more CpG islands within 5 kb of the 5' end of the gene and for which mRNA abundance was inversely correlated with CpG island methylation status. In primary tumors we identified 84 genes that appear to be robust components of the methylation signature that we identified in ER+ cell lines. Our analyses reveal a global pattern of differential CpG island methylation that contributes to the transcriptome landscape of ER+ and ER- breast cancer cells and tumors. The role of gene amplification/deletion appears to more modest, although several potentially significant genes appear to be regulated by copy number aberrations.

  19. Integrated genomic and gene expression profiling identifies two major genomic circuits in urothelial carcinoma.

    Directory of Open Access Journals (Sweden)

    David Lindgren

    Full Text Available Similar to other malignancies, urothelial carcinoma (UC is characterized by specific recurrent chromosomal aberrations and gene mutations. However, the interconnection between specific genomic alterations, and how patterns of chromosomal alterations adhere to different molecular subgroups of UC, is less clear. We applied tiling resolution array CGH to 146 cases of UC and identified a number of regions harboring recurrent focal genomic amplifications and deletions. Several potential oncogenes were included in the amplified regions, including known oncogenes like E2F3, CCND1, and CCNE1, as well as new candidate genes, such as SETDB1 (1q21, and BCL2L1 (20q11. We next combined genome profiling with global gene expression, gene mutation, and protein expression data and identified two major genomic circuits operating in urothelial carcinoma. The first circuit was characterized by FGFR3 alterations, overexpression of CCND1, and 9q and CDKN2A deletions. The second circuit was defined by E3F3 amplifications and RB1 deletions, as well as gains of 5p, deletions at PTEN and 2q36, 16q, 20q, and elevated CDKN2A levels. TP53/MDM2 alterations were common for advanced tumors within the two circuits. Our data also suggest a possible RAS/RAF circuit. The tumors with worst prognosis showed a gene expression profile that indicated a keratinized phenotype. Taken together, our integrative approach revealed at least two separate networks of genomic alterations linked to the molecular diversity seen in UC, and that these circuits may reflect distinct pathways of tumor development.

  20. Selectable tolerance to herbicides by mutated acetolactate synthase genes integrated into the chloroplast genome of tobacco.

    Science.gov (United States)

    Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu

    2008-08-01

    Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.

  1. Simultaneous inference of phenotype-associated genes and relevant tissues from GWAS data via Bayesian integration of multiple tissue-specific gene networks.

    Science.gov (United States)

    Wu, Mengmeng; Lin, Zhixiang; Ma, Shining; Chen, Ting; Jiang, Rui; Wong, Wing Hung

    2017-12-01

    Although genome-wide association studies (GWAS) have successfully identified thousands of genomic loci associated with hundreds of complex traits in the past decade, the debate about such problems as missing heritability and weak interpretability has been appealing for effective computational methods to facilitate the advanced analysis of the vast volume of existing and anticipated genetic data. Towards this goal, gene-level integrative GWAS analysis with the assumption that genes associated with a phenotype tend to be enriched in biological gene sets or gene networks has recently attracted much attention, due to such advantages as straightforward interpretation, less multiple testing burdens, and robustness across studies. However, existing methods in this category usually exploit non-tissue-specific gene networks and thus lack the ability to utilize informative tissue-specific characteristics. To overcome this limitation, we proposed a Bayesian approach called SIGNET (Simultaneously Inference of GeNEs and Tissues) to integrate GWAS data and multiple tissue-specific gene networks for the simultaneous inference of phenotype-associated genes and relevant tissues. Through extensive simulation studies, we showed the effectiveness of our method in finding both associated genes and relevant tissues for a phenotype. In applications to real GWAS data of 14 complex phenotypes, we demonstrated the power of our method in both deciphering genetic basis and discovering biological insights of a phenotype. With this understanding, we expect to see SIGNET as a valuable tool for integrative GWAS analysis, thereby boosting the prevention, diagnosis, and treatment of human inherited diseases and eventually facilitating precision medicine.

  2. GeneLab Phase 2: Integrated Search Data Federation of Space Biology Experimental Data

    Science.gov (United States)

    Tran, P. B.; Berrios, D. C.; Gurram, M. M.; Hashim, J. C. M.; Raghunandan, S.; Lin, S. Y.; Le, T. Q.; Heher, D. M.; Thai, H. T.; Welch, J. D.; hide

    2016-01-01

    The GeneLab project is a science initiative to maximize the scientific return of omics data collected from spaceflight and from ground simulations of microgravity and radiation experiments, supported by a data system for a public bioinformatics repository and collaborative analysis tools for these data. The mission of GeneLab is to maximize the utilization of the valuable biological research resources aboard the ISS by collecting genomic, transcriptomic, proteomic and metabolomic (so-called omics) data to enable the exploration of the molecular network responses of terrestrial biology to space environments using a systems biology approach. All GeneLab data are made available to a worldwide network of researchers through its open-access data system. GeneLab is currently being developed by NASA to support Open Science biomedical research in order to enable the human exploration of space and improve life on earth. Open access to Phase 1 of the GeneLab Data Systems (GLDS) was implemented in April 2015. Download volumes have grown steadily, mirroring the growth in curated space biology research data sets (61 as of June 2016), now exceeding 10 TB/month, with over 10,000 file downloads since the start of Phase 1. For the period April 2015 to May 2016, most frequently downloaded were data from studies of Mus musculus (39) followed closely by Arabidopsis thaliana (30), with the remaining downloads roughly equally split across 12 other organisms (each 10 of total downloads). GLDS Phase 2 is focusing on interoperability, supporting data federation, including integrated search capabilities, of GLDS-housed data sets with external data sources, such as gene expression data from NIHNCBIs Gene Expression Omnibus (GEO), proteomic data from EBIs PRIDE system, and metagenomic data from Argonne National Laboratory's MG-RAST. GEO and MG-RAST employ specifications for investigation metadata that are different from those used by the GLDS and PRIDE (e.g., ISA-Tab). The GLDS Phase 2 system

  3. DISEASES: text mining and data integration of disease-gene associations.

    Science.gov (United States)

    Pletscher-Frankild, Sune; Pallejà, Albert; Tsafou, Kalliopi; Binder, Janos X; Jensen, Lars Juhl

    2015-03-01

    Text mining is a flexible technology that can be applied to numerous different tasks in biology and medicine. We present a system for extracting disease-gene associations from biomedical abstracts. The system consists of a highly efficient dictionary-based tagger for named entity recognition of human genes and diseases, which we combine with a scoring scheme that takes into account co-occurrences both within and between sentences. We show that this approach is able to extract half of all manually curated associations with a false positive rate of only 0.16%. Nonetheless, text mining should not stand alone, but be combined with other types of evidence. For this reason, we have developed the DISEASES resource, which integrates the results from text mining with manually curated disease-gene associations, cancer mutation data, and genome-wide association studies from existing databases. The DISEASES resource is accessible through a web interface at http://diseases.jensenlab.org/, where the text-mining software and all associations are also freely available for download. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  4. SR proteins in vertical integration of gene expression from transcription to RNA processing to translation.

    Science.gov (United States)

    Zhong, Xiang-Yang; Wang, Pingping; Han, Joonhee; Rosenfeld, Michael G; Fu, Xiang-Dong

    2009-07-10

    SR proteins have been studied extensively as a family of RNA-binding proteins that participate in both constitutive and regulated pre-mRNA splicing in mammalian cells. However, SR proteins were first discovered as factors that interact with transcriptionally active chromatin. Recent studies have now uncovered properties that connect these once apparently disparate functions, showing that a subset of SR proteins seem to bind directly to the histone 3 tail, play an active role in transcriptional elongation, and colocalize with genes that are engaged in specific intra- and interchromosome interactions for coordinated regulation of gene expression in the nucleus. These transcription-related activities are also coupled with a further expansion of putative functions of specific SR protein family members in RNA metabolism downstream of mRNA splicing, from RNA export to stability control to translation. These findings, therefore, highlight the broader roles of SR proteins in vertical integration of gene expression and provide mechanistic insights into their contributions to genome stability and proper cell-cycle progression in higher eukaryotic cells.

  5. BiGGEsTS: integrated environment for biclustering analysis of time series gene expression data

    Directory of Open Access Journals (Sweden)

    Madeira Sara C

    2009-07-01

    Full Text Available Abstract Background The ability to monitor changes in expression patterns over time, and to observe the emergence of coherent temporal responses using expression time series, is critical to advance our understanding of complex biological processes. Biclustering has been recognized as an effective method for discovering local temporal expression patterns and unraveling potential regulatory mechanisms. The general biclustering problem is NP-hard. In the case of time series this problem is tractable, and efficient algorithms can be used. However, there is still a need for specialized applications able to take advantage of the temporal properties inherent to expression time series, both from a computational and a biological perspective. Findings BiGGEsTS makes available state-of-the-art biclustering algorithms for analyzing expression time series. Gene Ontology (GO annotations are used to assess the biological relevance of the biclusters. Methods for preprocessing expression time series and post-processing results are also included. The analysis is additionally supported by a visualization module capable of displaying informative representations of the data, including heatmaps, dendrograms, expression charts and graphs of enriched GO terms. Conclusion BiGGEsTS is a free open source graphical software tool for revealing local coexpression of genes in specific intervals of time, while integrating meaningful information on gene annotations. It is freely available at: http://kdbio.inesc-id.pt/software/biggests. We present a case study on the discovery of transcriptional regulatory modules in the response of Saccharomyces cerevisiae to heat stress.

  6. Obesity gene NEGR1 associated with white matter integrity in healthy young adults.

    Science.gov (United States)

    Dennis, Emily L; Jahanshad, Neda; Braskie, Meredith N; Warstadt, Nicholus M; Hibar, Derrek P; Kohannim, Omid; Nir, Talia M; McMahon, Katie L; de Zubicaray, Greig I; Montgomery, Grant W; Martin, Nicholas G; Toga, Arthur W; Wright, Margaret J; Thompson, Paul M

    2014-11-15

    Obesity is a crucial public health issue in developed countries, with implications for cardiovascular and brain health as we age. A number of commonly-carried genetic variants are associated with obesity. Here we aim to see whether variants in obesity-associated genes--NEGR1, FTO, MTCH2, MC4R, LRRN6C, MAP2K5, FAIM2, SEC16B, ETV5, BDNF-AS, ATXN2L, ATP2A1, KCTD15, and TNN13K--are associated with white matter microstructural properties, assessed by high angular resolution diffusion imaging (HARDI) in young healthy adults between 20 and 30 years of age from the Queensland Twin Imaging study (QTIM). We began with a multi-locus approach testing how a number of common genetic risk factors for obesity at the single nucleotide polymorphism (SNP) level may jointly influence white matter integrity throughout the brain and found a wide spread genetic effect. Risk allele rs2815752 in NEGR1 was most associated with lower white matter integrity across a substantial portion of the brain. Across the area of significance in the bilateral posterior corona radiata, each additional copy of the risk allele was associated with a 2.2% lower average FA. This is the first study to find an association between an obesity risk gene and differences in white matter integrity. As our subjects were young and healthy, our results suggest that NEGR1 has effects on brain structure independent of its effect on obesity. Copyright © 2014. Published by Elsevier Inc.

  7. Integrative analysis of genome-wide gene copy number changes and gene expression in non-small cell lung cancer.

    Directory of Open Access Journals (Sweden)

    Verena Jabs

    Full Text Available Non-small cell lung cancer (NSCLC represents a genomically unstable cancer type with extensive copy number aberrations. The relationship of gene copy number alterations and subsequent mRNA levels has only fragmentarily been described. The aim of this study was to conduct a genome-wide analysis of gene copy number gains and corresponding gene expression levels in a clinically well annotated NSCLC patient cohort (n = 190 and their association with survival. While more than half of all analyzed gene copy number-gene expression pairs showed statistically significant correlations (10,296 of 18,756 genes, high correlations, with a correlation coefficient >0.7, were obtained only in a subset of 301 genes (1.6%, including KRAS, EGFR and MDM2. Higher correlation coefficients were associated with higher copy number and expression levels. Strong correlations were frequently based on few tumors with high copy number gains and correspondingly increased mRNA expression. Among the highly correlating genes, GO groups associated with posttranslational protein modifications were particularly frequent, including ubiquitination and neddylation. In a meta-analysis including 1,779 patients we found that survival associated genes were overrepresented among highly correlating genes (61 of the 301 highly correlating genes, FDR adjusted p<0.05. Among them are the chaperone CCT2, the core complex protein NUP107 and the ubiquitination and neddylation associated protein CAND1. In conclusion, in a comprehensive analysis we described a distinct set of highly correlating genes. These genes were found to be overrepresented among survival-associated genes based on gene expression in a large collection of publicly available datasets.

  8. Integrating circadian activity and gene expression profiles to predict chronotoxicity of Drosophila suzukii response to insecticides.

    Science.gov (United States)

    Hamby, Kelly A; Kwok, Rosanna S; Zalom, Frank G; Chiu, Joanna C

    2013-01-01

    Native to Southeast Asia, Drosophila suzukii (Matsumura) is a recent invader that infests intact ripe and ripening fruit, leading to significant crop losses in the U.S., Canada, and Europe. Since current D. suzukii management strategies rely heavily on insecticide usage and insecticide detoxification gene expression is under circadian regulation in the closely related Drosophila melanogaster, we set out to determine if integrative analysis of daily activity patterns and detoxification gene expression can predict chronotoxicity of D. suzukii to insecticides. Locomotor assays were performed under conditions that approximate a typical summer or winter day in Watsonville, California, where D. suzukii was first detected in North America. As expected, daily activity patterns of D. suzukii appeared quite different between 'summer' and 'winter' conditions due to differences in photoperiod and temperature. In the 'summer', D. suzukii assumed a more bimodal activity pattern, with maximum activity occurring at dawn and dusk. In the 'winter', activity was unimodal and restricted to the warmest part of the circadian cycle. Expression analysis of six detoxification genes and acute contact bioassays were performed at multiple circadian times, but only in conditions approximating Watsonville summer, the cropping season, when most insecticide applications occur. Five of the genes tested exhibited rhythmic expression, with the majority showing peak expression at dawn (ZT0, 6am). We observed significant differences in the chronotoxicity of D. suzukii towards malathion, with highest susceptibility at ZT0 (6am), corresponding to peak expression of cytochrome P450s that may be involved in bioactivation of malathion. High activity levels were not found to correlate with high insecticide susceptibility as initially hypothesized. Chronobiology and chronotoxicity of D. suzukii provide valuable insights for monitoring and control efforts, because insect activity as well as insecticide timing

  9. GeneAnalytics: An Integrative Gene Set Analysis Tool for Next Generation Sequencing, RNAseq and Microarray Data.

    Science.gov (United States)

    Ben-Ari Fuchs, Shani; Lieder, Iris; Stelzer, Gil; Mazor, Yaron; Buzhor, Ella; Kaplan, Sergey; Bogoch, Yoel; Plaschkes, Inbar; Shitrit, Alina; Rappaport, Noa; Kohn, Asher; Edgar, Ron; Shenhav, Liraz; Safran, Marilyn; Lancet, Doron; Guan-Golan, Yaron; Warshawsky, David; Shtrichman, Ronit

    2016-03-01

    Postgenomics data are produced in large volumes by life sciences and clinical applications of novel omics diagnostics and therapeutics for precision medicine. To move from "data-to-knowledge-to-innovation," a crucial missing step in the current era is, however, our limited understanding of biological and clinical contexts associated with data. Prominent among the emerging remedies to this challenge are the gene set enrichment tools. This study reports on GeneAnalytics™ ( geneanalytics.genecards.org ), a comprehensive and easy-to-apply gene set analysis tool for rapid contextualization of expression patterns and functional signatures embedded in the postgenomics Big Data domains, such as Next Generation Sequencing (NGS), RNAseq, and microarray experiments. GeneAnalytics' differentiating features include in-depth evidence-based scoring algorithms, an intuitive user interface and proprietary unified data. GeneAnalytics employs the LifeMap Science's GeneCards suite, including the GeneCards®--the human gene database; the MalaCards-the human diseases database; and the PathCards--the biological pathways database. Expression-based analysis in GeneAnalytics relies on the LifeMap Discovery®--the embryonic development and stem cells database, which includes manually curated expression data for normal and diseased tissues, enabling advanced matching algorithm for gene-tissue association. This assists in evaluating differentiation protocols and discovering biomarkers for tissues and cells. Results are directly linked to gene, disease, or cell "cards" in the GeneCards suite. Future developments aim to enhance the GeneAnalytics algorithm as well as visualizations, employing varied graphical display items. Such attributes make GeneAnalytics a broadly applicable postgenomics data analyses and interpretation tool for translation of data to knowledge-based innovation in various Big Data fields such as precision medicine, ecogenomics, nutrigenomics, pharmacogenomics, vaccinomics

  10. Integrating Genetic and Gene Co-expression Analysis Identifies Gene Networks Involved in Alcohol and Stress Responses.

    Science.gov (United States)

    Luo, Jie; Xu, Pei; Cao, Peijian; Wan, Hongjian; Lv, Xiaonan; Xu, Shengchun; Wang, Gangjun; Cook, Melloni N; Jones, Byron C; Lu, Lu; Wang, Xusheng

    2018-01-01

    Although the link between stress and alcohol is well recognized, the underlying mechanisms of how they interplay at the molecular level remain unclear. The purpose of this study is to identify molecular networks underlying the effects of alcohol and stress responses, as well as their interaction on anxiety behaviors in the hippocampus of mice using a systems genetics approach. Here, we applied a gene co-expression network approach to transcriptomes of 41 BXD mouse strains under four conditions: stress, alcohol, stress-induced alcohol and control. The co-expression analysis identified 14 modules and characterized four expression patterns across the four conditions. The four expression patterns include up-regulation in no restraint stress and given an ethanol injection (NOE) but restoration in restraint stress followed by an ethanol injection (RSE; pattern 1), down-regulation in NOE but rescue in RSE (pattern 2), up-regulation in both restraint stress followed by a saline injection (RSS) and NOE, and further amplification in RSE (pattern 3), and up-regulation in RSS but reduction in both NOE and RSE (pattern 4). We further identified four functional subnetworks by superimposing protein-protein interactions (PPIs) to the 14 co-expression modules, including γ-aminobutyric acid receptor (GABA) signaling, glutamate signaling, neuropeptide signaling, cAMP-dependent signaling. We further performed module specificity analysis to identify modules that are specific to stress, alcohol, or stress-induced alcohol responses. Finally, we conducted causality analysis to link genetic variation to these identified modules, and anxiety behaviors after stress and alcohol treatments. This study underscores the importance of integrative analysis and offers new insights into the molecular networks underlying stress and alcohol responses.

  11. Integrating Genetic and Gene Co-expression Analysis Identifies Gene Networks Involved in Alcohol and Stress Responses

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-04-01

    Full Text Available Although the link between stress and alcohol is well recognized, the underlying mechanisms of how they interplay at the molecular level remain unclear. The purpose of this study is to identify molecular networks underlying the effects of alcohol and stress responses, as well as their interaction on anxiety behaviors in the hippocampus of mice using a systems genetics approach. Here, we applied a gene co-expression network approach to transcriptomes of 41 BXD mouse strains under four conditions: stress, alcohol, stress-induced alcohol and control. The co-expression analysis identified 14 modules and characterized four expression patterns across the four conditions. The four expression patterns include up-regulation in no restraint stress and given an ethanol injection (NOE but restoration in restraint stress followed by an ethanol injection (RSE; pattern 1, down-regulation in NOE but rescue in RSE (pattern 2, up-regulation in both restraint stress followed by a saline injection (RSS and NOE, and further amplification in RSE (pattern 3, and up-regulation in RSS but reduction in both NOE and RSE (pattern 4. We further identified four functional subnetworks by superimposing protein-protein interactions (PPIs to the 14 co-expression modules, including γ-aminobutyric acid receptor (GABA signaling, glutamate signaling, neuropeptide signaling, cAMP-dependent signaling. We further performed module specificity analysis to identify modules that are specific to stress, alcohol, or stress-induced alcohol responses. Finally, we conducted causality analysis to link genetic variation to these identified modules, and anxiety behaviors after stress and alcohol treatments. This study underscores the importance of integrative analysis and offers new insights into the molecular networks underlying stress and alcohol responses.

  12. Improvement of Fibrinolytic Activity of Bacillus subtilis 168 by Integration of a Fibrinolytic Gene into the Chromosome.

    Science.gov (United States)

    Jeong, Seon-Ju; Park, Ji Yeong; Lee, Jae Yong; Lee, Kang Wook; Cho, Kye Man; Kim, Gyoung Min; Shin, Jung-Hye; Kim, Jong-Sang; Kim, Jeong Hwan

    2015-11-01

    Fibrinolytic enzyme genes (aprE2, aprE176, and aprE179) were introduced into the Bacillus subtilis 168 chromosome without any antibiotic resistance gene. An integration vector, pDG1662, was used to deliver the genes into the amyE site of B. subtilis 168. Integrants, SJ3-5nc, SJ176nc, and SJ179nc, were obtained after two successive homologous recombinations. The integration of each fibrinolytic gene into the middle of the amyE site was confirmed by phenotypes (Amy(-), Spec(S)) and colony PCR results for these strains. The fibrinolytic activities of the integrants were higher than that of B. subtilis 168 by at least 3.2-fold when grown in LB broth. Cheonggukjang was prepared by inoculating each of B. subtilis 168, SJ3-5nc, SJ176nc, and SJ179nc, and the fibrinolytic activity of cheonggukjang was 4.6 ± 0.7, 10.8 ± 0.9, 7.0 ± 0.6, and 8.0 ± 0.2 (U/g of cheonggukjang), respectively at 72 h. These results showed that construction of B. subtilis strains with enhanced fibrinolytic activities is possible by integration of a strong fibrinolytic gene via a marker-free manner.

  13. Integration of heterogeneous molecular networks to unravel gene-regulation in Mycobacterium tuberculosis.

    Science.gov (United States)

    van Dam, Jesse C J; Schaap, Peter J; Martins dos Santos, Vitor A P; Suárez-Diez, María

    2014-09-26

    Different methods have been developed to infer regulatory networks from heterogeneous omics datasets and to construct co-expression networks. Each algorithm produces different networks and efforts have been devoted to automatically integrate them into consensus sets. However each separate set has an intrinsic value that is diluted and partly lost when building a consensus network. Here we present a methodology to generate co-expression networks and, instead of a consensus network, we propose an integration framework where the different networks are kept and analysed with additional tools to efficiently combine the information extracted from each network. We developed a workflow to efficiently analyse information generated by different inference and prediction methods. Our methodology relies on providing the user the means to simultaneously visualise and analyse the coexisting networks generated by different algorithms, heterogeneous datasets, and a suite of analysis tools. As a show case, we have analysed the gene co-expression networks of Mycobacterium tuberculosis generated using over 600 expression experiments. Regarding DNA damage repair, we identified SigC as a key control element, 12 new targets for LexA, an updated LexA binding motif, and a potential mismatch repair system. We expanded the DevR regulon with 27 genes while identifying 9 targets wrongly assigned to this regulon. We discovered 10 new genes linked to zinc uptake and a new regulatory mechanism for ZuR. The use of co-expression networks to perform system level analysis allows the development of custom made methodologies. As show cases we implemented a pipeline to integrate ChIP-seq data and another method to uncover multiple regulatory layers. Our workflow is based on representing the multiple types of information as network representations and presenting these networks in a synchronous framework that allows their simultaneous visualization while keeping specific associations from the different

  14. Boolean Dynamic Modeling Approaches to Study Plant Gene Regulatory Networks: Integration, Validation, and Prediction.

    Science.gov (United States)

    Velderraín, José Dávila; Martínez-García, Juan Carlos; Álvarez-Buylla, Elena R

    2017-01-01

    Mathematical models based on dynamical systems theory are well-suited tools for the integration of available molecular experimental data into coherent frameworks in order to propose hypotheses about the cooperative regulatory mechanisms driving developmental processes. Computational analysis of the proposed models using well-established methods enables testing the hypotheses by contrasting predictions with observations. Within such framework, Boolean gene regulatory network dynamical models have been extensively used in modeling plant development. Boolean models are simple and intuitively appealing, ideal tools for collaborative efforts between theorists and experimentalists. In this chapter we present protocols used in our group for the study of diverse plant developmental processes. We focus on conceptual clarity and practical implementation, providing directions to the corresponding technical literature.

  15. iHAP – integrated haplotype analysis pipeline for characterizing the haplotype structure of genes

    Directory of Open Access Journals (Sweden)

    Lim Yun Ping

    2006-12-01

    Full Text Available Abstract Background The advent of genotype data from large-scale efforts that catalog the genetic variants of different populations have given rise to new avenues for multifactorial disease association studies. Recent work shows that genotype data from the International HapMap Project have a high degree of transferability to the wider population. This implies that the design of genotyping studies on local populations may be facilitated through inferences drawn from information contained in HapMap populations. Results To facilitate analysis of HapMap data for characterizing the haplotype structure of genes or any chromosomal regions, we have developed an integrated web-based resource, iHAP. In addition to incorporating genotype and haplotype data from the International HapMap Project and gene information from the UCSC Genome Browser Database, iHAP also provides capabilities for inferring haplotype blocks and selecting tag SNPs that are representative of haplotype patterns. These include block partitioning algorithms, block definitions, tag SNP definitions, as well as SNPs to be "force included" as tags. Based on the parameters defined at the input stage, iHAP performs on-the-fly analysis and displays the result graphically as a webpage. To facilitate analysis, intermediate and final result files can be downloaded. Conclusion The iHAP resource, available at http://ihap.bii.a-star.edu.sg, provides a convenient yet flexible approach for the user community to analyze HapMap data and identify candidate targets for genotyping studies.

  16. Meta-Analysis of DNA Tumor-Viral Integration Site Selection Indicates a Role for Repeats, Gene Expression and Epigenetics

    Directory of Open Access Journals (Sweden)

    Janet M. Doolittle-Hall

    2015-11-01

    Full Text Available Oncoviruses cause tremendous global cancer burden. For several DNA tumor viruses, human genome integration is consistently associated with cancer development. However, genomic features associated with tumor viral integration are poorly understood. We sought to define genomic determinants for 1897 loci prone to hosting human papillomavirus (HPV, hepatitis B virus (HBV or Merkel cell polyomavirus (MCPyV. These were compared to HIV, whose enzyme-mediated integration is well understood. A comprehensive catalog of integration sites was constructed from the literature and experimentally-determined HPV integration sites. Features were scored in eight categories (genes, expression, open chromatin, histone modifications, methylation, protein binding, chromatin segmentation and repeats and compared to random loci. Random forest models determined loci classification and feature selection. HPV and HBV integrants were not fragile site associated. MCPyV preferred integration near sensory perception genes. Unique signatures of integration-associated predictive genomic features were detected. Importantly, repeats, actively-transcribed regions and histone modifications were common tumor viral integration signatures.

  17. MAGIC Database and Interfaces: An Integrated Package for Gene Discovery and Expression

    Directory of Open Access Journals (Sweden)

    Lee H. Pratt

    2006-03-01

    Full Text Available The rapidly increasing rate at which biological data is being produced requires a corresponding growth in relational databases and associated tools that can help laboratories contend with that data. With this need in mind, we describe here a Modular Approach to a Genomic, Integrated and Comprehensive (MAGIC Database. This Oracle 9i database derives from an initial focus in our laboratory on gene discovery via production and analysis of expressed sequence tags (ESTs, and subsequently on gene expression as assessed by both EST clustering and microarrays. The MAGIC Gene Discovery portion of the database focuses on information derived from DNA sequences and on its biological relevance. In addition to MAGIC SEQ-LIMS, which is designed to support activities in the laboratory, it contains several additional subschemas. The latter include MAGIC Admin for database administration, MAGIC Sequence for sequence processing as well as sequence and clone attributes, MAGIC Cluster for the results of EST clustering, MAGIC Polymorphism in support of microsatellite and single-nucleotide-polymorphism discovery, and MAGIC Annotation for electronic annotation by BLAST and BLAT. The MAGIC Microarray portion is a MIAME-compliant database with two components at present. These are MAGIC Array-LIMS, which makes possible remote entry of all information into the database, and MAGIC Array Analysis, which provides data mining and visualization. Because all aspects of interaction with the MAGIC Database are via a web browser, it is ideally suited not only for individual research laboratories but also for core facilities that serve clients at any distance.

  18. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  19. Integration of steady-state and temporal gene expression data for the inference of gene regulatory networks.

    Science.gov (United States)

    Wang, Yi Kan; Hurley, Daniel G; Schnell, Santiago; Print, Cristin G; Crampin, Edmund J

    2013-01-01

    We develop a new regression algorithm, cMIKANA, for inference of gene regulatory networks from combinations of steady-state and time-series gene expression data. Using simulated gene expression datasets to assess the accuracy of reconstructing gene regulatory networks, we show that steady-state and time-series data sets can successfully be combined to identify gene regulatory interactions using the new algorithm. Inferring gene networks from combined data sets was found to be advantageous when using noisy measurements collected with either lower sampling rates or a limited number of experimental replicates. We illustrate our method by applying it to a microarray gene expression dataset from human umbilical vein endothelial cells (HUVECs) which combines time series data from treatment with growth factor TNF and steady state data from siRNA knockdown treatments. Our results suggest that the combination of steady-state and time-series datasets may provide better prediction of RNA-to-RNA interactions, and may also reveal biological features that cannot be identified from dynamic or steady state information alone. Finally, we consider the experimental design of genomics experiments for gene regulatory network inference and show that network inference can be improved by incorporating steady-state measurements with time-series data.

  20. Growing functional modules from a seed protein via integration of protein interaction and gene expression data

    Directory of Open Access Journals (Sweden)

    Dimitrakopoulou Konstantina

    2007-10-01

    Full Text Available Abstract Background Nowadays modern biology aims at unravelling the strands of complex biological structures such as the protein-protein interaction (PPI networks. A key concept in the organization of PPI networks is the existence of dense subnetworks (functional modules in them. In recent approaches clustering algorithms were applied at these networks and the resulting subnetworks were evaluated by estimating the coverage of well-established protein complexes they contained. However, most of these algorithms elaborate on an unweighted graph structure which in turn fails to elevate those interactions that would contribute to the construction of biologically more valid and coherent functional modules. Results In the current study, we present a method that corroborates the integration of protein interaction and microarray data via the discovery of biologically valid functional modules. Initially the gene expression information is overlaid as weights onto the PPI network and the enriched PPI graph allows us to exploit its topological aspects, while simultaneously highlights enhanced functional association in specific pairs of proteins. Then we present an algorithm that unveils the functional modules of the weighted graph by expanding a kernel protein set, which originates from a given 'seed' protein used as starting-point. Conclusion The integrated data and the concept of our approach provide reliable functional modules. We give proofs based on yeast data that our method manages to give accurate results in terms both of structural coherency, as well as functional consistency.

  1. Evolution of endogenous non-retroviral genes integrated into plant genomes

    Directory of Open Access Journals (Sweden)

    Hyosub Chu

    2014-08-01

    Full Text Available Numerous comparative genome analyses have revealed the wide extent of horizontal gene transfer (HGT in living organisms, which contributes to their evolution and genetic diversity. Viruses play important roles in HGT. Endogenous viral elements (EVEs are defined as viral DNA sequences present within the genomes of non-viral organisms. In eukaryotic cells, the majority of EVEs are derived from RNA viruses using reverse transcription. In contrast, endogenous non-retroviral elements (ENREs are poorly studied. However, the increasing availability of genomic data and the rapid development of bioinformatics tools have enabled the identification of several ENREs in various eukaryotic organisms. To date, a small number of ENREs integrated into plant genomes have been identified. Of the known non-retroviruses, most identified ENREs are derived from double-strand (ds RNA viruses, followed by single-strand (ss DNA and ssRNA viruses. At least eight virus families have been identified. Of these, viruses in the family Partitiviridae are dominant, followed by viruses of the families Chrysoviridae and Geminiviridae. The identified ENREs have been primarily identified in eudicots, followed by monocots. In this review, we briefly discuss the current view on non-retroviral sequences integrated into plant genomes that are associated with plant-virus evolution and their possible roles in antiviral resistance.

  2. Graph-based semi-supervised learning with genomic data integration using condition-responsive genes applied to phenotype classification.

    Science.gov (United States)

    Doostparast Torshizi, Abolfazl; Petzold, Linda R

    2018-01-01

    Data integration methods that combine data from different molecular levels such as genome, epigenome, transcriptome, etc., have received a great deal of interest in the past few years. It has been demonstrated that the synergistic effects of different biological data types can boost learning capabilities and lead to a better understanding of the underlying interactions among molecular levels. In this paper we present a graph-based semi-supervised classification algorithm that incorporates latent biological knowledge in the form of biological pathways with gene expression and DNA methylation data. The process of graph construction from biological pathways is based on detecting condition-responsive genes, where 3 sets of genes are finally extracted: all condition responsive genes, high-frequency condition-responsive genes, and P-value-filtered genes. The proposed approach is applied to ovarian cancer data downloaded from the Human Genome Atlas. Extensive numerical experiments demonstrate superior performance of the proposed approach compared to other state-of-the-art algorithms, including the latest graph-based classification techniques. Simulation results demonstrate that integrating various data types enhances classification performance and leads to a better understanding of interrelations between diverse omics data types. The proposed approach outperforms many of the state-of-the-art data integration algorithms. © The Author 2017. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  3. In-Silico Integration Approach to Identify a Key miRNA Regulating a Gene Network in Aggressive Prostate Cancer

    Science.gov (United States)

    Colaprico, Antonio; Bontempi, Gianluca; Castiglioni, Isabella

    2018-01-01

    Like other cancer diseases, prostate cancer (PC) is caused by the accumulation of genetic alterations in the cells that drives malignant growth. These alterations are revealed by gene profiling and copy number alteration (CNA) analysis. Moreover, recent evidence suggests that also microRNAs have an important role in PC development. Despite efforts to profile PC, the alterations (gene, CNA, and miRNA) and biological processes that correlate with disease development and progression remain partially elusive. Many gene signatures proposed as diagnostic or prognostic tools in cancer poorly overlap. The identification of co-expressed genes, that are functionally related, can identify a core network of genes associated with PC with a better reproducibility. By combining different approaches, including the integration of mRNA expression profiles, CNAs, and miRNA expression levels, we identified a gene signature of four genes overlapping with other published gene signatures and able to distinguish, in silico, high Gleason-scored PC from normal human tissue, which was further enriched to 19 genes by gene co-expression analysis. From the analysis of miRNAs possibly regulating this network, we found that hsa-miR-153 was highly connected to the genes in the network. Our results identify a four-gene signature with diagnostic and prognostic value in PC and suggest an interesting gene network that could play a key regulatory role in PC development and progression. Furthermore, hsa-miR-153, controlling this network, could be a potential biomarker for theranostics in high Gleason-scored PC. PMID:29562723

  4. Integrative annotation of 21,037 human genes validated by full-length cDNA clones.

    Directory of Open Access Journals (Sweden)

    Tadashi Imanishi

    2004-06-01

    Full Text Available The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/. It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs, identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA

  5. Network motif-based identification of transcription factor-target gene relationships by integrating multi-source biological data

    Directory of Open Access Journals (Sweden)

    de los Reyes Benildo G

    2008-04-01

    Full Text Available Abstract Background Integrating data from multiple global assays and curated databases is essential to understand the spatio-temporal interactions within cells. Different experiments measure cellular processes at various widths and depths, while databases contain biological information based on established facts or published data. Integrating these complementary datasets helps infer a mutually consistent transcriptional regulatory network (TRN with strong similarity to the structure of the underlying genetic regulatory modules. Decomposing the TRN into a small set of recurring regulatory patterns, called network motifs (NM, facilitates the inference. Identifying NMs defined by specific transcription factors (TF establishes the framework structure of a TRN and allows the inference of TF-target gene relationship. This paper introduces a computational framework for utilizing data from multiple sources to infer TF-target gene relationships on the basis of NMs. The data include time course gene expression profiles, genome-wide location analysis data, binding sequence data, and gene ontology (GO information. Results The proposed computational framework was tested using gene expression data associated with cell cycle progression in yeast. Among 800 cell cycle related genes, 85 were identified as candidate TFs and classified into four previously defined NMs. The NMs for a subset of TFs are obtained from literature. Support vector machine (SVM classifiers were used to estimate NMs for the remaining TFs. The potential downstream target genes for the TFs were clustered into 34 biologically significant groups. The relationships between TFs and potential target gene clusters were examined by training recurrent neural networks whose topologies mimic the NMs to which the TFs are classified. The identified relationships between TFs and gene clusters were evaluated using the following biological validation and statistical analyses: (1 Gene set enrichment

  6. Integrative analysis of survival-associated gene sets in breast cancer.

    Science.gov (United States)

    Varn, Frederick S; Ung, Matthew H; Lou, Shao Ke; Cheng, Chao

    2015-03-12

    Patient gene expression information has recently become a clinical feature used to evaluate breast cancer prognosis. The emergence of prognostic gene sets that take advantage of these data has led to a rich library of information that can be used to characterize the molecular nature of a patient's cancer. Identifying robust gene sets that are consistently predictive of a patient's clinical outcome has become one of the main challenges in the field. We inputted our previously established BASE algorithm with patient gene expression data and gene sets from MSigDB to develop the gene set activity score (GSAS), a metric that quantitatively assesses a gene set's activity level in a given patient. We utilized this metric, along with patient time-to-event data, to perform survival analyses to identify the gene sets that were significantly correlated with patient survival. We then performed cross-dataset analyses to identify robust prognostic gene sets and to classify patients by metastasis status. Additionally, we created a gene set network based on component gene overlap to explore the relationship between gene sets derived from MSigDB. We developed a novel gene set based on this network's topology and applied the GSAS metric to characterize its role in patient survival. Using the GSAS metric, we identified 120 gene sets that were significantly associated with patient survival in all datasets tested. The gene overlap network analysis yielded a novel gene set enriched in genes shared by the robustly predictive gene sets. This gene set was highly correlated to patient survival when used alone. Most interestingly, removal of the genes in this gene set from the gene pool on MSigDB resulted in a large reduction in the number of predictive gene sets, suggesting a prominent role for these genes in breast cancer progression. The GSAS metric provided a useful medium by which we systematically investigated how gene sets from MSigDB relate to breast cancer patient survival. We used

  7. Discovery of new candidate genes for rheumatoid arthritis through integration of genetic association data with expression pathway analysis.

    Science.gov (United States)

    Shchetynsky, Klementy; Diaz-Gallo, Lina-Marcella; Folkersen, Lasse; Hensvold, Aase Haj; Catrina, Anca Irinel; Berg, Louise; Klareskog, Lars; Padyukov, Leonid

    2017-02-02

    Here we integrate verified signals from previous genetic association studies with gene expression and pathway analysis for discovery of new candidate genes and signaling networks, relevant for rheumatoid arthritis (RA). RNA-sequencing-(RNA-seq)-based expression analysis of 377 genes from previously verified RA-associated loci was performed in blood cells from 5 newly diagnosed, non-treated patients with RA, 7 patients with treated RA and 12 healthy controls. Differentially expressed genes sharing a similar expression pattern in treated and untreated RA sub-groups were selected for pathway analysis. A set of "connector" genes derived from pathway analysis was tested for differential expression in the initial discovery cohort and validated in blood cells from 73 patients with RA and in 35 healthy controls. There were 11 qualifying genes selected for pathway analysis and these were grouped into two evidence-based functional networks, containing 29 and 27 additional connector molecules. The expression of genes, corresponding to connector molecules was then tested in the initial RNA-seq data. Differences in the expression of ERBB2, TP53 and THOP1 were similar in both treated and non-treated patients with RA and an additional nine genes were differentially expressed in at least one group of patients compared to healthy controls. The ERBB2, TP53. THOP1 expression profile was successfully replicated in RNA-seq data from peripheral blood mononuclear cells from healthy controls and non-treated patients with RA, in an independent collection of samples. Integration of RNA-seq data with findings from association studies, and consequent pathway analysis implicate new candidate genes, ERBB2, TP53 and THOP1 in the pathogenesis of RA.

  8. Identification of Differentially Expressed Genes Induced by Aberrant Methylation in Oral Squamous Cell Carcinomas Using Integrated Bioinformatic Analysis

    Directory of Open Access Journals (Sweden)

    Xiaoqi Zhang

    2018-06-01

    Full Text Available Oral squamous cell carcinoma (OSCC is a malignant disease. Methylation plays a key role in the etiology and pathogenesis of OSCC. The goal of this study was to identify aberrantly methylated differentially expressed genes (DEGs in OSCCs, and to explore the underlying mechanisms of tumorigenesis by using integrated bioinformatic analysis. Gene expression profiles (GSE30784 and GSE38532 were analyzed using the R software to obtain aberrantly methylated DEGs. Functional enrichment analysis of screened genes was performed using the DAVID software. Protein–protein interaction (PPI networks were constructed using the STRING database. The cBioPortal software was used to exhibit the alterations of genes. Lastly, we validated the results with the Cancer Genome Atlas (TCGA data. Twenty-eight upregulated hypomethylated genes and 24 downregulated hypermethylated genes were identified. These genes were enriched in the biological process of regulation in immune response, and were mainly involved in the PI3K-AKT and EMT pathways. Additionally, three upregulated hypomethylated oncogenes and four downregulated hypermethylated tumor suppressor genes (TSGs were identified. In conclusion, our study indicated possible aberrantly methylated DEGs and pathways in OSCCs, which could improve the understanding of the underlying molecular mechanisms. Aberrantly methylated oncogenes and TSGs may also serve as biomarkers and therapeutic targets for the precise diagnosis and treatment of OSCCs in the future.

  9. Gene-metabolite profile integration to understand the cause of spaceflight induced immunodeficiency.

    Science.gov (United States)

    Chakraborty, Nabarun; Cheema, Amrita; Gautam, Aarti; Donohue, Duncan; Hoke, Allison; Conley, Carolynn; Jett, Marti; Hammamieh, Rasha

    2018-01-01

    Spaceflight presents a spectrum of stresses very different from those associated with terrestrial conditions. Our previous study (BMC Genom. 15 : 659, 2014) integrated the expressions of mRNAs, microRNAs, and proteins and results indicated that microgravity induces an immunosuppressive state that can facilitate opportunistic pathogenic attack. However, the existing data are not sufficient for elucidating the molecular drivers of the given immunosuppressed state. To meet this knowledge gap, we focused on the metabolite profile of spaceflown human cells. Independent studies have attributed cellular energy deficiency as a major cause of compromised immunity of the host, and metabolites that are closely associated with energy production could be a robust signature of atypical energy fluctuation. Our protocol involved inoculation of human endothelial cells in cell culture modules in spaceflight and on the ground concurrently. Ten days later, the cells in space and on the ground were exposed to lipopolysaccharide (LPS), a ubiquitous membrane endotoxin of Gram-negative bacteria. Nucleic acids, proteins, and metabolites were collected 4 and 8 h post-LPS exposure. Untargeted profiling of metabolites was followed by targeted identification of amino acids and knowledge integration with gene expression profiles. Consistent with the past reports associating microgravity with increased energy expenditure, we identified several markers linked to energy deficiency, including various amino acids such as tryptophan, creatinine, dopamine, and glycine, and cofactors such as lactate and pyruvate. The present study revealed a molecular architecture linking energy metabolism and immunodeficiency in microgravity. The energy-deficient condition potentially cascaded into dysregulation of protein metabolism and impairment of host immunity. This project is limited by a small sample size. Although a strict statistical screening was carefully implemented, the present results further emphasize

  10. An integrative multi-dimensional genetic and epigenetic strategy to identify aberrant genes and pathways in cancer

    Directory of Open Access Journals (Sweden)

    Lockwood William W

    2010-05-01

    Full Text Available Abstract Background Genomics has substantially changed our approach to cancer research. Gene expression profiling, for example, has been utilized to delineate subtypes of cancer, and facilitated derivation of predictive and prognostic signatures. The emergence of technologies for the high resolution and genome-wide description of genetic and epigenetic features has enabled the identification of a multitude of causal DNA events in tumors. This has afforded the potential for large scale integration of genome and transcriptome data generated from a variety of technology platforms to acquire a better understanding of cancer. Results Here we show how multi-dimensional genomics data analysis would enable the deciphering of mechanisms that disrupt regulatory/signaling cascades and downstream effects. Since not all gene expression changes observed in a tumor are causal to cancer development, we demonstrate an approach based on multiple concerted disruption (MCD analysis of genes that facilitates the rational deduction of aberrant genes and pathways, which otherwise would be overlooked in single genomic dimension investigations. Conclusions Notably, this is the first comprehensive study of breast cancer cells by parallel integrative genome wide analyses of DNA copy number, LOH, and DNA methylation status to interpret changes in gene expression pattern. Our findings demonstrate the power of a multi-dimensional approach to elucidate events which would escape conventional single dimensional analysis and as such, reduce the cohort sample size for cancer gene discovery.

  11. LmSmdB: an integrated database for metabolic and gene regulatory network in Leishmania major and Schistosoma mansoni

    Directory of Open Access Journals (Sweden)

    Priyanka Patel

    2016-03-01

    Full Text Available A database that integrates all the information required for biological processing is essential to be stored in one platform. We have attempted to create one such integrated database that can be a one stop shop for the essential features required to fetch valuable result. LmSmdB (L. major and S. mansoni database is an integrated database that accounts for the biological networks and regulatory pathways computationally determined by integrating the knowledge of the genome sequences of the mentioned organisms. It is the first database of its kind that has together with the network designing showed the simulation pattern of the product. This database intends to create a comprehensive canopy for the regulation of lipid metabolism reaction in the parasite by integrating the transcription factors, regulatory genes and the protein products controlled by the transcription factors and hence operating the metabolism at genetic level. Keywords: L.major, S.mansoni, Regulatory networks, Transcription factors, Database

  12. Integrative Gene Cloning and Expression System for Streptomyces sp. US 24 and Streptomyces sp. TN 58 Bioactive Molecule Producing Strains

    Directory of Open Access Journals (Sweden)

    Samiha Sioud

    2009-01-01

    Full Text Available Streptomyces sp. US 24 and Streptomyces sp. TN 58, two strains producing interesting bioactive molecules, were successfully transformed using E. coli ET12567 (pUZ8002, as a conjugal donor, carrying the integrative plasmid pSET152. For the Streptomyces sp. US 24 strain, two copies of this plasmid were tandemly integrated in the chromosome, whereas for Streptomyces sp. TN 58, the integration was in single copy at the attB site. Plasmid pSET152 was inherited every time for all analysed Streptomyces sp. US 24 and Streptomyces sp. TN 58 exconjugants under nonselective conditions. The growth, morphological differentiation, and active molecules production of all studied pSET152 integrated exconjugants were identical to those of wild type strains. Consequently, conjugal transfer using pSET152 integration system is a suitable means of genes transfer and expression for both studied strains. To validate the above gene transfer system, the glucose isomerase gene (xylA from Streptomyces sp. SK was expressed in strain Streptomyces sp. TN 58. Obtained results indicated that heterologous glucose isomerase could be expressed and folded effectively. Glucose isomerase activity of the constructed TN 58 recombinant strain is of about eighteenfold higher than that of the Streptomyces sp. SK strain. Such results are certainly of importance due to the potential use of improved strains in biotechnological process for the production of high-fructose syrup from starch.

