Meireles, C M; Schneider, M P; Sampaio, M I; Schneider, H; Slightom, J L; Chiu, C H; Neiswanger, K; Gumucio, D L; Czelusniak, J; Goodman, M
1995-01-01
Conclusive evidence was provided that gamma 1, the upstream of the two linked simian gamma-globin loci (5'-gamma 1-gamma 2-3'), is a pseudogene in a major group of New World monkeys. Sequence analysis of PCR-amplified genomic fragments of predicted sizes revealed that all extant genera of the platyrrhine family Atelidae [Lagothrix (woolly monkeys), Brachyteles (woolly spider monkeys), Ateles (spider monkeys), and Alouatta (howler monkeys)] share a large deletion that removed most of exon 2, all of intron 2 and exon 3, and much of the 3' flanking sequence of gamma 1. The fact that two functional gamma-globin genes were not present in early ancestors of the Atelidae (and that gamma 1 was the dispensible gene) suggests that for much or even all of their evolution, platyrrhines have had gamma 2 as the primary fetally expressed gamma-globin gene, in contrast to catarrhines (e.g., humans and chimpanzees) that have gamma 1 as the primary fetally expressed gamma-globin gene. Results from promoter sequences further suggest that all three platyrrhine families (Atelidae, Cebidae, and Pitheciidae) have gamma 2 rather than gamma 1 as their primary fetally expressed gamma-globin gene. The implications of this suggestion were explored in terms of how gene redundancy, regulatory mutations, and distance of each gamma-globin gene from the locus control region were possibly involved in the acquisition and maintenance of fetal, rather than embryonic, expression. Images Fig. 2 PMID:7535927
Expression of human gamma-globin genes in human erythroleukemia (K562) cells.
Donovan-Peluso, M; Acuto, S; Swanson, M; Dobkin, C; Bank, A
1987-12-15
K562 cells express embryonic (epsilon) and fetal (gamma) globins and hemoglobins but not adult (beta) globin. To define the cis acting regulatory elements involved in the discrimination between gamma and beta genes, we have constructed chimeric genes composed of portions of gamma and beta and evaluated their expression in stable K562 transfectants. A gamma beta fusion gene containing gamma 5' sequences to the EcoRI site in exon 3 and beta sequences 3' is expressed at 10-40% that of the endogenous gamma level. In 50% of the lines, this fusion gene appropriately increases its expression in response to hemin, an inducer of endogenous globin gene expression in K562 cells. In contrast, a beta gamma fusion gene, containing beta sequences 5' to the EcoRI site in exon 3 and gamma sequences 3', is neither expressed nor correctly initiated. A beta gene containing gamma-intervening sequence (IVS) 2 accumulates an mRNA transcript when analyzed with a 3' beta probe. However, no correctly initiated beta mRNA is observed. A gamma gene with beta-IVS 2 is only inducible in one of six expressing clones. All the results are consistent with the presence of stage-specific trans acting factors in K562 cells that stimulate expression of gamma genes and suggest a significant role for gamma-IVS 2 in gamma gene expression.
Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells
International Nuclear Information System (INIS)
Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.
1987-01-01
The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes
The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.
E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan
1983-01-01
textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA
International Nuclear Information System (INIS)
Liebhaber, S.A.; Weiss, I.; Cash, F.E.; Griese, E.U.; Horst, J.; Ayyub, H.; Higgs, D.R.
1990-01-01
Synthesis of normal human hemoglobin A, α 2 β 2 , is based upon balanced expression of genes in the α-globin gene cluster on chromosome 15 and the β-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the β-globin cluster depend on sequences located at a considerable distance 5' to the β-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the α-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with α-thalassemia in whom structurally normal α-globin genes have been inactivated in cis by a discrete de novo 35-kilobase deletion located ∼30 kilobases 5' from the α-globin gene cluster. They conclude that this deletion inactivates expression of the α-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the α-globin genes
Directory of Open Access Journals (Sweden)
Weiqun Lu
2011-01-01
Full Text Available In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW- than in seawater- (SW-adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW.
Molecular nature of alpha-globin genes in the Saudi population
Directory of Open Access Journals (Sweden)
J. Francis Borgio
2015-11-01
Full Text Available Alpha-thalassemia (α-thal is a disorder caused by the deletion of single or double α-globin genes, and/or point mutations in the α-globin genes. There are 2 common types of α-globin genes; HBA2 and HBA1. Recently, it has been discovered that the HBA2 gene is replaced by a unique HBA12 gene convert in 5.7% of the Saudi population. The α-globin genes have been emerging as a molecular target for the treatment of β-thalassemia (β-thal. Hence, it is essential to understand the molecular nature of α-globin genes to treat the most prevalent hemoglobin disorders, such as sickle cell disease, α-thal, and β-thal prevalent in the Kingdom of Saudi Arabia. Thirty-two different α-globin genotypes have been observed in the Saudi population. This review outlines the classification of the α-globin genes on the basis of their molecular nature and complex combinations of α-globin genes, and their variants predominant in Saudis.
Directory of Open Access Journals (Sweden)
Supachai Ekwattanakit
2012-01-01
Full Text Available Background and Objectives. To explore the role of cis-regulatory sequences within the β globin gene cluster at chromosome 11 on human γ globin gene expression related to Hb E allele, we analyze baseline hematological data and Hb F values together with β globin haplotypes in homozygous Hb E. Patients and Methods. 80 individuals with molecularly confirmed homozygous Hb E were analyzed for the β globin haplotypes and Xmn I polymorphism using PCR-RFLPs. 74 individuals with complete laboratory data were further studied for association analyses. Results. Eight different β globin haplotypes were found linked to Hb E alleles; three major haplotypes were (a (III, (b (V, and (c (IV accounting for 94% of Hb E chromosomes. A new haplotype (Th-1 was identified and most likely converted from the major ones. The majority of individuals had Hb F < 5%; only 10.8% of homozygous Hb E had high Hb F (average 10.5%, range 5.8–14.3%. No association was found on a specific haplotype or Xmn I in these individuals with high Hb F, measured by alkaline denaturation. Conclusion. The cis-regulation of γ globin gene expression might not be apparent under a milder condition with lesser globin imbalance such as homozygous Hb E.
Asynchronous DNA replication within the human β-globin gene locus
International Nuclear Information System (INIS)
Epner, E.; Forrester, W.C.; Groudine, M.
1988-01-01
The timing of DNA replication of the human β-globin gene locus has been studied by blot hybridization of newly synthesized BrdUrd-substituted DNA from cells in different stages of the S phase. Using probes that span >120 kilobases across the human β-globin gene locus, the authors show that the majority of this domain replicates in early S phase in the human erythroleukemia cell line K562 and in middle-to-late S phase in the lymphoid cell line Manca. However, in K562 cells three small regions display a strikingly different replication pattern than adjacent sequences. These islands, located in the inter-γ-globin gene region and approximately 20 kilobases 5' to the ε-globin gene and 20 kilobases 3' to the β-globin gene, replicate later and throughout S phase. A similar area is also present in the α-globin gene region in K562 cells. They suggest that these regions may represent sites of termination of replication forks
Human γ-globin genes silenced independently of other genes in the β-globin locus.
N.O. Dillon (Niall); F.G. Grosveld (Frank)
1991-01-01
textabstractErythropoiesis during human development is characterized by switches in expression of beta-like globin genes during the transition from the embryonic through fetal to adult stages. Activation and high-level expression of the genes is directed by the locus control region (LCR), located 5'
Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V
2017-07-11
In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing
Studies of globin gene expression in differentiating erythroid cells
International Nuclear Information System (INIS)
Sullivan, T.D.
1985-01-01
The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Importance of globin gene order for correct developmental expression.
O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)
1991-01-01
textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the
A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)
1996-01-01
textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly
Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.
Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P
2009-12-01
Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.
International Nuclear Information System (INIS)
Nandi, A.K.; Roginski, R.S.; Gregg, R.G.; Smithies, O.; Skoultchi, A.I.
1988-01-01
The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation
Distinctive patterns of evolution of the δ-globin gene (HBD in primates.
Directory of Open Access Journals (Sweden)
Ana Moleirinho
Full Text Available In most vertebrates, hemoglobin (Hb is a heterotetramer composed of two dissimilar globin chains, which change during development according to the patterns of expression of α- and β-globin family members. In placental mammals, the β-globin cluster includes three early-expressed genes, ε(HBE-γ(HBG-ψβ(HBBP1, and the late expressed genes, δ (HBD and β (HBB. While HBB encodes the major adult β-globin chain, HBD is weakly expressed or totally silent. Paradoxically, in human populations HBD shows high levels of conservation typical of genes under strong evolutionary constraints, possibly due to a regulatory role in the fetal-to-adult switch unique of Anthropoid primates. In this study, we have performed a comprehensive phylogenetic and comparative analysis of the two adult β-like globin genes in a set of diverse mammalian taxa, focusing on the evolution and functional divergence of HBD in primates. Our analysis revealed that anthropoids are an exception to a general pattern of concerted evolution in placental mammals, showing a high level of sequence conservation at HBD, less frequent and shorter gene conversion events. Moreover, this lineage is unique in the retention of a functional GATA-1 motif, known to be involved in the control of the developmental expression of the β-like globin genes. We further show that not only the mode but also the rate of evolution of the δ-globin gene in higher primates are strictly associated with the fetal/adult β-cluster developmental switch. To gain further insight into the possible functional constraints that have been shaping the evolutionary history of HBD in primates, we calculated dN/dS (ω ratios under alternative models of gene evolution. Although our results indicate that HBD might have experienced different selective pressures throughout primate evolution, as shown by different ω values between apes and Old World Monkeys + New World Monkeys (0.06 versus 0.43, respectively, these estimates
Energy Technology Data Exchange (ETDEWEB)
Lin, S.D.; Cooper, P.; Fung, J.; Weier, H.U.G.; Rubin, E.M.
2000-03-01
Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression of human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.
Raftopoulos, H; Ward, M; Bank, A
1998-06-30
Insertion of a normally functioning human beta-globin gene into the hematopoietic stem cells (HSC) of patients with beta-thalassemia may be an effective approach to the therapy of this disorder. Safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models are prerequisites for HSC somatic gene therapy. We have recently shown for the first time that, using a modified beta-globin retroviral vector in a mouse transplant model, long-term, high-level expression of a transferred human beta-globin gene is possible. The human beta-globin gene continues to be detected up to eight months post-transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice. The transferred human beta-globin gene is detected in three of five mice surviving long-term (> 4 months) transplanted with bone marrow cells transduced with high-titer virus. The unrearranged 5.1 kb human beta-globin gene-containing provirus is seen by Southern blotting in two of these mice. More importantly, long-term expression of the transferred gene is seen in two mice at levels of 5% and 20% that of endogenous murine beta-globin. We document stem cell transduction by showing continued high-level expression of the human beta-globin gene in secondarily transplanted recipient mice. These results provide evidence of HSC transduction with a human beta-globin gene in animals and demonstrate that retroviral-mediated unrearranged human beta-globin gene transfer leads to a high level of human beta-globin gene expression in the long term for the first time. A gene therapy strategy may be a feasible therapeutic approach to the beta-thalassemias if consistent human beta-globin gene transfer and expression into HSC can be achieved.
Walker, Aisha L.; Ofori-Acquah, Solomon
2016-01-01
The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...
Long-term transfer and expression of the human beta-globin gene in a mouse transplant model.
Raftopoulos, H; Ward, M; Leboulch, P; Bank, A
1997-11-01
Somatic gene therapy of hemoglobinopathies depends initially on the demonstration of safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models. We have used a beta-globin gene/beta-locus control region retroviral vector containing several modifications to optimize gene transfer and expression in a mouse transplant model. In this report we show that transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice leads to the continued presence of the gene up to 8 months posttransplantation. The transferred human beta-globin gene is detected in 3 of 5 mice surviving long term (>4 months) transplanted with bone marrow cells transduced with high-titer virus. Southern blotting confirms the presence of the unrearranged 5.1-kb human beta-globin gene-containing provirus in 2 of these mice. In addition, long-term expression of the transferred gene is seen in 2 mice at levels of 5% and 20% that of endogenous murine beta-globin at 6 and 8 months posttransplantation. We further document stem cell transduction by the successful transfer and high-level expression of the human beta-globin gene from mice transduced 9 months earlier into irradiated secondary recipient mice. These results demonstrate high-level, long-term somatic human beta-globin gene transfer into the hematopoietic stem cells of an animal for the first time, and suggest the potential feasibility of a retroviral gene therapy approach to sickle cell disease and the beta thalassemias.
International Nuclear Information System (INIS)
Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.
1988-01-01
The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells
Bradykinin stimulation of nitric oxide production is not sufficient for gamma-globin induction
Directory of Open Access Journals (Sweden)
Čokić Vladan P.
2014-01-01
Full Text Available Introduction. Hydroxycarbamide, used in therapy of hemoglobinopathies, enhances nitric oxide (NO production both in primary human umbilical vein endothelial cells (HUVECs and human bone marrow endothelial cell line (TrHBMEC. Moreover, NO increases γ-globin and fetal hemoglobin levels in human erythroid progenitors. Objective. In order to find out whether simple physiologic stimulation of NO production by components of hematopoietic microenvironment can increase γ-globin gene expression, the effects of NO-inducer bradykinin were examined in endothelial cells. Methods. The study was performed in co-cultures of human erythroid progenitors, TrHBMEC and HUVECs by ozone-based chemiluminescent determination of NO and real-time quantitative RT-PCR. Results. In accordance with previous reports, the endogenous factor bradykinin increased endothelial cell production of NO in a dose- and time-dependent manner (0.1-0.6 μM up to 30 minutes. This induction of NO in HUVECs and TrHBMEC by bradykinin was blocked by competitive inhibitors of NO synthase (NOS, demonstrating NOS-dependence. It has been shown that bradykinin significantly reduced endothelial NOS (eNOS mRNA level and eNOS/Я-actin ratio in HUVEC (by twofold. In addition, bradykinin failed to increase γ-globin mRNA expression in erythroid progenitors only, as well as in co-culture studies of erythroid progenitors with TrHBMEC and HUVEC after 24 hours of treatment. Furthermore, bradykinin did not induce γ/β globin ratio in erythroid progenitors in co-cultures with HUVEC. Conclusion. Bradykinin mediated eNOS activation leads to short time and low NO production in endothelial cells, insufficient to induce γ-globin gene expression. These results emphasized the significance of elevated and extended NO production in augmentation of γ-globin gene expression. [Projekat Ministarstva nauke Republike Srbije, br. 175053
Liebhaber, S A; Cash, F E; Main, D M
1985-01-01
alpha-Globin is encoded by the two adjacent genes, alpha 1 and alpha 2. Although it is clearly established that both alpha-globin genes are expressed, their relative contributions to alpha-globin messenger RNA (mRNA) and protein synthesis are not fully defined. Furthermore, changes that may occur in alpha-globin gene activity secondarily to the loss of function of one or more of these genes (alpha-thalassemia [Thal]) have not been directly investigated. This study further defines the expressi...
Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.
Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein
2016-10-01
β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.
In vivo protein-DNA interactions at the β-globin gene locus
International Nuclear Information System (INIS)
Tohru Ikuta; Yuet Wai Kan
1991-01-01
The authors have investigated in vivo protein-DNA interactions in the β-globin gene locus by dimethyl sulfate (DMS) footprinting in K562 cells, which express var-epsilon- and γ-globin but not β-globin. In the locus control region, hypersensitive site 2 (HS-2) exhibited footprints in several putative protein binding motifs. HS-3 was not footprinted. The β promoter was also not footprinted, while extensive footprints were observed in the promoter of the active γ-globin gene. No footprints were seen in the A γ and β3' enhancers. With several motifs, additional protein interactions and alterations in binding patterns occurred with hemin induction. In HeLa cells, some footprints were observed in some of the motifs in HS-2, compatible with the finding that HS-2 has some enhancer function in HeLa cells, albeit much weaker than its activity in K562 cells. No footprint was seen in B lymphocytes. In vivo footprinting is a useful method for studying relevant protein-DNA interactions in erythroid cells
Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies
Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina
2018-01-01
The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430
Directory of Open Access Journals (Sweden)
Mir A Hossain
2016-01-01
Full Text Available Reactivation of γ-globin expression has been shown to ameliorate disease phenotypes associated with mutations in the adult β-globin gene, including sickle cell disease. Specific mutations in the promoter of the γ-globin genes are known to prevent repression of the genes in the adult and thus lead to hereditary persistence of fetal hemoglobin. One such hereditary persistence of fetal hemoglobin is associated with a sequence located 567 bp upstream of the Gγ-globin gene which assembles a GATA-containing repressor complex. We generated two synthetic zinc-finger DNA-binding domains (ZF-DBDs targeting this sequence. The -567Gγ ZF-DBDs associated with high affinity and specificity with the target site in the γ-globin gene promoter. We delivered the -567Gγ ZF-DBDs directly to primary erythroid cells. Exposure of these cells to the recombinant -567Gγ ZF-DBDs led to increased expression of the γ-globin gene. Direct protein delivery of ZF-DBDs that compete with transcription regulatory proteins will have broad implications for modulating gene expression in analytical or therapeutic settings.
Chicken globin gene transcription is cell lineage specific during the time of the switch
International Nuclear Information System (INIS)
Lois, R.; Martinson, H.G.
1989-01-01
Posttranscriptional silencing of embryonic globin gene expression occurs during hemoglobin switching in chickens. Here the authors use Percoll density gradients to fractionate the red blood cells of 5-9 day embryos in order to determine the cellular source and the timing of this posttranscriptional process. By means of nuclear run-on transcription in vitro they show that it is within mature primitive cells that production of embryonic globin mRNA is terminated posttranscriptionally. In contrast, young definitive cells produce little (or no) embryonic globin mRNA because of regulation at the transcriptional level. Thus the lineage specificity of embryonic and adult globin gene expression is determined transcriptionally, and the posttranscriptional process described by Landes et al. is a property of the senescing primitive cells, not a mechanism operative in the hemoglobin switch. This conclusion is supported by [ 3 H]leucine incorporation experiments on Percoll-fractionated cells which reveal no posttranscriptional silencing of the embryonic genes during the early stages of the switch. In the course of these studies they have noticed a strong transcriptional pause near the second exon of the globin genes which is induced by 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) and which resembles a natural pause near that position
Meireles, C M; Czelusniak, J; Schneider, M P; Muniz, J A; Brigido, M C; Ferreira, H S; Goodman, M
1999-06-01
Nucleotide sequences, each spanning approximately 7 kb of the contiguous gamma1 and gamma2 globin genomic loci, were determined for seven species representing all extant genera (Ateles, Lagothrix, Brachyteles, and Alouatta) of the New World monkey subfamily Atelinae. After aligning these seven ateline sequences with outgroup sequences from several other primate (non-ateline) genera, they were analyzed by maximum parsimony, maximum likelihood, and neighbor-joining algorithms. All three analyzes estimated the same phylogenetic relationships: [Alouatta [Ateles (Brachyteles, Lagothrix)
International Nuclear Information System (INIS)
Helder, J.; Deisseroth, A.
1987-01-01
The loss of α-globin gene transcriptional activity rarely occurs as an acquired abnormality during the evolution of myeloproliferative disease or preleukemia. To test whether the mutation responsible for the loss of α-globin gene expression (hemoglobin H disease) in these patients is linked with the α-globin genes on chromosome 16, the authors transferred chromosome 16 from preleukemic patients with acquired hemoglobin H disease to mouse erythroleukemia cells and measured the transcriptional activity of the human α-globin genes. After transfer to mouse erythroleukemia cells, the expression of human α-globin genes from the peripheral blood or marrow cells of preleukemic patients with acquired hemoglobin H disease was similar to that of human α-globin genes transferred to mouse erythroleukemia cells from normal donors. These data showed that factor(s) in the mouse erythroleukemia cell can genetically complement the α-globin gene defect in these preleukemia patients with acquired hemoglobin H disease and suggest that altered expression of a gene in trans to the α-globin gene may be responsible for the acquisition of hemoglobin H disease in these patients
A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.
Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza
2014-07-01
In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.
Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies
Loucari, C.C. (Constantinos C.); Patsali, P. (Petros); T.B. van Dijk (Thamar); Stephanou, C. (Coralea); Papasavva, P. (Panayiota); Zanti, M. (Maria); Kurita, R. (Ryo); Nakamura, Y. (Yukio); S. Christou (Soteroula); Sitarou, M. (Maria); J.N.J. Philipsen (Sjaak); C.W. Lederer (Carsten); M. Kleanthous (Marina)
2018-01-01
textabstractThe β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of
Position-independent high level expression of the human β-globin gene in transgenic mice.
F.G. Grosveld (Frank); G. Blom van Assendelft (Greet); D.R. Greaves (David); G. Kollias (George)
1987-01-01
textabstractWe have constructed a "minilocus" that contains the 5' and 3' flanking regions of the human beta-globin locus and the beta-globin gene. These regions are characterized by erythroid-specific DNAase I-superhypersensitive sites and are normally located approximately 50 kb 5' and 20 kb 3' of
The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran
Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye
2017-01-01
Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378
Dominant control region of the human β- like globin gene cluster
Blom van Assendelft, Margaretha van
1989-01-01
The structure and regulation of the human β -like globin gene cluster has been studied extensively. Genetic disorders connected with this gene cluster are responsible for human diseases associated with high levels of morbidity and mortality, such as β-thalassaemia and sickle cell anaemia. The work
Energy Technology Data Exchange (ETDEWEB)
Louie, E.; Dietz, L.; Shafer, F. [Children`s Hosptial, Oakland, CA (United States)] [and others
1994-09-01
A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.
DEFF Research Database (Denmark)
Chin, Joanna Y; Kuan, Jean Y; Lonkar, Pallavi S
2008-01-01
Splice-site mutations in the beta-globin gene can lead to aberrant transcripts and decreased functional beta-globin, causing beta-thalassemia. Triplex-forming DNA oligonucleotides (TFOs) and peptide nucleic acids (PNAs) have been shown to stimulate recombination in reporter gene loci in mammalian...... DNA fragments, can promote single base-pair modification at the start of the second intron of the beta-globin gene, the site of a common thalassemia-associated mutation. This single base pair change was detected by the restoration of proper splicing of transcripts produced from a green fluorescent...
Nonsense mutations in the human β-globin gene affect mRNA metabolism
International Nuclear Information System (INIS)
Baserga, S.J.; Benz, E.J. Jr.
1988-01-01
A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation
A phylogenomic profile of globins
Directory of Open Access Journals (Sweden)
Dewilde Sylvia
2006-04-01
Full Text Available Abstract Background Globins occur in all three kingdoms of life: they can be classified into single-domain globins and chimeric globins. The latter comprise the flavohemoglobins with a C-terminal FAD-binding domain and the gene-regulating globin coupled sensors, with variable C-terminal domains. The single-domain globins encompass sequences related to chimeric globins and «truncated» hemoglobins with a 2-over-2 instead of the canonical 3-over-3 α-helical fold. Results A census of globins in 26 archaeal, 245 bacterial and 49 eukaryote genomes was carried out. Only ~25% of archaea have globins, including globin coupled sensors, related single domain globins and 2-over-2 globins. From one to seven globins per genome were found in ~65% of the bacterial genomes: the presence and number of globins are positively correlated with genome size. Globins appear to be mostly absent in Bacteroidetes/Chlorobi, Chlamydia, Lactobacillales, Mollicutes, Rickettsiales, Pastorellales and Spirochaetes. Single domain globins occur in metazoans and flavohemoglobins are found in fungi, diplomonads and mycetozoans. Although red algae have single domain globins, including 2-over-2 globins, the green algae and ciliates have only 2-over-2 globins. Plants have symbiotic and nonsymbiotic single domain hemoglobins and 2-over-2 hemoglobins. Over 90% of eukaryotes have globins: the nematode Caenorhabditis has the most putative globins, ~33. No globins occur in the parasitic, unicellular eukaryotes such as Encephalitozoon, Entamoeba, Plasmodium and Trypanosoma. Conclusion Although Bacteria have all three types of globins, Archaeado not have flavohemoglobins and Eukaryotes lack globin coupled sensors. Since the hemoglobins in organisms other than animals are enzymes or sensors, it is likely that the evolution of an oxygen transport function accompanied the emergence of multicellular animals.
International Nuclear Information System (INIS)
Melis, M.; Demopulos, G.; Najfeld, V.; Zhang, J.W.; Brice, M.; Papayannopoulou, T.; Stamatoyannopoulos, G.
1987-01-01
Hybrids formed by fusing mouse erythroleukemia (MEL) cells with human fetal erythroid cells produce human fetal globin, but they switch to adult globin production as culture time advances. To obtain information on the chromosomal assignment of the elements that control γ-to-β switching, the authors analyzed the chromosomal composition of hybrids producing exclusively or predominantly human fetal globin and hybrids producing only adult human globin. No human chromosome was consistently present in hybrids expressing fetal globin and consistently absent in hybrids expressing adult globin. Subcloning experiments demonstrated identical chromosomal compositions in subclones displaying the fetal globin program and those that had switched to expression of the adult globin program. These data indicate that retention of only one human chromosome -- i.e., chromosome 11 -- is sufficient for expression of human fetal globin and the subsequent γ-to-β switch. The results suggest that the γ-to-β switch is controlled either cis to the β-globin locus of by a trans-acting mechanism, the genes of which reside on human chromosome 11
International Nuclear Information System (INIS)
Evans, T.; Reitman, M.; Felsenfeld, G.
1988-01-01
The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites
Geographical distribution of β-globin gene mutations in Syria.
Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A
2018-04-11
Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.
Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P
1986-02-01
A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.
International Nuclear Information System (INIS)
Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru
2004-01-01
The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells
The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.
Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N
1985-01-01
The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.
Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.
Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi
2016-05-17
ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Xingguo Zhu
Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.
International Nuclear Information System (INIS)
Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.
1987-01-01
The predominant β-thalassemia in Sardinia is the β 0 type in which no β-globin chains are synthesized in the homozygous state. The authors determined the β-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same β/sup 39(CAG→TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the β-globin gene region
Hemolytic disease of the newborn caused by a new deletion of the entire beta-globin cluster.
Pirastu, M; Kan, Y W; Lin, C C; Baine, R M; Holbrook, C T
1983-01-01
We describe a new type of gamma delta beta-thalassemia in four generations of a family of Scotch-Irish descent. The proposita presented with hemolytic disease of the newborn, which was characterized by a microcytic anemia. Initial restriction endonuclease analysis of the DNA showed no grossly abnormal patterns, but studies of polymorphic restriction sites and gene dosage revealed an extensive deletion that removed all the beta- and beta-like globin genes from the affected chromosome. In situ ...
Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S
2017-12-30
Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.
Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S
2012-01-01
Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited
A Dual Reporter Mouse Model of the Human β-Globin Locus: Applications and Limitations
P. Papadopoulos (Petros); L. Gutiérrez (Laura); R. van der Linden (Reinier); J. Kong-a-San (John); A. Maas (Alex); D.D. Drabek (Dubravka); G.P. Patrinos (George); J.N.J. Philipsen (Sjaak); F.G. Grosveld (Frank)
2012-01-01
textabstractThe human β-globin locus contains the β-like globin genes (i.e. fetal γ-globin and adult β-globin), which heterotetramerize with α-globin subunits to form fetal or adult hemoglobin. Thalassemia is one of the commonest inherited disorders in the world, which results in quantitative
Directory of Open Access Journals (Sweden)
Giulia Breveglieri
2015-01-01
Full Text Available Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6 carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a the transgenic integration region is located in mouse chromosome 7; (b the expression of the transgene is tissue specific; (c as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia.
Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2015-01-01
Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845
International Nuclear Information System (INIS)
EL Serafi, T.I.; Ismail, E.F.; Mahmoud, M.A.; Mohamed, M.A.; Ghattas, M.H.; Badran, D.I.; El Serafi, I.T.; Mohamed, H.S.
2008-01-01
The beta-thalassemias (β- thalassemias) are among the most common autosomal recessive disorders. They have a remarkably high frequency in the Mediterranean region and represent one of the most common genetic diseases in Egypt. In this study, the spectrum of P- thalassemia mutations and genotype-to-phenotype correlations were defined in 32 β- thalassaemic patients (β- thalassemias major and intermedia) with varying disease severity in two cities of the Suez Canal region. Ten different mutations were identified and the most frequent ones were: Isi-6 (T-C) (37.5%), IVSI-110 (G-A) (34.4%) and both IVSI-1 (G-A), IVSII-745 (C-G) and -102 (C-G) (12.5% each). There was a wide spectrum of phenotypic severity in all patients. We studied the Xmnl polymorphism (C/T) in γ- globin gene position -158 of P- thalassemia as a modulating factor of the disease severity. Presence of the polymorphism was found in two patients and this was not sufficient to explain the diversity of the phenotype encountered. Co-inheritance of alpha thalassaemia as a modulating factor was not evident in our patients. In conclusion, we have been unable to find a molecular basis for the benign clinical course in all our patients. Other genetic or acquired factors must be hypothesized which ameliorate the clinical condition.
M. Sadelain (Michel); C.H.J. Wang (Jason); M. Antoniou (Michael); F.G. Grosveld (Frank); R.C. Mulligan
1995-01-01
textabstractRetrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and
Characterization of histone H3K27 modifications in the β-globin locus
International Nuclear Information System (INIS)
Kim, Yea Woon; Kim, AeRi
2011-01-01
Research highlights: → The β-globin locus control region is hyperacetylated and monomethylated at histone H3K27. → Highly transcribed globin genes are marked by H3K27ac, but H3K27me2 is remarkable at silent globin genes in erythroid K562 cells. → Association of PRC2 subunits is comparable with H3K27me3 pattern. → Modifications of histone H3K27 are established in an enhancer-dependent manner. -- Abstract: Histone H3K27 is acetylated or methylated in the environment of nuclear chromatin. Here, to characterize the modification pattern of H3K27 in locus control region (LCR) and to understand the correlation of various H3K27 modifications with transcriptional activity of genes, we analyzed the human β-globin locus using the ChIP assay. The LCR of the human β-globin locus was enriched by H3K27ac and H3K27me1 in erythroid K562 cells. The highly transcribed globin genes were hyperacetylated at H3K27, but the repressed globin genes were highly dimethylated at this lysine in these cells. However, in non-erythroid 293FT cells, the β-globin locus was marked by a high level of H3K27me3. EZH2 and SUZ12, subunits of polycomb repressive complex 2, were comparably detected with the H3K27me3 pattern in K562 and 293FT cells. In addition, H3K27ac, H3K27me1 and H3K27me3 were established in an enhancer-dependent manner in a model minichromosomal locus containing an enhancer and its target gene. Taken together, these results show that H3K27 modifications have distinctive correlations with the chromatin state or transcription level of genes and are influenced by an enhancer.
Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K
2017-07-01
In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.
Molecular analysis of the human β-globin locus activation region
International Nuclear Information System (INIS)
Forrester, W.C.; Novak, U.; Gelinas, R.; Groudine, M.
1989-01-01
Recently, DNA sequences containing four erythroid-specific DNase I hypersensitive sites within 20 kilobases 5' of the human ε-globin gene have been identified as an important cis-acting regulatory element, the locus activation region (LAR). Subfragments of the LAR, containing either all or only the two 5' or two 3' hypersensitive sites were linked to the human β-globin gene and analyzed for their effect on globin gene expression in stably transformed mouse erythroleukemia (MEL) cells. Constructs containing all four of the hypersensitive sites increase β-gobin mRNA levels 8- to 13-fold, while constructs with only the 5' or 3' sites increase globin expression to a lesser extent. No effect was seen when the constructs were assayed in 3T3 fibroblasts. All of the LAR derivatives form hypersensitive sites at the corresponding sequence position in MEL cells prior to and after induction of MEL cell differentiation. However, in 3T3 fibroblasts only the hypersensitive site corresponding to the previously described erythroid-specific -10.9 site was formed
Himelstein, A; Ward, M; Podda, S; de la Flor Weiss, E; Costantini, F; Bank, A
1993-03-01
When the human beta-globin gene is transferred into the bone marrow cells of live mice, its expression is very low. To investigate the reason for this, we transferred the bone marrow of transgenic mice containing and expressing the human beta-globin into irradiated recipients. We demonstrate that long-term high level expression of the human beta-globin gene can be maintained in the marrow and blood of irradiated recipients following transplantation. Although expression decreased over time in most animals because of host marrow reconstitution, the ratio of human beta-globin transgene expression to endogenous mouse beta-globin gene expression in donor-derived erythroid cells remained constant over time. We conclude that there is no inherent limitation to efficient expression of an exogenous human beta-globin gene in mouse bone marrow cells following marrow transplantation.
Directory of Open Access Journals (Sweden)
Jorge S.B.
2003-01-01
Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.
Directory of Open Access Journals (Sweden)
Zulema Romero
Full Text Available Lentiviral vectors designed for the treatment of the hemoglobinopathies require the inclusion of regulatory and strong enhancer elements to achieve sufficient expression of the β-globin transgene. Despite the inclusion of these elements, the efficacy of these vectors may be limited by transgene silencing due to the genomic environment surrounding the integration site. Barrier insulators can be used to give more consistent expression and resist silencing even with lower vector copies. Here, the barrier activity of an insulator element from the human ankyrin-1 gene was analyzed in a lentiviral vector carrying an antisickling human β-globin gene. Inclusion of a single copy of the Ankyrin insulator did not affect viral titer, and improved the consistency of expression from the vector in murine erythroleukemia cells. The presence of the Ankyrin insulator element did not change transgene expression in human hematopoietic cells in short-term erythroid culture or in vivo in primary murine transplants. However, analysis in secondary recipients showed that the lentiviral vector with the Ankyrin element preserved transgene expression, whereas expression from the vector lacking the Ankyrin insulator decreased in secondary recipients. These studies demonstrate that the Ankyrin insulator may improve long-term β-globin expression in hematopoietic stem cells for gene therapy of hemoglobinopathies.
Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.
2015-01-01
Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726
A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.
Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques
2016-01-01
We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.
NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran
2018-05-10
Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.
Genetic relationships among native americans based on b-globin gene cluster haplotype frequencies
Mousinho-Ribeiro Rita de Cassia; Pante-de-Sousa Gabriella; Santos Eduardo José Melo dos; Guerreiro João Farias
2003-01-01
The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village), Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13) had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - -) was the most common in all groups studied, with frequencies varying from 70% to 100%, followed...
Liebhaber, S A; Kan, Y W
1981-01-01
The alpha-globin polypeptide is encoded by two adjacent genes, alpha 1 and alpha 2. In the normal diploid state (alpha alpha/alpha alpha) all four alpha-globin genes are expressed. Loss or dysfunction of one or more of these genes leads to deficient alpha-globin production and results in alpha-thalassemia. We present a technique to differentially assess the steady-state levels of the alpha 1- and alpha-2-globin messenger RNA (mRNA) transcripts and thus delineate the relative level of expressi...
A membrane-bound vertebrate globin.
Directory of Open Access Journals (Sweden)
Miriam Blank
Full Text Available The family of vertebrate globins includes hemoglobin, myoglobin, and other O(2-binding proteins of yet unclear functions. Among these, globin X is restricted to fish and amphibians. Zebrafish (Danio rerio globin X is expressed at low levels in neurons of the central nervous system and appears to be associated with the sensory system. The protein harbors a unique N-terminal extension with putative N-myristoylation and S-palmitoylation sites, suggesting membrane-association. Intracellular localization and transport of globin X was studied in 3T3 cells employing green fluorescence protein fusion constructs. Both myristoylation and palmitoylation sites are required for correct targeting and membrane localization of globin X. To the best of our knowledge, this is the first time that a vertebrate globin has been identified as component of the cell membrane. Globin X has a hexacoordinate binding scheme and displays cooperative O(2 binding with a variable affinity (P(50∼1.3-12.5 torr, depending on buffer conditions. A respiratory function of globin X is unlikely, but analogous to some prokaryotic membrane-globins it may either protect the lipids in cell membrane from oxidation or may act as a redox-sensing or signaling protein.
In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.
Directory of Open Access Journals (Sweden)
Mohammed Alanazi
Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid
DEFF Research Database (Denmark)
Høgh, A M; Hviid, T V; Christensen, B
2001-01-01
BACKGROUND: Information about the appearance of gamma-, epsilon-, and zeta-globin mRNAs in fetal erythroblasts during gestation and about the presence and amounts of these mRNAs in pregnant and nonpregnant women is important from the perspective of using these molecules as a marker of fetal eryth...
the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia
International Nuclear Information System (INIS)
Abass, M.M.E.
2004-01-01
β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group
International Nuclear Information System (INIS)
Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.
1990-08-01
The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)
Genetic relationships among native americans based on beta-globin gene cluster haplotype frequencies
Directory of Open Access Journals (Sweden)
Rita de Cassia Mousinho-Ribeiro
2003-01-01
Full Text Available The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village, Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13 had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - - was the most common in all groups studied, with frequencies varying from 70% to 100%, followed by haplotype 6 (- + + - +, with frequencies between 7% and 18%. The frequency distribution of the b-globin gene haplotypes in the eighteen Brazilian Amerindian populations studied to date is characterized by a reduced number of haplotypes (average of 3.5 and low levels of heterozygosity and intrapopulational differentiation, with a single clearly predominant haplotype in most tribes (haplotype 2. The Parakanã, Urubú-Kaapór, Tiriyó and Xavante tribes constitute exceptions, presenting at least four haplotypes with relatively high frequencies. The closest genetic relationships were observed between the Brazilian and the Colombian Amerindians (Wayuu, Kamsa and Inga, and, to a lesser extent, with the Huichol of Mexico. North-American Amerindians are more differentiated and clearly separated from all other tribes, except the Xavante, from Brazil, and the Mapuche, from Argentina. A restricted pool of ancestral haplotypes may explain the low diversity observed among most present-day Brazilian and Colombian Amerindian groups, while interethnic admixture could be the most important factor to explain the high number of haplotypes and high levels of diversity observed in some South-American and most North-American tribes.
Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi
2005-11-01
Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.
International Nuclear Information System (INIS)
Moon, A.M.; Ley, T.J.
1990-01-01
DNA sequences located in a region 6-18 kilobases (kb) upstream from the human ε-globin gene are known as the locus-activating region (LAR) or dominant control region. This region is thought to play a key role in chromatin organization of the β-like globin gene cluster during erythroid development. Since the human β-globin LAR is functional in mice, the authors reasoned that critical LAR sequence elements might be conserved between mice and humans. They therefore cloned murine genomic sequences homologous to one portion of the human LAR. They found that this murine DNA fragment (mouse LAR site II) and sequences homologous to human LAR sites I and III are located upstream from the mouse β-like globin gene cluster and determined that their locations relative to the cluster are similar to that of their human counterparts. The homologous site II sequences are 70% identical between mice and humans over a stretch of ∼800 base pairs. These results suggest that primary structural elements endash and the spatial organization of these elements endash are important for function of the β-globin LAR
The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.
Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel
2012-01-01
Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.
Nuclear topography of beta-like globin gene cluster in IL-3-stimulated human leukemic K-562 cells
Czech Academy of Sciences Publication Activity Database
Galiová-Šustáčková, Gabriela; Bártová, Eva; Kozubek, Stanislav
2004-01-01
Roč. 33, č. 1 (2004), s. 4-14 ISSN 1079-9796 R&D Projects: GA ČR GA301/01/0186; GA AV ČR KSK5052113; GA AV ČR IAA5004306; GA ČR GA202/04/0907; GA MŠk ME 565 Institutional research plan: CEZ:AV0Z5004920 Keywords : beta-like globin gene cluster * K-562 cells * nuclear topography Subject RIV: BO - Biophysics Impact factor: 2.549, year: 2004
Search for antisense copies of beta-globin mRNA in anemic mouse spleen
Directory of Open Access Journals (Sweden)
Taylor John M
2001-03-01
Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.
Vinciguerra, Margherita; Passarello, Cristina; Leto, Filippo; Cassarà, Filippo; Cannata, Monica; Maggio, Aurelio; Giambona, Antonino
2015-04-01
Nearly 1183 different molecular defects of the globin genes leading to hemoglobin variants have been identified (http://globin.bx.psu.edu) over the past decades. The purpose of this study was to report three cases, never described in the literature, of co-inheritance of three β hemoglobin variants with other alterations in globin genes and to evaluate the clinical significance to conduct an appropriate genetic counseling. We report the molecular study performed in three probands and their families, sampling during the screening program conducted at the Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at Villa Sofia-Cervello Hospital in Palermo, Italy. This work allowed us to describe the co-inheritance of three rare β hemoglobin variants with other alterations in globin genes: the β hemoglobin variant Hb Yaounde [β134(H12)Val>Ala], found for the first time in combination with ααα(anti3.7) arrangement, and the β hemoglobin variants Hb Görwihl [β5(A2)Pro>Ala] and Hb City of Hope [β69(E13)Gly>Ser], found both in association with β(0) -thalassemia. The present work emphasizes the importance of a careful evaluation of the hematological data, especially in cases of atypical hematological parameters, to carry out an adequate and complete molecular study and to formulate an appropriate genetic counseling for couples at risk. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F
2014-06-01
Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.
Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein
2015-01-01
Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.
Directory of Open Access Journals (Sweden)
Heesun Shin
Full Text Available BACKGROUND: The molecular profile of circulating blood can reflect physiological and pathological events occurring in other tissues and organs of the body and delivers a comprehensive view of the status of the immune system. Blood has been useful in studying the pathobiology of many diseases. It is accessible and easily collected making it ideally suited to the development of diagnostic biomarker tests. The blood transcriptome has a high complement of globin RNA that could potentially saturate next-generation sequencing platforms, masking lower abundance transcripts. Methods to deplete globin mRNA are available, but their effect has not been comprehensively studied in peripheral whole blood RNA-Seq data. In this study we aimed to assess technical variability associated with globin depletion in addition to assessing general technical variability in RNA-Seq from whole blood derived samples. RESULTS: We compared technical and biological replicates having undergone globin depletion or not and found that the experimental globin depletion protocol employed removed approximately 80% of globin transcripts, improved the correlation of technical replicates, allowed for reliable detection of thousands of additional transcripts and generally increased transcript abundance measures. Differential expression analysis revealed thousands of genes significantly up-regulated as a result of globin depletion. In addition, globin depletion resulted in the down-regulation of genes involved in both iron and zinc metal ion bonding. CONCLUSIONS: Globin depletion appears to meaningfully improve the quality of peripheral whole blood RNA-Seq data, and may improve our ability to detect true biological variation. Some concerns remain, however. Key amongst them the significant reduction in RNA yields following globin depletion. More generally, our investigation of technical and biological variation with and without globin depletion finds that high-throughput sequencing by RNA
R. Calzolari (Roberta); T. McMorrow (Tara); N. Yannoutsos (Nikos); A. Langeveld (An); F.G. Grosveld (Frank)
1999-01-01
textabstractThe analysis of a number of cases of beta-globin thalassemia and hereditary persistence of fetal hemoglobin (HPFH) due to large deletions in the beta-globin locus has led to the identification of several DNA elements that have been implicated in the switch
International Nuclear Information System (INIS)
Studencki, A.B.; Wallace, R.B.
1984-01-01
The repair activity of E. coli DNA polymerase I (Klenow fragment) was used to prepare nonadecanucleotide hybridization probes which were complementary either to the normal human β-globin (β/sup A/) or to the sickle cell human β-globin (β/sup S/) gene. Template directed polymerization of highly radiolabeled α-/sup 32/P-deoxyribonucleoside triphosphates (3200, 5000 and/or 7800 Ci/mmol) onto nonamer and decamer primers produced probes with specific activities ranging from 1.0 - 2.0 x 10/sup 10/ dpm/μg. The extremely high specific activities of these probes made it possible to detect the β/sup A/ and β/sup S/ single copy gene sequences in as little as 1 μg of total human genomic DNA as well as to discriminate between the homozygous and heterozygous states. This means that it was possible to detect 0.5 - 1.0 x 10/sup -18/ moles of a given single copy sequence
Two α1-Globin Gene Point Mutations Causing Severe Hb H Disease.
Jiang, Hua; Huang, Lv-Yin; Zhen, Li; Jiang, Fan; Li, Dong-Zhi
Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zürich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- - SEA ) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - - SEA deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α 0 -thal carrier.
Directory of Open Access Journals (Sweden)
Amanda J Grieco
Full Text Available The molecular mechanisms governing γ-globin expression in a subset of fetal hemoglobin (α2γ2: HbF expressing red blood cells (F-cells and the mechanisms underlying the variability of response to hydroxyurea induced γ-globin expression in the treatment of sickle cell disease are not completely understood. Here we analyzed intra-person clonal populations of basophilic erythroblasts (baso-Es derived from bone marrow common myeloid progenitors in serum free cultures and report the level of fetal hemoglobin production in F-cells negatively correlates with expression of BCL11A, KLF1 and TAL1. We then examined the effects of hydroxyurea on these three transcription factors and conclude that a successful induction of γ-globin includes a reduction in BCL11A, KLF1 and TAL1 expression. These data suggests that expression changes in this transcription factor network modulate γ-globin expression in F-cells during steady state erythropoiesis and after induction with hydroxyurea.
Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2013-01-01
In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011
Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip
2018-03-01
There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.
Investigation of benzo(a)pyrene-globin adducts
Energy Technology Data Exchange (ETDEWEB)
Wallin, H; Jeffre, A M; Santella, R M
1987-05-01
The nature of the adducts formed between benzo(a)pyrene (BP) and globin were investigated in animals treated with (/sup 3/H)BP. Modification levels on globin were determined by radioactivity measurements. Since BP tetraols can be released from benzo(a)pyrene diol epoxide modified protein and DNA by acid treatment, globin samples were treated with acid, released tetraols separated by HPLC and quantitated by scintillation counting. In addition, acid released material was measured in competitive enzyme linked immunosorbent assay (ELISA) using antibodies which recognize BP tetraols. Both measurements indicate that only 2% of bound radioactivity could be released as free BP tetraols. These studies indicate that benzo(a)pyrene diol epoxide may not be the major metabolite of BP involved in globin binding. (author). 14 refs.
International Nuclear Information System (INIS)
Caterina, J.J.; Ryan, T.M.; Pawlik, K.M.; Townes, T.M.; Brinster, R.L.; Behringer, R.R.; Palmiter, R.D.
1991-01-01
The human β-globin locus control region (LCR) is essential for high-level expression of human var-epsilon-, γ-, and β-globin genes. Developmentally stable DNase I hypersensitive sites (designated HS) mark sequences within this region that are important for LCR activity. A 1.9-kilobase (kb) fragment containing the 5' HS 2 site enhances human β-globin gene expression 100-fold in transgenic mice and also confers position-independent expression. To further define important sequences within this region, deletion mutations of the 1.9-kb fragment were introduced upstream of the human β-globin gene, and the constructs were tested for activity in transgenic mice. Although enhancer activity was gradually lost with deletion of both 5' and 3' sequences, a 373-base-pair (BP) fragment retained the ability to confer relative position-independent expression. Three prominent DNase I footprints were observed in this region with extracts from the human erythroleukemia cell line K-562, one of which contained duplicated binding sites for transcription factor AP-1 (activator protein 1). When the 1.9-kb fragment containing an 19-bp deletion of the AP-1 binding sites was tested in transgenic mice, enhancer activity decreased 20-fold but position-independent expression was retained
Directory of Open Access Journals (Sweden)
Elza Miyuki Kimura
2015-04-01
Full Text Available Background: Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods: A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC. Mutations were identified by molecular analyses, and the oxygen affinity, heme-heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results: Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion: The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations.
Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor
2016-01-01
Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702
Evolutionary and functional properties of a two-locus β-globin polymorphism in Indian house mice
DEFF Research Database (Denmark)
Runck, Amy M; Weber, Roy E.; Fago, Angela
2010-01-01
exceeded neutral expectations, and reconstructed haplotype networks for both β-globin paralogs revealed extensive allele sharing with several other closely related species of Mus. However, despite this suggestive evidence for balancing selection, O2-equilibrium curves revealed no discernible functional......Electrophoretic surveys of hemoglobin (Hb) polymorphism in house mice from South Asia and the Middle East have revealed that two alternative β-globin haplotypes, Hbbd and Hbbp, are often present at intermediate frequencies in geographically disparate populations. Both haplotypes harbor two......) are distinguished by two amino acid substitutions. To investigate the possible adaptive significance of the Hbbd/Hbbp polymorphism we conducted a population genetic analysis of the duplicated β-globin genes of Indian house mice (Mus castaneus) in conjunction with experimental studies of Hb function in inbred...
Diversity of [beta]-globin mutations in Israeli ethnic groups reflects recent historic events
Energy Technology Data Exchange (ETDEWEB)
Filon, D.; Oron, V.; Krichevski, S.; Shaag, A.; Goldfarb, A.; Aker, M.; Rachmilewitz, E.A.; Rund, D.; Oppenheim, A. (Hebrew Univ. Hadassah-Medical School, Jerusalem (Israel)) (and others)
1994-05-01
The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsense codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.
International Nuclear Information System (INIS)
Somaya, E.T.; Soliman, M.D
2010-01-01
The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)
Kaushik, Mahima; Kukreti, Shrikant
2015-01-01
Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.
Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C
2011-01-01
Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.
Sox6 directly silences epsilon globin expression in definitive erythropoiesis.
Directory of Open Access Journals (Sweden)
2006-02-01
Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.
Investigation of epigenetic gene regulation in Arabidopsis modulated by gamma radiation
International Nuclear Information System (INIS)
Woo, Hye Ryun; Kim, Jae Sung; Lee, Myung Jin; Lee, Dong Joon; Kim, Young Min; Jung, Joon Yong; Han, Wan Keun; Kang, Soo Jin
2011-12-01
To investigate epigenetic gene regulation in Arabidopsis modulated by gamma radiation, we examined the changes in DNA methylation and histone modification after gamma radiation and investigated the effects of gamma radiation on epigenetic information and gene expression. We have selected 14 genes with changes in DNA methylation by gamma radiation, analyzed the changes of histone modification in the selected genes to reveal the relationship between DNA methylation and histone modification by gamma radiation. We have also analyzed the effects of gamma radiation on gene expression to investigate the relationship between epigenetic information and gene expression by gamma radiation. The results will be useful to reveal the effects of gamma radiation on DNA methylation, histone modification and gene expression. We anticipate that the information generated in this proposal will help to find out the mechanism underlying the changes in epigenetic information by gamma radiation
D'Surney, S. J.; Popp, R. A.
1992-01-01
Oxygen association-dissociation and hemoglobin stability analysis were performed on mouse hemoglobins with amino acid substitutions in an α-globin (α89, His to Leu) and a β-globin (β59, Lys to Ile). The variant α-globin, designated chain 5(m) in the Hba(g2) haplotype, had a high oxygen affinity and was stable. The variant β-globin, (β(s2)) of the Hbb(s2) haplotype, also had an elevated oxygen affinity and in addition was moderately unstable in 19% isopropanol. Hemoglobins from the expected nine (Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) X Hba(a)/Hba(a);Hbb(s2)/Hbb(s2)) F(2) genotypes can be grouped into five classes of P(50) values characterized by strict additivity and dependency on mutant globin gene dosage; physiologically, both globin variants gave indistinguishable effects on oxygen affinity. The hemoglobin of normal mice (Hba(a)/Hba(a);Hbb(s)/Hbb(s)) had a P(50) = 40 mm Hg and the hemoglobin of Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) F(2) mice had a P(50) = 25 mm Hg (human P(50) = 26 mm Hg). Peripheral blood from Hba(g2)/Hba(g2);Hbb(s)/Hbb(s), Hba(a)/Hba(a);Hbb(s2)/Hbb(s2) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice exhibited normal hematological values except for a slightly higher hematocrit for Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice, slightly elevated red cell counts for mice of the three mutant genotypes, and significantly lower values for the mean corpuscular volume and mean corpuscular hemoglobin for Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice. PMID:1427042
Gene expression profiling in cells with enhanced gamma-secretase activity.
Directory of Open Access Journals (Sweden)
Alexandra I Magold
2009-09-01
Full Text Available Processing by gamma-secretase of many type-I membrane protein substrates triggers signaling cascades by releasing intracellular domains (ICDs that, following nuclear translocation, modulate the transcription of different genes regulating a diverse array of cellular and biological processes. Because the list of gamma-secretase substrates is growing quickly and this enzyme is a cancer and Alzheimer's disease therapeutic target, the mapping of gamma-secretase activity susceptible gene transcription is important for sharpening our view of specific affected genes, molecular functions and biological pathways.To identify genes and molecular functions transcriptionally affected by gamma-secretase activity, the cellular transcriptomes of Chinese hamster ovary (CHO cells with enhanced and inhibited gamma-secretase activity were analyzed and compared by cDNA microarray. The functional clustering by FatiGO of the 1,981 identified genes revealed over- and under-represented groups with multiple activities and functions. Single genes with the most pronounced transcriptional susceptibility to gamma-secretase activity were evaluated by real-time PCR. Among the 21 validated genes, the strikingly decreased transcription of PTPRG and AMN1 and increased transcription of UPP1 potentially support data on cell cycle disturbances relevant to cancer, stem cell and neurodegenerative diseases' research. The mapping of interactions of proteins encoded by the validated genes exclusively relied on evidence-based data and revealed broad effects on Wnt pathway members, including WNT3A and DVL3. Intriguingly, the transcription of TERA, a gene of unknown function, is affected by gamma-secretase activity and was significantly altered in the analyzed human Alzheimer's disease brain cortices.Investigating the effects of gamma-secretase activity on gene transcription has revealed several affected clusters of molecular functions and, more specifically, 21 genes that hold significant
Energy Technology Data Exchange (ETDEWEB)
Ross, J
1976-09-15
In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.
DEFF Research Database (Denmark)
Lonkar, Pallavi; Kim, Ki-Hyun; Kuan, Jean Y
2009-01-01
Beta-thalassemia is a genetic disorder caused by mutations in the beta-globin gene. Triplex-forming oligonucleotides and triplex-forming peptide nucleic acids (PNAs) have been shown to stimulate recombination in mammalian cells via site-specific binding and creation of altered helical structures...
Spectrin interactions with globin chains in the presence of ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
chains, respectively. The fluorescence-binding data, on the other hand, revealed a larger number of about 80 globin chains binding to spectrin. Cross-linked aggregates of haemoglobin/globin and spectrin have been found under different pathophysiological conditions, e.g. in senescent red blood cells, under oxidative.
Directory of Open Access Journals (Sweden)
Anita Nadkarni
2013-02-01
Full Text Available The clinical presentation of b-thalassemia intermedia phenotypes are influenced by many factors .The persistence of fetal hemoglobin and several polymorphisms located in the promoters of g- and b-globin genes are some of them .The aim of this study was to evaluate the combined effect of the -158Gg (CàT polymorphism and of the (ATx(Ty configuration, as well as their eventual association with elevated levels of HbF in b-thalassemia carriers, b-thalassemia Intermedia , b-thalassemia major and normal controls of Indian origin. The -158 Gg T allele was found to be associated with increased levels of HbF in b-thalassemia carriers, and not in wild-type subjects. In the homozygous group the -158 Gg T allele was significantly higher in the thalassemia intermedia group (66% as against the thalassemia major group (21%. The (AT9(T5 allele did not show any association with raised HbF levels. However 24% of milder cases showed presence of this allele. This study suggests that two regions of the b globin cluster, whether in cis or in trans to each other, can interact to enhance HbF expression when a b thalassemic determinant is present in heterozigosity and help in amelioration of the severity of the disease in homozygotes.
Junier, Ivan; Dale, Ryan K.; Hou, Chunhui; Képès, François; Dean, Ann
2012-01-01
International audience; The principles underlying the architectural landscape of chromatin beyond the nucleosome level in living cells remains largely unknown despite its potential to play a role in mammalian gene regulation. We investigated the three-dimensional folding of a 1 Mbp region of human chromosome 11 containing the β-globin genes by integrating looping interactions of the CCCTC-binding insulator protein CTCF determined comprehensively by chromosome conformation capture (3C) into a ...
Energy Technology Data Exchange (ETDEWEB)
Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)
1994-09-01
Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. We have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.
Van Doorslaer, Sabine; Cuypers, Bert
2018-02-01
At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.
Phenotypic variability of Filipino beta(o)-thalassemia/HbE patients in Indonesia.
Setianingsih, I; Williamson, R; Daud, D; Harahap, A; Marzuki, S; Forrest, S
1999-09-01
Three Indonesian patients with identical genotypes, each compound heterozygotes for Filipino beta(o)-thalassemia/HbE, expressed different clinical severities. One patient has mild disease and is transfusion independent, while the other two are severely affected and transfusion dependent. The size of the Filipino beta(o)-globin gene deletion was confirmed to be 45 kb, resolving conflicting values given in the literature. Neither ameliorating genetic factors such as alpha-globin gene deletions or the XmnI restriction site polymorphism at position -158 upstream of the (G)gamma-globin gene, nor differences in beta-globin gene haplotype, explain the phenotypic variation. These observations have implications for the development of antenatal diagnosis in Indonesia, as at present it is not possible to give an accurate prediction of severity of phenotype for this common genotype. Copyright 1999 Wiley-Liss, Inc.
International Nuclear Information System (INIS)
Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.
1988-01-01
Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa
Size Polymorphism in Alleles of the Myoglobin Gene from Biomphalaria Mollusks
Directory of Open Access Journals (Sweden)
Marcelo M. Santoro
2010-10-01
Full Text Available Introns are common among all eukaryotes, while only a limited number of introns are found in prokaryotes. Globin and globin-like proteins are widely distributed in nature, being found even in prokaryotes and a wide range of patterns of intron-exon have been reported in several eukaryotic globin genes. Globin genes in invertebrates show considerable variation in the positions of introns; globins can be found without introns, with only one intron or with three introns in different positions. In this work we analyzed the introns in the myoglobin gene from Biomphalaria glabrata, B. straminea and B. tenagophila. In the Biomphalaria genus, the myoglobin gene has three introns; these were amplified by PCR and analyzed by PCR-RFLP. Results showed that the size (number or nucleotides and the nucleotide sequence of the coding gene of the myoglobin are variable in the three species. We observed the presence of size polymorphisms in intron 2 and 3; this characterizes a homozygous/heterozygous profile and it indicates the existence of two alleles which are different in size in each species of Biomphalaria. This polymorphism could be explored for specific identification of Biomphalaria individuals.
Role of novel and rare nucleotide substitutions of the β-globin gene
Directory of Open Access Journals (Sweden)
Margherita Vinciguerra
2012-11-01
Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序,旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段:1)血液及血红蛋白数据;2)珠蛋白基因分子分析以及家族遗传研究(如有可能)。 自2003年以来,我们已对这类病例进行DNA序列分析:传统的分子方法无法给出完整的诊断响应,尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。
Opposite responses of rabbit and human globin mRNAs to translational inhibition by cap analogues
International Nuclear Information System (INIS)
Shakin, S.H.; Liebhaber, S.A.
1987-01-01
The translational efficiency of an mRNA may be determined at the step of translational initiation by the efficiency of its interaction with the cap binding protein complex. To further investigate the role of these interactions in translational control, the authors compare in vitro the relative sensitivities of rabbit and human α- and β-globin mRNAs to translational inhibition by cap analogues. They find that rabbit β-globin mRNA is more resistant to translational inhibition by cap analogues than rabbit α-globin mRNA, while in contrast, human β-globin mRNA is more sensitive to cap analogue inhibition than human α- and β-globin mRNAs is unexpected as direct in vivo and in vitro comparisons of polysome profiles reveal parallel translational handling of the α- and β-globin mRNAs from these two species. This discordance between the relative translational sensitivities of these mRNAs to cap analogues and their relative ribosome loading activities suggests that cap-dependent events may not be rate limiting in steady-state globin translation
Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo
2013-12-01
Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events.
Hemoglobin genetics: recent contributions of GWAS and gene editing
Smith, Elenoe C.; Orkin, Stuart H.
2016-01-01
The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226
PPAR{gamma} regulates the expression of cholesterol metabolism genes in alveolar macrophages
Energy Technology Data Exchange (ETDEWEB)
Baker, Anna D.; Malur, Anagha; Barna, Barbara P.; Kavuru, Mani S. [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Malur, Achut G. [Department of Microbiology and Immunology, East Carolina University (United States); Thomassen, Mary Jane, E-mail: thomassenm@ecu.edu [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Department of Microbiology and Immunology, East Carolina University (United States)
2010-03-19
Peroxisome proliferator-activated receptor-gamma (PPAR{gamma}) is a nuclear transcription factor involved in lipid metabolism that is constitutively expressed in the alveolar macrophages of healthy individuals. PPAR{gamma} has recently been implicated in the catabolism of surfactant by alveolar macrophages, specifically the cholesterol component of surfactant while the mechanism remains unclear. Studies from other tissue macrophages have shown that PPAR{gamma} regulates cholesterol influx, efflux, and metabolism. PPAR{gamma} promotes cholesterol efflux through the liver X receptor-alpha (LXR{alpha}) and ATP-binding cassette G1 (ABCG1). We have recently shown that macrophage-specific PPAR{gamma} knockout (PPAR{gamma} KO) mice accumulate cholesterol-laden alveolar macrophages that exhibit decreased expression of LXR{alpha} and ABCG1 and reduced cholesterol efflux. We hypothesized that in addition to the dysregulation of these cholesterol efflux genes, the expression of genes involved in cholesterol synthesis and influx was also dysregulated and that replacement of PPAR{gamma} would restore regulation of these genes. To investigate this hypothesis, we have utilized a Lentivirus expression system (Lenti-PPAR{gamma}) to restore PPAR{gamma} expression in the alveolar macrophages of PPAR{gamma} KO mice. Our results show that the alveolar macrophages of PPAR{gamma} KO mice have decreased expression of key cholesterol synthesis genes and increased expression of cholesterol receptors CD36 and scavenger receptor A-I (SRA-I). The replacement of PPAR{gamma} (1) induced transcription of LXR{alpha} and ABCG1; (2) corrected suppressed expression of cholesterol synthesis genes; and (3) enhanced the expression of scavenger receptors CD36. These results suggest that PPAR{gamma} regulates cholesterol metabolism in alveolar macrophages.
VNTR alleles associated with the {alpha}-globin locus are haplotype and population related
Energy Technology Data Exchange (ETDEWEB)
Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)
1994-09-01
The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.
Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.
2014-01-01
β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969
Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein
2018-03-01
β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.
Gene duplication and the evolution of hemoglobin isoform differentiation in birds.
Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F
2012-11-02
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.
Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*
Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.
2012-01-01
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007
Brain alpha- and beta-globin expression after intracerebral hemorrhage
He, Yangdong; Hua, Ya; Lee, Jin-Yul; Liu, Wenquan; Keep, Richard F; Wang, Michael M.; Xi, Guohua
2010-01-01
Our recent study has demonstrated that hemoglobin (Hb) is present in cerebral neurons and neuronal Hb is inducible after cerebral ischemia. In the present study, we examined the effects of intracerebral hemorrhage (ICH) on the mRNA levels of the α-globin (HbA) and the β-globin (HbB) components of Hb and Hb protein in the brain in vivo and in vitro. In vivo, male Sprague-Dawley rats received either a needle insertion (sham) or an infusion of autologous whole blood into the basal ganglia and we...
DEFF Research Database (Denmark)
Leffers, H; Navarro, V M; Nielsen, John E
2006-01-01
Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element in the neuroe......Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element......, we screened for differentially expressed genes at the pituitary and hypothalamus of rats after neonatal exposure to estradiol benzoate. Our analyses identified persistent up-regulation of alpha- and beta-globin mRNAs at the pituitary following neonatal estrogenization. This finding was confirmed...... by combination of RT-PCR analyses and in situ hybridization. Induction of alpha- and beta-globin mRNA expression at the pituitary by neonatal exposure to estrogen was demonstrated as dose-dependent and it was persistently detected up to puberty. In contrast, durable up-regulation of alpha- and beta-globin genes...
Directory of Open Access Journals (Sweden)
Ze Tian
Full Text Available Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study.We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal.We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study.
Immunopurification of the suppressor tRNA dependent rabbit β-globin readthrough protein
International Nuclear Information System (INIS)
Hatfield, D.; Thorgeirsson, S.S.; Copeland, T.D.; Oroszlan, S.; Bustin, M.
1988-01-01
In mammalian cells, the rabbit β-globin readthrough protein is the only known example of a naturally occurring readthrough protein which does not involve a viral system. To provide an efficient means for its isolation, detection, and study, the authors elicited specific antibodies against this unique protein. The 22 amino acid peptide corresponding to the readthrough portion of this protein was synthesized, coupled to keyhole limpet hemocyanin, and injected into sheep. Specific antibodies to the peptide were produced as demonstrated by the enzyme-linked immunosorbent assay technique and by immunoblotting. The antibodies did not react with globin. The rabbit β-globin readthrough protein was separated from globin and other reticulocyte proteins by polyacrylamide gel electrophoresis and visualized by silver staining or by labeling with [ 35 S] methionine. Incorporation of [ 35 S] methionine into the readthrough protein was significantly enhanced upon addition of an opal suppressor tRNA to reticulocyte lysates. Immunoblotting revealed that the readthrough protein also occurs in lysates without added suppressor tRNA. The antibodies were purified on an affi-gel column which had been coupled with the peptide antigen. The readthrough protein was then purified from reticulocytes by immunoaffinity chromatography and by high-performance liquid chromatography. The results provide conclusive evidence that the β-globin readthrough protein is naturally occurring in rabbit reticulocytes
Recent trends in the gene therapy of β-thalassemia
Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto
2015-01-01
The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641
Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M
2014-05-13
Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.
Directory of Open Access Journals (Sweden)
Lesley Tilleman
Full Text Available Globins occur in all kingdoms of life where they fulfill a wide variety of functions. In the past they used to be primarily characterized as oxygen transport/storage proteins, but since the discovery of new members of the globin family like neuroglobin and cytoglobin, more diverse and complex functions have been assigned to this heterogeneous family. Here we propose a function for a membrane-bound globin of C. elegans, GLB-26. This globin was predicted to be myristoylated at its N-terminus, a post-translational modification only recently described in the globin family. In vivo, this globin is found in the membrane of the head mesodermal cell and in the tail stomato-intestinal and anal depressor muscle cells. Since GLB-26 is almost directly oxidized when exposed to oxygen, we postulate a possible function as electron transfer protein. Phenotypical studies show that GLB-26 takes part in regulating the length of the defecation cycle in C. elegans under oxidative stress conditions.
Gene Therapy Approaches to Hemoglobinopathies.
Ferrari, Giuliana; Cavazzana, Marina; Mavilio, Fulvio
2017-10-01
Gene therapy for hemoglobinopathies is currently based on transplantation of autologous hematopoietic stem cells genetically modified with a lentiviral vector expressing a globin gene under the control of globin transcriptional regulatory elements. Preclinical and early clinical studies showed the safety and potential efficacy of this therapeutic approach as well as the hurdles still limiting its general application. In addition, for both beta-thalassemia and sickle cell disease, an altered bone marrow microenvironment reduces the efficiency of stem cell harvesting as well as engraftment. These hurdles need be addressed for gene therapy for hemoglobinopathies to become a clinical reality. Copyright © 2017 Elsevier Inc. All rights reserved.
Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T
1993-12-22
The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.
Oxygen binding properties of non-mammalian nerve globins
DEFF Research Database (Denmark)
Hundahl, Christian; Fago, Angela; Dewilde, Sylvia
2006-01-01
Oxygen-binding globins occur in the nervous systems of both invertebrates and vertebrates. While the function of invertebrate nerve haemoglobins as oxygen stores that extend neural excitability under hypoxia has been convincingly demonstrated, the physiological role of vertebrate neuroglobins...... is less well understood. Here we provide a detailed analysis of the oxygenation characteristics of nerve haemoglobins from an annelid (Aphrodite aculeata), a nemertean (Cerebratulus lacteus) and a bivalve (Spisula solidissima) and of neuroglobin from zebrafish (Danio rerio). The functional differences...... have been related to haem coordination: the haem is pentacoordinate (as in human haemoglobin and myoglobin) in A. aculeata and C. lacteus nerve haemoglobins and hexacoordinate in S. solidissima nerve haemoglobin and D. rerio neuroglobin. Whereas pentacoordinate nerve globins lacked Bohr effects at all...
alpha-Globin genes: thalassemic and structural alterations in a Brazilian population
Directory of Open Access Journals (Sweden)
M.R.S.C. Wenning
2000-09-01
Full Text Available Seven unrelated patients with hemoglobin (Hb H disease and 27 individuals with alpha-chain structural alterations were studied to identify the alpha-globin gene mutations present in the population of Southeast Brazil. The -alpha3.7, --MED and -(alpha20.5 deletions were investigated by PCR, whereas non-deletional alpha-thalassemia (alphaHphalpha, alphaNcoIalpha, aaNcoI, alphaIcalpha and alphaTSaudialpha was screened with restriction enzymes and by nested PCR. Structural alterations were identified by direct DNA sequencing. Of the seven patients with Hb H disease, all of Italian descent, two had the -(alpha20.5/-alpha3.7 genotype, one had the --MED/-alpha3.7 genotype, one had the --MED/alphaHphalpha genotype and three showed interaction of the -alpha3.7 deletion with an unusual, unidentified form of non-deletional alpha-thalassemia [-alpha3.7/(aaT]. Among the 27 patients with structural alterations, 15 (of Italian descent had Hb Hasharon (alpha47Asp->His associated with the -alpha3.7 deletion, 4 (of Italian descent were heterozygous for Hb J-Rovigo (alpha53Ala->Asp, 4 (3 Blacks and 1 Caucasian were heterozygous for Hb Stanleyville-II (alpha78Asn->Lys associated with the alpha+-thalassemia, 1 (Black was heterozygous for Hb G-Pest (alpha74Asp->Asn, 1 (Caucasian was heterozygous for Hb Kurosaki (alpha7Lys->Glu, 1 (Caucasian was heterozygous for Hb Westmead (alpha122His->Gln, and 1 (Caucasian was the carrier of a novel silent variant (Hb Campinas, alpha26Ala->Val. Most of the mutations found reflected the Mediterranean and African origins of the population. Hbs G-Pest and Kurosaki, very rare, and Hb Westmead, common in southern China, were initially described in individuals of ethnic origin differing from those of the carriers reported in the present study and are the first cases to be reported in the Brazilian population.
Directory of Open Access Journals (Sweden)
Marta Durlak
Full Text Available The identification of drugs capable of reactivating γ-globin to ameliorate β-thalassemia and Sickle Cell anemia is still a challenge, as available γ-globin inducers still have limited clinical indications. High-throughput screenings (HTS aimed to identify new potentially therapeutic drugs require suitable first-step-screening methods combining the possibility to detect variation in the γ/β globin ratio with the robustness of a cell line. We took advantage of a K562 cell line variant expressing β-globin (β-K562 to set up a new multiplexed high-content immunofluorescence assay for the quantification of γ- and β-globin content at single-cell level. The assay was validated by using the known globin inducers hemin, hydroxyurea and butyric acid and further tested in a pilot screening that confirmed HDACs as targets for γ-globin induction (as proved by siRNA-mediated HDAC3 knockdown and by treatment with HDACs inhibitors entinostat and dacinostat and identified Heme-oxygenases as novel candidate targets for γ-globin induction. Indeed, Heme-oxygenase2 siRNA knockdown as well as its inhibition by Tin protoporphyrin-IX (TinPPIX greatly increased γ-globin expression. This result is particularly interesting as several metalloporphyrins have already been developed for clinical uses and could be tested (alone or in combination with other drugs to improve pharmacological γ-globin reactivation for the treatment of β-hemoglobinopathies.
Effect of gamma irradiation on the α and β chains of bovine hemoglobin and globin
International Nuclear Information System (INIS)
Duda, W.
1981-01-01
Hemoglobin was obtained from the blood of lowland black and white cattle with HbA phenotype. Water solutions of hemoglobin (Hb) or globin (Gl) in 20 mM KH 2 PO 4 were γ-irradiated with a dose of 2 Mrad, and the amino acid composition of α and β chains of control and irradiated Hb and Gl was analyzed. Quantitative differences were found between the radiation sensitivities of α and β chains of Hb and Gl. A sequence of radiation sensitivity of individual amino acids in α and β chains of Hb and Gl was determined. In the β chains, amino acid destruction was considerably higher than in α chains. These changes were confirmed by amino acid analysis which showed that Cys, Met, Tyr, Arg, Ser, Thr, Pro, and His residues were most destroyed or modified following irradiation
Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar
2018-01-02
Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and
Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.
Guerreiro, J F; Figueiredo, M S; Zago, M A
1994-01-01
We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.
Pakdeepak, Kanet; Pata, Supansa; Chiampanichayakul, Sawitree; Kasinrerk, Watchara; Tatu, Thanusak
2016-01-01
Monoclonal antibodies against α-globin containing human Hbs, named AMS-Alpha1 and AMS-Alpha 2, were produced by the hybridoma technique using spleen cells enriched by the newly developed B lymphocyte enrichment protocol. These two monoclonal antibodies were of IgM class, reacting to only intact form of human Hbs A, A2, E, and F, which contain α-globin chain. By the indirect ELISA, the AMS-Alpha1 and AMS-Alpha 2 quantified less amount of α-globin chain containing hemoglobins in HbH disease than the SEA-α thalassemia 1 carriers and normal individuals. It was thus anticipated that these monoclonal antibodies can be used for detecting Hb Bart's hydrops fetalis in which no α-globin chain is produced.
Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie
2010-05-16
Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.
Chromatin loops, gene positioning, and gene expression
Holwerda, S.; de Laat, W.
2012-01-01
Technological developments and intense research over the last years have led to a better understanding of the 3D structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the alpha- and beta-globin
Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen
1993-03-01
We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.
The 3D chromatin structure of the mouse β-haemoglobin gene cluster
M.P.C. van de Corput (Mariëtte); T.A. Knoch (Tobias); E. de Boer (Ernie); W.A. van Cappellen (Gert); M. Lesnussa (Michael); H.J.F.M.M. Eussen (Bert)
2010-01-01
textabstractHere we show a 3D DNA-FISH method to visualizes the 3D structure of the β-globin locus. Geometric size and shape measurements of the 3D rendered signals (128Kb) show that the volume of the β-globin locus decreases almost two fold upon gene activation. A decrease in length and a
International Nuclear Information System (INIS)
Popp, R.A.; Marsh, C.L.; Skow, L.C.
1981-01-01
Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues
Coordinate expression of heme and globin is essential for effective erythropoiesis.
Doty, Raymond T; Phelps, Susan R; Shadle, Christina; Sanchez-Bonilla, Marilyn; Keel, Siobán B; Abkowitz, Janis L
2015-12-01
Erythropoiesis requires rapid and extensive hemoglobin production. Heme activates globin transcription and translation; therefore, heme synthesis must precede globin synthesis. As free heme is a potent inducer of oxidative damage, its levels within cellular compartments require stringent regulation. Mice lacking the heme exporter FLVCR1 have a severe macrocytic anemia; however, the mechanisms that underlie erythropoiesis dysfunction in these animals are unclear. Here, we determined that erythropoiesis failure occurs in these animals at the CFU-E/proerythroblast stage, a point at which the transferrin receptor (CD71) is upregulated, iron is imported, and heme is synthesized--before ample globin is produced. From the CFU-E/proerythroblast (CD71(+) Ter119(-) cells) stage onward, erythroid progenitors exhibited excess heme content, increased cytoplasmic ROS, and increased apoptosis. Reducing heme synthesis in FLVCR1-defient animals via genetic and biochemical approaches improved the anemia, implying that heme excess causes, and is not just associated with, the erythroid marrow failure. Expression of the cell surface FLVCR1 isoform, but not the mitochondrial FLVCR1 isoform, restored normal rbc production, demonstrating that cellular heme export is essential. Together, these studies provide insight into how heme is regulated to allow effective erythropoiesis, show that erythropoiesis fails when heme is excessive, and emphasize the importance of evaluating Ter119(-) erythroid cells when studying erythroid marrow failure in murine models.
Gene expression in Catla catla (Hamilton) subjected to acute and protracted doses of gamma radiation
Energy Technology Data Exchange (ETDEWEB)
Anbumani, S., E-mail: aquatox1982@gmail.com; Mohankumar, Mary N., E-mail: marynmk@gmail.com
2016-09-15
Highlights: • Gamma radiation induced up- and down- regulation of cell cycle genes. • Protracted dose-rate induced gene up-regulation to facilitate cell survival. • bcl-2 gene facilitates repair at protracted dose and cell death at acute exposures. • gadd45α, cdk1 and bcl-2 genes work in concert to promote ‘repair’ and ‘death’ circuitries in fish blood cells. - Abstract: Studies on transcriptional modulation after gamma radiation exposure in fish are limited. Cell cycle perturbations and expression of apoptotic genes were investigated in the fish, Catla catla after acute and protracted exposures to gamma radiation over a 90 day period. Significant changes in gene expression were observed between day 1 and 90 post-exposure. Gamma radiation induced a significant down-regulation of target genes gadd45α, cdk1 and bcl-2 from day 1 to day 3 after protracted exposure, whereas it persists till day 6 upon acute exposure. From day 12 onwards, Gadd45α, cdk1 and bcl-2 genes were up-regulated following protracted exposure, indicating DNA repair, cell-cycle arrest and apoptosis. There exists a linear correlation between these genes (gadd45α – r = 0.85, p = 0.0073; cdk1 – r = 0.86, p = 0.0053; bcl-2 – r = 0.89, p = 0.0026) at protracted exposures. This is the first report on the dual role of bcl-2 gene in fish exposed to acute and protracted radiation and correlation among the aforementioned genes that work in concert to promote ‘repair’ and ‘death’ circuitries in fish blood cells.
Gene expression in Catla catla (Hamilton) subjected to acute and protracted doses of gamma radiation
International Nuclear Information System (INIS)
Anbumani, S.; Mohankumar, Mary N.
2016-01-01
Highlights: • Gamma radiation induced up- and down- regulation of cell cycle genes. • Protracted dose-rate induced gene up-regulation to facilitate cell survival. • bcl-2 gene facilitates repair at protracted dose and cell death at acute exposures. • gadd45α, cdk1 and bcl-2 genes work in concert to promote ‘repair’ and ‘death’ circuitries in fish blood cells. - Abstract: Studies on transcriptional modulation after gamma radiation exposure in fish are limited. Cell cycle perturbations and expression of apoptotic genes were investigated in the fish, Catla catla after acute and protracted exposures to gamma radiation over a 90 day period. Significant changes in gene expression were observed between day 1 and 90 post-exposure. Gamma radiation induced a significant down-regulation of target genes gadd45α, cdk1 and bcl-2 from day 1 to day 3 after protracted exposure, whereas it persists till day 6 upon acute exposure. From day 12 onwards, Gadd45α, cdk1 and bcl-2 genes were up-regulated following protracted exposure, indicating DNA repair, cell-cycle arrest and apoptosis. There exists a linear correlation between these genes (gadd45α – r = 0.85, p = 0.0073; cdk1 – r = 0.86, p = 0.0053; bcl-2 – r = 0.89, p = 0.0026) at protracted exposures. This is the first report on the dual role of bcl-2 gene in fish exposed to acute and protracted radiation and correlation among the aforementioned genes that work in concert to promote ‘repair’ and ‘death’ circuitries in fish blood cells.
International Nuclear Information System (INIS)
Moreno, Damaris; Fuentes, Jorge L.; Prieto Miranda, Enrique F.; Sanchez Lamar, Angel; Baluja, Ligia
2004-01-01
Radiosensitivity and kinetics of induction of gene conversion and reversion events in Saccharomyces cerevisiae strain D7 to gamma radiation at dose ranges from 100 to 800 Gy and 50 to 300 Gy respectively were studied. A source of 60Co PX- -30 at a dose rate of 49,43 GY/min was utilized. The cell survival curve showed DL50 of 150 Gy. Cell death kinetics was linear and adjusted over 98 %. The induction of gene conversion events was significant in relation to control from 50 Gy on. However, gene reversion was significant only at 200 Gy. Generally speaking, gene conversion event frequencies were higher than those of reversion, which indicates that gamma radiation preferably induces recombinogenic events. Both the conversion and reversion events showed exponential dependence on gamma radiation dose. The relative benefits of this test for mutagenesis and anti-mutagenesis studies were debated in this paper
Amselem, S; Nunes, V; Vidaud, M; Estivill, X; Wong, C; d'Auriol, L; Vidaud, D; Galibert, F; Baiget, M; Goossens, M
1988-01-01
We have delineated the molecular lesions causing beta-thalassemia in Spain, a country that has witnessed the passage of different Mediterranean populations over the centuries, in order to evaluate the extent of heterogeneity of these mutations and to make possible simplified prenatal diagnosis of the disorder in that country. The use of the polymerase chain-reaction (PCR) technique to preferentially amplify beta-globin DNA sequences that contain the most frequent beta-thalassemia mutations in...
Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.
Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe
2010-09-16
The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.
Recent trends in the gene therapy of β-thalassemia
Directory of Open Access Journals (Sweden)
Finotti A
2015-02-01
Full Text Available Alessia Finotti,1–3 Laura Breda,4 Carsten W Lederer,6,7 Nicoletta Bianchi,1–3 Cristina Zuccato,1–3 Marina Kleanthous,6,7 Stefano Rivella,4,5 Roberto Gambari1–3 1Laboratory for the Development of Gene and Pharmacogenomic Therapy of Thalassaemia, Biotechnology Centre of Ferrara University, Ferrara, Italy; 2Associazione Veneta per la Lotta alla Talassemia, Rovigo, Italy; 3Department of Life Sciences and Biotechnology, Section of Biochemistry and Molecular Biology, Ferrara University, Ferrara, Italy; 4Department of Pediatrics, Division of Haematology/Oncology, Weill Cornell Medical College, New York, NY, USA; 5Department of Cell and Development Biology, Weill Cornell Medical College, New York, NY, USA; 6Department of Molecular Genetics Thalassaemia, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus; 7Cyprus School of Molecular Medicine, Nicosia, Cyprus Abstract: The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most
International Nuclear Information System (INIS)
Takahashi, Noria; Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko
1992-10-01
An analysis of the ATTTT repeat polymorphism located approximately 1,400 base pairs upstream from the β-globin structural gene was carried out by denaturing gradient gel electrophoresis (DGGE) of RNA:DNA duplexes. Genomic or cloned DNAs were digested with restriction enzymes and hybridized with 32 P-labeled RNA probes, and resulting RNA:DNA duplexes were examined by DGGE. A difference in the number of repeat units was recognized by differences in duplex mobility on the DGGE gel. In this study of 81 unrelated Japanese from Hiroshima, a sequence heteromorphism was observed at this site. Alleles with 5 and 6 repeats of the ATTTT unit, which had already been reported, were found in polymorphic proportions. In addition, two unreported alleles, one having 7 repeats and the other having an A-to-G nucleotide substitution in the 5th repeat, were detected. Family study data showed that the segregation of these four types of variants is consistent with an autosomal codominant mode of inheritance. This study also demonstrated that DGGE of RNA:DNA duplexes is a sensitive tool for detecting variations in DNA. (author)
Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J
1994-07-08
The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.
Semisynthetic hemoglobin A: Reconstitution of functional tetramer from semisynthetic α-globin
International Nuclear Information System (INIS)
Sahni, G.; Cho, Y.J.; Iyer, K.S.; Khan, S.A.; Seetharam, R.; Acharya, A.S.
1989-01-01
The optimal conditions for the semisynthesis of α-globin through Staphylococcus aureus V8 protease condensation of a synthetic fragment (α 1-30 ) with the complementary apo fragment (α 31-141 ) in the presence of structure-inducing organic cosolvents and the reconstitution of the functional tetramer from semisynthetic α-globin have been investigated. The protease-catalyzed ligation of the complementary apo fragments α 1-30 and α 31-141 proceeds with very high selectivity at pH 6.0 and 4 degree C in the presence of 1-propanol as the organic cosolvent. A 30% 1-propanol solution was optimal for the semisynthetic reaction, and the synthetic reaction attained an equilibrium (approximately 50%) in 72 h. The synthetic reaction proceeds smoothly over a wide pH range (pH 5-8). Besides, the semisynthetic system is flexible, and it also proceeded well if trifluoroethanol or 2-propanol was used instead of 1-propanol. However, glycerol, a versatile organic cosolvent used in all other proteosynthetic reactions reported in the literature, was not very efficient as an organic cosolvent in the present synthetic reaction. The semisynthetic α-globin prepared with 1-propanol as the organic cosolvent has been reconstituted into HbA. The semisynthetic HbA was then purified by CM-cellulose chromatography. The semisynthetic HbA is indistinguishable from native HbA, in terms of its structural and functional properties. The semisynthetic approach provides the flexibility in protein engineering studies for the incorporation of spectroscopic labels ( 13 C- and/or 15 N-labeled amino acids), noncoded amino acids, or unnatural bond functionalities, which at present is not possible with genetic approaches
Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios
2012-01-01
Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313
Czech Academy of Sciences Publication Activity Database
Reading, N. S.; Shooter, C.; Song, J.; Miller, R.; Agarwal, A.; Láníková, Lucie; Clark, B.; Thein, S.L.; Divoký, V.; Prchal, J.T.
2016-01-01
Roč. 37, č. 11 (2016), s. 1153-1156 ISSN 1059-7794 R&D Projects: GA MŠk(CZ) LH15223 Institutional support: RVO:68378050 Keywords : globin genes * regulation * sickle cell disease * HBB duplication Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.601, year: 2016
Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...
African Journals Online (AJOL)
Dilay Ciglidag Dungul
carrying individuals with intact beta globin gene. DNA was extracted from peripheral blood sam- ples of seven healthy carrier individuals who have abnormal hemoglobin variants and 16 control individuals from Turkey. Complete coding and intronic sequences of HBA1 and HBA2 genes were amplified by polymerase chain ...
Directory of Open Access Journals (Sweden)
Sarah A Benson
2009-07-01
Full Text Available Mycobacterium tuberculosis uses multiple mechanisms to avoid elimination by the immune system. We have previously shown that M. tuberculosis can inhibit selected macrophage responses to IFN-gamma through TLR2-dependent and -independent mechanisms. To specifically address the role of TLR2 signaling in mediating this inhibition, we stimulated macrophages with the specific TLR2/1 ligand Pam(3CSK(4 and assayed responses to IFN-gamma. Pam(3CSK(4 stimulation prior to IFN-gamma inhibited transcription of the unrelated IFN-gamma-inducible genes, CIITA and CXCL11. Surface expression of MHC class II and secretion of CXCL11 were greatly reduced as well, indicating that the reduction in transcripts had downstream effects. Inhibition of both genes required new protein synthesis. Using chromatin immunoprecipitation, we found that TLR2 stimulation inhibited IFN-gamma-induced RNA polymerase II binding to the CIITA and CXCL11 promoters. Furthermore, TATA binding protein was unable to bind the TATA box of the CXCL11 promoter, suggesting that assembly of transcriptional machinery was disrupted. However, TLR2 stimulation affected chromatin modifications differently at each of the inhibited promoters. Histone H3 and H4 acetylation was reduced at the CIITA promoter but unaffected at the CXCL11 promoter. In addition, NF-kappaB signaling was required for inhibition of CXCL11 transcription, but not for inhibition of CIITA. Taken together, these results indicate that TLR2-dependent inhibition of IFN-gamma-induced gene expression is mediated by distinct, gene-specific mechanisms that disrupt binding of the transcriptional machinery to the promoters.
Babiss, L E; Friedman, J M; Darnell, J E
1986-01-01
In the accompanying paper (Friedman et al., Mol. Cell. Biol. 6:3791-3797, 1986), hepatoma-specific expression of the rat albumin promoter within the adenovirus genome was demonstrated. However, the rate of transcription was very low compared with that of the endogenous chromosomal albumin gene. Here we show that in hepatoma cells the adenovirus E1A enhancer, especially in the presence of E1A protein, greatly stimulates transcription from the albumin promoter but not the mouse beta-globin prom...
Directory of Open Access Journals (Sweden)
Elza M. Kimura
2009-01-01
Full Text Available Hb H Disease is caused by the loss or inactivation of three of the four functional a-globin genes. Patients present chronic hemolytic anemia and splenomegaly. In some cases, occasional blood transfusions are required. Deletions are the main cause of this type of thalassemia (α-thalassemia. We describe here an unusual case of Hb H disease caused by the combination of a common αº deletion [-(α20.5] with a rare point mutation (c.427T > A, thus resulting in an elongated and unstable α-globin variant, Hb Icaria, (X142K, with 31 additional amino-acid residues. Very high levels of Hb H and Hb Bart's were detected in the patient's red blood cells (14.7 and 19.0%, respectively. This is the first description of this infrequent association in the Brazilian population.
Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...
African Journals Online (AJOL)
Thalassemia is an inherited blood disorder which is divided into two groups: alpha and beta. HBA1 and HBA2 are the two genes associated with alpha thalassemia. The aim of this study is to investigate abnormal hemoglobin variants of alpha globin gene in healthy abnormal hemoglobin carrying individuals with intact beta ...
Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min
2012-07-15
Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.
Molecular basis for nondeletion alpha-thalassemia in American blacks. Alpha 2(116GAG----UAG).