  13. Integration of a laterally acquired gene into a cell network important for growth in a strain of Vibrio rotiferianus

    Directory of Open Access Journals (Sweden)

    Labbate Maurizio

    2011-11-01

    Full Text Available Abstract Background Lateral Gene Transfer (LGT is a major contributor to bacterial evolution and up to 25% of a bacterium's genome may have been acquired by this process over evolutionary periods of time. Successful LGT requires both the physical transfer of DNA and its successful incorporation into the host cell. One system that contributes to this latter step by site-specific recombination is the integron. Integrons are found in many diverse bacterial Genera and is a genetic system ubiquitous in vibrios that captures mobile DNA at a dedicated site. The presence of integron-associated genes, contained within units of mobile DNA called gene cassettes makes up a substantial component of the vibrio genome (1-3%. Little is known about the role of this system since the vast majority of genes in vibrio arrays are highly novel and functions cannot be ascribed. It is generally regarded that strain-specific mobile genes cannot be readily integrated into the cellular machinery since any perturbation of core metabolism is likely to result in a loss of fitness. Results In this study, at least one mobile gene contained within the Vibrio rotiferianus strain DAT722, but lacking close relatives elsewhere, is shown to greatly reduce host fitness when deleted and tested in growth assays. The precise role of the mobile gene product is unknown but impacts on the regulation of outermembrane porins. This demonstrates that strain specific laterally acquired mobile DNA can be integrated rapidly into bacterial networks such that it becomes advantageous for survival and adaptation in changing environments. Conclusions Mobile genes that are highly strain specific are generally believed to act in isolation. This is because perturbation of existing cell machinery by the acquisition of a new gene by LGT is highly likely to lower fitness. In contrast, we show here that at least one mobile gene, apparently unique to a strain, encodes a product that has integrated into central

  14. Integrative Analysis of CRISPR/Cas9 Target Sites in the Human HBB Gene

    Directory of Open Access Journals (Sweden)

    Yumei Luo

    2015-01-01

    Full Text Available Recently, the clustered regularly interspaced short palindromic repeats (CRISPR system has emerged as a powerful customizable artificial nuclease to facilitate precise genetic correction for tissue regeneration and isogenic disease modeling. However, previous studies reported substantial off-target activities of CRISPR system in human cells, and the enormous putative off-target sites are labor-intensive to be validated experimentally, thus motivating bioinformatics methods for rational design of CRISPR system and prediction of its potential off-target effects. Here, we describe an integrative analytical process to identify specific CRISPR target sites in the human β-globin gene (HBB and predict their off-target effects. Our method includes off-target analysis in both coding and noncoding regions, which was neglected by previous studies. It was found that the CRISPR target sites in the introns have fewer off-target sites in the coding regions than those in the exons. Remarkably, target sites containing certain transcriptional factor motif have enriched binding sites of relevant transcriptional factor in their off-target sets. We also found that the intron sites have fewer SNPs, which leads to less variation of CRISPR efficiency in different individuals during clinical applications. Our studies provide a standard analytical procedure to select specific CRISPR targets for genetic correction.

  15. Identifying gene-environment interactions in schizophrenia: contemporary challenges for integrated, large-scale investigations.

    Science.gov (United States)

    van Os, Jim; Rutten, Bart P; Myin-Germeys, Inez; Delespaul, Philippe; Viechtbauer, Wolfgang; van Zelst, Catherine; Bruggeman, Richard; Reininghaus, Ulrich; Morgan, Craig; Murray, Robin M; Di Forti, Marta; McGuire, Philip; Valmaggia, Lucia R; Kempton, Matthew J; Gayer-Anderson, Charlotte; Hubbard, Kathryn; Beards, Stephanie; Stilo, Simona A; Onyejiaka, Adanna; Bourque, Francois; Modinos, Gemma; Tognin, Stefania; Calem, Maria; O'Donovan, Michael C; Owen, Michael J; Holmans, Peter; Williams, Nigel; Craddock, Nicholas; Richards, Alexander; Humphreys, Isla; Meyer-Lindenberg, Andreas; Leweke, F Markus; Tost, Heike; Akdeniz, Ceren; Rohleder, Cathrin; Bumb, J Malte; Schwarz, Emanuel; Alptekin, Köksal; Üçok, Alp; Saka, Meram Can; Atbaşoğlu, E Cem; Gülöksüz, Sinan; Gumus-Akay, Guvem; Cihan, Burçin; Karadağ, Hasan; Soygür, Haldan; Cankurtaran, Eylem Şahin; Ulusoy, Semra; Akdede, Berna; Binbay, Tolga; Ayer, Ahmet; Noyan, Handan; Karadayı, Gülşah; Akturan, Elçin; Ulaş, Halis; Arango, Celso; Parellada, Mara; Bernardo, Miguel; Sanjuán, Julio; Bobes, Julio; Arrojo, Manuel; Santos, Jose Luis; Cuadrado, Pedro; Rodríguez Solano, José Juan; Carracedo, Angel; García Bernardo, Enrique; Roldán, Laura; López, Gonzalo; Cabrera, Bibiana; Cruz, Sabrina; Díaz Mesa, Eva Ma; Pouso, María; Jiménez, Estela; Sánchez, Teresa; Rapado, Marta; González, Emiliano; Martínez, Covadonga; Sánchez, Emilio; Olmeda, Ma Soledad; de Haan, Lieuwe; Velthorst, Eva; van der Gaag, Mark; Selten, Jean-Paul; van Dam, Daniella; van der Ven, Elsje; van der Meer, Floor; Messchaert, Elles; Kraan, Tamar; Burger, Nadine; Leboyer, Marion; Szoke, Andrei; Schürhoff, Franck; Llorca, Pierre-Michel; Jamain, Stéphane; Tortelli, Andrea; Frijda, Flora; Vilain, Jeanne; Galliot, Anne-Marie; Baudin, Grégoire; Ferchiou, Aziz; Richard, Jean-Romain; Bulzacka, Ewa; Charpeaud, Thomas; Tronche, Anne-Marie; De Hert, Marc; van Winkel, Ruud; Decoster, Jeroen; Derom, Catherine; Thiery, Evert; Stefanis, Nikos C; Sachs, Gabriele; Aschauer, Harald; Lasser, Iris; Winklbaur, Bernadette; Schlögelhofer, Monika; Riecher-Rössler, Anita; Borgwardt, Stefan; Walter, Anna; Harrisberger, Fabienne; Smieskova, Renata; Rapp, Charlotte; Ittig, Sarah; Soguel-dit-Piquard, Fabienne; Studerus, Erich; Klosterkötter, Joachim; Ruhrmann, Stephan; Paruch, Julia; Julkowski, Dominika; Hilboll, Desiree; Sham, Pak C; Cherny, Stacey S; Chen, Eric Y H; Campbell, Desmond D; Li, Miaoxin; Romeo-Casabona, Carlos María; Emaldi Cirión, Aitziber; Urruela Mora, Asier; Jones, Peter; Kirkbride, James; Cannon, Mary; Rujescu, Dan; Tarricone, Ilaria; Berardi, Domenico; Bonora, Elena; Seri, Marco; Marcacci, Thomas; Chiri, Luigi; Chierzi, Federico; Storbini, Viviana; Braca, Mauro; Minenna, Maria Gabriella; Donegani, Ivonne; Fioritti, Angelo; La Barbera, Daniele; La Cascia, Caterina Erika; Mulè, Alice; Sideli, Lucia; Sartorio, Rachele; Ferraro, Laura; Tripoli, Giada; Seminerio, Fabio; Marinaro, Anna Maria; McGorry, Patrick; Nelson, Barnaby; Amminger, G Paul; Pantelis, Christos; Menezes, Paulo R; Del-Ben, Cristina M; Gallo Tenan, Silvia H; Shuhama, Rosana; Ruggeri, Mirella; Tosato, Sarah; Lasalvia, Antonio; Bonetto, Chiara; Ira, Elisa; Nordentoft, Merete; Krebs, Marie-Odile; Barrantes-Vidal, Neus; Cristóbal, Paula; Kwapil, Thomas R; Brietzke, Elisa; Bressan, Rodrigo A; Gadelha, Ary; Maric, Nadja P; Andric, Sanja; Mihaljevic, Marina; Mirjanic, Tijana

    2014-07-01

    Recent years have seen considerable progress in epidemiological and molecular genetic research into environmental and genetic factors in schizophrenia, but methodological uncertainties remain with regard to validating environmental exposures, and the population risk conferred by individual molecular genetic variants is small. There are now also a limited number of studies that have investigated molecular genetic candidate gene-environment interactions (G × E), however, so far, thorough replication of findings is rare and G × E research still faces several conceptual and methodological challenges. In this article, we aim to review these recent developments and illustrate how integrated, large-scale investigations may overcome contemporary challenges in G × E research, drawing on the example of a large, international, multi-center study into the identification and translational application of G × E in schizophrenia. While such investigations are now well underway, new challenges emerge for G × E research from late-breaking evidence that genetic variation and environmental exposures are, to a significant degree, shared across a range of psychiatric disorders, with potential overlap in phenotype. © The Author 2014. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  16. Integration of gene dosage and gene expression in non-small cell lung cancer, identification of HSP90 as potential target.

    Directory of Open Access Journals (Sweden)

    Mariëlle I Gallegos Ruiz

    Full Text Available BACKGROUND: Lung cancer causes approximately 1.2 million deaths per year worldwide, and non-small cell lung cancer (NSCLC represents 85% of all lung cancers. Understanding the molecular events in non-small cell lung cancer (NSCLC is essential to improve early diagnosis and treatment for this disease. METHODOLOGY AND PRINCIPAL FINDINGS: In an attempt to identify novel NSCLC related genes, we performed a genome-wide screening of chromosomal copy number changes affecting gene expression using microarray based comparative genomic hybridization and gene expression arrays on 32 radically resected tumor samples from stage I and II NSCLC patients. An integrative analysis tool was applied to determine whether chromosomal copy number affects gene expression. We identified a deletion on 14q32.2-33 as a common alteration in NSCLC (44%, which significantly influenced gene expression for HSP90, residing on 14q32. This deletion was correlated with better overall survival (P = 0.008, survival was also longer in patients whose tumors had low expression levels of HSP90. We extended the analysis to three independent validation sets of NSCLC patients, and confirmed low HSP90 expression to be related with longer overall survival (P = 0.003, P = 0.07 and P = 0.04. Furthermore, in vitro treatment with an HSP90 inhibitor had potent antiproliferative activity in NSCLC cell lines. CONCLUSIONS: We suggest that targeting HSP90 will have clinical impact for NSCLC patients.

  17. Identification of novel type 1 diabetes candidate genes by integrating genome-wide association data, protein-protein interactions, and human pancreatic islet gene expression

    DEFF Research Database (Denmark)

    Bergholdt, Regine; Brorsson, Caroline; Palleja, Albert

    2012-01-01

    Genome-wide association studies (GWAS) have heralded a new era in susceptibility locus discovery in complex diseases. For type 1 diabetes, >40 susceptibility loci have been discovered. However, GWAS do not inevitably lead to identification of the gene or genes in a given locus associated with dis......-cells. Our results provide novel insight to the mechanisms behind type 1 diabetes pathogenesis and, thus, may provide the basis for the design of novel treatment strategies.......Genome-wide association studies (GWAS) have heralded a new era in susceptibility locus discovery in complex diseases. For type 1 diabetes, >40 susceptibility loci have been discovered. However, GWAS do not inevitably lead to identification of the gene or genes in a given locus associated...... with disease, and they do not typically inform the broader context in which the disease genes operate. Here, we integrated type 1 diabetes GWAS data with protein-protein interactions to construct biological networks of relevance for disease. A total of 17 networks were identified. To prioritize...

  18. Integrated analysis of microRNA and gene expression profiles reveals a functional regulatory module associated with liver fibrosis.

    Science.gov (United States)

    Chen, Wei; Zhao, Wenshan; Yang, Aiting; Xu, Anjian; Wang, Huan; Cong, Min; Liu, Tianhui; Wang, Ping; You, Hong

    2017-12-15

    Liver fibrosis, characterized with the excessive accumulation of extracellular matrix (ECM) proteins, represents the final common pathway of chronic liver inflammation. Ever-increasing evidence indicates microRNAs (miRNAs) dysregulation has important implications in the different stages of liver fibrosis. However, our knowledge of miRNA-gene regulation details pertaining to such disease remains unclear. The publicly available Gene Expression Omnibus (GEO) datasets of patients suffered from cirrhosis were extracted for integrated analysis. Differentially expressed miRNAs (DEMs) and genes (DEGs) were identified using GEO2R web tool. Putative target gene prediction of DEMs was carried out using the intersection of five major algorithms: DIANA-microT, TargetScan, miRanda, PICTAR5 and miRWalk. Functional miRNA-gene regulatory network (FMGRN) was constructed based on the computational target predictions at the sequence level and the inverse expression relationships between DEMs and DEGs. DAVID web server was selected to perform KEGG pathway enrichment analysis. Functional miRNA-gene regulatory module was generated based on the biological interpretation. Internal connections among genes in liver fibrosis-related module were determined using String database. MiRNA-gene regulatory modules related to liver fibrosis were experimentally verified in recombinant human TGFβ1 stimulated and specific miRNA inhibitor treated LX-2 cells. We totally identified 85 and 923 dysregulated miRNAs and genes in liver cirrhosis biopsy samples compared to their normal controls. All evident miRNA-gene pairs were identified and assembled into FMGRN which consisted of 990 regulations between 51 miRNAs and 275 genes, forming two big sub-networks that were defined as down-network and up-network, respectively. KEGG pathway enrichment analysis revealed that up-network was prominently involved in several KEGG pathways, in which "Focal adhesion", "PI3K-Akt signaling pathway" and "ECM

  19. Integrated Analysis of the Effects of Cold and Dehydration on Rice Metabolites, Phytohormones, and Gene Transcripts1[W][OPEN

    Science.gov (United States)

    Maruyama, Kyonoshin; Urano, Kaoru; Yoshiwara, Kyouko; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Kojima, Mikiko; Sakakibara, Hitoshi; Shibata, Daisuke; Saito, Kazuki; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2014-01-01

    Correlations between gene expression and metabolite/phytohormone levels under abiotic stress conditions have been reported for Arabidopsis (Arabidopsis thaliana). However, little is known about these correlations in rice (Oryza sativa ‘Nipponbare’), despite its importance as a model monocot. We performed an integrated analysis to clarify the relationships among cold- and dehydration-responsive metabolites, phytohormones, and gene transcription in rice. An integrated analysis of metabolites and gene expression indicated that several genes encoding enzymes involved in starch degradation, sucrose metabolism, and the glyoxylate cycle are up-regulated in rice plants exposed to cold or dehydration and that these changes are correlated with the accumulation of glucose (Glc), fructose, and sucrose. In particular, high expression levels of genes encoding isocitrate lyase and malate synthase in the glyoxylate cycle correlate with increased Glc levels in rice, but not in Arabidopsis, under dehydration conditions, indicating that the regulation of the glyoxylate cycle may be involved in Glc accumulation under dehydration conditions in rice but not Arabidopsis. An integrated analysis of phytohormones and gene transcripts revealed an inverse relationship between abscisic acid (ABA) signaling and cytokinin (CK) signaling under cold and dehydration stresses; these stresses increase ABA signaling and decrease CK signaling. High levels of Oryza sativa 9-cis-epoxycarotenoid dioxygenase transcripts correlate with ABA accumulation, and low levels of Cytochrome P450 (CYP) 735A transcripts correlate with decreased levels of a CK precursor in rice. This reduced expression of CYP735As occurs in rice but not Arabidopsis. Therefore, transcriptional regulation of CYP735As might be involved in regulating CK levels under cold and dehydration conditions in rice but not Arabidopsis. PMID:24515831

  20. Integrated analyses of microRNAs demonstrate their widespread influence on gene expression in high-grade serous ovarian carcinoma.

    Science.gov (United States)

    Creighton, Chad J; Hernandez-Herrera, Anadulce; Jacobsen, Anders; Levine, Douglas A; Mankoo, Parminder; Schultz, Nikolaus; Du, Ying; Zhang, Yiqun; Larsson, Erik; Sheridan, Robert; Xiao, Weimin; Spellman, Paul T; Getz, Gad; Wheeler, David A; Perou, Charles M; Gibbs, Richard A; Sander, Chris; Hayes, D Neil; Gunaratne, Preethi H

    2012-01-01

    The Cancer Genome Atlas (TCGA) Network recently comprehensively catalogued the molecular aberrations in 487 high-grade serous ovarian cancers, with much remaining to be elucidated regarding the microRNAs (miRNAs). Here, using TCGA ovarian data, we surveyed the miRNAs, in the context of their predicted gene targets. Integration of miRNA and gene patterns yielded evidence that proximal pairs of miRNAs are processed from polycistronic primary transcripts, and that intronic miRNAs and their host gene mRNAs derive from common transcripts. Patterns of miRNA expression revealed multiple tumor subtypes and a set of 34 miRNAs predictive of overall patient survival. In a global analysis, miRNA:mRNA pairs anti-correlated in expression across tumors showed a higher frequency of in silico predicted target sites in the mRNA 3'-untranslated region (with less frequency observed for coding sequence and 5'-untranslated regions). The miR-29 family and predicted target genes were among the most strongly anti-correlated miRNA:mRNA pairs; over-expression of miR-29a in vitro repressed several anti-correlated genes (including DNMT3A and DNMT3B) and substantially decreased ovarian cancer cell viability. This study establishes miRNAs as having a widespread impact on gene expression programs in ovarian cancer, further strengthening our understanding of miRNA biology as it applies to human cancer. As with gene transcripts, miRNAs exhibit high diversity reflecting the genomic heterogeneity within a clinically homogeneous disease population. Putative miRNA:mRNA interactions, as identified using integrative analysis, can be validated. TCGA data are a valuable resource for the identification of novel tumor suppressive miRNAs in ovarian as well as other cancers.

  1. Towards the prediction of essential genes by integration of network topology, cellular localization and biological process information

    Directory of Open Access Journals (Sweden)

    Lemke Ney

    2009-09-01

    Full Text Available Abstract Background The identification of essential genes is important for the understanding of the minimal requirements for cellular life and for practical purposes, such as drug design. However, the experimental techniques for essential genes discovery are labor-intensive and time-consuming. Considering these experimental constraints, a computational approach capable of accurately predicting essential genes would be of great value. We therefore present here a machine learning-based computational approach relying on network topological features, cellular localization and biological process information for prediction of essential genes. Results We constructed a decision tree-based meta-classifier and trained it on datasets with individual and grouped attributes-network topological features, cellular compartments and biological processes-to generate various predictors of essential genes. We showed that the predictors with better performances are those generated by datasets with integrated attributes. Using the predictor with all attributes, i.e., network topological features, cellular compartments and biological processes, we obtained the best predictor of essential genes that was then used to classify yeast genes with unknown essentiality status. Finally, we generated decision trees by training the J48 algorithm on datasets with all network topological features, cellular localization and biological process information to discover cellular rules for essentiality. We found that the number of protein physical interactions, the nuclear localization of proteins and the number of regulating transcription factors are the most important factors determining gene essentiality. Conclusion We were able to demonstrate that network topological features, cellular localization and biological process information are reliable predictors of essential genes. Moreover, by constructing decision trees based on these data, we could discover cellular rules governing

  2. Finding novel relationships with integrated gene-gene association network analysis of Synechocystis sp. PCC 6803 using species-independent text-mining.

    Science.gov (United States)

    Kreula, Sanna M; Kaewphan, Suwisa; Ginter, Filip; Jones, Patrik R

    2018-01-01

    The increasing move towards open access full-text scientific literature enhances our ability to utilize advanced text-mining methods to construct information-rich networks that no human will be able to grasp simply from 'reading the literature'. The utility of text-mining for well-studied species is obvious though the utility for less studied species, or those with no prior track-record at all, is not clear. Here we present a concept for how advanced text-mining can be used to create information-rich networks even for less well studied species and apply it to generate an open-access gene-gene association network resource for Synechocystis sp. PCC 6803, a representative model organism for cyanobacteria and first case-study for the methodology. By merging the text-mining network with networks generated from species-specific experimental data, network integration was used to enhance the accuracy of predicting novel interactions that are biologically relevant. A rule-based algorithm (filter) was constructed in order to automate the search for novel candidate genes with a high degree of likely association to known target genes by (1) ignoring established relationships from the existing literature, as they are already 'known', and (2) demanding multiple independent evidences for every novel and potentially relevant relationship. Using selected case studies, we demonstrate the utility of the network resource and filter to ( i ) discover novel candidate associations between different genes or proteins in the network, and ( ii ) rapidly evaluate the potential role of any one particular gene or protein. The full network is provided as an open-source resource.

  3. Pipette tip with integrated electrodes for gene electrotransfer of cells in suspension: a feasibility study in CHO cells

    International Nuclear Information System (INIS)

    Rebersek, Matej; Kanduser, Masa; Miklavcic, Damijan

    2011-01-01

    Gene electrotransfer is a non-viral gene delivery method that requires successful electroporation for DNA delivery into the cells. Changing the direction of the electric field during the pulse application improves the efficacy of gene delivery. In our study, we tested a pipette tip with integrated electrodes that enables changing the direction of the electric field for electroporation of cell suspension for gene electrotransfer. A new pipette tip consists of four cylindrical rod electrodes that allow the application of electric pulses in different electric field directions. The experiments were performed on cell suspension of CHO cells in phosphate buffer. Plasmid DNA encoding for green fluorescent protein (GFP) was used and the efficiency of gene electrotransfer was determined by counting cells expressing GFP 24 h after the experiment. Experimental results showed that the percentage of cells expressing GFP increased when the electric field orientation was changed during the application. The GFP expression was almost two times higher when the pulses were applied in orthogonal directions in comparison with single direction, while cell viability was not significantly affected. We can conclude that results obtained with the described pipette tip are comparable to previously published results on gene electrotransfer using similar electrode geometry and electric pulse parameters. The tested pipette tip, however, allows work with small volumes/samples and requires less cell manipulation

  4. Prevalence of antibiotic resistance genes in the bacterial flora of integrated fish farming environments of Pakistan and Tanzania.

    Science.gov (United States)

    Shah, Syed Q A; Colquhoun, Duncan J; Nikuli, Hamisi L; Sørum, Henning

    2012-08-21

    The use of a wide variety of antimicrobials in human and veterinary medicine, including aquaculture, has led to the emergence of antibiotic resistant pathogens. In the present study, bacteria from water, sediments, and fish were collected from fish farms in Pakistan and Tanzania with no recorded history of antibiotic use. The isolates were screened for the presence of resistance genes against various antimicrobials used in aquaculture and animal husbandry. Resistant isolates selected by disk diffusion and genotyped by Southern hybridization were further screened by polymerase chain reaction (PCR) and amplicon sequencing. The prominent resistance genes identified encoded tetracycline [tetA(A) and tetA(G)], trimethoprim [dfrA1, dfrA5, dfrA7, dfrA12, and dfrA15], amoxicillin [bla(TEM)], streptomycin [strA-strB], chloramphenicol [cat-1], and erythromycin resistance [mefA]. The int1 gene was found in more than 30% of the bacterial isolates in association with gene cassettes. MAR indices ranged from 0.2 to 1. The bla(NDM-1) gene was not identified in ertapenem resistant isolates. It is hypothesized that integrated fish farming practices utilizing domestic farm and poultry waste along with antibiotic residues from animal husbandry may have contributed to a pool of resistance genes in the aquaculture systems studied.

  5. Predicting spatial and temporal gene expression using an integrative model of transcription factor occupancy and chromatin state.

    Directory of Open Access Journals (Sweden)

    Bartek Wilczynski

    Full Text Available Precise patterns of spatial and temporal gene expression are central to metazoan complexity and act as a driving force for embryonic development. While there has been substantial progress in dissecting and predicting cis-regulatory activity, our understanding of how information from multiple enhancer elements converge to regulate a gene's expression remains elusive. This is in large part due to the number of different biological processes involved in mediating regulation as well as limited availability of experimental measurements for many of them. Here, we used a Bayesian approach to model diverse experimental regulatory data, leading to accurate predictions of both spatial and temporal aspects of gene expression. We integrated whole-embryo information on transcription factor recruitment to multiple cis-regulatory modules, insulator binding and histone modification status in the vicinity of individual gene loci, at a genome-wide scale during Drosophila development. The model uses Bayesian networks to represent the relation between transcription factor occupancy and enhancer activity in specific tissues and stages. All parameters are optimized in an Expectation Maximization procedure providing a model capable of predicting tissue- and stage-specific activity of new, previously unassayed genes. Performing the optimization with subsets of input data demonstrated that neither enhancer occupancy nor chromatin state alone can explain all gene expression patterns, but taken together allow for accurate predictions of spatio-temporal activity. Model predictions were validated using the expression patterns of more than 600 genes recently made available by the BDGP consortium, demonstrating an average 15-fold enrichment of genes expressed in the predicted tissue over a naïve model. We further validated the model by experimentally testing the expression of 20 predicted target genes of unknown expression, resulting in an accuracy of 95% for temporal

  6. Improving transcriptome construction in non-model organisms: integrating manual and automated gene definition in Emiliania huxleyi.

    OpenAIRE

    Feldmesser, Ester; Rosenwasser, Shilo; Vardi, Assaf; Ben-Dor, Shifra

    2014-01-01

    Background The advent of Next Generation Sequencing technologies and corresponding bioinformatics tools allows the definition of transcriptomes in non-model organisms. Non-model organisms are of great ecological and biotechnological significance, and consequently the understanding of their unique metabolic pathways is essential. Several methods that integrate de novo assembly with genome-based assembly have been proposed. Yet, there are many open challenges in defining genes, particularly whe...

  7. GTI: a novel algorithm for identifying outlier gene expression profiles from integrated microarray datasets.

    Directory of Open Access Journals (Sweden)

    John Patrick Mpindi

    Full Text Available BACKGROUND: Meta-analysis of gene expression microarray datasets presents significant challenges for statistical analysis. We developed and validated a new bioinformatic method for the identification of genes upregulated in subsets of samples of a given tumour type ('outlier genes', a hallmark of potential oncogenes. METHODOLOGY: A new statistical method (the gene tissue index, GTI was developed by modifying and adapting algorithms originally developed for statistical problems in economics. We compared the potential of the GTI to detect outlier genes in meta-datasets with four previously defined statistical methods, COPA, the OS statistic, the t-test and ORT, using simulated data. We demonstrated that the GTI performed equally well to existing methods in a single study simulation. Next, we evaluated the performance of the GTI in the analysis of combined Affymetrix gene expression data from several published studies covering 392 normal samples of tissue from the central nervous system, 74 astrocytomas, and 353 glioblastomas. According to the results, the GTI was better able than most of the previous methods to identify known oncogenic outlier genes. In addition, the GTI identified 29 novel outlier genes in glioblastomas, including TYMS and CDKN2A. The over-expression of these genes was validated in vivo by immunohistochemical staining data from clinical glioblastoma samples. Immunohistochemical data were available for 65% (19 of 29 of these genes, and 17 of these 19 genes (90% showed a typical outlier staining pattern. Furthermore, raltitrexed, a specific inhibitor of TYMS used in the therapy of tumour types other than glioblastoma, also effectively blocked cell proliferation in glioblastoma cell lines, thus highlighting this outlier gene candidate as a potential therapeutic target. CONCLUSIONS/SIGNIFICANCE: Taken together, these results support the GTI as a novel approach to identify potential oncogene outliers and drug targets. The algorithm is

  8. Integrative analysis of miRNA and gene expression reveals regulatory networks in tamoxifen-resistant breast cancer

    DEFF Research Database (Denmark)

    Joshi, Tejal; Elias, Daniel; Stenvang, Jan

    2016-01-01

    and 14-3-3 family genes. Integrating the inferred miRNA-target relationships, we investigated the functional importance of 2 central genes, SNAI2 and FYN, which showed increased expression in TamR cells, while their corresponding regulatory miRNA were downregulated. Using specific chemical inhibitors......Tamoxifen is an effective anti-estrogen treatment for patients with estrogen receptor-positive (ER+) breast cancer, however, tamoxifen resistance is frequently observed. To elucidate the underlying molecular mechanisms of tamoxifen resistance, we performed a systematic analysis of miRNA......-mediated gene regulation in three clinically-relevant tamoxifen-resistant breast cancer cell lines (TamRs) compared to their parental tamoxifen-sensitive cell line. Alterations in the expression of 131 miRNAs in tamoxifen-resistant vs. parental cell lines were identified, 22 of which were common to all Tam...

  9. Selective Gene Delivery for Integrating Exogenous DNA into Plastid and Mitochondrial Genomes Using Peptide-DNA Complexes.

    Science.gov (United States)

    Yoshizumi, Takeshi; Oikawa, Kazusato; Chuah, Jo-Ann; Kodama, Yutaka; Numata, Keiji

    2018-05-14

    Selective gene delivery into organellar genomes (mitochondrial and plastid genomes) has been limited because of a lack of appropriate platform technology, even though these organelles are essential for metabolite and energy production. Techniques for selective organellar modification are needed to functionally improve organelles and produce transplastomic/transmitochondrial plants. However, no method for mitochondrial genome modification has yet been established for multicellular organisms including plants. Likewise, modification of plastid genomes has been limited to a few plant species and algae. In the present study, we developed ionic complexes of fusion peptides containing organellar targeting signal and plasmid DNA for selective delivery of exogenous DNA into the plastid and mitochondrial genomes of intact plants. This is the first report of exogenous DNA being integrated into the mitochondrial genomes of not only plants, but also multicellular organisms in general. This fusion peptide-mediated gene delivery system is a breakthrough platform for both plant organellar biotechnology and gene therapy for mitochondrial diseases in animals.

  10. Towards systems genetic analyses in barley: Integration of phenotypic, expression and genotype data into GeneNetwork

    Directory of Open Access Journals (Sweden)

    Druka Arnis

    2008-11-01

    Full Text Available Abstract Background A typical genetical genomics experiment results in four separate data sets; genotype, gene expression, higher-order phenotypic data and metadata that describe the protocols, processing and the array platform. Used in concert, these data sets provide the opportunity to perform genetic analysis at a systems level. Their predictive power is largely determined by the gene expression dataset where tens of millions of data points can be generated using currently available mRNA profiling technologies. Such large, multidimensional data sets often have value beyond that extracted during their initial analysis and interpretation, particularly if conducted on widely distributed reference genetic materials. Besides quality and scale, access to the data is of primary importance as accessibility potentially allows the extraction of considerable added value from the same primary dataset by the wider research community. Although the number of genetical genomics experiments in different plant species is rapidly increasing, none to date has been presented in a form that allows quick and efficient on-line testing for possible associations between genes, loci and traits of interest by an entire research community. Description Using a reference population of 150 recombinant doubled haploid barley lines we generated novel phenotypic, mRNA abundance and SNP-based genotyping data sets, added them to a considerable volume of legacy trait data and entered them into the GeneNetwork http://www.genenetwork.org. GeneNetwork is a unified on-line analytical environment that enables the user to test genetic hypotheses about how component traits, such as mRNA abundance, may interact to condition more complex biological phenotypes (higher-order traits. Here we describe these barley data sets and demonstrate some of the functionalities GeneNetwork provides as an easily accessible and integrated analytical environment for exploring them. Conclusion By

  11. Longevity Genes Revealed by Integrative Analysis of Isoform-Specific daf-16/FoxO Mutants of Caenorhabditis elegans.

    Science.gov (United States)

    Chen, Albert Tzong-Yang; Guo, Chunfang; Itani, Omar A; Budaitis, Breane G; Williams, Travis W; Hopkins, Christopher E; McEachin, Richard C; Pande, Manjusha; Grant, Ana R; Yoshina, Sawako; Mitani, Shohei; Hu, Patrick J

    2015-10-01

    FoxO transcription factors promote longevity across taxa. How they do so is poorly understood. In the nematode Caenorhabditis elegans, the A- and F-isoforms of the FoxO transcription factor DAF-16 extend life span in the context of reduced DAF-2 insulin-like growth factor receptor (IGFR) signaling. To elucidate the mechanistic basis for DAF-16/FoxO-dependent life span extension, we performed an integrative analysis of isoform-specific daf-16/FoxO mutants. In contrast to previous studies suggesting that DAF-16F plays a more prominent role in life span control than DAF-16A, isoform-specific daf-16/FoxO mutant phenotypes and whole transcriptome profiling revealed a predominant role for DAF-16A over DAF-16F in life span control, stress resistance, and target gene regulation. Integration of these datasets enabled the prioritization of a subset of 92 DAF-16/FoxO target genes for functional interrogation. Among 29 genes tested, two DAF-16A-specific target genes significantly influenced longevity. A loss-of-function mutation in the conserved gene gst-20, which is induced by DAF-16A, reduced life span extension in the context of daf-2/IGFR RNAi without influencing longevity in animals subjected to control RNAi. Therefore, gst-20 promotes DAF-16/FoxO-dependent longevity. Conversely, a loss-of-function mutation in srr-4, a gene encoding a seven-transmembrane-domain receptor family member that is repressed by DAF-16A, extended life span in control animals, indicating that DAF-16/FoxO may extend life span at least in part by reducing srr-4 expression. Our discovery of new longevity genes underscores the efficacy of our integrative strategy while providing a general framework for identifying specific downstream gene regulatory events that contribute substantially to transcription factor functions. As FoxO transcription factors have conserved functions in promoting longevity and may be dysregulated in aging-related diseases, these findings promise to illuminate fundamental

  12. An integrated analysis of genes and pathways exhibiting metabolic differences between estrogen receptor positive breast cancer cells

    International Nuclear Information System (INIS)

    Mandal, Soma; Davie, James R

    2007-01-01

    The sex hormone estrogen (E2) is pivotal to normal mammary gland growth and differentiation and in breast carcinogenesis. In this in silico study, we examined metabolic differences between ER(+)ve breast cancer cells during E2 deprivation. Public repositories of SAGE and MA gene expression data generated from E2 deprived ER(+)ve breast cancer cell lines, MCF-7 and ZR75-1 were compared with normal breast tissue. We analyzed gene ontology (GO), enrichment, clustering, chromosome localization, and pathway profiles and performed multiple comparisons with cell lines and tumors with different ER status. In all GO terms, biological process (BP), molecular function (MF), and cellular component (CC), MCF-7 had higher gene utilization than ZR75-1. Various analyses showed a down-regulated immune function, an up-regulated protein (ZR75-1) and glucose metabolism (MCF-7). A greater percentage of 77 common genes localized to the q arm of all chromosomes, but in ZR75-1 chromosomes 11, 16, and 19 harbored more overexpressed genes. Despite differences in gene utilization (electron transport, proteasome, glycolysis/gluconeogenesis) and expression (ribosome) in both cells, there was an overall similarity of ZR75-1 with ER(-)ve cell lines and ER(+)ve/ER(-)ve breast tumors. This study demonstrates integral metabolic differences may exist within the same cell subtype (luminal A) in representative ER(+)ve cell line models. Selectivity of gene and pathway usage for strategies such as energy requirement minimization, sugar utilization by ZR75-1 contrasted with MCF-7 cells, expressing genes whose protein products require ATP utilization. Such characteristics may impart aggressiveness to ZR75-1 and may be prognostic determinants of ER(+)ve breast tumors

  13. The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

    Directory of Open Access Journals (Sweden)

    Daniel Menendez

    2011-03-01

    Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

  14. The MP65 gene is required for cell wall integrity, adherence to epithelial cells and biofilm formation in Candida albicans

    Directory of Open Access Journals (Sweden)

    Girolamo Antonietta

    2011-05-01

    Full Text Available Abstract Background The MP65 gene of Candida albicans (orf19.1779 encodes a putative β-glucanase mannoprotein of 65 kDa, which plays a main role in a host-fungus relationship, morphogenesis and pathogenicity. In this study, we performed an extensive analysis of a mp65Δ mutant to assess the role of this protein in cell wall integrity, adherence to epithelial cells and biofilm formation. Results The mp65Δ mutant showed a high sensitivity to a range of cell wall-perturbing and degrading agents, especially Congo red, which induced morphological changes such as swelling, clumping and formation of hyphae. The mp65Δ mutant showed an activation of two MAPKs (Mkc1p and Cek1p, a high level of expression of two stress-related genes (DDR48 and SOD5, and a modulated expression of β-glucan epitopes, but no gross changes in cell wall polysaccharide composition. Interestingly, the mp65Δ mutant displayed a marked reduction in adhesion to BEC and Caco-2 cells and severe defects in biofilm formation when compared to the wild type. All of the mentioned properties were totally or partially recovered in a revertant strain, demonstrating the specificity of gene deletion. Conclusions We demonstrate that the MP65 gene of Candida albicans plays a significant role in maintaining cell wall integrity, as well as in adherence to epithelia and biofilm formation, which are major virulence attributes of this fungus.

  15. Integration of genome-wide association studies with biological knowledge identifies six novel genes related to kidney function.

    Science.gov (United States)

    Chasman, Daniel I; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C; O'Seaghdha, Conall M; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V; O'Connell, Jeffrey R; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D; Gierman, Hinco J; Feitosa, Mary F; Hwang, Shih-Jen; Atkinson, Elizabeth J; Lohman, Kurt; Cornelis, Marilyn C; Johansson, Asa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B; Launer, Lenore J; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A; de Andrade, Mariza; Turner, Stephen T; Ding, Jingzhong; Andrews, Jeanette S; Freedman, Barry I; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H; Wright, Alan F; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G; Rivadeneira, Fernando; Aulchenko, Yurii S; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K; Portas, Laura; Ford, Ian; Buckley, Brendan M; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J Wouter; Probst-Hensch, Nicole M; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S; van Duijn, Cornelia M; Borecki, Ingrid B; Kardia, Sharon L R; Liu, Yongmei; Curhan, Gary C; Rudan, Igor; Gyllensten, Ulf; Wilson, James F; Franke, Andre; Pramstaller, Peter P; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M; Kao, W H Linda; Fox, Caroline S; Köttgen, Anna

    2012-12-15

    In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10(-9)) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10(-4)-2.2 × 10(-7). Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general.

  16. OpenFlyData: an exemplar data web integrating gene expression data on the fruit fly Drosophila melanogaster.

    Science.gov (United States)

    Miles, Alistair; Zhao, Jun; Klyne, Graham; White-Cooper, Helen; Shotton, David

    2010-10-01

    Integrating heterogeneous data across distributed sources is a major requirement for in silico bioinformatics supporting translational research. For example, genome-scale data on patterns of gene expression in the fruit fly Drosophila melanogaster are widely used in functional genomic studies in many organisms to inform candidate gene selection and validate experimental results. However, current data integration solutions tend to be heavy weight, and require significant initial and ongoing investment of effort. Development of a common Web-based data integration infrastructure (a.k.a. data web), using Semantic Web standards, promises to alleviate these difficulties, but little is known about the feasibility, costs, risks or practical means of migrating to such an infrastructure. We describe the development of OpenFlyData, a proof-of-concept system integrating gene expression data on D. melanogaster, combining Semantic Web standards with light-weight approaches to Web programming based on Web 2.0 design patterns. To support researchers designing and validating functional genomic studies, OpenFlyData includes user-facing search applications providing intuitive access to and comparison of gene expression data from FlyAtlas, the BDGP in situ database, and FlyTED, using data from FlyBase to expand and disambiguate gene names. OpenFlyData's services are also openly accessible, and are available for reuse by other bioinformaticians and application developers. Semi-automated methods and tools were developed to support labour- and knowledge-intensive tasks involved in deploying SPARQL services. These include methods for generating ontologies and relational-to-RDF mappings for relational databases, which we illustrate using the FlyBase Chado database schema; and methods for mapping gene identifiers between databases. The advantages of using Semantic Web standards for biomedical data integration are discussed, as are open issues. In particular, although the performance of open

  17. Data Integration and Applications of Functional Gene Networks in Drosophila Melanogaster

    Science.gov (United States)

    Costello, James Christopher

    2009-01-01

    Understanding the function of every gene in the genome is a central goal in the biological sciences. This includes full characterization of a genes phenotypic effects, molecular interactions, the evolutionary forces that shape its function(s), and how these functions interrelate. Despite a long history and considerable effort to understand all…

  18. Integrated Analyses of Gene Expression Profiles Digs out Common Markers for Rheumatic Diseases

    Science.gov (United States)

    Wang, Lan; Wu, Long-Fei; Lu, Xin; Mo, Xing-Bo; Tang, Zai-Xiang; Lei, Shu-Feng; Deng, Fei-Yan

    2015-01-01

    Objective Rheumatic diseases have some common symptoms. Extensive gene expression studies, accumulated thus far, have successfully identified signature molecules for each rheumatic disease, individually. However, whether there exist shared factors across rheumatic diseases has yet to be tested. Methods We collected and utilized 6 public microarray datasets covering 4 types of representative rheumatic diseases including rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis, and osteoarthritis. Then we detected overlaps of differentially expressed genes across datasets and performed a meta-analysis aiming at identifying common differentially expressed genes that discriminate between pathological cases and normal controls. To further gain insights into the functions of the identified common differentially expressed genes, we conducted gene ontology enrichment analysis and protein-protein interaction analysis. Results We identified a total of eight differentially expressed genes (TNFSF10, CX3CR1, LY96, TLR5, TXN, TIA1, PRKCH, PRF1), each associated with at least 3 of the 4 studied rheumatic diseases. Meta-analysis warranted the significance of the eight genes and highlighted the general significance of four genes (CX3CR1, LY96, TLR5, and PRF1). Protein-protein interaction and gene ontology enrichment analyses indicated that the eight genes interact with each other to exert functions related to immune response and immune regulation. Conclusion The findings support that there exist common factors underlying rheumatic diseases. For rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis and osteoarthritis diseases, those common factors include TNFSF10, CX3CR1, LY96, TLR5, TXN, TIA1, PRKCH, and PRF1. In-depth studies on these common factors may provide keys to understanding the pathogenesis and developing intervention strategies for rheumatic diseases. PMID:26352601

  19. Obsessive-compulsive disorder, which genes? Which functions? Which pathways? An integrated holistic view regarding OCD and its complex genetic etiology.

    Science.gov (United States)

    Bozorgmehr, Ali; Ghadirivasfi, Mohammad; Shahsavand Ananloo, Esmaeil

    2017-09-01

    Obsessive-compulsive disorder (OCD) is characterized by recurrent obtrusive and repetitive acts typically occurred following anxiety. In the last two decades, studies done on the gene sequences, large-scale and point mutations and gene-gene, gene-environment and gene-drug interactions have led to the discovery of hundreds of genes associated with OCD. Although each gene in turn is a part of the etiology of this disorder; however, OCD, like other mental disorders is complex and a comprehensive and integrated view is necessary to understand its genetic basis. In this study, through an extensive review of existing published studies, all genes associated with OCD were found. Then, in order to integrate the results, all the interactions between these genes were explored and the achievement was represented as an interactive genetic network. Furthermore, the reconstructed network was analyzed. It was found that GRIN2A, GRIN2B and GRIA2 are the most central nodes in the network. Functional and pathway enrichment analysis showed that glutamate-related pathways are the main deficient systems in patients with OCD. By studying genes shared between OCD and other diseases, it was cleared that OCD, epilepsy and some types of cancer have the most number of shared genes. The results of this study, in addition to reviewing the available results as a comprehensive and integrated manner, provide new hypotheses for future studies.

  20. Integration

    DEFF Research Database (Denmark)

    Emerek, Ruth

    2004-01-01

    Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration......Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration...

  1. Dact gene expression profiles suggest a role for this gene family in integrating Wnt and TGF-β signaling pathways during chicken limb development.

    Science.gov (United States)

    Sensiate, Lucimara Aparecida; Sobreira, Débora R; Da Veiga, Fernanda Cristina; Peterlini, Denner Jefferson; Pedrosa, Angelica Vasconcelos; Rirsch, Thaís; Joazeiro, Paulo Pinto; Schubert, Frank R; Collares-Buzato, Carla Beatriz; Xavier-Neto, José; Dietrich, Susanne; Alvares, Lúcia Elvira

    2014-03-01

    Dact gene family encodes multifunctional proteins that are important modulators of Wnt and TGF-β signaling pathways. Given that these pathways coordinate multiple steps of limb development, we investigated the expression pattern of the two chicken Dact genes (Dact1 and Dact2) from early limb bud up to stages when several tissues are differentiating. During early limb development (HH24-HH30) Dact1 and Dact2 were mainly expressed in the cartilaginous rudiments of the appendicular skeleton and perichondrium, presenting expression profiles related, but distinct. At later stages of development (HH31-HH35), the main sites of Dact1 and Dact2 expression were the developing synovial joints. In this context, Dact1 expression was shown to co-localize with regions enriched in the nuclear β-catenin protein, such as developing joint capsule and interzone. In contrast, Dact2 expression was restricted to the interzone surrounding the domains of bmpR-1b expression, a TGF-β receptor with crucial roles during digit morphogenesis. Additional sites of Dact expression were the developing tendons and digit blastemas. Our data indicate that Dact genes are good candidates to modulate and, possibly, integrate Wnt and TGF-β signaling during limb development, bringing new and interesting perspectives about the roles of Dact molecules in limb birth defects and human diseases. Copyright © 2013 Wiley Periodicals, Inc.

  2. Integrated bioinformatics analysis reveals key candidate genes and pathways in breast cancer.

    Science.gov (United States)

    Wang, Yuzhi; Zhang, Yi; Huang, Qian; Li, Chengwen

    2018-04-19

    Breast cancer (BC) is the leading malignancy in women worldwide, yet relatively little is known about the genes and signaling pathways involved in BC tumorigenesis and progression. The present study aimed to elucidate potential key candidate genes and pathways in BC. Five gene expression profile data sets (GSE22035, GSE3744, GSE5764, GSE21422 and GSE26910) were downloaded from the Gene Expression Omnibus (GEO) database, which included data from 113 tumorous and 38 adjacent non‑tumorous tissue samples. Differentially expressed genes (DEGs) were identified using t‑tests in the limma R package. These DEGs were subsequently investigated by pathway enrichment analysis and a protein‑protein interaction (PPI) network was constructed. The most significant module from the PPI network was selected for pathway enrichment analysis. In total, 227 DEGs were identified, of which 82 were upregulated and 145 were downregulated. Pathway enrichment analysis results revealed that the upregulated DEGs were mainly enriched in 'cell division', the 'proteinaceous extracellular matrix (ECM)', 'ECM structural constituents' and 'ECM‑receptor interaction', whereas downregulated genes were mainly enriched in 'response to drugs', 'extracellular space', 'transcriptional activator activity' and the 'peroxisome proliferator‑activated receptor signaling pathway'. The PPI network contained 174 nodes and 1,257 edges. DNA topoisomerase 2‑a, baculoviral inhibitor of apoptosis repeat‑containing protein 5, cyclin‑dependent kinase 1, G2/mitotic‑specific cyclin‑B1 and kinetochore protein NDC80 homolog were identified as the top 5 hub genes. Furthermore, the genes in the most significant module were predominantly involved in 'mitotic nuclear division', 'mid‑body', 'protein binding' and 'cell cycle'. In conclusion, the DEGs, relative pathways and hub genes identified in the present study may aid in understanding of the molecular mechanisms underlying BC progression and provide

  3. Functional annotation of rheumatoid arthritis and osteoarthritis associated genes by integrative genome-wide gene expression profiling analysis.

    Directory of Open Access Journals (Sweden)

    Zhan-Chun Li

    Full Text Available BACKGROUND: Rheumatoid arthritis (RA and osteoarthritis (OA are two major types of joint diseases that share multiple common symptoms. However, their pathological mechanism remains largely unknown. The aim of our study is to identify RA and OA related-genes and gain an insight into the underlying genetic basis of these diseases. METHODS: We collected 11 whole genome-wide expression profiling datasets from RA and OA cohorts and performed a meta-analysis to comprehensively investigate their expression signatures. This method can avoid some pitfalls of single dataset analyses. RESULTS AND CONCLUSION: We found that several biological pathways (i.e., the immunity, inflammation and apoptosis related pathways are commonly involved in the development of both RA and OA. Whereas several other pathways (i.e., vasopressin-related pathway, regulation of autophagy, endocytosis, calcium transport and endoplasmic reticulum stress related pathways present significant difference between RA and OA. This study provides novel insights into the molecular mechanisms underlying this disease, thereby aiding the diagnosis and treatment of the disease.

  4. ICESag37, a Novel Integrative and Conjugative Element Carrying Antimicrobial Resistance Genes and Potential Virulence Factors in Streptococcus agalactiae.

    Science.gov (United States)

    Zhou, Kaixin; Xie, Lianyan; Han, Lizhong; Guo, Xiaokui; Wang, Yong; Sun, Jingyong

    2017-01-01

    ICE Sag37 , a novel integrative and conjugative element carrying multidrug resistance and potential virulence factors, was characterized in a clinical isolate of Streptococcus agalactiae . Two clinical strains of S. agalactiae , Sag37 and Sag158, were isolated from blood samples of new-borns with bacteremia. Sag37 was highly resistant to erythromycin and tetracycline, and susceptible to levofloxacin and penicillin, while Sag158 was resistant to tetracycline and levofloxacin, and susceptible to erythromycin. Transfer experiments were performed and selection was carried out with suitable antibiotic concentrations. Through mating experiments, the erythromycin resistance gene was found to be transferable from Sag37 to Sag158. Sma I-PFGE revealed a new Sma I fragment, confirming the transfer of the fragment containing the erythromycin resistance gene. Whole genome sequencing and sequence analysis revealed a mobile element, ICE Sag37 , which was characterized using several molecular methods and in silico analyses. ICE Sag37 was excised to generate a covalent circular intermediate, which was transferable to S. agalactiae . Inverse PCR was performed to detect the circular form. A serine family integrase mediated its chromosomal integration into rumA , which is a known hotspot for the integration of streptococcal ICEs. The integration site was confirmed using PCR. ICE Sag37 carried genes for resistance to multiple antibiotics, including erythromycin [ erm(B) ], tetracycline [ tet(O) ], and aminoglycosides [ aadE, aphA , and ant(6) ]. Potential virulence factors, including a two-component signal transduction system ( nisK/nisR ), were also observed in ICE Sag37 . S1-PFGE analysis ruled out the existence of plasmids. ICE Sag37 is the first ICE Sa2603 family-like element identified in S. agalactiae carrying both resistance and potential virulence determinants. It might act as a vehicle for the dissemination of multidrug resistance and pathogenicity among S. agalactiae .

  5. Digital gene expression analysis based on integrated de novo transcriptome assembly of sweet potato [Ipomoea batatas (L. Lam].

    Directory of Open Access Journals (Sweden)

    Xiang Tao

    Full Text Available BACKGROUND: Sweet potato (Ipomoea batatas L. [Lam.] ranks among the top six most important food crops in the world. It is widely grown throughout the world with high and stable yield, strong adaptability, rich nutrient content, and multiple uses. However, little is known about the molecular biology of this important non-model organism due to lack of genomic resources. Hence, studies based on high-throughput sequencing technologies are needed to get a comprehensive and integrated genomic resource and better understanding of gene expression patterns in different tissues and at various developmental stages. METHODOLOGY/PRINCIPAL FINDINGS: Illumina paired-end (PE RNA-Sequencing was performed, and generated 48.7 million of 75 bp PE reads. These reads were de novo assembled into 128,052 transcripts (≥ 100 bp, which correspond to 41.1 million base pairs, by using a combined assembly strategy. Transcripts were annotated by Blast2GO and 51,763 transcripts got BLASTX hits, in which 39,677 transcripts have GO terms and 14,117 have ECs that are associated with 147 KEGG pathways. Furthermore, transcriptome differences of seven tissues were analyzed by using Illumina digital gene expression (DGE tag profiling and numerous differentially and specifically expressed transcripts were identified. Moreover, the expression characteristics of genes involved in viral genomes, starch metabolism and potential stress tolerance and insect resistance were also identified. CONCLUSIONS/SIGNIFICANCE: The combined de novo transcriptome assembly strategy can be applied to other organisms whose reference genomes are not available. The data provided here represent the most comprehensive and integrated genomic resources for cloning and identifying genes of interest in sweet potato. Characterization of sweet potato transcriptome provides an effective tool for better understanding the molecular mechanisms of cellular processes including development of leaves and storage roots

  6. CrEdit: CRISPR mediated multi-loci gene integration in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Ronda, Carlotta; Maury, Jerome; Jakociunas, Tadas

    2015-01-01

    episomal vectors. Existing approaches for achieving stable simultaneous genome integrations of multiple DNA fragments often result in relatively low integration efficiencies and furthermore rely on the use of selection markers. Results: Here, we have developed a novel method, CrEdit (CRISPR/Cas9 mediated...... genome Editing), which utilizes targeted double strand breaks caused by CRISPR/Cas9 to significantly increase the efficiency of homologous integration in order to edit and manipulate genomic DNA. Using CrEdit, the efficiency and locus specificity of targeted genome integrations reach close to 100...

  7. Integrated Metabolo-Transcriptomics Reveals Fusarium Head Blight Candidate Resistance Genes in Wheat QTL-Fhb2.

    Directory of Open Access Journals (Sweden)

    Dhananjay Dhokane

    Full Text Available Fusarium head blight (FHB caused by Fusarium graminearum not only causes severe losses in yield, but also reduces quality of wheat grain by accumulating mycotoxins. Breeding for host plant resistance is considered as the best strategy to manage FHB. Resistance in wheat to FHB is quantitative in nature, involving cumulative effects of many genes governing resistance. The poor understanding of genetics and lack of precise phenotyping has hindered the development of FHB resistant cultivars. Though more than 100 QTLs imparting FHB resistance have been reported, none discovered the specific genes localized within the QTL region, nor the underlying mechanisms of resistance.In our study recombinant inbred lines (RILs carrying resistant (R-RIL and susceptible (S-RIL alleles of QTL-Fhb2 were subjected to metabolome and transcriptome profiling to discover the candidate genes. Metabolome profiling detected a higher abundance of metabolites belonging to phenylpropanoid, lignin, glycerophospholipid, flavonoid, fatty acid, and terpenoid biosynthetic pathways in R-RIL than in S-RIL. Transcriptome analysis revealed up-regulation of several receptor kinases, transcription factors, signaling, mycotoxin detoxification and resistance related genes. The dissection of QTL-Fhb2 using flanking marker sequences, integrating metabolomic and transcriptomic datasets, identified 4-Coumarate: CoA ligase (4CL, callose synthase (CS, basic Helix Loop Helix (bHLH041 transcription factor, glutathione S-transferase (GST, ABC transporter-4 (ABC4 and cinnamyl alcohol dehydrogenase (CAD as putative resistance genes localized within the QTL-Fhb2 region.Some of the identified genes within the QTL region are associated with structural resistance through cell wall reinforcement, reducing the spread of pathogen through rachis within a spike and few other genes that detoxify DON, the virulence factor, thus eventually reducing disease severity. In conclusion, we report that the wheat

  8. Integration of metabolic and gene regulatory networks modulates the C. elegans dietary response.

    Science.gov (United States)

    Watson, Emma; MacNeil, Lesley T; Arda, H Efsun; Zhu, Lihua Julie; Walhout, Albertha J M

    2013-03-28

    Expression profiles are tailored according to dietary input. However, the networks that control dietary responses remain largely uncharacterized. Here, we combine forward and reverse genetic screens to delineate a network of 184 genes that affect the C. elegans dietary response to Comamonas DA1877 bacteria. We find that perturbation of a mitochondrial network composed of enzymes involved in amino acid metabolism and the TCA cycle affects the dietary response. In humans, mutations in the corresponding genes cause inborn diseases of amino acid metabolism, most of which are treated by dietary intervention. We identify several transcription factors (TFs) that mediate the changes in gene expression upon metabolic network perturbations. Altogether, our findings unveil a transcriptional response system that is poised to sense dietary cues and metabolic imbalances, illustrating extensive communication between metabolic networks in the mitochondria and gene regulatory networks in the nucleus. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Gene disruptions using P transposable elements: an integral component of the Drosophila genome project.

    OpenAIRE

    Spradling, A C; Stern, D M; Kiss, I; Roote, J; Laverty, T; Rubin, G M

    1995-01-01

    Biologists require genetic as well as molecular tools to decipher genomic information and ultimately to understand gene function. The Berkeley Drosophila Genome Project is addressing these needs with a massive gene disruption project that uses individual, genetically engineered P transposable elements to target open reading frames throughout the Drosophila genome. DNA flanking the insertions is sequenced, thereby placing an extensive series of genetic markers on the physical genomic map and a...

  10. Improving transcriptome construction in non-model organisms: integrating manual and automated gene definition in Emiliania huxleyi.

    Science.gov (United States)

    Feldmesser, Ester; Rosenwasser, Shilo; Vardi, Assaf; Ben-Dor, Shifra

    2014-02-22

    The advent of Next Generation Sequencing technologies and corresponding bioinformatics tools allows the definition of transcriptomes in non-model organisms. Non-model organisms are of great ecological and biotechnological significance, and consequently the understanding of their unique metabolic pathways is essential. Several methods that integrate de novo assembly with genome-based assembly have been proposed. Yet, there are many open challenges in defining genes, particularly where genomes are not available or incomplete. Despite the large numbers of transcriptome assemblies that have been performed, quality control of the transcript building process, particularly on the protein level, is rarely performed if ever. To test and improve the quality of the automated transcriptome reconstruction, we used manually defined and curated genes, several of them experimentally validated. Several approaches to transcript construction were utilized, based on the available data: a draft genome, high quality RNAseq reads, and ESTs. In order to maximize the contribution of the various data, we integrated methods including de novo and genome based assembly, as well as EST clustering. After each step a set of manually curated genes was used for quality assessment of the transcripts. The interplay between the automated pipeline and the quality control indicated which additional processes were required to improve the transcriptome reconstruction. We discovered that E. huxleyi has a very high percentage of non-canonical splice junctions, and relatively high rates of intron retention, which caused unique issues with the currently available tools. While individual tools missed genes and artificially joined overlapping transcripts, combining the results of several tools improved the completeness and quality considerably. The final collection, created from the integration of several quality control and improvement rounds, was compared to the manually defined set both on the DNA and

  11. The gene regulatory network for breast cancer: Integrated regulatory landscape of cancer hallmarks

    Directory of Open Access Journals (Sweden)

    Frank eEmmert-Streib

    2014-02-01

    Full Text Available In this study, we infer the breast cancer gene regulatory network from gene expression data. This network is obtained from the application of the BC3Net inference algorithm to a large-scale gene expression data set consisting of $351$ patient samples. In order to elucidate the functional relevance of the inferred network, we are performing a Gene Ontology (GO analysis for its structural components. Our analysis reveals that most significant GO-terms we find for the breast cancer network represent functional modules of biological processes that are described by known cancer hallmarks, including translation, immune response, cell cycle, organelle fission, mitosis, cell adhesion, RNA processing, RNA splicing and response to wounding. Furthermore, by using a curated list of census cancer genes, we find an enrichment in these functional modules. Finally, we study cooperative effects of chromosomes based on information of interacting genes in the beast cancer network. We find that chromosome $21$ is most coactive with other chromosomes. To our knowledge this is the first study investigating the genome-scale breast cancer network.

  12. Computational integration of homolog and pathway gene module expression reveals general stemness signatures.

    Directory of Open Access Journals (Sweden)

    Martina Koeva

    Full Text Available The stemness hypothesis states that all stem cells use common mechanisms to regulate self-renewal and multi-lineage potential. However, gene expression meta-analyses at the single gene level have failed to identify a significant number of genes selectively expressed by a broad range of stem cell types. We hypothesized that stemness may be regulated by modules of homologs. While the expression of any single gene within a module may vary from one stem cell type to the next, it is possible that the expression of the module as a whole is required so that the expression of different, yet functionally-synonymous, homologs is needed in different stem cells. Thus, we developed a computational method to test for stem cell-specific gene expression patterns from a comprehensive collection of 49 murine datasets covering 12 different stem cell types. We identified 40 individual genes and 224 stemness modules with reproducible and specific up-regulation across multiple stem cell types. The stemness modules included families regulating chromatin remodeling, DNA repair, and Wnt signaling. Strikingly, the majority of modules represent evolutionarily related homologs. Moreover, a score based on the discovered modules could accurately distinguish stem cell-like populations from other cell types in both normal and cancer tissues. This scoring system revealed that both mouse and human metastatic populations exhibit higher stemness indices than non-metastatic populations, providing further evidence for a stem cell-driven component underlying the transformation to metastatic disease.

  13. The oxytocin receptor gene, an integral piece of the evolution of Canis familaris from Canis lupus

    Directory of Open Access Journals (Sweden)

    Jessica Lee Oliva

    2016-07-01

    Full Text Available Previous research in canids has revealed both group (dog versus wolf and individual differences in object choice task (OCT performance. These differences might be explained by variation in the oxytocin receptor (OXTR gene, as intranasally administered oxytocin has recently been shown to improve performance on this task by domestic dogs. This study looked at microsatellites at various distances from the OXTR gene to determine whether there was an association between this gene and: i species (dog/wolf and ii good versus bad OCT performers. Ten primer sets were designed to amplify 10 microsatellites that were identified at various distances from the canine OXTR gene. We used 94 (52 males, 42 females blood samples from shelter dogs, 75 (33 males, 42 females saliva samples from pet dogs and 12 (6 males, 6 females captive wolf saliva samples to carry out our analyses. Significant species differences were found in the two markers closest to the OXTR gene, suggesting that this gene may have played an important part in the domestic dogs’ evolution from the wolf. However, no significant, meaningful differences were found in microsatellites between good versus bad OCT performers, which suggests that other factors, such as different training and socialisation experiences, probably impacted task performance

  14. Integrating gene transcription-based biomarkers to understand desert tortoise and ecosystem health

    Science.gov (United States)

    Bowen, Lizabeth; Miles, A. Keith; Drake, Karla K.; Waters, Shannon C.; Esque, Todd C.; Nussear, Kenneth E.

    2015-01-01

    Tortoises are susceptible to a wide variety of environmental stressors, and the influence of human disturbances on health and survival of tortoises is difficult to detect. As an addition to current diagnostic methods for desert tortoises, we have developed the first leukocyte gene transcription biomarker panel for the desert tortoise (Gopherus agassizii), enhancing the ability to identify specific environmental conditions potentially linked to declining animal health. Blood leukocyte transcript profiles have the potential to identify physiologically stressed animals in lieu of clinical signs. For desert tortoises, the gene transcript profile included a combination of immune or detoxification response genes with the potential to be modified by biological or physical injury and consequently provide information on the type and magnitude of stressors present in the animal’s habitat. Blood from 64 wild adult tortoises at three sites in Clark County, NV, and San Bernardino, CA, and from 19 captive tortoises in Clark County, NV, was collected and evaluated for genes indicative of physiological status. Statistical analysis using a priori groupings indicated significant differences among groups for several genes, while multidimensional scaling and cluster analyses of transcriptionC T values indicated strong differentiation of a large cluster and multiple outlying individual tortoises or small clusters in multidimensional space. These analyses highlight the effectiveness of the gene panel at detecting environmental perturbations as well as providing guidance in determining the health of the desert tortoise.

  15. Agrobacterium tumefaciens T-DNA Integration and Gene Targeting in Arabidopsis thaliana Non-Homologous End-Joining Mutants

    Directory of Open Access Journals (Sweden)

    Qi Jia

    2012-01-01

    Full Text Available In order to study the role of AtKu70 and AtKu80 in Agrobacterium-mediated transformation and gene targeting, plant lines with a T-DNA insertion in AtKu80 or AtKu70 genes were functionally characterized. Such plant lines lacked both subunits, indicating that heterodimer formation between AtKu70 and AtKu80 is needed for the stability of the proteins. Homozygous mutants were phenotypically indistinguishable from wild-type plants and were fertile. However, they were hypersensitive to the genotoxic agent bleomycin, resulting in more DSBs as quantified in comet assays. They had lower end-joining efficiency, suggesting that NHEJ is a critical pathway for DSB repair in plants. Both Atku mutants and a previously isolated Atmre11 mutant were impaired in Agrobacterium T-DNA integration via floral dip transformation, indicating that AtKu70, AtKu80, and AtMre11 play an important role in T-DNA integration in Arabidopsis. The frequency of gene targeting was not significantly increased in the Atku80 and Atku70 mutants, but it was increased at least 10-fold in the Atmre11 mutant compared with the wild type.

  16. Genetic modification of Lactobacillus plantarum by heterologous gene integration in a not functional region of the chromosome.

    Science.gov (United States)

    Rossi, Franca; Capodaglio, Alessandro; Dellaglio, Franco

    2008-08-01

    This report describes the vector-free engineering of Lactobacillus plantarum by chromosomal integration of an exogenous gene without inactivation of physiological traits. The integrative plasmid vector pP7B6 was derived from pGIP73 by replacing the cbh site, encoding the L. plantarum conjugated bile salt hydrolase, with the prophage fragment P7B6, from L. plantarum Lp80 (DSM 4229). Plasmid pP7B6NI was obtained by inserting the nisin immunity gene nisI of Lactococcus lactis subsp. lactis DSM 20729, preceded by the constitutive promoter P32 from the same strain, in a unique XbaI site of fragment P7B6 and was used to electrotransform L. plantarum Lp80. A food grade recombinant L. plantarum Lp80NI, with 480-fold higher immunity to nisin than the wild type, was derived by integration of pP7B6NI followed by the excision of pP7B6. Polymerase chain reaction tests demonstrated that the integration of nisI in the prophage region had occurred and that the erythromycin resistance marker from pP7B6 was lost. Fifteen among 31 L. plantarum strains tested hybridized with P7B6, indicating that the integration of pP7B6-derived vectors might occur in some other L. plantarum strains. This was experimentally confirmed by constructing the recombinant strain L. plantarum LZNI from the dairy isolate L. plantarum LZ (LMG 24600).

  17. [Integrity].

    Science.gov (United States)

    Gómez Rodríguez, Rafael Ángel

    2014-01-01

    To say that someone possesses integrity is to claim that that person is almost predictable about responses to specific situations, that he or she can prudentially judge and to act correctly. There is a closed interrelationship between integrity and autonomy, and the autonomy rests on the deeper moral claim of all humans to integrity of the person. Integrity has two senses of significance for medical ethic: one sense refers to the integrity of the person in the bodily, psychosocial and intellectual elements; and in the second sense, the integrity is the virtue. Another facet of integrity of the person is la integrity of values we cherish and espouse. The physician must be a person of integrity if the integrity of the patient is to be safeguarded. The autonomy has reduced the violations in the past, but the character and virtues of the physician are the ultimate safeguard of autonomy of patient. A field very important in medicine is the scientific research. It is the character of the investigator that determines the moral quality of research. The problem arises when legitimate self-interests are replaced by selfish, particularly when human subjects are involved. The final safeguard of moral quality of research is the character and conscience of the investigator. Teaching must be relevant in the scientific field, but the most effective way to teach virtue ethics is through the example of the a respected scientist.

  18. Diversifying Sunflower Germplasm by Integration and Mapping of a Novel Male Fertility Restoration Gene

    Science.gov (United States)

    Liu, Zhao; Wang, Dexing; Feng, Jiuhuan; Seiler, Gerald J.; Cai, Xiwen; Jan, Chao-Chien

    2013-01-01

    The combination of a single cytoplasmic male-sterile (CMS) PET-1 and the corresponding fertility restoration (Rf) gene Rf1 is used for commercial hybrid sunflower (Helianthus annuus L., 2n = 34) seed production worldwide. A new CMS line 514A was recently developed with H. tuberosus cytoplasm. However, 33 maintainers and restorers for CMS PET-1 and 20 additional tester lines failed to restore the fertility of CMS 514A. Here, we report the discovery, characterization, and molecular mapping of a novel Rf gene for CMS 514A derived from an amphiploid (Amp H. angustifolius/P 21, 2n = 68). Progeny analysis of the male-fertile (MF) plants (2n = 35) suggested that this gene, designated Rf6, was located on a single alien chromosome. Genomic in situ hybridization (GISH) indicated that Rf6 was on a chromosome with a small segment translocation on the long arm in the MF progenies (2n = 34). Rf6 was mapped to linkage group (LG) 3 of the sunflower SSR map. Eight markers were identified to be linked to this gene, covering a distance of 10.8 cM. Two markers, ORS13 and ORS1114, were only 1.6 cM away from the gene. Severe segregation distortions were observed for both the fertility trait and the linked marker loci, suggesting the possibility of a low frequency of recombination or gamete selection in this region. This study discovered a new CMS/Rf gene system derived from wild species and provided significant insight into the genetic basis of this system. This will diversify the germplasm for sunflower breeding and facilitate understanding of the interaction between the cytoplasm and nuclear genes. PMID:23307903

  19. Using Variable Precision Rough Set for Selection and Classification of Biological Knowledge Integrated in DNA Gene Expression

    Directory of Open Access Journals (Sweden)

    Calvo-Dmgz D.

    2012-12-01

    Full Text Available DNA microarrays have contributed to the exponential growth of genomic and experimental data in the last decade. This large amount of gene expression data has been used by researchers seeking diagnosis of diseases like cancer using machine learning methods. In turn, explicit biological knowledge about gene functions has also grown tremendously over the last decade. This work integrates explicit biological knowledge, provided as gene sets, into the classication process by means of Variable Precision Rough Set Theory (VPRS. The proposed model is able to highlight which part of the provided biological knowledge has been important for classification. This paper presents a novel model for microarray data classification which is able to incorporate prior biological knowledge in the form of gene sets. Based on this knowledge, we transform the input microarray data into supergenes, and then we apply rough set theory to select the most promising supergenes and to derive a set of easy interpretable classification rules. The proposed model is evaluated over three breast cancer microarrays datasets obtaining successful results compared to classical classification techniques. The experimental results shows that there are not significat differences between our model and classical techniques but it is able to provide a biological-interpretable explanation of how it classifies new samples.

  20. Muscle Research and Gene Ontology: New standards for improved data integration.

    Science.gov (United States)

    Feltrin, Erika; Campanaro, Stefano; Diehl, Alexander D; Ehler, Elisabeth; Faulkner, Georgine; Fordham, Jennifer; Gardin, Chiara; Harris, Midori; Hill, David; Knoell, Ralph; Laveder, Paolo; Mittempergher, Lorenza; Nori, Alessandra; Reggiani, Carlo; Sorrentino, Vincenzo; Volpe, Pompeo; Zara, Ivano; Valle, Giorgio; Deegan, Jennifer

    2009-01-29

    The Gene Ontology Project provides structured controlled vocabularies for molecular biology that can be used for the functional annotation of genes and gene products. In a collaboration between the Gene Ontology (GO) Consortium and the muscle biology community, we have made large-scale additions to the GO biological process and cellular component ontologies. The main focus of this ontology development work concerns skeletal muscle, with specific consideration given to the processes of muscle contraction, plasticity, development, and regeneration, and to the sarcomere and membrane-delimited compartments. Our aims were to update the existing structure to reflect current knowledge, and to resolve, in an accommodating manner, the ambiguity in the language used by the community. The updated muscle terminologies have been incorporated into the GO. There are now 159 new terms covering critical research areas, and 57 existing terms have been improved and reorganized to follow their usage in muscle literature. The revised GO structure should improve the interpretation of data from high-throughput (e.g. microarray and proteomic) experiments in the area of muscle science and muscle disease. We actively encourage community feedback on, and gene product annotation with these new terms. Please visit the Muscle Community Annotation Wiki http://wiki.geneontology.org/index.php/Muscle_Biology.

  1. Muscle Research and Gene Ontology: New standards for improved data integration

    Directory of Open Access Journals (Sweden)

    Nori Alessandra

    2009-01-01

    Full Text Available Abstract Background The Gene Ontology Project provides structured controlled vocabularies for molecular biology that can be used for the functional annotation of genes and gene products. In a collaboration between the Gene Ontology (GO Consortium and the muscle biology community, we have made large-scale additions to the GO biological process and cellular component ontologies. The main focus of this ontology development work concerns skeletal muscle, with specific consideration given to the processes of muscle contraction, plasticity, development, and regeneration, and to the sarcomere and membrane-delimited compartments. Our aims were to update the existing structure to reflect current knowledge, and to resolve, in an accommodating manner, the ambiguity in the language used by the community. Results The updated muscle terminologies have been incorporated into the GO. There are now 159 new terms covering critical research areas, and 57 existing terms have been improved and reorganized to follow their usage in muscle literature. Conclusion The revised GO structure should improve the interpretation of data from high-throughput (e.g. microarray and proteomic experiments in the area of muscle science and muscle disease. We actively encourage community feedback on, and gene product annotation with these new terms. Please visit the Muscle Community Annotation Wiki http://wiki.geneontology.org/index.php/Muscle_Biology.

  2. Targeted Gene Knock Out Using Nuclease-Assisted Vector Integration: Hemi- and Homozygous Deletion of JAG1.

    Science.gov (United States)

    Gapinske, Michael; Tague, Nathan; Winter, Jackson; Underhill, Gregory H; Perez-Pinera, Pablo

    2018-01-01

    Gene editing technologies are revolutionizing fields such as biomedicine and biotechnology by providing a simple means to manipulate the genetic makeup of essentially any organism. Gene editing tools function by introducing double-stranded breaks at targeted sites within the genome, which the host cells repair preferentially by Non-Homologous End Joining. While the technologies to introduce double-stranded breaks have been extensively optimized, this progress has not been matched by the development of methods to integrate heterologous DNA at the target sites or techniques to detect and isolate cells that harbor the desired modification. We present here a technique for rapid introduction of vectors at target sites in the genome that enables efficient isolation of successfully edited cells.

  3. An integrated catalog of reference genes in the human gut microbiome

    DEFF Research Database (Denmark)

    Li, Junhua; Jia, Huijue; Cai, Xianghang

    2014-01-01

    Many analyses of the human gut microbiome depend on a catalog of reference genes. Existing catalogs for the human gut microbiome are based on samples from single cohorts or on reference genomes or protein sequences, which limits coverage of global microbiome diversity. Here we combined 249 newly...... signatures. This expanded catalog should facilitate quantitative characterization of metagenomic, metatranscriptomic and metaproteomic data from the gut microbiome to understand its variation across populations in human health and disease.......) comprising 9,879,896 genes. The catalog includes close-to-complete sets of genes for most gut microbes, which are also of considerably higher quality than in previous catalogs. Analyses of a group of samples from Chinese and Danish individuals using the catalog revealed country-specific gut microbial...

  4. Integration of heterogeneous molecular networks to unravel gene-regulation in Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Dam, van J.C.J.; Schaap, P.J.; Martins dos Santos, V.A.P.; Suarez Diez, M.

    2014-01-01

    Background: Different methods have been developed to infer regulatory networks from heterogeneous omics datasets and to construct co-expression networks. Each algorithm produces different networks and efforts have been devoted to automatically integrate them into consensus sets. However each

  5. Efficient production of a gene mutant cell line through integrating TALENs and high-throughput cell cloning.

    Science.gov (United States)

    Sun, Changhong; Fan, Yu; Li, Juan; Wang, Gancheng; Zhang, Hanshuo; Xi, Jianzhong Jeff

    2015-02-01

    Transcription activator-like effectors (TALEs) are becoming powerful DNA-targeting tools in a variety of mammalian cells and model organisms. However, generating a stable cell line with specific gene mutations in a simple and rapid manner remains a challenging task. Here, we report a new method to efficiently produce monoclonal cells using integrated TALE nuclease technology and a series of high-throughput cell cloning approaches. Following this method, we obtained three mTOR mutant 293T cell lines within 2 months, which included one homozygous mutant line. © 2014 Society for Laboratory Automation and Screening.

  6. Bayesian mixture models for assessment of gene differential behaviour and prediction of pCR through the integration of copy number and gene expression data.

    Directory of Open Access Journals (Sweden)

    Filippo Trentini

    Full Text Available We consider modeling jointly microarray RNA expression and DNA copy number data. We propose Bayesian mixture models that define latent Gaussian probit scores for the DNA and RNA, and integrate between the two platforms via a regression of the RNA probit scores on the DNA probit scores. Such a regression conveniently allows us to include additional sample specific covariates such as biological conditions and clinical outcomes. The two developed methods are aimed respectively to make inference on differential behaviour of genes in patients showing different subtypes of breast cancer and to predict the pathological complete response (pCR of patients borrowing strength across the genomic platforms. Posterior inference is carried out via MCMC simulations. We demonstrate the proposed methodology using a published data set consisting of 121 breast cancer patients.

  7. The E7-associated cell-surface antigen: a marker for the 11p13 chromosomal deletion associated with aniridia-Wilms tumor.

    OpenAIRE

    Scoggin, C H; Fisher, J H; Shoemaker, S A; Morse, H; Leigh, T; Riccardi, V M

    1985-01-01

    Unbalanced interstitial deletions of the p13 region of human chromosome 11 have been associated with congenital hypoplasia or aplasia of the iris, mental retardation, ambiguous genitalia, and predisposition to Wilms tumor of the kidney. Utilizing somatic cell hybrids containing either the normal or abnormal chromosome 11 from a child with Wilms tumor and aniridia, we previously mapped the E7 cell-surface antigen to the 11p1300-to-11p15.1 region. To localize even further the site of this antig...

  8. Remedial Investigations Report for Fort Devens Subbury Training Annex, Maynard, Massachusetts, Sites P11/P13 and Sites A12/P36/P37, Phase 2. Volume 1

    Science.gov (United States)

    1995-12-01

    absorption from the lungs after inhalation. Ingestion of high doses of antimony can result in burning stomach pains, colic , nausea, and vomiting. Long-term...Lindane is still imported for use in consumer products including dog dips, shampoos, lotions, sprays, and creams . Although no longer used as a pesticide...absorb through the skin when used in lotions, creams , and shampoos. Data on human exposure comes primarily from occupational studies. BHC overexpo- sure

  9. Integration of C4-specific ppdk gene of Echinochloa to C3 upland ...

    African Journals Online (AJOL)

    Pyruvate orthophosphate dikinase (PPDK) plays a key role in C4 photosynthetic pathway. The enzymatic reaction is one of the rate-limiting steps of the C4 photosynthetic pathway. In this paper, the gene encoding Echinochloa pyruvate orthosphate dikinase (GenBank accession number: AB289641) was introduced into H65 ...

  10. Networks of neurons, networks of genes: An integrated view of memory consolidation

    Czech Academy of Sciences Publication Activity Database

    Miyashita, T.; Kubík, Štěpán; Lewandowski, G.; Guzowski, J. F.

    2008-01-01

    Roč. 89, č. 3 (2008), s. 269-284 ISSN 1074-7427 Institutional research plan: CEZ:AV0Z50110509 Keywords : hippocampus * immediate-early genes * arc Subject RIV: FH - Neurology Impact factor: 3.757, year: 2008

  11. Recurrent Fusion Genes in Gastric Cancer: CLDN18-ARHGAP26 Induces Loss of Epithelial Integrity

    Directory of Open Access Journals (Sweden)

    Fei Yao

    2015-07-01

    Full Text Available Genome rearrangements, a hallmark of cancer, can result in gene fusions with oncogenic properties. Using DNA paired-end-tag (DNA-PET whole-genome sequencing, we analyzed 15 gastric cancers (GCs from Southeast Asians. Rearrangements were enriched in open chromatin and shaped by chromatin structure. We identified seven rearrangement hot spots and 136 gene fusions. In three out of 100 GC cases, we found recurrent fusions between CLDN18, a tight junction gene, and ARHGAP26, a gene encoding a RHOA inhibitor. Epithelial cell lines expressing CLDN18-ARHGAP26 displayed a dramatic loss of epithelial phenotype and long protrusions indicative of epithelial-mesenchymal transition (EMT. Fusion-positive cell lines showed impaired barrier properties, reduced cell-cell and cell-extracellular matrix adhesion, retarded wound healing, and inhibition of RHOA. Gain of invasion was seen in cancer cell lines expressing the fusion. Thus, CLDN18-ARHGAP26 mediates epithelial disintegration, possibly leading to stomach H+ leakage, and the fusion might contribute to invasiveness once a cell is transformed.

  12. Foxf genes integrate tbx5 and hedgehog pathways in the second heart field for cardiac septation.

    Directory of Open Access Journals (Sweden)

    Andrew D Hoffmann

    2014-10-01

    Full Text Available The Second Heart Field (SHF has been implicated in several forms of congenital heart disease (CHD, including atrioventricular septal defects (AVSDs. Identifying the SHF gene regulatory networks required for atrioventricular septation is therefore an essential goal for understanding the molecular basis of AVSDs. We defined a SHF Hedgehog-dependent gene regulatory network using whole genome transcriptional profiling and GLI-chromatin interaction studies. The Forkhead box transcription factors Foxf1a and Foxf2 were identified as SHF Hedgehog targets. Compound haploinsufficiency for Foxf1a and Foxf2 caused atrioventricular septal defects, demonstrating the biological relevance of this regulatory network. We identified a Foxf1a cis-regulatory element that bound the Hedgehog transcriptional regulators GLI1 and GLI3 and the T-box transcription factor TBX5 in vivo. GLI1 and TBX5 synergistically activated transcription from this cis-regulatory element in vitro. This enhancer drove reproducible expression in vivo in the posterior SHF, the only region where Gli1 and Tbx5 expression overlaps. Our findings implicate Foxf genes in atrioventricular septation, describe the molecular underpinnings of the genetic interaction between Hedgehog signaling and Tbx5, and establish a molecular model for the selection of the SHF gene regulatory network for cardiac septation.

  13. Integrative analysis of a cross-loci regulation network identifies App as a gene regulating insulin secretion from pancreatic islets.

    Directory of Open Access Journals (Sweden)

    Zhidong Tu

    Full Text Available Complex diseases result from molecular changes induced by multiple genetic factors and the environment. To derive a systems view of how genetic loci interact in the context of tissue-specific molecular networks, we constructed an F2 intercross comprised of >500 mice from diabetes-resistant (B6 and diabetes-susceptible (BTBR mouse strains made genetically obese by the Leptin(ob/ob mutation (Lep(ob. High-density genotypes, diabetes-related clinical traits, and whole-transcriptome expression profiling in five tissues (white adipose, liver, pancreatic islets, hypothalamus, and gastrocnemius muscle were determined for all mice. We performed an integrative analysis to investigate the inter-relationship among genetic factors, expression traits, and plasma insulin, a hallmark diabetes trait. Among five tissues under study, there are extensive protein-protein interactions between genes responding to different loci in adipose and pancreatic islets that potentially jointly participated in the regulation of plasma insulin. We developed a novel ranking scheme based on cross-loci protein-protein network topology and gene expression to assess each gene's potential to regulate plasma insulin. Unique candidate genes were identified in adipose tissue and islets. In islets, the Alzheimer's gene App was identified as a top candidate regulator. Islets from 17-week-old, but not 10-week-old, App knockout mice showed increased insulin secretion in response to glucose or a membrane-permeant cAMP analog, in agreement with the predictions of the network model. Our result provides a novel hypothesis on the mechanism for the connection between two aging-related diseases: Alzheimer's disease and type 2 diabetes.

  14. An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger.

    Science.gov (United States)

    Sarkari, Parveen; Marx, Hans; Blumhoff, Marzena L; Mattanovich, Diethard; Sauer, Michael; Steiger, Matthias G

    2017-12-01

    Metabolic engineering requires functional genetic tools for easy and quick generation of multiple pathway variants. A genetic engineering toolbox for A. niger is presented, which facilitates the generation of strains carrying heterologous expression cassettes at a defined genetic locus. The system is compatible with Golden Gate cloning, which facilitates the DNA construction process and provides high design flexibility. The integration process is mediated by a CRISPR/Cas9 strategy involving the cutting of both the genetic integration locus (pyrG) as well as the integrating plasmid. Only a transient expression of Cas9 is necessary and the carrying plasmid is readily lost using a size-reduced AMA1 variant. A high integration efficiency into the fungal genome of up to 100% can be achieved, thus reducing the screening process significantly. The feasibility of the approach was demonstrated by the integration of an expression cassette enabling the production of aconitic acid in A. niger. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Integrated bioinformatic analysis unveils significant genes and pathways in the pathogenesis of supratentorial primitive neuroectodermal tumor

    Directory of Open Access Journals (Sweden)

    Wang G

    2018-04-01

    Full Text Available Guang-Yu Wang,1,* Ling Li,2,* Bo Liu,1 Xiao Han,1 Chun-Hua Wang,1 Ji-Wen Wang3 1Department of Neurosurgery, 2Department of Pediatrics, Qilu Children’s Hospital of Shandong University, Jinan, Shandong, 3Department of Neurology, Shanghai Children’s Medical Center, Shanghai Jiaotong University School of Medicine, Pudong New District, Shanghai, People’s Republic of China *These authors contributed equally to this work Purpose: This study aimed to explore significant genes and pathways involved in the pathogenesis of supratentorial primitive neuroectodermal tumor (sPNET. Materials and methods: Gene expression profile of GSE14295 was downloaded from publicly available Gene Expression Omnibus (GEO database. Differentially expressed genes (DEGs were screened out in primary sPNET samples compared with normal fetal and adult brain reference samples (sPNET vs fetal brain and sPNET vs adult brain. Pathway enrichment analysis of these DEGs was conducted, followed by protein–protein interaction (PPI network construction and significant module selection. Additionally, transcription factors (TFs regulating the common DEGs in the two comparison groups were identified, and the regulatory network was constructed. Results: In total, 526 DEGs (99 up- and 427 downregulated in sPNET vs fetal brain and 815 DEGs (200 up- and 615 downregulated in sPNET vs adult brain were identified. DEGs in sPNET vs fetal brain and sPNET vs adult brain were associated with calcium signaling pathway, cell cycle, and p53 signaling pathway. CDK1, CDC20, BUB1B, and BUB1 were hub nodes in the PPI networks of DEGs in sPNET vs fetal brain and sPNET vs adult brain. Significant modules were extracted from the PPI networks. In addition, 64 upregulated and 200 downregulated overlapping DEGs were identified in both sPNET vs fetal brain and sPNET vs adult brain. The genes involved in the regulatory network upon overlapping DEGs and the TFs were correlated with calcium signaling pathway

  16. Strategies for Integrated Analysis of Genetic, Epigenetic, and Gene Expression Variation in Cancer

    DEFF Research Database (Denmark)

    Thingholm, Louise B; Andersen, Lars; Makalic, Enes

    2016-01-01

    The development and progression of cancer, a collection of diseases with complex genetic architectures, is facilitated by the interplay of multiple etiological factors. This complexity challenges the traditional single-platform study design and calls for an integrated approach to data analysis...... to integration strategies used for analyzing genetic risk factors for cancer. We critically examine the ability of these strategies to handle the complexity of the human genome and also accommodate information about the biological and functional interactions between the elements that have been measured...

  17. Strategies for Integrated Analysis of Genetic, Epigenetic, and Gene Expression Variation in Cancer: Addressing the Challenges

    DEFF Research Database (Denmark)

    Thingholm, Louise Bruun; Andersen, Lars; Makalic, Enes

    2016-01-01

    to integration strategies used for analyzing genetic risk factors for cancer. We critically examine the ability of these strategies to handle the complexity of the human genome and also accommodate information about the biological and functional interactions between the elements that have been measured......The development and progression of cancer, a collection of diseases with complex genetic architectures, is facilitated by the interplay of multiple etiological factors. This complexity challenges the traditional single-platform study design and calls for an integrated approach to data analysis...

  18. Integrative microRNA and proteomic approaches identify novel osteoarthritis genes and their collaborative metabolic and inflammatory networks.

    Directory of Open Access Journals (Sweden)

    Dimitrios Iliopoulos

    Full Text Available BACKGROUND: Osteoarthritis is a multifactorial disease characterized by destruction of the articular cartilage due to genetic, mechanical and environmental components affecting more than 100 million individuals all over the world. Despite the high prevalence of the disease, the absence of large-scale molecular studies limits our ability to understand the molecular pathobiology of osteoathritis and identify targets for drug development. METHODOLOGY/PRINCIPAL FINDINGS: In this study we integrated genetic, bioinformatic and proteomic approaches in order to identify new genes and their collaborative networks involved in osteoarthritis pathogenesis. MicroRNA profiling of patient-derived osteoarthritic cartilage in comparison to normal cartilage, revealed a 16 microRNA osteoarthritis gene signature. Using reverse-phase protein arrays in the same tissues we detected 76 differentially expressed proteins between osteoarthritic and normal chondrocytes. Proteins such as SOX11, FGF23, KLF6, WWOX and GDF15 not implicated previously in the genesis of osteoarthritis were identified. Integration of microRNA and proteomic data with microRNA gene-target prediction algorithms, generated a potential "interactome" network consisting of 11 microRNAs and 58 proteins linked by 414 potential functional associations. Comparison of the molecular and clinical data, revealed specific microRNAs (miR-22, miR-103 and proteins (PPARA, BMP7, IL1B to be highly correlated with Body Mass Index (BMI. Experimental validation revealed that miR-22 regulated PPARA and BMP7 expression and its inhibition blocked inflammatory and catabolic changes in osteoarthritic chondrocytes. CONCLUSIONS/SIGNIFICANCE: Our findings indicate that obesity and inflammation are related to osteoarthritis, a metabolic disease affected by microRNA deregulation. Gene network approaches provide new insights for elucidating the complexity of diseases such as osteoarthritis. The integration of microRNA, proteomic

  19. Gene transfer to primary corneal epithelial cells with an integrating lentiviral vector

    Directory of Open Access Journals (Sweden)

    Lauro Augusto de Oliveira

    2010-10-01

    Full Text Available PURPOSE: To evaluate the transfer of heterologous genes carrying a Green Fluorescent Protein (GFP reporter cassette to primary corneal epithelial cells ex vivo. METHODS: Freshly enucleated rabbit corneoscleral tissue was used to obtain corneal epithelial cell suspension via enzymatic digestion. Cells were plated at a density of 5×10³ cells/cm² and allowed to grow for 5 days (to 70-80% confluency prior to transduction. Gene transfer was monitored using fluorescence microscopy and fluorescence activated cell sorter (FACS. We evaluated the transduction efficiency (TE over time and the dose-response effect of different lentiviral particles. One set of cells were dual sorted by fluorescence activated cell sorter for green fluorescent protein expression as well as Hoechst dye exclusion to evaluate the transduction of potentially corneal epithelial stem cells (side-population phenotypic cells. RESULTS: Green fluorescent protein expressing lentiviral vectors were able to effectively transduce rabbit primary epithelial cells cultured ex vivo. Live cell imaging post-transduction demonstrated GFP-positive cells with normal epithelial cell morphology and growth. The transduction efficiency over time was higher at the 5th post-transduction day (14.1% and tended to stabilize after the 8th day. The number of transduced cells was dose-dependent, and at the highest lentivirus concentrations approached 7%. When double sorted by fluorescence activated cell sorter to isolate both green fluorescent protein positive and side population cells, transduced side population cells were identified. CONCLUSIONS: Lentiviral vectors can effectively transfer heterologous genes to primary corneal epithelial cells expanded ex vivo. Genes were stably expressed over time, transferred in a dose-dependence fashion, and could be transferred to mature corneal cells as well as presumable putative stem cells.

  20. Bayesian inference based modelling for gene transcriptional dynamics by integrating multiple source of knowledge

    Directory of Open Access Journals (Sweden)

    Wang Shu-Qiang

    2012-07-01

    Full Text Available Abstract Background A key challenge in the post genome era is to identify genome-wide transcriptional regulatory networks, which specify the interactions between transcription factors and their target genes. Numerous methods have been developed for reconstructing gene regulatory networks from expression data. However, most of them are based on coarse grained qualitative models, and cannot provide a quantitative view of regulatory systems. Results A binding affinity based regulatory model is proposed to quantify the transcriptional regulatory network. Multiple quantities, including binding affinity and the activity level of transcription factor (TF are incorporated into a general learning model. The sequence features of the promoter and the possible occupancy of nucleosomes are exploited to estimate the binding probability of regulators. Comparing with the previous models that only employ microarray data, the proposed model can bridge the gap between the relative background frequency of the observed nucleotide and the gene's transcription rate. Conclusions We testify the proposed approach on two real-world microarray datasets. Experimental results show that the proposed model can effectively identify the parameters and the activity level of TF. Moreover, the kinetic parameters introduced in the proposed model can reveal more biological sense than previous models can do.

  1. Cloning, reassembling and integration of the entire nikkomycin biosynthetic gene cluster into Streptomyces ansochromogenes lead to an improved nikkomycin production

    Directory of Open Access Journals (Sweden)

    Yang Haihua

    2010-01-01

    Full Text Available Abstract Background Nikkomycins are a group of peptidyl nucleoside antibiotics produced by Streptomyces ansochromogenes. They are competitive inhibitors of chitin synthase and show potent fungicidal, insecticidal, and acaricidal activities. Nikkomycin X and Z are the main components produced by S. ansochromogenes. Generation of a high-producing strain is crucial to scale up nikkomycins production for further clinical trials. Results To increase the yields of nikkomycins, an additional copy of nikkomycin biosynthetic gene cluster (35 kb was introduced into nikkomycin producing strain, S. ansochromogenes 7100. The gene cluster was first reassembled into an integrative plasmid by Red/ET technology combining with classic cloning methods and then the resulting plasmid(pNIKwas introduced into S. ansochromogenes by conjugal transfer. Introduction of pNIK led to enhanced production of nikkomycins (880 mg L-1, 4 -fold nikkomycin X and 210 mg L-1, 1.8-fold nikkomycin Z in the resulting exconjugants comparing with the parent strain (220 mg L-1 nikkomycin X and 120 mg L-1 nikkomycin Z. The exconjugants are genetically stable in the absence of antibiotic resistance selection pressure. Conclusion A high nikkomycins producing strain (1100 mg L-1 nikkomycins was obtained by introduction of an extra nikkomycin biosynthetic gene cluster into the genome of S. ansochromogenes. The strategies presented here could be applicable to other bacteria to improve the yields of secondary metabolites.

  2. SemFunSim: a new method for measuring disease similarity by integrating semantic and gene functional association.

    Directory of Open Access Journals (Sweden)

    Liang Cheng

    Full Text Available Measuring similarity between diseases plays an important role in disease-related molecular function research. Functional associations between disease-related genes and semantic associations between diseases are often used to identify pairs of similar diseases from different perspectives. Currently, it is still a challenge to exploit both of them to calculate disease similarity. Therefore, a new method (SemFunSim that integrates semantic and functional association is proposed to address the issue.SemFunSim is designed as follows. First of all, FunSim (Functional similarity is proposed to calculate disease similarity using disease-related gene sets in a weighted network of human gene function. Next, SemSim (Semantic Similarity is devised to calculate disease similarity using the relationship between two diseases from Disease Ontology. Finally, FunSim and SemSim are integrated to measure disease similarity.The high average AUC (area under the receiver operating characteristic curve (96.37% shows that SemFunSim achieves a high true positive rate and a low false positive rate. 79 of the top 100 pairs of similar diseases identified by SemFunSim are annotated in the Comparative Toxicogenomics Database (CTD as being targeted by the same therapeutic compounds, while other methods we compared could identify 35 or less such pairs among the top 100. Moreover, when using our method on diseases without annotated compounds in CTD, we could confirm many of our predicted candidate compounds from literature. This indicates that SemFunSim is an effective method for drug repositioning.

  3. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA Genes in Flax (Linum usitatissimum L.

    Directory of Open Access Journals (Sweden)

    Olga Y. Yurkevich

    2017-08-01

    Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  4. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA) Genes in Flax (Linum usitatissimum L.).

    Science.gov (United States)

    Yurkevich, Olga Y; Kirov, Ilya V; Bolsheva, Nadezhda L; Rachinskaya, Olga A; Grushetskaya, Zoya E; Zoschuk, Svyatoslav A; Samatadze, Tatiana E; Bogdanova, Marina V; Lemesh, Valentina A; Amosova, Alexandra V; Muravenko, Olga V

    2017-01-01

    Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase ( CesA ) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH)-based chromosomal localization of the CesA conserved fragment (KF011584.1), 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum . Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG) 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  5. Integrated physical map of bread wheat chromosome arm 7DS to facilitate gene cloning and comparative studies.

    Science.gov (United States)

    Tulpová, Zuzana; Luo, Ming-Cheng; Toegelová, Helena; Visendi, Paul; Hayashi, Satomi; Vojta, Petr; Paux, Etienne; Kilian, Andrzej; Abrouk, Michaël; Bartoš, Jan; Hajdúch, Marián; Batley, Jacqueline; Edwards, David; Doležel, Jaroslav; Šimková, Hana

    2018-03-08

    Bread wheat (Triticum aestivum L.) is a staple food for a significant part of the world's population. The growing demand on its production can be satisfied by improving yield and resistance to biotic and abiotic stress. Knowledge of the genome sequence would aid in discovering genes and QTLs underlying these traits and provide a basis for genomics-assisted breeding. Physical maps and BAC clones associated with them have been valuable resources from which to generate a reference genome of bread wheat and to assist map-based gene cloning. As a part of a joint effort coordinated by the International Wheat Genome Sequencing Consortium, we have constructed a BAC-based physical map of bread wheat chromosome arm 7DS consisting of 895 contigs and covering 94% of its estimated length. By anchoring BAC contigs to one radiation hybrid map and three high resolution genetic maps, we assigned 73% of the assembly to a distinct genomic position. This map integration, interconnecting a total of 1713 markers with ordered and sequenced BAC clones from a minimal tiling path, provides a tool to speed up gene cloning in wheat. The process of physical map assembly included the integration of the 7DS physical map with a whole-genome physical map of Aegilops tauschii and a 7DS Bionano genome map, which together enabled efficient scaffolding of physical-map contigs, even in the non-recombining region of the genetic centromere. Moreover, this approach facilitated a comparison of bread wheat and its ancestor at BAC-contig level and revealed a reconstructed region in the 7DS pericentromere. Copyright © 2018. Published by Elsevier B.V.

  6. Integrative multi-platform meta-analysis of gene expression profiles in pancreatic ductal adenocarcinoma patients for identifying novel diagnostic biomarkers.