Liebhaber, S A; Coleman, M B; Adams, J G; Cash, F E; Steinberg, M H
1987-01-01
An American black woman was found to have the phenotype of moderately severe alpha-thalassemia normally associated with the loss of two to three alpha-globin genes despite an alpha-globin gene map that demonstrated the loss of only a single alpha-globin gene (-alpha/alpha alpha). Several individuals in her kindred with normal alpha-globin gene mapping studies (alpha alpha/alpha alpha) had mild alpha-thalassemia hematologic values consistent with the loss of one to two alpha-globin genes. Thes...
Chu, L Y; Rhoads, R E
1978-06-13
The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.
A Survey of ABO, Rhesus (D) Antigen and Haemoglobin Genes ...
African Journals Online (AJOL)
olayemitoyin
transporting the bound oxygen throughout the body where it is used in ... the globin genes that alter the protein composition but not necessarily ... oxygen carrying capacity and hence the rate of aerobic metabolic ... to participate in the exercise.
Directory of Open Access Journals (Sweden)
Gene A Morrill
2016-09-01
Full Text Available ABSTRACT: Globins contain one or more cavities that control or affect such functions as ligand movement and ligand binding. Here we report that the extended globin family [cytoglobin (Cygb; neuroglobin (Ngb; myoglobin (Mb; hemoglobin (Hb subunits Hba(α and Hbb(β] contain either a transmembrane (TM helix or pore-lining region as well as internal cavities. Protein motif/domain analyses indicate that Ngb and Hbb each contain 5 cholesterol-binding (CRAC/CARC domains and 1 caveolin binding motif, whereas the Cygb dimer has 6 cholesterol-binding domains but lacks caveolin-binding motifs. Mb and Hba each exhibit 2 cholesterol-binding domains and also lack caveolin-binding motifs. The Hb αβ-tetramer contains 14 cholesterol-binding domains. Computer algorithms indicate that Cygb and Ngb cavities display multiple partitions and C-terminal pore-lining regions, whereas Mb has three major cavities plus a C-terminal pore-lining region. The Hb tetramer exhibits a large internal cavity but the subunits differ in that they contain a C-terminal TM helix (Hba and pore-lining region (Hbb. The cavities include 43 of 190 Cygb residues, 38 of 151 of Ngb residues, 55 of 154 Mb residues and 137 of 688 residues in the Hb tetramer. Each cavity complex includes 6 to 8 residues of the TM helix or pore-lining region and CRAC/CARC domains exist within all cavities. Erythrocyte Hb αβ-tetramers are largely cytosolic but also bind to a membrane anion exchange protein, band 3, which contains a large internal cavity and 12 TM helices (5 being pore-lining regions. The Hba TM helix may be the erythrocyte membrane band 3 attachment site. Band 3 contributes 4 caveolin binding motifs and 10 CRAC/CARC domains. Cholesterol binding may create lipid-disordered phases that alter globin cavities and facilitate ligand movement, permitting ion channel formation and conformational changes that orchestrate anion and ligand (O2, CO2, NO movement within the large internal cavities and
Usage of U7 snRNA in gene therapy of hemoglobin C disorder ...
African Journals Online (AJOL)
Here, a bioinformatic analysis was performed to study the effect of co-expression between human Hb C b-globin chain gene and U7.623. The gene ontological results show that full recovery of hemoglobin function and biological process can be derived. This confirms that U7 snRNA can be a good tool for gene therapy in Hb ...
Expression of fully functional tetrameric human hemoglobin in Escherichia coli
International Nuclear Information System (INIS)
Hoffman, S.J.; Looker, D.L.; Roehrich, J.M.; Cozart, P.E.; Durfee, S.L.; Tedesco, J.L.; Stetler, G.L.
1990-01-01
Synthesis genes encoding the human α- and β-globin polypeptides have been expressed from a single operon in Escherichia coli. The α- and β-globin polypeptides associate into soluble tetramers, incorporate heme, and accumulate to >5% of the total cellular protein. Purified recombinant hemoglobin has the correct stoichiometry of α- and β-globin chains and contains a full complement of heme. Each globin chain also contains an additional methionine as an extension to the amino terminus. The recombinant hemoglobin has a C 4 reversed-phase HPLC profile essentially identical to that of human hemoglobin A 0 and comigrates with hemoglobin A 0 on SDS/PAGE. The visible spectrum and oxygen affinity are similar to that of native human hemoglobin A 0 . The authors have also expressed the α- and β-globin genes separately and found that the expression of the α-globin gene alone results in a marked decrease in the accumulation of α-globin in the cell. Separate expression of the β-globin gene results in high levels of insoluble β-globin. These observations suggest that the presence of α- and β-globin in the same cell stabilizes α-globin and aids the correct folding of β-globin. This system provides a simple method for expressing large quantities of recombinant hemoglobin and allows facile manipulation of the genes encoding hemoglobin to produce functionally altered forms of this protein
Factor IX gene haplotypes in Amerindians.
Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S
1997-02-01
We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.
Energy Technology Data Exchange (ETDEWEB)
Rhee, Jae-Sung [Research Institute for Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Kim, Bo-Mi; Kim, Ryeo-Ok [Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Seo, Jung Soo [Pathology Team, National Fisheries Research and Development Institute, Busan 619-902 (Korea, Republic of); Kim, Il-Chan [Division of Life Sciences, Korea Polar Research Institute, Korea Institute of Ocean Science and Technology, Incheon 406-840 (Korea, Republic of); Lee, Young-Mi, E-mail: ymlee70@smu.ac.kr [Department of Green Life Science, College of Convergence, Sangmyung University, Seoul 110-743 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@hanyang.ac.kr [Research Institute for Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of)
2013-09-15
Highlights: •Novel identification of DNA repair-related genes in fish. •Investigation of whole expression profiling of DNA repair genes upon gamma radiation. •Analysis of effects of gamma radiation on antioxidant system and cell stress proteins. •Usefulness of verification of pathway-based profiling for mechanistic understanding. -- Abstract: To investigate effects of gamma ray irradiation in the hermaphroditic fish, Kryptolebias marmoratus larvae, we checked expression of p53, DNA repair, and heat shock protein genes with several antioxidant enzyme activities by quantitative real-time RT-PCR and biochemical methods in response to different doses of gamma radiation. As a result, the level of gamma radiation-induced DNA damage was initiated after 4 Gy of radiation, and biochemical and molecular damage became substantial from 8 Gy. In particular, several DNA repair mechanism-related genes were significantly modulated in the 6 Gy gamma radiation-exposed fish larvae, suggesting that upregulation of such DNA repair genes was closely associated with cell survival after gamma irradiation. The mRNA expression of p53 and most hsps was also significantly upregulated at high doses of gamma radiation related to cellular damage. This finding indicates that gamma radiation can induce oxidative stress with associated antioxidant enzyme activities, and linked to modulation of the expression of DNA repair-related genes as one of the defense mechanisms against radiation damage. This study provides a better understanding of the molecular mode of action of defense mechanisms upon gamma radiation in fish larvae.
Yang, Zhantao; Keel, Siobán B; Shimamura, Akiko; Liu, Li; Gerds, Aaron T; Li, Henry Y; Wood, Brent L; Scott, Bart L; Abkowitz, Janis L
2016-05-11
Diamond Blackfan anemia (DBA) and myelodysplastic syndrome (MDS) with isolated del(5q) are severe macrocytic anemias; although both are associated with impaired ribosome assembly, why the anemia occurs is not known. We cultured marrow cells from DBA (n = 3) and del(5q) MDS (n = 6) patients and determined how heme (a toxic chemical) and globin (a protein) are coordinated. We show that globin translation initiates slowly, whereas heme synthesis proceeds normally. This results in insufficient globin protein, excess heme and excess reactive oxygen species in early erythroid precursors, and CFU-E (colony-forming unit-erythroid)/proerythroblast cell death. The cells that can more rapidly and effectively export heme or can slow heme synthesis preferentially survive and appropriately mature. Consistent with these observations, treatment with 10 μM succinylacetone, a specific inhibitor of heme synthesis, improved the erythroid cell output of DBA and del(5q) MDS marrow cultures by 68 to 95% (P = 0.03 to 0.05), whereas the erythroid cell output of concurrent control marrow cultures decreased by 4 to 13%. Our studies demonstrate that erythropoiesis fails when heme exceeds globin. Our data further suggest that therapies that decrease heme synthesis (or facilitate heme export) could improve the red blood cell production of persons with DBA, del(5q) MDS, and perhaps other macrocytic anemias. Copyright © 2016, American Association for the Advancement of Science.
Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique
2014-01-01
Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.
DEFF Research Database (Denmark)
Ek, J; Andersen, G; Urhammer, S A
2001-01-01
We examined whether the Pro12-Ala polymorphism of the human peroxisome proliferator-activated receptor-gamma2 (PPAR-gamma2) gene was related to altered insulin sensitivity among glucose-tolerant subjects or a lower accumulated incidence or prevalence of IGT and Type II (non-insulin-dependent) dia......-insulin-dependent) diabetes mellitus among Scandinavian Caucasians....
From gene trees to organismal phylogeny in prokaryotes: the case of the gamma-Proteobacteria.
Directory of Open Access Journals (Sweden)
Emmanuelle Lerat
2003-10-01
Full Text Available The rapid increase in published genomic sequences for bacteria presents the first opportunity to reconstruct evolutionary events on the scale of entire genomes. However, extensive lateral gene transfer (LGT may thwart this goal by preventing the establishment of organismal relationships based on individual gene phylogenies. The group for which cases of LGT are most frequently documented and for which the greatest density of complete genome sequences is available is the gamma-Proteobacteria, an ecologically diverse and ancient group including free-living species as well as pathogens and intracellular symbionts of plants and animals. We propose an approach to multigene phylogeny using complete genomes and apply it to the case of the gamma-Proteobacteria. We first applied stringent criteria to identify a set of likely gene orthologs and then tested the compatibilities of the resulting protein alignments with several phylogenetic hypotheses. Our results demonstrate phylogenetic concordance among virtually all (203 of 205 of the selected gene families, with each of the exceptions consistent with a single LGT event. The concatenated sequences of the concordant families yield a fully resolved phylogeny. This topology also received strong support in analyses aimed at excluding effects of heterogeneity in nucleotide base composition across lineages. Our analysis indicates that single-copy orthologous genes are resistant to horizontal transfer, even in ancient bacterial groups subject to high rates of LGT. This gene set can be identified and used to yield robust hypotheses for organismal phylogenies, thus establishing a foundation for reconstructing the evolutionary transitions, such as gene transfer, that underlie diversity in genome content and organization.
McKinney, Cushla; Fanciulli, Manuela; Merriman, Marilyn E.; Phipps-Green, Amanda; Alizadeh, Behrooz Z.; Koeleman, Bobby P. C.; Dalbeth, Nicola; Gow, Peter J.; Harrison, Andrew A.; Highton, John; Jones, Peter B.; Stamp, Lisa K.; Steer, Sophia; Barrera, Pilar; Coenen, Marieke J. H.; Franke, Barbara; van Riel, Piet L. C. M.; Vyse, Tim J.; Aitman, Tim J.; Radstake, Timothy R. D. J.; Merriman, Tony R.
2010-01-01
Objective There is increasing evidence that variation in gene copy number (CN) influences clinical phenotype. The low-affinity Fc gamma receptor 3B (FCGR3B) located in the FCGR gene cluster is a CN polymorphic gene involved in the recruitment to sites of inflammation and activation of
Kim, J H; Go, Y S; Kim, J K; Chung, B Y
2016-07-29
MicroRNAs (miRNAs) regulate gene expression in response to biotic and abiotic stress in plants. We investigated gamma-ray-responsive miRNAs in Arabidopsis wild-type and cmt3-11t mutant plants using miRNA microarray analysis. miRNA expression was differentiated between the wild-type and cmt3-11t mutants. miR164a, miR169d, miR169h, miR172b*, and miR403 were identified as repressible in the wild-type and/or cmt3-11t mutant in response to gamma irradiation, while miR827, miR840, and miR850 were strongly inducible. These eight miRNA genes contain UV-B-responsive cis-elements, including G-box, I-box core, ARE, and/or MBS in the putative promoter regions. Moreover, Box 4, MBS, TCA-element, and Unnamed_4, as well as CAAT- and TATA-box, were identified in these eight miRNA genes. However, a positive correlation between the transcriptions of miRNAs and their putative target genes was only observed between miR169d and At1g30560 in the wild-type, and between miR827 and At1g70700 in the cmt3-11t mutant. Quantitative RT-PCR analysis confirmed that the transcription of miR164a, miR169d, miR169h, miR172b*, miR403, and miR827 differed after gamma irradiation depending on the genotype (wild-type, cmt3-11t, drm2, drd1-6, and ddm1-2) and developmental stage (14 or 28 days after sowing). In contrast, high transcriptional induction of miR840 and miR850 was observed in these six genotypes regardless of the developmental stage. Although the actual target genes and functions of miR840 and miR850 remain to be determined, our results indicate that these two miRNAs may be strongly induced and reproducible genetic markers in Arabidopsis plants exposed to gamma rays.
International Nuclear Information System (INIS)
Ussuf, K.K.; Laxmi, N.H.; Nair, P.M.
1996-01-01
Hydroxyproline rich glycoprotein (HRGP) gene is induced in both control and gamma irradiated potato tubers after wounding. The enhanced RNA synthesis in response to wounding correlated well with the accumulation of both HRGP gene transcripts and protein. Initially, the level of HRGP gene expression in gamma irradiated potatoes in response to wounding was 30% more than the corresponding controls. After post irradiation storage of 3-5 weeks, HRGP gene expression in response to wounding was significantly lower than the unirradiated samples. This low level of HRGP gene expression in irradiated potatoes was partially retrieved by 5 mM Ca 2+ treatment. Prior treatment with trifluoperazine, a calcium channel blocker resulted in 35% reduction in wound induced HRGP gene expression in control potatoes, further providing evidence for the involvement of Ca 2+ dependency for HRGP gene activation. A comparative study on in vivo protein phosphorylation induced by wounding in control and irradiated potatoes exhibited significant differences. A good correlation was observed in the modulation of phosphorylation and HRGP gene expression by Ca 2+ in irradiated potatoes. Wound induced signal transduction system and subsequent Ca 2+ dependent protein phosphorylation for the activation of HRGP gene is affected in potatoes after gamma irradiation, thus impairing the wound healing process adversely. (author). 25 refs., 5 figs
Polymorphisms in an interferon-gamma receptor-1 gene marker and susceptibility to periodontitis
Fraser, DA; Loos, BG; Boman, U; van Winkelhoff, AJ; van der Velden, U; Schenck, K; Dembic, Z
2003-01-01
Chronic marginal periodontitis is an inflammatory condition in which the supporting tissues of the teeth are destroyed. Interferon (IFN)-gamma is a cytokine that plays a pivotal role in the defense against infection, and mutations in the gene coding for the ligand binding chain (alpha, RI) of the
Linhart, Igor; Hanzlíková, Iveta; Mráz, Jaroslav; Dušková, Šárka
2017-10-01
3-Nitrobenzanthrone (3-NBA), a potent environmental mutagen and carcinogen, is known to be activated in vivo to 3-benzanthronylnitrenium ion which forms both NH and C2-bound adducts with DNA and also reacts with glutathione giving rise to urinary 3-aminobenzanthron-2-ylmercapturic acid. In this study, acid hydrolysate of globin from rats dosed intraperitoneally with 3-NBA was analysed by HPLC/MS to identify a novel type of cysteine adduct, 3-aminobenzanthron-2-ylcysteine (3-ABA-Cys), confirmed using a synthesised standard. The 3-ABA-Cys levels in globin peaked after single 3-NBA doses of 1 and 2 mg/kg on day 2 to attain 0.25 and 0.49 nmol/g globin, respectively, thereafter declining slowly to 70-80% of their maximum values during 15 days. After dosing rats for three consecutive days with 1 mg 3-NBA/kg a significant cumulation of 3-ABA-Cys in globin was observed. 3-ABA-Cys was also found in the plasma hydrolysate. Herein, after dosing with 1 and 2 mg 3-NBA/kg the adduct levels peaked on day 1 at 0.15 and 0.51 nmol/ml plasma, respectively, thereafter declining rapidly to undetectable levels on day 15. In addition, sulphinamide adducts were also found in the exposed rats, measured indirectly as 3-aminobenzanthrone (3-ABA) split off from globin by mild acid hydrolysis. Levels of both types of adducts in the globin samples parallelled very well with 3-ABA/3-ABA-Cys ratio being around 1:8. In conclusion, 3-ABA-Cys is the first example of arylnitrenium-cysteine adduct in globin representing a new promising class of biomarkers to assess cumulative exposures to aromatic amines, nitroaromatics and heteroaromatic amines.
DEFF Research Database (Denmark)
Kepp, Kasper Planeta
2015-01-01
Fast and accurate computation of protein stability is increasingly important for e.g. protein engineering and protein misfolding diseases, but no consensus methods exist for important proteins such as globins, and performance may depend on the type of structural input given. This paper reports be...
Gene therapy for sickle cell disease: An update.
Demirci, Selami; Uchida, Naoya; Tisdale, John F
2018-05-30
Sickle cell disease (SCD) is one of the most common life-threatening monogenic diseases affecting millions of people worldwide. Allogenic hematopietic stem cell transplantation is the only known cure for the disease with high success rates, but the limited availability of matched sibling donors and the high risk of transplantation-related side effects force the scientific community to envision additional therapies. Ex vivo gene therapy through globin gene addition has been investigated extensively and is currently being tested in clinical trials that have begun reporting encouraging data. Recent improvements in our understanding of the molecular pathways controlling mammalian erythropoiesis and globin switching offer new and exciting therapeutic options. Rapid and substantial advances in genome engineering tools, particularly CRISPR/Cas9, have raised the possibility of genetic correction in induced pluripotent stem cells as well as patient-derived hematopoietic stem and progenitor cells. However, these techniques are still in their infancy, and safety/efficacy issues remain that must be addressed before translating these promising techniques into clinical practice. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Gentil Claudino de Galiza Neto
2005-10-01
Full Text Available No presente trabalho abordam-se vários aspectos relacionados à natureza molecular da anemia falciforme (AF, desordem hematológica de caráter hereditário. A descoberta do polimorfismo do DNA no grupamento do gene betaS, originando diferentes haplótipos da doença, permitiu ampliar o conhecimento em torno da heterogeneidade clínica observada nos pacientes falcêmicos nas mais diversas regiões do mundo. Analisaram-se os diferentes haplótipos e seus parâmetros hematológicos, presentes em um grupo de 22 pacientes naturais e procedentes do estado do Ceará. A distribuição das freqüências dos haplótipos encontrados foi de 55,9% para Benin; 41,2% para República Centro-Africana (CAR; e de 2,9% para o haplótipo Senegal. Esses dados, em comparação com os demais estudos realizados no Brasil, mostram associação entre os seus valores para um alfa de 5% (p The present work deals with numerous aspects related to the molecular nature of sickle cell anemia. The discovery of the DNA polymorphism in the betas-globin gene cluster, gave origin to different haplotypes of the disease, making possible to enlarge the knowledge about the clinical heterogenity observed on the patients with sickle cell disease, in the various regions of the world. The different haplotypes and its hematological parameters were analysed in a group of 22 patients born in the State of Ceará, northeast of Brazil. The distribution found in the haplotypes frequency was of 55.9% for the Benin, of 41.2% for the CAR, and of 2.9% for Senegal haplotype. The data, compared to the others works done in Brazil, show relations among their values to alpha of 5% (p < 0,05. The results make possible a full understanding of the pathophisiology of the illness and of its clinical complexity in our State, as well as it allows a better knowledge of the sickle cell disease in our country.
Hojjati, Mohammad T; Azarkeivan, Azita; Pourfathollah, Ali A; Amirizadeh, Naser
2017-03-01
Drug induction of Hb F seems to be an ideal therapy for patients with hemoglobin (Hb) disorders, and many efforts have been made to reveal the mechanism behind it. Thus, we examined in vivo expression of some microRNAs (miRNAs) that are thought to be involved in this process. Among β-thalassemia (β-thal) patients who were undergoing hydroxyurea (HU) therapy in the past 3 months and five healthy individuals, five responders and five non-responders, were also included in the study. Erythroid progenitors were isolated by magnetic activated cell sorting (MACS) and miRNA expression analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We showed that γ-globin, miR-210 and miR-486-3p had higher levels in the responders than the non-responders group. Moreover, miR-150 and miR-320 had higher levels in the healthy group than both non-responders and responders groups, but the expression of miR-96 did not show any significant difference between the study groups. To the best of our knowledge, this is the first study proposing that 'induction of cellular hypoxic condition by Hb F inducing agents' could be the milestone of possible mechanisms that explain why responders are able to reactivate γ-globin genes and subsequently, more production of Hb F, in response to these agents in comparison to non-responders. However, further investigations need to be performed to verify this hypothesis.
Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long
2006-11-17
The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (Pprotection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (Pprotected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.
Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region
Energy Technology Data Exchange (ETDEWEB)
Miyamoto, M.M.; Slightom, J.L.; Goodman, M.
1987-10-16
Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.
Gene Expression Changes in Mouse Intestinal Tissue Following Whole-Body Proton or Gamma-Irradiation
Purgason, Ashley; Zhang, Ye; Mangala, Lingegowda; Nie, Ying; Gridley, Daila; Hamilton, Stanley R.; Seidel, Derek V.; Wu, Honglu
2014-01-01
Crew members face potential consequences following exposure to the space radiation environment including acute radiation syndrome and cancer. The space radiation environment is ample with protons, and numerous studies have been devoted to the understanding of the health consequences of proton exposures. In this project, C57BL/6 mice underwent whole-body exposure to 250 MeV of protons at doses of 0, 0.1, 0.5, 2 and 6 Gy and the gastrointestinal (GI) tract of each animal was dissected four hours post-irradiation. Standard H&E staining methods to screen for morphologic changes in the tissue showed an increase in apoptotic lesions for even the lowest dose of 0.1 Gy, and the percentage of apoptotic cells increased with increasing dose. Results of gene expression changes showed consistent up- or down- regulation, up to 10 fold, of a number of genes across exposure doses that may play a role in proton-induced oxidative stress including Gpx2. A separate study in C57BL/6 mice using the same four hour time point but whole-body gamma-irradiation showed damage to the small intestine with lesions appearing at the smallest dose of 0.05 Gy and increasing with increasing absorbed dose. Expressions of genes associated with oxidative stress processes were analyzed at four hours and twenty-four hours after exposure to gamma rays. We saw a much greater number of genes with significant up- or down-regulation twenty-four hours post-exposure as compared to the four hour time point. At both four hours and twenty-four hours post-exposure, Duox1 and Mpo underwent up-regulation for the highest dose of 6 Gy. Both protons and gamma rays lead to significant variation in gene expressions and these changes may provide insight into the mechanism of injury seen in the GI tract following radiation exposure. We have also completed experiments using a BALB/c mouse model undergoing whole-body exposure to protons. Doses of 0, 0.1, 1 and 2 Gy were used and results will be compared to the work mentioned
Lederer, Carsten W; Pavlou, Eleni; Tanteles, George A; Evangelidou, Paola; Sismani, Carolina; Kolnagou, Annita; Sitarou, Maria; Christou, Soteroulla; Hadjigavriel, Michael; Kleanthous, Marina
2017-06-01
Thalassaemia is a potentially lethal inherited anaemia, caused by reduced or absent synthesis of globin chains. Measurement of the minor adult haemoglobin Hb A 2 , combining α- with δ-globin, is critical for the routine diagnosis of carrier status for α- or β-thalassaemia. Here, we aim to characterize a novel δ-globin variant, Hb A 2 Episkopi, in a single family of mixed Lebanese and Cypriot ancestry with mild hypochromic anaemia and otherwise normal globin genotype, which also presents with a coincidental 0.78-Mb sequence duplication on chromosome 1 (1q44) and developmental abnormalities. Analyses included comprehensive haematological analyses, cation-exchange high-performance liquid chromatography (CE-HPLC), cellulose acetate electrophoresis (CAE), Sanger sequencing and structure-based stability predictions for Hb A 2 Episkopi. The GCT > GTT missense mutation, underlying Hb A 2 Episkopi, HBD:c.428C > T, introduces a cd142 codon change in the mature protein, resulting in reduced normal Hb A 2 amounts and a novel, less abundant Hb A 2 variant (HGVS: HBD:p.A143V), detectable as a delayed peak by CE-HPLC. The latter was in line with structure-based stability predictions, which indicated that the substitution of a marginal, non-helical and non-interface residue, five amino acids from the δ-globin chain carboxy-terminus, was moderately destabilizing. Detection of the new variant depends on the diagnostic set-up and had failed by CAE and on an independent CE-HPLC system, which, in unfavourable circumstances, may lead to misdiagnoses of β-thalassaemia as α-thalassaemia. Given the mixed background of the affected family, the ethnic origin of the mutation is unclear, and this study thus suggests awareness for possible detection of Hb A 2 Episkopi in both the Cypriot and the Lebanese populations.
Two cloned β thalassemia genes are associated with amber mutations at codon 39
Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur
1981-01-01
Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453
Determination of proteolytic activity using L-[4,5-3H]leucine-labelled globin as a substrate
International Nuclear Information System (INIS)
Maliopoulou, T.B.; Dionyssiou-Asteriou, A.; Loucopoulos, D.
1980-01-01
A simple and sensitive method for the assay of proteolytic enzyme activity is described. This is based on the digestion of L-[4,5- 3 H]leucine globin by proteolytic enzymes and radioactivity measurement of the trichloroacetic acid soluble cleavage products. (Auth.)
TRUNCATED OR 2/2 HEMOGLOBINS : A NEW CLASS OF GLOBINS WITH NOVEL STRUCTURE AND FUNCTION
Directory of Open Access Journals (Sweden)
Amit Kumar
2013-06-01
Full Text Available Bright red hemoglobins, the most well-known paradigm in protein science, seem to be ubiquitous in nature. With advances in modern tools and techniques, discovery of new globins at a rapid pace has expanded this family. With every discovery, new insights emerged regarding their novel structure, function and several other characteristics previously not observed for hemoglobins. Even the classical function unanimously assigned to hemoglobins – oxygen transport and storage – needed re-evaluation. The ability of this class of proteins to show responses against various gaseous ligands, even the poisonous ones, indicate that it is obviously as ancient as life. As organisms evolved, hemoglobins also evolved, and accumulated a great degree of diversity in all aspects. The classical globin fold is very unique with 3-on-3 alpha helical bundle as observed in the traditional oxygen-transport hemoglobins like myoglobin, human blood hemoglobin and leghemoglobins in plants. However, a class of the newly discovered hemoglobins, which dominate the superfamily and appears ancient in origin mostly have 2-on-2 fold, commonly termed as “truncated” hemoglobins. These hemoglobins are phylogenetically distinct from their classical counterparts and are often shorter in their polypeptide length by 20-40 residues mainly due to a lack of short A helix, D helix and F helix. However, hemoglobins with 2-on-2 fold were also later found to have polypeptide chain lengths similar in size to classical globins. Disordered pre-F helix region, conserved glycine motifs and other key residues and apolar tunnels through their protein matrix for migration of ligands are some unique characteristics features of these truncated hemoglobins. Some of these are also hexacoordinated at heme iron where an amino acid from within the protein coordinates heme iron in absence of a ligand. These hemoglobins are well known for their high affinity towards ligand and have a diverse mechanism of
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Directory of Open Access Journals (Sweden)
Laura Breda
Full Text Available Preclinical and clinical studies demonstrate the feasibility of treating β-thalassemia and Sickle Cell Disease (SCD by lentiviral-mediated transfer of the human β-globin gene. However, previous studies have not addressed whether the ability of lentiviral vectors to increase hemoglobin synthesis might vary in different patients.We generated lentiviral vectors carrying the human β-globin gene with and without an ankyrin insulator and compared their ability to induce hemoglobin synthesis in vitro and in thalassemic mice. We found that insertion of an ankyrin insulator leads to higher, potentially therapeutic levels of human β-globin through a novel mechanism that links the rate of transcription of the transgenic β-globin mRNA during erythroid differentiation with polysomal binding and efficient translation, as reported here for the first time. We also established a preclinical assay to test the ability of this novel vector to synthesize adult hemoglobin in erythroid precursors and in CD34(+ cells isolated from patients affected by β-thalassemia and SCD. Among the thalassemic patients, we identified a subset of specimens in which hemoglobin production can be achieved using fewer copies of the vector integrated than in others. In SCD specimens the treatment with AnkT9W ameliorates erythropoiesis by increasing adult hemoglobin (Hb A and concurrently reducing the sickling tetramer (Hb S.Our results suggest two major findings. First, we discovered that for the purpose of expressing the β-globin gene the ankyrin element is particularly suitable. Second, our analysis of a large group of specimens from β-thalassemic and SCD patients indicates that clinical trials could benefit from a simple test to predict the relationship between the number of vector copies integrated and the total amount of hemoglobin produced in the erythroid cells of prospective patients. This approach would provide vital information to select the best candidates for these
Gene Therapy in Thalassemia and Hemoglobinopathies
Breda, Laura; Gambari, Roberto; Rivella, Stefano
2009-01-01
Sickle cell disease (SCD) and ß-thalassemia represent the most common hemoglobinopathies caused, respectively, by the alteration of structural features or deficient production of the ß-chain of the Hb molecule. Other hemoglobinopathies are characterized by different mutations in the α- or ß-globin genes and are associated with anemia and might require periodic or chronic blood transfusions. Therefore, ß-thalassemia, SCD and other hemoglobinopathies are excellent candidates for genetic approac...
International Nuclear Information System (INIS)
Lim, Sang Yong; Jung, Sun Wook; Joe, Min Ho; Kim, Dong Ho
2008-01-01
Microarrays can measure the expression of thousands of genes to identify the changes in expression between different biological states. To survey the change of whole Salmonella genes after a relatively high dose of gamma radiation (1 kGy), transcriptome dynamics were examined in the cells by using DNA microarrays. At least 75 genes were induced and 89 genes were reduced two-fold or more after irradiation. Several genes located in pSLT plasmid, cyo operon, and Gifsy prophage were induced along with many genes encoding uncharacterized proteins.While, the expression of genes involved in the virulence of Salmonella as well as metabolic functions were decreased. Although the radiation response as a whole could not be illustrated by using DNA microarrays, the data suggest that the response to high dose of irradiation might be more complex than the SOS response
Energy Technology Data Exchange (ETDEWEB)
Lim, Sang Yong; Jung, Sun Wook; Joe, Min Ho; Kim, Dong Ho [Radiation Research Division for Biotechnology, Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)
2008-08-15
Microarrays can measure the expression of thousands of genes to identify the changes in expression between different biological states. To survey the change of whole Salmonella genes after a relatively high dose of gamma radiation (1 kGy), transcriptome dynamics were examined in the cells by using DNA microarrays. At least 75 genes were induced and 89 genes were reduced two-fold or more after irradiation. Several genes located in pSLT plasmid, cyo operon, and Gifsy prophage were induced along with many genes encoding uncharacterized proteins.While, the expression of genes involved in the virulence of Salmonella as well as metabolic functions were decreased. Although the radiation response as a whole could not be illustrated by using DNA microarrays, the data suggest that the response to high dose of irradiation might be more complex than the SOS response.
A new alpha(0)-thalassemia deletion found in a Dutch family (--(AW)).
Phylipsen, M.; Vogelaar, I.P.; Schaap, R.A.; Arkesteijn, S.G.; Boxma, G.L.; Helden, W.C. van; Wildschut, I.C.; Bruin-Roest, A.C. de; Giordano, P.C.; Harteveld, C.L.
2010-01-01
Alpha-thalassemia is an inherited hemoglobin disorder characterized by a microcytic hypochromic anemia caused by a quantitative reduction of the alpha-globin chain. The majority of the alpha-thalassemias is caused by deletions in the alpha-globin gene cluster. A deletion in the alpha-globin gene
Detection of trans-acting factors for hemoglobin switching by cell fusions
International Nuclear Information System (INIS)
Broyles, R.H.; Palmer, J.C.; Smith, D.J.; Ramseyer, T.H.
1986-01-01
The authors have devised protocols for chemically fusing erythroid cells from amphibians of different developmental stages, so that we may study the short-term effects of trans-acting factors on globin gene expression. The authors are performing both homospecifc (Rana x Rana) and heterospecific (Rana x Xenopus) fusions; and they are detecting the expression of specific globin genes with selective radioactive labeling ( 35 S-methionine is incorporated only into adult globins), polyacrylamide gel electrophoresis, monospecific antisera, and cDNA probes that are species-and developmental stage-specific. Their results indicate that: (1) there are factors in tadpole erythroblasts that can reactivate adult Hb synthesis in mature, synthetically-inactive adult RBCs; (2) there are factors in tadpole erythroblasts that can reactivate tadpole globin genes in adult RBCs; and (3) there are factors in adult erythroid cells that apparently activate adult globin genes in tadpole RBCs. These results suggests that erythroid cells from animals of different developmental stages possess different sets of globin gene-specific trans-acting factors which can be studied with a system that exhibits normal developmental Hb switching
Kimura, Shinzo; Ishidou, Emi; Kurita, Sakiko; Suzuki, Yoshiteru; Shibato, Junko; Rakwal, Randeep; Iwahashi, Hitoshi
2006-07-21
Ionizing radiation (IR) is the most enigmatic of genotoxic stress inducers in our environment that has been around from the eons of time. IR is generally considered harmful, and has been the subject of numerous studies, mostly looking at the DNA damaging effects in cells and the repair mechanisms therein. Moreover, few studies have focused on large-scale identification of cellular responses to IR, and to this end, we describe here an initial study on the transcriptional responses of the unicellular genome model, yeast (Saccharomyces cerevisiae strain S288C), by cDNA microarray. The effect of two different IR, X-rays, and gamma (gamma)-rays, was investigated by irradiating the yeast cells cultured in YPD medium with 50 Gy doses of X- and gamma-rays, followed by resuspension of the cells in YPD for time-course experiments. The samples were collected for microarray analysis at 20, 40, and 80 min after irradiation. Microarray analysis revealed a time-course transcriptional profile of changed gene expressions. Up-regulated genes belonged to the functional categories mainly related to cell cycle and DNA processing, cell rescue defense and virulence, protein and cell fate, and metabolism (X- and gamma-rays). Similarly, for X- and gamma-rays, the down-regulated genes belonged to mostly transcription and protein synthesis, cell cycle and DNA processing, control of cellular organization, cell fate, and C-compound and carbohydrate metabolism categories, respectively. This study provides for the first time a snapshot of the genome-wide mRNA expression profiles in X- and gamma-ray post-irradiated yeast cells and comparatively interprets/discusses the changed gene functional categories as effects of these two radiations vis-à-vis their energy levels.
N-alkylvaline levels in globin as a new type of biomarker in risk assessment of alkylating agents.
Lewalter, J
1996-01-01
Adducts with the N-terminal valine of erythrocyte globin can serve as individual biomarkers of systemic and cellular exposure to endogenous and exogenous alkylating agents. In contrast to "detoxification markers" of this kind of mecapturic acids derived from alkylation of glutathione, individual N-alkylations of valine in globin reflect the formally "toxifying" part of the stress due to alkylating agents transformed into the ultimate toxicant. Thus, in contrast to the traditional methods of biological monitoring this approach enables a better evaluation of systemic exposure to reactive agents, adapted more sensibly to the exposure situation over the whole life span of erythrocytes, and it can serve as a specific biomarker of exposure for the purpose of health surveillance in occupational medicine. An individual evaluation of exposures in comparison with the range of corresponding background levels is discussed from the point of view of supplementary risk assessment in medical surveillance of occupationally exposed persons.
Energy Technology Data Exchange (ETDEWEB)
Lim, Sangyong; Jung, Jinwoo [Radiation Food Science and Biotechnology Team, Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongup 580-185 (Korea, Republic of); Kim, Dongho [Radiation Food Science and Biotechnology Team, Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongup 580-185 (Korea, Republic of)], E-mail: fungikim@kaeri.re.kr
2007-11-15
The principle benefit of food irradiation is the reduction of food-borne bacteria in food products. However, the microbiological safety with respect to increased virulence of surviving pathogens after irradiation remains an important issue with regard to the effectiveness of food irradiation. In this study, the transcriptional changes of virulence genes of Salmonella and Vibrio spp. after {gamma} radiation were investigated by real-time PCR (RT-PCR). Samonella typhimurium is dependent upon the products of a large number of genes located within Salmonella pathogenicity islands (SPI) on the chromosome. The expressions of seven genes including four SPI genes, hilD, ssrB, pipB, and sopD, were measured at 1 h after 1 kGy irradiation. Compared with non-irradiated controls, the expression of hilD encoded within SPI1 and sopD encoding SPI1-related effector proteins was reduced about 4- and 16-fold, respectively. The expressions of Vibrio toxin genes, vvhA, ctxA, and tdh, were also monitored during the course of a growth cycle after re-inoculation of irradiated Vibrio spp. (0.5 and 1.0 kGy). The expressions of Vibrio toxin genes tested did not increase compared with non-irradiated counterparts. Results from this study indicate that {gamma} radiation is much more likely to reduce the virulence gene expression of surviving pathogens.
International Nuclear Information System (INIS)
ELMAGHRABY, T.
2010-01-01
The environmental or silent smoke of tobacco contains a large number of components, and many of them are toxic to the epithelial cells. The environmental smoke contains reactive oxygen species (ROS) and reactive nitrogen species (RNS) that are responsible for 50% of the global mortality, and also 56% of the disease burdens are attributed to tobacco in developing countries. The aim of the present study is to evaluate the effects of ROS and RNS on antioxidant enzymes and expression of eNOS and iNOS genes that synthesis NO in addition to the gene expression of MUC5AC that synthesis mucin. Moreover, the present study aimed also to evaluate the role of N-acetylcysteine (NAC) as antioxidant. Male guinea pigs exposed to cigarette smoke and/or gamma radiation were treated with N-acetylcysteine (NAC). The study included determination of the activities of Cu-Zn superoxide dismutase, Mn-superoxide dismutase, glutathione peroxidase in lung and heart and expressions of eNOS, iNOS and MUC5AC genes in lung tissue. The results revealed significant increase in Mn-superoxide dismutase, iNOS gene expression and MUC5AC gene expression, and significant decrease in eNOS gene expression in lung of guinea pig exposed to cigarette smoke and/or gamma radiation. The results also revealed that NAC can reduce the effects of cigarette smoke and radiation on antioxidant enzymes and the expression of genes that synthesis NO and MUC5AC that synthesis mucin. It could be concluded that NAC can ameliorate the action of the bad effects of cigarette smoke and gamma radiation.
Directory of Open Access Journals (Sweden)
Xiaolei Li
Full Text Available OBJECTIVES: Hemoglobin (Hgb is the main oxygen and carbon dioxide carrier in cells of erythroid lineage and is responsible for oxygen delivery to the respiring tissues of the body. However, Hgb is also expressed in nonerythroid cells. In the present study, the expression of Hgb in human uterine cervix carcinoma cells and its role in cervical cancer were investigated. METHODOLOGY: The expression level of Hgb in cervical cancer tissues was assessed by quantitative reverse transcriptase-PCR (qRT-PCR. We applied multiple methods, such as RT-PCR, immunoblotting, and immunohistochemical analysis, to confirm Hgb expression in cervical cancer cells. The effects of ectopic expression of Hgb and Hgb mutants on oxidative stress and cell viability were investigated by cellular reactive oxygen species (ROS analysis and lactate dehydrogenase (LDH array, respectively. Both Annexin V staining assay by flow cytometry and caspase-3 activity assay were used, respectively, to evaluate cell apoptosis. RESULTS: qRT-PCR analysis showed that Hgb-α- (HBA1 and Hgb-β-globin (HBB gene expression was significantly higher in cervical carcinoma than in normal cervical tissues, whereas the expression of hematopoietic transcription factors and erythrocyte specific marker genes was not increased. Immunostaining experiments confirmed the expression of Hgb in cancer cells of the uterine cervix. Hgb mRNA and protein were also detected in the human cervical carcinoma cell lines SiHa and CaSki, and Hgb expression was up-regulated by hydrogen peroxide-induced oxidative stress. Importantly, ectopic expression of wild type HBA1/HBB or HBA1, rather than mutants HBA1(H88R/HBB(H93R unable to bind hemo, suppressed oxidative stress and improved cell viability. CONCLUSIONS: The present findings show for the first time that Hgb is expressed in cervical carcinoma cells and may act as an antioxidant, attenuating oxidative stress-induced damage in cervical cancer cells. These data provide a
International Nuclear Information System (INIS)
Becard, N.
2003-01-01
The aim of this work was to assess whether direct intra-marrow injection of an adeno-viral vector expressing human IL-1α gene stimulates hematopoiesis in healthy non-irradiated and gamma irradiated cynomolgus macaques. In the first hand, we have evaluated the feasibility of this gene therapy strategy in two healthy non-irradiated macaques. In this work, we have observed an increase of neutrophil, monocyte and platelets in the two animals treated with the therapeutic construct. This effect was associated with no abnormal clinical side effect. On the other hand, we have evaluated this strategy in non-human primate exposed to a sublethal gamma irradiation. Two of three animals treated by the therapeutic construct reduced significantly the neutropenia, thrombocytopenia and anemia radio-induced. In conclusion, this gene therapy strategy gave a similar clinical benefit comparatively to systemic administration of huIL-1α but without severe side effect. (author) [fr
A. Wai (Albert); N. Gillemans (Nynke); S. Raguz-Bolognesi (Selina); S. Pruzina (Sara); G. Zafarana (Gaetano); D.N. Meijer (Dies); F.G. Grosveld (Frank); J.N.J. Philipsen (Sjaak)
2003-01-01
textabstractElements with insulator/border activity have been characterized most extensively in Drosophila melanogaster. In vertebrates, the first example of such an element was provided by a hypersensitive site of the chicken beta-globin locus, cHS4. It has been proposed that the homologous site in
Comparative genomics of neuroglobin reveals its early origins.
Directory of Open Access Journals (Sweden)
Jasmin Dröge
Full Text Available Neuroglobin (Ngb is a hexacoordinated globin expressed mainly in the central and peripheral nervous system of vertebrates. Although several hypotheses have been put forward regarding the role of neuroglobin, its definite function remains uncertain. Ngb appears to have a neuro-protective role enhancing cell viability under hypoxia and other types of oxidative stress. Ngb is phylogenetically ancient and has a substitution rate nearly four times lower than that of other vertebrate globins, e.g. hemoglobin. Despite its high sequence conservation among vertebrates Ngb seems to be elusive in invertebrates.We determined candidate orthologs in invertebrates and identified a globin of the placozoan Trichoplax adhaerens that is most likely orthologous to vertebrate Ngb and confirmed the orthologous relationship of the polymeric globin of the sea urchin Strongylocentrotus purpuratus to Ngb. The putative orthologous globin genes are located next to genes orthologous to vertebrate POMT2 similarly to localization of vertebrate Ngb. The shared syntenic position of the globins from Trichoplax, the sea urchin and of vertebrate Ngb strongly suggests that they are orthologous. A search for conserved transcription factor binding sites (TFBSs in the promoter regions of the Ngb genes of different vertebrates via phylogenetic footprinting revealed several TFBSs, which may contribute to the specific expression of Ngb, whereas a comparative analysis with myoglobin revealed several common TFBSs, suggestive of regulatory mechanisms common to globin genes.Identification of the placozoan and echinoderm genes orthologous to vertebrate neuroglobin strongly supports the hypothesis of the early evolutionary origin of this globin, as it shows that neuroglobin was already present in the placozoan-bilaterian last common ancestor. Computational determination of the transcription factor binding sites repertoire provides on the one hand a set of transcriptional factors that are
Directory of Open Access Journals (Sweden)
Ying Huang
2011-01-01
Full Text Available Pyramidal neurons in the hippocampal area CA3 express high levels of BDNF, but how this BDNF contributes to oscillatory properties of hippocampus is unknown.Here we examined carbachol-induced gamma oscillations in hippocampal slices lacking BDNF gene in the area CA3. The power of oscillations was reduced in the hippocampal area CA1, which coincided with increases in the expression and activity of 5-HT3 receptor. Pharmacological block of this receptor partially restored power of gamma oscillations in slices from KO mice, but had no effect in slices from WT mice.These data suggest that BDNF facilitates gamma oscillations in the hippocampus by attenuating signaling through 5-HT3 receptor. Thus, BDNF modulates hippocampal oscillations through serotonergic system.