    Science.gov (United States)

    Irigoyen, Antonio; Jimenez-Luna, Cristina; Benavides, Manuel; Caba, Octavio; Gallego, Javier; Ortuño, Francisco Manuel; Guillen-Ponce, Carmen; Rojas, Ignacio; Aranda, Enrique; Torres, Carolina; Prados, Jose

    2018-01-01

    Applying differentially expressed genes (DEGs) to identify feasible biomarkers in diseases can be a hard task when working with heterogeneous datasets. Expression data are strongly influenced by technology, sample preparation processes, and/or labeling methods. The proliferation of different microarray platforms for measuring gene expression increases the need to develop models able to compare their results, especially when different technologies can lead to signal values that vary greatly. Integrative meta-analysis can significantly improve the reliability and robustness of DEG detection. The objective of this work was to develop an integrative approach for identifying potential cancer biomarkers by integrating gene expression data from two different platforms. Pancreatic ductal adenocarcinoma (PDAC), where there is an urgent need to find new biomarkers due its late diagnosis, is an ideal candidate for testing this technology. Expression data from two different datasets, namely Affymetrix and Illumina (18 and 36 PDAC patients, respectively), as well as from 18 healthy controls, was used for this study. A meta-analysis based on an empirical Bayesian methodology (ComBat) was then proposed to integrate these datasets. DEGs were finally identified from the integrated data by using the statistical programming language R. After our integrative meta-analysis, 5 genes were commonly identified within the individual analyses of the independent datasets. Also, 28 novel genes that were not reported by the individual analyses ('gained' genes) were also discovered. Several of these gained genes have been already related to other gastroenterological tumors. The proposed integrative meta-analysis has revealed novel DEGs that may play an important role in PDAC and could be potential biomarkers for diagnosing the disease.

  7. ANLN functions as a key candidate gene in cervical cancer as determined by integrated bioinformatic analysis

    Directory of Open Access Journals (Sweden)

    Xia L

    2018-04-01

    Full Text Available Leilei Xia,1,* Xiaoling Su,1,2,* Jizi Shen,1,* Qi Meng,1 Jiuqiong Yan,1 Caihong Zhang,1 Yu Chen,1 Han Wang,3 Mingjuan Xu,1 1Department of Obstetrics and Gynecology, Changhai Hospital, Second Military Medical University, Shanghai, People’s Republic of China; 2Department of Obstetrics and Gynecology, No. 455 Hospital, Shanghai, People’s Republic of China; 3Department of Pathology, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai, People’s Republic of China *These authors contributed equally to this work Background: Cervical cancer, one of the leading causes of female deaths, remains a top cause of mortality in gynecologic oncology and tends to affect younger individuals. However, the pathogenesis of cervical cancer is still far from clear. Given the high incidence and mortality of cervical cancer, uncovering the causes and pathogenesis as well as identifying novel biomarkers are of great significance and are desperately needed.Materials and methods: First, raw data were downloaded from the Gene Expression Omnibus database. The Robuse Multi-Array Average algorithm and combat function of the sva package were subsequently applied to preprocess and remove batch effects. Differentially expressed genes (DEGs analyzed with the limma package were followed by gene ontology and pathway analysis, and a protein–protein interaction (PPI network based on the STRING website and the Cytoscape software was constructed. Weighted Correlation Network Analysis (WGCNA was utilized to build the coexpression network. Subsequently, UALCAN websites were employed to conduct survival analysis. Finally, the oncomine database was used to validate the expression of ANLN in other datasets.Results: GSE29570 and GSE89657, including 49 cervical cancer tissues and 20 normal cervical tissues, were screened as the datasets. Three-hundred-twenty-four DEGs were identified and, among them, 123 were upregulated, while 201 were downregulated. The

  8. Thylakoid redox signals are integrated into organellar-gene-expression-dependent retrograde signalling in the prors1-1 mutant

    Directory of Open Access Journals (Sweden)

    Luca eTadini

    2012-12-01

    Full Text Available Perturbations in organellar gene expression (OGE and the thylakoid redox state (TRS activate retrograde signalling pathways that adaptively modify nuclear gene expression (NGE, according to developmental and metabolic needs. The prors1-1 mutation in Arabidopsis down-regulates the expression of the nuclear gene Prolyl-tRNA Synthetase1 (PRORS1 which acts in both plastids and mitochondria, thereby impairing protein synthesis in both organelles and triggering OGE-dependent retrograde signalling. Because the mutation also affects thylakoid electron transport, TRS-dependent signals may likewise have an impact on the changes in NGE observed in this genotype. In this study, we have investigated whether signals related to TRS are actually integrated into the OGE-dependent retrograde signalling pathway. To this end, the chaos mutation (for chlorophyll a/b binding protein harvesting-organelle specific, which shows a partial loss of PSII antennae proteins and thus a reduction in PSII light absorption capability, was introduced into the prors1-1 mutant background. The resulting double mutant displayed a prors1-1-like reduction in plastid translation rate and a chaos-like decrease in PSII antenna size, whereas the hyper-reduction of the thylakoid electron transport chain, caused by the prors1-1 mutation, was alleviated, as determined by monitoring chlorophyll (Chl fluorescence and thylakoid phosphorylation. Interestingly, a substantial fraction of the nucleus-encoded photosynthesis genes down-regulated in the prors1-1 mutant are expressed at nearly wild-type rates in prors1-1 chaos leaves, and this recovery is reflected in the steady-state levels of their protein products in the chloroplast. We therefore conclude that signals related to photosynthetic electron transport and TRS, and indirectly to carbohydrate metabolism and energy balance, are indeed fed into the OGE-dependent retrograde pathway to modulate NGE and adjust the abundance of chloroplast proteins.

  9. Integration of mouse and human genome-wide association data identifies KCNIP4 as an asthma gene.

    Directory of Open Access Journals (Sweden)

    Blanca E Himes

    Full Text Available Asthma is a common chronic respiratory disease characterized by airway hyperresponsiveness (AHR. The genetics of asthma have been widely studied in mouse and human, and homologous genomic regions have been associated with mouse AHR and human asthma-related phenotypes. Our goal was to identify asthma-related genes by integrating AHR associations in mouse with human genome-wide association study (GWAS data. We used Efficient Mixed Model Association (EMMA analysis to conduct a GWAS of baseline AHR measures from males and females of 31 mouse strains. Genes near or containing SNPs with EMMA p-values <0.001 were selected for further study in human GWAS. The results of the previously reported EVE consortium asthma GWAS meta-analysis consisting of 12,958 diverse North American subjects from 9 study centers were used to select a subset of homologous genes with evidence of association with asthma in humans. Following validation attempts in three human asthma GWAS (i.e., Sepracor/LOCCS/LODO/Illumina, GABRIEL, DAG and two human AHR GWAS (i.e., SHARP, DAG, the Kv channel interacting protein 4 (KCNIP4 gene was identified as nominally associated with both asthma and AHR at a gene- and SNP-level. In EVE, the smallest KCNIP4 association was at rs6833065 (P-value 2.9e-04, while the strongest associations for Sepracor/LOCCS/LODO/Illumina, GABRIEL, DAG were 1.5e-03, 1.0e-03, 3.1e-03 at rs7664617, rs4697177, rs4696975, respectively. At a SNP level, the strongest association across all asthma GWAS was at rs4697177 (P-value 1.1e-04. The smallest P-values for association with AHR were 2.3e-03 at rs11947661 in SHARP and 2.1e-03 at rs402802 in DAG. Functional studies are required to validate the potential involvement of KCNIP4 in modulating asthma susceptibility and/or AHR. Our results suggest that a useful approach to identify genes associated with human asthma is to leverage mouse AHR association data.

  10. Integrated bioinformatic analysis unveils significant genes and pathways in the pathogenesis of supratentorial primitive neuroectodermal tumor

    OpenAIRE

    Wang G; Li L; Liu B; Han X; Wang CH; Wang JW

    2018-01-01

    Guang-Yu Wang,1,* Ling Li,2,* Bo Liu,1 Xiao Han,1 Chun-Hua Wang,1 Ji-Wen Wang3 1Department of Neurosurgery, 2Department of Pediatrics, Qilu Children’s Hospital of Shandong University, Jinan, Shandong, 3Department of Neurology, Shanghai Children’s Medical Center, Shanghai Jiaotong University School of Medicine, Pudong New District, Shanghai, People’s Republic of China *These authors contributed equally to this work Purpose: This study aimed to explore significant gene...

  11. Strategies for integrated analysis of genetic, epigenetic and gene expression variation in cancer: addressing the challenges

    Directory of Open Access Journals (Sweden)

    Louise Bruun Thingholm

    2016-02-01

    Full Text Available The development and progression of cancer, a collection of diseases with complex genetic architectures, is facilitated by the interplay of multiple etiological factors. This complexity challenges the traditional single-platform study design and calls for an integrated approach to data analysis. However, integration of heterogeneous measurements of biological variation is a non-trivial exercise due to the diversity of the human genome and the variety of output data formats and genome coverage obtained from the commonly used molecular platforms. This review article will provide an introduction to integration strategies used for analyzing genetic risk factors for cancer. We critically examine the ability of these strategies to handle the complexity of the human genome and also accommodate information about the biological and functional interactions between the elements that have been measured – making the assessment of disease risk against a composite genomic factor possible. The focus of this review is to provide an overview and introduction to the main strategies and to discuss where there is a need for further development.

  12. CRISPR-Mediated Integration of Large Gene Cassettes Using AAV Donor Vectors

    Directory of Open Access Journals (Sweden)

    Rasmus O. Bak

    2017-07-01

    Full Text Available The CRISPR/Cas9 system has recently been shown to facilitate high levels of precise genome editing using adeno-associated viral (AAV vectors to serve as donor template DNA during homologous recombination (HR. However, the maximum AAV packaging capacity of ∼4.5 kb limits the donor size. Here, we overcome this constraint by showing that two co-transduced AAV vectors can serve as donors during consecutive HR events for the integration of large transgenes. Importantly, the method involves a single-step procedure applicable to primary cells with relevance to therapeutic genome editing. We use the methodology in primary human T cells and CD34+ hematopoietic stem and progenitor cells to site-specifically integrate an expression cassette that, as a single donor vector, would otherwise amount to a total of 6.5 kb. This approach now provides an efficient way to integrate large transgene cassettes into the genomes of primary human cells using HR-mediated genome editing with AAV vectors.

  13. MultiLoc2: integrating phylogeny and Gene Ontology terms improves subcellular protein localization prediction

    Directory of Open Access Journals (Sweden)

    Kohlbacher Oliver

    2009-09-01

    Full Text Available Abstract Background Knowledge of subcellular localization of proteins is crucial to proteomics, drug target discovery and systems biology since localization and biological function are highly correlated. In recent years, numerous computational prediction methods have been developed. Nevertheless, there is still a need for prediction methods that show more robustness and higher accuracy. Results We extended our previous MultiLoc predictor by incorporating phylogenetic profiles and Gene Ontology terms. Two different datasets were used for training the system, resulting in two versions of this high-accuracy prediction method. One version is specialized for globular proteins and predicts up to five localizations, whereas a second version covers all eleven main eukaryotic subcellular localizations. In a benchmark study with five localizations, MultiLoc2 performs considerably better than other methods for animal and plant proteins and comparably for fungal proteins. Furthermore, MultiLoc2 performs clearly better when using a second dataset that extends the benchmark study to all eleven main eukaryotic subcellular localizations. Conclusion MultiLoc2 is an extensive high-performance subcellular protein localization prediction system. By incorporating phylogenetic profiles and Gene Ontology terms MultiLoc2 yields higher accuracies compared to its previous version. Moreover, it outperforms other prediction systems in two benchmarks studies. MultiLoc2 is available as user-friendly and free web-service, available at: http://www-bs.informatik.uni-tuebingen.de/Services/MultiLoc2.

  14. Construction of an integrated map and location of a bruchid resistance gene in mung bean

    Directory of Open Access Journals (Sweden)

    Lixia Wang

    2016-10-01

    Full Text Available Bruchid beetle (Callosobruchus chinensis poses a serious threat to the production and storage of mung bean (Vigna radiata. Mapping bruchid resistance (Br will provide an important basis for cloning the responsible gene(s and elucidating its functional mechanism, and will also facilitate marker-assisted selection in mung bean breeding. Here, we report the construction of the genetic linkage groups of mung bean and mapping of the Br1 locus using an RIL population derived from a cross between Berken, a bruchid-susceptible line, and ACC41, a bruchid-resistant line. A total of 560 markers were mapped onto 11 linkage groups, with 38.0% of the markers showing distorted segregation. The lengths of the linkage groups ranged from 45.2 to 117.0 cM with a total coverage of 732.9 cM and an average interval of 1.3 cM between loci. Br1 was located on LG9 between BM202 (0.7 cM and Vr2-627 (1.7 cM. Based on 270 shared SSR markers, most of the linkage groups were assigned to specific chromosomes. These results should further accelerate the genetic study of this crop.

  15. A database and tool, IM Browser, for exploring and integrating emerging gene and protein interaction data for Drosophila

    Directory of Open Access Journals (Sweden)

    Parrish Jodi R

    2006-04-01

    Full Text Available Abstract Background Biological processes are mediated by networks of interacting genes and proteins. Efforts to map and understand these networks are resulting in the proliferation of interaction data derived from both experimental and computational techniques for a number of organisms. The volume of this data combined with the variety of specific forms it can take has created a need for comprehensive databases that include all of the available data sets, and for exploration tools to facilitate data integration and analysis. One powerful paradigm for the navigation and analysis of interaction data is an interaction graph or map that represents proteins or genes as nodes linked by interactions. Several programs have been developed for graphical representation and analysis of interaction data, yet there remains a need for alternative programs that can provide casual users with rapid easy access to many existing and emerging data sets. Description Here we describe a comprehensive database of Drosophila gene and protein interactions collected from a variety of sources, including low and high throughput screens, genetic interactions, and computational predictions. We also present a program for exploring multiple interaction data sets and for combining data from different sources. The program, referred to as the Interaction Map (IM Browser, is a web-based application for searching and visualizing interaction data stored in a relational database system. Use of the application requires no downloads and minimal user configuration or training, thereby enabling rapid initial access to interaction data. IM Browser was designed to readily accommodate and integrate new types of interaction data as it becomes available. Moreover, all information associated with interaction measurements or predictions and the genes or proteins involved are accessible to the user. This allows combined searches and analyses based on either common or technique-specific attributes

  16. Development of a multiple-gene-loading method by combining multi-integration system-equipped mouse artificial chromosome vector and CRISPR-Cas9.

    Directory of Open Access Journals (Sweden)

    Kazuhisa Honma

    Full Text Available Mouse artificial chromosome (MAC vectors have several advantages as gene delivery vectors, such as stable and independent maintenance in host cells without integration, transferability from donor cells to recipient cells via microcell-mediated chromosome transfer (MMCT, and the potential for loading a megabase-sized DNA fragment. Previously, a MAC containing a multi-integrase platform (MI-MAC was developed to facilitate the transfer of multiple genes into desired cells. Although the MI system can theoretically hold five gene-loading vectors (GLVs, there are a limited number of drugs available for the selection of multiple-GLV integration. To overcome this issue, we attempted to knock out and reuse drug resistance genes (DRGs using the CRISPR-Cas9 system. In this study, we developed new methods for multiple-GLV integration. As a proof of concept, we introduced five GLVs in the MI-MAC by these methods, in which each GLV contained a gene encoding a fluorescent or luminescent protein (EGFP, mCherry, BFP, Eluc, and Cluc. Genes of interest (GOI on the MI-MAC were expressed stably and functionally without silencing in the host cells. Furthermore, the MI-MAC carrying five GLVs was transferred to other cells by MMCT, and the resultant recipient cells exhibited all five fluorescence/luminescence signals. Thus, the MI-MAC was successfully used as a multiple-GLV integration vector using the CRISPR-Cas9 system. The MI-MAC employing these methods may resolve bottlenecks in developing multiple-gene humanized models, multiple-gene monitoring models, disease models, reprogramming, and inducible gene expression systems.

  17. SKIP and BIR-1/Survivin have potential to integrate proteome status with gene expression

    Czech Academy of Sciences Publication Activity Database

    Kostrouchová, V.; Kostrouch, Z.; Kostrouch, D.; Kostrouchová, M.; Yilma, P.; Chughtai, Ahmed A.; Novotný, Jan P.; Novák, Petr

    2014-01-01

    Roč. 110, č. 4 (2014), s. 93-106 ISSN 1874-3919 R&D Projects: GA MŠk(CZ) cz.1.07/2.3.00/20.0055; GA MŠk ED1.1.00/02.0109; GA MŠk(CZ) EE2.3.30.0003; GA MŠk ED0012/01/01 Grant - others:Masaryk University, Brno(CZ) MUNI/A/1012/2009; Universita Karlova(CZ) UNCE 204022; Universita Karlova(GB) UNCE204011; Univesita Karlova(CZ) PRVOUK-P24/LF/1/3 Institutional support: RVO:61388971 Keywords : Survivin * proteomics * gene expression Subject RIV: EE - Microbiology, Virology Impact factor: 3.888, year: 2014

  18. Linking genes to microbial growth kinetics: an integrated biochemical systems engineering approach.

    Science.gov (United States)

    Koutinas, Michalis; Kiparissides, Alexandros; Silva-Rocha, Rafael; Lam, Ming-Chi; Martins Dos Santos, Vitor A P; de Lorenzo, Victor; Pistikopoulos, Efstratios N; Mantalaris, Athanasios

    2011-07-01

    The majority of models describing the kinetic properties of a microorganism for a given substrate are unstructured and empirical. They are formulated in this manner so that the complex mechanism of cell growth is simplified. Herein, a novel approach for modelling microbial growth kinetics is proposed, linking biomass growth and substrate consumption rates to the gene regulatory programmes that control these processes. A dynamic model of the TOL (pWW0) plasmid of Pseudomonas putida mt-2 has been developed, describing the molecular interactions that lead to the transcription of the upper and meta operons, known to produce the enzymes for the oxidative catabolism of m-xylene. The genetic circuit model was combined with a growth kinetic model decoupling biomass growth and substrate consumption rates, which are expressed as independent functions of the rate-limiting enzymes produced by the operons. Estimation of model parameters and validation of the model's predictive capability were successfully performed in batch cultures of mt-2 fed with different concentrations of m-xylene, as confirmed by relative mRNA concentration measurements of the promoters encoded in TOL. The growth formation and substrate utilisation patterns could not be accurately described by traditional Monod-type models for a wide range of conditions, demonstrating the critical importance of gene regulation for the development of advanced models closely predicting complex bioprocesses. In contrast, the proposed strategy, which utilises quantitative information pertaining to upstream molecular events that control the production of rate-limiting enzymes, predicts the catabolism of a substrate and biomass formation and could be of central importance for the design of optimal bioprocesses. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Integrative analysis of single nucleotide polymorphisms and gene expression efficiently distinguishes samples from closely related ethnic populations

    Directory of Open Access Journals (Sweden)

    Yang Hsin-Chou

    2012-07-01

    Full Text Available Abstract Background Ancestry informative markers (AIMs are a type of genetic marker that is informative for tracing the ancestral ethnicity of individuals. Application of AIMs has gained substantial attention in population genetics, forensic sciences, and medical genetics. Single nucleotide polymorphisms (SNPs, the materials of AIMs, are useful for classifying individuals from distinct continental origins but cannot discriminate individuals with subtle genetic differences from closely related ancestral lineages. Proof-of-principle studies have shown that gene expression (GE also is a heritable human variation that exhibits differential intensity distributions among ethnic groups. GE supplies ethnic information supplemental to SNPs; this motivated us to integrate SNP and GE markers to construct AIM panels with a reduced number of required markers and provide high accuracy in ancestry inference. Few studies in the literature have considered GE in this aspect, and none have integrated SNP and GE markers to aid classification of samples from closely related ethnic populations. Results We integrated a forward variable selection procedure into flexible discriminant analysis to identify key SNP and/or GE markers with the highest cross-validation prediction accuracy. By analyzing genome-wide SNP and/or GE markers in 210 independent samples from four ethnic groups in the HapMap II Project, we found that average testing accuracies for a majority of classification analyses were quite high, except for SNP-only analyses that were performed to discern study samples containing individuals from two close Asian populations. The average testing accuracies ranged from 0.53 to 0.79 for SNP-only analyses and increased to around 0.90 when GE markers were integrated together with SNP markers for the classification of samples from closely related Asian populations. Compared to GE-only analyses, integrative analyses of SNP and GE markers showed comparable testing

  20. Integrative Analysis of Hippocampus Gene Expression Profiles Identifies Network Alterations in Aging and Alzheimer’s Disease

    Directory of Open Access Journals (Sweden)

    Vinay Lanke

    2018-05-01

    Full Text Available Alzheimer’s disease (AD is a neurodegenerative disorder contributing to rapid decline in cognitive function and ultimately dementia. Most cases of AD occur in elderly and later years. There is a growing need for understanding the relationship between aging and AD to identify shared and unique hallmarks associated with the disease in a region and cell-type specific manner. Although genomic studies on AD have been performed extensively, the molecular mechanism of disease progression is still not clear. The major objective of our study is to obtain a higher-order network-level understanding of aging and AD, and their relationship using the hippocampal gene expression profiles of young (20–50 years, aging (70–99 years, and AD (70–99 years. The hippocampus is vulnerable to damage at early stages of AD and altered neurogenesis in the hippocampus is linked to the onset of AD. We combined the weighted gene co-expression network and weighted protein–protein interaction network-level approaches to study the transition from young to aging to AD. The network analysis revealed the organization of co-expression network into functional modules that are cell-type specific in aging and AD. We found that modules associated with astrocytes, endothelial cells and microglial cells are upregulated and significantly correlate with both aging and AD. The modules associated with neurons, mitochondria and endoplasmic reticulum are downregulated and significantly correlate with AD than aging. The oligodendrocytes module does not show significant correlation with neither aging nor disease. Further, we identified aging- and AD-specific interactions/subnetworks by integrating the gene expression with a human protein–protein interaction network. We found dysregulation of genes encoding protein kinases (FYN, SYK, SRC, PKC, MAPK1, ephrin receptors and transcription factors (FOS, STAT3, CEBPB, MYC, NFKβ, and EGR1 in AD. Further, we found genes that encode proteins

  1. A new essential protein discovery method based on the integration of protein-protein interaction and gene expression data

    Directory of Open Access Journals (Sweden)

    Li Min

    2012-03-01

    Full Text Available Abstract Background Identification of essential proteins is always a challenging task since it requires experimental approaches that are time-consuming and laborious. With the advances in high throughput technologies, a large number of protein-protein interactions are available, which have produced unprecedented opportunities for detecting proteins' essentialities from the network level. There have been a series of computational approaches proposed for predicting essential proteins based on network topologies. However, the network topology-based centrality measures are very sensitive to the robustness of network. Therefore, a new robust essential protein discovery method would be of great value. Results In this paper, we propose a new centrality measure, named PeC, based on the integration of protein-protein interaction and gene expression data. The performance of PeC is validated based on the protein-protein interaction network of Saccharomyces cerevisiae. The experimental results show that the predicted precision of PeC clearly exceeds that of the other fifteen previously proposed centrality measures: Degree Centrality (DC, Betweenness Centrality (BC, Closeness Centrality (CC, Subgraph Centrality (SC, Eigenvector Centrality (EC, Information Centrality (IC, Bottle Neck (BN, Density of Maximum Neighborhood Component (DMNC, Local Average Connectivity-based method (LAC, Sum of ECC (SoECC, Range-Limited Centrality (RL, L-index (LI, Leader Rank (LR, Normalized α-Centrality (NC, and Moduland-Centrality (MC. Especially, the improvement of PeC over the classic centrality measures (BC, CC, SC, EC, and BN is more than 50% when predicting no more than 500 proteins. Conclusions We demonstrate that the integration of protein-protein interaction network and gene expression data can help improve the precision of predicting essential proteins. The new centrality measure, PeC, is an effective essential protein discovery method.

  2. The use of semantic similarity measures for optimally integrating heterogeneous Gene Ontology data from large scale annotation pipelines

    Directory of Open Access Journals (Sweden)

    Gaston K Mazandu

    2014-08-01

    Full Text Available With the advancement of new high throughput sequencing technologies, there has been an increase in the number of genome sequencing projects worldwide, which has yielded complete genome sequences of human, animals and plants. Subsequently, several labs have focused on genome annotation, consisting of assigning functions to gene products, mostly using Gene Ontology (GO terms. As a consequence, there is an increased heterogeneity in annotations across genomes due to different approaches used by different pipelines to infer these annotations and also due to the nature of the GO structure itself. This makes a curator's task difficult, even if they adhere to the established guidelines for assessing these protein annotations. Here we develop a genome-scale approach for integrating GO annotations from different pipelines using semantic similarity measures. We used this approach to identify inconsistencies and similarities in functional annotations between orthologs of human and Drosophila melanogaster, to assess the quality of GO annotations derived from InterPro2GO mappings compared to manually annotated GO annotations for the Drosophila melanogaster proteome from a FlyBase dataset and human, and to filter GO annotation data for these proteomes. Results obtained indicate that an efficient integration of GO annotations eliminates redundancy up to 27.08 and 22.32% in the Drosophila melanogaster and human GO annotation datasets, respectively. Furthermore, we identified lack of and missing annotations for some orthologs, and annotation mismatches between InterPro2GO and manual pipelines in these two proteomes, thus requiring further curation. This simplifies and facilitates tasks of curators in assessing protein annotations, reduces redundancy and eliminates inconsistencies in large annotation datasets for ease of comparative functional genomics.

  3. Cross-species multiple environmental stress responses: An integrated approach to identify candidate genes for multiple stress tolerance in sorghum (Sorghum bicolor (L. Moench and related model species.

    Directory of Open Access Journals (Sweden)

    Adugna Abdi Woldesemayat

    Full Text Available Crop response to the changing climate and unpredictable effects of global warming with adverse conditions such as drought stress has brought concerns about food security to the fore; crop yield loss is a major cause of concern in this regard. Identification of genes with multiple responses across environmental stresses is the genetic foundation that leads to crop adaptation to environmental perturbations.In this paper, we introduce an integrated approach to assess candidate genes for multiple stress responses across-species. The approach combines ontology based semantic data integration with expression profiling, comparative genomics, phylogenomics, functional gene enrichment and gene enrichment network analysis to identify genes associated with plant stress phenotypes. Five different ontologies, viz., Gene Ontology (GO, Trait Ontology (TO, Plant Ontology (PO, Growth Ontology (GRO and Environment Ontology (EO were used to semantically integrate drought related information.Target genes linked to Quantitative Trait Loci (QTLs controlling yield and stress tolerance in sorghum (Sorghum bicolor (L. Moench and closely related species were identified. Based on the enriched GO terms of the biological processes, 1116 sorghum genes with potential responses to 5 different stresses, such as drought (18%, salt (32%, cold (20%, heat (8% and oxidative stress (25% were identified to be over-expressed. Out of 169 sorghum drought responsive QTLs associated genes that were identified based on expression datasets, 56% were shown to have multiple stress responses. On the other hand, out of 168 additional genes that have been evaluated for orthologous pairs, 90% were conserved across species for drought tolerance. Over 50% of identified maize and rice genes were responsive to drought and salt stresses and were co-located within multifunctional QTLs. Among the total identified multi-stress responsive genes, 272 targets were shown to be co-localized within QTLs

  4. Integrated in silico Analyses of Regulatory and Metabolic Networks of Synechococcus sp. PCC 7002 Reveal Relationships between Gene Centrality and Essentiality

    Directory of Open Access Journals (Sweden)

    Hyun-Seob Song

    2015-03-01

    Full Text Available Cyanobacteria dynamically relay environmental inputs to intracellular adaptations through a coordinated adjustment of photosynthetic efficiency and carbon processing rates. The output of such adaptations is reflected through changes in transcriptional patterns and metabolic flux distributions that ultimately define growth strategy. To address interrelationships between metabolism and regulation, we performed integrative analyses of metabolic and gene co-expression networks in a model cyanobacterium, Synechococcus sp. PCC 7002. Centrality analyses using the gene co-expression network identified a set of key genes, which were defined here as “topologically important.” Parallel in silico gene knock-out simulations, using the genome-scale metabolic network, classified what we termed as “functionally important” genes, deletion of which affected growth or metabolism. A strong positive correlation was observed between topologically and functionally important genes. Functionally important genes exhibited variable levels of topological centrality; however, the majority of topologically central genes were found to be functionally essential for growth. Subsequent functional enrichment analysis revealed that both functionally and topologically important genes in Synechococcus sp. PCC 7002 are predominantly associated with translation and energy metabolism, two cellular processes critical for growth. This research demonstrates how synergistic network-level analyses can be used for reconciliation of metabolic and gene expression data to uncover fundamental biological principles.

  5. Trans-activation function of a 3' truncated X gene-cell fusion product from integrated hepatitis B virus DNA in chronic hepatitis tissues

    International Nuclear Information System (INIS)

    Takada, Shinako; Koike, Katsuro

    1990-01-01

    To investigate the expression and transactivation function of the X gene in integrated hepatitis B virus (HBV) DNA from chronic hepatitis tissues, a series of transfectants containing cloned integrated HBV DNAs was made and analyzed for X mRNA expression and trans-activation activity by using a chloramphenicol acetyltransferase assay. Most of the integrated HBV DNAs expressed X mRNA and encoded a product with trans-activation activity in spite of the loss of the 3' end region of the X gene due to integration. From cDNA cloning and sequence analysis of X mRNA transcribed from native or integrated HBV DNA, the X protein was found to be translated from the X open reading frame without splicing. For integrated HBV DNA, transcription was extended to a cellular flanking DNA and an X gene-cell fusion transcript was terminated by using a cellular poly(A) signal. The amino acid sequence deduced from an X-cell fusion transcript indicated truncation of the carboxyl-terminal five amino acids, but the upstream region of seven amino acids conserved among hepadnaviruses was retained in the integrated HBV DNA, suggesting that this conserved region is essential for the transactivation function of the X protein. These findings support the following explanation for hepatocarcinogenesis by HBV DNA integration: the expression of a cellular oncogene(s) is transactivated at the time of chronic infection by the increasing amounts of the integrated HBV gene product(s), such as the X-cell fusion product

  6. Integration of the Pokeweed miRNA and mRNA Transcriptomes Reveals Targeting of Jasmonic Acid-Responsive Genes

    Directory of Open Access Journals (Sweden)

    Kira C. M. Neller

    2018-05-01

    Full Text Available The American pokeweed plant, Phytolacca americana, displays broad-spectrum resistance to plant viruses and is a heavy metal hyperaccumulator. However, little is known about the regulation of biotic and abiotic stress responses in this non-model plant. To investigate the control of miRNAs in gene expression, we sequenced the small RNA transcriptome of pokeweed treated with jasmonic acid (JA, a hormone that mediates pathogen defense and stress tolerance. We predicted 145 miRNAs responsive to JA, most of which were unique to pokeweed. These miRNAs were low in abundance and condition-specific, with discrete expression change. Integration of paired mRNA-Seq expression data enabled us to identify correlated, novel JA-responsive targets that mediate hormone biosynthesis, signal transduction, and pathogen defense. The expression of approximately half the pairs was positively correlated, an uncommon finding that we functionally validated by mRNA cleavage. Importantly, we report that a pokeweed-specific miRNA targets the transcript of OPR3, novel evidence that a miRNA regulates a JA biosynthesis enzyme. This first large-scale small RNA study of a Phytolaccaceae family member shows that miRNA-mediated control is a significant component of the JA response, associated with widespread changes in expression of genes required for stress adaptation.

  7. Beyond the chromosome: the prevalence of unique extra-chromosomal bacteriophages with integrated virulence genes in pathogenic Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Bryan Utter

    Full Text Available In Staphylococcus aureus, the disease impact of chromosomally integrated prophages on virulence is well described. However, the existence of extra-chromosomal prophages, both plasmidial and episomal, remains obscure. Despite the recent explosion in bacterial and bacteriophage genomic sequencing, studies have failed to specifically focus on extra-chromosomal elements. We selectively enriched and sequenced extra-chromosomal DNA from S. aureus isolates using Roche-454 technology and uncovered evidence for the widespread distribution of multiple extra-chromosomal prophages (ExPΦs throughout both antibiotic-sensitive and -resistant strains. We completely sequenced one such element comprised of a 43.8 kbp, circular ExPΦ (designated ФBU01 from a vancomycin-intermediate S. aureus (VISA strain. Assembly and annotation of ФBU01 revealed a number of putative virulence determinants encoded within a bacteriophage immune evasion cluster (IEC. Our identification of several potential ExPΦs and mobile genetic elements (MGEs also revealed numerous putative virulence factors and antibiotic resistance genes. We describe here a previously unidentified level of genetic diversity of stealth extra-chromosomal elements in S. aureus, including phages with a larger presence outside the chromosome that likely play a prominent role in pathogenesis and strain diversity driven by horizontal gene transfer (HGT.

  8. Development of a chromosomally integrated metabolite-inducible Leu3p-alpha-IPM "off-on" gene switch.

    Directory of Open Access Journals (Sweden)

    Maria Poulou

    2010-08-01

    Full Text Available Present technology uses mostly chimeric proteins as regulators and hormones or antibiotics as signals to induce spatial and temporal gene expression.Here, we show that a chromosomally integrated yeast 'Leu3p-alpha-IotaRhoMu' system constitutes a ligand-inducible regulatory "off-on" genetic switch with an extensively dynamic action area. We find that Leu3p acts as an active transcriptional repressor in the absence and as an activator in the presence of alpha-isopropylmalate (alpha-IotaRhoMu in primary fibroblasts isolated from double transgenic mouse embryos bearing ubiquitously expressing Leu3p and a Leu3p regulated GFP reporter. In the absence of the branched amino acid biosynthetic pathway in animals, metabolically stable alpha-IPM presents an EC(50 equal to 0.8837 mM and fast "OFF-ON" kinetics (t(50ON = 43 min, t(50OFF = 2.18 h, it enters the cells via passive diffusion, while it is non-toxic to mammalian cells and to fertilized mouse eggs cultured ex vivo.Our results demonstrate that the 'Leu3p-alpha-IotaRhoMu' constitutes a simpler and safer system for inducible gene expression in biomedical applications.

  9. The Escherichia coli Cpx envelope stress response regulates genes of diverse function that impact antibiotic resistance and membrane integrity.

    Science.gov (United States)

    Raivio, Tracy L; Leblanc, Shannon K D; Price, Nancy L

    2013-06-01

    The Cpx envelope stress response mediates adaptation to stresses that cause envelope protein misfolding. Adaptation is partly conferred through increased expression of protein folding and degradation factors. The Cpx response also plays a conserved role in the regulation of virulence determinant expression and impacts antibiotic resistance. We sought to identify adaptive mechanisms that may be involved in these important functions by characterizing changes in the transcriptome of two different Escherichia coli strains when the Cpx response is induced. We show that, while there is considerable strain- and condition-specific variability in the Cpx response, the regulon is enriched for proteins and functions that are inner membrane associated under all conditions. Genes that were changed by Cpx pathway induction under all conditions were involved in a number of cellular functions and included several intergenic regions, suggesting that posttranscriptional regulation is important during Cpx-mediated adaptation. Some Cpx-regulated genes are centrally involved in energetics and play a role in antibiotic resistance. We show that a number of small, uncharacterized envelope proteins are Cpx regulated and at least two of these affect phenotypes associated with membrane integrity. Altogether, our work suggests new mechanisms of Cpx-mediated envelope stress adaptation and antibiotic resistance.

  10. Uncovering the molecular secrets of inflammatory breast cancer biology: an integrated analysis of three distinct affymetrix gene expression datasets.

    Science.gov (United States)

    Van Laere, Steven J; Ueno, Naoto T; Finetti, Pascal; Vermeulen, Peter; Lucci, Anthony; Robertson, Fredika M; Marsan, Melike; Iwamoto, Takayuki; Krishnamurthy, Savitri; Masuda, Hiroko; van Dam, Peter; Woodward, Wendy A; Viens, Patrice; Cristofanilli, Massimo; Birnbaum, Daniel; Dirix, Luc; Reuben, James M; Bertucci, François

    2013-09-01

    Inflammatory breast cancer (IBC) is a poorly characterized form of breast cancer. So far, the results of expression profiling in IBC are inconclusive due to various reasons including limited sample size. Here, we present the integration of three Affymetrix expression datasets collected through the World IBC Consortium allowing us to interrogate the molecular profile of IBC using the largest series of IBC samples ever reported. Affymetrix profiles (HGU133-series) from 137 patients with IBC and 252 patients with non-IBC (nIBC) were analyzed using unsupervised and supervised techniques. Samples were classified according to the molecular subtypes using the PAM50-algorithm. Regression models were used to delineate IBC-specific and molecular subtype-independent changes in gene expression, pathway, and transcription factor activation. Four robust IBC-sample clusters were identified, associated with the different molecular subtypes (Pmolecular subtype-independent 79-gene signature, which held independent prognostic value in a series of 871 nIBCs. Functional analysis revealed attenuated TGF-β signaling in IBC. We show that IBC is transcriptionally heterogeneous and that all molecular subtypes described in nIBC are detectable in IBC, albeit with a different frequency. The molecular profile of IBC, bearing molecular traits of aggressive breast tumor biology, shows attenuation of TGF-β signaling, potentially explaining the metastatic potential of IBC tumor cells in an unexpected manner. ©2013 AACR.

  11. Arabidopsis plastid AMOS1/EGY1 integrates abscisic acid signaling to regulate global gene expression response to ammonium stress

    KAUST Repository

    Li, Baohai

    2012-10-12

    Ammonium (NH4 +) is a ubiquitous intermediate of nitrogen metabolism but is notorious for its toxic effects on most organisms. Extensive studies of the underlying mechanisms of NH4 + toxicity have been reported in plants, but it is poorly understood how plants acclimate to high levels of NH4 +. Here, we identified an Arabidopsis (Arabidopsis thaliana) mutant, ammonium overly sensitive1 (amos1), that displays severe chlorosis under NH4 + stress. Map-based cloning shows amos1 to carry a mutation in EGY1 (for ethylene-dependent, gravitropism-deficient, and yellow-green-like protein1), which encodes a plastid metalloprotease. Transcriptomic analysis reveals that among the genes activated in response to NH4 +, 90% are regulated dependent on AMOS1/ EGY1. Furthermore, 63% of AMOS1/EGY1-dependent NH4 +-activated genes contain an ACGTG motif in their promoter region, a core motif of abscisic acid (ABA)-responsive elements. Consistent with this, our physiological, pharmacological, transcriptomic, and genetic data show that ABA signaling is a critical, but not the sole, downstream component of the AMOS1/EGY1-dependent pathway that regulates the expression of NH4 +-responsive genes and maintains chloroplast functionality under NH4 + stress. Importantly, abi4 mutants defective in ABA-dependent and retrograde signaling, but not ABA-deficient mutants, mimic leaf NH4 + hypersensitivity of amos1. In summary, our findings suggest that an NH4 +-responsive plastid retrograde pathway, which depends on AMOS1/EGY1 function and integrates with ABA signaling, is required for the regulation of expression of the presence of high NH4 + levels. © 2012 American Society of Plant Biologists. All Rights Reserved.

  12. Arabidopsis plastid AMOS1/EGY1 integrates abscisic acid signaling to regulate global gene expression response to ammonium stress

    KAUST Repository

    Li, Baohai; Li, Qing; Xiong, Liming; Kronzucker, Herbert J.; Krä mer, Ute; Shi, Weiming

    2012-01-01

    Ammonium (NH4 +) is a ubiquitous intermediate of nitrogen metabolism but is notorious for its toxic effects on most organisms. Extensive studies of the underlying mechanisms of NH4 + toxicity have been reported in plants, but it is poorly understood how plants acclimate to high levels of NH4 +. Here, we identified an Arabidopsis (Arabidopsis thaliana) mutant, ammonium overly sensitive1 (amos1), that displays severe chlorosis under NH4 + stress. Map-based cloning shows amos1 to carry a mutation in EGY1 (for ethylene-dependent, gravitropism-deficient, and yellow-green-like protein1), which encodes a plastid metalloprotease. Transcriptomic analysis reveals that among the genes activated in response to NH4 +, 90% are regulated dependent on AMOS1/ EGY1. Furthermore, 63% of AMOS1/EGY1-dependent NH4 +-activated genes contain an ACGTG motif in their promoter region, a core motif of abscisic acid (ABA)-responsive elements. Consistent with this, our physiological, pharmacological, transcriptomic, and genetic data show that ABA signaling is a critical, but not the sole, downstream component of the AMOS1/EGY1-dependent pathway that regulates the expression of NH4 +-responsive genes and maintains chloroplast functionality under NH4 + stress. Importantly, abi4 mutants defective in ABA-dependent and retrograde signaling, but not ABA-deficient mutants, mimic leaf NH4 + hypersensitivity of amos1. In summary, our findings suggest that an NH4 +-responsive plastid retrograde pathway, which depends on AMOS1/EGY1 function and integrates with ABA signaling, is required for the regulation of expression of the presence of high NH4 + levels. © 2012 American Society of Plant Biologists. All Rights Reserved.

  13. Gene expression patterns regulating embryogenesis based on the integrated de novo transcriptome assembly of the Japanese flounder.

    Science.gov (United States)

    Fu, Yuanshuai; Jia, Liang; Shi, Zhiyi; Zhang, Junling; Li, Wenjuan

    2017-06-01

    The Japanese flounder (Paralichthys olivaceus) is one of the most important commercial and biological marine fishes. However, the molecular biology involved during embryogenesis and early development of the Japanese flounder remains largely unknown due to a lack of genomic resources. A comprehensive and integrated transcriptome is necessary to study the molecular mechanisms of early development and to allow for the detailed characterization of gene expression patterns during embryogenesis; this approach is critical to understanding the processes that occur prior to mesectoderm formation during early embryonic development. In this study, more than 117.8 million 100bp PE reads were generated from pooled RNA extracted from unfertilized eggs to 41dph (days post-hatching) embryos and were sequenced using Illumina pair-end sequencing technology. In total, 121,513 transcripts (≥200bp) were obtained using de novo assembly. A sequence similarity search indicated that 52,338 transcripts show significant similarity to 22,462 known proteins from the NCBI non-redundant database and the Swiss-Prot protein database and were annotated using Blast2GO. GO terms were assigned to 44,627 transcripts with 12,006 functional terms, and 10,024 transcripts were assigned to 133 KEGG pathways. Furthermore, gene expression differences between the unfertilized egg and the gastrula embryo were analysed using Illumina RNA-Seq with single-read sequencing technology, and 24,837 differentially and specifically expressed transcripts were identified and included 5,286 annotated transcripts and 19,569 non-annotated transcripts. All of the expressed transcripts in the unfertilized egg and gastrula embryo were further classified as maternal, zygotic, or maternal-zygotic transcripts, which may help us to understand the roles of these transcripts during the embryonic development of the Japanese flounder. Thus, the results will contribute to an improved understanding of the gene expression patterns and

  14. Root Systems Biology: Integrative Modeling across Scales, from Gene Regulatory Networks to the Rhizosphere1

    Science.gov (United States)

    Hill, Kristine; Porco, Silvana; Lobet, Guillaume; Zappala, Susan; Mooney, Sacha; Draye, Xavier; Bennett, Malcolm J.

    2013-01-01

    Genetic and genomic approaches in model organisms have advanced our understanding of root biology over the last decade. Recently, however, systems biology and modeling have emerged as important approaches, as our understanding of root regulatory pathways has become more complex and interpreting pathway outputs has become less intuitive. To relate root genotype to phenotype, we must move beyond the examination of interactions at the genetic network scale and employ multiscale modeling approaches to predict emergent properties at the tissue, organ, organism, and rhizosphere scales. Understanding the underlying biological mechanisms and the complex interplay between systems at these different scales requires an integrative approach. Here, we describe examples of such approaches and discuss the merits of developing models to span multiple scales, from network to population levels, and to address dynamic interactions between plants and their environment. PMID:24143806

  15. Orígenes y desarrollo del constructivismo: Una mirada integral

    Directory of Open Access Journals (Sweden)

    Vicente Vargas Cera

    2017-02-01

    Full Text Available Este articulo tiene como propósito sistematizar las diferentes acepciones y enfoques teóricos que han tenido que ver con los orígenes y desarrollo del constructivismo; todo esto a partir de un recorri-do sobre el extenso campo conceptual del construc-tivismo. Se busca dar una mirada crítica sobre las principales vertientes y enfoques que han estudiado el Constructivismo. El término “constructivismo” ha adquirido una amplia variedad de significados en la educación y psicología contemporánea, e inclusive podría decirse que ha alcanzado por eso una vague-dad tan grande que resulta difícil hablar de ello. Por lo tanto, defino mi postura y enmarco al constructi-vismo en un sentido histórico amplio a partir de las principales variantes epistemológicas, educativas y psicológicas que lo han estudiado.

  16. Abelson Helper Integration Site-1 Gene Variants on Major Depressive Disorder and Bipolar Disorder

    Science.gov (United States)

    Porcelli, Stefano; Han, Changsu; Lee, Soo-Jung; Patkar, Ashwin A.; Masand, Prakash S.; Balzarro, Beatrice; Alberti, Siegfried; De Ronchi, Diana; Serretti, Alessandro

    2014-01-01

    Objective The present study aimed to explore whether 4 single nucleotide polymorphisms (SNPs) within the AHI1 gene could be associated with major depressive disorder (MD) and bipolar disorder (BD), and whether they could predict clinical outcomes in mood disorders. Methods One hundred and eighty-four (184) patients with MD, 170 patients with BD and 170 healthy controls were genotyped for 4 AHI1 SNPs (rs11154801, rs7750586, rs9647635 and rs9321501). Baseline and final clinical measures for MD patients were assessed through the Hamilton Rating Scale for Depression (HAM-D). Allelic and genotypic frequencies in MD and BD subjects were compared with those of each disorder and healthy group using the χ2 statistics. Repeated measures ANOVA was used to test possible influences of SNPs on treatment efficacy. Results The rs9647635 A/A was more represented in subjects with BD as compared with MD and healthy subjects together. The rs9647635 A/A was also more presented in patients with MD than in healthy subjects. With regard to the allelic analysis, rs9647635 A allele was more represented in subjects with BD compared with healthy subjects, while it was not observed between patients with MD and healthy subjects. Conclusion Our findings provide potential evidence of an association between some variants of AHI1 and mood disorders susceptibility but not with clinical outcomes. However, we will need to do more adequately-powered and advanced association studies to draw any conclusion due to clear limitations. PMID:25395981

  17. Integrating Horizontal Gene Transfer and Common Descent to Depict Evolution and Contrast It with “Common Design”1

    Science.gov (United States)

    GUILLERMO PAZ-Y-MIÑO-C; ESPINOSA, AVELINA

    2016-01-01

    Horizontal gene transfer (HGT) and common descent interact in space and time. Because events of HGT co-occur with phylogenetic evolution, it is difficult to depict evolutionary patterns graphically. Tree-like representations of life’s diversification are useful, but they ignore the significance of HGT in evolutionary history, particularly of unicellular organisms, ancestors of multicellular life. Here we integrate the reticulated-tree model, ring of life, symbiogenesis whole-organism model, and eliminative pattern pluralism to represent evolution. Using Entamoeba histolytica alcohol dehydrogenase 2 (EhADH2), a bifunctional enzyme in the glycolytic pathway of amoeba, we illustrate how EhADH2 could be the product of both horizontally acquired features from ancestral prokaryotes (i.e. aldehyde dehydrogenase [ALDH] and alcohol dehydrogenase [ADH]), and subsequent functional integration of these enzymes into EhADH2, which is now inherited by amoeba via common descent. Natural selection has driven the evolution of EhADH2 active sites, which require specific amino acids (cysteine 252 in the ALDH domain; histidine 754 in the ADH domain), iron- and NAD+ as cofactors, and the substrates acetyl-CoA for ALDH and acetaldehyde for ADH. Alternative views invoking “common design” (i.e. the non-naturalistic emergence of major taxa independent from ancestry) to explain the interaction between horizontal and vertical evolution are unfounded. PMID:20021546

  18. Integrated analysis of DNA methylation and gene expression reveals specific signaling pathways associated with platinum resistance in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Chung Jae

    2009-06-01

    Full Text Available Abstract Background Cisplatin and carboplatin are the primary first-line therapies for the treatment of ovarian cancer. However, resistance to these platinum-based drugs occurs in the large majority of initially responsive tumors, resulting in fully chemoresistant, fatal disease. Although the precise mechanism(s underlying the development of platinum resistance in late-stage ovarian cancer patients currently remains unknown, CpG-island (CGI methylation, a phenomenon strongly associated with aberrant gene silencing and ovarian tumorigenesis, may contribute to this devastating condition. Methods To model the onset of drug resistance, and investigate DNA methylation and gene expression alterations associated with platinum resistance, we treated clonally derived, drug-sensitive A2780 epithelial ovarian cancer cells with increasing concentrations of cisplatin. After several cycles of drug selection, the isogenic drug-sensitive and -resistant pairs were subjected to global CGI methylation and mRNA expression microarray analyses. To identify chemoresistance-associated, biological pathways likely impacted by DNA methylation, promoter CGI methylation and mRNA expression profiles were integrated and subjected to pathway enrichment analysis. Results Promoter CGI methylation revealed a positive association (Spearman correlation of 0.99 between the total number of hypermethylated CGIs and GI50 values (i.e., increased drug resistance following successive cisplatin treatment cycles. In accord with that result, chemoresistance was reversible by DNA methylation inhibitors. Pathway enrichment analysis revealed hypermethylation-mediated repression of cell adhesion and tight junction pathways and hypomethylation-mediated activation of the cell growth-promoting pathways PI3K/Akt, TGF-beta, and cell cycle progression, which may contribute to the onset of chemoresistance in ovarian cancer cells. Conclusion Selective epigenetic disruption of distinct biological

  19. Alzheimer's disease susceptibility genes APOE and TOMM40, and brain white matter integrity in the Lothian Birth Cohort 1936.