Weickert, M J; Pagratis, M; Curry, S R; Blackmore, R
1997-01-01
Accumulation of soluble recombinant hemoglobin (rHb1.1) in Escherichia coli requires proper protein folding, prosthetic group (heme) addition, and subunit assembly. This served as a new model system for the study of the effects of temperature, protein synthesis rates, and protein accumulation rates on protein solubility in E. coli. Fermentation expression of rHb1.1 at 30 degrees C from cultures containing a medium or high globin gene dosage (pBR-based or pUC-based plasmids with rHb1.1 genes under the control of the tac promoter) was compared. A medium gene dosage resulted in rHb1.1 accumulating to approximately 7% of the soluble cell protein, of which 78% was soluble. A high globin gene dosage resulted in a > or = 3-fold increase in total globin to 23 to 24% of the soluble cell protein, but 70% was insoluble. Accumulation of insoluble rHb1.1 began immediately upon induction. The proportion of rHb1.1 from the high globin gene dosage that accumulated as insoluble globin was affected by reducing (i) the inducer concentration and (ii) the temperature. Reducing the inducer concentration reduced globin synthesis up to eightfold but increased the proportion of soluble rHb1.1 to 93%. In contrast, total globin protein synthesis was barely affected by reducing the temperature from 30 to 26 degrees C, while soluble globin accumulation increased > 2-fold to approximately 15% of the soluble cell protein. The contrast between the effects of reducing rates of protein synthesis and accumulation and those of reducing temperature suggests that lower temperature stabilizes one or more folding intermediates. We propose a simplified physical model which integrates protein synthesis, folding, and heme association. This model shows that temperature-dependent apoglobin stability is the most critical factor in soluble rHb1.1 accumulation. PMID:9361418
The change of p16 gene expression in glioma cell line C6 after radiation with gamma knife
International Nuclear Information System (INIS)
Zhao Xingli; Zhao Conghai; Tian Yu
2002-01-01
Objective: T observe the change of expression of p16 gene product, P16 protein, after treated by gamma knife on glioma cell line C6. Methods: Glioma C6 cells proliferated in vitro, treated by γ-knife in dose of 5.00 and 6.22 Gy, respectively. P16 protein was detected by immunohistochemical technique and image analysis. Results: The P16 protein in glioma C6 cells was notably increased after treatment with γ knife (P < 0.01). The grey number in C6 group (control group) was 167.1 +- 6.2 and was 155.4 +- 2.0 and 124.9 +- 7.1, respectively, in 5.00 Gy and 6.22 Gy gamma knife treated group. Conclusion: It is suggests that one of the mechanisms of glioma cell C6 apoptosis induced by γ-knife radiation may be associated with activation of p16 gene and increase of P16 protein expression
Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth
2006-10-01
In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.
Dobbs, Larry J; Madigan, Merle N; Carter, Alexis B; Earls, Lori
2002-01-01
Efficient methods of storing tumor specimens for molecular testing are needed in the modern surgical pathology laboratory. The FTA Gene Guard system is a novel method for the collection and room temperature storage of blood samples for DNA testing. The method uses index card-sized filter papers that provide an ideal medium on which to store tumor specimens for DNA testing. To determine whether FTA filter paper can be used in the surgical pathology laboratory to store tumor cells for DNA testing. Cell suspensions were prepared from 60 surgical specimens, and DNA was extracted either immediately or after storage on FTA paper. The DNA extracted by each method was tested by polymerase chain reaction (PCR) for the beta-globin and interferon gamma genes, and the results were compared. Fifteen lymph node specimens stored on FTA paper were then tested for immunoglobulin heavy chain (IgH) gene rearrangement by PCR, and these results were compared with those obtained for immediately extracted DNA. University medical center. The DNA extracted from cells stored on FTA paper performed as well in the PCR as the freshly extracted DNA in nearly all cases (>95%). The results of tests for IgH gene rearrangements showed 100% concordance between the 2 methods of DNA extraction.Conclusion.-Cells from surgical specimens can be stored on FTA paper for extended lengths of time, and DNA can be extracted from these cells for PCR-based testing. FTA filter paper is a reliable medium for the storage and/or transport of tumor cells for PCR-based DNA analysis.
International Nuclear Information System (INIS)
Bahreyni, M. T.; Rezaee, M.
2004-01-01
Ionizing radiation has been shown to produce a broad range of genetic aberrations in human and other species. Most of the genetic aberrations are deletions. To study genetic alterations, an assessment of somatic ell gene mutations induced by ionizing radiation is proper method. In this study, the intragenic and total gene deletions of 18 HPRT-mutants derived from T-lymphocytes and induced by gamma rays were analyzed. PCR amplification of individual HPRT exons and multiplex PCR. HPRT-mutants were isolated by treatment of irradiated samples with 6-thioguanine. MPCR and PCR of individual exons of HPRT demonstrated that the intragenic and total gene deletions were not significantly different. The samples including more than one deletion had non-random significantly higher frequency. Mapping of all intragenic deleltion exhibited a nonrandom distribution. Middle part of HPRT gene was more sensitive to gamma rays. The sensitivity was increased with radiation dose. This study showed that the size of deletions are dose dependent. Our results suggest that alterations in T- lymphocytes mutant genes, induced deletions, size of deletions and distribution of DNA breakpoints appeared to be dependent on low LET radiation dose. (Author) 11 refs
Akinbami, Anthony O; Campbell, Andrew D; Han, Zeqiu J; Luo, Hong-Yuan; Chui, David H K; Steinberg, Martin H
2016-01-01
Hereditary persistence of fetal hemoglobin (HPFH) can be caused by point mutations in the γ-globin gene promoters. We report three rare cases: a child compound heterozygous for Hb S (HBB: c.20A > T) and HPFH with a novel point mutation in the (A)γ-globin gene promoter who had 42.0% Hb S, 17.0% Hb A and 38.0% Hb F; a man with Hb SC (HBB: c.19G > A) disease and a point mutation in the (G)γ-globin gene promoter who had 54.0% Hb S, 18.0% Hb C and 25.0% Hb F; a child heterozygous for Hb S and HPFH due to mutations in both the (A)γ- and (G)γ-globin gene promoters in cis [(G)γ(A)γ(β(+)) HPFH], with 67.0% Hb A, 6.5% Hb S and 25.0% Hb F.
Badii, Ramin; Bener, Abdulbari; Zirie, Mahmoud; Al-Rikabi, Ammar; Simsek, Mehmet; Al-Hamaq, Abdulla O A A; Ghoussaini, Maya; Froguel, Philippe; Wareham, Nick J
2008-03-01
Peroxisome proliferators-activated receptor gamma (PPAR gamma) is a nuclear hormone receptor that serves as a master regulator for adipocytes-specific genes contributing to adipocytes differentiation, insulin sensitivity and lipid metabolism. The substitution of proline to alanine at codon 12 of the PPAR gamma 2 gene (Pro12Ala polymorphism) is most widely studied, and the associations with diabetes, obesity, and other clinical parameters have been reported and discussed in several ethnic groups. Among native Qatar ethnicity, however, there is no report about this polymorphism. The aim of this study was to estimate the allele frequency of the Pro12Ala polymorphism of PPAR gamma 2 gene among Qatari population and investigate the association between this polymorphism and obesity or type 2 diabetes. This is a matched case-control study. It was carried out among diabetic patients and healthy subjects at the Primary Healthcare Clinics, and the survey was conducted from February 2003 to March 2006 in Qatari male and female nationals aged 35 to 60 years. The study was based on matched age, sex, and ethnicity of 400 cases (with diabetes) and 450 controls (without diabetes). Face-to-face interviews were based on a questionnaire that included variables such as age, sex, sociodemographic status, body mass index (BMI), and obesity. Their health status was assessed by medical conditions, family history, and blood pressure measurements. The allele frequency of Pro12Ala polymorphism in PPAR gamma 2 gene among Qataris is lower than that in many Caucasian ethnic groups. No association is seen between the Pro12Ala and type 2 Diabetes (0.055 vs 0.059, OR = 1.1311, P = 0.669). Nearly half of the diabetic type 2 patients (48.5%) were obese (BMI > 30) compared to nondiabetic subjects (29.8%) (P Qatar.
DEFF Research Database (Denmark)
Maestrini, E.; Lai, C.; Marlow, A.
1999-01-01
Previous studies have suggested that the serotonin transporter (5-HTT) gene and the gamma-aminobutyric acid receptor subunit beta3 (GABRB3) gene, or other genes in the 15q11-q13 region, are possibly involved in susceptibility to autism. To test this hypothesis we performed an association study on...
A Family with γ-Thalassemia and High Hb A2 Levels.
Parmeggiani, Giulia; Gualandi, Francesca; Selvatici, Rita; Rimessi, Paola; Bigoni, Stefania; Taddei Masieri, Marina; Dolcini, Bernadetta; Venturoli, Anna; Cappabianca, Maria P; Ferlini, Alessandra; Ravani, Anna
2016-06-01
We describe a family carrying a γ-globin gene deletion associated with an increase of Hb A2 level beyond the normal range. The family included the proband, his sister and their father, all with increased Hb A2 and normal Hb F levels. The proband and his sister showed borderline values of mean corpuscular volume (MCV) and reduced values of mean corpuscular hemoglobin (Hb) (MCH). The proband was referred to our Medical Genetics Service for preconception counseling together with his partner, a typical β-thalassemia (β-thal) carrier. The results were negative for the most frequent α-thalassemia (α-thal) mutations, and had no significant sequence variations of the coding sequences and promoter of the β- and δ-globin genes. Quantitative analysis by multiplex ligation-dependent probe amplification (MPLA) of the β-globin gene cluster detected a heterozygous deletion, ranging between 2.1 and 4.7 kb, in the proband, his sister and the father. The deletion involved the (G)γ gene and (G)γ-(A)γ intergenic region, whereas the 3' region of the (A)γ gene was preserved. A subsequent gap-polymerase chain reaction (gap-PCR) showed that a hybrid (GA)γ fusion gene was present. The deletion segregated with the elevation of Hb A2. The MLPA analysis of the β-globin gene cluster in 150 control alleles excluded a common polymorphism. Despite stronger evidence being needed, the described family suggests a possible role of this γ-globin gene deletion in contributing to Hb A2 elevation, possibly by altering the transcription regulation of the cluster. We propose γ-globin gene dosage analysis to be performed in patients with unexplained elevated Hb A2 levels.
Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.
Directory of Open Access Journals (Sweden)
Jackie A Pallister
Full Text Available BACKGROUND: The cane toad, Bufo (Chaunus marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. METHODOLOGY/PRINCIPAL FINDINGS: The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs, developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin and genetic (adult globin mRNA levels measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. CONCLUSIONS/SIGNIFICANCE: While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.
Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.
Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D
2011-01-25
The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.
Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali
2016-10-01
The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.
A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast
DEFF Research Database (Denmark)
Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.
2007-01-01
and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...
Directory of Open Access Journals (Sweden)
Biaoru Li
Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34
Expression profile of cell cycle genes in the fish CATLA CATLA (Ham.) exposed to gamma radiation
International Nuclear Information System (INIS)
Anbumani, S.; Mohankumar Mary, N.
2012-01-01
The International Commission on Radiological Protection (ICRP) emphasized the need to protect non-human biota from the potential effects of ionizing radiation and proposed to include molecular effects such as DNA damage as endpoints. Molecular effects of ionizing radiation exposure in representative non-humans are largely unexplored and sufficient data is not available in fishes. Gene expression is a fast and sensitive end point in detecting the molecular cues as a result of ionizing radiation exposure in a wide variety of aquatic organisms under suspected environmental contamination. Exposure to ionizing radiation transiently alters gene expression profiles as cells regulate certain genes to protect cellular structures and repair damage. The present study focused on genes like Gadd45á, Cdk1 and Bcl-2 in DNA damage repair and cell cycle machinery and its implication as molecular markers of radiation exposure. This study is first of its kind showing the in vivo expression profile of cell cycle genes in fish exposed to gamma radiation. Although this preliminary investigation points to certain molecular markers of ionizing radiation, elaborate studies with various doses and dose-rates are required before these markers find application as prospective molecular markers in aquatic radiation biodosimetry
Mild and severe muscular dystrophy caused by a single {gamma}-sarcoglycan mutation
Energy Technology Data Exchange (ETDEWEB)
McNally, E.M.; Boennemann, C.G.; Lidov, H.G.W. [Brigham and Women`s Hospital, Boston, MA (United States)] [and others
1996-11-01
Autosomal recessive muscular dystrophy is genetically heterogeneous. One form of this disorder, limb-girdle muscular dystrophy type 2C (LGMD 2C), is prevalent in northern Africa and has been shown to be associated with a single mutation in the gene encoding the dystrophin-associated protein {gamma}-sarcoglycan. The previous mutation analysis of {gamma}-sarcoglycan required the availability of muscle biopsies. To establish a mutation assay for genomic DNA, the intron-exon structure of the {gamma}-sarcoglycan gene was determined, and primers were designed to amplify each of the exons encoding {gamma}-sarcoglycan. We studied a group of Brazilian muscular dystrophy patients for mutations in the {gamma}-sarcoglycan gene. These patients were selected on the basis of autosomal inheritance and/or the presence of normal dystrophin and/or deficiency of {alpha}-sarcoglycan immunostaining. Four of 19 patients surveyed had a single, homozygous mutation in the {gamma}-sarcoglycan gene. The mutation identified in these patients, all of African-Brazilian descent, is identical to that seen in the North African population, suggesting that even patients of remote African descent may carry this mutation. The phenotype in these patients varied considerably. Of four families with an identical mutation, three have a severe Duchenne-like muscular dystrophy. However, one family has much milder symptoms, suggesting that other loci may be present that modify the severity of the clinical course resulting from {gamma}-sarcoglycan gene mutations. 19 refs., 5 figs., 3 tabs.
Rivella, Stefano
2015-04-01
β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.
α:Non–α and Gγ:Aγ globin chain ratios in thalassemia intermedia patients treated with hydroxyurea
Directory of Open Access Journals (Sweden)
Abbas Najjari
2014-05-01
Conclusions: Improvement in α:non-α ratio and consequent decrease of free α-globin chain might be the cause of beneficial effects of hydroxyurea therapy. Two patients who felt better didn't show significant increase in their fetal hemoglobin level, and this is in contradiction with the hypothesis claiming that the HbF level increase is the cause of such therapeutic effect. In spite of the unclear mechanism of action of this drug, hydroxyurea therapy had noticeable impacts on thalassemia intermedia and also sickle cell disease and even patients suffering from thalassemia major.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
International Nuclear Information System (INIS)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun
2012-01-01
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2012-11-15
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
DEFF Research Database (Denmark)
Blomberg Jensen, M; Leffers, H; Petersen, J H
2008-01-01
BACKGROUND: A possible association between the polymorphic CAG repeat in the DNA polymerase gamma (POLG) gene and the risk of testicular germ-cell tumours (TGCT) was investigated in this study. The hypothesis was prompted by an earlier preliminary study proposing an association of the absence...
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K
1996-09-01
To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.
Directory of Open Access Journals (Sweden)
Ali Dehghanifard
2012-07-01
Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.
Energy Technology Data Exchange (ETDEWEB)
Narang, Himanshi, E-mail: narangh@barc.gov.in [Radiation Biology and Health Sciences Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Kumar, Amit [Radiation Biology and Health Sciences Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Bhat, Nagesh [Radiological Physics and Advisory Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Pandey, Badri N.; Ghosh, Anu [Radiation Biology and Health Sciences Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)
2015-10-15
Highlights: • Biological effectiveness of proton and gamma irradiation is compared in A549 cells. • Proton irradiation is two times more cytotoxic than gamma irradiation. • It alters ten times more number of early genes, as observed by microarray study. • It does not enhance cell migration, invasion and adhesion, unlike gamma irradiation. • It was more effective in reducing the percentage of cancer stem cell like cells. - Abstract: Proton beam therapy is a cutting edge modality over conventional gamma radiotherapy because of its physical dose deposition advantage. However, not much is known about its biological effects vis-a-vis gamma irradiation. Here we investigated the effect of proton- and gamma- irradiation on cell cycle, death, epithelial-mesenchymal transition (EMT) and “stemness” in human non-small cell lung carcinoma cells (A549). Proton beam (3 MeV) was two times more cytotoxic than gamma radiation and induced higher and longer cell cycle arrest. At equivalent doses, numbers of genes responsive to proton irradiation were ten times higher than those responsive to gamma irradiation. At equitoxic doses, the proton-irradiated cells had reduced cell adhesion and migration ability as compared to the gamma-irradiated cells. It was also more effective in reducing population of Cancer Stem Cell (CSC) like cells as revealed by aldehyde dehydrogenase activity and surface phenotyping by CD44{sup +}, a CSC marker. These results can have significant implications for proton therapy in the context of suppression of molecular and cellular processes that are fundamental to tumor expansion.
International Nuclear Information System (INIS)
Ailan, He; Shuanglin, Xiang; Xiangwen, Xiao; Daolong, Ren; Lu, Gan; Xiaofeng, Ding; Xi, Qiao; Xingwang, Hu; Rushi, Liu; Jian, Zhang
2009-01-01
Activator protein 2 gamma (AP-2γ) is a member of the transcription factor activator protein-2 (AP-2) family, which is developmentally regulated and plays a role in human neoplasia. AP-2γ has been found to be overexpressed in most breast cancers, and have a dual role to inhibit tumor initiation and promote tumor progression afterwards during mammary tumorigensis. To identify the gene targets that mediate its effects, we performed chromatin immunoprecipitation (ChIP) to isolate AP-2γ binding sites on genomic DNA from human breast cancer cell line MDA-MB-453. 20 novel DNA fragments proximal to potential AP-2γ targets were obtained. They are categorized into functional groups of carcinogenesis, metabolism and others. A combination of sequence analysis, reporter gene assays, quantitative real-time PCR, electrophoretic gel mobility shift assays and immunoblot analysis further confirmed the four AP-2γ target genes in carcinogenesis group: ErbB2, CDH2, HPSE and IGSF11. Our results were consistent with the previous reports that ErbB2 was the target gene of AP-2γ. Decreased expression and overexpression of AP-2γ in human breast cancer cells significantly altered the expression of these four genes, indicating that AP-2γ directly regulates them. This suggested that AP-2γ can coordinate the expression of a network of genes, involving in carcinogenesis, especially in breast cancer. They could serve as therapeutic targets against breast cancers in the future
Regulation of PPAR{gamma} function by TNF-{alpha}
Energy Technology Data Exchange (ETDEWEB)
Ye Jianping [Pennington Biomedical Research Center, Louisiana State University System, 6400 Perkins Road, Baton Rouge, LA 70808 (United States)], E-mail: yej@pbrc.edu
2008-09-26
The nuclear receptor PPAR{gamma} is a lipid sensor that regulates lipid metabolism through gene transcription. Inhibition of PPAR{gamma} activity by TNF-{alpha} is involved in pathogenesis of insulin resistance, atherosclerosis, inflammation, and cancer cachexia. PPAR{gamma} activity is regulated by TNF-{alpha} at pre-translational and post-translational levels. Activation of serine kinases including IKK, ERK, JNK, and p38 may be involved in the TNF-regulation of PPAR{gamma}. Of the four kinases, IKK is a dominant signaling molecule in the TNF-regulation of PPAR{gamma}. IKK acts through at least two mechanisms: inhibition of PPAR{gamma} expression and activation of PPAR{gamma} corepressor. In this review article, literature is reviewed with a focus on the mechanisms of PPAR{gamma} inhibition by TNF-{alpha}.
Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.
Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun
α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.
Energy Technology Data Exchange (ETDEWEB)
Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others
1995-12-01
T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
The effect of HBB:c.*+96T>C (3’UTR +1570 T>C on the mild b-thalassemia intermedia phenotype
Directory of Open Access Journals (Sweden)
Türker Bilgen
2011-09-01
Full Text Available Hemoglobin beta (HBB:c.*+96T>C substitution is very rare among β-globin gene mutations and its clinical significance remains to be clarified. The present study aimed to investigate the role of HBB:c.*+96T>C in the β-thalassemia intermedia phenotype in a Turkish family. The proband and parents were screened for β-globin gene mutations via direct sequencing. Hematological and physical examination results were recorded, and correlated according to genotype. The proband was compound heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, whereas his mother and father were heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, respectively. The father had almost normal hematological findings, whereas the mother had the typical β-thalassemia trait phenotype. The proband was diagnosed as mild β-thalassemia intermedia based on hepatosplenomegaly and hematological findings. To the best of our knowledge this is the first report of HBB:c.*+96T>C mutation in a Turkish family. HBB:c.* 96T>C substitution is a very rare, but clinically relevant β-globin gene mutation. Additionally, we think that if 1 spouse is a carrier for β-globin gene mutation the other should be screened for silent mutations, such as HBB:c.*+96T>C mutation of the β-globin gene, even if she/he does not have any clinical or hematological signs of the β-thalassemia trait phenotype.
Rat embryo cells immortalized with transfected oncogenes are transformed by gamma irradiation.
Endlich, B; Salavati, R; Sullivan, T; Ling, C C
1992-12-01
Cesium-137 gamma rays were used to transform rat embryo cells (REC) which were first transfected with activated c-myc or c-Ha-ras oncogenes to produce immortal cell lines (REC:myc and REC:ras). When exposed to 6 Gy of 137Cs gamma rays, some cells became morphologically transformed with focus formation frequencies of approximately 3 x 10(-4) for REC:myc and approximately 1 x 10(-4) for REC:ras, respectively. Cells isolated from foci of gamma-ray-transformed REC:myc (REC:myc:gamma) formed anchorage-independent colonies and were tumorigenic in nude mice, but foci from gamma-ray-transformed REC:ras (REC:ras:gamma) did not exhibit either of these criteria of transformation. Similar to the results with gamma irradiation, we observed a sequence-dependent phenomenon when myc and ras were transfected into REC, one at a time. REC immortalized by ras transfection were not converted to a tumorigenic phenotype by secondary transfection with myc, but REC transfected with myc were very susceptible to transformation by subsequent ras transfection. This suggests that myc-immortalized cells are more permissive to transformation via secondary treatments. In sequentially transfected REC, myc expression was high whether it was transfected first or second, whereas ras expression was highest when the ras gene was transfected secondarily into myc-containing REC. Molecular analysis of REC:ras:gamma transformants showed no alterations in structure of the transfected ras or of the endogenous ras, myc, p53, or fos genes. The expression of ras and p53 was increased in some isolates of REC:ras:gamma, but myc and fos expression were not affected. Similarly, REC:myc:gamma transformants did not demonstrate rearrangement or amplification of the transfected or the endogenous myc genes, or of the potentially cooperating Ha-, Ki-, or N-ras genes. Northern hybridization analysis revealed increased expression of N-ras in two isolates, REC:myc:gamma 33 and gamma 41, but no alterations in the expression
International Nuclear Information System (INIS)
I Ishak
2016-01-01
The BADH2 gene acts as suppressor of 2-acetyl-1-pyrolline (2AP) biosynthesis in plants. 2AP is the volatile compound which provides fragrance in rice. Biosynthesis of 2AP occurs when BADH2 loses its function as suppressor gene. Aromatic rice cultivars naturally incur mutation of BADH2 gene at 8 bp. In this experiment, aromatic mutant rice lines derived from irradiation of Sintanur cultivar by gamma rays with dose of 100 Gy were studied in molecular level. These mutant lines were characterized at the M10 plantgeneration under the assumption that genetically these aromatic mutant rice lines were homozygotic. Several primers related to aroma in rice have been used for polymerase chain reaction (PCR) in a thermal cycler instrument. Gel electrophoreses were carried out using 1.5% agarose in TAE buffer. DNA fragments at 254 bp and 355 bp (base pair) were taken and amplified by primer for nucleotide sequencing of these fragments. Molecular identification and characterization after electrophoresis showed that the mutant line from AR1020 can be differentiated from AR.1080 at 254 bp. Nucleotide sequence data from of these DNA fragments showed that point mutations (deletions and substitutions) occurred at the BADH2 gene in exon 7; those are called second mutation and were caused by gamma rays effects. The Sintanur variety was used as check cultivar and its DNA sequence was compared to that of the AR.1020 mutant line. The results from both DNA sequences (from cv. Sintanur and AR.1020) derived from fragments at 254 bp show that point mutations occurred within exon 7 and earlier stop codon occurred in the AR.1020 mutant rice line. Further, the use of EA primer in PCR resulted in detection of deletion and substitution of nucleotides in the AR.1020 mutant line. (author)
Temporal Gene Expression of the Cyanobacterium Arthrospira in Response to Gamma Rays
Badri, Hanène; Monsieurs, Pieter; Coninx, Ilse; Nauts, Robin; Wattiez, Ruddy; Leys, Natalie
2015-01-01
The edible cyanobacterium Arthrospira is resistant to ionising radiation. The cellular mechanisms underlying this radiation resistance are, however, still largely unknown. Therefore, additional molecular analysis was performed to investigate how these cells can escape from, protect against, or repair the radiation damage. Arthrospira cells were shortly exposed to different doses of 60Co gamma rays and the dynamic response was investigated by monitoring its gene expression and cell physiology at different time points after irradiation. The results revealed a fast switch from an active growth state to a kind of 'survival modus' during which the cells put photosynthesis, carbon and nitrogen assimilation on hold and activate pathways for cellular protection, detoxification, and repair. The higher the radiation dose, the more pronounced this global emergency response is expressed. Genes repressed during early response, suggested a reduction of photosystem II and I activity and reduced tricarboxylic acid (TCA) and Calvin-Benson-Bassham (CBB) cycles, combined with an activation of the pentose phosphate pathway (PPP). For reactive oxygen species detoxification and restoration of the redox balance in Arthrospira cells, the results suggested a powerful contribution of the antioxidant molecule glutathione. The repair mechanisms of Arthrospira cells that were immediately switched on, involve mainly proteases for damaged protein removal, single strand DNA repair and restriction modification systems, while recA was not induced. Additionally, the exposed cells showed significant increased expression of arh genes, coding for a novel group of protein of unknown function, also seen in our previous irradiation studies. This observation confirms our hypothesis that arh genes are key elements in radiation resistance of Arthrospira, requiring further investigation. This study provides new insights into phasic response and the cellular pathways involved in the radiation resistance of
Temporal Gene Expression of the Cyanobacterium Arthrospira in Response to Gamma Rays.
Directory of Open Access Journals (Sweden)
Hanène Badri
Full Text Available The edible cyanobacterium Arthrospira is resistant to ionising radiation. The cellular mechanisms underlying this radiation resistance are, however, still largely unknown. Therefore, additional molecular analysis was performed to investigate how these cells can escape from, protect against, or repair the radiation damage. Arthrospira cells were shortly exposed to different doses of 60Co gamma rays and the dynamic response was investigated by monitoring its gene expression and cell physiology at different time points after irradiation. The results revealed a fast switch from an active growth state to a kind of 'survival modus' during which the cells put photosynthesis, carbon and nitrogen assimilation on hold and activate pathways for cellular protection, detoxification, and repair. The higher the radiation dose, the more pronounced this global emergency response is expressed. Genes repressed during early response, suggested a reduction of photosystem II and I activity and reduced tricarboxylic acid (TCA and Calvin-Benson-Bassham (CBB cycles, combined with an activation of the pentose phosphate pathway (PPP. For reactive oxygen species detoxification and restoration of the redox balance in Arthrospira cells, the results suggested a powerful contribution of the antioxidant molecule glutathione. The repair mechanisms of Arthrospira cells that were immediately switched on, involve mainly proteases for damaged protein removal, single strand DNA repair and restriction modification systems, while recA was not induced. Additionally, the exposed cells showed significant increased expression of arh genes, coding for a novel group of protein of unknown function, also seen in our previous irradiation studies. This observation confirms our hypothesis that arh genes are key elements in radiation resistance of Arthrospira, requiring further investigation. This study provides new insights into phasic response and the cellular pathways involved in the radiation
Thrombosis in Hb Taybe [codons 38/39 (-ACC) (α1)
DEFF Research Database (Denmark)
Juul, Maja Bech; Vestergaard, Hanne; Petersen, Jesper
2012-01-01
Hb Taybe is a highly unstable hemoglobin (Hb) variant caused by a 3 bp deletion at codons 38/39 (-ACC) on the α1-globin gene. We report for the first time, a patient with a compound heterozygosity for Hb Taybe and a 5 bp deletion at the splice donor site of IVS-I on the α2-globin gene and ischemic...
Directory of Open Access Journals (Sweden)
Mario Iorio
2004-01-01
Full Text Available On 398 river buffalo samples, randomly collected in distinct breeding areas of the Campania region, high-resolution analytical systems were used to identify both qualitative and quantitative variations of the Hb phenotype. Polyacrylamide gel isoelectric focusing and HPLC were used to determine the ratio between HBA1 and HBA2 globin chains; restriction endonuclease analysis was performed to assess whether quantitative variations in Hb bands were related to an unusual number of a-globin genes. In the two buffalo subpopulations, allele frequencies of the alpha and beta globin systems were calculated, and F statistics (FIS, FIT and FST were estimated as parameters of genetic diversity. The results suggest that: i as shown by RFLP analysis, only a couple of associated a globin genes account for the quantitative variations recorded at the phenotypic level; ii as expected, in the a globin gene system (HBA, the frequency of haplotype B (HBA-B largely exceeded that of haplotype A (HBA-A (95.1% vs 4.9%; iii the frequency of the usual allele at the beta locus is 0.6, as opposed to 0.4 of the slow variant; iiii the most significant component of variation of the genetic system of hemoglobin is between individuals within the same location.
DEFF Research Database (Denmark)
Christensen, M; Funder, A D; Bendix, K
2006-01-01
AIM: To compare clonal T cell receptor gamma (TCRgamma) gene rearrangements in frozen and formalin-fixed paraffin wax-embedded (FFPE) tissue, using capillary electrophoresis for use in diagnostics, as T cell lymphomas may be difficult to diagnose by conventional methods.METHODS: The DNA for PCR......% for patient specimens and the specificity 100%. The junctional region between the Vgamma and Jgamma segments was specific for each patient.CONCLUSIONS: Capillary electrophoresis of PCR products from frozen and FFPE tissue is suitable for detecting clonal TCRgamma gene rearrangements. It is important, however...
Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G
1981-01-01
Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with...
Polymerase Gamma Disease through the Ages
Saneto, Russell P.; Naviaux, Robert K.
2010-01-01
The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…
Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.
Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca
2015-01-01
β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.
Xu, Anping; Chen, Weidong; Xia, Yong; Zhou, Yu; Ji, Ling
2018-04-07
HbA1c is a widely used biomarker for diabetes mellitus management. Here, we evaluated the accuracy of six methods for determining HbA1c values in Chinese patients with common α- and β-globin chains variants in China. Blood samples from normal subjects and individuals exhibiting hemoglobin variants were analyzed for HbA1c, using Sebia Capillarys 2 Flex Piercing (C2FP), Bio-Rad Variant II Turbo 2.0, Tosoh HLC-723 G8 (ver. 5.24), Arkray ADAMS A1c HA-8180V fast mode, Cobas c501 and Trinity Ultra2 systems. DNA sequencing revealed five common β-globin chain variants and three common α-globin chain variants. The most common variant was Hb E, followed by Hb New York, Hb J-Bangkok, Hb G-Coushatta, Hb Q-Thailand, Hb G-Honolulu, Hb Ube-2 and Hb G-Taipei. Variant II Turbo 2.0, Ultra2 and Cobas c501 showed good agreement with C2FP for most samples with variants. HLC-723 G8 yielded no HbA1c values for Hb J-Bangkok, Hb Q-Thailand and Hb G-Honolulu. Samples with Hb E, Hb G-Coushatta, Hb G-Taipei and Hb Ube-2 produced significant negative biases for HLC-723 G8. HA-8180V showed statistically significant differences for Hb E, Hb G-Coushatta, Hb G-Taipei, Hb Q-Thailand and Hb G-Honolulu. HA-8180V yielded no HbA1c values for Hb J-Bangkok. All methods showed good agreement for samples with Hb New York. Some common hemoglobin variants can interfere with HbA1c determination by the most popular methods in China.
International Nuclear Information System (INIS)
Putintseva, O.V.; Artykhov, V.G.; Kalaeva, E.A.
2000-01-01
The contribution of hem and globin components of electrophoretic fractions of UV-irradiated human carboxyhemoglobin to photo destruction of the protein was studied. The changes observed are the result of summation of some processes unequal in intensity and direction that take place in microgeterogenous media of photo modified protein. Photo sensitivity of hemoproteid in electrophoretic fraction depends on apoprotein condition, whereas the hem photo resistance cannot be the evidence of the photo stability of the whole molecule [ru
Lapolla, Annunziata; Ragazzi, Eugenio; Andretta, Barbara; Fedele, Domenico; Tubaro, Michela; Seraglia, Roberta; Molin, Laura; Traldi, Pietro
2007-06-01
To clarify the possible pathogenetic role of oxidation products originated from the glycation of proteins, human globins from nephropathic patients have been studied by matrix-assisted laser desorption/ionization mass spectrometry (MALDI), revealing not only unglycated and monoglycated globins, but also a series of different species. For the last ones, structural assignments were tentatively done on the basis of observed masses and expectations for the Maillard reaction pattern. Consequently, they must be considered only propositive, and the discussion which will follow must be considered in this view. In our opinion this approach does not seem to compromise the intended diagnostic use of the data because distinctions are valid even if the assignments are uncertain. We studied nine healthy subjects and 19 nephropathic patients and processed the data obtained from the MALDI spectra using a multivariate analysis. Our results showed that multivariate analytical techniques enable differential aspects of the profile of molecular species to be identified in the blood of end stage nephropathic patients. A correct grouping can be achieved by principal component analysis (PCA) and the results suggest that several products involved in carbonyl stress exist in nephropathic patients. These compounds may have a relevant role as specific markers of the pathological state.
Energy Technology Data Exchange (ETDEWEB)
Serment G, J. H.; Martinez M, E.; Alcantara D, D., E-mail: jorge.serment@inin.gob.mx [ININ, Departamento de Biologia, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)
2013-05-01
All living organisms are naturally exposed to radiation from different sources. Ionizing radiation produces a plethora of lesions upon DNA that can be categorized as single and double strand breaks and base damage. Among them, unrepaired double strand breaks (Dbs) have the greatest biological significance, since they are responsible of cell death. In Escherichia coli this kind of lesions are repaired mostly by homologous recombination. In this work the participation of some recombination genes in the repair of Dbs is evaluated. Escherichia coli defective strains were exposed to gamma radiation and incubated for different periods in ideal conditions. Both micro electrophoresis and pulse field gel electrophoresis techniques were used to evaluate the kinetics of repair of such lesions, reflecting the importance of each defective gene in the process. (Author)
Talbot, D.; Collis, P.; Antoniou, Michael; Vidal, M.; Grosveld, Frank; Greaves, David
1989-01-01
textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell lines and transgenic animals has turned out to be at a low level relative to that of endogenous genes, and influenced by the chromosomal site of insertion of the exogenous construct. We have previo...
LCR/MEL: A versatile system for high-level expression of heterologous proteins in erythroid cells.
M. Needham; C. Gooding; K. Hudson; M. Antoniou (Michael); F.G. Grosveld (Frank); M. Hollis
1992-01-01
textabstractWe have used the human globin locus control region (LCR) to assemble an expression system capable of high-level, integration position-independent expression of heterologous genes and cDNAs in murine erythroleukaemia (MEL) cells. The cDNAs are inserted between the human beta-globin
Hb TAYBE: clinical and morphological findings IN 43 patients.
Koren, Ariel; Levin, Carina; Zalman, Luci; Palmor, Haya; Filon, Dvora; Chubar, Evgeny; Resnitzky, Peretz; Bennett, Michael
2016-08-01
Hereditary sequence variants in globin genes are usually silent and are rarer in α-globin chains than β-globin chains. Some may lead to an unstable protein with a hemolytic or thalassemic phenotype. Hb Taybe is an unstable α-chain hemoglobin variant caused by the deletion of a threonine residue at codon 38 or 39 of the α1 globin gene. This deletion results in a structural abnormality that affects the α1 β2 contact and the α1 β1 interface, producing a highly unstable Hb. We describe the clinical, laboratory, and morphological characteristics of 43 patients with Hb Taybe, sixteen of whom are heterozygous, eight are homozygous, and nineteen are double heterozygous for Hb Taybe and other α-gene mutations or deletions. The clinical presentation is very variable from a mild hemolytic anemia to the need for red cell transfusion. Morphological characteristics include erythroid hyperplasia, defective hemoglobin production, and dyserythropoietic features. On electron microscopy dyserythropoiesis and cytoplasmic precipitation of globin compatible optical dense material is seen. This is the largest report of Hb Taybe patients. Previous reported cohorts are not related to these cases. We conclude that patients carrying Hb Taybe have a unique hematological and clinical phenotype distinct from other hemoglobinopathies and from congenital dyserythropoietic anemia. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Phenotypic spectrum associated with mutations of the mitochondrial polymerase gamma gene.
Horvath, Rita; Hudson, Gavin; Ferrari, Gianfrancesco; Fütterer, Nancy; Ahola, Sofia; Lamantea, Eleonora; Prokisch, Holger; Lochmüller, Hanns; McFarland, Robert; Ramesh, V; Klopstock, Thomas; Freisinger, Peter; Salvi, Fabrizio; Mayr, Johannes A; Santer, Rene; Tesarova, Marketa; Zeman, Jiri; Udd, Bjarne; Taylor, Robert W; Turnbull, Douglass; Hanna, Michael; Fialho, Doreen; Suomalainen, Anu; Zeviani, Massimo; Chinnery, Patrick F
2006-07-01
Mutations in the gene coding for the catalytic subunit of the mitochondrial DNA (mtDNA) polymerase gamma (POLG1) have recently been described in patients with diverse clinical presentations, revealing a complex relationship between genotype and phenotype in patients and their families. POLG1 was sequenced in patients from different European diagnostic and research centres to define the phenotypic spectrum and advance understanding of the recurrence risks. Mutations were identified in 38 cases, with the majority being sporadic compound heterozygotes. Eighty-nine DNA sequence changes were identified, including 2 predicted to alter a splice site, 1 predicted to cause a premature stop codon and 13 predicted to cause novel amino acid substitutions. The majority of children had a mutation in the linker region, often 1399G-->A (A467T), and a mutation affecting the polymerase domain. Others had mutations throughout the gene, and 11 had 3 or more substitutions. The clinical presentation ranged from the neonatal period to late adult life, with an overlapping phenotypic spectrum from severe encephalopathy and liver failure to late-onset external ophthalmoplegia, ataxia, myopathy and isolated muscle pain or epilepsy. There was a strong gender bias in children, with evidence of an environmental interaction with sodium valproate. POLG1 mutations cause an overlapping clinical spectrum of disease with both dominant and recessive modes of inheritance. 1399G-->A (A467T) is common in children, but complete POLG1 sequencing is required to identify multiple mutations that can have complex implications for genetic counselling.
Directory of Open Access Journals (Sweden)
Wellington dos Santos Silva
2010-01-01
Full Text Available Five restriction site polymorphisms in the β-globin gene cluster (HincII-5'ε, HindIII-Gγ, HindIII-ªγ, HincII-'ψβ1 and HincII-3''ψβ1 were analyzed in three populations (n = 114 from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+----,3(----+,4(-+--+and6(-++-+onthe βA chromosomes were the most common, and two haplotypes, 9 (-++++and 14 (++--+, were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16 had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin and CAR (Central African Republic, with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.
Roles of genes and Alu repeats in nonlinear correlations of HUMHBB DNA sequence
International Nuclear Information System (INIS)
Xiao Yi; Huang Yanzhao
2004-01-01
DNA sequences of different species and different portion of the DNA of the same species may have completely different correlation properties, but the origin of these correlations is still not very clear and is currently being investigated, especially in different particular cases. We report here a study of the DNA sequence of human beta globin region (HUMHBB) which has strong linear and nonlinear correlations. We studied the roles of two of the typical elements of DNA sequence, genes and Alu repeats, in the nonlinear correlations of HUMHBB. We find that there exist strong nonlinear correlations between the exons or introns in different genes and between the Alu repeats. They may be one of the major sources of the nonlinear correlations in HUMBHB
Convergent evolution of hemoglobin switching in jawed and jawless vertebrates.
Rohlfing, Kim; Stuhlmann, Friederike; Docker, Margaret F; Burmester, Thorsten
2016-02-01
During development, humans and other jawed vertebrates (Gnathostomata) express distinct hemoglobin genes, resulting in different hemoglobin tetramers. Embryonic and fetal hemoglobin have higher oxygen affinities than the adult hemoglobin, sustaining the oxygen demand of the developing organism. Little is known about the expression of hemoglobins during development of jawless vertebrates (Agnatha). We identified three hemoglobin switches in the life cycle of the sea lamprey. Three hemoglobin genes are specifically expressed in the embryo, four genes in the filter feeding larva (ammocoete), and nine genes correspond to the adult hemoglobin chains. During the development from the parasitic to the reproductive adult, the composition of hemoglobin changes again, with a massive increase of chain aHb1. A single hemoglobin chain is expressed constitutively in all stages. We further showed the differential expression of other globin genes: Myoglobin 1 is most highly expressed in the reproductive adult, myoglobin 2 expression peaks in the larva. Globin X1 is restricted to the embryo; globin X2 was only found in the reproductive adult. Cytoglobin is expressed at low levels throughout the life cycle. Because the hemoglobins of jawed and jawless vertebrates evolved independently from a common globin ancestor, hemoglobin switching must also have evolved convergently in these taxa. Notably, the ontogeny of sea lamprey hemoglobins essentially recapitulates their phylogeny, with the embryonic hemoglobins emerging first, followed by the evolution of larval and adult hemoglobins.
Energy Technology Data Exchange (ETDEWEB)
Ferre, Silvia [Department of Physiology, Radboud University Nijmegen Medical Centre (Netherlands); Veenstra, Gert Jan C. [Department of Molecular Biology, Faculty of Science, Nijmegen Centre for Molecular Life Sciences, Radboud University Nijmegen (Netherlands); Bouwmeester, Rianne; Hoenderop, Joost G.J. [Department of Physiology, Radboud University Nijmegen Medical Centre (Netherlands); Bindels, Rene J.M., E-mail: r.bindels@fysiol.umcn.nl [Department of Physiology, Radboud University Nijmegen Medical Centre (Netherlands)
2011-01-07
Research highlights: {yields} Defects in HNF-1B transcription factor affect Mg{sup 2+} handling in the distal kidney. {yields} {gamma}a- and {gamma}b- subunits of the Na{sup +}/K{sup +}-ATPase colocalize in the distal convoluted tubule of the nephron. {yields} HNF-1B specifically activates {gamma}a expression. {yields} HNF-1B mutants have a dominant negative effect on wild type HNF-1B activity. {yields} Defective transcription of {gamma}a may promote renal Mg{sup 2+} wasting. -- Abstract: Hepatocyte nuclear factor-1B (HNF-1B) is a transcription factor involved in embryonic development and tissue-specific gene expression in several organs, including the kidney. Recently heterozygous mutations in the HNF1B gene have been identified in patients with hypomagnesemia due to renal Mg{sup 2+} wasting. Interestingly, ChIP-chip data revealed HNF-1B binding sites in the FXYD2 gene, encoding the {gamma}-subunit of the Na{sup +}/K{sup +}-ATPase. The {gamma}-subunit has been described as one of the molecular players in the renal Mg{sup 2+} reabsorption in the distal convoluted tubule (DCT). Of note, the FXYD2 gene can be alternatively transcribed into two main variants, namely {gamma}a and {gamma}b. In the present study, we demonstrated via two different reporter gene assays that HNF-1B specifically acts as an activator of the {gamma}a-subunit, whereas the {gamma}b-subunit expression was not affected. Moreover, the HNF-1B mutations H69fsdelAC, H324S325fsdelCA, Y352finsA and K156E, previously identified in patients with hypomagnesemia, prevented transcription activation of {gamma}a-subunit via a dominant negative effect on wild type HNF1-B. By immunohistochemistry, it was shown that the {gamma}a- and {gamma}b-subunits colocalize at the basolateral membrane of the DCT segment of mouse kidney. On the basis of these data, we suggest that abnormalities involving the HNF-1B gene may impair the relative abundance of {gamma}a and {gamma}b, thus affecting the transcellular Mg{sup 2
Synthetic review on the different anthropological aspects of ...
African Journals Online (AJOL)
Hemoglobinopathies are a group of hereditary hemolytic anemia characterized by qualitative (sickle cell disease) or quantitative (thalassemia) defects in the alpha or beta-globin chain synthesis. Homozygotes or compound heterozygotes for the mutated alpha or beta-globin genes can cause severe anemia at an early age.