    Science.gov (United States)

    Lyall, Donald M; Harris, Sarah E; Bastin, Mark E; Muñoz Maniega, Susana; Murray, Catherine; Lutz, Michael W; Saunders, Ann M; Roses, Allen D; Valdés Hernández, Maria del C; Royle, Natalie A; Starr, John M; Porteous, David J; Wardlaw, Joanna M; Deary, Ian J

    2014-06-01

    Apolipoprotein E (APOE) ε genotype has previously been significantly associated with cognitive, brain imaging, and Alzheimer's disease-related phenotypes (e.g., age of onset). In the TOMM40 gene, the rs10524523 ("523") variable length poly-T repeat polymorphism has more recently been associated with similar ph/enotypes, although the allelic directions of these associations have varied between initial reports. Using diffusion magnetic resonance imaging tractography, the present study aimed to investigate whether there are independent effects of apolipoprotein E (APOE) and TOMM40 genotypes on human brain white matter integrity in a community-dwelling sample of older adults, the Lothian Birth Cohort 1936 (mean age = 72.70 years, standard deviation = 0.74, N approximately = 640-650; for most analyses). Some nominally significant effects were observed (i.e., covariate-adjusted differences between genotype groups at p vs. absence) were found in the right ventral cingulum and left inferior longitudinal fasciculus. To test for biologically independent effects of the TOMM40 523 repeat, participants were stratified into APOE genotype subgroups, so that any significant effects could not be attributed to APOE variation. In participants with the APOE ε3/ε4 genotype, effects of TOMM40 523 status were found in the left uncinate fasciculus, left rostral cingulum, left ventral cingulum, and a general factor of white matter integrity. In all 4 of these tractography measures, carriers of the TOMM40 523 "short" allele showed lower white matter integrity when compared with carriers of the "long" and "very-long" alleles. Most of these effects survived correction for childhood intelligence test scores and vascular disease history, though only the effect of TOMM40 523 on the left ventral cingulum integrity survived correction for false discovery rate. The effects of APOE in this older population are more specific and restricted compared with those reported in previous studies, and the

  20. 'Integration'

    DEFF Research Database (Denmark)

    Olwig, Karen Fog

    2011-01-01

    , while the countries have adopted disparate policies and ideologies, differences in the actual treatment and attitudes towards immigrants and refugees in everyday life are less clear, due to parallel integration programmes based on strong similarities in the welfare systems and in cultural notions...... of equality in the three societies. Finally, it shows that family relations play a central role in immigrants’ and refugees’ establishment of a new life in the receiving societies, even though the welfare society takes on many of the social and economic functions of the family....

  1. Network-Based Integration of GWAS and Gene Expression Identifies a HOX-Centric Network Associated with Serous Ovarian Cancer Risk.

    Science.gov (United States)

    Kar, Siddhartha P; Tyrer, Jonathan P; Li, Qiyuan; Lawrenson, Kate; Aben, Katja K H; Anton-Culver, Hoda; Antonenkova, Natalia; Chenevix-Trench, Georgia; Baker, Helen; Bandera, Elisa V; Bean, Yukie T; Beckmann, Matthias W; Berchuck, Andrew; Bisogna, Maria; Bjørge, Line; Bogdanova, Natalia; Brinton, Louise; Brooks-Wilson, Angela; Butzow, Ralf; Campbell, Ian; Carty, Karen; Chang-Claude, Jenny; Chen, Yian Ann; Chen, Zhihua; Cook, Linda S; Cramer, Daniel; Cunningham, Julie M; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; Dennis, Joe; Dicks, Ed; Doherty, Jennifer A; Dörk, Thilo; du Bois, Andreas; Dürst, Matthias; Eccles, Diana; Easton, Douglas F; Edwards, Robert P; Ekici, Arif B; Fasching, Peter A; Fridley, Brooke L; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G; Glasspool, Rosalind; Goode, Ellen L; Goodman, Marc T; Grownwald, Jacek; Harrington, Patricia; Harter, Philipp; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A T; Hillemanns, Peter; Hogdall, Estrid; Hogdall, Claus K; Hosono, Satoyo; Iversen, Edwin S; Jakubowska, Anna; Paul, James; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y; Kjaer, Susanne K; Kelemen, Linda E; Kellar, Melissa; Kelley, Joseph; Kiemeney, Lambertus A; Krakstad, Camilla; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D; Lee, Alice W; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A; Liang, Dong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R; McNeish, Iain A; Menon, Usha; Modugno, Francesmary; Moysich, Kirsten B; Narod, Steven A; Nedergaard, Lotte; Ness, Roberta B; Nevanlinna, Heli; Odunsi, Kunle; Olson, Sara H; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Pearce, Celeste Leigh; Pejovic, Tanja; Pelttari, Liisa M; Permuth-Wey, Jennifer; Phelan, Catherine M; Pike, Malcolm C; Poole, Elizabeth M; Ramus, Susan J; Risch, Harvey A; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H; Rudolph, Anja; Runnebaum, Ingo B; Rzepecka, Iwona K; Salvesen, Helga B; Schildkraut, Joellen M; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C; Sucheston-Campbell, Lara E; Tangen, Ingvild L; Teo, Soo-Hwang; Terry, Kathryn L; Thompson, Pamela J; Timorek, Agnieszka; Tsai, Ya-Yu; Tworoger, Shelley S; van Altena, Anne M; Van Nieuwenhuysen, Els; Vergote, Ignace; Vierkant, Robert A; Wang-Gohrke, Shan; Walsh, Christine; Wentzensen, Nicolas; Whittemore, Alice S; Wicklund, Kristine G; Wilkens, Lynne R; Woo, Yin-Ling; Wu, Xifeng; Wu, Anna; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Sellers, Thomas A; Monteiro, Alvaro N A; Freedman, Matthew L; Gayther, Simon A; Pharoah, Paul D P

    2015-10-01

    Genome-wide association studies (GWAS) have so far reported 12 loci associated with serous epithelial ovarian cancer (EOC) risk. We hypothesized that some of these loci function through nearby transcription factor (TF) genes and that putative target genes of these TFs as identified by coexpression may also be enriched for additional EOC risk associations. We selected TF genes within 1 Mb of the top signal at the 12 genome-wide significant risk loci. Mutual information, a form of correlation, was used to build networks of genes strongly coexpressed with each selected TF gene in the unified microarray dataset of 489 serous EOC tumors from The Cancer Genome Atlas. Genes represented in this dataset were subsequently ranked using a gene-level test based on results for germline SNPs from a serous EOC GWAS meta-analysis (2,196 cases/4,396 controls). Gene set enrichment analysis identified six networks centered on TF genes (HOXB2, HOXB5, HOXB6, HOXB7 at 17q21.32 and HOXD1, HOXD3 at 2q31) that were significantly enriched for genes from the risk-associated end of the ranked list (P < 0.05 and FDR < 0.05). These results were replicated (P < 0.05) using an independent association study (7,035 cases/21,693 controls). Genes underlying enrichment in the six networks were pooled into a combined network. We identified a HOX-centric network associated with serous EOC risk containing several genes with known or emerging roles in serous EOC development. Network analysis integrating large, context-specific datasets has the potential to offer mechanistic insights into cancer susceptibility and prioritize genes for experimental characterization. ©2015 American Association for Cancer Research.

  2. Common variation in the autism risk gene CNTNAP2, brain structural connectivity and multisensory speech integration.

    Science.gov (United States)

    Ross, Lars A; Del Bene, Victor A; Molholm, Sophie; Jae Woo, Young; Andrade, Gizely N; Abrahams, Brett S; Foxe, John J

    2017-11-01

    Three lines of evidence motivated this study. 1) CNTNAP2 variation is associated with autism risk and speech-language development. 2) CNTNAP2 variations are associated with differences in white matter (WM) tracts comprising the speech-language circuitry. 3) Children with autism show impairment in multisensory speech perception. Here, we asked whether an autism risk-associated CNTNAP2 single nucleotide polymorphism in neurotypical adults was associated with multisensory speech perception performance, and whether such a genotype-phenotype association was mediated through white matter tract integrity in speech-language circuitry. Risk genotype at rs7794745 was associated with decreased benefit from visual speech and lower fractional anisotropy (FA) in several WM tracts (right precentral gyrus, left anterior corona radiata, right retrolenticular internal capsule). These structural connectivity differences were found to mediate the effect of genotype on audiovisual speech perception, shedding light on possible pathogenic pathways in autism and biological sources of inter-individual variation in audiovisual speech processing in neurotypicals. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. The RCSB protein data bank: integrative view of protein, gene and 3D structural information.

    Science.gov (United States)

    Rose, Peter W; Prlić, Andreas; Altunkaya, Ali; Bi, Chunxiao; Bradley, Anthony R; Christie, Cole H; Costanzo, Luigi Di; Duarte, Jose M; Dutta, Shuchismita; Feng, Zukang; Green, Rachel Kramer; Goodsell, David S; Hudson, Brian; Kalro, Tara; Lowe, Robert; Peisach, Ezra; Randle, Christopher; Rose, Alexander S; Shao, Chenghua; Tao, Yi-Ping; Valasatava, Yana; Voigt, Maria; Westbrook, John D; Woo, Jesse; Yang, Huangwang; Young, Jasmine Y; Zardecki, Christine; Berman, Helen M; Burley, Stephen K

    2017-01-04

    The Research Collaboratory for Structural Bioinformatics Protein Data Bank (RCSB PDB, http://rcsb.org), the US data center for the global PDB archive, makes PDB data freely available to all users, from structural biologists to computational biologists and beyond. New tools and resources have been added to the RCSB PDB web portal in support of a 'Structural View of Biology.' Recent developments have improved the User experience, including the high-speed NGL Viewer that provides 3D molecular visualization in any web browser, improved support for data file download and enhanced organization of website pages for query, reporting and individual structure exploration. Structure validation information is now visible for all archival entries. PDB data have been integrated with external biological resources, including chromosomal position within the human genome; protein modifications; and metabolic pathways. PDB-101 educational materials have been reorganized into a searchable website and expanded to include new features such as the Geis Digital Archive. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Integrated gene mapping and synteny studies give insights into the evolution of a sex proto-chromosome in Solea senegalensis.

    Science.gov (United States)

    Portela-Bens, Silvia; Merlo, Manuel Alejandro; Rodríguez, María Esther; Cross, Ismael; Manchado, Manuel; Kosyakova, Nadezda; Liehr, Thomas; Rebordinos, Laureana

    2017-03-01

    The evolution of genes related to sex and reproduction in fish shows high plasticity and, to date, the sex determination system has only been identified in a few species. Solea senegalensis has 42 chromosomes and an XX/XY chromosome system for sex determination, while related species show the ZZ/ZW system. Next-generation sequencing (NGS), multi-color fluorescence in situ hybridization (mFISH) techniques, and bioinformatics analysis have been carried out, with the objective of revealing new information about sex determination and reproduction in S. senegalensis. To that end, several bacterial artificial chromosome (BAC) clones that contain candidate genes involved in such processes (dmrt1, dmrt2, dmrt3, dmrt4, sox3, sox6, sox8, sox9, lh, cyp19a1a, amh, vasa, aqp3, and nanos3) were analyzed and compared with the same region in other related species. Synteny studies showed that the co-localization of dmrt1-dmrt2-drmt3 in the largest metacentric chromosome of S. senegalensis is coincident with that found in the Z chromosome of Cynoglossus semilaevis, which would potentially make this a sex proto-chromosome. Phylogenetic studies show the close proximity of S. senegalensis to Oryzias latipes, a species with an XX/XY system and a sex master gene. Comparative mapping provides evidence of the preferential association of these candidate genes in particular chromosome pairs. By using the NGS and mFISH techniques, it has been possible to obtain an integrated genetic map, which shows that 15 out of 21 chromosome pairs of S. senegalensis have at least one BAC clone. This result is important for distinguishing those chromosome pairs of S. senegalensis that are similar in shape and size. The mFISH analysis shows the following co-localizations in the same chromosomes: dmrt1-dmrt2-dmrt3, dmrt4-sox9-thrb, aqp3-sox8, cyp19a1a-fshb, igsf9b-sox3, and lysg-sox6.

  5. Integration of ATAC-seq and RNA-seq identifies human alpha cell and beta cell signature genes.

    Science.gov (United States)

    Ackermann, Amanda M; Wang, Zhiping; Schug, Jonathan; Naji, Ali; Kaestner, Klaus H

    2016-03-01

    Although glucagon-secreting α-cells and insulin-secreting β-cells have opposing functions in regulating plasma glucose levels, the two cell types share a common developmental origin and exhibit overlapping transcriptomes and epigenomes. Notably, destruction of β-cells can stimulate repopulation via transdifferentiation of α-cells, at least in mice, suggesting plasticity between these cell fates. Furthermore, dysfunction of both α- and β-cells contributes to the pathophysiology of type 1 and type 2 diabetes, and β-cell de-differentiation has been proposed to contribute to type 2 diabetes. Our objective was to delineate the molecular properties that maintain islet cell type specification yet allow for cellular plasticity. We hypothesized that correlating cell type-specific transcriptomes with an atlas of open chromatin will identify novel genes and transcriptional regulatory elements such as enhancers involved in α- and β-cell specification and plasticity. We sorted human α- and β-cells and performed the "Assay for Transposase-Accessible Chromatin with high throughput sequencing" (ATAC-seq) and mRNA-seq, followed by integrative analysis to identify cell type-selective gene regulatory regions. We identified numerous transcripts with either α-cell- or β-cell-selective expression and discovered the cell type-selective open chromatin regions that correlate with these gene activation patterns. We confirmed cell type-selective expression on the protein level for two of the top hits from our screen. The "group specific protein" (GC; or vitamin D binding protein) was restricted to α-cells, while CHODL (chondrolectin) immunoreactivity was only present in β-cells. Furthermore, α-cell- and β-cell-selective ATAC-seq peaks were identified to overlap with known binding sites for islet transcription factors, as well as with single nucleotide polymorphisms (SNPs) previously identified as risk loci for type 2 diabetes. We have determined the genetic landscape of

  6. Integration of light and temperature in the regulation of circadian gene expression in Drosophila.

    Directory of Open Access Journals (Sweden)

    Catharine E Boothroyd

    2007-04-01

    together, these findings suggest that information from both light and temperature is integrated by the transcriptional clock mechanism in the adult fly head.

  7. The CanOE strategy: integrating genomic and metabolic contexts across multiple prokaryote genomes to find candidate genes for orphan enzymes.

    Directory of Open Access Journals (Sweden)

    Adam Alexander Thil Smith

    2012-05-01

    Full Text Available Of all biochemically characterized metabolic reactions formalized by the IUBMB, over one out of four have yet to be associated with a nucleic or protein sequence, i.e. are sequence-orphan enzymatic activities. Few bioinformatics annotation tools are able to propose candidate genes for such activities by exploiting context-dependent rather than sequence-dependent data, and none are readily accessible and propose result integration across multiple genomes. Here, we present CanOE (Candidate genes for Orphan Enzymes, a four-step bioinformatics strategy that proposes ranked candidate genes for sequence-orphan enzymatic activities (or orphan enzymes for short. The first step locates "genomic metabolons", i.e. groups of co-localized genes coding proteins catalyzing reactions linked by shared metabolites, in one genome at a time. These metabolons can be particularly helpful for aiding bioanalysts to visualize relevant metabolic data. In the second step, they are used to generate candidate associations between un-annotated genes and gene-less reactions. The third step integrates these gene-reaction associations over several genomes using gene families, and summarizes the strength of family-reaction associations by several scores. In the final step, these scores are used to rank members of gene families which are proposed for metabolic reactions. These associations are of particular interest when the metabolic reaction is a sequence-orphan enzymatic activity. Our strategy found over 60,000 genomic metabolons in more than 1,000 prokaryote organisms from the MicroScope platform, generating candidate genes for many metabolic reactions, of which more than 70 distinct orphan reactions. A computational validation of the approach is discussed. Finally, we present a case study on the anaerobic allantoin degradation pathway in Escherichia coli K-12.

  8. Algal Functional Annotation Tool: a web-based analysis suite to functionally interpret large gene lists using integrated annotation and expression data

    Directory of Open Access Journals (Sweden)

    Merchant Sabeeha S

    2011-07-01

    Full Text Available Abstract Background Progress in genome sequencing is proceeding at an exponential pace, and several new algal genomes are becoming available every year. One of the challenges facing the community is the association of protein sequences encoded in the genomes with biological function. While most genome assembly projects generate annotations for predicted protein sequences, they are usually limited and integrate functional terms from a limited number of databases. Another challenge is the use of annotations to interpret large lists of 'interesting' genes generated by genome-scale datasets. Previously, these gene lists had to be analyzed across several independent biological databases, often on a gene-by-gene basis. In contrast, several annotation databases, such as DAVID, integrate data from multiple functional databases and reveal underlying biological themes of large gene lists. While several such databases have been constructed for animals, none is currently available for the study of algae. Due to renewed interest in algae as potential sources of biofuels and the emergence of multiple algal genome sequences, a significant need has arisen for such a database to process the growing compendiums of algal genomic data. Description The Algal Functional Annotation Tool is a web-based comprehensive analysis suite integrating annotation data from several pathway, ontology, and protein family databases. The current version provides annotation for the model alga Chlamydomonas reinhardtii, and in the future will include additional genomes. The site allows users to interpret large gene lists by identifying associated functional terms, and their enrichment. Additionally, expression data for several experimental conditions were compiled and analyzed to provide an expression-based enrichment search. A tool to search for functionally-related genes based on gene expression across these conditions is also provided. Other features include dynamic visualization of

  9. The Integration of Epistasis Network and Functional Interactions in a GWAS Implicates RXR Pathway Genes in the Immune Response to Smallpox Vaccine.

    Directory of Open Access Journals (Sweden)

    Brett A McKinney

    Full Text Available Although many diseases and traits show large heritability, few genetic variants have been found to strongly separate phenotype groups by genotype. Complex regulatory networks of variants and expression of multiple genes lead to small individual-variant effects and difficulty replicating the effect of any single variant in an affected pathway. Interaction network modeling of GWAS identifies effects ignored by univariate models, but population differences may still cause specific genes to not replicate. Integrative network models may help detect indirect effects of variants in the underlying biological pathway. In this study, we used gene-level functional interaction information from the Integrative Multi-species Prediction (IMP tool to reveal important genes associated with a complex phenotype through evidence from epistasis networks and pathway enrichment. We test this method for augmenting variant-based network analyses with functional interactions by applying it to a smallpox vaccine immune response GWAS. The integrative analysis spotlights the role of genes related to retinoid X receptor alpha (RXRA, which has been implicated in a previous epistasis network analysis of smallpox vaccine.

  10. A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

    Science.gov (United States)

    Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

    2014-01-01

    Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

  11. A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

    Directory of Open Access Journals (Sweden)

    Teruhiko Suzuki

    Full Text Available Human artificial chromosomes (HACs are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

  12. Integration of TP53, DREAM, MMB-FOXM1 and RB-E2F target gene analyses identifies cell cycle gene regulatory networks.

    Science.gov (United States)

    Fischer, Martin; Grossmann, Patrick; Padi, Megha; DeCaprio, James A

    2016-07-27

    Cell cycle (CC) and TP53 regulatory networks are frequently deregulated in cancer. While numerous genome-wide studies of TP53 and CC-regulated genes have been performed, significant variation between studies has made it difficult to assess regulation of any given gene of interest. To overcome the limitation of individual studies, we developed a meta-analysis approach to identify high confidence target genes that reflect their frequency of identification in independent datasets. Gene regulatory networks were generated by comparing differential expression of TP53 and CC-regulated genes with chromatin immunoprecipitation studies for TP53, RB1, E2F, DREAM, B-MYB, FOXM1 and MuvB. RNA-seq data from p21-null cells revealed that gene downregulation by TP53 generally requires p21 (CDKN1A). Genes downregulated by TP53 were also identified as CC genes bound by the DREAM complex. The transcription factors RB, E2F1 and E2F7 bind to a subset of DREAM target genes that function in G1/S of the CC while B-MYB, FOXM1 and MuvB control G2/M gene expression. Our approach yields high confidence ranked target gene maps for TP53, DREAM, MMB-FOXM1 and RB-E2F and enables prediction and distinction of CC regulation. A web-based atlas at www.targetgenereg.org enables assessing the regulation of any human gene of interest. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Integrated network analysis identifies fight-club nodes as a class of hubs encompassing key putative switch genes that induce major transcriptome reprogramming during grapevine development.

    Science.gov (United States)

    Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

    2014-12-01

    We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.

  14. Integrative Analysis of DCE-MRI and Gene Expression Profiles in Construction of a Gene Classifier for Assessment of Hypoxia-Related Risk of Chemoradiotherapy Failure in Cervical Cancer

    DEFF Research Database (Denmark)

    Fjeldbo, Christina S; Julin, Cathinka H; Lando, Malin

    2016-01-01

    platforms. The prognostic value was independent of existing clinical markers, regardless of clinical endpoints. CONCLUSIONS: A robust DCE-MRI-associated gene classifier has been constructed that may be used to achieve an early indication of patients' risk of hypoxia-related chemoradiotherapy failure.......PURPOSE: A 31-gene expression signature reflected in dynamic contrast enhanced (DCE)-MR images and correlated with hypoxia-related aggressiveness in cervical cancer was identified in previous work. We here aimed to construct a dichotomous classifier with key signature genes and a predefined...... as an indicator of hypoxia. RESULTS: Classifier candidates were constructed by integrative analysis of ABrix and gene expression profiles in the training cohort and evaluated by a leave-one-out cross-validation approach. On the basis of their ability to separate patients correctly according to hypoxia status, a 6...

  15. Nanobody-based chimeric receptor gene integration in Jurkat cells mediated by PhiC31 integrase

    International Nuclear Information System (INIS)

    Iri-Sofla, Farnoush Jafari; Rahbarizadeh, Fatemeh; Ahmadvand, Davoud; Rasaee, Mohammad J.

    2011-01-01

    The crucial role of T lymphocytes in anti-tumor immunity has led to the development of novel strategies that can target and activate T cells against tumor cells. Recombinant DNA technology has been used to generate non-MHC-restricted chimeric antigen receptors (CARs). Here, we constructed a panel of recombinant CAR that harbors the anti-MUC1 nanobody and the signaling and co-signaling moieties (CD3ζ/CD28) with different spacer regions derived from human IgG3 with one or two repeats of the hinge sequence or the hinge region of FcγRII. The PhiC31 integrase system was employed to investigate if the recombination efficiency could be recruited for high and stable expression of T cell chimeric receptor genes. The effect of nuclear localization signal (NLS) and two different promoters (CMV and CAG) on efficacy of PhiC31 integrase in human T cell lines was evaluated. The presence of integrase in combination with NLS, mediated up to 7.6 and 8.5 fold increases in CAR expression in ZCHN-attB and ZCHHN-attB cassette integrated T cells, respectively. Our results showed that highly efficient and stable transduction of the Jurkat cell line by PhiC31 integrase is a feasible modality for generating anti-cancer chimeric T cells for use in cancer immunotherapy.

  16. Nanobody-based chimeric receptor gene integration in Jurkat cells mediated by PhiC31 integrase

    Energy Technology Data Exchange (ETDEWEB)

    Iri-Sofla, Farnoush Jafari [Department of Medical Biotechnology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Rahbarizadeh, Fatemeh, E-mail: rahbarif@modares.ac.ir [Department of Medical Biotechnology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Ahmadvand, Davoud [Center of Pharmaceutical Nanotechnology and Nanotoxicology, Department of Pharmaceutics and Analytical Chemistry, University of Copenhagen, Universitetsparken 2, DK-2100 Copenhagen O (Denmark); Rasaee, Mohammad J. [Department of Medical Biotechnology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran (Iran, Islamic Republic of)

    2011-11-01

    The crucial role of T lymphocytes in anti-tumor immunity has led to the development of novel strategies that can target and activate T cells against tumor cells. Recombinant DNA technology has been used to generate non-MHC-restricted chimeric antigen receptors (CARs). Here, we constructed a panel of recombinant CAR that harbors the anti-MUC1 nanobody and the signaling and co-signaling moieties (CD3{zeta}/CD28) with different spacer regions derived from human IgG3 with one or two repeats of the hinge sequence or the hinge region of Fc{gamma}RII. The PhiC31 integrase system was employed to investigate if the recombination efficiency could be recruited for high and stable expression of T cell chimeric receptor genes. The effect of nuclear localization signal (NLS) and two different promoters (CMV and CAG) on efficacy of PhiC31 integrase in human T cell lines was evaluated. The presence of integrase in combination with NLS, mediated up to 7.6 and 8.5 fold increases in CAR expression in ZCHN-attB and ZCHHN-attB cassette integrated T cells, respectively. Our results showed that highly efficient and stable transduction of the Jurkat cell line by PhiC31 integrase is a feasible modality for generating anti-cancer chimeric T cells for use in cancer immunotherapy.

  17. Self-excising Cre/mutant lox marker recycling system for multiple gene integrations and consecutive gene deletions in Aspergillus oryzae.

    Science.gov (United States)

    Zhang, Silai; Ban, Akihiko; Ebara, Naoki; Mizutani, Osamu; Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya

    2017-04-01

    In this study, we developed a self-excising Cre/loxP-mediated marker recycling system with mutated lox sequences to introduce a number of biosynthetic genes into Aspergillus oryzae. To construct the self-excising marker cassette, both the selectable marker, the Aspergillus nidulans adeA gene, and the Cre recombinase gene (cre), conditionally expressed by the xylanase-encoding gene promoter, were designed to be located between the mutant lox sequences, lox66 and lox71. However, construction of the plasmid failed, possibly owing to a slight expression of cre downstream of the fungal gene promoter in Escherichia coli. Hence, to avoid the excision of the cassette in E. coli, a 71-bp intron of the A. oryzae xynG2 gene was inserted into the cre gene. The A. oryzae adeA deletion mutant was transformed with the resulting plasmid in the presence of glucose, and the transformants were cultured in medium containing xylose as the sole carbon source. PCR analysis of genomic DNA from resultant colonies revealed the excision of both the marker and Cre expression construct, indicating that the self-excising marker cassette was efficient at removing the selectable marker. Using the marker recycling system, hyperproduction of kojic acid could be achieved in A. oryzae by the introduction of two genes that encode oxidoreductase and transporter. Furthermore, we also constructed an alternative marker recycling cassette bearing the A. nidulans pyrithiamine resistant gene (ptrA) as a dominant selectable marker. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  18. IIS--Integrated Interactome System: a web-based platform for the annotation, analysis and visualization of protein-metabolite-gene-drug interactions by integrating a variety of data sources and tools.

    Science.gov (United States)

    Carazzolle, Marcelo Falsarella; de Carvalho, Lucas Miguel; Slepicka, Hugo Henrique; Vidal, Ramon Oliveira; Pereira, Gonçalo Amarante Guimarães; Kobarg, Jörg; Meirelles, Gabriela Vaz

    2014-01-01

    High-throughput screening of physical, genetic and chemical-genetic interactions brings important perspectives in the Systems Biology field, as the analysis of these interactions provides new insights into protein/gene function, cellular metabolic variations and the validation of therapeutic targets and drug design. However, such analysis depends on a pipeline connecting different tools that can automatically integrate data from diverse sources and result in a more comprehensive dataset that can be properly interpreted. We describe here the Integrated Interactome System (IIS), an integrative platform with a web-based interface for the annotation, analysis and visualization of the interaction profiles of proteins/genes, metabolites and drugs of interest. IIS works in four connected modules: (i) Submission module, which receives raw data derived from Sanger sequencing (e.g. two-hybrid system); (ii) Search module, which enables the user to search for the processed reads to be assembled into contigs/singlets, or for lists of proteins/genes, metabolites and drugs of interest, and add them to the project; (iii) Annotation module, which assigns annotations from several databases for the contigs/singlets or lists of proteins/genes, generating tables with automatic annotation that can be manually curated; and (iv) Interactome module, which maps the contigs/singlets or the uploaded lists to entries in our integrated database, building networks that gather novel identified interactions, protein and metabolite expression/concentration levels, subcellular localization and computed topological metrics, GO biological processes and KEGG pathways enrichment. This module generates a XGMML file that can be imported into Cytoscape or be visualized directly on the web. We have developed IIS by the integration of diverse databases following the need of appropriate tools for a systematic analysis of physical, genetic and chemical-genetic interactions. IIS was validated with yeast two

  19. Multiple-integrations of HPV16 genome and altered transcription of viral oncogenes and cellular genes are associated with the development of cervical cancer.

    Directory of Open Access Journals (Sweden)

    Xulian Lu

    Full Text Available The constitutive expression of the high-risk HPV E6 and E7 viral oncogenes is the major cause of cervical cancer. To comprehensively explore the composition of HPV16 early transcripts and their genomic annotation, cervical squamous epithelial tissues from 40 HPV16-infected patients were collected for analysis of papillomavirus oncogene transcripts (APOT. We observed different transcription patterns of HPV16 oncogenes in progression of cervical lesions to cervical cancer and identified one novel transcript. Multiple-integration events in the tissues of cervical carcinoma (CxCa are significantly more often than those of low-grade squamous intraepithelial lesions (LSIL and high-grade squamous intraepithelial lesions (HSIL. Moreover, most cellular genes within or near these integration sites are cancer-associated genes. Taken together, this study suggests that the multiple-integrations of HPV genome during persistent viral infection, which thereby alters the expression patterns of viral oncogenes and integration-related cellular genes, play a crucial role in progression of cervical lesions to cervix cancer.

  20. Enterobacter cloacae Complex Isolates Harboring blaNMC-A or blaIMI-Type Class A Carbapenemase Genes on Novel Chromosomal Integrative Elements and Plasmids.

    Science.gov (United States)

    Boyd, David A; Mataseje, Laura F; Davidson, Ross; Delport, Johannes A; Fuller, Jeff; Hoang, Linda; Lefebvre, Brigitte; Levett, Paul N; Roscoe, Diane L; Willey, Barbara M; Mulvey, Michael R

    2017-05-01

    Carbapenem-resistant Enterobacter cloacae complex isolates submitted to a reference laboratory from 2010 to 2015 were screened by PCR for seven common carbapenemase gene groups, namely, KPC, NDM, OXA-48, VIM, IMP, GES, and NMC-A/IMI. Nineteen of the submitted isolates (1.7%) were found to harbor Ambler class A bla NMC-A or bla IMI -type carbapenemases. All 19 isolates were resistant to at least one carbapenem but susceptible to aminoglycosides, trimethoprim-sulfamethoxazole, tigecycline, and ciprofloxacin. Most isolates (17/19) gave positive results with the Carba-NP test for phenotypic carbapenemase detection. Isolates were genetically diverse by pulsed-field gel electrophoresis macrorestriction analysis, multilocus sequence typing, and hsp60 gene analysis. The genes were found in various Enterobacter cloacae complex species; however, bla NMC-A was highly associated with Enterobacter ludwigii Whole-genome sequencing and bioinformatics analysis revealed that all NMC-A ( n = 10), IMI-1 ( n = 5), and IMI-9 ( n = 2) producers harbored the carbapenemase gene on EludIMEX-1-like integrative mobile elements (EcloIMEXs) located in the identical chromosomal locus. Two novel genes, bla IMI-5 and bla IMI-6 , were harbored on different IncFII-type plasmids. Enterobacter cloacae complex isolates harboring bla NMC-A/IMI -type carbapenemases are relatively rare in Canada. Though mostly found integrated into the chromosome, some variants are located on plasmids that may enhance their mobility potential. © Crown copyright 2017.

  1. Integrating toxin gene expression, growth and fumonisin B1 and B2 production by a strain of Fusarium verticillioides under different environmental factors

    Science.gov (United States)

    Medina, Angel; Schmidt-Heydt, Markus; Cárdenas-Chávez, Diana L.; Parra, Roberto; Geisen, Rolf; Magan, Naresh

    2013-01-01

    The objective of this study was to integrate data on the effect of water activity (aw; 0.995–0.93) and temperature (20–35°C) on activation of the biosynthetic FUM genes, growth and the mycotoxins fumonisin (FB1, FB2) by Fusarium verticillioides in vitro. The relative expression of nine biosynthetic cluster genes (FUM1, FUM7, FUM10, FUM11, FUM12, FUM13, FUM14, FUM16 and FUM19) in relation to the environmental factors was determined using a microarray analysis. The expression was related to growth and phenotypic FB1 and FB2 production. These data were used to develop a mixed-growth-associated product formation model and link this to a linear combination of the expression data for the nine genes. The model was then validated by examining datasets outside the model fitting conditions used (35°C). The relationship between the key gene (FUM1) and other genes in the cluster (FUM11, FUM13, FUM9, FUM14) were examined in relation to aw, temperature, FB1 and FB2 production by developing ternary diagrams of relative expression. This model is important in developing an integrated systems approach to develop prevention strategies to control fumonisin biosynthesis in staple food commodities and could also be used to predict the potential impact that climate change factors may have on toxin production. PMID:23697716

  2. Identification of auxotrophic mutants of the yeast Kluyveromyces marxianus by non-homologous end joining-mediated integrative transformation with genes from Saccharomyces cerevisiae.

    Science.gov (United States)

    Yarimizu, Tohru; Nonklang, Sanom; Nakamura, Junpei; Tokuda, Shuya; Nakagawa, Takaaki; Lorreungsil, Sasithorn; Sutthikhumpha, Surasit; Pukahuta, Charida; Kitagawa, Takao; Nakamura, Mikiko; Cha-Aim, Kamonchai; Limtong, Savitree; Hoshida, Hisashi; Akada, Rinji

    2013-12-01

    The isolation and application of auxotrophic mutants for gene manipulations, such as genetic transformation, mating selection and tetrad analysis, form the basis of yeast genetics. For the development of these genetic methods in the thermotolerant fermentative yeast Kluyveromyces marxianus, we isolated a series of auxotrophic mutants with defects in amino acid or nucleic acid metabolism. To identify the mutated genes, linear DNA fragments of nutrient biosynthetic pathway genes were amplified from Saccharomyces cerevisiae chromosomal DNA and used to directly transform the K. marxianus auxotrophic mutants by random integration into chromosomes through non-homologous end joining (NHEJ). The appearance of transformant colonies indicated that the specific S. cerevisiae gene complemented the K. marxianus mutant. Using this interspecific complementation approach with linear PCR-amplified DNA, we identified auxotrophic mutations of ADE2, ADE5,7, ADE6, HIS2, HIS3, HIS4, HIS5, HIS6, HIS7, LYS1, LYS2, LYS4, LYS9, LEU1, LEU2, MET2, MET6, MET17, TRP3, TRP4 and TRP5 without the labour-intensive requirement of plasmid construction. Mating, sporulation and tetrad analysis techniques for K. marxianus were also established. With the identified auxotrophic mutant strains and S. cerevisiae genes as selective markers, NHEJ-mediated integrative transformation with PCR-amplified DNA is an attractive system for facilitating genetic analyses in the yeast K. marxianus. Copyright © 2013 John Wiley & Sons, Ltd.

  3. Integration of gene-based markers in a pearl millet genetic map for identification of candidate genes underlying drought tolerance quantitative trait loci

    Directory of Open Access Journals (Sweden)

    Sehgal Deepmala

    2012-01-01

    Full Text Available Abstract Background Identification of genes underlying drought tolerance (DT quantitative trait loci (QTLs will facilitate understanding of molecular mechanisms of drought tolerance, and also will accelerate genetic improvement of pearl millet through marker-assisted selection. We report a map based on genes with assigned functional roles in plant adaptation to drought and other abiotic stresses and demonstrate its use in identifying candidate genes underlying a major DT-QTL. Results Seventy five single nucleotide polymorphism (SNP and conserved intron spanning primer (CISP markers were developed from available expressed sequence tags (ESTs using four genotypes, H 77/833-2, PRLT 2/89-33, ICMR 01029 and ICMR 01004, representing parents of two mapping populations. A total of 228 SNPs were obtained from 30.5 kb sequenced region resulting in a SNP frequency of 1/134 bp. The positions of major pearl millet linkage group (LG 2 DT-QTLs (reported from crosses H 77/833-2 × PRLT 2/89-33 and 841B × 863B were added to the present consensus function map which identified 18 genes, coding for PSI reaction center subunit III, PHYC, actin, alanine glyoxylate aminotransferase, uridylate kinase, acyl-CoA oxidase, dipeptidyl peptidase IV, MADS-box, serine/threonine protein kinase, ubiquitin conjugating enzyme, zinc finger C- × 8-C × 5-C × 3-H type, Hd3, acetyl CoA carboxylase, chlorophyll a/b binding protein, photolyase, protein phosphatase1 regulatory subunit SDS22 and two hypothetical proteins, co-mapping in this DT-QTL interval. Many of these candidate genes were found to have significant association with QTLs of grain yield, flowering time and leaf rolling under drought stress conditions. Conclusions We have exploited available pearl millet EST sequences to generate a mapped resource of seventy five new gene-based markers for pearl millet and demonstrated its use in identifying candidate genes underlying a major DT-QTL in this species. The reported gene

  4. Site-specific integration of CAR gene into Jurkat T cells with a linear close-ended AAV-based DNA vector for CAR-T engineering.

    Science.gov (United States)

    Zhang, Yun; Liu, Xiaomei; Zhang, Jinju; Zhang, Chun

    2016-09-01

    To develop a site-specific integration strategy for CAR-T engineering by using a non-viral vector dependent on adeno-associated viral (AAV) genome, which tends to be integrated into AAVS1 site with the help of its Rep proteins. AAV-dependent vectors were produced in Sf9 cells. Structural analyses revealed the vector as covalently close-ended, linear duplex molecules, which was termed "CELiD" DNA. A plasmid CMV-Rep was constructed to express the integrases Rep78 and Rep68. Jurkat cells were co-electroporated with "CELiD" DNA and plasmid CMV-Rep in order to specifically integrate CAR gene into AAVS1 site. We examined 71 stably transfected Jurkat clones by nested PCR, sequencing and southern blotting, of which 30 clones bore CAR gene within AAVS1 site. The site-specific integration efficiency was nearly 42.2 %. The AAV-dependent vector preferentially integrated CAR into AAVS1 site, which could be further used in human T cell modification and enhance the security of CAR-T therapy.

  5. The tetracycline resistance determinant Tet 39 and the sulphonamide resistance gene sulII are common among resistant Acinetobacter spp. isolated from integrated fish farms in Thailand

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Petersen, Andreas

    2007-01-01

    Objectives: To determine the genetic basis for tetracycline and sulphonamide resistance and the prevalence of class I and II integrons in oxytetracycline-resistant Acinetobacter spp. from integrated fish farms in Thailand. Methods: A total of 222 isolates were screened for tetracycline resistance...... and Southern blots with sulII and tet(39) probes were performed on selected isolates. Results: The recently identified tetracycline resistance gene tet(39) was demonstrated in 75% (166/222) of oxytetracycline-resistant Acinetobacter spp. from integrated fish farms in Thailand. Isolates that were also...

  6. Identification of a gene module associated with BMD through the integration of network analysis and genome-wide association data.

    Science.gov (United States)

    Farber, Charles R

    2010-11-01

    Bone mineral density (BMD) is influenced by a complex network of gene interactions; therefore, elucidating the relationships between genes and how those genes, in turn, influence BMD is critical for developing a comprehensive understanding of osteoporosis. To investigate the role of transcriptional networks in the regulation of BMD, we performed a weighted gene coexpression network analysis (WGCNA) using microarray expression data on monocytes from young individuals with low or high BMD. WGCNA groups genes into modules based on patterns of gene coexpression. and our analysis identified 11 gene modules. We observed that the overall expression of one module (referred to as module 9) was significantly higher in the low-BMD group (p = .03). Module 9 was highly enriched for genes belonging to the immune system-related gene ontology (GO) category "response to virus" (p = 7.6 × 10(-11)). Using publically available genome-wide association study data, we independently validated the importance of module 9 by demonstrating that highly connected module 9 hubs were more likely, relative to less highly connected genes, to be genetically associated with BMD. This study highlights the advantages of systems-level analyses to uncover coexpression modules associated with bone mass and suggests that particular monocyte expression patterns may mediate differences in BMD. © 2010 American Society for Bone and Mineral Research.

  7. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    Directory of Open Access Journals (Sweden)

    Tung Shu-Yun

    2011-04-01

    Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.

  8. Integrating Gene Correction in the Reprogramming and Transdifferentiation Processes: A One-Step Strategy to Overcome Stem Cell-Based Gene Therapy Limitations

    Directory of Open Access Journals (Sweden)

    Seo-Young Lee

    2016-01-01

    Full Text Available The recent advent of induced pluripotent stem cells (iPSCs and gene therapy tools has raised the possibility of autologous cell therapy for rare genetic diseases. However, cellular reprogramming is inefficient in certain diseases such as ataxia telangiectasia, Fanconi anemia, LIG4 syndrome, and fibrodysplasia ossificans progressiva syndrome, owing to interference of the disease-related genes. To overcome these therapeutic limitations, it is necessary to fundamentally correct the abnormal gene during or prior to the reprogramming process. In addition, as genetic etiology of Parkinson’s disease, it has been well known that induced neural stem cells (iNSCs were progressively depleted by LRRK2 gene mutation, LRRK2 (G2019S. Thus, to maintain the induced NSCs directly derived from PD patient cells harboring LRRK2 (G2019S, it would be ideal to simultaneously treat the LRRK2 (G2019S fibroblast during the process of TD. Therefore, simultaneous reprogramming (or TD and gene therapy would provide the solution for therapeutic limitation caused by vulnerability of reprogramming or TD, in addition to being suitable for general application to the generation of autologous cell-therapy products for patients with genetic defects, thereby obviating the need for the arduous processes currently required.

  9. The genetic interaction network of CCW12, a Saccharomyces cerevisiae gene required for cell wall integrity during budding and formation of mating projections

    Science.gov (United States)

    2011-01-01

    Background Mannoproteins construct the outer cover of the fungal cell wall. The covalently linked cell wall protein Ccw12p is an abundant mannoprotein. It is considered as crucial structural cell wall component since in baker's yeast the lack of CCW12 results in severe cell wall damage and reduced mating efficiency. Results In order to explore the function of CCW12, we performed a Synthetic Genetic Analysis (SGA) and identified genes that are essential in the absence of CCW12. The resulting interaction network identified 21 genes involved in cell wall integrity, chitin synthesis, cell polarity, vesicular transport and endocytosis. Among those are PFD1, WHI3, SRN2, PAC10, FEN1 and YDR417C, which have not been related to cell wall integrity before. We correlated our results with genetic interaction networks of genes involved in glucan and chitin synthesis. A core of genes essential to maintain cell integrity in response to cell wall stress was identified. In addition, we performed a large-scale transcriptional analysis and compared the transcriptional changes observed in mutant ccw12Δ with transcriptomes from studies investigating responses to constitutive or acute cell wall damage. We identified a set of genes that are highly induced in the majority of the mutants/conditions and are directly related to the cell wall integrity pathway and cell wall compensatory responses. Among those are BCK1, CHS3, EDE1, PFD1, SLT2 and SLA1 that were also identified in the SGA. In contrast, a specific feature of mutant ccw12Δ is the transcriptional repression of genes involved in mating. Physiological experiments substantiate this finding. Further, we demonstrate that Ccw12p is present at the cell periphery and highly concentrated at the presumptive budding site, around the bud, at the septum and at the tip of the mating projection. Conclusions The combination of high throughput screenings, phenotypic analyses and localization studies provides new insight into the function of Ccw

  10. A dominant control region from the human β-globin locus conferring integration site-independent gene expression.

    OpenAIRE

    Talbot, D.; Collis, P.; Antoniou, Michael; Vidal, M.; Grosveld, Frank; Greaves, David

    1989-01-01

    textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell lines and transgenic animals has turned out to be at a low level relative to that of endogenous genes, and influenced by the chromosomal site of insertion of the exogenous construct. We have previo...

  11. An integrated and comparative approach towards identification, characterization and functional annotation of candidate genes for drought tolerance in sorghum (Sorghum bicolor (L.) Moench).

    Science.gov (United States)

    Woldesemayat, Adugna Abdi; Van Heusden, Peter; Ndimba, Bongani K; Christoffels, Alan

    2017-12-22

    Drought is the most disastrous abiotic stress that severely affects agricultural productivity worldwide. Understanding the biological basis of drought-regulated traits, requires identification and an in-depth characterization of genetic determinants using model organisms and high-throughput technologies. However, studies on drought tolerance have generally been limited to traditional candidate gene approach that targets only a single gene in a pathway that is related to a trait. In this study, we used sorghum, one of the model crops that is well adapted to arid regions, to mine genes and define determinants for drought tolerance using drought expression libraries and RNA-seq data. We provide an integrated and comparative in silico candidate gene identification, characterization and annotation approach, with an emphasis on genes playing a prominent role in conferring drought tolerance in sorghum. A total of 470 non-redundant functionally annotated drought responsive genes (DRGs) were identified using experimental data from drought responses by employing pairwise sequence similarity searches, pathway and interpro-domain analysis, expression profiling and orthology relation. Comparison of the genomic locations between these genes and sorghum quantitative trait loci (QTLs) showed that 40% of these genes were co-localized with QTLs known for drought tolerance. The genome reannotation conducted using the Program to Assemble Spliced Alignment (PASA), resulted in 9.6% of existing single gene models being updated. In addition, 210 putative novel genes were identified using AUGUSTUS and PASA based analysis on expression dataset. Among these, 50% were single exonic, 69.5% represented drought responsive and 5.7% were complete gene structure models. Analysis of biochemical metabolism revealed 14 metabolic pathways that are related to drought tolerance and also had a strong biological network, among categories of genes involved. Identification of these pathways, signifies the

  12. Role for the Wilms tumor gene in genital development?

    International Nuclear Information System (INIS)

    van Heyningen, V.; Bickmore, W.A.; Seawright, A.; Fletcher, J.M.; Maule, J.; Hastie, N.D.; Fekete, G.; Gessler, M.; Bruns, G.A.P.; Huerre-Jeanpierre, C.; Junien, C.; Williams, B.R.G.

    1990-01-01

    Detailed molecular definition of the WAGR region at chromosome 11p13 has been achieved by chromosome breakpoint analysis and long-range restriction mapping. Here the authors describe the molecular detection of a cytogenetically invisible 1-megabase deletion in an individual with aniridia, cryptorchidism, and hypospadias but no Wilms tumor (WT). The region of overlap between this deletion and one associated with WT and similar genital anomalies but no aniridia covers a region of 350-400 kilobases, which is coincident with the extent of homozygous deletion detected in tumor tissue from a sporadic WT. A candidate WT gene located within this region has recently been isolated, suggesting nonpenetrance for tumor expression in the first individual. The inclusion within the overlap region of a gene for WT predisposition and a gene for the best-documented WT-associated genitourinary malformations leads to suggest that both of these anomalies result from a loss-of-function mutation at the same locus. This in turn implies that the WT gene exerts pleiotropic effect on both kidney and genitourinary development, a possibility supported by the observed expression pattern of the WT candidate gene in developing kidney and gonads

  13. Analysis of gene expression profiles of soft tissue sarcoma using a combination of knowledge-based filtering with integration of multiple statistics.

    Directory of Open Access Journals (Sweden)

    Anna Takahashi

    Full Text Available The diagnosis and treatment of soft tissue sarcomas (STS have been difficult. Of the diverse histological subtypes, undifferentiated pleomorphic sarcoma (UPS is particularly difficult to diagnose accurately, and its classification per se is still controversial. Recent advances in genomic technologies provide an excellent way to address such problems. However, it is often difficult, if not impossible, to identify definitive disease-associated genes using genome-wide analysis alone, primarily because of multiple testing problems. In the present study, we analyzed microarray data from 88 STS patients using a combination method that used knowledge-based filtering and a simulation based on the integration of multiple statistics to reduce multiple testing problems. We identified 25 genes, including hypoxia-related genes (e.g., MIF, SCD1, P4HA1, ENO1, and STAT1 and cell cycle- and DNA repair-related genes (e.g., TACC3, PRDX1, PRKDC, and H2AFY. These genes showed significant differential expression among histological subtypes, including UPS, and showed associations with overall survival. STAT1 showed a strong association with overall survival in UPS patients (logrank p = 1.84 × 10(-6 and adjusted p value 2.99 × 10(-3 after the permutation test. According to the literature, the 25 genes selected are useful not only as markers of differential diagnosis but also as prognostic/predictive markers and/or therapeutic targets for STS. Our combination method can identify genes that are potential prognostic/predictive factors and/or therapeutic targets in STS and possibly in other cancers. These disease-associated genes deserve further preclinical and clinical validation.