D. Talbot; P. Collis; M. Antoniou (Michael); M. Vidal; F.G. Grosveld (Frank); D.R. Greaves (David)
1989-01-01
textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell
Daar, Shahina; Al Zadjali, Shoaib; Alkindi, Salam; Wali, Yasser; Al-Rawas, Abdulhakeem; Al-Haddabi, Humood; Al-Riyami, Arwa Z
2018-04-01
To describe the laboratory features of haemoglobin Fontainebleau (Hb FB) and its interactions with various α and β globin gene mutations in the Omani population. Over a period of 10 years, a total of 94 blood samples were suspected to have an α variant on HPLC at the Sultan Qaboos University Hospital, Muscat, Oman. Molecular testing was performed using PCR based techniques to define the variant and to analyse other interacting mutations in either α or β globin genes. Of 94 subjects, molecular analysis confirmed the Hb FB variant in 55 samples (38 non-cord and 17 cord blood). A total of 36/38 non-cord samples were heterozygous for the variant, while all 17 cord blood samples were heterozygotes. A total of 43/55 individuals had a concomitant α and/or β globin gene mutation. Hb FB is the the most common α variant in the Omani population. We report the different HPLC profiles of this variant that we observed, with and without other haemoglobinopathies in non-cord and cord blood samples. This is the first report describing the HPLC profiles of this α globin chain variant on 1 year follow-up testing of cord blood samples. With careful analysis by HPLC, it is possible not only to identify Hb FB but also to predict any concomitant α and/or β globin gene mutations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
International Nuclear Information System (INIS)
Farooh, H.A.A.
2010-01-01
The effect of radiotherapy on hemoglobin (Hb) polymer, obtained from patients (cases) before and after two periods of local gamma irradiation was studied. The results were compared with healthy volunteer. The patients were classified into two main groups. The first group represents cases that suffer from breast cancer, while, the second group represents cases that suffer from pelvic cancer. The total doses for breast cancer were ranged from 45 to 50 Gy, divided into 25 fractions for 5 weeks. While the total doses for pelvic irradiation were ranged from 20 to 66 Gy; divided into 10-25 fraction for 2-5 weeks. The physical properties of Hb have been studied via several characterization techniques, such as X-ray diffraction, viscosity, Fourier Transform Infra-red spectroscopy (FTIR), Electron Spin Resonance (ESR) and UV-visible spectra. The resultant effects of radiotherapy can be summarized as follows: X-ray diffraction pattern of Hb polymer, for control and cancer breast before and after exposure to accumulated gamma irradiation, were characterized by halo consisting of two adjacent peaks with maximum intensity observed at 2θ = 9.549 and 21.222, respectively. By increasing the gamma doses, a decrease in crystalline phase (disordering character) were obtained. Also, the halos width at half of maximal intensity (δW) shows a decrease followed by an increase with increasing the accumulative gamma dose up to 50 Gy, but still below + ve and -ve control values. The viscosity were measured for Hb solutions of concentration 4.1x10 -5 Mol on the base of heme-heme interaction and at different shear rates (10-400 sec -1 ). The plastic viscosity for every hemoglobin samples was calculated by Bingham equation using specific software of the viscometer. There was an increase in the plastic viscosity of Hb cancer patients compared to -ve control. On irradiation the viscosity shows an increase with increasing the accumulative gamma dose. Fourier transform infra-red spectra (FTIR
Directory of Open Access Journals (Sweden)
Ikuta T
2013-12-01
Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to
Transdifferentiation of Human Hair Follicle Mesenchymal Stem Cells into Red Blood Cells by OCT4
Directory of Open Access Journals (Sweden)
Zhijing Liu
2015-01-01
Full Text Available Shortage of red blood cells (RBCs, erythrocytes can have potentially life-threatening consequences for rare or unusual blood type patients with massive blood loss resulting from various conditions. Erythrocytes have been derived from human pluripotent stem cells (PSCs, but the risk of potential tumorigenicity cannot be ignored, and a majority of these cells produced from PSCs express embryonic ε- and fetal γ-globins with little or no adult β-globin and remain nucleated. Here we report a method to generate erythrocytes from human hair follicle mesenchymal stem cells (hHFMSCs by enforcing OCT4 gene expression and cytokine stimulation. Cells generated from hHFMSCs expressed mainly the adult β-globin chain with minimum level of the fetal γ-globin chain. Furthermore, these cells also underwent multiple maturation events and formed enucleated erythrocytes with a biconcave disc shape. Gene expression analyses showed that OCT4 regulated the expression of genes associated with both pluripotency and erythroid development during hHFMSC transdifferentiation toward erythroid cells. These findings show that mature erythrocytes can be generated from adult somatic cells, which may serve as an alternative source of RBCs for potential autologous transfusion.
Hb Presbyterian (HBB: c.327C>G) in a Nicaraguan Family.
Pernudy-Ubau, Allan; Salinas-Molina, Jaslyn; Requenez, Yaneris; Ortiz-Lopez, Marianela; Puller, Ann-Christin; García-Rosales, Kenia; Rodríguez-Estrada, Anaishelle; Rodríguez-Romero, Walter; Mejía-Baltodano, Gerardo; Luo, Hong-Yuan; Chui, David H K
2017-01-01
Hemoglobin (Hb) is the protein responsible for oxygen transportation. It is a tetrameric protein comprising two α- and two β-globin subunits. In the literature, a large number of mutations in the α- and β-globin genes have been documented. Among these mutations, Hb Presbyterian (HBB: c.327 C>G), is a naturally occurring mutant exerting low oxygen affinity. The C to G exchange (AAC>AAG) at codon 108 of the β-globin gene results in the substitution of asparagine by lysine. Here, we document the identification of HBB: c.327 C>G in a 6-year-old female patient and her father from Nicaragua and Cuba, respectively. The presence of the abnormal Hb was confirmed by cellulose acetate electrophoresis, high performance liquid chromatography (HPLC) and genomic DNA sequencing. The β-globin gene sequences for both, father and daughter, disclosed the heterozygous mutation at codon 108 to be Hb Presbyterian or HBB: c.327 C>G. The mutant Hb was previously reported in four families from North America, Germany, Japan and Spain, respectively. This is the fifth family carrying HBB: c.327 C>G described to date and the first report from Latin America.
Zhou, Jian-Ying; Yan, Jin-Mei; Li, Jian; Li, Dong-Zhi
2016-06-01
Nondeletional α-thalassemia (α-thal) is the result of point mutations in critical regions of the α-globin genes, affecting mRNA processing, mRNA translation, or α-globin stability. Hb Constant Spring (Hb CS, HBA2: c.427T > C) is the most common nondeletional α-thal that results from a nucleotide substitution at the termination codon of the α2-globin gene. Hb Quong Sze (Hb QS, HBA2: c.377T > C) is another nondeletional α-thal in South China with the missense mutation at codon 125 of the α2-globin gene making this hemoglobin (Hb) variant highly unstable. Although homozygosity for Hb CS (α(CS)α/α(CS)α) or Hb QS (α(QS)α/α(QS)α) has been reported, clinical pictures vary from severe hemolysis that developed early in life to only mild anemia, no clinical phenotypic data of compound heterozygosity for Hb CS/Hb QS (α(CS)α/α(QS)α) has been described. In this report we describe an adult case with such a compound heterozygosity who presented with a mild α-thal.
Induced disease resistance of satsuma mandarings against penicillium digitatum by gamma irradiation
International Nuclear Information System (INIS)
Jeong, Rae Dong
2017-01-01
Gamma irradiation, which is a type of ionizing radiation, can be used as a fruit inducible factor. In the present study, the effects of gamma irradiation on the resistance of mandarin fruits against Penicillium digitatum, the causal agent of postharvest green mold disease, were investigated. Pretreatment of a low dose of gamma irradiation effectively reduced the disease incidence and lesion diameter of mandarin fruits inoculated with P. digatatum during storage for 14 d. Interestingly, exposed to 400 Gy of gamma irradiation significantly maintained firmness and stimulated the synthesis of defense-related enzymes, (e.g., β-1,3-glucanase, phenylalanine, peroxidase, and polyphenol oxidase) and pathogenesis-related (PR) genes (e.g., PR-1 and PR-2). Therefore, the gamma irradiation-induced resistance against P. digatatum involves both changes of phenolic compounds and the induction of expression of defense-related genes. In addition, scanning electron microscopy analysis revealed that induced disease resistance by gamma irradiation signifcantly inhibits the growth of P. digatatum in mandarin fruits. These results suggest that the exposure of gamma irradiation is a potential methods for inducing the disease resistance of fruit to postharvest fungal pathogens and for extending the postharvest life of mandarin fruit
Induced disease resistance of satsuma mandarings against penicillium digitatum by gamma irradiation
Energy Technology Data Exchange (ETDEWEB)
Jeong, Rae Dong [Dept. of Applied Biology, Institute of Environmentally Friendly Agriculture, Chonnam National University, Gwangju (Korea, Republic of)
2017-06-15
Gamma irradiation, which is a type of ionizing radiation, can be used as a fruit inducible factor. In the present study, the effects of gamma irradiation on the resistance of mandarin fruits against Penicillium digitatum, the causal agent of postharvest green mold disease, were investigated. Pretreatment of a low dose of gamma irradiation effectively reduced the disease incidence and lesion diameter of mandarin fruits inoculated with P. digatatum during storage for 14 d. Interestingly, exposed to 400 Gy of gamma irradiation significantly maintained firmness and stimulated the synthesis of defense-related enzymes, (e.g., β-1,3-glucanase, phenylalanine, peroxidase, and polyphenol oxidase) and pathogenesis-related (PR) genes (e.g., PR-1 and PR-2). Therefore, the gamma irradiation-induced resistance against P. digatatum involves both changes of phenolic compounds and the induction of expression of defense-related genes. In addition, scanning electron microscopy analysis revealed that induced disease resistance by gamma irradiation signifcantly inhibits the growth of P. digatatum in mandarin fruits. These results suggest that the exposure of gamma irradiation is a potential methods for inducing the disease resistance of fruit to postharvest fungal pathogens and for extending the postharvest life of mandarin fruit.
Fc receptor gamma subunit polymorphisms and systemic lupus erythematosus
International Nuclear Information System (INIS)
Al-Ansari, Aliya; Ollier, W.E.; Gonzalez-Gay, Miguel A.; Gul, Ahmet; Inanac, Murat; Ordi, Jose; Teh, Lee-Suan; Hajeer, Ali H.
2004-01-01
To investigate the possible association between Fc receptor gamma polymorphisms and systemic lupus erythematosus (SLE). We have investigated the full FcR gamma gene for polymorphisms using polymerase chain reaction (PCR)-single strand confirmational polymorphisms and DNA sequencing .The polymorphisms identified were genotype using PCR-restriction fragment length polymorphism. Systemic lupus erythematosus cases and controls were available from 3 ethnic groups: Turkish, Spanish and Caucasian. The study was conducted in the year 2001 at the Arthritis Research Campaign, Epidemiology Unit, Manchester University Medical School, Manchester, United Kingdom. Five single nucleotide polymorphisms were identified, 2 in the promoter, one in intron 4 and, 2 in the 3'UTR. Four of the 5 single nucleotide polymorphisms (SNPs) were relatively common and investigated in the 3 populations. Allele and genotype frequencies of all 4 investigated SNPs were not statistically different cases and controls. fc receptor gamma gene does not appear to contribute to SLE susceptibility. The identified polymorphisms may be useful in investigating other diseases where receptors containing the FcR gamma subunit contribute to the pathology. (author)
Contribution of long-range interactions to the secondary structure of an unfolded globin.
Fedyukina, Daria V; Rajagopalan, Senapathy; Sekhar, Ashok; Fulmer, Eric C; Eun, Ye-Jin; Cavagnero, Silvia
2010-09-08
This work explores the effect of long-range tertiary contacts on the distribution of residual secondary structure in the unfolded state of an alpha-helical protein. N-terminal fragments of increasing length, in conjunction with multidimensional nuclear magnetic resonance, were employed. A protein representative of the ubiquitous globin fold was chosen as the model system. We found that, while most of the detectable alpha-helical population in the unfolded ensemble does not depend on the presence of the C-terminal region (corresponding to the native G and H helices), specific N-to-C long-range contacts between the H and A-B-C regions enhance the helical secondary structure content of the N terminus (A-B-C regions). The simple approach introduced here, based on the evaluation of N-terminal polypeptide fragments of increasing length, is of general applicability to identify the influence of long-range interactions in unfolded proteins. Copyright 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Vidaud, M.; Vidaud, D.; Amselem, S.; Rosa, J.; Goossens, M.; Gattoni, R.; Stevenin, J.; Chibani, J.
1989-01-01
The authors have characterized a Mediterranean β-thalassemia allele containing a sequence change at codon 30 that alters both β-globin pre-mRNA splicing and the structure of the homoglobin product. Presumably, this G → C transversion at position -1 of intron 1 reduces severely the utilization of the normal 5' splice site since the level of the Arg → Thr mutant hemoglobin (designated hemoglobin Kairouan) found in the erythrocytes of the patient is very low (2% of total hemoglobin). Since no natural mutations of the guanine located at position -1 of the CAG/GTAAGT consensus sequence had been isolated previously. They investigated the role of this nucleotide in the constitution of an active 5' splice site by studying the splicing of the pre-mRNA in cell-free extracts. They demonstrate that correct splicing of the mutant pre-mRNA is 98% inhibited. Their results provide further insights into the mechanisms of pre-mRNA maturation by revealing that the last residue of the exon plays a role at least equivalent to that of the intron residue at position +5
A new mutant gene su-1 in corn obtained by irradiation with low doses of gamma rays
International Nuclear Information System (INIS)
Diaconu, P.
1993-01-01
This paper provides a description of a sugar corn mutant obtained by irradiation of wetted kernels of Romanesc de Studina variety with low doses of gamma rays (300 R). This mutant influences the structure of the endosperm similarly to the su-1 genes developed spontaneously which resulted in the corn variety Zea mays saccharata thousands of years ago. Although the mutant is a multiple allele of the su-1 locus in chromosome IV it differs widely from the spontaneous mutant. The length of the ears is much reduced, varying between 4 and 6 cm, with numbers of kernels per ear varying between 45 and 72. Attempts to improve the cob size and the number of kernels by breeding and propagation in an insulated area led to no result. Crossing the mutants with the sugar hybrid Delicious resulted in sugar type progeny which confirms the common position of the mutant gene induced by irradiation and the spontaneous su-1 gene. The progenies of sugar mutant x Delicious are 38-43 % lower in cob vigor and 36-46% lower in kernel number. (author). 2 figs, 2 tab., 16 refs
International Nuclear Information System (INIS)
Serment G, J. H.; Martinez M, E.; Alcantara D, D.
2013-01-01
All living organisms are naturally exposed to radiation from different sources. Ionizing radiation produces a plethora of lesions upon DNA that can be categorized as single and double strand breaks and base damage. Among them, unrepaired double strand breaks (Dbs) have the greatest biological significance, since they are responsible of cell death. In Escherichia coli this kind of lesions are repaired mostly by homologous recombination. In this work the participation of some recombination genes in the repair of Dbs is evaluated. Escherichia coli defective strains were exposed to gamma radiation and incubated for different periods in ideal conditions. Both micro electrophoresis and pulse field gel electrophoresis techniques were used to evaluate the kinetics of repair of such lesions, reflecting the importance of each defective gene in the process. (Author)
[Obesity studies in candidate genes].
Ochoa, María del Carmen; Martí, Amelia; Martínez, J Alfredo
2004-04-17
There are more than 430 chromosomic regions with gene variants involved in body weight regulation and obesity development. Polymorphisms in genes related to energy expenditure--uncoupling proteins (UCPs), related to adipogenesis and insulin resistance--hormone-sensitive lipase (HLS), peroxisome proliferator-activated receptor gamma (PPAR gamma), beta adrenergic receptors (ADRB2,3), and alfa tumor necrosis factor (TNF-alpha), and related to food intake--ghrelin (GHRL)--appear to be associated with obesity phenotypes. Obesity risk depends on two factors: a) genetic variants in candidate genes, and b) biographical exposure to environmental risk factors. It is necessary to perform new studies, with appropriate control groups and designs, in order to reach relevant conclusions with regard to gene/environmental (diet, lifestyle) interactions.
The effect of histone deacetylase inhibitors on AHSP expression.
Directory of Open Access Journals (Sweden)
Mohammad Ali Okhovat
Full Text Available Alpha-hemoglobin stabilizing protein (AHSP is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms, γ-globin genes (HBG1/2, and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p < 0.05, except for the expression of BCL11A, which was down-regulated (p < 0.05 in the cells treated with both compounds relative to the levels measured for untreated cells. The findings indicated that sodium valproate had a more considerable effect than sodium phenylbutyrate (p < 0.0005 on BCL11A repression and the up-regulation of other studied genes. γ-Globin and AHSP gene expression continuously increased during the culture period in the treated cells, with the highest gene expression observed for 1 mM sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies.
Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza
2018-04-01
Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (PC) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.
Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.
Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B
1995-01-01
Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.
Panyasai, Sitthichai; Pornprasert, Sakorn
2017-03-01
We report the hematological parameters and provide a rapid molecular analysis method for detection of Hb Wiangpapao [α44(CE2)Pro→Ser, CCG>TCG; HBA1: c.133C>T], a new α-globin variant found in a pregnant Thai woman. Her red cell indices were measured by an automated blood counter. The results were: red blood cell (RBC) count 4.03 × 10 12 /L, Hb 13.1 (g/dL), packed cell volume (PCV) 0.39 L/L, mean corpuscular volume (MCV) 97.0 fL, mean corpuscular hemoglobin (Hb) (MCH) 32.5 pg, mean corpuscular Hb concentration (MCHC) 33.4 g/dL, and RBC distribution width (RDW) 9.4%. The Hb typing by high performance liquid chromatography (HPLC) showed 13.6% abnormal Hb at a retention time of 2.20 min. that was difficult to distinguish from Hb A. On the capillary electrophoresis (CE) electropherogram, this hemoglobinopathy peak did not separate from the Hb A peak. DNA sequencing showed a C>T transition at the first position of codon 44 (CCG>TCG) of the α1-globin gene that led to a substitution of proline for serine. This mutation has not been recorded in the public databases. Therefore, we named it Hb Wiangpapao as it was first discovered in the Wiangpapao District, Chiang Rai, Thailand. The multiplex allele-specific polymerase chain reaction (ASPCR) for detection of Hb Wiangpapao was developed and revealed a 510 bp specifically amplified fragment. The better understanding of hematological characterizations and the newly developed multiplex ASPCR for diagnosis of Hb Wiangpapao are useful for genetic counseling and family education.
Mengin-Lecreulx, D; van Heijenoort, J; Park, J T
1996-01-01
A gene, mpl, encoding UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelat e ligase was recognized by its amino acid sequence homology with murC as the open reading frame yjfG present at 96 min on the Escherichia coli map. The existence of such an enzymatic activity was predicted from studies indicating that reutilization of the intact tripeptide L-alanyl-gamma-D-glutamyl-meso-diaminopimelate occurred and accounted for well over 30% of new cell wall synthesis. Murein tripeptide ligase activity could be demonstrated in crude extracts, and greatly increased activity was produced when the gene was cloned and expressed under control of the trc promoter. A null mutant totally lacked activity but was viable, showing that the enzyme is not essential for growth. PMID:8808921
Directory of Open Access Journals (Sweden)
Suzana Makpol
2013-02-01
Full Text Available The present study was designed to determine the radioprotective effects of Malaysian Gelam honey on gene expression and enzyme activity of superoxide dismutase (SOD, catalase (CAT and glutathione peroxidase (GPx of human diploid fibroblasts (HDFs subjected to gamma-irradiation. Six groups of HDFs were studied: untreated control, irradiated HDFs, Gelam honey-treated HDFs and HDF treated with Gelam honey pre-, during- and post-irradiation. HDFs were treated with 6 mg/mL of sterilized Gelam honey (w/v for 24 h and exposed to 1 Gray (Gy of gamma rays at the dose rate of 0.25 Gy/min. Gamma-irradiation was shown to down-regulate SOD1, SOD2, CAT and GPx1 gene expressions (p < 0.05. Conversely, HDFs treated with Gelam honey alone showed up-regulation of all genes studied. Similarly, SOD, CAT and GPx enzyme activities in HDFs decreased with gamma-irradiation and increased when cells were treated with Gelam honey (p < 0.05. Furthermore, of the three different stages of study treatment, pre-treatment with Gelam honey caused up-regulation of SOD1, SOD2 and CAT genes expression and increased the activity of SOD and CAT. As a conclusion, Gelam honey modulates the expression of antioxidant enzymes at gene and protein levels in irradiated HDFs indicating its potential as a radioprotectant agent.
Differential androgenesis in gamma irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Kim, Jihyang; Yoon, Yongdal [Hanyang Univ., Seoul (Korea, Republic of); Kim, Jin Kyu [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)
2002-07-01
The Leydig cells of the testis account for at least 75% of the total testosterone produced in the normal adult male. Whereas the production of estrogen from androgen is catalyzed by aromatase cytochrome P450, which is found in many tissues, including gonad, brain, adipose tissue, bone, and heart. The gamma-irradiation causes the impairment of spermatogenesis and steroidogenesis in male mice. The present study was performed to analyze changes in testosterone concentrations and expression of steroidogenic enzyme of mice after whole body gamma-irradiation. Eight-week-old male ICR mice were irradiated with 6.5 or 10 Gy. At days 1, 2, 3, 4, and 5 after irradiation, testes were removed and processed for paraffin sections and isolation of mRNA. We calculated the gonad index from body and testis weight, and checked the testis volume. Hormonal analysis was performed by means of radioimmunoassay (RIA) in serum and intratesticular fluid. Semiquantitative reverse transcription polymerase chain reaction (RT-PCR) was used to evaluate the expression kinetics of the apoptotic gene and the cytochrome P450 aromatase gene after irradiation. In gamma-irradiated mice, the body weight reduced in comparison to that of the control group. Therefore, gonad indices increased. The testosterone concentrations in serum and intratesticular fluid were significantly reduced. RT- PCR data represented that the expression of Fas, Fas ligand, and aromatase cytochrome P450 showed the specific patterns against control groups. These results indicated that gamma- irradiation of adult mice induced the alteration of androgenesis and suggested that might counteract the spermatogenesis.
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although established diagnostic criteria exist for mature T-cell neoplasms, a definitive diagnosis of a T-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because T-cell malignancies contain identically rearranged T-cell receptor gamma (TCRG) and/or beta (TCRB) genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal T-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal TCRB and TCRG gene rearrangements (TCRB and TCRG PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol for the TCRB assay involves the use of three separate multiplex master mix tubes. Tubes A and B target the framework regions within the variable and joining regions of the TCRB gene, and Tube C targets the diversity and joining regions of the TCRB gene. The core protocol for the TCRG assay utilizes two multiplex master mix tubes (Tubes A and B) that target the variable and joining regions of the TCRG gene. Use of the five BIOMED-2 TCRB and TCRG PCR multiplex tubes in parallel can detect approximately 94% of clonal TCR gene rearrangements.
Energy Technology Data Exchange (ETDEWEB)
Han, Jeonghoon; Won, Eun-Ji; Lee, Bo-Young [Department of Biological Sciences, College of Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Hwang, Un-Ki [Marine Ecological Risk Assessment Center, West Sea Fisheries Research Institute, National Fisheries Research and Development Institute, Incheon 400-420 (Korea, Republic of); Kim, Il-Chan; Yim, Joung Han [Division of Life Sciences, Korea Polar Research Institute, Incheon 406-840 (Korea, Republic of); Leung, Kenneth Mei Yee [School of Biological Sciences and the Swire Institute of Marine Science, The University of Hong Kong, Pokfulam Road, Hong Kong (China); Lee, Yong Sung [Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul 133-791 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Sciences, College of Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of)
2014-07-01
Highlights: • Mortality rate was significantly increased in response to gamma radiation. • A dose-dependent reduction in fecundity of ovigerous females. • Growth retardation, particularly at the nauplius stage. • Upon gamma radiation, T. japonicus showed an increased ROS levels. • Antioxidant genes and Hsps genes were upregulated at sublethal doses. - Abstract: Nuclear radioisotope accidents are potentially ecologically devastating due to their impact on marine organisms. To examine the effects of exposure of a marine organism to radioisotopes, we irradiated the intertidal copepod Tigriopus japonicus with several doses of gamma radiation and analyzed the effects on mortality, fecundity, and molting by assessing antioxidant enzyme activities and gene expression patterns. No mortality was observed at 96 h, even in response to exposure to a high dose (800 Gy) of radiation, but mortality rate was significantly increased 120 h (5 days) after exposure to 600 or 800 Gy gamma ray radiation. We observed a dose-dependent reduction in fecundity of ovigerous females; even the group irradiated with 50 Gy showed a significant reduction in fecundity, suggesting that gamma rays are likely to have a population level effect. In addition, we observed growth retardation, particularly at the nauplius stage, in individuals after gamma irradiation. In fact, nauplii irradiated with more than 200 Gy, though able to molt to copepodite stage 1, did not develop into adults. Upon gamma radiation, T. japonicus showed a dose-dependent increase in reactive oxygen species (ROS) levels, the activities of several antioxidant enzymes, and expression of double-stranded DNA break damage genes (e.g. DNA-PK, Ku70, Ku80). At a low level (sub-lethal dose) of gamma irradiation, we found dose-dependent upregulation of p53, implying cellular damage in T. japonicus in response to sub-lethal doses of gamma irradiation, suggesting that T. japonicus is not susceptible to sub-lethal doses of gamma
International Nuclear Information System (INIS)
Han, Jeonghoon; Won, Eun-Ji; Lee, Bo-Young; Hwang, Un-Ki; Kim, Il-Chan; Yim, Joung Han; Leung, Kenneth Mei Yee; Lee, Yong Sung; Lee, Jae-Seong
2014-01-01
Highlights: • Mortality rate was significantly increased in response to gamma radiation. • A dose-dependent reduction in fecundity of ovigerous females. • Growth retardation, particularly at the nauplius stage. • Upon gamma radiation, T. japonicus showed an increased ROS levels. • Antioxidant genes and Hsps genes were upregulated at sublethal doses. - Abstract: Nuclear radioisotope accidents are potentially ecologically devastating due to their impact on marine organisms. To examine the effects of exposure of a marine organism to radioisotopes, we irradiated the intertidal copepod Tigriopus japonicus with several doses of gamma radiation and analyzed the effects on mortality, fecundity, and molting by assessing antioxidant enzyme activities and gene expression patterns. No mortality was observed at 96 h, even in response to exposure to a high dose (800 Gy) of radiation, but mortality rate was significantly increased 120 h (5 days) after exposure to 600 or 800 Gy gamma ray radiation. We observed a dose-dependent reduction in fecundity of ovigerous females; even the group irradiated with 50 Gy showed a significant reduction in fecundity, suggesting that gamma rays are likely to have a population level effect. In addition, we observed growth retardation, particularly at the nauplius stage, in individuals after gamma irradiation. In fact, nauplii irradiated with more than 200 Gy, though able to molt to copepodite stage 1, did not develop into adults. Upon gamma radiation, T. japonicus showed a dose-dependent increase in reactive oxygen species (ROS) levels, the activities of several antioxidant enzymes, and expression of double-stranded DNA break damage genes (e.g. DNA-PK, Ku70, Ku80). At a low level (sub-lethal dose) of gamma irradiation, we found dose-dependent upregulation of p53, implying cellular damage in T. japonicus in response to sub-lethal doses of gamma irradiation, suggesting that T. japonicus is not susceptible to sub-lethal doses of gamma
Kraemer, S. M.; Vannais, D. B.; Kronenberg, A.; Ueno, A.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)
2001-01-01
Kraemer, S. M., Vannais, D. B., Kronenberg, A., Ueno, A. and Waldren, C. A. Gamma-Ray Mutagenesis Studies in a New Human-Hamster Hybrid, A(L)CD59(+/-), which has Two Human Chromosomes 11 but is Hemizygous for the CD59 Gene. Radiat. Res. 156, 10-19 (2001).We have developed a human-CHO hybrid cell line, named A(L)CD59(+/-), which has two copies of human chromosome 11 but is hemizygous for the CD59 gene and the CD59 cell surface antigen that it encodes. Our previous studies used the A(L) and A(L)C hybrids that respectively contain one or two sets of CHO chromosomes plus a single copy of human chromosome 11. The CD59 gene at 11p13.5 and the CD59 antigen encoded by it are the principal markers used in our mutagenesis studies. The hybrid A(L)CD59(+/-) contains two copies of human chromosome 11, only one of which carries the CD59 gene. The incidence of CD59 (-) mutants (formerly called S1(-)) induced by (137)Cs gamma rays is about fivefold greater in A(L)CD59(+/-) cells than in A(L) cells. Evidence is presented that this increase in mutant yield is due to the increased induction of certain classes of large chromosomal mutations that are lethal to A(L) cells but are tolerated in the A(L)CD59(+/-) hybrid. In addition, significantly more of the CD59 (-) mutants induced by (137)Cs gamma rays in A(L)CD59(+/-) cells display chromosomal instability than in A(L) cells. On the other hand, the yield of gamma-ray-induced CD59 (-) mutants in A(L)CD59(+/-) cells is half that of the A(L)C hybrid, which also tolerates very large mutations but has only one copy of human chromosome 11. We interpret the difference in mutability as evidence that repair processes involving the homologous chromosomes 11 play a role in determining mutant yields. The A(L)CD59(+/-) hybrid provides a useful new tool for quantifying mutagenesis and shedding light on mechanisms of genetic instability and mutagenesis.
High Frequency of Hb E-Saskatoon (HBB: c.67G > A) in Brazilians: A New Genetic Origin?
Wagner, Sandrine C; Lindenau, Juliana D; Castro, Simone M de; Santin, Ana Paula; Zaleski, Carina F; Azevedo, Laura A; Ribeiro Dos Santos, Ândrea K C; Dos Santos, Sidney E B; Hutz, Mara H
2016-08-01
Hb E-Saskatoon [β22(B4)Glu→Lys, HBB: c.67G > A] is a rare, nonpathological β-globin variant that was first described in a Canadian woman of Scottish and Dutch ancestry and has since then been detected in several populations. The aim of the present study was to identify the origin of Hb E-Saskatoon in Brazil using β-globin haplotypes and genetic ancestry in carriers of this hemoglobin (Hb) variant. Blood samples were investigated by isoelectric focusing (IEF) and high performance liquid chromatography (HPLC) using commercial kits. Hb E-Saskatoon was confirmed by amplification of the HBB gene, followed by sequence analysis. Haplotypes of the β-globin gene were determined by polymerase chain reaction (PCR), followed by digestion with specific restriction enzymes. Individual ancestry was estimated with 48 biallelic insertion/deletions using three 16-plex PCR amplifications. The IEF pattern was similar to Hbs C (HBB: c.19G > A) and Hb E (HBB: c.79G > A) [isoelectric point (pI): 7.59-7.65], and HPLC results showed an elution in the Hb S (HBB: c.20A > T) window [retention time (RT): 4.26-4.38]. DNA sequencing of the amplified β-globin gene showed a mutation at codon 22 (GAA>AAA) corresponding to Hb E-Saskatoon. A total of 11 cases of this variant were identified. In nine unrelated individuals, Hb E-Saskatoon was in linkage disequilibrium with haplotype 2 [+ - - - -]. All subjects showed a high degree of European contribution (mean = 0.85). Hb E-Saskatoon occurred on the β-globin gene of haplotype 2 in all Brazilian carriers. These findings suggest a different genetic origin for this Hb variant from that previously described.
International Nuclear Information System (INIS)
Skroch, P.
1987-05-01
In the first part of my thesis I show that the DNA element conferring glucocorticoid inducibility to the Mouse Mammary Tumor Virus (HRE) has enhancer properties. It activates a heterologous promoter - that of the β-globin gene, independently of distance, position and orientation. These properties however have to be regarded in relation to the remaining regulatory elements of the activated gene as the recombinants between HRE and the TK gene have demonstrated. In the second part of my thesis I investigated the biological significance of certain sequence motifs of the HRE, which are remarkable by their interaction with transacting factors or sequence homologies with other regulatory DNA elements. I could confirm the generally postulated modular structure of enhancers for the HRE and bring the relevance of the single subdomains for the function of the element into relationship. (orig.) [de
Giavedoni, L D; Jones, L; Gardner, M B; Gibson, H L; Ng, C T; Barr, P J; Yilma, T
1992-01-01
We have developed a method for attenuating vaccinia virus recombinants by expressing a fusion protein of a lymphokine and an immunogen. Chimeric genes were constructed that coded for gamma interferon (IFN-gamma) and structural proteins of the human immunodeficiency virus type 1 (HIV-1). In this study, we describe the biological and immunological properties of vaccinia virus recombinants expressing chimeric genes of murine or human IFN-gamma with glycoprotein gp120, gag, and a fragment of gp41...
Mapping the transcription termination region of the mouse immunoglobulin kappa gene
International Nuclear Information System (INIS)
Xu, M.; Garrard, W.T.
1986-01-01
To define the transcription termination region of the mouse immunoglobulin kappa gene, they have subcloned single copy DNA sequences corresponding to both the template and the non-template strands of this locus. In vitro nuclear transcription with isolated MPC-11 nuclei was performed and the resulting 32 P-labeled RNA was hybridized to slot-blotted, single-stranded M13 probes covering regions within and flanking the kappa gene. The hybridization pattern for the template-strand reveals that transcription terminates within the region between 1.1 to 2.3 kb downstream from the poly(A) site. Ten different short sequences (8-13 bp) reside within 460 bp of this region that exhibit homology with sequences found in the termination regions of mouse β-globin and chicken ovalbumin genes. Transcription of the non-template strand occurs on either side of this termination region. They note that no transcription is detectable on the non-template strand downstream of the enhancer, indicating that if RNA polymerase II enters at this site, it does not initiate transcription during transit to the promoter region. They conclude that transcription of the kappa gene passes the poly(A) addition site and terminates within 2.3 Kb downstream
The effect of histone deacetylase inhibitors on AHSP expression
Ziari, Katayoun; Ranjbaran, Reza; Nikouyan, Negin
2018-01-01
Alpha-hemoglobin stabilizing protein (AHSP) is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs) that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms), γ-globin genes (HBG1/2), and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p sodium valproate had a more considerable effect than sodium phenylbutyrate (p sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S) and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies. PMID:29389946
Comparison of different methods for erythroid differentiation in the K562 cell line.
Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein
2016-08-01
To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.
Directory of Open Access Journals (Sweden)
Zaki Tubesha
2013-02-01
Full Text Available Dysregulated metabolism is implicated in obesity and other disease conditions like type 2 diabetes mellitus and cardiovascular diseases, which are linked to abnormalities of peroxisome proliferator-activated receptor gamma (PPARγ. PPARγ has been the focus of much research aimed at managing these diseases. Also, germinated brown rice (GBR is known to possess antidiabetic, antiobesity and hypocholesterolemic effects. We hypothesized that GBR bioactive compounds may mediate some of the improvements in metabolic indices through PPARγ modulation. Cultured HEP-G2 cells were treated with 50 ppm and 100 ppm of extracts from GBR (GABA, ASG and oryzanol after determination of cell viabilities using MTT assays. Results showed that all extracts upregulated the expression of the PPARγ. However, combination of all three extracts showed downregulation of the gene, suggesting that, in combination, the effects of these bioactives differ from their individual effects likely mediated through competitive inhibition of the gene. Upregulation of the gene may have therapeutic potential in diabetes mellitus and cardiovascular diseases, while its downregulation likely contributes to GBR’s antiobesity effects. These potentials are worth studying further.
molecular analysis of intron-1 mutation in β-Globin gene of β-Thalassemia
International Nuclear Information System (INIS)
Kamel, S.A.L.M.
2004-01-01
β-thalassemia is considered the most common genetic disorder worldwide, it occurs in a particularly high frequency in abroad belt extending from the mediterranean basin through the middle east, and abundance in egypt. the thalassemias are a group of genetic (inherited) blood disorders that share in common one feature, the defective production of hemoglobin. there are many different disorders with defective hemoglobin synthesis and, hence, many types of thalassemia. about 3% of the world's population (180 million people) carry β-thalassemia genes.the present study was carried out in the biological application department of nuclear research center, atomic energy authority and microbiology department and hematology unit of pediatrics department, faculty of medicine, Zagazig University
Revealing a steroid receptor ligand as a unique PPAR[gamma] agonist
Energy Technology Data Exchange (ETDEWEB)
Lin, Shengchen; Han, Ying; Shi, Yuzhe; Rong, Hui; Zheng, Songyang; Jin, Shikan; Lin, Shu-Yong; Lin, Sheng-Cai; Li, Yong (Pitt); (Xiamen)
2012-06-28
Peroxisome proliferator-activated receptor gamma (PPAR{gamma}) regulates metabolic homeostasis and is a molecular target for anti-diabetic drugs. We report here the identification of a steroid receptor ligand, RU-486, as an unexpected PPAR{gamma} agonist, thereby uncovering a novel signaling route for this steroid drug. Similar to rosiglitazone, RU-486 modulates the expression of key PPAR{gamma} target genes and promotes adipocyte differentiation, but with a lower adipogenic activity. Structural and functional studies of receptor-ligand interactions reveal the molecular basis for a unique binding mode for RU-486 in the PPAR{gamma} ligand-binding pocket with distinctive properties and epitopes, providing the molecular mechanisms for the discrimination of RU-486 from thiazolidinediones (TZDs) drugs. Our findings together indicate that steroid compounds may represent an alternative approach for designing non-TZD PPAR{gamma} ligands in the treatment of insulin resistance.
Induction of cytoplasmic male sterility by gamma-ray and chemical mutagens in sugar beets
Energy Technology Data Exchange (ETDEWEB)
Kinoshita, Toshiro [Hokkaido Univ., Sapporo (Japan). Faculty of Agriculture
1982-03-01
Male sterile plants appeared in the population of N cytoplasm sugar beet strains, H-19 and H-2002, when their dry seeds were exposed to 50 kR gamma-ray, and the male sterility was maintained up to the M/sub 4/ generation through the mother plants. Cytoplasmic inheritance was confirmed by the reciprocal crossings between plants with normal phenotype from gamma-strains (progeneis of the male mutants which transmitted male sterility through the mother plants) and H-19 or H-1001. The crossing experiments suggested that various kinds of cytoplasm were induced by gamma-ray irradiation, and that different nuclear genes were responsible for the respective cytoplasms. A specific relationship between the pollen restoring genes and the sterile cytoplasms was established, and was named ''one set of pollen restoring genes for one cytoplasm''. It is probable that the cytoplasmic mutation occurred in normal cytoplasm strains and the specific combination between the altered cytoplasm and the recessive nuclear gene produced male sterility. Ethyl methane sulphonate, ethidium bromide, acriflavine and streptomycin were also effective in inducing cytoplasmic mutation in sugar beets.
Induction of cytoplasmic male sterility by gamma-ray and chemical mutagens in sugar beets
International Nuclear Information System (INIS)
Kinoshita, Toshiro
1982-01-01
Male sterile plants appeared in the population of N cytoplasm sugar beet strains, H-19 and H-2002, when their dry seeds were exposed to 50 kR gamma-ray, and the male sterility was maintained up to the M 4 generation through the mother plants. Cytoplasmic inheritance was confirmed by the reciprocal crossings between plants with normal phenotype from gamma-strains (progeneis of the male mutants which transmitted male sterility through the mother plants) and H-19 or H-1001. The crossing experiments suggested that various kinds of cytoplasm were induced by gamma-ray irradiation, and that different nuclear genes were responsible for the respective cytoplasms. A specific relationship between the pollen restoring genes and the sterile cytoplasms was established, and was named ''one set of pollen restoring genes for one cytoplasm''. It is probable that the cytoplasmic mutation occurred in normal cytoplasm strains and the specific combination between the altered cytoplasm and the recessive nuclear gene produced male sterility. Ethyl methane sulphonate, ethidium bromide, acriflavine and streptomycin were also effective in inducing cytoplasmic mutation in sugar beets. (Kaihara, S.)
Medveczky, Maria M; Sherwood, Tracy A; Klein, Thomas W; Friedman, Herman; Medveczky, Peter G
2004-09-15
The major psychoactive cannabinoid compound of marijuana, delta-9 tetrahydrocannabinol (THC), has been shown to modulate immune responses and lymphocyte function. After primary infection the viral DNA genome of gamma herpesviruses persists in lymphoid cell nuclei in a latent episomal circular form. In response to extracellular signals, the latent virus can be activated, which leads to production of infectious virus progeny. Therefore, we evaluated the potential effects of THC on gamma herpesvirus replication. Tissue cultures infected with various gamma herpesviruses were cultured in the presence of increasing concentrations of THC and the amount of viral DNA or infectious virus yield was compared to those of control cultures. The effect of THC on Kaposi's Sarcoma Associated Herpesvirus (KSHV) and Epstein-Barr virus (EBV) replication was measured by the Gardella method and replication of herpesvirus saimiri (HVS) of monkeys, murine gamma herpesvirus 68 (MHV 68), and herpes simplex type 1 (HSV-1) was measured by yield reduction assays. Inhibition of the immediate early ORF 50 gene promoter activity was measured by the dual luciferase method. Micromolar concentrations of THC inhibit KSHV and EBV reactivation in virus infected/immortalized B cells. THC also strongly inhibits lytic replication of MHV 68 and HVS in vitro. Importantly, concentrations of THC that inhibit virus replication of gamma herpesviruses have no effect on cell growth or HSV-1 replication, indicating selectivity. THC was shown to selectively inhibit the immediate early ORF 50 gene promoter of KSHV and MHV 68. THC specifically targets viral and/or cellular mechanisms required for replication and possibly shared by these gamma herpesviruses, and the endocannabinoid system is possibly involved in regulating gamma herpesvirus latency and lytic replication. The immediate early gene ORF 50 promoter activity was specifically inhibited by THC. These studies may also provide the foundation for the development
Zhang, Wei; He, Yulian; Gao, Weixia; Feng, Jun; Cao, Mingfeng; Yang, Chao; Song, Cunjiang; Wang, Shufang
2015-02-01
Here, we attempted to elevate poly-gamma-glutamic acid (γ-PGA) production by modifying genes involved in glutamate metabolism in Bacillus amyloliquefaciens LL3. Products of rocR, rocG and gudB facilitate the conversion from glutamate to 2-oxoglutarate in Bacillus subtillis. The gene odhA is responsible for the synthesis of a component of the 2-oxoglutarate dehydrogenase complex that catalyzes the oxidative decarboxylation of 2-oxoglutarate to succinyl coenzyme A. In-frame deletions of these four genes were performed. In shake flask experiments the gudB/rocG double mutant presented enhanced production of γ-PGA, a 38 % increase compared with wild type. When fermented in a 5-L fermenter with pH control, the γ-PGA yield of the rocR mutant was increased to 5.83 g/L from 4.55 g/L for shake flask experiments. The gudB/rocG double mutant produced 5.68 g/L γ-PGA compared with that of 4.03 g/L for the wild type, a 40 % increase. Those results indicated the possibility of improving γ-PGA production by modifying glutamate metabolism, and identified potential genetic targets to improve γ-PGA production.
Ali, Nadir; Ayyub, Muhammad; Khan, Saleem Ahmed; Ahmed, Suhaib; Abbas, Kazim; Malik, Hamid Saeed; Tashfeen, Sunila
2015-03-01
Response to hydroxyurea therapy in homozygous or compound heterozygous beta thalassaemia (BT) has been reported as more favourable in the presence of XmnI polymorphism. The prevalence of XmnI polymorphism may vary with BT phenotypes and genotypes, and differs geographically in distribution. Prevalence of XmnI polymorphism is not known in northern Pakistan. To determine the frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism (XmnI polymorphism) in patients with homozygous or compound heterozygous beta thalassaemia. Polymerase chain reaction (PCR) for common beta thalassaemia mutations and Gγ-globin promoter -158 (C>T) XmnI polymorphism was performed on 107 blood samples of transfusion dependent beta thalassaemia (BT) patients in Pakistan. One hundred samples of unrelated BT traits and 94 samples of healthy subjects as controls were also analysed for BT mutations and XmnI polymorphism. Out of 301 DNA samples, XmnI polymorphism was detected in 71(24%); in normal controls, XmnI polymorphism was detected in 34/94 (36%) subjects; while in homozygous/compound heterozygous BT, it was detected in 14/107(13%) patients (Fisher's exact test, p=.0002). In heterozygous BT group, XmnI polymorphism was detected in 23/100 subjects (Fisher's exact test, p=.03 with normal controls, and p=.049 with homozygous/compound heterozygous BT). The most common BT genotype was Frame Shift (Fr) 8-9/Fr 8-9, and none of the patients with this genotype had XmnI polymorphism. The second most common genotype was IVSI-5/IVSI-5; 4/26 (15%). Cases with this genotype had XmnI polymorphism. XmnI polymorphism in homozygous/compound heterozygous BT group is 13%. The most common genotype associated with XmnI polymorphism was IVSI-5/IVSI-5. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.
The role of T cell PPAR gamma in mice with experimental inflammatory bowel disease.
Guri, Amir J; Mohapatra, Saroj K; Horne, William T; Hontecillas, Raquel; Bassaganya-Riera, Josep
2010-06-10
Peroxisome proliferator-activated receptor gamma (PPAR gamma) is a nuclear receptor whose activation has been shown to modulate macrophage and T cell-mediated inflammation. The objective of this study was to investigate the mechanisms by which the deletion of PPAR gamma in T cells modulates immune cell distribution and colonic gene expression and the severity of experimental IBD. PPAR gamma flfl; CD4 Cre+ (CD4cre) or Cre- (WT) mice were challenged with 2.5% dextran sodium sulfate in their drinking water for 0, 2, or 7 days. Mice were scored on disease severity both clinically and histopathologically. Flow cytometry was used to assess lymphocyte and macrophage populations in the blood, spleen, and mesenteric lymph nodes (MLN). Global gene expression in colonic mucosa was profiled using Affymetrix microarrays. The deficiency of PPAR gamma in T cells accelerated the onset of disease and body weight loss. Examination of colon histopathology revealed significantly greater epithelial erosion, leukocyte infiltration, and mucosal thickening in the CD4cre mice on day 7. CD4cre mice had more CD8+ T cells than WT mice and fewer CD4+ FoxP3+ regulatory T cells (Treg) and IL10+ CD4+ T cells in blood and MLN, respectively. Transcriptomic profiling revealed around 3000 genes being transcriptionally altered as a result of DSS challenge in CD4cre mice. These included up-regulated mRNA expression of adhesion molecules, proinflammatory cytokines interleukin-6 (IL-6) and IL-1beta, and suppressor of cytokine signaling 3 (SOCS-3) on day 7. Gene set enrichment analysis (GSEA) showed that the ribosome and Krebs cycle pathways were downregulated while the apoptosis pathway was upregulated in colons of mice lacking PPAR gamma in T cells. The expression of PPAR gamma in T cells is involved in preventing gut inflammation by regulating colonic expression of adhesion molecules and inflammatory mediators at later stages of disease while favoring the recruitment of Treg to the mucosal inductive
$\\gamma$-$\\gamma$ and $\\gamma$-p events at high energies
Schuler, Gerhard A.; Gerhard A Schuler; Torbjorn Sjostrand
1994-01-01
A real photon has a complicated nature, whereby it may remain unresolved or fluctuate into a vector meson or a perturbative q-qbar pair. Based on this picture, we previously presented a model for gamma-p events that is based on the presence of three main event classes: direct, VMD and anomalous. In gamma-gamma events, a natural generalization gives three-by-three combinations of the nature of the two incoming photons, and thus six distinct event classes. The properties of these classes are constrained by the choices already made, in the gamma-p model, of cut-off procedures and other aspects. It is therefore possible to predict the energy-dependence of the cross section for each of the six components separately. The total cross section thus obtained is in good agreement with data, and also gives support to the idea that a simple factorized ansatz with a pomeron and a reggeon term can be a good approximation. Event properties undergo a logical evolution from p-p to gamma-p to gamma-gamma events, with larger cha...
Energy Technology Data Exchange (ETDEWEB)
Bhaskar,; Kumari, Neeti [Division of Biochemistry, CSIR-Central Drug Research Institute, Chattar Manzil Palace, PO Box 173, Lucknow (India); Goyal, Neena, E-mail: neenacdri@yahoo.com [Division of Biochemistry, CSIR-Central Drug Research Institute, Chattar Manzil Palace, PO Box 173, Lucknow (India)
2012-12-07
Highlights: Black-Right-Pointing-Pointer The study presents cloning and characterization of TCP1{gamma} gene from L. donovani. Black-Right-Pointing-Pointer TCP1{gamma} is a subunit of T-complex protein-1 (TCP1), a chaperonin class of protein. Black-Right-Pointing-Pointer LdTCP{gamma} exhibited differential expression in different stages of promastigotes. Black-Right-Pointing-Pointer LdTCP{gamma} co-localized with actin, a cytoskeleton protein. Black-Right-Pointing-Pointer The data suggests that this gene may have a role in differentiation/biogenesis. Black-Right-Pointing-Pointer First report on this chapronin in Leishmania. -- Abstract: T-complex protein-1 (TCP1) complex, a chaperonin class of protein, ubiquitous in all genera of life, is involved in intracellular assembly and folding of various proteins. The gamma subunit of TCP1 complex (TCP1{gamma}), plays a pivotal role in the folding and assembly of cytoskeleton protein(s) as an individual or complexed with other subunits. Here, we report for the first time cloning, characterization and expression of the TCP1{gamma} of Leishmania donovani (LdTCP1{gamma}), the causative agent of Indian Kala-azar. Primary sequence analysis of LdTCP1{gamma} revealed the presence of all the characteristic features of TCP1{gamma}. However, leishmanial TCP1{gamma} represents a distinct kinetoplastid group, clustered in a separate branch of the phylogenic tree. LdTCP1{gamma} exhibited differential expression in different stages of promastigotes. The non-dividing stationary phase promastigotes exhibited 2.5-fold less expression of LdTCP1{gamma} as compared to rapidly dividing log phase parasites. The sub-cellular distribution of LdTCP1{gamma} was studied in log phase promastigotes by employing indirect immunofluorescence microscopy. The protein was present not only in cytoplasm but it was also localized in nucleus, peri-nuclear region, flagella, flagellar pocket and apical region. Co-localization of LdTCP1{gamma} with actin suggests
Altrock, Philipp M; Brendel, Christian; Renella, Raffaele; Orkin, Stuart H; Williams, David A; Michor, Franziska
2016-09-01
Recent advances in gene therapy and genome-engineering technologies offer the opportunity to correct sickle cell disease (SCD), a heritable disorder caused by a point mutation in the β-globin gene. The developmental switch from fetal γ-globin to adult β-globin is governed in part by the transcription factor (TF) BCL11A. This TF has been proposed as a therapeutic target for reactivation of γ-globin and concomitant reduction of β-sickle globin. In this and other approaches, genetic alteration of a portion of the hematopoietic stem cell (HSC) compartment leads to a mixture of sickling and corrected red blood cells (RBCs) in periphery. To reverse the sickling phenotype, a certain proportion of corrected RBCs is necessary; the degree of HSC alteration required to achieve a desired fraction of corrected RBCs remains unknown. To address this issue, we developed a mathematical model describing aging and survival of sickle-susceptible and normal RBCs; the former can have a selective survival advantage leading to their overrepresentation. We identified the level of bone marrow chimerism required for successful stem cell-based gene therapies in SCD. Our findings were further informed using an experimental mouse model, where we transplanted mixtures of Berkeley SCD and normal murine bone marrow cells to establish chimeric grafts in murine hosts. Our integrative theoretical and experimental approach identifies the target frequency of HSC alterations required for effective treatment of sickling syndromes in humans. Our work replaces episodic observations of such target frequencies with a mathematical modeling framework that covers a large and continuous spectrum of chimerism conditions. Am. J. Hematol. 91:931-937, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Ambrosino, F.; Massarotti, P.; Meola, S.; Napolitano, M. [Dipartimento di Scienze Fisiche dell' Universita ' ' Federico II' ' , Napoli (Italy); INFN Sezione di Napoli, Napoli (Italy); Antonelli, A.; Antonelli, M.; Bencivenni, G.; Bloise, C.; Bossi, F.; Capon, G.; Capussela, T.; Ciambrone, P.; De Lucia, E.; De Simone, P.; Dreucci, M.; Felici, G.; Gatti, C.; Giovannella, S.; Jacewicz, M.; Lanfranchi, G.; Miscetti, S.; Moulson, M.; Murtas, F.; Palutan, M.; Santangelo, P.; Sciascia, B.; Sibidanov, A.; Spadaro, T.; Venanzoni, G. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); Archilli, F. [Dipartimento di Fisica dell' Universita ' ' Tor Vergata' ' , Rome (Italy); INFN Sezione di Roma Tor Vergata, Rome (Italy); Beltrame, P.; Denig, A.; Mueller, S. [Johannes Gutenberg-Universitaet, Institut fuer Kernphysik, Mainz (Germany); Bini, C.; De Santis, A.; De Zorzi, G.; Di Domenico, A.; Fiore, S.; Franzini, P.; Gauzzi, P. [Dipartimento di Fisica dell' Universita ' ' La Sapienza' ' , Rome (Italy); INFN Sezione di Roma, Rome (Italy); Bocchetta, S.; Ceradini, F.; Di Micco, B.; Nguyen, F. [Dipartimento di Fisica dell' Universita ' ' Roma Tre' ' , Rome (Italy); INFN Sezione di Roma Tre, Rome (Italy); Branchini, P.; Graziani, E.; Passeri, A.; Tortora, L. [INFN Sezione di Roma Tre, Rome (Italy); Capriotti, D. [Dipartimento di Fisica dell' Universita ' ' Roma Tre' ' , Rome (Italy); Di Donato, C. [INFN Sezione di Napoli, Napoli (Italy); Kulikov, V. [Institute for Theoretical and Experimental Physics, Moscow (Russian Federation); Lee-Franzini, J. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); State University of New York, Physics Department, Stony Brook (United States); Martini, M.; Patera, V.; Versaci, R. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); Dipartimento di Energetica dell' Universita ' ' La Sapienza' ' , Rome (Italy); Valente, P. [INFN Sezione di Roma, Rome (Italy)
2009-12-15
We present a precise measurement of the ratio R{sub K}={gamma}(K{yields}e{nu}({gamma}))/{gamma}(K{yields}{mu}{nu}({gamma})) and a study of the radiative process K{yields}e{nu}{gamma}, performed with the KLOE detector. The results are based on data collected at the Frascati e{sup +}e{sup -} collider DA {phi}NE for an integrated luminosity of 2.2 fb{sup -1}. We find R{sub K}=(2.493{+-}0.025{sub stat}{+-}0.019{sub syst}) x 10{sup -5}, in agreement with the Standard Model expectation. This result is used to improve constraints on parameters of the Minimal Supersymmetric Standard Model with lepton flavor violation. We also measured the differential decay rate d {gamma}(K{yields}e{nu}{gamma})/dE{sub {gamma}} for photon energies 10
Carbonic anhydrase III regulates peroxisome proliferator-activated receptor-{gamma}2
Energy Technology Data Exchange (ETDEWEB)
Mitterberger, Maria C. [Cell Metabolism and Differentiation Research Group, Institute for Biomedical Aging Research of the Austrian Academy of Sciences, 6020 Innsbruck (Austria); Kim, Geumsoo [Laboratory of Biochemistry, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892-8012 (United States); Rostek, Ursula [Cell Metabolism and Differentiation Research Group, Institute for Biomedical Aging Research of the Austrian Academy of Sciences, 6020 Innsbruck (Austria); Levine, Rodney L. [Laboratory of Biochemistry, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892-8012 (United States); Zwerschke, Werner, E-mail: werner.zwerschke@oeaw.ac.at [Cell Metabolism and Differentiation Research Group, Institute for Biomedical Aging Research of the Austrian Academy of Sciences, 6020 Innsbruck (Austria)
2012-05-01
Carbonic anhydrase III (CAIII) is an isoenzyme of the CA family. Because of its low specific anhydrase activity, physiological functions in addition to hydrating CO{sub 2} have been proposed. CAIII expression is highly induced in adipogenesis and CAIII is the most abundant protein in adipose tissues. The function of CAIII in both preadipocytes and adipocytes is however unknown. In the present study we demonstrate that adipogenesis is greatly increased in mouse embryonic fibroblasts (MEFs) from CAIII knockout (KO) mice, as demonstrated by a greater than 10-fold increase in the induction of fatty acid-binding protein-4 (FABP4) and increased triglyceride formation in CAIII{sup -/-} MEFs compared with CAIII{sup +/+} cells. To address the underlying mechanism, we investigated the expression of the two adipogenic key regulators, peroxisome proliferator-activated receptor-{gamma}2 (PPAR{gamma}2) and CCAAT/enhancer binding protein-{alpha}. We found a considerable (approximately 1000-fold) increase in the PPAR{gamma}2 expression in the CAIII{sup -/-} MEFs. Furthermore, RNAi-mediated knockdown of endogenous CAIII in NIH 3T3-L1 preadipocytes resulted in a significant increase in the induction of PPAR{gamma}2 and FABP4. When both CAIII and PPAR{gamma}2 were knocked down, FABP4 was not induced. We conclude that down-regulation of CAIII in preadipocytes enhances adipogenesis and that CAIII is a regulator of adipogenic differentiation which acts at the level of PPAR{gamma}2 gene expression. -- Highlights: Black-Right-Pointing-Pointer We discover a novel function of Carbonic anhydrase III (CAIII). Black-Right-Pointing-Pointer We show that CAIII is a regulator of adipogenesis. Black-Right-Pointing-Pointer We demonstrate that CAIII acts at the level of PPAR{gamma}2 gene expression. Black-Right-Pointing-Pointer Our data contribute to a better understanding of the role of CAIII in fat tissue.
Kho, S L; Chua, K H; George, E; Tan, J A M A
2013-07-15
Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.
Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda
2015-07-01
The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.
Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina
Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).
Systematic documentation and analysis of human genetic variation using the microattribution approach
Giardine, Belinda; Borg, Joseph; Higgs, Douglas R.; Peterson, Kenneth R.; Maglott, Donna; Basak, A. Nazli; Clark, Barnaby; Faustino, Paula; Felice, Alex E.; Francina, Alain; Gallivan, Monica V. E.; Georgitsi, Marianthi; Gibbons, Richard J.; Giordano, Piero C.; Harteveld, Cornelis L.; Joly, Philippe; Kanavakis, Emmanuel; Kollia, Panagoula; Menzel, Stephan; Miller, Webb; Moradkhani, Kamran; Old, John; Papachatzopoulou, Adamantia; Papadakis, Manoussos N.; Papadopoulos, Petros; Pavlovic, Sonja; Philipsen, Sjaak; Radmilovic, Milena; Riemer, Cathy; Schrijver, Iris; Stojiljkovic, Maja; Thein, Swee Lay; Traeger-Synodinos, Jan; Tully, Ray; Wada, Takahito; Waye, John; Wiemann, Claudia; Zukic, Branka; Chui, David H. K.; Wajcman, Henri; Hardison, Ross C.; Patrinos, George P.
2013-01-01
We developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to these disorders, and then implemented microattribution to encourage submission of unpublished observations of genetic variation to these public repositories 1. A total of 1,941 unique genetic variants in 37 genes, encoding globins (HBA2, HBA1, HBG2, HBG1, HBD, HBB) and other erythroid proteins (ALOX5AP, AQP9, ARG2, ASS1, ATRX, BCL11A, CNTNAP2, CSNK2A1, EPAS1, ERCC2, FLT1, GATA1, GPM6B, HAO2, HBS1L, KDR, KL, KLF1, MAP2K1, MAP3K5, MAP3K7, MYB, NOS1, NOS2, NOS3, NOX3, NUP133, PDE7B, SMAD3, SMAD6, and TOX) are currently documented in these databases with reciprocal attribution of microcitations to data contributors. Our project provides the first example of implementing microattribution to incentivise submission of all known genetic variation in a defined system. It has demonstrably increased the reporting of human variants and now provides a comprehensive online resource for systematically describing human genetic variation in the globin genes and other genes contributing to hemoglobinopathies and thalassemias. The large repository of previously reported data, together with more recent data, acquired by microattribution, demonstrates how the comprehensive documentation of human variation will provide key insights into normal biological processes and how these are perturbed in human genetic disease. Using the microattribution process set out here, datasets which took decades to accumulate for the globin genes could be assembled rapidly for other genes and disease systems. The principles established here for the globin gene system will serve as a model for other systems and the analysis of other common and/or complex human genetic diseases. PMID:21423179
Energy Technology Data Exchange (ETDEWEB)
Efimov, G V; Ivanov, M A; Nogovitsyn, E A [Joint Inst. for Nuclear Research, Dubna (USSR)
1981-07-01
P..--> gamma gamma.. (P=..pi../sup 0/, eta, eta'), eta..--> pi../sup +/..pi../sup -/..gamma.., eta..--> pi../sup 0/..gamma gamma.., eta/sup 1/..-->..V..gamma.. (V=rho/sup 0/, ..omega..), p..--> gamma..l/sup +/l/sup -/ (p=..pi../sup 0/, eta, eta') radiation decays are studied for testing the applicability of the non-local quark model for description of the experimental data. The Feynman diagrams of these decays are presented, values of the widths of the Veta..--> gamma gamma.., eta..--> pi../sup +/..pi../sup -/..gamma.., eta..--> pi../sup 0/..gamma gamma.., eta'..--> gamma gamma.., eta'..-->..rho/sup 0/..gamma.., eta'..--> omega gamma.. decays are calculated and given in the form of a table. Calculations are carried out for two values of the eta eta'-crossing angle: THETA=-11 deg and -18 deg. Values of invariant amplitudes of these decays are determined for ..pi../sup 0/..--> gamma..e/sup +/e/sup -/, eta..--> gamma mu../sup +/..mu../sup -/, eta'..--> gamma mu../sup +/..mu../sup -/ decays at THETA=-11 deg and -18 deg. The best agreement with the experimental data is noted to take place at THETA=-11 deg, the determined width of the eta..--> pi../sup 0/..gamma gamma.. decays is underestimated as compared with the experimental one.
Testes and brain gene expression in precocious male and adult maturing Atlantic salmon (Salmo salar
Directory of Open Access Journals (Sweden)
Houeix Benoit
2010-03-01
Full Text Available Abstract Background The male Atlantic salmon generally matures in fresh water upon returning after one or several years at sea. Some fast-growing male parr develop an alternative life strategy where they sexually mature before migrating to the oceans. These so called 'precocious' parr or 'sneakers' can successfully fertilise adult female eggs and so perpetuate their line. We have used a custom-built cDNA microarray to investigate gene expression changes occurring in the salmon gonad and brain associated with precocious maturation. The microarray has been populated with genes selected specifically for involvement in sexual maturation (precocious and adult and in the parr-smolt transformation. Results Immature and mature parr collected from a hatchery-reared stock in January were significantly different in weight, length and condition factor. Changes in brain expression were small - never more than 2-fold on the microarray, and down-regulation of genes was much more pronounced than up-regulation. Significantly changing genes included isotocin, vasotocin, cathepsin D, anamorsin and apolipoprotein E. Much greater changes in expression were seen in the testes. Among those genes in the testis with the most significant changes in expression were anti-Mullerian hormone, collagen 1A, and zinc finger protein (Zic1, which were down-regulated in precocity and apolipoproteins E and C-1, lipoprotein lipase and anti-leukoproteinase precursor which were up-regulated in precocity. Expression changes of several genes were confirmed in individual fish by quantitative PCR and several genes (anti-Mullerian hormone, collagen 1A, beta-globin and guanine nucleotide binding protein (G protein beta polypeptide 2-like 1 (GNB2L1 were also examined in adult maturing testes. Down-regulation of anti-Mullerian hormone was judged to be greater than 160-fold for precocious males and greater than 230-fold for November adult testes in comparison to July testes by this method. For
Energy Technology Data Exchange (ETDEWEB)
Song, You, E-mail: you.song@niva.no [Norwegian University of Life Sciences (NMBU), Faculty of Environmental Science and Technology, Department of Environmental Sciences (IMV), Centre for Environmental Radioactivity - CERAD, P.O. Box 5003, N-1432 Ås (Norway); Norwegian Institute for Water Research (NIVA), Gaustadalléen 21, N-0349 Oslo (Norway); Salbu, Brit; Teien, Hans-Christian; Heier, Lene Sørlie [Norwegian University of Life Sciences (NMBU), Faculty of Environmental Science and Technology, Department of Environmental Sciences (IMV), Centre for Environmental Radioactivity - CERAD, P.O. Box 5003, N-1432 Ås (Norway); Rosseland, Bjørn Olav [Norwegian University of Life Sciences (NMBU), Faculty of Environmental Science and Technology, Department of Environmental Sciences (IMV), Centre for Environmental Radioactivity - CERAD, P.O. Box 5003, N-1432 Ås (Norway); Norwegian University of Life Sciences (NMBU), Department of Ecology and Natural Resource Management, P.O. Box 5003, N-1432 Ås (Norway); Tollefsen, Knut Erik [Norwegian University of Life Sciences (NMBU), Faculty of Environmental Science and Technology, Department of Environmental Sciences (IMV), Centre for Environmental Radioactivity - CERAD, P.O. Box 5003, N-1432 Ås (Norway); Norwegian Institute for Water Research (NIVA), Gaustadalléen 21, N-0349 Oslo (Norway)
2014-11-15
Highlights: • First study on early stress responses in salmon exposed to low-dose gamma radiation. • Dramatic dose-dependent transcriptional responses characterized. • Multiple modes of action proposed for gamma radiation. - Abstract: Due to the production of free radicals, gamma radiation may pose a hazard to living organisms. The high-dose radiation effects have been extensively studied, whereas the ecotoxicity data on low-dose gamma radiation is still limited. The present study was therefore performed using Atlantic salmon (Salmo salar) to characterize effects of low-dose (15, 70 and 280 mGy) gamma radiation after short-term (48 h) exposure. Global transcriptional changes were studied using a combination of high-density oligonucleotide microarrays and quantitative real-time reverse transcription polymerase chain reaction (qPCR). Differentially expressed genes (DEGs; in this article the phrase gene expression is taken as a synonym of gene transcription, although it is acknowledged that gene expression can also be regulated, e.g., at protein stability and translational level) were determined and linked to their biological meanings predicted using both Gene Ontology (GO) and mammalian ortholog-based functional analyses. The plasma glucose level was also measured as a general stress biomarker at the organism level. Results from the microarray analysis revealed a dose-dependent pattern of global transcriptional responses, with 222, 495 and 909 DEGs regulated by 15, 70 and 280 mGy gamma radiation, respectively. Among these DEGs, only 34 were commonly regulated by all radiation doses, whereas the majority of differences were dose-specific. No GO functions were identified at low or medium doses, but repression of DEGs associated with GO functions such as DNA replication, cell cycle regulation and response to reactive oxygen species (ROS) were observed after 280 mGy gamma exposure. Ortholog-based toxicity pathway analysis further showed that 15 mGy radiation
Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis
2018-01-01
Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482
Baldwin, Kismet; Urbinati, Fabrizia; Romero, Zulema; Campo-Fernandez, Beatriz; Kaufman, Michael L; Cooper, Aaron R; Masiuk, Katelyn; Hollis, Roger P; Kohn, Donald B
2015-05-01
Autologous hematopoietic stem cell (HSC) gene therapy for sickle cell disease has the potential to treat this illness without the major immunological complications associated with allogeneic transplantation. However, transduction efficiency by β-globin lentiviral vectors using CD34-enriched cell populations is suboptimal and large vector production batches may be needed for clinical trials. Transducing a cell population more enriched for HSC could greatly reduce vector needs and, potentially, increase transduction efficiency. CD34(+) /CD38(-) cells, comprising ∼1%-3% of all CD34(+) cells, were isolated from healthy cord blood CD34(+) cells by fluorescence-activated cell sorting and transduced with a lentiviral vector expressing an antisickling form of beta-globin (CCL-β(AS3) -FB). Isolated CD34(+) /CD38(-) cells were able to generate progeny over an extended period of long-term culture (LTC) compared to the CD34(+) cells and required up to 40-fold less vector for transduction compared to bulk CD34(+) preparations containing an equivalent number of CD34(+) /CD38(-) cells. Transduction of isolated CD34(+) /CD38(-) cells was comparable to CD34(+) cells measured by quantitative PCR at day 14 with reduced vector needs, and average vector copy/cell remained higher over time for LTC initiated from CD34(+) /38(-) cells. Following in vitro erythroid differentiation, HBBAS3 mRNA expression was similar in cultures derived from CD34(+) /CD38(-) cells or unfractionated CD34(+) cells. In vivo studies showed equivalent engraftment of transduced CD34(+) /CD38(-) cells when transplanted in competition with 100-fold more CD34(+) /CD38(+) cells. This work provides initial evidence for the beneficial effects from isolating human CD34(+) /CD38(-) cells to use significantly less vector and potentially improve transduction for HSC gene therapy. © 2015 AlphaMed Press.
Thorne, James L; Ouboussad, Lylia; Lefevre, Pascal F
2012-09-01
IκB kinase α (IKKα) is part of the cytoplasmic IKK complex regulating nuclear factor-κB (NF-κB) release and translocation into the nucleus in response to pro-inflammatory signals. IKKα can also be recruited directly to the promoter of NF-κB-dependent genes by NF-κB where it phosphorylates histone H3 at serine 10, triggering recruitment of the bromodomain-containing protein 4 and the positive transcription elongation factor b. Herein, we report that IKKα travels with the elongating form of ribonucleic acid polymerase II together with heterochromatin protein 1 gamma (HP1γ) at NF-κB-dependent genes in activated macrophages. IKKα binds to and phosphorylates HP1γ, which in turn controls IKKα binding to chromatin and phosphorylation of the histone variant H3.3 at serine 31 within transcribing regions. Downstream of transcription end sites, IKKα accumulates with its inhibitor the CUE-domain containing protein 2, suggesting a link between IKKα inactivation and transcription termination.
Directory of Open Access Journals (Sweden)
Friedman Herman
2004-09-01
Full Text Available Abstract Background The major psychoactive cannabinoid compound of marijuana, delta-9 tetrahydrocannabinol (THC, has been shown to modulate immune responses and lymphocyte function. After primary infection the viral DNA genome of gamma herpesviruses persists in lymphoid cell nuclei in a latent episomal circular form. In response to extracellular signals, the latent virus can be activated, which leads to production of infectious virus progeny. Therefore, we evaluated the potential effects of THC on gamma herpesvirus replication. Methods Tissue cultures infected with various gamma herpesviruses were cultured in the presence of increasing concentrations of THC and the amount of viral DNA or infectious virus yield was compared to those of control cultures. The effect of THC on Kaposi's Sarcoma Associated Herpesvirus (KSHV and Epstein-Barr virus (EBV replication was measured by the Gardella method and replication of herpesvirus saimiri (HVS of monkeys, murine gamma herpesvirus 68 (MHV 68, and herpes simplex type 1 (HSV-1 was measured by yield reduction assays. Inhibition of the immediate early ORF 50 gene promoter activity was measured by the dual luciferase method. Results Micromolar concentrations of THC inhibit KSHV and EBV reactivation in virus infected/immortalized B cells. THC also strongly inhibits lytic replication of MHV 68 and HVS in vitro. Importantly, concentrations of THC that inhibit virus replication of gamma herpesviruses have no effect on cell growth or HSV-1 replication, indicating selectivity. THC was shown to selectively inhibit the immediate early ORF 50 gene promoter of KSHV and MHV 68. Conclusions THC specifically targets viral and/or cellular mechanisms required for replication and possibly shared by these gamma herpesviruses, and the endocannabinoid system is possibly involved in regulating gamma herpesvirus latency and lytic replication. The immediate early gene ORF 50 promoter activity was specifically inhibited by THC
de Waal Malefyt, R.; Yssel, H.; Spits, H.; de Vries, J. E.; Sancho, J.; Terhorst, C.; Alarcon, B.
1990-01-01
Infection and transformation by human T cell leukemia virus type I (HTLV-I) up-regulates expression of several inducible genes including those coding for cytokines involved in the proliferation of normal and leukemic T cells. We demonstrate that HTLV-I can also shut off expression of the CD3-gamma,
Effect of gamma rays at the dihydrofolate reductase locus: deletions and inversions
International Nuclear Information System (INIS)
Urlaub, G.; Mitchell, P.J.; Kas, E.; Chasin, L.A.; Funanage, V.L.; Myoda, T.T.; Hamlin, J.
1986-01-01
A series 11 gamma-ray-induced mutants at the dihydrofolate reductase (dhfr) locus in Chinese hamster ovary cells has been examined for the types of DNA sequence change brought about by this form of ionizing radiation. All 11 mutants were found to have suffered major structural changes affecting the dhfr gene. In eight of the mutants, all or part of the dhfr gene has been deleted. The extent of these deletions was examined in seven of these mutants and, for comparison, in two deletion mutants that were induced by UV irradiation. For this purpose, probes from an overlapping set of cosmids that span 210 kb of DNA in this region were used. Three of seven gamma-ray-induced mutants and one UV-induced mutant were shown to have deleted the entire 210-kb region. In the remaining mutants, endpoints ranging from within the dhfr gene to 100 kb downstream were observed. No upstream endpoints were detected, so that an upper limit on the size of these large deletions could not be assigned. Three of the 11 gamma-ray-induced mutants contained an interruption in the dhfr gene without any detectable loss of sequence. Restriction analysis of these interrupted mutants showed that at least 8-14 kb of foreign DNA sequence became joined to the gene at the point of disruption. Cytogenetic analysis of these mutants showed that in two cases an inversion of the banding pattern on chromosome Z-2 had taken place. The inverted dhfr mutants contain very low amounts of dhfr RNA sequences, and the 5' end of an inversion mutant gene exhibits the same pattern of DNA methylation and DNase I-hypersensitivity as the wild-type gene. Our results suggest that ionizing radiation causes primarily, if not exclusively, large deletions and inversions in mammalian cells
Gene expression in IFN-g-activated murine macrophages
Directory of Open Access Journals (Sweden)
Pereira C.A.
2004-01-01
Full Text Available Macrophages are critical for natural immunity and play a central role in specific acquired immunity. The IFN-gamma activation of macrophages derived from A/J or BALB/c mice yielded two different patterns of antiviral state in murine hepatitis virus 3 infection, which were related to a down-regulation of the main virus receptor. Using cDNA hybridization to evaluate mRNA accumulation in the cells, we were able to identify several genes that are differently up- or down-regulated by IFN-gamma in A/J (267 and 266 genes, respectively, up- and down-regulated or BALB/c (297 and 58 genes, respectively, up- and down-regulated mouse macrophages. Macrophages from mice with different genetic backgrounds behave differently at the molecular level and comparison of the patterns of non-activated and IFN-gamma-activated A/J or BALB/c mouse macrophages revealed, for instance, an up-regulation and a down-regulation of genes coding for biological functions such as enzymatic reactions, nucleic acid synthesis and transport, protein synthesis, transport and metabolism, cytoskeleton arrangement and extracellular matrix, phagocytosis, resistance and susceptibility to infection and tumors, inflammation, and cell differentiation or activation. The present data are reported in order to facilitate future correlation of proteomic/transcriptomic findings as well as of results obtained from a classical approach for the understanding of biological phenomena. The possible implication of the role of some of the gene products relevant to macrophage biology can now be further scrutinized. In this respect, a down-regulation of the main murine hepatitis virus 3 receptor gene was detected only in IFN-gamma-activated macrophages of resistant mice.
Ito, Tomonobu; Nishiyama, Chiharu; Nakano, Nobuhiro; Nishiyama, Makoto; Usui, Yoshihiko; Takeda, Kazuyoshi; Kanada, Shunsuke; Fukuyama, Kanako; Akiba, Hisaya; Tokura, Tomoko; Hara, Mutsuko; Tsuboi, Ryoji; Ogawa, Hideoki; Okumura, Ko
2009-07-01
Over-expression of PU.1, a myeloid- and lymphoid-specific transcription factor belonging to the Ets family, induces monocyte-specific gene expression in mast cells. However, the effects of PU.1 on each target gene and the involvement of cytokine signaling in PU.1-mediated gene expression are largely unknown. In the present study, PU.1 was over-expressed in two different types of bone marrow-derived cultured mast cells (BMMCs): BMMCs cultured with IL-3 plus stem cell factor (SCF) and BMMCs cultured with pokeweed mitogen-stimulated spleen-conditioned medium (PWM-SCM). PU.1 over-expression induced expression of MHC class II, CD11b, CD11c and F4/80 on PWM-SCM-cultured BMMCs, whereas IL-3/SCF-cultured BMMCs expressed CD11b and F4/80, but not MHC class II or CD11c. When IFN-gamma was added to the IL-3/SCF-based medium, PU.1 transfectant acquired MHC class II expression, which was abolished by antibody neutralization or in Ifngr(-/-) BMMCs, through the induction of expression of the MHC class II transactivator, CIITA. Real-time PCR detected CIITA mRNA driven by the fourth promoter, pIV, and chromatin immunoprecipitation indicated direct binding of PU.1 to pIV in PU.1-over-expressing BMMCs. PU.1-over-expressing cells showed a marked increase in IL-6 production in response to LPS stimulation in both IL-3/SCF and PWM-SCM cultures. These results suggest that PU.1 overproduction alone is sufficient for both expression of CD11b and F4/80 and for amplification of LPS-induced IL-6 production. However, IFN-gamma stimulation is essential for PU.1-mediated transactivation of CIITA pIV. Reduced expression of mast cell-related molecules and transcription factors GATA-1/2 and up-regulation of C/EBPalpha in PU.1 transfectants indicate that enforced PU.1 suppresses mast cell-specific gene expression through these transcription factors.
Effectiveness of gamma ray irradiation and ethyl methane ...
African Journals Online (AJOL)
채소실험실
2013-07-24
Jul 24, 2013 ... Department of Plant Science, Gangneung-Wonju National University, ... DNKW001 were discovered sturdy plants with thicker leaf and bigger pollen than octoploid plant, while ... Application of mutagen was intended to increase gene- ..... Effects of gamma ray and EMS treatment on the survival rate of ...
Current and future alternative therapies for beta-thalassemia major
Directory of Open Access Journals (Sweden)
Edouard de Dreuzy
2016-02-01
Full Text Available Beta-thalassemia is a group of frequent genetic disorders resulting in the synthesis of little or no β-globin chains. Novel approaches are being developed to correct the resulting α/β-globin chain imbalance, in an effort to move beyond the palliative management of this disease and the complications of its treatment (e.g. life-long red blood cell transfusion, iron chelation, splenectomy, which impose high costs on healthcare systems. Three approaches are envisaged: fetal globin gene reactivation by pharmacological compounds injected into patients throughout their lives, allogeneic hematopoietic stem cell transplantation (HSCT, and gene therapy. HSCT is currently the only treatment shown to provide an effective, definitive cure for β-thalassemia. However, this procedure remains risky and histocompatible donors are identified for only a small fraction of patients. New pharmacological compounds are being tested, but none has yet made it into common clinical practice for the treatment of beta-thalassemia major. Gene therapy is in the experimental phase. It is emerging as a powerful approach without the immunological complications of HSCT, but with other possible drawbacks. Rapid progress is being made in this field, and long-term efficacy and safety studies are underway.
International Nuclear Information System (INIS)
Kim, Dong-Sub; Kang, Si-Yong; Lee, Geung-Joo; Kim, Jin-Baek
2008-06-01
The purpose of this study is to characterize genes specifically expressed in response to ionizing energy (gamma-rays) of acute irradiation and elucidate signalling mechanisms via functional analysis of isolated genes in Arabidopsis thaliana. Recent improvements in DNA microarray technologies and bioinformatics have made it possible to look for common features of ionizing radiation-responsive genes and their regulatory regions. It has produced massive quantities of gene expression and other functional genomics data, and its application will increase in plant genomics. In this study, we used oligonucleotide microarrays to detect the Arabidopsis genes expressed differentially by a gamma-irradiation during the vegetative (VT, 21 DAG) and reproductive (RT, 28 DAG) stages. Wild-type (Ler) Arabidopsis was irradiated with gamma-rays with 100 and 800 Gy doses. Among the 21,500 genes represented in the Agilent chip, approximately 13,500 ( ∼ 61.4 %) responsive genes to ν -irradiation were expressed with signal intensity greater than 192 when compared to the combined control (non-irradiated vegetative and reproductive pool). Expression patterns of several radiation inducible genes were confirmed by RT-PCR and Northern blotting. Our microarray results may contribute to an overall understanding of the type and quantities of genes that are expressed by an acute gamma-irradiation. In addition, to investigate the oxidative damage caused by irradiation, RT-PCR analysis for the expression of antioxidant isoenzyme genes, and a Transmission Electron Microscope (TEM) observation for visualizing the H 2 O 2 scavenging activity in leaves were applied
In vivo regulation of gene transcription by alpha- and gamma-Tocopherol in murine T lymphocytes
Of the 8 different analogues (alpha-, beta-, gamma-, delta-tocopherols and tocotrienols) designated as vitamin E, alpha-tocopherol (a-T) has been mostly studied, together with gamma-tocopherol (g-T) which is abundant in the US diet. We compared the effect of dietary supplementation with adequate or ...
LDB1-mediated enhancer looping can be established independent of mediator and cohesin.
Krivega, Ivan; Dean, Ann
2017-08-21
Mechanistic studies in erythroid cells indicate that LDB1, as part of a GATA1/TAL1/LMO2 complex, brings erythroid-expressed genes into proximity with enhancers for transcription activation. The role of co-activators in establishing this long-range interaction is poorly understood. Here we tested the contributions of the RNA Pol II pre-initiation complex (PIC), mediator and cohesin to establishment of locus control region (LCR)/β-globin proximity. CRISPR/Cas9 editing of the β-globin promoter to eliminate the RNA Pol II PIC by deleting the TATA-box resulted in loss of transcription, but enhancer-promoter interaction was unaffected. Additional deletion of the promoter GATA1 site eliminated LDB1 complex and mediator occupancy and resulted in loss of LCR/β-globin proximity. To separate the roles of LDB1 and mediator in LCR looping, we expressed a looping-competent but transcription-activation deficient form of LDB1 in LDB1 knock down cells: LCR/β-globin proximity was restored without mediator core occupancy. Further, Cas9-directed tethering of mutant LDB1 to the β-globin promoter forced LCR loop formation in the absence of mediator or cohesin occupancy. Moreover, ENCODE data and our chromatin immunoprecipitation results indicate that cohesin is almost completely absent from validated and predicted LDB1-regulated erythroid enhancer-gene pairs. Thus, lineage specific factors largely mediate enhancer-promoter looping in erythroid cells independent of mediator and cohesin. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Energy Technology Data Exchange (ETDEWEB)
Czubek, J A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires. Departement d' Electronique Generale, Service d' Electronique Industrielle; Institut de Recherches Nucleaires, Dep. VI, Cracow (Poland)
1966-07-01
The work presented here deals with the problem of the application of the similitude principle to rock density measurements by the gamma-gamma method. A formula is presented which makes it possible to transform results of gamma-gamma measurements carried out on models in order to make them suitable for comparison with results obtained under actual field conditions. Both the space coordinates and the densities are transformed. This transformation makes it possible to obtain a calibration curve as a function of the density for a gamma-gamma probe using only a single model of given density. The influence has also been studied of the chemical composition on the results obtained from gamma-gamma measurements. A method has been developed for estimating the equivalent Z parameter of the medium; the possibility of completely eliminating the influence of the chemical composition of the medium on the measurement results has been studied. (author) [French] L'etude presentee ci-dessous traite le probleme de l'application du principe de similitude aux mesures de densite des roches par la methode gamma-gamma. Nous indiquons une formule qui permet de transformer les resultats des mesures gamma-gamma effectuees sur les modeles pour les comparer aux resultats obtenus dans les conditions reelles sur le terrain. On transforme les coordonnees spatiales ainsi que les densites. Cette transformation donne la possibilite d'obtenir une courbe d'etalonnage (en fonction de la densite) pour une sonde gamma-gamma en utilisant un seul modele de densite donnee. On a etudie aussi l'influence de la composition chimique sur les resultats obtenus des mesures gamma-gamma. On a etabli une methode d'estimation du parametre Z equivalent du milieu, ainsi que la possibilite d'eliminer completement l'influence de la composition chimique du milieu sur les resultats des mesures de densite. (auteur)
Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard
2013-05-30
Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.
Directory of Open Access Journals (Sweden)
Yijun Du
Full Text Available Highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV had caused catastrophic losses in swine industry in China. The current inactivated vaccine provided only limited protection, and the attenuated live vaccine could protect piglets against the HP-PRRSV but there was a possibility that the attenuated virus returned to high virulence. In this study, the eukaryotic expression vector pVAX1© was modified under the control of rabbit β-globin intron II gene and the modified vector pMVAX1© was constructed. Porcine interleukin-2 (IL-2 and GP3-GP5 fusion protein of HP-PRRSV strain SD-JN were highly expressed by pMVAX1©. Mice inoculated with pMVAX1©-GP35 developed significantly higher PRRSV-specific antibody responses and T cell proliferation than those vaccinated with pVAX1©-GP35. pMVAX1©-GP35 was selected as PRRS DNA vaccine candidate and co-administrated with pVAX1©-IL-2 or pMVAX1©-IL-2 in pigs. pMVAX1©-IL-2+pMVAX1©-GP35 could provide enhanced PRRSV-specific antibody responses, T cell proliferation, Th1-type and Th2-type cytokine responses and CTL responses than pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35. Following homologous challenge with HP-PRRSV strain SD-JN, similar with attenuated PRRS vaccine group, pigs inoculated with pMVAX1©-IL-2+pMVAX1©-GP35 showed no clinical signs, almost no lung lesions and no viremia, as compared to those in pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35 groups. It indicated that pMVAX1©-IL-2 effectively increases humoral and cell mediated immune responses of pMVAX1©-GP35. Co-administration of pMVAX1©-IL-2 and pMVAX1©-GP35 might be attractive candidate vaccines for preventing HP-PRRSV infections.
Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade
2006-12-15
Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.
Molecular ecophysiology of Antarctic notothenioid fishes.
Cheng, C-H Christina; Detrich, H William
2007-12-29
the mechanistic understanding of the dynamics of AFGP gene gain and loss. In humans and most vertebrates, mutations in the alpha- or beta-globin genes or defects in globin chain synthesis are causes of severe genetic disease. Thus, the 16 species of haemoglobinless, erythrocyte-null icefishes are surprising anomalies -- in fact, they could only have evolved and thrived due to relaxed selection pressure for oxygen-binding proteins in the cold, oxygen-rich waters of the Southern Ocean. Fifteen of the sixteen icefish species have lost most of the adult alphabeta-globin locus and retain only a small 3' fragment of the alpha-globin gene. The only exception to this pattern occurs in Neopagetopsis ionah, which possesses a disrupted alphabeta-globin gene complex that probably represents a non-functional intermediate on the evolutionary pathway to near total globin gene extinction. By contrast, six of the icefish species fail to express myoglobin. The absence of myoglobin expression has occurred by several independent mutations and distinct mechanisms. Haemoprotein loss is correlated with dramatic increases in cellular mitochondrial density, heart size, blood volume and capillary bed volume. Evolution of these compensatory traits was probably facilitated by the homeostatic activity of nitric oxide, a key modulator of angiogenesis and mitochondrial biogenesis. These natural knockouts of the red blood cell lineage are an excellent genomic resource for erythroid gene discovery by comparative genomics, as illustrated for the newly described gene, bloodthirsty.
International Nuclear Information System (INIS)
Wu Dianxing; Ye Qingfu; Wang Zhonghua; Xia Yingwu
2004-01-01
The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein
Institute of Scientific and Technical Information of China (English)
Ping Yang; Guoqiang Cai; Youqing Cai; Jian Fei; Guoxiang Liu
2013-01-01
Attention deficit/hyperactivity disorder (ADHD) is characterized by hyperactivity,impaired sustained attention,impulsivity,and is usually accompanied by varying degrees of learning difficulties and lack of motor coordination.However,the pathophysiology and etiology of ADHD remain inconclusive so far.Our previous studies have demonstrated that the gamma aminobutyric acid transporter subtype 1 (GAT1) gene knockout (ko) mouse (gat1-/-)is hyperactive and exhibited impaired memory performance in the Morris water maze.In the current study,we found that the gat1-/-mice showed low levels of attentional focusing and increased impulsivity.In addition,the gat1-/-mice displayed ataxia characterized by defects in motor coordination and balance skills.The hyperactivity in the ko mice was reduced by both methylphenidate and amphetamine.Collectively,these results suggest that GAT1 ko mouse is a new animal model for ADHD studying and GAT1 may be a new target to treat ADHD.