  14. Recombinant adeno-associated virus mediates a high level of gene transfer but less efficient integration in the K562 human hematopoietic cell line.

    Science.gov (United States)

    Malik, P; McQuiston, S A; Yu, X J; Pepper, K A; Krall, W J; Podsakoff, G M; Kurtzman, G J; Kohn, D B

    1997-03-01

    We tested the ability of a recombinant adeno-associated virus (rAAV) vector to express and integrate exogenous DNA into human hematopoietic cells in the absence of selection. We developed an rAAV vector, AAV-tNGFR, carrying a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under the control of the Moloney murine leukemia virus (MoMuLV) long terminal repeat. An analogous MoMuLV-based retroviral vector (L-tNGFR) was used in parallel, and gene transfer and expression in human hematopoietic cells were assessed by flow cytometry and DNA analyses. Following gene transfer into K562 cells with AAV-tNGFR at a multiplicity of infection (MOI) of 13 infectious units (IU), 26 to 38% of cells expressed tNGFR on the surface early after transduction, but the proportion of tNGFR expressing cells steadily declined to 3.0 to 3.5% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately posttransduction, but the proportion of cells expressing tNGFR declined to 62% over 2 months of culture. The decline in the proportion of AAV-tNGFR-expressing cells was associated with ongoing losses of vector genomes. In contrast, K562 cells transduced with the retroviral vector L-tNGFR expressed tNGFR in a constant fraction. Integration analyses on clones showed that integration occurred at different sites. Integration frequencies were estimated at about 49% at an MOI of 130 and 2% at an MOI of 1.3. Transduction of primary human CD34+ progenitor cells by AAV-tNGFR was less efficient than with K562 cells and showed a declining percentage of cells expressing tNGFR over 2 weeks of culture. Thus, purified rAAV caused very high gene transfer and expression in human hematopoietic cells early after transduction, which steadily declined during cell passage in the absence of selection. Although the efficiency of integration was low, overall integration was markedly improved at a high MOI. While prolonged episomal persistence may be adequate

  15. Integrative miRNA-Gene Expression Analysis Enables Refinement of Associated Biology and Prediction of Response to Cetuximab in Head and Neck Squamous Cell Cancer

    Directory of Open Access Journals (Sweden)

    Loris De Cecco

    2017-01-01

    Full Text Available This paper documents the process by which we, through gene and miRNA expression profiling of the same samples of head and neck squamous cell carcinomas (HNSCC and an integrative miRNA-mRNA expression analysis, were able to identify candidate biomarkers of progression-free survival (PFS in patients treated with cetuximab-based approaches. Through sparse partial least square–discriminant analysis (sPLS-DA and supervised analysis, 36 miRNAs were identified in two components that clearly separated long- and short-PFS patients. Gene set enrichment analysis identified a significant correlation between the miRNA first-component and EGFR signaling, keratinocyte differentiation, and p53. Another significant correlation was identified between the second component and RAS, NOTCH, immune/inflammatory response, epithelial–mesenchymal transition (EMT, and angiogenesis pathways. Regularized canonical correlation analysis of sPLS-DA miRNA and gene data combined with the MAGIA2 web-tool highlighted 16 miRNAs and 84 genes that were interconnected in a total of 245 interactions. After feature selection by a smoothed t-statistic support vector machine, we identified three miRNAs and five genes in the miRNA-gene network whose expression result was the most relevant in predicting PFS (Area Under the Curve, AUC = 0.992. Overall, using a well-defined clinical setting and up-to-date bioinformatics tools, we are able to give the proof of principle that an integrative miRNA-mRNA expression could greatly contribute to the refinement of the biology behind a predictive model.

  16. Roles of horizontal gene transfer and gene integration in evolution of 1,3-dichloropropene- and 1,2-dibromoethane-degradative pathways

    NARCIS (Netherlands)

    Poelarends, GJ; Kulakov, LA; Larkin, MJ; van Hylckama Vlieg, Johan E.T.; Janssen, DB

    The haloalkane-degrading bacteria Rhodococcus rhodochrous NCIMB13064, Pseudomonas pavonaceae 170, and Mycobacterium sp. strain GP1 share a highly conserved haloalkane dehalogenase gene (dhaA). Here, we describe the extent of the conserved dhaA segments in these three phylogenetically distinct

  17. Expansion of the known Klebsiella pneumoniae species gene pool by characterization of novel alien DNA islands integrated into tmRNA gene sites.

    Science.gov (United States)

    Zhang, Jie; van Aartsen, Jon Jurriaan; Jiang, Xiaofei; Shao, Yucheng; Tai, Cui; He, Xinyi; Tan, Zhilei; Deng, Zixin; Jia, Shiru; Rajakumar, Kumar; Ou, Hong-Yu

    2011-02-01

    Klebsiella pneumoniae is an important bacterial pathogen of man that is commonly associated with opportunistic and hospital-associated infections. Increasing levels of multiple-antibiotic resistance associated with this species pose a major emerging clinical problem. This organism also occurs naturally in other diverse environments, including the soil. Consistent with its varied lifestyle and membership of the Enterobacteriaceae family, K. pneumoniae genomes exhibit highly plastic architecture comprising a core genome backbone interspersed with numerous and varied alien genomic islands. In this study the size of the presently known K. pneumoniae pan-genome gene pool was estimated through analysis of complete sequences of three chromosomes and 31 plasmids belonging to K. pneumoniae strains. In addition, using a PCR-based strategy the genomic content of eight tRNA/tmRNA gene sites that serve as DNA insertion hotspots were investigated in 28 diverse environmental and clinical strains of K. pneumoniae. Sequencing and characterization of five newly identified horizontally-acquired tmRNA-associated islands further expanded the archived K. pneumoniae gene pool to a total of 7648 unique gene members. Large-scale investigation of the content of tRNA/tmRNA hotspots will be useful to identify and/or survey accessory sequences dispersed amongst hundreds to thousands of members of many key bacterial species. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. A dominant control region from the human β-globin locus conferring integration site-independent gene expression.

    NARCIS (Netherlands)

    D. Talbot; P. Collis; M. Antoniou (Michael); M. Vidal; F.G. Grosveld (Frank); D.R. Greaves (David)

    1989-01-01

    textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell

  19. AP2/EREBP transcription factors are part of gene regulatory networks and integrate metabolic, hormonal and environmental signals in stress acclimation and retrograde signalling.

    Science.gov (United States)

    Dietz, Karl-Josef; Vogel, Marc Oliver; Viehhauser, Andrea

    2010-09-01

    To optimize acclimation responses to environmental growth conditions, plants integrate and weigh a diversity of input signals. Signal integration within the signalling networks occurs at different sites including the level of transcription factor activation. Accumulating evidence assigns a major and diversified role in environmental signal integration to the family of APETALA 2/ethylene response element binding protein (AP2/EREBP) transcription factors. Presently, the Plant Transcription Factor Database 3.0 assigns 147 gene loci to this family in Arabidopsis thaliana, 200 in Populus trichocarpa and 163 in Oryza sativa subsp. japonica as compared to 13 to 14 in unicellular algae ( http://plntfdb.bio.uni-potsdam.de/v3.0/ ). AP2/EREBP transcription factors have been implicated in hormone, sugar and redox signalling in context of abiotic stresses such as cold and drought. This review exemplarily addresses present-day knowledge of selected AP2/EREBP with focus on a function in stress signal integration and retrograde signalling and defines AP2/EREBP-linked gene networks from transcriptional profiling-based graphical Gaussian models. The latter approach suggests highly interlinked functions of AP2/EREBPs in retrograde and stress signalling.

  20. MicroScope-an integrated resource for community expertise of gene functions and comparative analysis of microbial genomic and metabolic data.

    Science.gov (United States)

    Médigue, Claudine; Calteau, Alexandra; Cruveiller, Stéphane; Gachet, Mathieu; Gautreau, Guillaume; Josso, Adrien; Lajus, Aurélie; Langlois, Jordan; Pereira, Hugo; Planel, Rémi; Roche, David; Rollin, Johan; Rouy, Zoe; Vallenet, David

    2017-09-12

    The overwhelming list of new bacterial genomes becoming available on a daily basis makes accurate genome annotation an essential step that ultimately determines the relevance of thousands of genomes stored in public databanks. The MicroScope platform (http://www.genoscope.cns.fr/agc/microscope) is an integrative resource that supports systematic and efficient revision of microbial genome annotation, data management and comparative analysis. Starting from the results of our syntactic, functional and relational annotation pipelines, MicroScope provides an integrated environment for the expert annotation and comparative analysis of prokaryotic genomes. It combines tools and graphical interfaces to analyze genomes and to perform the manual curation of gene function in a comparative genomics and metabolic context. In this article, we describe the free-of-charge MicroScope services for the annotation and analysis of microbial (meta)genomes, transcriptomic and re-sequencing data. Then, the functionalities of the platform are presented in a way providing practical guidance and help to the nonspecialists in bioinformatics. Newly integrated analysis tools (i.e. prediction of virulence and resistance genes in bacterial genomes) and original method recently developed (the pan-genome graph representation) are also described. Integrated environments such as MicroScope clearly contribute, through the user community, to help maintaining accurate resources. © The Author 2017. Published by Oxford University Press.

  1. Prevalence of anal infection due to high-risk human papillomavirus and analysis of E2 gene integrity among women with cervical abnormalities.

    Science.gov (United States)

    Gonzalez-Losa, María Del Refugio; Puerto-Solís, Marylin; Ayora-Talavera, Guadalupe; Gómez-Carvallo, Jesús; Euán-López, Alejandra; Cisneros-Cutz, José I; Rosado-López, Ariel; Echeverría Salazar, Jesúa; Conde-Ferráez, Laura

    2018-04-01

    High-risk human papillomaviruses (HR-HPV) infection has been associated with 90% of anal cancer cases. Women with abnormal cytology are a high-risk group to develop anal neoplasia. The aim of this study is to describe the prevalence and epidemiology of HR-HPV 16, 18, 45, and 58 anal infections in women with cervical abnormalities, as well as to assess E2 gene integrity. A cross-sectional study was performed on 311 cervical and 311 anal samples from patients with abnormal cytology in two colposcopy clinics in Yucatan, Mexico. A specific PCR for oncogenes was performed in order to identify HVP 16, 18, 45 and 58. Real time PCR was used to amplify the whole HPV 16, 18, and 58 E2 gene to verify its integrity in anal samples. High risk HPV 16, 18, 58, and/or 45 were found in 41.47% (129/311) of cervical samples, and in 30.8% (96/331) of anal samples, with 18% (57/311) of the patients being positive in both samples. The same genotypes in both anatomical sites were observed in 11.25% (35/311). The E2 gene was disrupted in 82% of all tested samples. The frequency of genome disruption viral integration in anal samples by genotype was: HPV 58 (97.2%); HPV 16 (72.4%), and HPV 18 (0%). Women with cervical disease have HR-HPV anal infections, and most of them have the E2 gene disrupted, which represents a risk to develop anal cancer. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  2. Identification of Transcriptional Modules and Key Genes in Chickens Infected with Salmonella enterica Serovar Pullorum Using Integrated Coexpression Analyses

    Directory of Open Access Journals (Sweden)

    Bao-Hong Liu

    2017-01-01

    Full Text Available Salmonella enterica Pullorum is one of the leading causes of mortality in poultry. Understanding the molecular response in chickens in response to the infection by S. enterica is important in revealing the mechanisms of pathogenesis and disease progress. There have been studies on identifying genes associated with Salmonella infection by differential expression analysis, but the relationships among regulated genes have not been investigated. In this study, we employed weighted gene coexpression network analysis (WGCNA and differential coexpression analysis (DCEA to identify coexpression modules by exploring microarray data derived from chicken splenic tissues in response to the S. enterica infection. A total of 19 modules from 13,538 genes were associated with the Jak-STAT signaling pathway, the extracellular matrix, cytoskeleton organization, the regulation of the actin cytoskeleton, G-protein coupled receptor activity, Toll-like receptor signaling pathways, and immune system processes; among them, 14 differentially coexpressed modules (DCMs and 2,856 differentially coexpressed genes (DCGs were identified. The global expression of module genes between infected and uninfected chickens showed slight differences but considerable changes for global coexpression. Furthermore, DCGs were consistently linked to the hubs of the modules. These results will help prioritize candidate genes for future studies of Salmonella infection.

  3. Reduction in the copy number and expression level of the recurrent human papillomavirus integration gene fragile histidine triad (FHIT predicts the transition of cervical lesions.

    Directory of Open Access Journals (Sweden)

    Liming Wang

    Full Text Available Cervical cancer is the second most common cancer and the third leading cause of cancer death in females worldwide, especially in developing countries. High risk human papillomavirus (HR-HPV infection causes cervical cancer and precancerous cervical intraepithelial neoplasia (CIN. Integration of the HR-HPV genome into the host chromatin is an important step in cervical carcinogenesis. The detection of integrated papillomavirus sequences-PCR (DIPS-PCR allowed us to explore HPV integration in the human genome and to determine the pattern of this integration. We performed DIPS-PCR for 4 cell lines including 3 cervical cancer cell lines and 40 tissue samples. Overall, 32 HR-HPV integration loci were detected in the clinical samples and the HeLa and SiHa cell lines. Among all the integration loci, we identified three recurrent integration loci: 3p14.2 (3 samples, 13q22.1 (2 samples and a SiHa cell line and 8q24 (1 sample and a HeLa cell line. To further explore the effect of HR-HPV integration in the 3p14.2 locus, we used fluorescence in situ hybridization (FISH to determine the copy number of the 3p14.2 locus and immunohistochemistry (IHC to determine the protein expression levels of the related FHIT gene in the clinical samples. Both the 3p14.2 locus copy number and FHIT protein expression levels showed significant decreases when CIN transitioned to cervical cancer. HPV copy number was also evaluated in these clinical samples, and the copy number of HPV increased significantly between CIN and cervical cancer samples. Finally, we employed receiver operating characteristic curve (ROC curve analysis to evaluate the potential of all these indexes in distinguishing CIN and cervical cancer, and the HPV copy number, FHIT copy number and FHIT protein expression levels have good diagnostic efficiencies.

  4. Integrated analysis of genetic variation and gene expression reveals novel variant for increased warfarin dose requirement in African Americans

    NARCIS (Netherlands)

    Hernandez, W.; Gamazon, E. R.; Aquino-Michaels, K.; Smithberger, E.; O'Brien, T. J.; Harralson, A. F.; Tuck, M.; Barbour, A.; Cavallari, L. H.; Perera, M. A.

    2017-01-01

    Essentials Genetic variants controlling gene regulation have not been explored in pharmacogenomics. We tested liver expression quantitative trait loci for association with warfarin dose response. A novel predictor for increased warfarin dose response in African Americans was identified. Precision

  5. bHLH106 Integrates Functions of Multiple Genes through Their G-Box to Confer Salt Tolerance on Arabidopsis.

    Science.gov (United States)

    Ahmad, Aftab; Niwa, Yasuo; Goto, Shingo; Ogawa, Takeshi; Shimizu, Masanori; Suzuki, Akane; Kobayashi, Kyoko; Kobayashi, Hirokazu

    2015-01-01

    An activation-tagging methodology was applied to dedifferentiated calli of Arabidopsis to identify new genes involved in salt tolerance. This identified salt tolerant callus 8 (stc8) as a gene encoding the basic helix-loop-helix transcription factor bHLH106. bHLH106-knockout (KO) lines were more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. Back-transformation of the KO line rescued its phenotype, and over-expression (OX) of bHLH106 in differentiated plants exhibited tolerance to NaCl. Green fluorescent protein (GFP) fused with bHLH106 revealed that it was localized to the nucleus. Prepared bHLH106 protein was subjected to electrophoresis mobility shift assays against E-box sequences (5'-CANNTG-3'). The G-box sequence 5'-CACGTG-3' had the strongest interaction with bHLH106. bHLH106-OX lines were transcriptomically analyzed, and resultant up- and down-regulated genes selected on the criterion of presence of a G-box sequence. There were 198 genes positively regulated by bHLH106 and 36 genes negatively regulated; these genes possessed one or more G-box sequences in their promoter regions. Many of these genes are known to be involved in abiotic stress response. It is concluded that bHLH106 locates at a branching point in the abiotic stress response network by interacting directly to the G-box in genes conferring salt tolerance on plants.

  6. Distinct high resolution genome profiles of early onset and late onset colorectal cancer integrated with gene expression data identify candidate susceptibility loci

    Directory of Open Access Journals (Sweden)

    Merok Marianne A

    2010-05-01

    Full Text Available Abstract Background Estimates suggest that up to 30% of colorectal cancers (CRC may develop due to an increased genetic risk. The mean age at diagnosis for CRC is about 70 years. Time of disease onset 20 years younger than the mean age is assumed to be indicative of genetic susceptibility. We have compared high resolution tumor genome copy number variation (CNV (Roche NimbleGen, 385 000 oligo CGH array in microsatellite stable (MSS tumors from two age groups, including 23 young at onset patients without known hereditary syndromes and with a median age of 44 years (range: 28-53 and 17 elderly patients with median age 79 years (range: 69-87. Our aim was to identify differences in the tumor genomes between these groups and pinpoint potential susceptibility loci. Integration analysis of CNV and genome wide mRNA expression data, available for the same tumors, was performed to identify a restricted candidate gene list. Results The total fraction of the genome with aberrant copy number, the overall genomic profile and the TP53 mutation spectrum were similar between the two age groups. However, both the number of chromosomal aberrations and the number of breakpoints differed significantly between the groups. Gains of 2q35, 10q21.3-22.1, 10q22.3 and 19q13.2-13.31 and losses from 1p31.3, 1q21.1, 2q21.2, 4p16.1-q28.3, 10p11.1 and 19p12, positions that in total contain more than 500 genes, were found significantly more often in the early onset group as compared to the late onset group. Integration analysis revealed a covariation of DNA copy number at these sites and mRNA expression for 107 of the genes. Seven of these genes, CLC, EIF4E, LTBP4, PLA2G12A, PPAT, RG9MTD2, and ZNF574, had significantly different mRNA expression comparing median expression levels across the transcriptome between the two groups. Conclusions Ten genomic loci, containing more than 500 protein coding genes, are identified as more often altered in tumors from early onset versus late

  7. Association of Apolipoprotein B and Adiponectin Receptor 1 Genes with Carcass, Bone Integrity and Performance Traits in a Paternal Broiler Line.

    Directory of Open Access Journals (Sweden)

    Valdecy Aparecida Rocha da Cruz

    Full Text Available Apolipoprotein B (APOB and Adiponectin Receptor 1 (ADIPOR1 are related to the regulation of feed intake, fat metabolism and protein deposition and are candidate genes for genomic studies in birds. In this study, associations of two single nucleotide polymorphisms (SNPs g.102A>T (APOB and g.729C>T (ADIPOR1 with carcass, bone integrity and performance traits in broilers were investigated. Genotyping was performed on a paternal line of 1,454 broilers. The SNP detection was carried out by PCR-RFLP technique using the restriction enzymes HhaI for the SNP g.729C>T and MslI for the SNP g.102A>T. The association analyses of the two SNPs with 85 traits were performed using the restricted maximum likelihood (REML and Generalized Quasi-Likelihood Score (GQLS methods. For REML the model included the random additive genetic effect of animal and fixed effects of sex, hatch and SNP genotypes. In the GQLS method, a logistic regression was used to associate the genotypes with phenotypes adjusted for fixed effects of sex and hatch. The SNP g.729C>T in the ADIPOR1 gene was associated with thickness of the femur and breast skin yield. Thus, the ADIPOR1 gene seems implicated in the metabolism and/or fat deposition and bone integrity in broilers.

  8. geneCBR: a translational tool for multiple-microarray analysis and integrative information retrieval for aiding diagnosis in cancer research

    Directory of Open Access Journals (Sweden)

    Fdez-Riverola Florentino

    2009-06-01

    Full Text Available Abstract Background Bioinformatics and medical informatics are two research fields that serve the needs of different but related communities. Both domains share the common goal of providing new algorithms, methods and technological solutions to biomedical research, and contributing to the treatment and cure of diseases. Although different microarray techniques have been successfully used to investigate useful information for cancer diagnosis at the gene expression level, the true integration of existing methods into day-to-day clinical practice is still a long way off. Within this context, case-based reasoning emerges as a suitable paradigm specially intended for the development of biomedical informatics applications and decision support systems, given the support and collaboration involved in such a translational development. With the goals of removing barriers against multi-disciplinary collaboration and facilitating the dissemination and transfer of knowledge to real practice, case-based reasoning systems have the potential to be applied to translational research mainly because their computational reasoning paradigm is similar to the way clinicians gather, analyze and process information in their own practice of clinical medicine. Results In addressing the issue of bridging the existing gap between biomedical researchers and clinicians who work in the domain of cancer diagnosis, prognosis and treatment, we have developed and made accessible a common interactive framework. Our geneCBR system implements a freely available software tool that allows the use of combined techniques that can be applied to gene selection, clustering, knowledge extraction and prediction for aiding diagnosis in cancer research. For biomedical researches, geneCBR expert mode offers a core workbench for designing and testing new techniques and experiments. For pathologists or oncologists, geneCBR diagnostic mode implements an effective and reliable system that can

  9. Integrated microarray and ChIP analysis identifies multiple Foxa2 dependent target genes in the notochord.

    Science.gov (United States)

    Tamplin, Owen J; Cox, Brian J; Rossant, Janet

    2011-12-15

    The node and notochord are key tissues required for patterning of the vertebrate body plan. Understanding the gene regulatory network that drives their formation and function is therefore important. Foxa2 is a key transcription factor at the top of this genetic hierarchy and finding its targets will help us to better understand node and notochord development. We performed an extensive microarray-based gene expression screen using sorted embryonic notochord cells to identify early notochord-enriched genes. We validated their specificity to the node and notochord by whole mount in situ hybridization. This provides the largest available resource of notochord-expressed genes, and therefore candidate Foxa2 target genes in the notochord. Using existing Foxa2 ChIP-seq data from adult liver, we were able to identify a set of genes expressed in the notochord that had associated regions of Foxa2-bound chromatin. Given that Foxa2 is a pioneer transcription factor, we reasoned that these sites might represent notochord-specific enhancers. Candidate Foxa2-bound regions were tested for notochord specific enhancer function in a zebrafish reporter assay and 7 novel notochord enhancers were identified. Importantly, sequence conservation or predictive models could not have readily identified these regions. Mutation of putative Foxa2 binding elements in two of these novel enhancers abrogated reporter expression and confirmed their Foxa2 dependence. The combination of highly specific gene expression profiling and genome-wide ChIP analysis is a powerful means of understanding developmental pathways, even for small cell populations such as the notochord. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. A Population of Deletion Mutants and an Integrated Mapping and Exome-seq Pipeline for Gene Discovery in Maize

    Science.gov (United States)

    Jia, Shangang; Li, Aixia; Morton, Kyla; Avoles-Kianian, Penny; Kianian, Shahryar F.; Zhang, Chi; Holding, David

    2016-01-01

    To better understand maize endosperm filling and maturation, we used γ-irradiation of the B73 maize reference line to generate mutants with opaque endosperm and reduced kernel fill phenotypes, and created a population of 1788 lines including 39 Mo17 × F2s showing stable, segregating, and viable kernel phenotypes. For molecular characterization of the mutants, we developed a novel functional genomics platform that combined bulked segregant RNA and exome sequencing (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. To exemplify the utility of the mutants and provide proof-of-concept for the bioinformatics platform, we present detailed characterization of line 937, an opaque mutant harboring a 6203 bp in-frame deletion covering six exons within the Opaque-1 gene. In addition, we describe mutant line 146 which contains a 4.8 kb intragene deletion within the Sugary-1 gene and line 916 in which an 8.6 kb deletion knocks out a Cyclin A2 gene. The publically available algorithm developed in this work improves the identification of causative deletions and its corresponding gaps within mapping peaks. This study demonstrates the utility of γ-irradiation for forward genetics in large nondense genomes such as maize since deletions often affect single genes. Furthermore, we show how this classical mutagenesis method becomes applicable for functional genomics when combined with state-of-the-art genomics tools. PMID:27261000

  11. Gene-Environment Interplay in Common Complex Diseases: Forging an Integrative Model—Recommendations From an NIH Workshop

    Science.gov (United States)

    Bookman, Ebony B.; McAllister, Kimberly; Gillanders, Elizabeth; Wanke, Kay; Balshaw, David; Rutter, Joni; Reedy, Jill; Shaughnessy, Daniel; Agurs-Collins, Tanya; Paltoo, Dina; Atienza, Audie; Bierut, Laura; Kraft, Peter; Fallin, M. Daniele; Perera, Frederica; Turkheimer, Eric; Boardman, Jason; Marazita, Mary L.; Rappaport, Stephen M.; Boerwinkle, Eric; Suomi, Stephen J.; Caporaso, Neil E.; Hertz-Picciotto, Irva; Jacobson, Kristen C.; Lowe, William L.; Goldman, Lynn R.; Duggal, Priya; Gunnar, Megan R.; Manolio, Teri A.; Green, Eric D.; Olster, Deborah H.; Birnbaum, Linda S.

    2011-01-01

    Although it is recognized that many common complex diseases are a result of multiple genetic and environmental risk factors, studies of gene-environment interaction remain a challenge and have had limited success to date. Given the current state-of-the-science, NIH sought input on ways to accelerate investigations of gene-environment interplay in health and disease by inviting experts from a variety of disciplines to give advice about the future direction of gene-environment interaction studies. Participants of the NIH Gene-Environment Interplay Workshop agreed that there is a need for continued emphasis on studies of the interplay between genetic and environmental factors in disease and that studies need to be designed around a multifaceted approach to reflect differences in diseases, exposure attributes, and pertinent stages of human development. The participants indicated that both targeted and agnostic approaches have strengths and weaknesses for evaluating main effects of genetic and environmental factors and their interactions. The unique perspectives represented at the workshop allowed the exploration of diverse study designs and analytical strategies, and conveyed the need for an interdisciplinary approach including data sharing, and data harmonization to fully explore gene-environment interactions. Further, participants also emphasized the continued need for high-quality measures of environmental exposures and new genomic technologies in ongoing and new studies. PMID:21308768

  12. Identification of a gene expression core signature for Duchenne Muscular Dystrophy (DMD) via integrative analysis reveals novel potential compounds for treatment

    KAUST Repository

    Ichim-Moreno, Norú

    2010-05-01

    Duchenne muscular dystrophy (DMD) is a recessive X-linked form of muscular dystrophy and one of the most prevalent genetic disorders of childhood. DMD is characterized by rapid progression of muscle degeneration, and ultimately death. Currently, glucocorticoids are the only available treatment for DMD, but they have been shown to result in serious side effects. The purpose of this research was to define a core signature of gene expression related to DMD via integrative analysis of mouse and human datasets. This core signature was subsequently used to screen for novel potential compounds that antagonistically affect the expression of signature genes. With this approach we were able to identify compounds that are 1) already used to treat DMD, 2) currently under investigation for treatment, and 3) so far unknown but promising candidates. Our study highlights the potential of meta-analyses through the combination of datasets to unravel previously unrecognized associations and reveal new relationships. © IEEE.

  13. DTFP-Growth: Dynamic Threshold-Based FP-Growth Rule Mining Algorithm Through Integrating Gene Expression, Methylation, and Protein-Protein Interaction Profiles.

    Science.gov (United States)

    Mallik, Saurav; Bhadra, Tapas; Mukherji, Ayan; Mallik, Saurav; Bhadra, Tapas; Mukherji, Ayan; Mallik, Saurav; Bhadra, Tapas; Mukherji, Ayan

    2018-04-01

    Association rule mining is an important technique for identifying interesting relationships between gene pairs in a biological data set. Earlier methods basically work for a single biological data set, and, in maximum cases, a single minimum support cutoff can be applied globally, i.e., across all genesets/itemsets. To overcome this limitation, in this paper, we propose dynamic threshold-based FP-growth rule mining algorithm that integrates gene expression, methylation and protein-protein interaction profiles based on weighted shortest distance to find the novel associations among different pairs of genes in multi-view data sets. For this purpose, we introduce three new thresholds, namely, Distance-based Variable/Dynamic Supports (DVS), Distance-based Variable Confidences (DVC), and Distance-based Variable Lifts (DVL) for each rule by integrating co-expression, co-methylation, and protein-protein interactions existed in the multi-omics data set. We develop the proposed algorithm utilizing these three novel multiple threshold measures. In the proposed algorithm, the values of , , and are computed for each rule separately, and subsequently it is verified whether the support, confidence, and lift of each evolved rule are greater than or equal to the corresponding individual , , and values, respectively, or not. If all these three conditions for a rule are found to be true, the rule is treated as a resultant rule. One of the major advantages of the proposed method compared with other related state-of-the-art methods is that it considers both the quantitative and interactive significance among all pairwise genes belonging to each rule. Moreover, the proposed method generates fewer rules, takes less running time, and provides greater biological significance for the resultant top-ranking rules compared to previous methods.

  14. Layered signaling regulatory networks analysis of gene expression involved in malignant tumorigenesis of non-resolving ulcerative colitis via integration of cross-study microarray profiles.

    Science.gov (United States)

    Fan, Shengjun; Pan, Zhenyu; Geng, Qiang; Li, Xin; Wang, Yefan; An, Yu; Xu, Yan; Tie, Lu; Pan, Yan; Li, Xuejun

    2013-01-01

    Ulcerative colitis (UC) was the most frequently diagnosed inflammatory bowel disease (IBD) and closely linked to colorectal carcinogenesis. By far, the underlying mechanisms associated with the disease are still unclear. With the increasing accumulation of microarray gene expression profiles, it is profitable to gain a systematic perspective based on gene regulatory networks to better elucidate the roles of genes associated with disorders. However, a major challenge for microarray data analysis is the integration of multiple-studies generated by different groups. In this study, firstly, we modeled a signaling regulatory network associated with colorectal cancer (CRC) initiation via integration of cross-study microarray expression data sets using Empirical Bayes (EB) algorithm. Secondly, a manually curated human cancer signaling map was established via comprehensive retrieval of the publicly available repositories. Finally, the co-differently-expressed genes were manually curated to portray the layered signaling regulatory networks. Overall, the remodeled signaling regulatory networks were separated into four major layers including extracellular, membrane, cytoplasm and nucleus, which led to the identification of five core biological processes and four signaling pathways associated with colorectal carcinogenesis. As a result, our biological interpretation highlighted the importance of EGF/EGFR signaling pathway, EPO signaling pathway, T cell signal transduction and members of the BCR signaling pathway, which were responsible for the malignant transition of CRC from the benign UC to the aggressive one. The present study illustrated a standardized normalization approach for cross-study microarray expression data sets. Our model for signaling networks construction was based on the experimentally-supported interaction and microarray co-expression modeling. Pathway-based signaling regulatory networks analysis sketched a directive insight into colorectal carcinogenesis

  15. An Integrated Approach Identifies Nhlh1 and Insm1 as Sonic Hedgehog-regulated Genes in Developing Cerebellum and Medulloblastoma

    Directory of Open Access Journals (Sweden)

    Enrico De Smaele

    2008-01-01

    Full Text Available Medulloblastoma (MB is the most common malignant brain tumor of childhood arising from deregulated cerebellar development. Sonic Hedgehog (Shh pathway plays a critical role in cerebellar development and its aberrant expression has been identified in MB. Gene expression profiling of cerebella from 1- to 14-day-old mice unveiled a cluster of genes whose expression correlates with the levels of Hedgehog (HH activity. From this cluster, we identified Insm1 and Nhlh1/NSCL1 as novel HH targets induced by Shh treatment in cultured cerebellar granule cell progenitors. Nhlh1 promoter was found to be bound and activated by Gli1 transcription factor. Remarkably, the expression of these genes is also upregulated in mouse and human HH-dependent MBs, suggesting that they may be either a part of the HH-induced tumorigenic process or a specific trait of HH-dependent tumor cells.

  16. Integrating gene expression data with demographic, clinical, and environmental exposure information to reveal endotypes of childhood asthma

    Science.gov (United States)

    RATIONALE. Childhood asthma is a multifactorial disease whose pathogenesis involves complex interplay between genetic susceptibility and modulating external factors. Therefore, effectively characterizing these multiple etiological pathways, or “endotypes”, requires an integrative...

  17. Integrating gene flow, crop biology, and farm management in on-farm conservation of avocado (Persea americana, Lauraceae).

    Science.gov (United States)

    Birnbaum, Kenneth; Desalle, Rob; Peters, Charles M; Benfey, Philip N

    2003-11-01

    Maintaining crop diversity on farms where cultivars can evolve is a conservation goal, but few tools are available to assess the long-term maintenance of genetic diversity on farms. One important issue for on-farm conservation is gene flow from crops with a narrow genetic base into related populations that are genetically diverse. In a case study of avocado (Persea americana var. americana) in one of its centers of diversity (San Jerónimo, Costa Rica), we used 10 DNA microsatellite markers in a parentage analysis to estimate gene flow from commercialized varieties into a traditional crop population. Five commercialized genotypes comprised nearly 40% of orchard trees, but they contributed only about 14.5% of the gametes to the youngest cohort of trees. Although commercialized varieties and the diverse population were often planted on the same farm, planting patterns appeared to keep the two types of trees separated on small scales, possibly explaining the limited gene flow. In a simulation that combined gene flow estimates, crop biology, and graft tree management, loss of allelic diversity was less than 10% over 150 yr, and selection was effective in retaining desirable alleles in the diverse subpopulation. Simulations also showed that, in addition to gene flow, managing the genetic makeup and life history traits of the invasive commercialized varieties could have a significant impact on genetic diversity in the target population. The results support the feasibility of on-farm crop conservation, but simulations also showed that higher levels of gene flow could lead to severe losses of genetic diversity even if farmers continue to plant diverse varieties.

  18. Molecular responses during cadmium-induced stress in Daphnia magna: Integration of differential gene expression with higher-level effects

    Energy Technology Data Exchange (ETDEWEB)

    Soetaert, Anneleen [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)]. E-mail: anneleen.soetaert@ua.ac.be; Vandenbrouck, Tine [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Ven, Karlijn van der [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Maras, Marleen [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Remortel, Piet van [Department of Mathematics and Informatics, Intelligent Systems Laboratory, University of Antwerp, Middelheimlaan 1, B-2020 Antwerp (Belgium); Blust, Ronny [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Coen, Wim M. de [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)

    2007-07-20

    DNA microarrays offer great potential in revealing insight into mechanistic toxicity of contaminants. The aim of the present study was (i) to gain insight in concentration- and time-dependent cadmium-induced molecular responses by using a customized Daphnia magna microarray, and (ii) to compare the gene expression profiles with effects at higher levels of biological organization (e.g. total energy budget and growth). Daphnids were exposed to three cadmium concentrations (nominal value of 10, 50, 100 {mu}g/l) for two time intervals (48 and 96 h). In general, dynamic expression patterns were obtained with a clear increase of gene expression changes at higher concentrations and longer exposure duration. Microarray analysis revealed cadmium affected molecular pathways associated with processes such as digestion, oxygen transport, cuticula metabolism and embryo development. These effects were compared with higher-level effects (energy budgets and growth). For instance, next to reduced energy budgets due to a decline in lipid, carbohydrate and protein content, we found an up-regulated expression of genes related to digestive processes (e.g. {alpha}-esterase, cellulase, {alpha}-amylase). Furthermore, cadmium affected the expression of genes coding for proteins involved in molecular pathways associated with immune response, stress response, cell adhesion, visual perception and signal transduction in the present study.

  19. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  20. Integration analysis of microRNA and mRNA paired expression profiling identifies deregulated microRNA-transcription factor-gene regulatory networks in ovarian endometriosis.

    Science.gov (United States)

    Zhao, Luyang; Gu, Chenglei; Ye, Mingxia; Zhang, Zhe; Li, Li'an; Fan, Wensheng; Meng, Yuanguang

    2018-01-22

    The etiology and pathophysiology of endometriosis remain unclear. Accumulating evidence suggests that aberrant microRNA (miRNA) and transcription factor (TF) expression may be involved in the pathogenesis and development of endometriosis. This study therefore aims to survey the key miRNAs, TFs and genes and further understand the mechanism of endometriosis. Paired expression profiling of miRNA and mRNA in ectopic endometria compared with eutopic endometria were determined by high-throughput sequencing techniques in eight patients with ovarian endometriosis. Binary interactions and circuits among the miRNAs, TFs, and corresponding genes were identified by the Pearson correlation coefficients. miRNA-TF-gene regulatory networks were constructed using bioinformatic methods. Eleven selected miRNAs and TFs were validated by quantitative reverse transcription-polymerase chain reaction in 22 patients. Overall, 107 differentially expressed miRNAs and 6112 differentially expressed mRNAs were identified by comparing the sequencing of the ectopic endometrium group and the eutopic endometrium group. The miRNA-TF-gene regulatory network consists of 22 miRNAs, 12 TFs and 430 corresponding genes. Specifically, some key regulators from the miR-449 and miR-34b/c cluster, miR-200 family, miR-106a-363 cluster, miR-182/183, FOX family, GATA family, and E2F family as well as CEBPA, SOX9 and HNF4A were suggested to play vital regulatory roles in the pathogenesis of endometriosis. Integration analysis of the miRNA and mRNA expression profiles presents a unique insight into the regulatory network of this enigmatic disorder and possibly provides clues regarding replacement therapy for endometriosis.

  1. Integrated transcriptome catalogue and organ-specific profiling of gene expression in fertile garlic (Allium sativum L.).

    Science.gov (United States)

    Kamenetsky, Rina; Faigenboim, Adi; Shemesh Mayer, Einat; Ben Michael, Tomer; Gershberg, Chen; Kimhi, Sagie; Esquira, Itzhak; Rohkin Shalom, Sarit; Eshel, Dani; Rabinowitch, Haim D; Sherman, Amir

    2015-01-22

    Garlic is cultivated and consumed worldwide as a popular condiment and green vegetable with medicinal and neutraceutical properties. Garlic cultivars do not produce seeds, and therefore, this plant has not been the subject of either classical breeding or genetic studies. However, recent achievements in fertility restoration in a number of genotypes have led to flowering and seed production, thus enabling genetic studies and breeding in garlic. A transcriptome catalogue of fertile garlic was produced from multiplexed gene libraries, using RNA collected from various plant organs, including inflorescences and flowers. Over 32 million 250-bp paired-end reads were assembled into an extensive transcriptome of 240,000 contigs. An abundant transcriptome assembled separately from 102,000 highly expressed contigs was annotated and analyzed for gene ontology and metabolic pathways. Organ-specific analysis showed significant variation of gene expression between plant organs, with the highest number of specific reads in inflorescences and flowers. Analysis of the enriched biological processes and molecular functions revealed characteristic patterns for stress response, flower development and photosynthetic activity. Orthologues of key flowering genes were differentially expressed, not only in reproductive tissues, but also in leaves and bulbs, suggesting their role in flower-signal transduction and the bulbing process. More than 100 variants and isoforms of enzymes involved in organosulfur metabolism were differentially expressed and had organ-specific patterns. In addition to plant genes, viral RNA of at least four garlic viruses was detected, mostly in the roots and cloves, whereas only 1-4% of the reads were found in the foliage leaves. The de novo transcriptome of fertile garlic represents a new resource for research and breeding of this important crop, as well as for the development of effective molecular markers for useful traits, including fertility and seed production

  2. Integrating genome-wide genetic variations and monocyte expression data reveals trans-regulated gene modules in humans.

    Directory of Open Access Journals (Sweden)

    Maxime Rotival

    2011-12-01

    Full Text Available One major expectation from the transcriptome in humans is to characterize the biological basis of associations identified by genome-wide association studies. So far, few cis expression quantitative trait loci (eQTLs have been reliably related to disease susceptibility. Trans-regulating mechanisms may play a more prominent role in disease susceptibility. We analyzed 12,808 genes detected in at least 5% of circulating monocyte samples from a population-based sample of 1,490 European unrelated subjects. We applied a method of extraction of expression patterns-independent component analysis-to identify sets of co-regulated genes. These patterns were then related to 675,350 SNPs to identify major trans-acting regulators. We detected three genomic regions significantly associated with co-regulated gene modules. Association of these loci with multiple expression traits was replicated in Cardiogenics, an independent study in which expression profiles of monocytes were available in 758 subjects. The locus 12q13 (lead SNP rs11171739, previously identified as a type 1 diabetes locus, was associated with a pattern including two cis eQTLs, RPS26 and SUOX, and 5 trans eQTLs, one of which (MADCAM1 is a potential candidate for mediating T1D susceptibility. The locus 12q24 (lead SNP rs653178, which has demonstrated extensive disease pleiotropy, including type 1 diabetes, hypertension, and celiac disease, was associated to a pattern strongly correlating to blood pressure level. The strongest trans eQTL in this pattern was CRIP1, a known marker of cellular proliferation in cancer. The locus 12q15 (lead SNP rs11177644 was associated with a pattern driven by two cis eQTLs, LYZ and YEATS4, and including 34 trans eQTLs, several of them tumor-related genes. This study shows that a method exploiting the structure of co-expressions among genes can help identify genomic regions involved in trans regulation of sets of genes and can provide clues for understanding the

  3. Stable integration and expression of a cry1Ia gene conferring resistance to fall armyworm and boll weevil in cotton plants.

    Science.gov (United States)

    Silva, Carliane Rc; Monnerat, Rose; Lima, Liziane M; Martins, Érica S; Melo Filho, Péricles A; Pinheiro, Morganna Pn; Santos, Roseane C

    2016-08-01

    Boll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (T0-34) containing one copy of cry1Ia detected by Southern blot. Protein was expressed in high concentration at 45 days after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A binding of cry1Ia antibody was found in the midgut of boll weevils fed on T0-34 buds in an immunodetection assay. The gene introduced into plants confers resistance to boll weevil and fall armyworm. Transmission of the transgene occurred normally to T1 progeny. All plants showed phenotypically normal growth, with fertile flowers and abundant seeds. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  4. An integration of genome-wide association study and gene expression profiling to prioritize the discovery of novel susceptibility Loci for osteoporosis-related traits.

    Directory of Open Access Journals (Sweden)

    Yi-Hsiang Hsu

    2010-06-01

    Full Text Available Osteoporosis is a complex disorder and commonly leads to fractures in elderly persons. Genome-wide association studies (GWAS have become an unbiased approach to identify variations in the genome that potentially affect health. However, the genetic variants identified so far only explain a small proportion of the heritability for complex traits. Due to the modest genetic effect size and inadequate power, true association signals may not be revealed based on a stringent genome-wide significance threshold. Here, we take advantage of SNP and transcript arrays and integrate GWAS and expression signature profiling relevant to the skeletal system in cellular and animal models to prioritize the discovery of novel candidate genes for osteoporosis-related traits, including bone mineral density (BMD at the lumbar spine (LS and femoral neck (FN, as well as geometric indices of the hip (femoral neck-shaft angle, NSA; femoral neck length, NL; and narrow-neck width, NW. A two-stage meta-analysis of GWAS from 7,633 Caucasian women and 3,657 men, revealed three novel loci associated with osteoporosis-related traits, including chromosome 1p13.2 (RAP1A, p = 3.6x10(-8, 2q11.2 (TBC1D8, and 18q11.2 (OSBPL1A, and confirmed a previously reported region near TNFRSF11B/OPG gene. We also prioritized 16 suggestive genome-wide significant candidate genes based on their potential involvement in skeletal metabolism. Among them, 3 candidate genes were associated with BMD in women. Notably, 2 out of these 3 genes (GPR177, p = 2.6x10(-13; SOX6, p = 6.4x10(-10 associated with BMD in women have been successfully replicated in a large-scale meta-analysis of BMD, but none of the non-prioritized candidates (associated with BMD did. Our results support the concept of our prioritization strategy. In the absence of direct biological support for identified genes, we highlighted the efficiency of subsequent functional characterization using publicly available expression profiling relevant

  5. Integrated GWAS and Pathway profiling for feed efficiency traits in pigs leads to novel genes and their molecular pathways

    DEFF Research Database (Denmark)

    Do, Duy Ngoc; Ostersen, Tage; Strathe, Anders Bjerring

    2013-01-01

    Genome wide association studies (GWAS) are being extensively used in revealing genetic architecture of complex traits. However, GWAS offer limited understanding of the biological role of significant single nucleotide polymorphisms (SNPs) affecting complex traits. Pathway analysis using GWAS results...... is an important step where we firstly detect genes located near GWAS-detected SNPs and subsequently we detect enrichment of these genes in various biological processes and pathways. The objective of this study was to apply these steps to identify relevant pathways involved in residual feed intake (RFI) in pigs....... Residual feed intake is a feed efficiency measure and is highly economically important in animal production. In our study, a total of 596 Yorkshire boars had phenotypic and genotypic records. After quality control, 37,915 SNPs were available for GWAS which was implemented in the DMU software package...

  6. Integration of ATAC-seq and RNA-seq identifies human alpha cell and beta cell signature genes

    Directory of Open Access Journals (Sweden)

    Amanda M. Ackermann

    2016-03-01

    Conclusions: We have determined the genetic landscape of human α- and β-cells based on chromatin accessibility and transcript levels, which allowed for detection of novel α- and β-cell signature genes not previously known to be expressed in islets. Using fine-mapping of open chromatin, we have identified thousands of potential cis-regulatory elements that operate in an endocrine cell type-specific fashion.

  7. Inducible and reversible suppression of Npm1 gene expression using stably integrated small interfering RNA vector in mouse embryonic stem cells

    International Nuclear Information System (INIS)

    Wang Beibei; Lu Rui; Wang Weicheng; Jin Ying

    2006-01-01

    The tetracycline (Tc)-inducible small interference RNA (siRNA) is a powerful tool for studying gene function in mammalian cells. However, the system is infrequently utilized in embryonic stem (ES) cells. Here, we present First application of the Tc-inducible, stably integrated plasmid-based siRNA system in mouse ES cells to down-regulate expression of Npm1, an essential gene for embryonic development. The physiological role of Npm1 in ES cells has not been defined. Our data show that the knock-down of Npm1 expression by this siRNA system was not only highly efficient, but also Tc- dose- and induction time-dependent. Particularly, the down-regulation of Npm1 expression was reversible. Importantly, suppression of Npm1 expression in ES cells resulted in reduced cell proliferation. Taken together, this system allows for studying gene function in a highly controlled manner, otherwise difficult to achieve in ES cells. Moreover, our results demonstrate that Npm1 is essential for ES cell proliferation

  8. Sequence Analysis of Inducible Prophage phIS3501 Integrated into the Haemolysin II Gene of Bacillus thuringiensis var israelensis ATCC35646

    Directory of Open Access Journals (Sweden)

    Bouziane Moumen

    2012-01-01

    Full Text Available Diarrheic food poisoning by bacteria of the Bacillus cereus group is mostly due to several toxins encoded in the genomes. One of them, cytotoxin K, was recently identified as responsible for severe necrotic syndromes. Cytotoxin K is similar to a class of proteins encoded by genes usually annotated as haemolysin II (hlyII in the majority of genomes of the B. cereus group. The partially sequenced genome of Bacillus thuringiensis var israelensis ATCC35646 contains several potentially induced prophages, one of them integrated into the hlyII gene. We determined the complete sequence and established the genomic organization of this prophage-designated phIS3501. During induction of excision of this prophage with mitomycin C, intact hlyII gene is formed, thus providing to cells a genetic ability to synthesize the active toxin. Therefore, this prophage, upon its excision, can be implicated in the regulation of synthesis of the active toxin and thus in the virulence of bacterial host. A generality of selection for such systems in bacterial pathogens is indicated by the similarity of this genetic arrangement to that of Staphylococcus aureus  β-haemolysin.

  9. Human Herpesvirus 6B Induces Hypomethylation on Chromosome 17p13.3, Correlating with Increased Gene Expression and Virus Integration.

    Science.gov (United States)

    Engdahl, Elin; Dunn, Nicky; Niehusmann, Pitt; Wideman, Sarah; Wipfler, Peter; Becker, Albert J; Ekström, Tomas J; Almgren, Malin; Fogdell-Hahn, Anna

    2017-06-01

    Human herpesvirus 6B (HHV-6B) is a neurotropic betaherpesvirus that achieves latency by integrating its genome into host cell chromosomes. Several viruses can induce epigenetic modifications in their host cells, but no study has investigated the epigenetic modifications induced by HHV-6B. This study analyzed methylation with an Illumina 450K array, comparing HHV-6B-infected and uninfected Molt-3 T cells 3 days postinfection. Bisulfite pyrosequencing was used to validate the Illumina results and to investigate methylation over time in vitro Expression of genes was investigated using quantitative PCR (qPCR), and virus integration was investigated with PCR. A total of 406 CpG sites showed a significant HHV-6B-induced change in methylation in vitro Remarkably, 86% (351/406) of these CpGs were located integration in Molt-3 cell DNA 3 days after infection. The telomere at 17p has repeatedly been described as an integration site for HHV-6B, and we show for the first time that HHV-6B induces hypomethylation in this region during acute infection, which may play a role in the integration process, possibly by making the DNA more accessible. IMPORTANCE The ability to establish latency in the host is a hallmark of herpesviruses, but the mechanisms differ. Human herpesvirus 6B (HHV-6B) is known to establish latency through integration of its genome into the telomeric regions of host cells, with the ability to reactivate. Our study is the first to show that HHV-6B specifically induces hypomethylated regions close to the telomeres and that integrating viruses may use the host methylation machinery to facilitate their integration process. The results from this study contribute to knowledge of HHV-6B biology and virus-host interaction. This in turn will lead to further progress in our understanding of the underlying mechanisms by which HHV-6B contributes to pathological processes and may have important implications in both disease prevention and treatment. Copyright © 2017 American

  10. Exposure to atrazine affects the expression of key genes in metabolic pathways integral to energy homeostasis in Xenopus laevis tadpoles.

    Science.gov (United States)

    Zaya, Renee M; Amini, Zakariya; Whitaker, Ashley S; Ide, Charles F

    2011-08-01

    In our laboratory, Xenopus laevis tadpoles exposed throughout development to 200 or 400 μg/L atrazine, concentrations reported to periodically occur in puddles, vernal ponds and runoff soon after application, were smaller and had smaller fat bodies (the tadpole's lipid storage organ) than controls. It was hypothesized that these changes were due to atrazine-related perturbations of energy homeostasis. To investigate this hypothesis, selected metabolic responses to exposure at the transcriptional and biochemical levels in atrazine-exposed tadpoles were measured. DNA microarray technology was used to determine which metabolic pathways were affected after developmental exposure to 400 μg/L atrazine. From these data, genes representative of the affected pathways were selected for assay using quantitative real time polymerase chain reaction (qRT-PCR) to measure changes in expression during a 2-week exposure to 400 μg/L. Finally, ATP levels were measured from tadpoles both early in and at termination of exposure to 200 and 400 μg/L. Microarray analysis revealed significant differential gene expression in metabolic pathways involved with energy homeostasis. Pathways with increased transcription were associated with the conversion of lipids and proteins into energy. Pathways with decreased transcription were associated with carbohydrate metabolism, fat storage, and protein synthesis. Using qRT-PCR, changes in gene expression indicative of an early stress response to atrazine were noted. Exposed tadpoles had significant decreases in acyl-CoA dehydrogenase (AD) and glucocorticoid receptor protein (GR) mRNA after 24 h of exposure, and near-significant (p=0.07) increases in peroxisome proliferator-activated receptor β (PPAR-β) mRNA by 72 h. Decreases in AD suggested decreases in fatty acid β-oxidation while decreases in GR may have been a receptor desensitization response to a glucocorticoid surge. Involvement of PPAR-β, an energy homeostasis regulatory molecule, also

  11. Exposure to atrazine affects the expression of key genes in metabolic pathways integral to energy homeostasis in Xenopus laevis tadpoles

    International Nuclear Information System (INIS)

    Zaya, Renee M.; Amini, Zakariya; Whitaker, Ashley S.; Ide, Charles F.

    2011-01-01

    In our laboratory, Xenopus laevis tadpoles exposed throughout development to 200 or 400 μg/L atrazine, concentrations reported to periodically occur in puddles, vernal ponds and runoff soon after application, were smaller and had smaller fat bodies (the tadpole's lipid storage organ) than controls. It was hypothesized that these changes were due to atrazine-related perturbations of energy homeostasis. To investigate this hypothesis, selected metabolic responses to exposure at the transcriptional and biochemical levels in atrazine-exposed tadpoles were measured. DNA microarray technology was used to determine which metabolic pathways were affected after developmental exposure to 400 μg/L atrazine. From these data, genes representative of the affected pathways were selected for assay using quantitative real time polymerase chain reaction (qRT-PCR) to measure changes in expression during a 2-week exposure to 400 μg/L. Finally, ATP levels were measured from tadpoles both early in and at termination of exposure to 200 and 400 μg/L. Microarray analysis revealed significant differential gene expression in metabolic pathways involved with energy homeostasis. Pathways with increased transcription were associated with the conversion of lipids and proteins into energy. Pathways with decreased transcription were associated with carbohydrate metabolism, fat storage, and protein synthesis. Using qRT-PCR, changes in gene expression indicative of an early stress response to atrazine were noted. Exposed tadpoles had significant decreases in acyl-CoA dehydrogenase (AD) and glucocorticoid receptor protein (GR) mRNA after 24 h of exposure, and near-significant (p = 0.07) increases in peroxisome proliferator-activated receptor β (PPAR-β) mRNA by 72 h. Decreases in AD suggested decreases in fatty acid β-oxidation while decreases in GR may have been a receptor desensitization response to a glucocorticoid surge. Involvement of PPAR-β, an energy homeostasis regulatory molecule

  12. Exposure to atrazine affects the expression of key genes in metabolic pathways integral to energy homeostasis in Xenopus laevis tadpoles

    Energy Technology Data Exchange (ETDEWEB)

    Zaya, Renee M., E-mail: renee.zaya@wmich.edu [Great Lakes Environmental and Molecular Sciences Center, Department of Biological Sciences, 3425 Wood Hall, Western Michigan University, 1903 West Michigan Avenue, Kalamazoo, MI 49008 (United States); Amini, Zakariya, E-mail: zakariya.amini@wmich.edu [Great Lakes Environmental and Molecular Sciences Center, Department of Biological Sciences, 3425 Wood Hall, Western Michigan University, 1903 West Michigan Avenue, Kalamazoo, MI 49008 (United States); Whitaker, Ashley S., E-mail: ashley.s.whitaker@wmich.edu [Great Lakes Environmental and Molecular Sciences Center, Department of Biological Sciences, 3425 Wood Hall, Western Michigan University, 1903 West Michigan Avenue, Kalamazoo, MI 49008 (United States); Ide, Charles F., E-mail: charles.ide@wmich.edu [Great Lakes Environmental and Molecular Sciences Center, Department of Biological Sciences, 3425 Wood Hall, Western Michigan University, 1903 West Michigan Avenue, Kalamazoo, MI 49008 (United States)

    2011-08-15

    In our laboratory, Xenopus laevis tadpoles exposed throughout development to 200 or 400 {mu}g/L atrazine, concentrations reported to periodically occur in puddles, vernal ponds and runoff soon after application, were smaller and had smaller fat bodies (the tadpole's lipid storage organ) than controls. It was hypothesized that these changes were due to atrazine-related perturbations of energy homeostasis. To investigate this hypothesis, selected metabolic responses to exposure at the transcriptional and biochemical levels in atrazine-exposed tadpoles were measured. DNA microarray technology was used to determine which metabolic pathways were affected after developmental exposure to 400 {mu}g/L atrazine. From these data, genes representative of the affected pathways were selected for assay using quantitative real time polymerase chain reaction (qRT-PCR) to measure changes in expression during a 2-week exposure to 400 {mu}g/L. Finally, ATP levels were measured from tadpoles both early in and at termination of exposure to 200 and 400 {mu}g/L. Microarray analysis revealed significant differential gene expression in metabolic pathways involved with energy homeostasis. Pathways with increased transcription were associated with the conversion of lipids and proteins into energy. Pathways with decreased transcription were associated with carbohydrate metabolism, fat storage, and protein synthesis. Using qRT-PCR, changes in gene expression indicative of an early stress response to atrazine were noted. Exposed tadpoles had significant decreases in acyl-CoA dehydrogenase (AD) and glucocorticoid receptor protein (GR) mRNA after 24 h of exposure, and near-significant (p = 0.07) increases in peroxisome proliferator-activated receptor {beta} (PPAR-{beta}) mRNA by 72 h. Decreases in AD suggested decreases in fatty acid {beta}-oxidation while decreases in GR may have been a receptor desensitization response to a glucocorticoid surge. Involvement of PPAR-{beta}, an energy

  13. A new mosaic integrative and conjugative element from Streptococcus agalactiae carrying resistance genes for chloramphenicol (catQ) and macrolides [mef(I) and erm(TR)].

    Science.gov (United States)

    Morici, Eleonora; Simoni, Serena; Brenciani, Andrea; Giovanetti, Eleonora; Varaldo, Pietro E; Mingoia, Marina

    2017-01-01

    To investigate the genetic basis of catQ-mediated chloramphenicol resistance in Streptococcus agalactiae. Two clinical strains of catQ-positive chloramphenicol-resistant S. agalactiae (Sag236 and Sag403) were recently isolated, typed (MLST, PFGE pulsotypes, capsular types) and their antibiotic resistances investigated by phenotypic and genotypic approaches. Several molecular methods (PCR mapping, restriction assays, Southern blotting, sequencing and sequence analysis, conjugal transfer assays) were used to determine the genetic context of catQ and characterize a genetic element detected in the isolates. Sag236 and Sag403 shared the same ST (ST19), but exhibited a different capsular type (III and V, respectively) and pulsotype. Both harboured the macrolide resistance genes mef(I) and erm(TR) and the tetracycline resistance gene tet(M). Accordingly, they were resistant to chloramphenicol, erythromycin and tetracycline. catQ and mef(I) were associated in an IQ module that was indistinguishable in Sag236 and Sag403. In mating assays, chloramphenicol and erythromycin resistance proved transferable, at low frequency, only from Sag236. Transconjugants carried not only catQ and mef(I), but also erm(TR), suggesting a linkage of the three resistance genes in a mobile element, which, though seemingly non-mobile, was also detected in Sag403. The new element (designated ICESag236, ∼110 kb) results from recombination of two integrative and conjugative elements (ICEs) originally described in different streptococcal species: S. agalactiae ICESagTR7, carrying erm(TR); and Streptococcus pneumoniae ICESpn529IQ, carrying the prototype IQ module. These findings strengthen the notion that widespread streptococcal ICEs may form mosaics that enhance their diversity and spread, broaden their host range and carry new cargo genes. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions

  14. From gene to structure: Lactobacillus bulgaricus D-lactate dehydrogenase from yogurt as an integrated curriculum model for undergraduate molecular biology and biochemistry laboratory courses.

    Science.gov (United States)

    Lawton, Jeffrey A; Prescott, Noelle A; Lawton, Ping X

    2018-05-01

    We have developed an integrated, project-oriented curriculum for undergraduate molecular biology and biochemistry laboratory courses spanning two semesters that is organized around the ldhA gene from the yogurt-fermenting bacterium Lactobacillus bulgaricus, which encodes the enzyme d-lactate dehydrogenase. The molecular biology module, which consists of nine experiments carried out over eleven sessions, begins with the isolation of genomic DNA from L. bulgaricus in yogurt and guides students through the process of cloning the ldhA gene into a prokaryotic expression vector, followed by mRNA isolation and characterization of recombinant gene expression levels using RT-PCR. The biochemistry module, which consists of nine experiments carried out over eight sessions, begins with overexpression of the cloned ldhA gene and guides students through the process of affinity purification, biochemical characterization of the purified LdhA protein, and analysis of enzyme kinetics using various substrates and an inhibitor, concluding with a guided inquiry investigation of structure-function relationships in the three-dimensional structure of LdhA using molecular visualization software. Students conclude by writing a paper describing their work on the project, formatted as a manuscript to be submitted for publication in a scientific journal. Overall, this curriculum, with its emphasis on experiential learning, provides hands-on training with a variety of common laboratory techniques in molecular biology and biochemistry and builds experience with the process of scientific reasoning, along with reinforcement of essential transferrable skills such as critical thinking, information literacy, and written communication, all within the framework of an extended project having the look and feel of a research experience. © 2018 by The International Union of Biochemistry and Molecular Biology, 46(3):270-278, 2018. © 2018 The International Union of Biochemistry and Molecular Biology.

  15. Fine mapping of a linkage peak with integration of lipid traits identifies novel coronary artery disease genes on chromosome 5

    Directory of Open Access Journals (Sweden)

    Nolan Daniel K

    2012-02-01

    Full Text Available Abstract Background Coronary artery disease (CAD, and one of its intermediate risk factors, dyslipidemia, possess a demonstrable genetic component, although the genetic architecture is incompletely defined. We previously reported a linkage peak on chromosome 5q31-33 for early-onset CAD where the strength of evidence for linkage was increased in families with higher mean low density lipoprotein-cholesterol (LDL-C. Therefore, we sought to fine-map the peak using association mapping of LDL-C as an intermediate disease-related trait to further define the etiology of this linkage peak. The study populations consisted of 1908 individuals from the CATHGEN biorepository of patients undergoing cardiac catheterization; 254 families (N = 827 individuals from the GENECARD familial study of early-onset CAD; and 162 aorta samples harvested from deceased donors. Linkage disequilibrium-tagged SNPs were selected with an average of one SNP per 20 kb for 126.6-160.2 MB (region of highest linkage and less dense spacing (one SNP per 50 kb for the flanking regions (117.7-126.6 and 160.2-167.5 MB and genotyped on all samples using a custom Illumina array. Association analysis of each SNP with LDL-C was performed using multivariable linear regression (CATHGEN and the quantitative trait transmission disequilibrium test (QTDT; GENECARD. SNPs associated with the intermediate quantitative trait, LDL-C, were then assessed for association with CAD (i.e., a qualitative phenotype using linkage and association in the presence of linkage (APL; GENECARD and logistic regression (CATHGEN and aortas. Results We identified four genes with SNPs that showed the strongest and most consistent associations with LDL-C and CAD: EBF1, PPP2R2B, SPOCK1, and PRELID2. The most significant results for association of SNPs with LDL-C were: EBF1, rs6865969, p = 0.01; PPP2R2B, rs2125443, p = 0.005; SPOCK1, rs17600115, p = 0.003; and PRELID2, rs10074645, p = 0.0002. The most significant results for

  16. Integrative analysis of miRNA and gene expression reveals regulatory networks in tamoxifen-resistant breast cancer

    DEFF Research Database (Denmark)

    Joshi, Tejal; Elias, Daniel; Stenvang, Jan

    2016-01-01

    Tamoxifen is an effective anti-estrogen treatment for patients with estrogen receptor-positive (ER+) breast cancer, however, tamoxifen resistance is frequently observed. To elucidate the underlying molecular mechanisms of tamoxifen resistance, we performed a systematic analysis of mi......+ breast cancer patients receiving adjuvant tamoxifen mono-therapy. Our results provide new insight into the molecular mechanisms of tamoxifen resistance and may form the basis for future medical intervention for the large number of women with tamoxifen-resistant ER+ breast cancer.......RNA-mediated gene regulation in three clinically-relevant tamoxifen-resistant breast cancer cell lines (TamRs) compared to their parental tamoxifen-sensitive cell line. Alterations in the expression of 131 miRNAs in tamoxifen-resistant vs. parental cell lines were identified, 22 of which were common to all Tam...

  17. Integrative DNA methylation and gene expression analysis to assess the universality of the CpG island methylator phenotype.

    Science.gov (United States)

    Moarii, Matahi; Reyal, Fabien; Vert, Jean-Philippe

    2015-10-13

    The CpG island methylator phenotype (CIMP) was first characterized in colorectal cancer but since has been extensively studied in several other tumor types such as breast, bladder, lung, and gastric. CIMP is of clinical importance as it has been reported to be associated with prognosis or response to treatment. However, the identification of a universal molecular basis to define CIMP across tumors has remained elusive. We perform a genome-wide methylation analysis of over 2000 tumor samples from 5 cancer sites to assess the existence of a CIMP with common molecular basis across cancers. We then show that the CIMP phenotype is associated with specific gene expression variations. However, we do not find a common genetic signature in all tissues associated with CIMP. Our results suggest the existence of a universal epigenetic and transcriptomic signature that defines the CIMP across several tumor types but does not indicate the existence of a common genetic signature of CIMP.

  18. The Gene Ontology (GO) Cellular Component Ontology: integration with SAO (Subcellular Anatomy Ontology) and other recent developments

    Science.gov (United States)

    2013-01-01

    Background The Gene Ontology (GO) (http://www.geneontology.org/) contains a set of terms for describing the activity and actions of gene products across all kingdoms of life. Each of these activities is executed in a location within a cell or in the vicinity of a cell. In order to capture this context, the GO includes a sub-ontology called the Cellular Component (CC) ontology (GO-CCO). The primary use of this ontology is for GO annotation, but it has also been used for phenotype annotation, and for the annotation of images. Another ontology with similar scope to the GO-CCO is the Subcellular Anatomy Ontology (SAO), part of the Neuroscience Information Framework Standard (NIFSTD) suite of ontologies. The SAO also covers cell components, but in the domain of neuroscience. Description Recently, the GO-CCO was enriched in content and links to the Biological Process and Molecular Function branches of GO as well as to other ontologies. This was achieved in several ways. We carried out an amalgamation of SAO terms with GO-CCO ones; as a result, nearly 100 new neuroscience-related terms were added to the GO. The GO-CCO also contains relationships to GO Biological Process and Molecular Function terms, as well as connecting to external ontologies such as the Cell Ontology (CL). Terms representing protein complexes in the Protein Ontology (PRO) reference GO-CCO terms for their species-generic counterparts. GO-CCO terms can also be used to search a variety of databases. Conclusions In this publication we provide an overview of the GO-CCO, its overall design, and some recent extensions that make use of additional spatial information. One of the most recent developments of the GO-CCO was the merging in of the SAO, resulting in a single unified ontology designed to serve the needs of GO annotators as well as the specific needs of the neuroscience community. PMID:24093723

  19. Autism genetic database (AGD: a comprehensive database including autism susceptibility gene-CNVs integrated with known noncoding RNAs and fragile sites

    Directory of Open Access Journals (Sweden)

    Talebizadeh Zohreh

    2009-09-01

    Full Text Available Abstract Background Autism is a highly heritable complex neurodevelopmental disorder, therefore identifying its genetic basis has been challenging. To date, numerous susceptibility genes and chromosomal abnormalities have been reported in association with autism, but most discoveries either fail to be replicated or account for a small effect. Thus, in most cases the underlying causative genetic mechanisms are not fully understood. In the present work, the Autism Genetic Database (AGD was developed as a literature-driven, web-based, and easy to access database designed with the aim of creating a comprehensive repository for all the currently reported genes and genomic copy number variations (CNVs associated with autism in order to further facilitate the assessment of these autism susceptibility genetic factors. Description AGD is a relational database that organizes data resulting from exhaustive literature searches for reported susceptibility genes and CNVs associated with autism. Furthermore, genomic information about human fragile sites and noncoding RNAs was also downloaded and parsed from miRBase, snoRNA-LBME-db, piRNABank, and the MIT/ICBP siRNA database. A web client genome browser enables viewing of the features while a web client query tool provides access to more specific information for the features. When applicable, links to external databases including GenBank, PubMed, miRBase, snoRNA-LBME-db, piRNABank, and the MIT siRNA database are provided. Conclusion AGD comprises a comprehensive list of susceptibility genes and copy number variations reported to-date in association with autism, as well as all known human noncoding RNA genes and fragile sites. Such a unique and inclusive autism genetic database will facilitate the evaluation of autism susceptibility factors in relation to known human noncoding RNAs and fragile sites, impacting on human diseases. As a result, this new autism database offers a valuable tool for the research

  20. Integrative analysis of copy number and gene expression in breast cancer using formalin-fixed paraffin-embedded core biopsy tissue: a feasibility study.

    Science.gov (United States)

    Iddawela, Mahesh; Rueda, Oscar; Eremin, Jenny; Eremin, Oleg; Cowley, Jed; Earl, Helena M; Caldas, Carlos

    2017-07-11

    An absence of reliable molecular markers has hampered individualised breast cancer treatments, and a major limitation for translational research is the lack of fresh tissue. There are, however, abundant banks of formalin-fixed paraffin-embedded (FFPE) tissue. This study evaluated two platforms available for the analysis of DNA copy number and gene expression using FFPE samples. The cDNA-mediated annealing, selection, extension, and ligation assay (DASL™) has been developed for gene expression analysis and the Molecular Inversion Probes assay (Oncoscan™), were used for copy number analysis using FFPE tissues. Gene expression and copy number were evaluated in core-biopsy samples from patients with breast cancer undergoing neoadjuvant chemotherapy (NAC). Forty-three core-biopsies were evaluated and characteristic copy number changes in breast cancers, gains in 1q, 8q, 11q, 17q and 20q and losses in 6q, 8p, 13q and 16q, were confirmed. Regions that frequently exhibited gains in tumours showing a pathological complete response (pCR) to NAC were 1q (55%), 8q (40%) and 17q (40%), whereas 11q11 (37%) gain was the most frequent change in non-pCR tumours. Gains associated with poor survival were 11q13 (62%), 8q24 (54%) and 20q (47%). Gene expression assessed by DASL correlated with immunohistochemistry (IHC) analysis for oestrogen receptor (ER) [area under the curve (AUC) = 0.95], progesterone receptor (PR)(AUC = 0.90) and human epidermal growth factor type-2 receptor (HER-2) (AUC = 0.96). Differential expression analysis between ER+ and ER- cancers identified over-expression of TTF1, LAF-4 and C-MYB (p ≤ 0.05), and between pCR vs non-pCRs, over-expression of CXCL9, AREG, B-MYB and under-expression of ABCG2. This study was an integrative analysis of copy number and gene expression using FFPE core biopsies and showed that molecular marker data from FFPE tissues were consistent with those in previous studies using fresh-frozen samples. FFPE tissue can provide

  1. Molecular nature of X-ray-induced mutations compared with that of spontaneous ones in human c-hprt gene integrated into mammalian chromosomal DNA

    International Nuclear Information System (INIS)

    Kimura, Hiroshi; Kato, Takesi.

    1992-01-01

    X-ray-induced mutations were analysed at molecular levels in comparison with spontaneous mutations. Altered sequences were determined tentatively of 30 independent X-ray-induced mutations in a cDNA of the human hprt gene which was integrated into mammalian chromosome as a part of a shuttle vector. Mutations consisted of base substitutions (37 %), frameshifts (27 %), deletions (27 %) and others (10 %). All these mutational events were distributed randomly over the gene without there being hot spots. The spectrum and distribution of X-ray-induced mutations resembled those of spontaneous mutations. Among base substitutions, transversions were predominant and base substitution mutations occurred more at A:T sites than at G:C sites, which is also the case in spontaneous mutations. Most of the frameshift and deletion mutations induced by X-rays, as well as those spontaneously arising, were characterized by the existence of short direct repeats of several identical bases in a row at the sites of the mutations. A slippage misalignment mechanism in replication well accounts for the generation of these classes of mutations. Judging from the data accumulated so far, it can be concluded that X-ray-induced mutations at molecular levels are similar to those spontaneously occurring. (author)

  2. Gene Prioritization by Integrated Analysis of Protein Structural and Network Topological Properties for the Protein-Protein Interaction Network of Neurological Disorders

    Directory of Open Access Journals (Sweden)

    Yashna Paul

    2016-01-01

    Full Text Available Neurological disorders are known to show similar phenotypic manifestations like anxiety, depression, and cognitive impairment. There is a need to identify shared genetic markers and molecular pathways in these diseases, which lead to such comorbid conditions. Our study aims to prioritize novel genetic markers that might increase the susceptibility of patients affected with one neurological disorder to other diseases with similar manifestations. Identification of pathways involving common candidate markers will help in the development of improved diagnosis and treatments strategies for patients affected with neurological disorders. This systems biology study for the first time integratively uses 3D-structural protein interface descriptors and network topological properties that characterize proteins in a neurological protein interaction network, to aid the identification of genes that are previously not known to be shared between these diseases. Results of protein prioritization by machine learning have identified known as well as new genetic markers which might have direct or indirect involvement in several neurological disorders. Important gene hubs have also been identified that provide an evidence for shared molecular pathways in the neurological disease network.

  3. SWPhylo - A Novel Tool for Phylogenomic Inferences by Comparison of Oligonucleotide Patterns and Integration of Genome-Based and Gene-Based Phylogenetic Trees.

    Science.gov (United States)

    Yu, Xiaoyu; Reva, Oleg N

    2018-01-01

    Modern phylogenetic studies may benefit from the analysis of complete genome sequences of various microorganisms. Evolutionary inferences based on genome-scale analysis are believed to be more accurate than the gene-based alternative. However, the computational complexity of current phylogenomic procedures, inappropriateness of standard phylogenetic tools to process genome-wide data, and lack of reliable substitution models which correlates with alignment-free phylogenomic approaches deter microbiologists from using these opportunities. For example, the super-matrix and super-tree approaches of phylogenomics use multiple integrated genomic loci or individual gene-based trees to infer an overall consensus tree. However, these approaches potentially multiply errors of gene annotation and sequence alignment not mentioning the computational complexity and laboriousness of the methods. In this article, we demonstrate that the annotation- and alignment-free comparison of genome-wide tetranucleotide frequencies, termed oligonucleotide usage patterns (OUPs), allowed a fast and reliable inference of phylogenetic trees. These were congruent to the corresponding whole genome super-matrix trees in terms of tree topology when compared with other known approaches including 16S ribosomal RNA and GyrA protein sequence comparison, complete genome-based MAUVE, and CVTree methods. A Web-based program to perform the alignment-free OUP-based phylogenomic inferences was implemented at http://swphylo.bi.up.ac.za/. Applicability of the tool was tested on different taxa from subspecies to intergeneric levels. Distinguishing between closely related taxonomic units may be enforced by providing the program with alignments of marker protein sequences, eg, GyrA.

  4. SWPhylo – A Novel Tool for Phylogenomic Inferences by Comparison of Oligonucleotide Patterns and Integration of Genome-Based and Gene-Based Phylogenetic Trees

    Science.gov (United States)

    Yu, Xiaoyu; Reva, Oleg N

    2018-01-01

    Modern phylogenetic studies may benefit from the analysis of complete genome sequences of various microorganisms. Evolutionary inferences based on genome-scale analysis are believed to be more accurate than the gene-based alternative. However, the computational complexity of current phylogenomic procedures, inappropriateness of standard phylogenetic tools to process genome-wide data, and lack of reliable substitution models which correlates with alignment-free phylogenomic approaches deter microbiologists from using these opportunities. For example, the super-matrix and super-tree approaches of phylogenomics use multiple integrated genomic loci or individual gene-based trees to infer an overall consensus tree. However, these approaches potentially multiply errors of gene annotation and sequence alignment not mentioning the computational complexity and laboriousness of the methods. In this article, we demonstrate that the annotation- and alignment-free comparison of genome-wide tetranucleotide frequencies, termed oligonucleotide usage patterns (OUPs), allowed a fast and reliable inference of phylogenetic trees. These were congruent to the corresponding whole genome super-matrix trees in terms of tree topology when compared with other known approaches including 16S ribosomal RNA and GyrA protein sequence comparison, complete genome-based MAUVE, and CVTree methods. A Web-based program to perform the alignment-free OUP-based phylogenomic inferences was implemented at http://swphylo.bi.up.ac.za/. Applicability of the tool was tested on different taxa from subspecies to intergeneric levels. Distinguishing between closely related taxonomic units may be enforced by providing the program with alignments of marker protein sequences, eg, GyrA. PMID:29511354

  5. Integration of sequence data from a Consanguineous family with genetic data from an outbred population identifies PLB1 as a candidate rheumatoid arthritis risk gene.

    Directory of Open Access Journals (Sweden)

    Yukinori Okada

    Full Text Available Integrating genetic data from families with highly penetrant forms of disease together with genetic data from outbred populations represents a promising strategy to uncover the complete frequency spectrum of risk alleles for complex traits such as rheumatoid arthritis (RA. Here, we demonstrate that rare, low-frequency and common alleles at one gene locus, phospholipase B1 (PLB1, might contribute to risk of RA in a 4-generation consanguineous pedigree (Middle Eastern ancestry and also in unrelated individuals from the general population (European ancestry. Through identity-by-descent (IBD mapping and whole-exome sequencing, we identified a non-synonymous c.2263G>C (p.G755R mutation at the PLB1 gene on 2q23, which significantly co-segregated with RA in family members with a dominant mode of inheritance (P = 0.009. We further evaluated PLB1 variants and risk of RA using a GWAS meta-analysis of 8,875 RA cases and 29,367 controls of European ancestry. We identified significant contributions of two independent non-coding variants near PLB1 with risk of RA (rs116018341 [MAF = 0.042] and rs116541814 [MAF = 0.021], combined P = 3.2 × 10(-6. Finally, we performed deep exon sequencing of PLB1 in 1,088 RA cases and 1,088 controls (European ancestry, and identified suggestive dispersion of rare protein-coding variant frequencies between cases and controls (P = 0.049 for C-alpha test and P = 0.055 for SKAT. Together, these data suggest that PLB1 is a candidate risk gene for RA. Future studies to characterize the full spectrum of genetic risk in the PLB1 genetic locus are warranted.

  6. Predicting protein-protein interactions in Arabidopsis thaliana through integration of orthology, gene ontology and co-expression

    Directory of Open Access Journals (Sweden)

    Vandepoele Klaas

    2009-06-01

    Full Text Available Abstract Background Large-scale identification of the interrelationships between different components of the cell, such as the interactions between proteins, has recently gained great interest. However, unraveling large-scale protein-protein interaction maps is laborious and expensive. Moreover, assessing the reliability of the interactions can be cumbersome. Results In this study, we have developed a computational method that exploits the existing knowledge on protein-protein interactions in diverse species through orthologous relations on the one hand, and functional association data on the other hand to predict and filter protein-protein interactions in Arabidopsis thaliana. A highly reliable set of protein-protein interactions is predicted through this integrative approach making use of existing protein-protein interaction data from yeast, human, C. elegans and D. melanogaster. Localization, biological process, and co-expression data are used as powerful indicators for protein-protein interactions. The functional repertoire of the identified interactome reveals interactions between proteins functioning in well-conserved as well as plant-specific biological processes. We observe that although common mechanisms (e.g. actin polymerization and components (e.g. ARPs, actin-related proteins exist between different lineages, they are active in specific processes such as growth, cancer metastasis and trichome development in yeast, human and Arabidopsis, respectively. Conclusion We conclude that the integration of orthology with functional association data is adequate to predict protein-protein interactions. Through this approach, a high number of novel protein-protein interactions with diverse biological roles is discovered. Overall, we have predicted a reliable set of protein-protein interactions suitable for further computational as well as experimental analyses.

  7. Deciphering the Correlation between Breast Tumor Samples and Cell Lines by Integrating Copy Number Changes and Gene Expression Profiles

    Directory of Open Access Journals (Sweden)

    Yi Sun

    2015-01-01

    Full Text Available Breast cancer is one of the most common cancers with high incident rate and high mortality rate worldwide. Although different breast cancer cell lines were widely used in laboratory investigations, accumulated evidences have indicated that genomic differences exist between cancer cell lines and tissue samples in the past decades. The abundant molecular profiles of cancer cell lines and tumor samples deposited in the Cancer Cell Line Encyclopedia and The Cancer Genome Atlas now allow a systematical comparison of the breast cancer cell lines with breast tumors. We depicted the genomic characteristics of breast primary tumors based on the copy number variation and gene expression profiles and the breast cancer cell lines were compared to different subgroups of breast tumors. We identified that some of the breast cancer cell lines show high correlation with the tumor group that agrees with previous knowledge, while a big part of them do not, including the most used MCF7, MDA-MB-231, and T-47D. We presented a computational framework to identify cell lines that mostly resemble a certain tumor group for the breast tumor study. Our investigation presents a useful guide to bridge the gap between cell lines and tumors and helps to select the most suitable cell line models for personalized cancer studies.

  8. Integrating Morphology, Breeding Ground and Mitochondrial COI Gene Analysis for Species Identification of Bellamya lithophaga (Gastropoda: Viviparidae in China.

    Directory of Open Access Journals (Sweden)

    Youzhu Cheng

    2014-06-01

    Full Text Available Angiostrongylus cantonensis is a zoonotic public health concern that causes human severe eosinophilic meningitis in Southeast Asia and China. As a medically important intermediate host of A. cantonensis, Bellamya lithophaga (Gastropoda: Viviparidae is often confused with other morphologically similar sibling species of genus Bellamya, such as B. aeruginosa and B. purificata in the past. Hence, the aim of the present study was to investigate evidences to discriminate these equivocal Bellamya species.This study was carried out by getting Bellamya snail samples from Fujian Province in the South-East of China. The snail morphological features, breeding grounds and phylogenetic relationship according to mitochondrial cytochrome c oxidase subunit I (COI gene marker were analyzed.Based on external morphology, radular shape and cusp formula, as well as major breeding environment, B. lithophaga could be distinguished from B. aeruginosa, B. purificata. The phylogenetic tree also unconfirmed that B. lithophaga belongs to a different genetic clade from other morphologically similar species.Our findings demonstrate the significant differences in B. lithophaga and other sibling species, which supports the traditional species delimitation in the genus Bellamya.

  9. Cutting the canopy to defeat the "selfish gene"; conflicting selection pressures for the integration of phototrophy in mixotrophic protists.

    Science.gov (United States)

    Flynn, Kevin J; Hansen, Per Juel

    2013-11-01

    In strict photoautotrophs, and in many mixotrophic protists, growth at low light stimulates the increased content of photopigment. This photoacclimation further elevates cellular Chl:C content through positive feedback (self-shading), until cellular Chl:C attains a maximum (ChlC(max)). This process, driven by the "selfish gene", enhances the fitness of the individual but decreases total population growth potential through community self-shading. However, some mixotrophic protists (generalist non-constitutives; GNC-mixotrophs) acquire their photosystems ready-made from phototrophic prey but they have no regulatory control on the acquired photosystems. When light is limiting, such organisms cannot photoacclimate; their total Chl:C ratio falls as their acquired photosystems are divided amongst daughter cells and also as the photosystems fail. We show that during that process, and with the removal (consumption) of their individually more efficient phototrophic prey, there is potential for populations of GNC-mixotrophs to become more efficient at light harvesting. Through this process these organisms may retain a critical additional period of photosynthetic capacity. Together with the fact that the acquired photosystem biomass can be potentially almost entirely converted into mixotroph biomass (while chloroplasts must remain an important component of biomass in constitutive mixotrophs, with an associated investment), this may help explain the success of GNC-mixotrophs. Copyright © 2013 Elsevier GmbH. All rights reserved.

  10. Genes Linked to Endometriosis by GWAS Are Integral to Cytoskeleton Regulation and Suggests That Mesothelial Barrier Homeostasis Is a Factor in the Pathogenesis of Endometriosis.

    Science.gov (United States)

    Albertsen, Hans M; Ward, Kenneth

    2017-06-01

    Endometriosis, defined by the presence of ectopic endometrial lesions, is a common disease in reproductive-age women that profoundly affects patients' quality of life. Various pathogenic models have been proposed, but the origin of endometriosis remains elusive. In this article, we propose that the mesothelial barrier, which protects the underlying stroma from endometrial transplants present in retrograde menstrual fluid, can be compromised by activation of the epithelial to mesenchymal transition (EMT) repair mechanism that lead to temporary loss of barrier integrity. Absent of the mesothelial barrier, endometrial cells can more readily adhere to the underlying peritoneal stroma and establish endometrial lesions. The hypothesis is based on the clinical and experimental observations that correlate the location of endometrial lesions with areas of mesothelial damage, together with genetic evidence that 4 genes associated with endometriosis are direct regulators of the actin-cytoskeleton, which coordinates mesothelial barrier integrity. It supports past observations that implicate the peritoneum in the pathogenesis of endometriosis and unifies previously disparate theories that endometriosis may be triggered by infection, mechanical damage, and inflammation since each of these mechanisms can induce EMT in the mesothelium. If the hypothesis is correct, inhibition of EMT in the mesothelial barrier provides a novel paradigm for the prevention and treatment of endometriosis.

  11. An integrative data analysis platform for gene set analysis and knowledge discovery in a data warehouse framework.

    Science.gov (United States)

    Chen, Yi-An; Tripathi, Lokesh P; Mizuguchi, Kenji

    2016-01-01

    Data analysis is one of the most critical and challenging steps in drug discovery and disease biology. A user-friendly resource to visualize and analyse high-throughput data provides a powerful medium for both experimental and computational biologists to understand vastly different biological data types and obtain a concise, simplified and meaningful output for better knowledge discovery. We have previously developed TargetMine, an integrated data warehouse optimized for target prioritization. Here we describe how upgraded and newly modelled data types in TargetMine can now survey the wider biological and chemical data space, relevant to drug discovery and development. To enhance the scope of TargetMine from target prioritization to broad-based knowledge discovery, we have also developed a new auxiliary toolkit to assist with data analysis and visualization in TargetMine. This toolkit features interactive data analysis tools to query and analyse the biological data compiled within the TargetMine data warehouse. The enhanced system enables users to discover new hypotheses interactively by performing complicated searches with no programming and obtaining the results in an easy to comprehend output format. Database URL: http://targetmine.mizuguchilab.org. © The Author(s) 2016. Published by Oxford University Press.

  12. Integrative genomic approaches to dissect clinically-significant relationships between the VDR cistrome and gene expression in primary colon cancer.

    Science.gov (United States)

    Long, Mark D; Campbell, Moray J

    2017-10-01

    Recently, we undertook a pan-cancer analyses of the nuclear hormone receptor (NR) superfamily in The Cancer Genome Atlas (TCGA), and revealed that the vitamin D receptor (NR1I1/VDR) was commonly and significantly down-regulated specifically in colon adenocarcinoma cohort (COAD). To examine the consequence of down-regulated VDR expression we re-analyzed VDR chromatin immunoprecipitation sequencing (ChIP-Seq) data from LS180 colon cancer cells (GSE31939). This analysis identified 1809 loci that displayed significant (p.adjcolon tumor suppressor, Galactin 4) had significantly shorted disease free survival. These analyses suggest that reduced expression of VDR in colon cancer (but neither loss nor mutation) changes the actions of the VDR by both dampening the expression of tumor suppressors (e.g. LGALS4) whilst either stabilizing or not down-regulating expression of oncogenes (e.g. Carbonic Anhydrase 9 (CA9)). These integrative genomic approaches are relatively generic and applicable to the study of any transcription factor. Copyright © 2016. Published by Elsevier Ltd.

  13. Deep Sequence Analysis of Non-Small Cell Lung Cancer: Integrated Analysis of Gene Expression, Alternative Splicing, and Single Nucleotide Variations in Lung Adenocarcinomas with and without Oncogenic KRAS Mutations

    International Nuclear Information System (INIS)

    Kalari, Krishna R.; Rossell, David; Necela, Brian M.; Asmann, Yan W.; Nair, Asha

    2012-01-01

    KRAS mutations are highly prevalent in non-small cell lung cancer (NSCLC), and tumors harboring these mutations tend to be aggressive and resistant to chemotherapy. We used next-generation sequencing technology to identify pathways that are specifically altered in lung tumors harboring a KRAS mutation. Paired-end RNA-sequencing of 15 primary lung adenocarcinoma tumors (8 harboring mutant KRAS and 7 with wild-type KRAS) were performed. Sequences were mapped to the human genome, and genomic features, including differentially expressed genes, alternate splicing isoforms and single nucleotide variants, were determined for tumors with and without KRAS mutation using a variety of computational methods. Network analysis was carried out on genes showing differential expression (374 genes), alternate splicing (259 genes), and SNV-related changes (65 genes) in NSCLC tumors harboring a KRAS mutation. Genes exhibiting two or more connections from the lung adenocarcinoma network were used to carry out integrated pathway analysis. The most significant signaling pathways identified through this analysis were the NFκB, ERK1/2, and AKT pathways. A 27 gene mutant KRAS-specific sub network was extracted based on gene–gene connections from the integrated network, and interrogated for druggable targets. Our results confirm previous evidence that mutant KRAS tumors exhibit activated NFκB, ERK1/2, and AKT pathways and may be preferentially sensitive to target therapeutics toward these pathways. In addition, our analysis indicates novel, previously unappreciated links between mutant KRAS and the TNFR and PPARγ signaling pathways, suggesting that targeted PPARγ antagonists and TNFR inhibitors may be useful therapeutic strategies for treatment of mutant KRAS lung tumors. Our study is the first to integrate genomic features from RNA-Seq data from NSCLC and to define a first draft genomic landscape model that is unique to tumors with oncogenic KRAS mutations.

  14. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  15. Integrative Analyses of Hepatic Differentially Expressed Genes and Blood Biomarkers during the Peripartal Period between Dairy Cows Overfed or Restricted-Fed Energy Prepartum

    Science.gov (United States)

    Shahzad, Khuram; Bionaz, Massimo; Trevisi, Erminio; Bertoni, Giuseppe; Rodriguez-Zas, Sandra L.; Loor, Juan J.

    2014-01-01

    Using published dairy cattle liver transcriptomics dataset along with novel blood biomarkers of liver function, metabolism, and inflammation we have attempted an integrative systems biology approach applying the classical functional enrichment analysis using DAVID, a newly-developed Dynamic Impact Approach (DIA), and an upstream gene network analysis using Ingenuity Pathway Analysis (IPA). Transcriptome data was generated from experiments evaluating the impact of prepartal plane of energy intake [overfed (OF) or restricted (RE)] on liver of dairy cows during the peripartal period. Blood biomarkers uncovered that RE vs. OF led to greater prepartal liver distress accompanied by a low-grade inflammation and larger proteolysis (i.e., higher haptoglobin, bilirubin, and creatinine). Post-partum the greater bilirubinaemia and lipid accumulation in OF vs. RE indicated a large degree of liver distress. The re-analysis of microarray data revealed that expression of >4,000 genes was affected by diet × time. The bioinformatics analysis indicated that RE vs. OF cows had a liver with a greater lipid and amino acid catabolic capacity both pre- and post-partum while OF vs. RE cows had a greater activation of pathways/functions related to triglyceride synthesis. Furthermore, RE vs. OF cows had a larger (or higher capacity to cope with) ER stress likely associated with greater protein synthesis/processing, and a higher activation of inflammatory-related functions. Liver in OF vs. RE cows had a larger cell proliferation and cell-to-cell communication likely as a response to the greater lipid accumulation. Analysis of upstream regulators indicated a pivotal role of several lipid-related transcription factors (e.g., PPARs, SREBPs, and NFE2L2) in priming the liver of RE cows to better face the early postpartal metabolic and inflammatory challenges. An all-encompassing dynamic model was proposed based on the findings. PMID:24914544

  16. Gene-Culture Coevolution in a Social Cetacean: Integrating Acoustic and Genetic Data to Understand Population Structure in the Short-Finned Pilot Whale (Globicephala macrorhynchus)

    Science.gov (United States)

    Van Cise, Amy

    The evolutionary ecology of a species is driven by a combination of random events, ecological and environmental mechanisms, and social behavior. Gene-culture coevolutionary theory attempts to understand the evolutionary trajectory of a species by examining the interactions between these potential drivers. Further, our choice of data type will affect the patterns we observe, therefore by integrating several types of data we achieve a holistic understanding of the various aspects of evolutionary ecology within a species. In order to understand population structure in short-finned pilot whales, I use a combination of genetic and acoustic data to examine structure on evolutionary (genetic) and cultural (acoustic) timescales. I first examine structure among geographic populations in the Pacific Ocean. Using genetic sequences from the mitochondrial control region, I show that two genetically and morphologically distinct types of short-finned pilot whale, described off the coast of Japan, have non-overlapping distributions throughout their range in the Pacific Ocean. Analysis of the acoustic features of their social calls indicates that they are acoustically differentiated, possibly due to limited communication between the two types. This evidence supports the hypothesis that the two types may be separate species or subspecies. Next, I examine structure among island communities and social groups within the Hawaiian Island population of short-finned pilot whales. Using a combination of mitochondrial and nuclear DNA, I showed that the hierarchical social structure in Hawaiian pilot whales is driven by genetic relatedness; individuals remain in groups with their immediate family members, and preferentially associate with relatives. Similarly, social structure affects genetic differentiation, likely by restricting access to mates. Acoustic differentiation among social groups indicates that social structure may also restrict the flow of cultural information, such as vocal

  17. A Wheat SIMILAR TO RCD-ONE Gene Enhances Seedling Growth and Abiotic Stress Resistance by Modulating Redox Homeostasis and Maintaining Genomic Integrity[C][W

    Science.gov (United States)

    Liu, Shuantao; Liu, Shuwei; Wang, Mei; Wei, Tiandi; Meng, Chen; Wang, Meng; Xia, Guangmin

    2014-01-01

    Plant growth inhibition is a common response to salinity. Under saline conditions, Shanrong No. 3 (SR3), a bread wheat (Triticum aestivum) introgression line, performs better than its parent wheat variety Jinan 177 (JN177) with respect to both seedling growth and abiotic stress tolerance. Furthermore, the endogenous reactive oxygen species (ROS) was also elevated in SR3 relative to JN177. The SR3 allele of sro1, a gene encoding a poly(ADP ribose) polymerase (PARP) domain protein, was identified to be crucial for both aspects of its superior performance. Unlike RADICAL-INDUCED CELL DEATH1 and other Arabidopsis thaliana SIMILAR TO RCD-ONE (SRO) proteins, sro1 has PARP activity. Both the overexpression of Ta-sro1 in wheat and its heterologous expression in Arabidopsis promote the accumulation of ROS, mainly by enhancing the activity of NADPH oxidase and the expression of NAD(P)H dehydrogenase, in conjunction with the suppression of alternative oxidase expression. Moreover, it promotes the activity of ascorbate-GSH cycle enzymes and GSH peroxidase cycle enzymes, which regulate ROS content and cellular redox homeostasis. sro1 is also found to be involved in the maintenance of genomic integrity. We show here that the wheat SRO has PARP activity; such activity could be manipulated to improve the growth of seedlings exposed to salinity stress by modulating redox homeostasis and maintaining genomic stability. PMID:24443520

  18. Clinical and cytogenetic features of a population-based consecutive series of 285 pediatric T-cell acute lymphoblastic leukemias: rare T-cell receptor gene rearrangements are associated with poor outcome

    DEFF Research Database (Denmark)

    Karrman, Kristina; Forestier, Erik; Heyman, Mats

    2009-01-01

    -cell receptor (TCR) gene rearrangements (20%) [TCR;11p13 (10%), TCR;10q24 (3%), TCR;other (8%)], del(9p) (17%), +8 (14%), del(6q) (12%), and 11q23 rearrangements (6%). The TCR;other group comprised the rare rearrangements t(X;14)(p11;q11), t(X;7)(q22;q34), t(1;14)(p32;q11), ins(14;5)(q11;q?q?), inv(7)(p15q34....... In a multivariate analysis, two factors affected negatively the EFS, namely a WBC count of > or =200 x 10(9)/l (P rearrangements (P = 0.001). In conclusion, in this large series of childhood T-ALLs from the Nordic countries, the cytogenetic findings were not associated...

  19. Integrated Network Analysis Identifies Fight-Club Nodes as a Class of Hubs Encompassing Key Putative Switch Genes That Induce Major Transcriptome Reprogramming during Grapevine Development[W][OPEN

    Science.gov (United States)

    Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

    2014-01-01

    We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named “fight-club hubs” characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named “switch genes” was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. PMID:25490918

  20. Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells

    Science.gov (United States)

    Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Lu, Fengmin

    2017-01-01

    Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis‐activate the expression of proto‐oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV‐integrated haplotype, and a long‐range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long‐range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence‐associated acidic β‐gal activity in HeLa cells. These data indicate a long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. PMID:28470669

  1. Long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele-specific MYC expression in HeLa cells.

    Science.gov (United States)

    Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Chen, Xiangmei; Lu, Fengmin

    2017-08-01

    Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis-activate the expression of proto-oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV-integrated haplotype, and a long-range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long-range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence-associated acidic β-gal activity in HeLa cells. These data indicate a long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  2. A novel growth hormone receptor gene deletion mutation in a patient with primary growth hormone insensitivity syndrome (Laron syndrome).