Meunier, Cédric; Andersen, Ann C; Bruneaux, Matthieu; Le Guen, Dominique; Terrier, Peran; Leize-Wagner, Emmanuelle; Zal, Franck
2010-01-01
Siboglinids are symbiotic polychete annelids having hemoglobins as essential oxygen- and sulfide-carriers for their endosymbiotic bacteria. We analyzed the structure of the hemoglobins from two species of siboglinids: the monilifera Sclerolinum contortum and the frenulata Oligobrachia webbi (i.e. haakonmosbiensis) from Norwegian cold seeps. Measured by Multi-Angle Laser Light Scattering (MALLS), Sclerolinum shows a 3190+/-50 kDa hexagonal bilayer hemoglobin (HBL-Hb) and a 461+/-46 kDa ring-Hb, just as vestimentifera, whereas Oligobrachia has a 409+/-3.7 kDa ring-Hb only. Electrospray Ionization-Mass Spectrometry (ESI-MS) showed Sclerolinum HBL-Hb composed of seven monomeric globins (15-16 kDa), three disulfide-bonded globin heterodimers and three linkers. The heterodimers always contain globin-b (15814.4+/-1.5 Da). Sclerolinum ring-Hb is composed of globins and dimers with identical masses as its HBL-Hb, but lacks linkers. Oligobrachia ring-Hb has three globin monomers (14-15 kDa) only, with no disulfide-bonded dimers. Comparison of Sclerolinum hemoglobins between Storegga and Haakon Mosby Mud Volcano, using the normalized height of deconvoluted ESI-MS peaks, shows differences in globin monomers abundances that could reflect genetic differences or differential gene expression between distinct seep populations. The discovery of HBL-Hb in Sclerolinum is a new element supporting the hypothesis of monilifera being phylogenetically more closely related to vestimentifera, than to frenulata.
Exposure of luminous marine bacteria to low-dose gamma-radiation.
Kudryasheva, N S; Petrova, A S; Dementyev, D V; Bondar, A A
2017-04-01
The study addresses biological effects of low-dose gamma-radiation. Radioactive 137 Cs-containing particles were used as model sources of gamma-radiation. Luminous marine bacterium Photobacterium phosphoreum was used as a bioassay with the bioluminescent intensity as the physiological parameter tested. To investigate the sensitivity of the bacteria to the low-dose gamma-radiation exposure (≤250 mGy), the irradiation conditions were varied as follows: bioluminescence intensity was measured at 5, 10, and 20°С for 175, 100, and 47 h, respectively, at different dose rates (up to 4100 μGy/h). There was no noticeable effect of gamma-radiation at 5 and 10°С, while the 20°С exposure revealed authentic bioluminescence inhibition. The 20°С results of gamma-radiation exposure were compared to those for low-dose alpha- and beta-radiation exposures studied previously under comparable experimental conditions. In contrast to ionizing radiation of alpha and beta types, gamma-emission did not initiate bacterial bioluminescence activation (adaptive response). As with alpha- and beta-radiation, gamma-emission did not demonstrate monotonic dose-effect dependencies; the bioluminescence inhibition efficiency was found to be related to the exposure time, while no dose rate dependence was found. The sequence analysis of 16S ribosomal RNA gene did not reveal a mutagenic effect of low-dose gamma radiation. The exposure time that caused 50% bioluminescence inhibition was suggested as a test parameter for radiotoxicity evaluation under conditions of chronic low-dose gamma irradiation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Testing for haemoglobinopathies in Johannesburg, South Africa: A ...
African Journals Online (AJOL)
Thus, haemoglobinopathies are seen in diverse populations in SA, broadly reflecting their origins. Further, the globin genes were among the first human genes cloned in the recombinant DNA era and they served as model genes for the establishment of genetic services worldwide, with the first molecular prenatal diagnosis ...
Directory of Open Access Journals (Sweden)
Labedan Bernard
2006-01-01
Full Text Available Abstract Background The N-acetylation of L-glutamate is regarded as a universal metabolic strategy to commit glutamate towards arginine biosynthesis. Until recently, this reaction was thought to be catalyzed by either of two enzymes: (i the classical N-acetylglutamate synthase (NAGS, gene argA first characterized in Escherichia coli and Pseudomonas aeruginosa several decades ago and also present in vertebrates, or (ii the bifunctional version of ornithine acetyltransferase (OAT, gene argJ present in Bacteria, Archaea and many Eukaryotes. This paper focuses on a new and surprising aspect of glutamate acetylation. We recently showed that in Moritella abyssi and M. profunda, two marine gamma proteobacteria, the gene for the last enzyme in arginine biosynthesis (argH is fused to a short sequence that corresponds to the C-terminal, N-acetyltransferase-encoding domain of NAGS and is able to complement an argA mutant of E. coli. Very recently, other authors identified in Mycobacterium tuberculosis an independent gene corresponding to this short C-terminal domain and coding for a new type of NAGS. We have investigated the two prokaryotic Domains for patterns of gene-enzyme relationships in the first committed step of arginine biosynthesis. Results The argH-A fusion, designated argH(A, and discovered in Moritella was found to be present in (and confined to marine gamma proteobacteria of the Alteromonas- and Vibrio-like group. Most of them have a classical NAGS with the exception of Idiomarina loihiensis and Pseudoalteromonas haloplanktis which nevertheless can grow in the absence of arginine and therefore appear to rely on the arg(A sequence for arginine biosynthesis. Screening prokaryotic genomes for virtual argH-X 'fusions' where X stands for a homologue of arg(A, we retrieved a large number of Bacteria and several Archaea, all of them devoid of a classical NAGS. In the case of Thermus thermophilus and Deinococcus radiodurans, the arg(A-like sequence
Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.
Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A
1997-05-01
The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.
Energy Technology Data Exchange (ETDEWEB)
Kim, Dong-Sub; Kang, Si-Yong; Lee, Geung-Joo; Kim, Jin-Baek
2008-06-15
The purpose of this study is to characterize genes specifically expressed in response to ionizing energy (gamma-rays) of acute irradiation and elucidate signalling mechanisms via functional analysis of isolated genes in Arabidopsis thaliana. Recent improvements in DNA microarray technologies and bioinformatics have made it possible to look for common features of ionizing radiation-responsive genes and their regulatory regions. It has produced massive quantities of gene expression and other functional genomics data, and its application will increase in plant genomics. In this study, we used oligonucleotide microarrays to detect the Arabidopsis genes expressed differentially by a gamma-irradiation during the vegetative (VT, 21 DAG) and reproductive (RT, 28 DAG) stages. Wild-type (Ler) Arabidopsis was irradiated with gamma-rays with 100 and 800 Gy doses. Among the 21,500 genes represented in the Agilent chip, approximately 13,500 ({sup {approx}}61.4 %) responsive genes to {nu} -irradiation were expressed with signal intensity greater than 192 when compared to the combined control (non-irradiated vegetative and reproductive pool). Expression patterns of several radiation inducible genes were confirmed by RT-PCR and Northern blotting. Our microarray results may contribute to an overall understanding of the type and quantities of genes that are expressed by an acute gamma-irradiation. In addition, to investigate the oxidative damage caused by irradiation, RT-PCR analysis for the expression of antioxidant isoenzyme genes, and a Transmission Electron Microscope (TEM) observation for visualizing the H{sub 2}O{sub 2} scavenging activity in leaves were applied.
Exploring cellular memory molecules marking competent and active transcriptions
Directory of Open Access Journals (Sweden)
Liu De-Pei
2007-05-01
Full Text Available Abstract Background Development in higher eukaryotes involves programmed gene expression. Cell type-specific gene expression is established during this process and is inherited in succeeding cell cycles. Higher eukaryotes have evolved elegant mechanisms by which committed gene-expression states are transmitted through numerous cell divisions. Previous studies have shown that both DNase I-sensitive sites and the basal transcription factor TFIID remain on silenced mitotic chromosomes, suggesting that certain trans-factors might act as bookmarks, maintaining the information and transmitting it to the next generation. Results We used the mouse globin gene clusters as a model system to examine the retention of active information on M-phase chromosomes and its contribution to the persistence of transcriptional competence of these gene clusters in murine erythroleukemia cells. In cells arrested in mitosis, the erythroid-specific activator NF-E2p45 remained associated with its binding sites on the globin gene loci, while the other major erythroid factor, GATA-1, was removed from chromosome. Moreover, despite mitotic chromatin condensation, the distant regulatory regions and promoters of transcriptionally competent globin gene loci are marked by a preserved histone code consisting in active histone modifications such as H3 acetylation, H3-K4 dimethylation and K79 dimethylation. Further analysis showed that other active genes are also locally marked by the preserved active histone code throughout mitotic inactivation of transcription. Conclusion Our results imply that certain kinds of specific protein factors and active histone modifications function as cellular memory markers for both competent and active genes during mitosis, and serve as a reactivated core for the resumption of transcription when the cells exit mitosis.
Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway
Directory of Open Access Journals (Sweden)
Michelle R. Campbell
2013-01-01
Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.
Thalassemia and related hemoglobinopathies.
Sarnaik, Sharada A
2005-04-01
Hemoglobinopathies are the most common single gene disorders in man. There are several hundred of these disorders though the thalassemias -- alpha and beta and the sickling disorders make up the vast majority. Recent advances in the understanding of the hemoglobin structure and the genetics of its synthesis has contributed significantly to the understanding of these diseases. Disorders include those with reduced globin synthesis, abnormal globin chains and failure to switch globin chain synthesis at the appropriate age. This review focuses on the clinical features, diagnosis and management strategies of the alpha and beta thalassemias, the sickling disorders and touches on a few rarer hemoglobinopathies. It also emphasizes prevention strategies and chronic transfusion safety in countries like India where there are limited resources.
Mohapatra, Saroj K; Guri, Amir J; Climent, Montse; Vives, Cristina; Carbo, Adria; Horne, William T; Hontecillas, Raquel; Bassaganya-Riera, Josep
2010-04-20
Peroxisome proliferator-activated receptors are nuclear receptors highly expressed in intestinal epithelial cells (IEC) and immune cells within the gut mucosa and are implicated in modulating inflammation and immune responses. The objective of this study was to investigate the effect of targeted deletion of PPAR gamma in IEC on progression of experimental inflammatory bowel disease (IBD). In the first phase, PPAR gamma flfl; Villin Cre- (VC-) and PPAR gamma flfl; Villin Cre+ (VC+) mice in a mixed FVB/C57BL/6 background were challenged with 2.5% dextran sodium sulfate (DSS) in drinking water for 0, 2, or 7 days. VC+ mice express a transgenic recombinase under the control of the Villin-Cre promoter that causes an IEC-specific deletion of PPAR gamma. In the second phase, we generated VC- and VC+ mice in a C57BL/6 background that were challenged with 2.5% DSS. Mice were scored on disease severity both clinically and histopathologically. Flow cytometry was used to phenotypically characterize lymphocyte and macrophage populations in blood, spleen and mesenteric lymph nodes. Global gene expression analysis was profiled using Affymetrix microarrays. The IEC-specific deficiency of PPAR gamma in mice with a mixed background worsened colonic inflammatory lesions, but had no effect on disease activity (DAI) or weight loss. In contrast, the IEC-specific PPAR gamma null mice in C57BL/6 background exhibited more severe inflammatory lesions, DAI and weight loss in comparison to their littermates expressing PPAR gamma in IEC. Global gene expression profiling revealed significantly down-regulated expression of lysosomal pathway genes and flow cytometry results demonstrated suppressed production of IL-10 by CD4+ T cells in mesenteric lymph nodes (MLN) of IEC-specific PPAR gamma null mice. Our results demonstrate that adequate expression of PPAR gamma in IEC is required for the regulation of mucosal immune responses and prevention of experimental IBD, possibly by modulation of
Directory of Open Access Journals (Sweden)
Saroj K Mohapatra
Full Text Available BACKGROUND: Peroxisome proliferator-activated receptors are nuclear receptors highly expressed in intestinal epithelial cells (IEC and immune cells within the gut mucosa and are implicated in modulating inflammation and immune responses. The objective of this study was to investigate the effect of targeted deletion of PPAR gamma in IEC on progression of experimental inflammatory bowel disease (IBD. METHODOLOGY/PRINCIPAL FINDINGS: In the first phase, PPAR gamma flfl; Villin Cre- (VC- and PPAR gamma flfl; Villin Cre+ (VC+ mice in a mixed FVB/C57BL/6 background were challenged with 2.5% dextran sodium sulfate (DSS in drinking water for 0, 2, or 7 days. VC+ mice express a transgenic recombinase under the control of the Villin-Cre promoter that causes an IEC-specific deletion of PPAR gamma. In the second phase, we generated VC- and VC+ mice in a C57BL/6 background that were challenged with 2.5% DSS. Mice were scored on disease severity both clinically and histopathologically. Flow cytometry was used to phenotypically characterize lymphocyte and macrophage populations in blood, spleen and mesenteric lymph nodes. Global gene expression analysis was profiled using Affymetrix microarrays. The IEC-specific deficiency of PPAR gamma in mice with a mixed background worsened colonic inflammatory lesions, but had no effect on disease activity (DAI or weight loss. In contrast, the IEC-specific PPAR gamma null mice in C57BL/6 background exhibited more severe inflammatory lesions, DAI and weight loss in comparison to their littermates expressing PPAR gamma in IEC. Global gene expression profiling revealed significantly down-regulated expression of lysosomal pathway genes and flow cytometry results demonstrated suppressed production of IL-10 by CD4+ T cells in mesenteric lymph nodes (MLN of IEC-specific PPAR gamma null mice. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate that adequate expression of PPAR gamma in IEC is required for the regulation of mucosal
Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo
2003-08-01
The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.
MacMurray, James; Comings, David E; Napolioni, Valerio
2014-01-01
Cytokine gene variants are known to influence both infectious disease susceptibility and harm-avoidant behaviors, suggesting that these risk variants may be pleiotropically linked to instinctual disease-avoidant traits. The gamma-interferon (IFNG) +874 T>A polymorphism (rs2430561) is an ideal candidate gene variant for immune-behavioral studies. It is a functional SNP, regulating IFNG mRNA expression; it is known to modulate serotonergic activity and is therefore capable of modifying behavior; and it has previously been associated with increased susceptibility to malaria, tuberculosis, leprosy and Chagas disease. We hypothesized that the infectious disease-high-risk IFNG +874 A-allele would be associated with four personality traits previously reported as behavioral defenses against infection: Harm Avoidance (HA), Extraversion (E), Exploratory Excitability (Exp E), and Openness to Experience (O). We tested this hypothesis in a sample of 168 healthy university students from Southern California genotyped for IFNG +874 T>A and evaluated by the Temperament and Character Inventory-Revised (TCI-R) and the NEO Five-Factor Inventory (NEO-FFI). We found that the infectious disease-high-risk IFNG +874 A-allele was associated with increased HA (P=0.001) and decreased E (P=0.030) and Exp E (P=0.030). These findings suggest that the IFNG +874 A gene variant is linked both to infectious disease susceptibility and to proactive behavioral defenses that reduce infection risk in healthy subjects. Copyright © 2013 Elsevier Inc. All rights reserved.
Jorgez, Carolina J; Bischoff, Farideh Z
2009-01-01
Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.
Biochemical and Molecular Analysis of the Hb Lepore Boston Washington in a Syrian Homozygous Child
Directory of Open Access Journals (Sweden)
Monica Pirastru
2017-01-01
Full Text Available Hemoglobin (Hb Lepore is composed of two normal α chains and two δβ fusion globins that arise from unequal crossover events between the δ- and β-globin genes. The Hb Lepore is widespread all over the world and in many ethnic groups. It includes some of the few clinically significant Hb variants that are associated with a β-thalassemia phenotype. Here, we describe the first occurrence of Hb Lepore Boston Washington in a Syrian individual. The patient, a 10-year-old child, shows severe anemia with a Hb level of 6.85 g/dL and typical thalassemic red cell indices. The diagnostic procedure implies hematological, biochemical, and molecular analysis, including multiplex ligation-dependent probe amplification (MLPA assay, GAP-PCR, and DNA sequencing. This latter allowed us to define the correct structure of the hybrid δβ-globin gene. The knowledge of the spectrum of mutations associated with different geographical areas is the prerequisite to set up large-scale screening programs and be able to offer genetic counseling to couples at risk.
Mediterranean anemia; Cooley anemia; Beta thalassemia; Alpha thalassemia ... alpha globin protein are missing or changed (mutated). Beta thalassemia occurs when similar gene defects affect production of ...
Experience gained in gamma spectroscopy; Experience acquise dans la spectrometrie gamma
Energy Technology Data Exchange (ETDEWEB)
Jeanmaire, L [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires
1960-07-01
type SAE 25 classe les impulsions selon leur amplitude. II est donc possible de distinguer des rayonnements {gamma} d'energie differente. 3) Une protection relativement tres legere, constituee par une epaisseur de 5 cm de plomb seulement, attenue les rayonnements {gamma} ambiants de facon satisfaisante pour la plupart des mesures. De plus, le cristal detecteur est place dans une sorte de puits en plomb. On obtient ainsi une certaine collimation qui permet d'effectuer des localisations grossieres et de ne pas etre tres gene dans les mesures par des contaminations externes. (auteur)
Infusion of Autologous Retrodifferentiated Stem Cells into Patients with Beta-Thalassemia
Directory of Open Access Journals (Sweden)
Ilham Saleh Abuljadayel
2006-01-01
Full Text Available Beta-thalassemia is a genetic, red blood cell disorder affecting the beta-globin chain of the adult hemoglobin gene. This results in excess accumulation of unpaired alpha-chain gene products leading to reduced red blood cell life span and the development of severe anemia. Current treatment of this disease involves regular blood transfusion and adjunct chelation therapy to lower blood transfusion–induced iron overload. Fetal hemoglobin switching agents have been proposed to treat genetic blood disorders, such as sickle cell anemia and beta-thalassemia, in an effort to compensate for the dysfunctional form of the beta-globin chain in adult hemoglobin. The rationale behind this approach is to pair the excess normal alpha-globin chain with the alternative fetal gamma-chain to promote red blood cell survival and ameliorate the anemia. Reprogramming of differentiation in intact, mature, adult white blood cells in response to inclusion of monoclonal antibody CR3/43 has been described. This form of retrograde development has been termed “retrodifferentiation”, with the ability to re-express a variety of stem cell markers in a heterogeneous population of white blood cells. This form of reprogramming, or reontogeny, to a more pluripotent stem cell state ought to recapitulate early hematopoiesis and facilitate expression of a fetal and/or adult program of hemoglobin synthesis or regeneration on infusion and subsequent redifferentiation. Herein, the outcome of infusion of autologous retrodifferentiated stem cells (RSC into 21 patients with beta-thalassemia is described. Over 6 months, Infusion of 3-h autologous RSC subjected to hematopoietic-conducive conditions into patients with beta-thalassemia reduced mean blood transfusion requirement, increased mean fetal hemoglobin synthesis, and significantly lowered mean serum ferritin. This was always accompanied by an increase in mean corpuscular volume (MCV, mean corpuscular hemoglobin (MCH, and mean
Directory of Open Access Journals (Sweden)
Alexandre Vallée
2017-05-01
Full Text Available Gliomas cells are the site of numerous metabolic and thermodynamics abnormalities with an increasing entropy rate which is characteristic of irreversible processes driven by changes in Gibbs energy, heat production, intracellular acidity, membrane potential gradient, and ionic conductance. We focus our review on the opposing interactions observed in glioma between the canonical WNT/beta-catenin pathway and PPAR gamma and their metabolic and thermodynamic implications. In gliomas, WNT/beta-catenin pathway is upregulated while PPAR gamma is downregulated. Upregulation of WNT/beta-catenin signaling induces changes in key metabolic enzyme that modify their thermodynamics behavior. This leads to activation pyruvate dehydrogenase kinase 1(PDK-1 and monocarboxylate lactate transporter 1 (MCT-1. Consequently, phosphorylation of PDK-1 inhibits pyruvate dehydrogenase complex (PDH. Thus, a large part of pyruvate cannot be converted into acetyl-CoA in mitochondria and in TCA (tricarboxylic acid cycle. This leads to aerobic glycolysis despite the availability of oxygen, named Warburg effect. Cytoplasmic pyruvate is, in major part, converted into lactate. The WNT/beta-catenin pathway induces also the transcription of genes involved in cell proliferation, cell invasiveness, nucleotide synthesis, tumor growth, and angiogenesis, such as c-Myc, cyclin D1, PDK. In addition, in gliomas cells, PPAR gamma is downregulated, leading to a decrease in insulin sensitivity and an increase in neuroinflammation. Moreover, PPAR gamma contributes to regulate some key circadian genes. Abnormalities in the regulation of circadian rhythms and dysregulation in circadian clock genes are observed in gliomas. Circadian rhythms are dissipative structures, which play a key role in far-from-equilibrium thermodynamics through their interactions with WNT/beta-catenin pathway and PPAR gamma. In gliomas, metabolism, thermodynamics, and circadian rhythms are tightly interrelated.
Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang
2015-05-01
The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.
Study of the $e^+ e^- \\to Z\\gamma\\gamma \\to q\\overline{q}\\gamma\\gamma$ Process at LEP
Acciarri, M.; Adriani, O.; Aguilar-Benitez, M.; Alcaraz, J.; Alemanni, G.; Allaby, J.; Aloisio, A.; Alviggi, M.G.; Ambrosi, G.; Anderhub, H.; Andreev, Valery P.; Angelescu, T.; Anselmo, F.; Arefev, A.; Azemoon, T.; Aziz, T.; Bagnaia, P.; Bajo, A.; Baksay, L.; Balandras, A.; Baldew, S.V.; Banerjee, S.; Banerjee, Sw.; Barczyk, A.; Barillere, R.; Bartalini, P.; Basile, M.; Batalova, N.; Battiston, R.; Bay, A.; Becattini, F.; Becker, U.; Behner, F.; Bellucci, L.; Berbeco, R.; Berdugo, J.; Berges, P.; Bertucci, B.; Betev, B.L.; Bhattacharya, S.; Biasini, M.; Biglietti, M.; Biland, A.; Blaising, J.J.; Blyth, S.C.; Bobbink, G.J.; Bohm, A.; Boldizsar, L.; Borgia, B.; Bourilkov, D.; Bourquin, M.; Braccini, S.; Branson, J.G.; Brochu, F.; Buffini, A.; Buijs, A.; Burger, J.D.; Burger, W.J.; Cai, X.D.; Capell, M.; Cara Romeo, G.; Carlino, G.; Cartacci, A.M.; Casaus, J.; Castellini, G.; Cavallari, F.; Cavallo, N.; Cecchi, C.; Cerrada, M.; Cesaroni, F.; Chamizo, M.; Chang, Y.H.; Chaturvedi, U.K.; Chemarin, M.; Chen, A.; Chen, G.; Chen, G.M.; Chen, H.F.; Chen, H.S.; Chiefari, G.; Cifarelli, L.; Cindolo, F.; Civinini, C.; Clare, I.; Clare, R.; Coignet, G.; Colino, N.; Costantini, S.; Cotorobai, F.; de la Cruz, B.; Csilling, A.; Cucciarelli, S.; Dai, T.S.; van Dalen, J.A.; D'Alessandro, R.; de Asmundis, R.; Deglon, P.; Degre, A.; Deiters, K.; della Volpe, D.; Delmeire, E.; Denes, P.; DeNotaristefani, F.; De Salvo, A.; Diemoz, M.; Dierckxsens, M.; van Dierendonck, D.; Dionisi, C.; Dittmar, M.; Dominguez, A.; Doria, A.; Dova, M.T.; Duchesneau, D.; Dufournaud, D.; Duinker, P.; El Mamouni, H.; Engler, A.; Eppling, F.J.; Erne, F.C.; Ewers, A.; Extermann, P.; Fabre, M.; Falagan, M.A.; Falciano, S.; Favara, A.; Fay, J.; Fedin, O.; Felcini, M.; Ferguson, T.; Fesefeldt, H.; Fiandrini, E.; Field, J.H.; Filthaut, F.; Fisher, P.H.; Fisk, I.; Forconi, G.; Freudenreich, K.; Furetta, C.; Galaktionov, Iouri; Ganguli, S.N.; Garcia-Abia, Pablo; Gataullin, M.; Gau, S.S.; Gentile, S.; Gheordanescu, N.; Giagu, S.; Gong, Z.F.; Grenier, Gerald Jean; Grimm, O.; Gruenewald, M.W.; Guida, M.; van Gulik, R.; Gupta, V.K.; Gurtu, A.; Gutay, L.J.; Haas, D.; Hasan, A.; Hatzifotiadou, D.; Hebbeker, T.; Herve, Alain; Hidas, P.; Hirschfelder, J.; Hofer, H.; Holzner, G.; Hoorani, H.; Hou, S.R.; Hu, Y.; Iashvili, I.; Jin, B.N.; Jones, Lawrence W.; de Jong, P.; Josa-Mutuberria, I.; Khan, R.A.; Kafer, D.; Kaur, M.; Kienzle-Focacci, M.N.; Kim, D.; Kim, J.K.; Kirkby, Jasper; Kiss, D.; Kittel, W.; Klimentov, A.; Konig, A.C.; Kopal, M.; Kopp, A.; Koutsenko, V.; Kraber, M.; Kraemer, R.W.; Krenz, W.; Kruger, A.; Kunin, A.; Ladron de Guevara, P.; Laktineh, I.; Landi, G.; Lebeau, M.; Lebedev, A.; Lebrun, P.; Lecomte, P.; Lecoq, P.; Le Coultre, P.; Lee, H.J.; Le Goff, J.M.; Leiste, R.; Levtchenko, P.; Li, C.; Likhoded, S.; Lin, C.H.; Lin, W.T.; Linde, F.L.; Lista, L.; Liu, Z.A.; Lohmann, W.; Longo, E.; Lu, Y.S.; Lubelsmeyer, K.; Luci, C.; Luckey, David; Lugnier, L.; Luminari, L.; Lustermann, W.; Ma, W.G.; Maity, M.; Malgeri, L.; Malinin, A.; Mana, C.; Mangeol, D.; Mans, J.; Marian, G.; Martin, J.P.; Marzano, F.; Mazumdar, K.; McNeil, R.R.; Mele, S.; Merola, L.; Meschini, M.; Metzger, W.J.; von der Mey, M.; Mihul, A.; Milcent, H.; Mirabelli, G.; Mnich, J.; Mohanty, G.B.; Moulik, T.; Muanza, G.S.; Muijs, A.J.M.; Musicar, B.; Musy, M.; Napolitano, M.; Nessi-Tedaldi, F.; Newman, H.; Niessen, T.; Nisati, A.; Kluge, Hannelies; Ofierzynski, R.; Organtini, G.; Oulianov, A.; Palomares, C.; Pandoulas, D.; Paoletti, S.; Paolucci, P.; Paramatti, R.; Park, H.K.; Park, I.H.; Passaleva, G.; Patricelli, S.; Paul, Thomas Cantzon; Pauluzzi, M.; Paus, C.; Pauss, F.; Pedace, M.; Pensotti, S.; Perret-Gallix, D.; Petersen, B.; Piccolo, D.; Pierella, F.; Pieri, M.; Piroue, P.A.; Pistolesi, E.; Plyaskin, V.; Pohl, M.; Pojidaev, V.; Postema, H.; Pothier, J.; Prokofev, D.O.; Prokofiev, D.; Quartieri, J.; Rahal-Callot, G.; Rahaman, M.A.; Raics, P.; Raja, N.; Ramelli, R.; Rancoita, P.G.; Ranieri, R.; Raspereza, A.; Raven, G.; Razis, P.; Ren, D.; Rescigno, M.; Reucroft, S.; Riemann, S.; Riles, Keith; Rodin, J.; Roe, B.P.; Romero, L.; Rosca, A.; Rosier-Lees, S.; Roth, Stefan; Rosenbleck, C.; Roux, B.; Rubio, J.A.; Ruggiero, G.; Rykaczewski, H.; Saremi, S.; Sarkar, S.; Salicio, J.; Sanchez, E.; Sanders, M.P.; Schafer, C.; Schegelsky, V.; Schmidt-Kaerst, S.; Schmitz, D.; Schopper, H.; Schotanus, D.J.; Schwering, G.; Sciacca, C.; Seganti, A.; Servoli, L.; Shevchenko, S.; Shivarov, N.; Shoutko, V.; Shumilov, E.; Shvorob, A.; Siedenburg, T.; Son, D.; Smith, B.; Spillantini, P.; Steuer, M.; Stickland, D.P.; Stone, A.; Stoyanov, B.; Straessner, A.; Sudhakar, K.; Sultanov, G.; Sun, L.Z.; Sushkov, S.; Suter, H.; Swain, J.D.; Szillasi, Z.; Sztaricskai, T.; Tang, X.W.; Tauscher, L.; Taylor, L.; Tellili, B.; Teyssier, D.; Timmermans, Charles; Ting, Samuel C.C.; Ting, S.M.; Tonwar, S.C.; Toth, J.; Tully, C.; Tung, K.L.; Uchida, Y.; Ulbricht, J.; Valente, E.; Vesztergombi, G.; Vetlitsky, I.; Vicinanza, D.; Viertel, G.; Villa, S.; Vivargent, M.; Vlachos, S.; Vodopianov, I.; Vogel, H.; Vogt, H.; Vorobev, I.; Vorobov, A.A.; Vorvolakos, A.; Wadhwa, M.; Wallraff, W.; Wang, M.; Wang, X.L.; Wang, Z.M.; Weber, A.; Weber, M.; Wienemann, P.; Wilkens, H.; Wu, S.X.; Wynhoff, S.; Xia, L.; Xu, Z.Z.; Yamamoto, J.; Yang, B.Z.; Yang, C.G.; Yang, H.J.; Yang, M.; Ye, J.B.; Yeh, S.C.; Zalite, A.; Zalite, Yu.; Zhang, Z.P.; Zhu, G.Y.; Zhu, R.Y.; Zichichi, A.; Zilizi, G.; Zimmermann, B.; Zoller, M.
2001-01-01
The process e^+e^- -> Z gamma gamma -> q q~ gamma gamma$ is studied in 0.5\\,fb-1$ of data collected with the L3 detector at centre-of-mass energies between 130.1 GeV and 201.7 GeV. Cross sections are measured and found to be consistent with the Standard Model expectations. The study of the least energetic photon constrains the quartic gauge boson couplings to -0.008 GeV-2 < a_0/\\Lambda^2 < 0.005 GeV-2 and -0.007 GeV-2 < a_c/\\Lambda^2 < 0.011 GeV-2, at 95% confidence level.
Induction of a Radio-Adaptive Response by Low-dose Gamma Irradiation in Mouse Cardiomyocytes
Westby, Christian M.; Seawright, John W.; Wu, Honglu
2011-01-01
One of the most significant occupational hazards to an astronaut is the frequent exposure to radiation. Commonly associated with increased risk for cancer related morbidity and mortality, radiation is also known to increase the risk for cardiovascular related disorders including: pericarditis, hypertension, and heart failure. It is believed that these radiation-induced disorders are a result of abnormal tissue remodeling. It is unknown whether radiation exposure promotes remodeling through fibrotic changes alone or in combination with programmed cell death. Furthermore, it is not known whether it is possible to mitigate the hazardous effects of radiation exposure. As such, we assessed the expression and mechanisms of radiation-induced tissue remodeling and potential radio-adaptive responses of p53-mediated apoptosis and fibrosis pathways along with markers for oxidative stress and inflammation in mice myocardium. 7 week old, male, C57Bl/6 mice were exposed to 6Gy (H) or 5cGy followed 24hr later with 6Gy (LH) 137Cs gamma radiation. Mice were sacrificed and their hearts extirpated 4, 24, or 72hr after final irradiation. Real Time - Polymerase Chain Reaction was used to evaluate target genes. Apoptotic genes Bad and Bax, pro-cell survival genes Bcl2 and Bcl2l2, fibrosis gene Vegfa, and oxidative stress genes Sod2 and GPx4 showed a reduced fold regulation change (Bad,-6.18; Bax,-6.94; Bcl2,-5.09; Bcl2l2,-4.03; Vegfa, -11.84; Sod2,-5.97; GPx4*,-28.72; * = Bonferroni adjusted p-value present compared to 24hr control. These data suggest a general reduction in genetic expression 4hrs after a high dose of gamma radiation. However, pre-exposure to 5cGy gamma radiation appears to facilitate a radio-adaptive response that mitigates the reduction in genetic expression associated with single high-dose gamma radiation exposure. This radio-adaptive response may serve as a potential countermeasure to radiation-induced myocardial remodeling and preserve the cardiovascular health of
System for gamma-gamma formation density logging while drilling
International Nuclear Information System (INIS)
Paske, W.C.
1991-01-01
The patent relates to a system for logging subterranean formations for the determination of formation density by using gamma radiation. Gamma ray source and detection means are disposed within a housing adapted for positioning within a borehole for the emission and detection of gamma rays propagating through earth formations and borehole drilling fluid. The gamma ray detection means comprises first and second gamma radiation sensors geometrically disposed within the housing, the same longitudinal distance from the gamma ray source and diametrically opposed in a common plane. A formation matrix density output signal is produced in proportion to the output signal from each of the gamma ray sensors and in conjunction with certain constants established by the geometrical configuration of the sensors relative to the gamma ray source and the borehole diameter. Formation density is determined without regard to the radial position of the logging probe within the borehole in a measuring while drilling mode. 6 figs
DEFF Research Database (Denmark)
Ek, J; Andersen, G; Urhammer, S A
2001-01-01
This study aimed to investigate if variability in the peroxisome proliferator-activated receptor-gamma coactivator-1 (PGC-1) gene is associated with Type II (non-insulin-dependent) diabetes mellitus.......This study aimed to investigate if variability in the peroxisome proliferator-activated receptor-gamma coactivator-1 (PGC-1) gene is associated with Type II (non-insulin-dependent) diabetes mellitus....
Very high-energy gamma rays from gamma-ray bursts.
Chadwick, Paula M
2007-05-15
Very high-energy (VHE) gamma-ray astronomy has undergone a transformation in the last few years, with telescopes of unprecedented sensitivity having greatly expanded the source catalogue. Such progress makes the detection of a gamma-ray burst at the highest energies much more likely than previously. This paper describes the facilities currently operating and their chances for detecting gamma-ray bursts, and reviews predictions for VHE gamma-ray emission from gamma-ray bursts. Results to date are summarized.
Directory of Open Access Journals (Sweden)
Hosein Norozian
2016-02-01
Full Text Available Background: Hepatitis C virus (HCV is a worldwide health problem, which associated with cirrhosis and hepatocellular carcinoma. Interferon-α and Ribavirin are only acceptable treatment regimen for these patients. These regimen are effective only on 50% of the patients. The aim of this study was to evaluate the response to treatment with interferon gamma gene polymorphism in patients with hepatitis C. Materials and Methods: In this study, a cross - sectional study, response or lack of response to treatment in 78 patients treated with interferon gamma gene polymorphism were studied at Shiraz Namazi Hospital from 2011-2012 . DNA samples extract by salt (salting out and interferon gamma gene polymorphism (+874T/A IFN–gamma was evaluate with ARMS-PCR technique. Data were analyzed using EPI Info2000 and SPSS 16 software (chi-square test. Results: Results showed that 39 patients (50% out of 78 studied patients had TT alleles, 11 patients (1.14% had AA alleles and 28 patients (9.39% had TA alleles. 49 patients (62.82% responded to treatment. TT genotype and allele frequencies between the studied groups showed significant differencey (P=0.002. Conclusion: Interferon gamma is a key cytokine in the immune response against hepatitis C. Polymorphism in the interferon-gamma gene is (+874T/AIFN–gamma One of the most important factors interferes with treatment response in hepatitis C patients.
DEFF Research Database (Denmark)
Pedersen, G.; Brynskov, Jørn
2010-01-01
and functional activity in human colonic epithelium and explored the potential of topical treatment with rosiglitazone (a PPAR gamma ligand) in patients with ulcerative colitis. METHODS: Spontaneous and rosiglitazone-mediated PPAR gamma and adipophillin expression (a gene transcriptionally activated by PPAR...... for 14 days. RESULTS: PPAR gamma expression was fourfold reduced in epithelial cells from inflamed compared with uninflamed mucosa and controls. Adipophillin levels were decreased in parallel. Rosiglitazone induced a concentration-dependent increase in adipophillin levels and restored PPAR gamma activity...... in epithelial cells from inflamed mucosa in vitro. Rosiglitazone enema treatment was well tolerated and reduced the Mayo ulcerative colitis score from 8.9 to 4.3 (P levels in the epithelial cells of the patients, indicating PPAR...
Asmundson, Anna L.; Taber, Alexandria M.; van der Walde, Adella; Lin, Danielle H.; Olson, John S.; Anthony-Cahill, Spencer J.
2009-01-01
For the first time, a circularly permuted human β-globin (cpβ) has been coexpressed with human α-globin in bacterial cells and shown to associate to form α-cpβ hemoglobin in solution. Flash photolysis studies of α-cpβ show markedly biphasic CO and O2 kinetics with the amplitudes for the fast association phases being dominant due the presence of large amounts of high-affinity liganded hemoglobin dimers. Extensive dimerization of liganded but not deoxygenated α-cpβ was observed by gel chromatography. The rate constants for O2 and CO binding to the R state forms of α-cpβ are almost identical to those of native HbA (k′R(CO) ≈ 5.0 μM−1 s−1; k′R(O2) ≈ 50 μM−1 s−1), and the rate of O2 dissociation from fully oxygenated α-cpβ is also very similar to that observed for HbA (kR(O2) ≈ 21–28 s−1). When the equilibrium deoxyHb form of α-cpβ is reacted with CO in rapid mixing experiments, the observed time courses are monophasic and the observed bimolecular association rate constant is ∼1.0 μM−1 s−1, which is intermediate between the R state rate measured in partial photolysis experiments (∼5 μM−1 s−1) and that observed for T state deoxyHbA (k′T(CO) ≈ 0.1 to 0.2 μM−1 s−1). Thus the deoxygenated permutated β subunits generate an intermediate, higher affinity, deoxyHb quaternary state. This conclusion is supported by equilibrium oxygen binding measurements in which α-cpβ exhibits a P50 of ∼1.5 mmHg and a low n-value (∼1.3) at pH 7, 20 °C, compared to 8.5 mmHg and n ≈ 2.8 for native HbA under identical, dilute conditions. PMID:19397368
Phylogeny of Echinoderm Hemoglobins.
Directory of Open Access Journals (Sweden)
Ana B Christensen
Full Text Available Recent genomic information has revealed that neuroglobin and cytoglobin are the two principal lineages of vertebrate hemoglobins, with the latter encompassing the familiar myoglobin and α-globin/β-globin tetramer hemoglobin, and several minor groups. In contrast, very little is known about hemoglobins in echinoderms, a phylum of exclusively marine organisms closely related to vertebrates, beyond the presence of coelomic hemoglobins in sea cucumbers and brittle stars. We identified about 50 hemoglobins in sea urchin, starfish and sea cucumber genomes and transcriptomes, and used Bayesian inference to carry out a molecular phylogenetic analysis of their relationship to vertebrate sequences, specifically, to assess the hypothesis that the neuroglobin and cytoglobin lineages are also present in echinoderms.The genome of the sea urchin Strongylocentrotus purpuratus encodes several hemoglobins, including a unique chimeric 14-domain globin, 2 androglobin isoforms and a unique single androglobin domain protein. Other strongylocentrotid genomes appear to have similar repertoires of globin genes. We carried out molecular phylogenetic analyses of 52 hemoglobins identified in sea urchin, brittle star and sea cucumber genomes and transcriptomes, using different multiple sequence alignment methods coupled with Bayesian and maximum likelihood approaches. The results demonstrate that there are two major globin lineages in echinoderms, which are related to the vertebrate neuroglobin and cytoglobin lineages. Furthermore, the brittle star and sea cucumber coelomic hemoglobins appear to have evolved independently from the cytoglobin lineage, similar to the evolution of erythroid oxygen binding globins in cyclostomes and vertebrates.The presence of echinoderm globins related to the vertebrate neuroglobin and cytoglobin lineages suggests that the split between neuroglobins and cytoglobins occurred in the deuterostome ancestor shared by echinoderms and vertebrates.
Cross-Section of Hadron Production in $\\gamma\\gamma$ Collisions at LEP
Acciarri, M; Aguilar-Benítez, M; Ahlen, S P; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alverson, G; Alviggi, M G; Ambrosi, G; Anderhub, H; Andreev, V P; Angelescu, T; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Baksay, L; Banerjee, S; Banerjee, Sw; Banicz, K; Barczyk, A; Barillère, R; Barone, L; Bartalini, P; Baschirotto, A; Basile, M; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Bhattacharya, S; Biasini, M; Biland, A; Bilei, G M; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böck, R K; Böhm, A; Boldizsar, L; Borgia, B; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brigljevic, V; Brock, I C; Buffini, A; Buijs, A; Burger, J D; Burger, W J; Busenitz, J K; Button, A M; Cai, X D; Campanelli, M; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Castellini, G; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada-Canales, M; Cesaroni, F; Chamizo-Llatas, M; Chang, Y H; Chaturvedi, U K; Chekanov, S V; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chéreau, X J; Chiefari, G; Chien, C Y; Cifarelli, Luisa; Cindolo, F; Civinini, C; Clare, I; Clare, R; Cohn, H O; Coignet, G; Colijn, A P; Colino, N; Commichau, V; Costantini, S; Cotorobai, F; de la Cruz, B; Csilling, Akos; Dai, T S; D'Alessandro, R; De Asmundis, R; Degré, A; Deiters, K; Della Volpe, D; Denes, P; De Notaristefani, F; DiBitonto, Daryl; Diemoz, M; Van Dierendonck, D N; Di Lodovico, F; Dionisi, C; Dittmar, Michael; Dominguez, A; Doria, A; Dova, M T; Duchesneau, D; Duinker, P; Durán, I; Dutta, S; Easo, S; Efremenko, Yu V; El-Mamouni, H; Engler, A; Eppling, F J; Erné, F C; Ernenwein, J P; Extermann, Pierre; Fabre, M; Faccini, R; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, Marta; Fenyi, B; Ferguson, T; Ferroni, F; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Fisk, I; Forconi, G; Fredj, L; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gau, S S; Gentile, S; Gheordanescu, N; Giagu, S; Goldfarb, S; Goldstein, J; Gong, Z F; Gougas, Andreas; Gratta, Giorgio; Grünewald, M W; Gupta, V K; Gurtu, A; Gutay, L J; Hartmann, B; Hasan, A; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Van Hoek, W C; Hofer, H; Hong, S J; Hoorani, H; Hou, S R; Hu, G; Innocente, Vincenzo; Jenkes, K; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Kasser, A; Khan, R A; Kamrad, D; Kamyshkov, Yu A; Kapustinsky, J S; Karyotakis, Yu; Kaur, M; Kienzle-Focacci, M N; Kim, D; Kim, D H; Kim, J K; Kim, S C; Kim, Y G; Kinnison, W W; Kirkby, A; Kirkby, D; Kirkby, Jasper; Kiss, D; Kittel, E W; Klimentov, A; König, A C; Kopp, A; Korolko, I; Koutsenko, V F; Krämer, R W; Krenz, W; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Lapoint, C; Lassila-Perini, K M; Laurikainen, P; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Le Goff, J M; Leiste, R; Leonardi, E; Levchenko, P M; Li Chuan; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lu, W; Lü, Y S; Lübelsmeyer, K; Luci, C; Luckey, D; Luminari, L; Lustermann, W; Ma Wen Gan; Maity, M; Majumder, G; Malgeri, L; Malinin, A; Maña, C; Mangeol, D J J; Mangla, S; Marchesini, P A; Marin, A; Martin, J P; Marzano, F; Massaro, G G G; McNally, D; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Von der Mey, M; Mi, Y; Mihul, A; Van Mil, A J W; Mirabelli, G; Mnich, J; Molnár, P; Monteleoni, B; Moore, R; Morganti, S; Moulik, T; Mount, R; Müller, S; Muheim, F; Muijs, A J M; Nahn, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Niessen, T; Nippe, A; Nisati, A; Nowak, H; Oh, Yu D; Opitz, H; Organtini, G; Ostonen, R; Palomares, C; Pandoulas, D; Paoletti, S; Paolucci, P; Park, H K; Park, I H; Pascale, G; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Peach, D; Pei, Y J; Pensotti, S; Perret-Gallix, D; Petersen, B; Petrak, S; Pevsner, A; Piccolo, D; Pieri, M; Pinto, J C; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Postema, H; Produit, N; Prokofev, D; Prokofiev, D O; Rahal-Callot, G; Raja, N; Rancoita, P G; Rattaggi, M; Raven, G; Razis, P A; Read, K; Ren, D; Rescigno, M; Reucroft, S; Van Rhee, T; Riemann, S; Riles, K; Robohm, A; Rodin, J; Roe, B P; Romero, L; Rosier-Lees, S; Rosselet, P; Van Rossum, W; Roth, S; Rubio, Juan Antonio; Ruschmeier, D; Rykaczewski, H; Salicio, J; Sánchez, E; Sanders, M P; Sarakinos, M E; Sarkar, S; Sassowsky, M; Schäfer, C; Shchegelskii, V; Schmidt-Kärst, S; Schmitz, D; Schmitz, P; Scholz, N; Schopper, Herwig Franz; Schotanus, D J; Schwenke, J; Schwering, G; Sciacca, C; Sciarrino, D; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shukla, J; Shumilov, E; Shvorob, A V; Siedenburg, T; Son, D; Sopczak, André; Smith, B; Spillantini, P; Steuer, M; Stickland, D P; Stone, A; Stone, H; Stoyanov, B; Strässner, A; Strauch, K; Sudhakar, K; Sultanov, G G; Sun, L Z; Susinno, G F; Suter, H; Swain, J D; Tang, X W; Tauscher, Ludwig; Taylor, L; Ting, Samuel C C; Ting, S M; Tonutti, M; Tonwar, S C; Tóth, J; Tully, C; Tuchscherer, H; Tung, K L; Uchida, Y; Ulbricht, J; Uwer, U; Valente, E; Van de Walle, R T; Vesztergombi, G; Vetlitskii, I; Viertel, Gert M; Vivargent, M; Völkert, R; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Vorvolakos, A; Wadhwa, M; Wallraff, W; Wang, J C; Wang, X L; Wang, Z M; Weber, A; Wittgenstein, F; Wu, S X; Wynhoff, S; Xu, J; Xu, Z Z; Yang, B Z; Yang, C G; Yao, X Y; Ye, J B; Yeh, S C; You, J M; Zalite, A; Zalite, Yu; Zemp, P; Zeng, Y; Zhang, Z; Zhang, Z P; Zhou, B; Zhu, G Y; Zhu, R Y; Zichichi, Antonino; Ziegler, F
1997-01-01
The reaction $\\mathrm{e}^{+} \\mathrm{e}^{-} \\rightarrow \\mathrm{e}^{+} \\mathrm{e}^{-} \\gamma ^{*} \\gamma ^{*} \\rightarrow \\mathrm{e}^{+} \\mathrm{e}^{-} $ {\\sl hadrons} is analysed using data collected by the L3 detector during the LEP runs at $\\sqrt {s}$ = 130-140 GeV and $\\sqrt {s}$ = 161 GeV. The cross sections $\\sigma(\\mathrm{e}^{+} \\mathrm{e}^{-} \\rightarrow \\mathrm{e}^{+} \\mathrm{e}^{-} $ {\\sl hadrons}) and $\\sigma (\\gamma\\gamma \\rightarrow $ {\\sl hadrons}) are measured in the interval 5 $\\leq W_{\\gamma\\gamma} \\leq$ 75 GeV. The energy dependence of the $\\sigma (\\gamma\\gamma \\rightarrow $ {\\sl hadrons}) cross section is consistent with the universal Regge behaviour of total hadronic cross sections. %\\end{abstract}
Qi, Wencai; Zhang, Liang; Wang, Lin; Xu, Hangbo; Jin, Qingsheng; Jiao, Zhen
2015-05-01
Heavy metals are important environmental pollutants with negative impact on plant growth and development. To investigate the physiological and molecular mechanisms of heavy metal stress mitigated by low-dose gamma irradiation, the dry seeds of Arabidopsis thaliana were exposed to a Cobalt-60 gamma source at doses ranging from 25 to 150Gy before being subjected to 75µM CdCl2 or 500µM Pb(NO3)2. Then, the growth parameters, and physiological and molecular changes were determined in response to gamma irradiation. Our results showed that 50-Gy gamma irradiation gave maximal beneficial effects on the germination index and root length in response to cadmium/lead stress in Arabidopsis seedlings. The hydrogen peroxide and malondialdehyde contents in seedlings irradiated with 50-Gy gamma rays under stress were significantly lower than those of controls. The antioxidant enzyme activities and proline levels in the irradiated seedlings were significantly increased compared with the controls. Furthermore, a transcriptional expression analysis of selected genes revealed that some components of heavy metal detoxification were stimulated by low-dose gamma irradiation under cadmium/lead stress. Our results suggest that low-dose gamma irradiation alleviates heavy metal stress, probably by modulating the physiological responses and gene expression levels related to heavy metal resistance in Arabidopsis seedlings. Copyright © 2015 Elsevier Inc. All rights reserved.
Improved amylose content of rice (IR72) induced through gamma radiation
International Nuclear Information System (INIS)
Barrida, Adelaida C.; Rivera, Faye G.; Manrique, Mary Jayne C.; Dimaano, Arvin O.; Costimiano, Eduardo C.
2015-01-01
In general grain quality and quality preferences vary across rice growing countries and regions. Filipinos preferres translucent, well milled, long grain rice with aroma and minimal broken grains which is soft after cooling. The amylose content of rice starch is a major eating quality factor. The aim of this study is to develop rice mutants with good eating quality and low to intermediate amylose content through induced mutation using gamma radiation. Low to intermediate amylose content in rice were identified and selected among the advance generation lines irradiated with 200 and 300Gy dose of gamma radiation. Screening was done using qualitative method (Iodine staining method). Selected lines were analyzed quantitatively, to determine the percent amylose content. Percent amylose were group to several categories where; 0-6% is waxy, 6-12% is very low, 12-18% is low, 18-24% is intermediate and >25% is high. Results were further confirmed using molecular marker technique by looking at the waxy gene which code for granule bound starch synthase I (GBSSI) and controls amylose content in rice. Among the 30 lines selcted and anaylzes, 2 lines were confirmed to have a gene base mutation with a low to intermediate amylose content. Thus, induced mutation using gamma radiation has successfully improved amylose content in rice (IR72). (author)
External gamma irradiation-induced effects in early-life stages of zebrafish, Danio rerio
International Nuclear Information System (INIS)
Gagnaire, B.; Cavalié, I.; Pereira, S.; Floriani, M.; Dubourg, N.; Camilleri, V.; Adam-Guillermin, C.
2015-01-01
Highlights: • The present study aimed to evaluate the effects of gamma rays on zebrafish larvae. • Different techniques were used: gene expression, biochemistry, microscopy and macroscopical observations. • The results showed that gamma irradiation can alter embryo-larval development at several levels of organization. - Abstract: In the general context of validation of tools useful for the characterization of ecological risk linked to ionizing radiation, the effects of an external gamma irradiation were studied in zebrafish larvae irradiated for 96 h with two dose rates: 0.8 mGy/d, which is close to the level recommended to protect ecosystems from adverse effects of ionizing radiation (0.24 mGy/d) and a higher dose rate of 570 mGy/d. Several endpoints were investigated, such as mortality, hatching, and some parameters of embryo-larval development, immunotoxicity, apoptosis, genotoxicity, neurotoxicity and histological alterations. Results showed that an exposure to gamma rays induced an acceleration of hatching for both doses and a decrease of yolk bag diameter for the highest dose, which could indicate an increase of global metabolism. AChE activity decreased with the low dose rate of gamma irradiation and alterations were also shown in muscles of irradiated larvae. These results suggest that gamma irradiation can induce damages on larval neurotransmission, which could have repercussions on locomotion. DNA damages, basal ROS production and apoptosis were also induced by irradiation, while ROS stimulation index and EROD biotransformation activity were decreased and gene expression of acetylcholinesterase, choline acetyltransferase, cytochrome p450 and myeloperoxidase increased. These results showed that ionizing radiation induced an oxidative stress conducting to DNA damages. This study characterized further the modes of action of ionizing radiation in fish.
External gamma irradiation-induced effects in early-life stages of zebrafish, Danio rerio
Energy Technology Data Exchange (ETDEWEB)
Gagnaire, B., E-mail: beatrice.gagnaire@irsn.fr [Institut de Radioprotection et de Sureté Nucléaire (IRSN), PRP-ENV/SERIS/LECO, Cadarache, Saint-Paul-lez-Durance 13115 (France); Cavalié, I. [Institut de Radioprotection et de Sureté Nucléaire (IRSN), PRP-ENV/SERIS/LECO, Cadarache, Saint-Paul-lez-Durance 13115 (France); Pereira, S. [Neolys Diagnostics, Lyon 69373 (France); Floriani, M.; Dubourg, N.; Camilleri, V.; Adam-Guillermin, C. [Institut de Radioprotection et de Sureté Nucléaire (IRSN), PRP-ENV/SERIS/LECO, Cadarache, Saint-Paul-lez-Durance 13115 (France)
2015-12-15
Highlights: • The present study aimed to evaluate the effects of gamma rays on zebrafish larvae. • Different techniques were used: gene expression, biochemistry, microscopy and macroscopical observations. • The results showed that gamma irradiation can alter embryo-larval development at several levels of organization. - Abstract: In the general context of validation of tools useful for the characterization of ecological risk linked to ionizing radiation, the effects of an external gamma irradiation were studied in zebrafish larvae irradiated for 96 h with two dose rates: 0.8 mGy/d, which is close to the level recommended to protect ecosystems from adverse effects of ionizing radiation (0.24 mGy/d) and a higher dose rate of 570 mGy/d. Several endpoints were investigated, such as mortality, hatching, and some parameters of embryo-larval development, immunotoxicity, apoptosis, genotoxicity, neurotoxicity and histological alterations. Results showed that an exposure to gamma rays induced an acceleration of hatching for both doses and a decrease of yolk bag diameter for the highest dose, which could indicate an increase of global metabolism. AChE activity decreased with the low dose rate of gamma irradiation and alterations were also shown in muscles of irradiated larvae. These results suggest that gamma irradiation can induce damages on larval neurotransmission, which could have repercussions on locomotion. DNA damages, basal ROS production and apoptosis were also induced by irradiation, while ROS stimulation index and EROD biotransformation activity were decreased and gene expression of acetylcholinesterase, choline acetyltransferase, cytochrome p450 and myeloperoxidase increased. These results showed that ionizing radiation induced an oxidative stress conducting to DNA damages. This study characterized further the modes of action of ionizing radiation in fish.
... News Physician Resources Professions Site Index A-Z Gamma Knife Gamma Knife® is a radiation therapy that uses computerized ... If you're scheduled for radiation therapy using Gamma Knife®, a treatment team consisting of a radiation ...
International Nuclear Information System (INIS)
Majorowicz, J.
1973-01-01
In this article, the author presents the possibility of a complex utilization of radiometric logging methods, neutron-gamma profiling and gamma-gamma density logging for determining percentage of iron and establishing geophysical possibilities of identifying zones of economically profitable ores in borehole profiles. Figures present the correlations between indices of neutron-gamma and gamma-gamma logging methods and the percentage of iron, as well as the correlation of neutron-gamma and gamma-gamma indices for zones minerallized with iron ores. The article presents the correlational analyses of the results: the correlational coefficients are given as well as total error in determining iron content on the basis of each of the methods described. Next, a multidimensional statistical analysis is carried out on the results obtained. On the basis of the two-dimensional correlational coefficients calculated and the average standard deviation, an equation of linear regression was formulated, simultaneously involving three parameters - the indices of neutron-gamma and gamma-gamma logging and the percentage of iron. The multiple correlational coefficient obtained markedly exceeds the two-dimentional correlation coefficient (r=0.974>rsub(xz)>rsub(yz)>rsub(xy)). The given method of utilizing multidimensional statistics in borehole geophysics for identifying iron ores is an efficient one. On the basis of several relationships among independent variables which are less obvious (smaller values of correlational coefficient), it is possible to obtain a single distinct relationship involving all variables simultaneously. (author)
International Nuclear Information System (INIS)
Peterson, V.M.; Adamovicz, J.J.; Madonna, G.S.; Gause, W.C.; Elliott, T.B.; Moore, M.M.; Ledney, G.D.; Jackson, W.E. III
1994-01-01
Prompt, cytokine-mediated restoration of hematopoiesis is a prerequisite for survival after irradiation. Therapy with biologic response modifiers (BRMs), such as LPS, 3D monophosphoryl lipid A (MPL), and synthetic trehalose dicrynomycolate (S-TDCM) presumably accelerates hematopoietic recovery after irradiation are poorly defined. One hour after sublethal (7.0 Gy) 60 Co gamma irradiation, B6D2F1/J female mice received a single i.p. injection of LPS, MPL, S-TDCM, an extract from Serratia marcescens (Sm-BRM), or Tween 80 in saline (TS). Five hours later, a quantitative reverse transcription-PCR assay demonstrated marked splenic gene expression for IL-1β, IL-3, IL-6, and granulocyte-CSF (G-CSF). Enhanced gene expression for TNF-α, macrophage-CSF (M-CSF), and stem cell factor (SCF) was not detected. Injection of any BRM further enhanced cytokine gene expression and plasma levels of CSF activity within 24 h after irradiation and hastened bone marrow recovery. Mice injected with S-TDCM or Sm-BRM sustained expression of the IL-6 gene for at least 24 h after irradiation. Sm-BRM-treated mice exhibited greater gene expression for IL-1β, IL-3, TNF-α, and G-CSF at day 1 than any other BRM. When challenged with 2 LD 50/30 of Klebsiella pneumoniae 4 days after irradiation, 100% of Sm-BRM-treated mice and 70% of S-TDCM-treated mice survived, whereas ≤30% of mice treated with LPS, MPL, or TS survived. Thus, sublethal irradiation induces transient, splenic cytokine gene expression that can be differentially amplified and prolonged by BRMs. BRMs that sustained and/or enhanced irradiation-induced expression of specific cytokine genes improved survival after experimental infection. 67 refs., 7 figs., 1 tab
P53 suppresses expression of the 14-3-3gamma oncogene
Directory of Open Access Journals (Sweden)
Qi Wenqing
2011-08-01
Full Text Available Abstract Background 14-3-3 proteins are a family of highly conserved proteins that are involved in a wide range of cellular processes. Recent evidence indicates that some of these proteins have oncogenic activity and that they may promote tumorigenesis. We previously showed that one of the 14-3-3 family members, 14-3-3gamma, is over expressed in human lung cancers and that it can induce transformation of rodent cells in vitro. Methods qRTPCR and Western blot analysis were performed to examine 14-3-3gamma expression in non-small cell lung cancers (NSCLC. Gene copy number was analyzed by qPCR. P53 mutations were detected by direct sequencing and also by western blot. CHIP and yeast one hybrid assays were used to detect p53 binding to 14-3-3gamma promoter. Results Quantitative rtPCR results showed that the expression level of 14-3-3gamma was elevated in the majority of NSCLC that we examined which was also consistent with protein expression. Further analysis of the expression pattern of 14-3-3gamma in lung tumors showed a correlation with p53 mutations suggesting that p53 might suppress 14-3-3 gamma expression. Analysis of the gamma promoter sequence revealed the presence of a p53 consensus binding motif and in vitro assays demonstrated that wild-type p53 bound to this motif when activated by ionizing radiation. Deletion of the p53 binding motif eliminated p53's ability to suppress 14-3-3gamma expression. Conclusion Increased expression of 14-3-3gamma in lung cancer coincides with loss of functional p53. Hence, we propose that 14-3-3gamma's oncogenic activities cooperate with loss of p53 to promote lung tumorigenesis.
Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu
2008-08-01
The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.
The high intensity {gamma}-ray source (HI{gamma}S) and recent results
Energy Technology Data Exchange (ETDEWEB)
Tonchev, A.P. [Duke University and TUNL, Triangle University Nuclear Laboratory, P.O. Box 90308, Durham, NC 27708 0308 (United States)]. E-mail: tonchev@tunl.duke.edu; Boswell, M. [University of North Carolina at Chapel Hill and TUNL, Chapel Hill, NC 27599 (United States); Howell, C.R. [Duke University and TUNL, Triangle University Nuclear Laboratory, P.O. Box 90308, Durham, NC 27708 0308 (United States); Karwowski, H.J. [University of North Carolina at Chapel Hill and TUNL, Chapel Hill, NC 27599 (United States); Kelley, J.H. [North Carolina State University and TUNL, Raleigh, NC 27695 (United States); Tornow, W. [Duke University and TUNL, Triangle University Nuclear Laboratory, P.O. Box 90308, Durham, NC 27708 0308 (United States); Wu, Y.K. [Duke University and Duke Free Electron Laser Laboratory, Durham, NC 27708-0319 (United States)
2005-12-15
The high intensity {gamma}-ray source (HI{gamma}S) utilizes intra-cavity backscattering of free electron laser photons from the Duke electron storage ring to produce a unique monoenergetic beam of high-flux {gamma}-rays with high polarization and selectable energy resolution. At present, {gamma}-ray beams with energies from 2 to 58 MeV are available with intensities as high as 10{sup 5}-5 x 10{sup 6} {gamma}/s, energy spreads of 3% or better, and nearly 100% linear polarization. The quality and intensity of the {gamma}-ray beams at HI{gamma}S are responsible for the unprecedented performance of this facility in a broad range of research programs in nuclear structure, nuclear astrophysics and nuclear applications. Recent results from excitation of isomeric states in ({gamma}, n) reactions and parity assignments of dipole states determined via the ({gamma}, {gamma}') reaction are presented.
Directory of Open Access Journals (Sweden)
Raichel Jacob
2016-05-01
Conclusion: PPARγ2 gene Pro12Ala polymorphism was supposed to be susceptible genes in PCOS. The present study demonstrated that there is a statistical difference between the distributions of PPAR gamma Pro12Ala polymorphism in South Indian Population.
International Nuclear Information System (INIS)
Morris, T.; Marashi, F.; Weber, L.; Hickey, E.; Greenspan, D.; Bonner, J.; Stein, J.; Stein, G.
1986-01-01
Two lines of evidence derived from fusion gene constructs indicate that sequences residing in the 5'-nontranslated region of a cell cycle-dependent human H3 histone mRNA are involved in the selective destabilization that occurs when DNA synthesis is terminated. The experimental approach was to construct chimeric genes in which fragments of the mRNA coding regions of the H3 histone gene were fused with fragments of genes not expressed in a cell cycle-dependent manner. After transfection in HeLa S3 cells with the recombinant plasmids, levels of fusion mRNAs were determined by S1 nuclease analysis prior to and following DNA synthesis inhibition. When the first 20 nucleotides of an H3 histone mRNA leader were replaced with 89 nucleotides of the leader from a Drosophila heat-shock (hsp70) mRNA, the fusion transcript remained stable during inhibition of DNA synthesis, in contrast to the rapid destabilization of the endogenous histone mRNA in these cells. In a reciprocal experiment, a histone-globin fusion gene was constructed that produced a transcript with the initial 20 nucleotides of the H3 histone mRNA substituted for the human β-globin mRNA leader. In HeLa cells treated with inhibitors of DNA synthesis and/or protein synthesis, cellular levels of this histone-globin fusion mRNA appeared to be regulated in a manner similar to endogenous histone mRNA levels. These results suggest that the first 20 nucleotides of the leader are sufficient to couple histone mRNA stability with DNA replication
Zakharov, I A; Kasinova, G V; Koval'tsova, S V
1983-01-01
The effect of UV- and gamma-irradiation on the survival and intragenic mitotic recombination (gene conversion) of 5 radiosensitive mutants was studied in comparison with the wild type. The level of spontaneous conversion was similar for RAD, rad2 and rad15, mutations xrs2 and xrs4 increasing and rad54 significantly decreasing it. The frequency of conversion induced by UV-light was greater in rad2, rad15 and xrs2 mutants and lower in xrs4, as compared to RAD. Gamma-irradiation caused induction of gene conversion with an equal frequency in RAD, rad2, rad15. Xrs2 and xrs4 mutations slightly decreased gamma-induced conversion. In rad54 mutant, UV-and gamma-induced conversion was practically absent. In the wild type yeast, a diploid strain is more resistant than a haploid, whereas in rad54 a diploid strain has the same or an increased sensitivity, as compared to a haploid strain (the "inverse ploidy effect"). This effect and also the block of induced mitotic recombination caused by rad54 indicate the presence in the yeast Saccharomyces cerevisiae of repair pathways of UV- and gamma-induced damages acting in diploid cells and realised by recombination. The data obtained as a result of many years' investigation of genetic effects in radiosensitive mutants of yeast are summarised and considered.
Chen, Xin; Song, In-Hwan; Dennis, James E; Greenfield, Edward M
2007-05-01
PKI gamma knockdown substantially extended the anti-apoptotic effects of PTH and beta-adrenergic agonists, whereas PKI gamma overexpression decreased these effects. Therefore, inhibition of PKI gamma activity may provide a useful co-therapy in combination with intermittent PTH or beta-adrenergic agonists for bone loss in conditions such as osteoporosis. PTH has both catabolic and anabolic effects on bone, which are primarily caused by cAMP/protein kinase A (PKA) signaling and regulation of gene expression. We previously showed that protein kinase inhibitor-gamma (PKI gamma) is required for efficient termination of cAMP/PKA signaling and gene expression after stimulation with PTH or beta-adrenergic agonists. Inhibition of osteoblast apoptosis is thought to be an important, but transient, mechanism partly responsible for the anabolic effects of intermittent PTH. Therefore, we hypothesized that endogenous PKI gamma also terminates the anti-apoptotic effect of PTH. PKI gamma knockdown by antisense transfection or siRNA was used to examine the ability of endogenous PKI gamma to modulate the anti-apoptotic effects of PTH and beta-adrenergic agonists in ROS 17/2.8 cells. Knockdown of PKI gamma substantially extended the anti-apoptotic effects of PTH, whether apoptosis was induced by etoposide or dexamethasone. In contrast, overexpression of PKI gamma decreased the anti-apoptotic effect of PTH pretreatment. This study is also the first demonstration that beta-adrenergic agonists mimic the anti-apoptotic effects of PTH in osteoblasts. Moreover, PKI gamma knockdown also substantially extended this anti-apoptotic effect of beta-adrenergic agonists. Taken together, these results show that endogenous PKI gamma limits the duration of the anti-apoptotic effects of cAMP/PKA signaling in osteoblasts. Because significant individual variability exists in the anabolic responses to PTH therapy in current clinical treatment of osteoporosis, inhibition of PKI gamma activity may provide a
Study of {gamma}'s in Naiade; Etude des gamma de Naiade
Energy Technology Data Exchange (ETDEWEB)
Millot, J P; Rastoin, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1958-07-01
Following a study of the gamma sources, the flux of gamma of different energies in the swimming pool is investigated. The biological dose can thus be obtained by calculation, and compared with the results given by photographic plates. The influence of photoneutrons is estimated by calculation, and research is being carried out on their influence on the thermal neutron flux curve on the axis of the uranium plate, with the plate emitting neutrons and with the plate protected by boral. (author) [French] Apres l'etude des sources de gamma, l'on etudie le flux de gamma de differentes energies dans la piscine. La dose biologique peut etre obtenue ainsi par le calcul et comparee avec les resultats donnes par les plaques photographiques. L'influence des photoneutrons est estimee par le calcul et l'on recherche leur influence sur la courbe de flux de neutrons thermiques sur l'axe de la plaque d'uranium, la plaque emettant des neutrons et la plaque protegee par du boral. (auteur)
Measurement of K{sup {+-}}{yields}{pi}{sup {+-}}{gamma}{gamma} decays
Energy Technology Data Exchange (ETDEWEB)
Morales Morales, Cristina
2009-07-21
The goal of this thesis was an experimental test of an effective theory of strong interactions at low energy, called Chiral Perturbation Theory (ChPT). Weak decays of kaon mesons provide such a test. In particular, K{sup {+-}} {yields} {pi}{sup {+-}}{gamma}{gamma} decays are interesting because there is no tree-level O(p{sup 2}) contribution in ChPT, and the leading contributions start at O(p{sup 4}). At this order, these decays include one undetermined coupling constant, c. Both the branching ratio and the spectrum shape of K{sup {+-}} {yields} {pi}{sup {+-}}{gamma}{gamma} decays are sensitive to this parameter. O(p{sup 6}) contributions to K{sup {+-}} {yields} {pi}{sup {+-}}{gamma}{gamma} ChPT predict a 30-40% increase in the branching ratio. From the measurement of the branching ratio and spectrum shape of K{sup {+-}} {yields} {pi}{sup {+-}}{gamma}{gamma} decays, it is possible to determine a model dependent value of c and also to examine whether the O(p{sup 6}) corrections are necessary and enough to explain the rate. About 40% of the data collected in the year 2003 by the NA48/2 experiment have been analyzed and 908 K{sup {+-}} {yields} {pi}{sup {+-}}{gamma}{gamma} candidates with about 8% background contamination have been selected in the region with z=m{sup 2}{sub {gamma}}{sub {gamma}}/m{sub K}{sup 2}{>=}0.2. Using 5,750,121 selected K{sup {+-}} {yields} {pi}{sup {+-}}{pi}{sup 0} decays as normalization channel, a model independent differential branching ratio of K{sup {+-}} {yields} {pi}{sup {+-}}{gamma}{gamma} has been measured to be: BR(K{sup {+-}} {yields} {pi}{sup {+-}}{gamma}{gamma}, z{>=}0.2)=(1.018{+-}0.038{sub stat}{+-}0.039{sub syst}{+-}0.004{sub ext}).10{sup -6}. From the fit to the O(p{sup 6}) ChPT prediction of the measured branching ratio and the shape of the z-spectrum, a value of c=1.54{+-}0.15{sub stat}{+-}0.18{sub syst} has been extracted. Using the measured c value and the O(p{sup 6}) ChPT prediction, the branching ratio for z=m{sup 2}{sub
Phenotype-genotype correlation in β-thalassemia
Directory of Open Access Journals (Sweden)
R. Galanello
2011-12-01
Full Text Available The clinical manifestations of β-thalassemia are extremely heterogeneous, ranging from severe transfusion-dependent anemia, to the mild non transfusion dependent thalassemia intermedia and to the asymptomatic carrier state. The remarkable phenotypic variability is primary due to variations in the different globin genes (primary gene modifiers. The main pathophysiological determinant of the severity of β-thalassemia syndromes is the extent of a/non-a globin chain imbalance. Therefore, any factor capable of reducing the globin chain imbalance may have an ameliorating effect on the clinical picture. The most common mechanisms responsible of the amelioration of the phenotype are mild or silent β thalassemia alleles, coinheritance of a thalassemia, or of genetic determinants associated with increased g globin chain production. Rarely, other complex mechanisms including dominantly inherited β thalassemia, somatic deletion of β globin gene and coinheritance of extra a globin genes with heterozygous β thalassemia have been reported. In addition to the variability of the phenotype resulting from primary gene modifiers, other genetic factors (secondary gene modifiers, mapping outside the β and a globin cluster, may influence the disease complications. Among these factors the ones best so far defined are those affecting bilirubin, iron and bone metabolism. However, the new methods of DNA analysis (i.e. GWAS and related methods are expect expand the number of genes or gene variants involved in the phenotypic variability and in the response to treatment of β thalassemia. 从严重的输液依赖型贫血症到轻度非输液依赖性中间型地中海贫血,再到无症状携带状态,β地中海贫血的临床表现极度异源性。 由于不同珠蛋白基因(初级基因修饰因子)发生各种变异,主要表现为显著的表型变异。
Directory of Open Access Journals (Sweden)
Anil K Singh
2010-03-01
Full Text Available Resistin is a cysteine rich protein, mainly expressed and secreted by circulating human mononuclear cells. While several factors responsible for transcription of mouse resistin gene have been identified, not much is known about the factors responsible for the differential expression of human resistin.We show that the minimal promoter of human resistin lies within approximately 80 bp sequence upstream of the transcriptional start site (-240 whereas binding sites for cRel, CCAAT enhancer binding protein alpha (C/EBP-alpha, activating transcription factor 2 (ATF-2 and activator protein 1 (AP-1 transcription factors, important for induced expression, are present within sequences up to -619. Specificity Protein 1(Sp1 binding site (-276 to -295 is also present and an interaction of Sp1 with peroxisome proliferator activating receptor gamma (PPARgamma is necessary for constitutive expression in U937 cells. Indeed co-immunoprecipitation assay demonstrated a direct physical interaction of Sp1 with PPARgamma in whole cell extracts of U937 cells. Phorbol myristate acetate (PMA upregulated the expression of resistin mRNA in U937 cells by increasing the recruitment of Sp1, ATF-2 and PPARgamma on the resistin gene promoter. Furthermore, PMA stimulation of U937 cells resulted in the disruption of Sp1 and PPARgamma interaction. Chromatin immunoprecipitation (ChIP assay confirmed the recruitment of transcription factors phospho ATF-2, Sp1, Sp3, PPARgamma, chromatin modifier histone deacetylase 1 (HDAC1 and the acetylated form of histone H3 but not cRel, C/EBP-alpha and phospho c-Jun during resistin gene transcription.Our findings suggest a complex interplay of Sp1 and PPARgamma along with other transcription factors that drives the expression of resistin in human monocytic U937 cells.
Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan
2015-01-01
Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a mutation at codon 91 of α1-globin gene whereas Hb E is a common β-globin chain variant among Southeast Asian population. We report two hitherto undescribed conditions of Hb Grey Lynn found in Thai individuals. The study was done on two unrelated Thai subjects. Hematological parameters were recorded and Hb analysis was carried out using automated Hb analyzers. Mutations were identified by DNA analysis. Hematological features of the patients were compared with those of various forms of Hb Grey Lynn documented previously. Hb and DNA analyses identified a heterozygous Hb Grey Lynn in one patient and a double heterozygous Hb Grey Lynn and Hb E with α(+)-thalassemia in another. Interaction of α(Grey Lynn) with β(E) chains leads to the formation of a new Hb variant, namely the Hb Grey Lynn E (α(GL)2β(E)2), detectable by liquid chromatography (10.3%) but masked by Hb E on capillary electrophoresis. Interaction of these multiple globin gene defects could lead to complex hemoglobinopathies requiring combined analysis with multiple Hb analyzers followed by DNA testing to provide accurate diagnosis of the cases.
The tyrosine B10 hydroxyl is crucial for oxygen avidity of Ascaris hemoglobin.
Kloek, A P; Yang, J; Mathews, F S; Frieden, C; Goldberg, D E
1994-01-28
The parasitic nematode Ascaris suum has a gene encoding a two-domain hemoglobin with remarkable oxygen avidity. The strong interaction with oxygen is a consequence of a particularly slow oxygen off-rate. The single polypeptide chain consists of two domains, each of which can be expressed separately in Escherichia coli as a globin-like protein exhibiting oxygen binding characteristics comparable with the native molecule. Site-directed mutagenesis was performed on the gene segment encoding domain one. The E7 position, involved in forming a hydrogen bond with the liganded oxygen in vertebrate globins, is a glutamine in both Ascaris domains. Conversion of this residue to leucine or alanine produced a hemoglobin variant with an oxygen off-rate 5- or 60-fold faster than that of unaltered domain one. Replacement of the tyrosine B10 with either phenylalanine or leucine (as found in vertebrate globins) yielded hemoglobin mutants with oxygen off-rates 280- or 570-fold faster, approaching rates found with vertebrate myoglobins. The data suggest that the distal glutamine hydrogen bonds with the liganded oxygen and that the tyrosine B10 hydroxyl contributes an additional hydrogen bond that appears substantially responsible for the extreme oxygen avidity of Ascaris hemoglobin.
Normal uniform mixture differential gene expression detection for cDNA microarrays
Directory of Open Access Journals (Sweden)
Raftery Adrian E
2005-07-01
Full Text Available Abstract Background One of the primary tasks in analysing gene expression data is finding genes that are differentially expressed in different samples. Multiple testing issues due to the thousands of tests run make some of the more popular methods for doing this problematic. Results We propose a simple method, Normal Uniform Differential Gene Expression (NUDGE detection for finding differentially expressed genes in cDNA microarrays. The method uses a simple univariate normal-uniform mixture model, in combination with new normalization methods for spread as well as mean that extend the lowess normalization of Dudoit, Yang, Callow and Speed (2002 1. It takes account of multiple testing, and gives probabilities of differential expression as part of its output. It can be applied to either single-slide or replicated experiments, and it is very fast. Three datasets are analyzed using NUDGE, and the results are compared to those given by other popular methods: unadjusted and Bonferroni-adjusted t tests, Significance Analysis of Microarrays (SAM, and Empirical Bayes for microarrays (EBarrays with both Gamma-Gamma and Lognormal-Normal models. Conclusion The method gives a high probability of differential expression to genes known/suspected a priori to be differentially expressed and a low probability to the others. In terms of known false positives and false negatives, the method outperforms all multiple-replicate methods except for the Gamma-Gamma EBarrays method to which it offers comparable results with the added advantages of greater simplicity, speed, fewer assumptions and applicability to the single replicate case. An R package called nudge to implement the methods in this paper will be made available soon at http://www.bioconductor.org.
International Nuclear Information System (INIS)
ELMAGHRABY, T.K.
2010-01-01
The study aimed to determine the effect of CCl 4 and/or gamma radiation on Mn-SOD, Cu-Zn-SOD and GPx, nitric oxide NO stable end products (N 2 , N 3 , NO x ), eNOS, iNOS RNA gene expression, gene expression of tumour necrotic factor (TNF-Α ) and immunohistochemistry of fibronectin (FN) in the liver of guinea pig that triggers cirrhosis and allows to obtain harmful physiological modifications. The study was also carried out to evaluate the role of shark cartilage (SC) as antioxidant to minimize the side effects of CCl 4 . The results revealed significant increase in iNOS and TNF-gene expression, and significant decrease in Mn-SOD, Cu-Zn-SOD and GPx enzymes in liver tissues of guinea pig treated with CCl 4 and/or gamma radiation. Moreover, the results demonstrated that SC can minimize the hazardous effects of CCl 4 and gamma radiation on liver of guinea pig.
Investigation of genes coding for inflammatory components in Parkinson's disease.
Håkansson, Anna; Westberg, Lars; Nilsson, Staffan; Buervenich, Silvia; Carmine, Andrea; Holmberg, Björn; Sydow, Olof; Olson, Lars; Johnels, Bo; Eriksson, Elias; Nissbrandt, Hans
2005-05-01
Several findings obtained recently indicate that inflammation may contribute to the pathogenesis in Parkinson's disease (PD). Genetic variants of genes coding for components involved in immune reactions in the brain might therefore influence the risk of developing PD or the age of disease onset. Five single nucleotide polymorphisms (SNPs) in the genes coding for interferon-gamma (IFN-gamma; T874A in intron 1), interferon-gamma receptor 2 (IFN-gamma R2; Gln64Arg), interleukin-10 (IL-10; G1082A in the promoter region), platelet-activating factor acetylhydrolase (PAF-AH; Val379Ala), and intercellular adhesion molecule 1 (ICAM-1; Lys469Glu) were genotyped, using pyrosequencing, in 265 patients with PD and 308 controls. None of the investigated SNPs was found to be associated with PD; however, the G1082A polymorphism in the IL-10 gene promoter was found to be related to the age of disease onset. Linear regression showed a significantly earlier onset with more A-alleles (P = 0.0095; after Bonferroni correction, P = 0.048), resulting in a 5-year delayed age of onset of the disease for individuals having two G-alleles compared with individuals having two A-alleles. The results indicate that the IL-10 G1082A SNP could possibly be related to the age of onset of PD. Copyright 2005 Movement Disorder Society.
Chromatin Dynamics of the mouse β-globin locus
M.P.C. van de Corput (Mariëtte); E. de Boer (Ernie); T.A. Knoch (Tobias); W.A. van Cappellen (Gert); M. Lesnussa (Michael); H.J.F.M.M. Eussen (Bert)
2010-01-01
textabstractLately it has become more clear that (subtle) changes in 3D organization of chromatin can either trigger transcription or silence genes or gene clusters. It has also been postulated that due to changes in chromatin structure, a change in chromatin accessibility of transcription factors
Firestone, Richard B; Reijonen, Jani
2014-05-27
An embodiment of a gamma ray generator includes a neutron generator and a moderator. The moderator is coupled to the neutron generator. The moderator includes a neutron capture material. In operation, the neutron generator produces neutrons and the neutron capture material captures at least some of the neutrons to produces gamma rays. An application of the gamma ray generator is as a source of gamma rays for calibration of gamma ray detectors.
Host Gene Expression Analysis in Sri Lankan Melioidosis Patients
2017-06-19
CCL5 Chemokine (C-C motif) ligand 5 /RANTES. IFNγ Interferon gamma TNFα Tumor necrosis factor alpha HMGB1 High mobility group box 1 protein /high...aim of this study was to analyze gene expression levels of human host factors in melioidosis patients and establish useful correlation with disease...PBMC’s) of study subjects. Gene expression profiles of 25 gene targets including 19 immune response genes and 6 epigenetic factors were analyzed by
DEFF Research Database (Denmark)
Shaw, A.; Larsen, M.; Roepstorff, P.
1999-01-01
magnitude of IFN-gamma responsive genes has been reported previously. Our goal is to identify and map IFN-gamma-regulated HeLa cell proteins to the two-dimensional polyacrylamide gel electrophoresis with the immobilized pH gradient (IPG) two-dimensional polyacrylamide gel electrophoresis (2-D PAGE) system...
Chaudhary, Pankaj; Shukla, Sandeep Kumar; Sharma, Rakesh Kumar
2011-01-01
Podophyllum hexandrum, a perennial herb commonly known as the Himalayan May Apple, is well known in Indian and Chinese traditional systems of medicine. P. hexandrum has been widely used for the treatment of venereal warts, skin infections, bacterial and viral infections, and different cancers of the brain, lung and bladder. This study aimed at elucidating the effect of REC-2006, a bioactive fractionated extract from the rhizome of P. hexandrum, on the kinetics of induction and repair of radiation-induced DNA damage in murine thymocytes in vivo. We evaluated its effect on non-specific radiation-induced DNA damage by the alkaline halo assay in terms of relative nuclear spreading factor (RNSF) and gene-specific radiation-induced DNA damage via semi-quantitative polymerase chain reaction. Whole body exposure of animals with gamma rays (10 Gy) caused a significant amount of DNA damage in thymocytes (RNSF values 17.7 ± 0.47, 12.96 ± 1.64 and 3.3 ± 0.014) and a reduction in the amplification of β-globin gene to 0, 28 and 43% at 0, 15 and 60 min, respectively. Administrating REC-2006 at a radioprotective concentration (15 mg kg(-1) body weight) 1 h before irradiation resulted in time-dependent reduction of DNA damage evident as a decrease in RNSF values 6.156 ± 0.576, 1.647 ± 0.534 and 0.496 ± 0.012, and an increase in β-globin gene amplification 36, 95 and 99%, at 0, 15 and 60 min, respectively. REC-2006 scavenged radiation-induced hydroxyl radicals in a dose-dependent manner stabilized DPPH free radicals and also inhibited superoxide anions. Various polyphenols and flavonoides present in REC-2006 might contribute to scavenging of radiation-induced free radicals, thereby preventing DNA damage and stimulating its repair.
Chaudhary, Pankaj; Shukla, Sandeep Kumar; Sharma, Rakesh Kumar
2011-01-01
Podophyllum hexandrum, a perennial herb commonly known as the Himalayan May Apple, is well known in Indian and Chinese traditional systems of medicine. P. hexandrum has been widely used for the treatment of venereal warts, skin infections, bacterial and viral infections, and different cancers of the brain, lung and bladder. This study aimed at elucidating the effect of REC-2006, a bioactive fractionated extract from the rhizome of P. hexandrum, on the kinetics of induction and repair of radiation-induced DNA damage in murine thymocytes in vivo. We evaluated its effect on non-specific radiation-induced DNA damage by the alkaline halo assay in terms of relative nuclear spreading factor (RNSF) and gene-specific radiation-induced DNA damage via semi-quantitative polymerase chain reaction. Whole body exposure of animals with gamma rays (10 Gy) caused a significant amount of DNA damage in thymocytes (RNSF values 17.7 ± 0.47, 12.96 ± 1.64 and 3.3 ± 0.014) and a reduction in the amplification of β-globin gene to 0, 28 and 43% at 0, 15 and 60 min, respectively. Administrating REC-2006 at a radioprotective concentration (15 mg kg−1 body weight) 1 h before irradiation resulted in time-dependent reduction of DNA damage evident as a decrease in RNSF values 6.156 ± 0.576, 1.647 ± 0.534 and 0.496 ± 0.012, and an increase in β-globin gene amplification 36, 95 and 99%, at 0, 15 and 60 min, respectively. REC-2006 scavenged radiation-induced hydroxyl radicals in a dose-dependent manner stabilized DPPH free radicals and also inhibited superoxide anions. Various polyphenols and flavonoides present in REC-2006 might contribute to scavenging of radiation-induced free radicals, thereby preventing DNA damage and stimulating its repair. PMID:20008078
Gene number determination and genetic polymorphism of the gamma delta T cell co-receptor WC1 genes
Directory of Open Access Journals (Sweden)
Chen Chuang
2012-10-01
Full Text Available Abstract Background WC1 co-receptors belong to the scavenger receptor cysteine-rich (SRCR superfamily and are encoded by a multi-gene family. Expression of particular WC1 genes defines functional subpopulations of WC1+ γδ T cells. We have previously identified partial or complete genomic sequences for thirteen different WC1 genes through annotation of the bovine genome Btau_3.1 build. We also identified two WC1 cDNA sequences from other cattle that did not correspond to sequences in the Btau_3.1 build. Their absence in the Btau_3.1 build may have reflected gaps in the genome assembly or polymorphisms among animals. Since the response of γδ T cells to bacterial challenge is determined by WC1 gene expression, it was critical to understand whether individual cattle or breeds differ in the number of WC1 genes or display polymorphisms. Results Real-time quantitative PCR using DNA from the animal whose genome was sequenced (“Dominette” and sixteen other animals representing ten breeds of cattle, showed that the number of genes coding for WC1 co-receptors is thirteen. The complete coding sequences of those thirteen WC1 genes is presented, including the correction of an error in the WC1-2 gene due to mis-assembly in the Btau_3.1 build. All other cDNA sequences were found to agree with the previous annotation of complete or partial WC1 genes. PCR amplification and sequencing of the most variable N-terminal SRCR domain (domain 1 which has the SRCR “a” pattern of each of the thirteen WC1 genes showed that the sequences are highly conserved among individuals and breeds. Of 160 sequences of domain 1 from three breeds of cattle, no additional sequences beyond the thirteen described WC1 genes were found. Analysis of the complete WC1 cDNA sequences indicated that the thirteen WC1 genes code for three distinct WC1 molecular forms. Conclusion The bovine WC1 multi-gene family is composed of thirteen genes coding for three structural forms whose
Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.
Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C
2010-02-01
The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.
International Nuclear Information System (INIS)
Ramebaeck, H.; Straelberg, E.; Klemola, S.; Nielsen, Sven P.; Palsson, S.E.
2012-01-01
Due to a sparse interaction during the last years between practioners in gamma ray spectrometry in the Nordic countries, a NKS activity was started in 2009. This GammaSem was focused on seminars relevant to gamma spectrometry. A follow up seminar was held in 2010. As an outcome of these activities it was suggested that the 2011 meeting should be focused on practical issues, e.g. different corrections needed in gamma spectrometric measurements. This three day's meeting, GammaWorkshops, was held in September at Risoe-DTU. Experts on different topics relevant for gamma spectrometric measurements were invited to the GammaWorkshops. The topics included efficiency transfer, true coincidence summing corrections, self-attenuation corrections, measurement of natural radionuclides (natural decay series), combined measurement uncertainty calculations, and detection limits. These topics covered both lectures and practical sessions. The practical sessions included demonstrations of tools for e.g. corrections and calculations of the above meantioned topics. (Author)
Energy Technology Data Exchange (ETDEWEB)
Ramebaeck, H. (ed.) (Swedish Defence Research Agency (Sweden)); Straalberg, E. (Institute for Energy Technology, Kjeller (Norway)); Klemola, S. (Radiation and Nuclear Safety Authority, STUK (Finland)); Nielsen, Sven P. (Technical Univ. of Denmark. Risoe National Lab. for Sustainable Energy, Roskilde (Denmark)); Palsson, S.E. (Icelandic Radiation Safety Authority (Iceland))
2012-01-15
Due to a sparse interaction during the last years between practioners in gamma ray spectrometry in the Nordic countries, a NKS activity was started in 2009. This GammaSem was focused on seminars relevant to gamma spectrometry. A follow up seminar was held in 2010. As an outcome of these activities it was suggested that the 2011 meeting should be focused on practical issues, e.g. different corrections needed in gamma spectrometric measurements. This three day's meeting, GammaWorkshops, was held in September at Risoe-DTU. Experts on different topics relevant for gamma spectrometric measurements were invited to the GammaWorkshops. The topics included efficiency transfer, true coincidence summing corrections, self-attenuation corrections, measurement of natural radionuclides (natural decay series), combined measurement uncertainty calculations, and detection limits. These topics covered both lectures and practical sessions. The practical sessions included demonstrations of tools for e.g. corrections and calculations of the above meantioned topics. (Author)
ATLAS searches for VH, HH, VV, V+$\\gamma$/$\\gamma\\gamma$ resonances
AUTHOR|(INSPIRE)INSPIRE-00441490; The ATLAS collaboration
2017-01-01
The discovery of a Higgs boson at the Large Hadron Collider motivates searches for physics beyond the Standard Model in channels involving coupling to the Higgs boson. A search for massive resonances decaying into couples of bosons is described. The considered final states are: $HH$, $VH$, $VV$, $V\\gamma$ and $\\gamma\\gamma$ with $V$