    Science.gov (United States)

    Yamamoto, Hiroyasu; Kouhara, Haruhiko; Iida, Keiji; Chihara, Kazuo; Kasayama, Soji

    2008-04-01

    Growth hormone (GH) insensitivity syndrome (Laron syndrome) is known to be caused by genetic disorders of the GH-IGF-1 axis. Although many mutations in the GH receptor have been identified, there have been only a few reports of deletions of the GH receptor gene. A Japanese adult female patient with Laron syndrome was subjected to chromosome analysis with basic G-banding and also with a high accuracy technique. Each exon of the GH receptor gene was amplified by means of PCR. Since this patient was diagnosed with osteoporosis, the effects of alendronate on bone mineral density (BMD) were also examined. The chromosome analysis with the high accuracy technique demonstrated a large deletion of the short arm in one allele of chromosome 5 from p11 to p13.1 [46, XX, del (5) (p11-p13.1)]. PCR amplification of exons of the GH receptor gene showed that only exons 2 and 3 were amplified. Low-dose IGF-1 administration (30microg/kg body weight) failed to increase her BMD, whereas alendronate administration resulted in an increase associated with a decrease in urinary deoxypyridinoline (DPD) and serum osteocalcin concentrations. The GH receptor gene of the patient was shown to lack exons 4-10. To the best of our knowledge, this is the third case report of Laron syndrome with large GH receptor deletion. Alendronate was effective for the enhancement of BMD.

  3. Network-Based Integration of GWAS and Gene Expression Identifies a HOX-Centric Network Associated with Serous Ovarian Cancer Risk

    DEFF Research Database (Denmark)

    Kar, Siddhartha P; Tyrer, Jonathan P; Li, Qiyuan

    2015-01-01

    BACKGROUND: Genome-wide association studies (GWAS) have so far reported 12 loci associated with serous epithelial ovarian cancer (EOC) risk. We hypothesized that some of these loci function through nearby transcription factor (TF) genes and that putative target genes of these TFs as identified...... in the unified microarray dataset of 489 serous EOC tumors from The Cancer Genome Atlas. Genes represented in this dataset were subsequently ranked using a gene-level test based on results for germline SNPs from a serous EOC GWAS meta-analysis (2,196 cases/4,396 controls). RESULTS: Gene set enrichment analysis...

  4. Integration of liver gene co-expression networks and eGWAs analyses highlighted candidate regulators implicated in lipid metabolism in pigs.

    Science.gov (United States)

    Ballester, Maria; Ramayo-Caldas, Yuliaxis; Revilla, Manuel; Corominas, Jordi; Castelló, Anna; Estellé, Jordi; Fernández, Ana I; Folch, Josep M

    2017-04-19

    In the present study, liver co-expression networks and expression Genome Wide Association Study (eGWAS) were performed to identify DNA variants and molecular pathways implicated in the functional regulatory mechanisms of meat quality traits in pigs. With this purpose, the liver mRNA expression of 44 candidates genes related with lipid metabolism was analysed in 111 Iberian x Landrace backcross animals. The eGWAS identified 92 eSNPs located in seven chromosomal regions and associated with eight genes: CROT, CYP2U1, DGAT1, EGF, FABP1, FABP5, PLA2G12A, and PPARA. Remarkably, cis-eSNPs associated with FABP1 gene expression which may be determining the C18:2(n-6)/C18:3(n-3) ratio in backfat through the multiple interaction of DNA variants and genes were identified. Furthermore, a hotspot on SSC8 associated with the gene expression of eight genes was identified and the TBCK gene was pointed out as candidate gene regulating it. Our results also suggested that the PI3K-Akt-mTOR pathway plays an important role in the control of the analysed genes highlighting nuclear receptors as the NR3C1 or PPARA. Finally, sex-dimorphism associated with hepatic lipid metabolism was identified with over-representation of female-biased genes. These results increase our knowledge of the genetic architecture underlying fat composition traits.

  5. Genetic control of functional traits related to photosynthesis and water use efficiency in Pinus pinaster Ait. drought response: integration of genome annotation, allele association and QTL detection for candidate gene identification.

    Science.gov (United States)

    de Miguel, Marina; Cabezas, José-Antonio; de María, Nuria; Sánchez-Gómez, David; Guevara, María-Ángeles; Vélez, María-Dolores; Sáez-Laguna, Enrique; Díaz, Luis-Manuel; Mancha, Jose-Antonio; Barbero, María-Carmen; Collada, Carmen; Díaz-Sala, Carmen; Aranda, Ismael; Cervera, María-Teresa

    2014-06-12

    Understanding molecular mechanisms that control photosynthesis and water use efficiency in response to drought is crucial for plant species from dry areas. This study aimed to identify QTL for these traits in a Mediterranean conifer and tested their stability under drought. High density linkage maps for Pinus pinaster were used in the detection of QTL for photosynthesis and water use efficiency at three water irrigation regimes. A total of 28 significant and 27 suggestive QTL were found. QTL detected for photochemical traits accounted for the higher percentage of phenotypic variance. Functional annotation of genes within the QTL suggested 58 candidate genes for the analyzed traits. Allele association analysis in selected candidate genes showed three SNPs located in a MYB transcription factor that were significantly associated with efficiency of energy capture by open PSII reaction centers and specific leaf area. The integration of QTL mapping of functional traits, genome annotation and allele association yielded several candidate genes involved with molecular control of photosynthesis and water use efficiency in response to drought in a conifer species. The results obtained highlight the importance of maintaining the integrity of the photochemical machinery in P. pinaster drought response.

  6. Multi-Omics and Integrated Network Analyses Reveal New Insights into the Systems Relationships between Metabolites, Structural Genes, and Transcriptional Regulators in Developing Grape Berries (Vitis vinifera L. Exposed to Water Deficit

    Directory of Open Access Journals (Sweden)

    Stefania Savoi

    2017-07-01

    Full Text Available Grapes are one of the major fruit crops and they are cultivated in many dry environments. This study comprehensively characterizes the metabolic response of grape berries exposed to water deficit at different developmental stages. Increases of proline, branched-chain amino acids, phenylpropanoids, anthocyanins, and free volatile organic compounds have been previously observed in grape berries exposed to water deficit. Integrating RNA-sequencing analysis of the transcriptome with large-scale analysis of central and specialized metabolites, we reveal that these increases occur via a coordinated regulation of key structural pathway genes. Water deficit-induced up-regulation of flavonoid genes is also coordinated with the down-regulation of many stilbene synthases and a consistent decrease in stilbenoid concentration. Water deficit activated both ABA-dependent and ABA-independent signal transduction pathways by modulating the expression of several transcription factors. Gene-gene and gene-metabolite network analyses showed that water deficit-responsive transcription factors such as bZIPs, AP2/ERFs, MYBs, and NACs are implicated in the regulation of stress-responsive metabolites. Enrichment of known and novel cis-regulatory elements in the promoters of several ripening-specific/water deficit-induced modules further affirms the involvement of a transcription factor cross-talk in the berry response to water deficit. Together, our integrated approaches show that water deficit-regulated gene modules are strongly linked to key fruit-quality metabolites and multiple signal transduction pathways may be critical to achieve a balance between the regulation of the stress-response and the berry ripening program. This study constitutes an invaluable resource for future discoveries and comparative studies, in grapes and other fruits, centered on reproductive tissue metabolism under abiotic stress.

  7. Multi-Omics and Integrated Network Analyses Reveal New Insights into the Systems Relationships between Metabolites, Structural Genes, and Transcriptional Regulators in Developing Grape Berries (Vitis vinifera L.) Exposed to Water Deficit.

    Science.gov (United States)

    Savoi, Stefania; Wong, Darren C J; Degu, Asfaw; Herrera, Jose C; Bucchetti, Barbara; Peterlunger, Enrico; Fait, Aaron; Mattivi, Fulvio; Castellarin, Simone D

    2017-01-01

    Grapes are one of the major fruit crops and they are cultivated in many dry environments. This study comprehensively characterizes the metabolic response of grape berries exposed to water deficit at different developmental stages. Increases of proline, branched-chain amino acids, phenylpropanoids, anthocyanins, and free volatile organic compounds have been previously observed in grape berries exposed to water deficit. Integrating RNA-sequencing analysis of the transcriptome with large-scale analysis of central and specialized metabolites, we reveal that these increases occur via a coordinated regulation of key structural pathway genes. Water deficit-induced up-regulation of flavonoid genes is also coordinated with the down-regulation of many stilbene synthases and a consistent decrease in stilbenoid concentration. Water deficit activated both ABA-dependent and ABA-independent signal transduction pathways by modulating the expression of several transcription factors. Gene-gene and gene-metabolite network analyses showed that water deficit-responsive transcription factors such as bZIPs, AP2/ERFs, MYBs, and NACs are implicated in the regulation of stress-responsive metabolites. Enrichment of known and novel cis -regulatory elements in the promoters of several ripening-specific/water deficit-induced modules further affirms the involvement of a transcription factor cross-talk in the berry response to water deficit. Together, our integrated approaches show that water deficit-regulated gene modules are strongly linked to key fruit-quality metabolites and multiple signal transduction pathways may be critical to achieve a balance between the regulation of the stress-response and the berry ripening program. This study constitutes an invaluable resource for future discoveries and comparative studies, in grapes and other fruits, centered on reproductive tissue metabolism under abiotic stress.

  8. Integrative genomics approaches validate PpYUC11-like as candidate gene for the stony hard trait in peach (P. persica L. Batsch).

    Science.gov (United States)

    Cirilli, Marco; Giovannini, Daniela; Ciacciulli, Angelo; Chiozzotto, Remo; Gattolin, Stefano; Rossini, Laura; Liverani, Alessandro; Bassi, Daniele

    2018-05-18

    Texture is one of the most important fruit quality attributes. In peach, stony hard (SH) is a recessive monogenic trait (hd/hd) that confers exceptionally prolonged firm flesh to fully ripe fruit. Previous studies have shown that the SH mutation affects the fruit ability to synthesize appropriate amounts of indol-3-acetic acid (IAA), which orchestrates the ripening processes through the activation of system 2 ethylene pathway. Allelic variation in a TC microsatellite located within the first intron of PpYUC11-like (a YUCCA-like auxin-biosynthesis gene) has been recently proposed as the causal mutation of the SH phenotype. The simple genetic determinism of the SH trait has been clarified through genome-wide association and LD analyses in a diverse set of accessions, restricting the hd locus to an interval of about 1.8 Mbp in chromosome 6. The comparison of fruit transcriptome data from non-SH (melting flesh) and SH accessions provided an expression patterns overview of the annotated transcripts within the hd locus, confirming the absence of PpYUC11-like expression in SH fruits. To explore further possible associations between genomic variants at the hd locus and the SH phenotype, re-sequencing data of the SH accession 'D41-62' were compared with several SH and non-SH accessions with different genetic backgrounds. A further step of validation was provided through the evaluation of variant-trait association in two bi-parental F 2 populations issued from the SH accession 'D41-62' and a panel of advanced breeding selections, showing perfect co-segregation of the PpYUC11-like intron TC 20 allele and the SH phenotype. In this study, we provide a multi-level validation of the genetic control of the SH trait through the integration of genome-wide association mapping, transcriptome analysis and whole-genome resequencing data for SH and non-SH accessions, and marker-trait association in a panel of advanced breeding selections and segregating progenies. Collectively, our data

  9. Integrated Enrichment Analysis of Variants and Pathways in Genome-Wide Association Studies Indicates Central Role for IL-2 Signaling Genes in Type 1 Diabetes, and Cytokine Signaling Genes in Crohn's Disease

    Science.gov (United States)

    Carbonetto, Peter; Stephens, Matthew

    2013-01-01

    Pathway analyses of genome-wide association studies aggregate information over sets of related genes, such as genes in common pathways, to identify gene sets that are enriched for variants associated with disease. We develop a model-based approach to pathway analysis, and apply this approach to data from the Wellcome Trust Case Control Consortium (WTCCC) studies. Our method offers several benefits over existing approaches. First, our method not only interrogates pathways for enrichment of disease associations, but also estimates the level of enrichment, which yields a coherent way to promote variants in enriched pathways, enhancing discovery of genes underlying disease. Second, our approach allows for multiple enriched pathways, a feature that leads to novel findings in two diseases where the major histocompatibility complex (MHC) is a major determinant of disease susceptibility. Third, by modeling disease as the combined effect of multiple markers, our method automatically accounts for linkage disequilibrium among variants. Interrogation of pathways from eight pathway databases yields strong support for enriched pathways, indicating links between Crohn's disease (CD) and cytokine-driven networks that modulate immune responses; between rheumatoid arthritis (RA) and “Measles” pathway genes involved in immune responses triggered by measles infection; and between type 1 diabetes (T1D) and IL2-mediated signaling genes. Prioritizing variants in these enriched pathways yields many additional putative disease associations compared to analyses without enrichment. For CD and RA, 7 of 8 additional non-MHC associations are corroborated by other studies, providing validation for our approach. For T1D, prioritization of IL-2 signaling genes yields strong evidence for 7 additional non-MHC candidate disease loci, as well as suggestive evidence for several more. Of the 7 strongest associations, 4 are validated by other studies, and 3 (near IL-2 signaling genes RAF1, MAPK14

  10. Integrative analysis of deep sequencing data identifies estrogen receptor early response genes and links ATAD3B to poor survival in breast cancer.

    Directory of Open Access Journals (Sweden)

    Kristian Ovaska

    Full Text Available Identification of responsive genes to an extra-cellular cue enables characterization of pathophysiologically crucial biological processes. Deep sequencing technologies provide a powerful means to identify responsive genes, which creates a need for computational methods able to analyze dynamic and multi-level deep sequencing data. To answer this need we introduce here a data-driven algorithm, SPINLONG, which is designed to search for genes that match the user-defined hypotheses or models. SPINLONG is applicable to various experimental setups measuring several molecular markers in parallel. To demonstrate the SPINLONG approach, we analyzed ChIP-seq data reporting PolII, estrogen receptor α (ERα, H3K4me3 and H2A.Z occupancy at five time points in the MCF-7 breast cancer cell line after estradiol stimulus. We obtained 777 ERa early responsive genes and compared the biological functions of the genes having ERα binding within 20 kb of the transcription start site (TSS to genes without such binding site. Our results show that the non-genomic action of ERα via the MAPK pathway, instead of direct ERa binding, may be responsible for early cell responses to ERα activation. Our results also indicate that the ERα responsive genes triggered by the genomic pathway are transcribed faster than those without ERα binding sites. The survival analysis of the 777 ERα responsive genes with 150 primary breast cancer tumors and in two independent validation cohorts indicated the ATAD3B gene, which does not have ERα binding site within 20 kb of its TSS, to be significantly associated with poor patient survival.

  11. Radiogenomics of hepatocellular carcinoma: multiregion analysis-based identification of prognostic imaging biomarkers by integrating gene data—a preliminary study

    Science.gov (United States)

    Xia, Wei; Chen, Ying; Zhang, Rui; Yan, Zhuangzhi; Zhou, Xiaobo; Zhang, Bo; Gao, Xin

    2018-02-01

    Our objective was to identify prognostic imaging biomarkers for hepatocellular carcinoma in contrast-enhanced computed tomography (CECT) with biological interpretations by associating imaging features and gene modules. We retrospectively analyzed 371 patients who had gene expression profiles. For the 38 patients with CECT imaging data, automatic intra-tumor partitioning was performed, resulting in three spatially distinct subregions. We extracted a total of 37 quantitative imaging features describing intensity, geometry, and texture from each subregion. Imaging features were selected after robustness and redundancy analysis. Gene modules acquired from clustering were chosen for their prognostic significance. By constructing an association map between imaging features and gene modules with Spearman rank correlations, the imaging features that significantly correlated with gene modules were obtained. These features were evaluated with Cox’s proportional hazard models and Kaplan-Meier estimates to determine their prognostic capabilities for overall survival (OS). Eight imaging features were significantly correlated with prognostic gene modules, and two of them were associated with OS. Among these, the geometry feature volume fraction of the subregion, which was significantly correlated with all prognostic gene modules representing cancer-related interpretation, was predictive of OS (Cox p  =  0.022, hazard ratio  =  0.24). The texture feature cluster prominence in the subregion, which was correlated with the prognostic gene module representing lipid metabolism and complement activation, also had the ability to predict OS (Cox p  =  0.021, hazard ratio  =  0.17). Imaging features depicting the volume fraction and textural heterogeneity in subregions have the potential to be predictors of OS with interpretable biological meaning.

  12. Integrative genome-wide gene expression profiling of clear cell renal cell carcinoma in Czech Republic and in the United States.

    Directory of Open Access Journals (Sweden)

    Magdalena B Wozniak

    Full Text Available Gene expression microarray and next generation sequencing efforts on conventional, clear cell renal cell carcinoma (ccRCC have been mostly performed in North American and Western European populations, while the highest incidence rates are found in Central/Eastern Europe. We conducted whole-genome expression profiling on 101 pairs of ccRCC tumours and adjacent non-tumour renal tissue from Czech patients recruited within the "K2 Study", using the Illumina HumanHT-12 v4 Expression BeadChips to explore the molecular variations underlying the biological and clinical heterogeneity of this cancer. Differential expression analysis identified 1650 significant probes (fold change ≥2 and false discovery rate <0.05 mapping to 630 up- and 720 down-regulated unique genes. We performed similar statistical analysis on the RNA sequencing data of 65 ccRCC cases from the Cancer Genome Atlas (TCGA project and identified 60% (402 of the downregulated and 74% (469 of the upregulated genes found in the K2 series. The biological characterization of the significantly deregulated genes demonstrated involvement of downregulated genes in metabolic and catabolic processes, excretion, oxidation reduction, ion transport and response to chemical stimulus, while simultaneously upregulated genes were associated with immune and inflammatory responses, response to hypoxia, stress, wounding, vasculature development and cell activation. Furthermore, genome-wide DNA methylation analysis of 317 TCGA ccRCC/adjacent non-tumour renal tissue pairs indicated that deregulation of approximately 7% of genes could be explained by epigenetic changes. Finally, survival analysis conducted on 89 K2 and 464 TCGA cases identified 8 genes associated with differential prognostic outcomes. In conclusion, a large proportion of ccRCC molecular characteristics were common to the two populations and several may have clinical implications when validated further through large clinical cohorts.

  13. Integrated analysis of miRNAs and transcriptomes in Aedes albopictus midgut reveals the differential expression profiles of immune-related genes during dengue virus serotype-2 infection.

    Science.gov (United States)

    Liu, Yan-Xia; Li, Fen-Xiang; Liu, Zhuan-Zhuan; Jia, Zhi-Rong; Zhou, Yan-He; Zhang, Hao; Yan, Hui; Zhou, Xian-Qiang; Chen, Xiao-Guang

    2016-06-01

    Mosquito microRNAs (miRNAs) are involved in host-virus interaction, and have been reported to be altered by dengue virus (DENV) infection in Aedes albopictus (Diptera: Culicidae). However, little is known about the molecular mechanisms of Aedes albopictus midgut-the first organ to interact with DENV-involved in its resistance to DENV. Here we used high-throughput sequencing to characterize miRNA and messenger RNA (mRNA) expression patterns in Aedes albopictus midgut in response to dengue virus serotype 2. A total of three miRNAs and 777 mRNAs were identified to be differentially expressed upon DENV infection. For the mRNAs, we identified 198 immune-related genes and 31 of them were differentially expressed. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses also showed that the differentially expressed immune-related genes were involved in immune response. Then the differential expression patterns of six immune-related genes and three miRNAs were confirmed by real-time reverse transcription polymerase chain reaction. Furthermore, seven known miRNA-mRNA interaction pairs were identified by aligning our two datasets. These analyses of miRNA and mRNA transcriptomes provide valuable information for uncovering the DENV response genes and provide a basis for future study of the resistance mechanisms in Aedes albopictus midgut. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  14. Integration of the blaNDM-1 carbapenemase gene into Proteus genomic island 1 (PGI1-PmPEL) in a Proteus mirabilis clinical isolate.

    Science.gov (United States)

    Girlich, Delphine; Dortet, Laurent; Poirel, Laurent; Nordmann, Patrice

    2015-01-01

    To decipher the mechanisms and their associated genetic determinants responsible for β-lactam resistance in a Proteus mirabilis clinical isolate. The entire genetic structure surrounding the β-lactam resistance genes was characterized by PCR, gene walking and DNA sequencing. Genes encoding the carbapenemase NDM-1 and the ESBL VEB-6 were located in a 38.5 kb MDR structure, which itself was inserted into a new variant of the Proteus genomic island 1 (PGI1). This new PGI1-PmPEL variant of 64.4 kb was chromosomally located, as an external circular form in the P. mirabilis isolate, suggesting potential mobility. This is the first known description of the bla(NDM-1) gene in a genomic island structure, which might further enhance the spread of the bla(NDM-1) carbapenemase gene among enteric pathogens. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. Integrative analysis and expression profiling of secondary cell wall genes in C4 biofuel model Setaria italica reveals targets for lignocellulose bioengineering

    Directory of Open Access Journals (Sweden)

    Mehanathan eMuthamilarasan

    2015-11-01

    Full Text Available Several underutilized grasses have excellent potential for use as bioenergy feedstock due to their lignocellulosic biomass. Genomic tools have enabled identification of lignocellulose biosynthesis genes in several sequenced plants. However, the non-availability of whole genome sequence of bioenergy grasses hinders the study on bioenergy genomics and their genomics-assisted crop improvement. Foxtail millet (Setaria italica L.; Si is a model crop for studying systems biology of bioenergy grasses. In the present study, a systematic approach has been used for identification of gene families involved in cellulose (CesA/Csl, callose (Gsl and monolignol biosynthesis (PAL, C4H, 4CL, HCT, C3H, CCoAOMT, F5H, COMT, CCR, CAD and construction of physical map of foxtail millet. Sequence alignment and phylogenetic analysis of identified proteins showed that monolignol biosynthesis proteins were highly diverse, whereas CesA/Csl and Gsl proteins were homologous to rice and Arabidopsis. Comparative mapping of foxtail millet lignocellulose biosynthesis genes with other C4 panicoid genomes revealed maximum homology with switchgrass, followed by sorghum and maize. Expression profiling of candidate lignocellulose genes in response to different abiotic stresses and hormone treatments showed their differential expression pattern, with significant higher expression of SiGsl12, SiPAL2, SiHCT1, SiF5H2 and SiCAD6 genes. Further, due to the evolutionary conservation of grass genomes, the insights gained from the present study could be extrapolated for identifying genes involved in lignocellulose biosynthesis in other biofuel species for further characterization.

  16. Integrative analysis and expression profiling of secondary cell wall genes in C4 biofuel model Setaria italica reveals targets for lignocellulose bioengineering.

    Science.gov (United States)

    Muthamilarasan, Mehanathan; Khan, Yusuf; Jaishankar, Jananee; Shweta, Shweta; Lata, Charu; Prasad, Manoj

    2015-01-01

    Several underutilized grasses have excellent potential for use as bioenergy feedstock due to their lignocellulosic biomass. Genomic tools have enabled identification of lignocellulose biosynthesis genes in several sequenced plants. However, the non-availability of whole genome sequence of bioenergy grasses hinders the study on bioenergy genomics and their genomics-assisted crop improvement. Foxtail millet (Setaria italica L.; Si) is a model crop for studying systems biology of bioenergy grasses. In the present study, a systematic approach has been used for identification of gene families involved in cellulose (CesA/Csl), callose (Gsl) and monolignol biosynthesis (PAL, C4H, 4CL, HCT, C3H, CCoAOMT, F5H, COMT, CCR, CAD) and construction of physical map of foxtail millet. Sequence alignment and phylogenetic analysis of identified proteins showed that monolignol biosynthesis proteins were highly diverse, whereas CesA/Csl and Gsl proteins were homologous to rice and Arabidopsis. Comparative mapping of foxtail millet lignocellulose biosynthesis genes with other C4 panicoid genomes revealed maximum homology with switchgrass, followed by sorghum and maize. Expression profiling of candidate lignocellulose genes in response to different abiotic stresses and hormone treatments showed their differential expression pattern, with significant higher expression of SiGsl12, SiPAL2, SiHCT1, SiF5H2, and SiCAD6 genes. Further, due to the evolutionary conservation of grass genomes, the insights gained from the present study could be extrapolated for identifying genes involved in lignocellulose biosynthesis in other biofuel species for further characterization.

  17. Integrated assessment by multiple gene expression analysis of quercetin bioactivity on anticancer-related mechanisms in colon cancer cells in vitro

    NARCIS (Netherlands)

    Erk, van M.J.; Roepman, P.; Lende, van der T.R.; Stierum, R.H.; Aarts, J.M.M.J.G.; Bladeren, van P.J.; Ommen, van B.

    2005-01-01

    Background Many different mechanisms are involved in nutrient¿related prevention of colon cancer. In this study, a comprehensive assessment of the spectrum of possible biological actions of the bioactive compound quercetin is made using multiple gene expression analysis. Quercetin is a flavonoid

  18. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  19. Spatio-Temporal Gene Expression Profiling during In Vivo Early Ovarian Folliculogenesis: Integrated Transcriptomic Study and Molecular Signature of Early Follicular Growth.

    Directory of Open Access Journals (Sweden)

    Agnes Bonnet

    Full Text Available The successful achievement of early ovarian folliculogenesis is important for fertility and reproductive life span. This complex biological process requires the appropriate expression of numerous genes at each developmental stage, in each follicular compartment. Relatively little is known at present about the molecular mechanisms that drive this process, and most gene expression studies have been performed in rodents and without considering the different follicular compartments.We used RNA-seq technology to explore the sheep transcriptome during early ovarian follicular development in the two main compartments: oocytes and granulosa cells. We documented the differential expression of 3,015 genes during this phase and described the gene expression dynamic specific to these compartments. We showed that important steps occurred during primary/secondary transition in sheep. We also described the in vivo molecular course of a number of pathways. In oocytes, these pathways documented the chronology of the acquisition of meiotic competence, migration and cellular organization, while in granulosa cells they concerned adhesion, the formation of cytoplasmic projections and steroid synthesis. This study proposes the involvement in this process of several members of the integrin and BMP families. The expression of genes such as Kruppel-like factor 9 (KLF9 and BMP binding endothelial regulator (BMPER was highlighted for the first time during early follicular development, and their proteins were also predicted to be involved in gene regulation. Finally, we selected a data set of 24 biomarkers that enabled the discrimination of early follicular stages and thus offer a molecular signature of early follicular growth. This set of biomarkers includes known genes such as SPO11 meiotic protein covalently bound to DSB (SPO11, bone morphogenetic protein 15 (BMP15 and WEE1 homolog 2 (S. pombe(WEE2 which play critical roles in follicular development but other biomarkers

  20. Independent Gene Discovery and Testing

    Science.gov (United States)

    Palsule, Vrushalee; Coric, Dijana; Delancy, Russell; Dunham, Heather; Melancon, Caleb; Thompson, Dennis; Toms, Jamie; White, Ashley; Shultz, Jeffry

    2010-01-01

    A clear understanding of basic gene structure is critical when teaching molecular genetics, the central dogma and the biological sciences. We sought to create a gene-based teaching project to improve students' understanding of gene structure and to integrate this into a research project that can be implemented by instructors at the secondary level…

  1. An integrative transcriptomic approach to identify depot differences in genes and microRNAs in adipose tissues from high fat fed mice.

    Science.gov (United States)

    Wijayatunga, Nadeeja N; Pahlavani, Mandana; Kalupahana, Nishan S; Kottapalli, Kameswara Rao; Gunaratne, Preethi H; Coarfa, Cristian; Ramalingam, Latha; Moustaid-Moussa, Naima

    2018-02-06

    Obesity contributes to metabolic disorders such as diabetes and cardiovascular disease. Characterization of differences between the main adipose tissue depots, white (WAT) [including subcutaneous (SAT) and visceral adipose tissue (VAT)] and brown adipose tissue (BAT) helps to identify their roles in obesity. Thus, we studied depot-specific differences in whole transcriptome and miRNA profiles of SAT, VAT and BAT from high fat diet (HFD/45% of calories from fat) fed mice using RNA sequencing and small RNA-Seq. Using quantitative real-time polymerase chain reaction, we validated depot-specific differences in endoplasmic reticulum (ER) stress related genes and miRNAs using mice fed a HFD vs. low fat diet (LFD/10% of calories from fat). According to the transcriptomic analysis, lipogenesis, adipogenesis, inflammation, endoplasmic reticulum (ER) stress and unfolded protein response (UPR) were higher in VAT compared to BAT, whereas energy expenditure, fatty acid oxidation and oxidative phosphorylation were higher in BAT than in VAT of the HFD fed mice. In contrast to BAT, ER stress marker genes were significantly upregulated in VAT of HFD fed mice than the LFD fed mice. For the first time, we report depot specific differences in ER stress related miRNAs including; downregulation of miR-125b-5p, upregulation miR-143-3p, and miR-222-3p in VAT following HFD and upregulation of miR-30c-2-3p only in BAT following a HFD in mice than the LFD mice. In conclusion, HFD differentially regulates miRNAs and genes in different adipose depots with significant induction of genes related to lipogenesis, adipogenesis, inflammation, ER stress, and UPR in WAT compared to BAT.

  2. Overexpression of a peach CBF gene in apple: a model for understanding the integration of growth, dormancy, and cold hardiness in woody plants

    Science.gov (United States)

    The timing of cold acclimation and de-acclimation, dormancy, and bud break play an integral role in the life cycle of woody plants. The molecular events that regulate these parameters have been the subject of much study, however, in most studies these events have been investigated independently of ...

  3. Gene Therapy

    Science.gov (United States)

    Gene therapy Overview Gene therapy involves altering the genes inside your body's cells in an effort to treat or stop disease. Genes contain your ... that don't work properly can cause disease. Gene therapy replaces a faulty gene or adds a new ...

  4. Influence of the intrinsic gut microbiota on transcriptional regulation of genes involved in the early life development of intestinal epithelial integrity

    DEFF Research Database (Denmark)

    Bergström, Anders; Kristensen, Matilde Bylov; Frøkjær, Hanne

    2010-01-01

    surfaces of all epithelial linings by physical or specific hindrance of pathogenic species e.g. virus and bacteria. Moreover, the proteins constituting the tight junctions in the apical membrane of the epithelial cells are important as they take part in controlling, which substances can penetrate...... GF and SPF. Comelli EM et al (2008) have shown very similar results on the mucin genes, when colonizing with human adult or baby “full” microbiota. This is the first study with monocolonization however. Finally, we observed inverse correlation between Muc-1 and Lactobacillus 16S rRNA expression...

  5. Integral or integrated marketing

    Directory of Open Access Journals (Sweden)

    Davčik Nebojša

    2006-01-01

    Full Text Available Marketing theorists and experts try to develop business efficient organization and to get marketing performance at higher, business integrated level since its earliest beginnings. The core issue in this paperwork is the dialectic and practical approach dilemma should we develop integrated or integral marketing approach in the organization. The presented company cases as well as dialectic and functional explanations of this dilemma clearly shows that integrated marketing is narrower approach than integral marketing if we take as focal point new, unique and completed entity. In the integration the essence is in getting different parts together, which do not have to make necessary the new entity. The key elements in the definition of the integral marketing are necessity and holistic, e.g. necessity to develop new, holistic entity.

  6. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    Directory of Open Access Journals (Sweden)

    Dawyndt Peter

    2010-01-01

    Full Text Available Abstract Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the

  7. From learning taxonomies to phylogenetic learning: integration of 16S rRNA gene data into FAME-based bacterial classification.

    Science.gov (United States)

    Slabbinck, Bram; Waegeman, Willem; Dawyndt, Peter; De Vos, Paul; De Baets, Bernard

    2010-01-30

    Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial

  8. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    Science.gov (United States)

    2010-01-01

    Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for

  9. Gene-based SSR markers for common bean (Phaseolus vulgaris L.) derived from root and leaf tissue ESTs: an integration of the BMc series.

    Science.gov (United States)

    Blair, Matthew W; Hurtado, Natalia; Chavarro, Carolina M; Muñoz-Torres, Monica C; Giraldo, Martha C; Pedraza, Fabio; Tomkins, Jeff; Wing, Rod

    2011-03-22

    Sequencing of cDNA libraries for the development of expressed sequence tags (ESTs) as well as for the discovery of simple sequence repeats (SSRs) has been a common method of developing microsatellites or SSR-based markers. In this research, our objective was to further sequence and develop common bean microsatellites from leaf and root cDNA libraries derived from the Andean gene pool accession G19833 and the Mesoamerican gene pool accession DOR364, mapping parents of a commonly used reference map. The root libraries were made from high and low phosphorus treated plants. A total of 3,123 EST sequences from leaf and root cDNA libraries were screened and used for direct simple sequence repeat discovery. From these EST sequences we found 184 microsatellites; the majority containing tri-nucleotide motifs, many of which were GC rich (ACC, AGC and AGG in particular). Di-nucleotide motif microsatellites were about half as common as the tri-nucleotide motif microsatellites but most of these were AGn microsatellites with a moderate number of ATn microsatellites in root ESTs followed by few ACn and no GCn microsatellites. Out of the 184 new SSR loci, 120 new microsatellite markers were developed in the BMc (Bean Microsatellites from cDNAs) series and these were evaluated for their capacity to distinguish bean diversity in a germplasm panel of 18 genotypes. We developed a database with images of the microsatellites and their polymorphism information content (PIC), which averaged 0.310 for polymorphic markers. The present study produced information about microsatellite frequency in root and leaf tissues of two important genotypes for common bean genomics: namely G19833, the Andean genotype selected for whole genome shotgun sequencing from race Peru, and DOR364 a race Mesoamerica subgroup 2 genotype that is a small-red seeded, released variety in Central America. Both race Peru and Mesoamerica subgroup 2 (small red beans) have been understudied in comparison to race Nueva

  10. Integrative analysis of genes and miRNA alterations in human embryonic stem cells-derived neural cells after exposure to silver nanoparticles

    International Nuclear Information System (INIS)

    Oh, Jung-Hwa; Son, Mi-Young; Choi, Mi-Sun; Kim, Soojin; Choi, A-young; Lee, Hyang-Ae; Kim, Ki-Suk; Kim, Janghwan; Song, Chang Woo; Yoon, Seokjoo

    2016-01-01

    Given the rapid growth of engineered and customer products made of silver nanoparticles (Ag NPs), understanding their biological and toxicological effects on humans is critically important. The molecular developmental neurotoxic effects associated with exposure to Ag NPs were analyzed at the physiological and molecular levels, using an alternative cell model: human embryonic stem cell (hESC)-derived neural stem/progenitor cells (NPCs). In this study, the cytotoxic effects of Ag NPs (10–200 μg/ml) were examined in these hESC-derived NPCs, which have a capacity for neurogenesis in vitro, at 6 and 24 h. The results showed that Ag NPs evoked significant toxicity in hESC-derived NPCs at 24 h in a dose-dependent manner. In addition, Ag NPs induced cell cycle arrest and apoptosis following a significant increase in oxidative stress in these cells. To further clarify the molecular mechanisms of the toxicological effects of Ag NPs at the transcriptional and post-transcriptional levels, the global expression profiles of genes and miRNAs were analyzed in hESC-derived NPCs after Ag NP exposure. The results showed that Ag NPs induced oxidative stress and dysfunctional neurogenesis at the molecular level in hESC-derived NPCs. Based on this hESC-derived neural cell model, these findings have increased our understanding of the molecular events underlying developmental neurotoxicity induced by Ag NPs in humans. - Highlights: • This system served as a suitable model for developmental neurotoxicity testing. • Ag NPs induce the apoptosis in human neural cells by ROS generation. • Genes for development of neurons were dysregulated in response to Ag NPs. • Molecular events during early developmental neurotoxicity were proposed.

  11. An integrated tool to study MHC region: accurate SNV detection and HLA genes typing in human MHC region using targeted high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Hongzhi Cao

    Full Text Available The major histocompatibility complex (MHC is one of the most variable and gene-dense regions of the human genome. Most studies of the MHC, and associated regions, focus on minor variants and HLA typing, many of which have been demonstrated to be associated with human disease susceptibility and metabolic pathways. However, the detection of variants in the MHC region, and diagnostic HLA typing, still lacks a coherent, standardized, cost effective and high coverage protocol of clinical quality and reliability. In this paper, we presented such a method for the accurate detection of minor variants and HLA types in the human MHC region, using high-throughput, high-coverage sequencing of target regions. A probe set was designed to template upon the 8 annotated human MHC haplotypes, and to encompass the 5 megabases (Mb of the extended MHC region. We deployed our probes upon three, genetically diverse human samples for probe set evaluation, and sequencing data show that ∼97% of the MHC region, and over 99% of the genes in MHC region, are covered with sufficient depth and good evenness. 98% of genotypes called by this capture sequencing prove consistent with established HapMap genotypes. We have concurrently developed a one-step pipeline for calling any HLA type referenced in the IMGT/HLA database from this target capture sequencing data, which shows over 96% typing accuracy when deployed at 4 digital resolution. This cost-effective and highly accurate approach for variant detection and HLA typing in the MHC region may lend further insight into immune-mediated diseases studies, and may find clinical utility in transplantation medicine research. This one-step pipeline is released for general evaluation and use by the scientific community.

  12. Integrative analysis of genes and miRNA alterations in human embryonic stem cells-derived neural cells after exposure to silver nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Jung-Hwa [Korea Institute of Toxicology (KIT), Daejeon 34114 (Korea, Republic of); Department of human and environmental toxicology, University of Science & Technology, Daejeon 34113 (Korea, Republic of); Son, Mi-Young [Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahangno, Yuseong-gu, Daejeon 34141 (Korea, Republic of); Department of functional genomics, University of Science & Technology, 217 Gajungro, Yuseong-gu, Daejeon 34113 (Korea, Republic of); Choi, Mi-Sun; Kim, Soojin; Choi, A-young [Korea Institute of Toxicology (KIT), Daejeon 34114 (Korea, Republic of); Lee, Hyang-Ae; Kim, Ki-Suk [Korea Institute of Toxicology (KIT), Daejeon 34114 (Korea, Republic of); Department of human and environmental toxicology, University of Science & Technology, Daejeon 34113 (Korea, Republic of); Kim, Janghwan [Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahangno, Yuseong-gu, Daejeon 34141 (Korea, Republic of); Department of functional genomics, University of Science & Technology, 217 Gajungro, Yuseong-gu, Daejeon 34113 (Korea, Republic of); Song, Chang Woo, E-mail: cwsong@kitox.re.kr [Korea Institute of Toxicology (KIT), Daejeon 34114 (Korea, Republic of); Department of human and environmental toxicology, University of Science & Technology, Daejeon 34113 (Korea, Republic of); Yoon, Seokjoo, E-mail: sjyoon@kitox.re.kr [Korea Institute of Toxicology (KIT), Daejeon 34114 (Korea, Republic of); Department of human and environmental toxicology, University of Science & Technology, Daejeon 34113 (Korea, Republic of)

    2016-05-15

    Given the rapid growth of engineered and customer products made of silver nanoparticles (Ag NPs), understanding their biological and toxicological effects on humans is critically important. The molecular developmental neurotoxic effects associated with exposure to Ag NPs were analyzed at the physiological and molecular levels, using an alternative cell model: human embryonic stem cell (hESC)-derived neural stem/progenitor cells (NPCs). In this study, the cytotoxic effects of Ag NPs (10–200 μg/ml) were examined in these hESC-derived NPCs, which have a capacity for neurogenesis in vitro, at 6 and 24 h. The results showed that Ag NPs evoked significant toxicity in hESC-derived NPCs at 24 h in a dose-dependent manner. In addition, Ag NPs induced cell cycle arrest and apoptosis following a significant increase in oxidative stress in these cells. To further clarify the molecular mechanisms of the toxicological effects of Ag NPs at the transcriptional and post-transcriptional levels, the global expression profiles of genes and miRNAs were analyzed in hESC-derived NPCs after Ag NP exposure. The results showed that Ag NPs induced oxidative stress and dysfunctional neurogenesis at the molecular level in hESC-derived NPCs. Based on this hESC-derived neural cell model, these findings have increased our understanding of the molecular events underlying developmental neurotoxicity induced by Ag NPs in humans. - Highlights: • This system served as a suitable model for developmental neurotoxicity testing. • Ag NPs induce the apoptosis in human neural cells by ROS generation. • Genes for development of neurons were dysregulated in response to Ag NPs. • Molecular events during early developmental neurotoxicity were proposed.

  13. Molecular cloning, expression, functional characterization, chromosomal localization, and gene structure of junctate, a novel integral calcium binding protein of sarco(endo)plasmic reticulum membrane.

    Science.gov (United States)

    Treves, S; Feriotto, G; Moccagatta, L; Gambari, R; Zorzato, F

    2000-12-15

    Screening a cDNA library from human skeletal muscle and cardiac muscle with a cDNA probe derived from junctin led to the isolation of two groups of cDNA clones. The first group displayed a deduced amino acid sequence that is 84% identical to that of dog heart junctin, whereas the second group had a single open reading frame that encoded a polypeptide with a predicted mass of 33 kDa, whose first 78 NH(2)-terminal residues are identical to junctin whereas its COOH terminus domain is identical to aspartyl beta-hydroxylase, a member of the alpha-ketoglutarate-dependent dioxygenase family. We named the latter amino acid sequence junctate. Northern blot analysis indicates that junctate is expressed in a variety of human tissues including heart, pancreas, brain, lung, liver, kidney, and skeletal muscle. Fluorescence in situ hybridization analysis revealed that the genetic loci of junctin and junctate map to the same cytogenetic band on human chromosome 8. Analysis of intron/exon boundaries of the genomic BAC clones demonstrate that junctin, junctate, and aspartyl beta-hydroxylase result from alternative splicing of the same gene. The predicted lumenal portion of junctate is enriched in negatively charged residues and is able to bind calcium. Scatchard analysis of equilibrium (45)Ca(2+) binding in the presence of a physiological concentration of KCl demonstrate that junctate binds 21.0 mol of Ca(2+)/mol protein with a k(D) of 217 +/- 20 microm (n = 5). Tagging recombinant junctate with green fluorescent protein and expressing the chimeric polypeptide in COS-7-transfected cells indicates that junctate is located in endoplasmic reticulum membranes and that its presence increases the peak amplitude and transient calcium released by activation of surface membrane receptors coupled to InsP(3) receptor activation. Our study shows that alternative splicing of the same gene generates the following functionally distinct proteins: an enzyme (aspartyl beta-hydroxylase), a structural

  14. Aniridia-associated cytogenetic rearrangements suggest that a position effect may cause the mutant phenotype

    NARCIS (Netherlands)

    Fantes, J.; Redeker, B.; Breen, M.; Boyle, S.; Brown, J.; Fletcher, J.; Jones, S.; Bickmore, W.; Fukushima, Y.; Mannens, M.

    1995-01-01

    Current evidence suggests that aniridia (absence of iris) is caused by loss of function of one copy of the PAX6 gene, which maps to 11p13. We present the further characterisation of two aniridia pedigrees in which the disease segregates with chromosomal rearrangements which involve 11p13 but do not

  15. Integrative analysis of genes and miRNA alterations in human embryonic stem cells-derived neural cells after exposure to silver nanoparticles.

    Science.gov (United States)

    Oh, Jung-Hwa; Son, Mi-Young; Choi, Mi-Sun; Kim, Soojin; Choi, A-Young; Lee, Hyang-Ae; Kim, Ki-Suk; Kim, Janghwan; Song, Chang Woo; Yoon, Seokjoo

    2016-05-15

    Given the rapid growth of engineered and customer products made of silver nanoparticles (Ag NPs), understanding their biological and toxicological effects on humans is critically important. The molecular developmental neurotoxic effects associated with exposure to Ag NPs were analyzed at the physiological and molecular levels, using an alternative cell model: human embryonic stem cell (hESC)-derived neural stem/progenitor cells (NPCs). In this study, the cytotoxic effects of Ag NPs (10-200μg/ml) were examined in these hESC-derived NPCs, which have a capacity for neurogenesis in vitro, at 6 and 24h. The results showed that Ag NPs evoked significant toxicity in hESC-derived NPCs at 24h in a dose-dependent manner. In addition, Ag NPs induced cell cycle arrest and apoptosis following a significant increase in oxidative stress in these cells. To further clarify the molecular mechanisms of the toxicological effects of Ag NPs at the transcriptional and post-transcriptional levels, the global expression profiles of genes and miRNAs were analyzed in hESC-derived NPCs after Ag NP exposure. The results showed that Ag NPs induced oxidative stress and dysfunctional neurogenesis at the molecular level in hESC-derived NPCs. Based on this hESC-derived neural cell model, these findings have increased our understanding of the molecular events underlying developmental neurotoxicity induced by Ag NPs in humans. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Integral-preserving integrators

    International Nuclear Information System (INIS)

    McLaren, D I; Quispel, G R W

    2004-01-01

    Ordinary differential equations having a first integral may be solved numerically using one of several methods, with the integral preserved to machine accuracy. One such method is the discrete gradient method. It is shown here that the order of the method can be bootstrapped repeatedly to higher orders of accuracy. The method is illustrated using the Henon-Heiles system. (letter to the editor)

  17. RBiomirGS: an all-in-one miRNA gene set analysis solution featuring target mRNA mapping and expression profile integration

    Directory of Open Access Journals (Sweden)

    Jing Zhang

    2018-01-01

    Full Text Available Background With the continuous discovery of microRNA’s (miRNA association with a wide range of biological and cellular processes, expression profile-based functional characterization of such post-transcriptional regulation is crucial for revealing its significance behind particular phenotypes. Profound advancement in bioinformatics has been made to enable in depth investigation of miRNA’s role in regulating cellular and molecular events, resulting in a huge quantity of software packages covering different aspects of miRNA functional analysis. Therefore, an all-in-one software solution is in demand for a comprehensive yet highly efficient workflow. Here we present RBiomirGS, an R package for a miRNA gene set (GS analysis. Methods The package utilizes multiple databases for target mRNA mapping, estimates miRNA effect on the target mRNAs through miRNA expression profile and conducts a logistic regression-based GS enrichment. Additionally, human ortholog Entrez ID conversion functionality is included for target mRNAs. Results By incorporating all the core steps into one package, RBiomirGS eliminates the need for switching between different software packages. The modular structure of RBiomirGS enables various access points to the analysis, with which users can choose the most relevant functionalities for their workflow. Conclusions With RBiomirGS, users are able to assess the functional significance of the miRNA expression profile under the corresponding experimental condition by minimal input and intervention. Accordingly, RBiomirGS encompasses an all-in-one solution for miRNA GS analysis. RBiomirGS is available on GitHub (http://github.com/jzhangc/RBiomirGS. More information including instruction and examples can be found on website (http://kenstoreylab.com/?page_id=2865.

  18. Integrated microRNA and gene expression profiling reveals the crucial miRNAs in curcumin anti-lung cancer cell invasion.

    Science.gov (United States)

    Zhan, Jian-Wei; Jiao, De-Min; Wang, Yi; Song, Jia; Wu, Jin-Hong; Wu, Li-Jun; Chen, Qing-Yong; Ma, Sheng-Lin

    2017-09-01

    Curcumin (diferuloylmethane) has chemopreventive and therapeutic properties against many types of tumors, both in vitro and in vivo. Previous reports have shown that curcumin exhibits anti-invasive activities, but the mechanisms remain largely unclear. In this study, both microRNA (miRNA) and messenger RNA (mRNA) expression profiles were used to characterize the anti-metastasis mechanisms of curcumin in human non-small cell lung cancer A549 cell line. Microarray analysis revealed that 36 miRNAs were differentially expressed between the curcumin-treated and control groups. miR-330-5p exhibited maximum upregulation, while miR-25-5p exhibited maximum downregulation in the curcumin treatment group. mRNA expression profiles and functional analysis indicated that 226 differentially expressed mRNAs belonged to different functional categories. Significant pathway analysis showed that mitogen-activated protein kinase, transforming growth factor-β, and Wnt signaling pathways were significantly downregulated. At the same time, axon guidance, glioma, and ErbB tyrosine kinase receptor signaling pathways were significantly upregulated. We constructed a miRNA gene network that contributed to the curcumin inhibition of metastasis in lung cancer cells. let-7a-3p, miR-1262, miR-499a-5p, miR-1276, miR-331-5p, and miR-330-5p were identified as key microRNA regulators in the network. Finally, using miR-330-5p as an example, we confirmed the role of miR-330-5p in mediating the anti-migration effect of curcumin, suggesting the importance of miRNAs in the regulation of curcumin biological activity. Our findings provide new insights into the anti-metastasis mechanism of curcumin in lung cancer. © 2017 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

  19. FunGene: the functional gene pipeline and repository.

    Science.gov (United States)

    Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

    2013-01-01

    Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

  20. FunGene: the Functional Gene Pipeline and Repository

    Directory of Open Access Journals (Sweden)

    Jordan A. Fish

    2013-10-01

    Full Text Available Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer.While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/ offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces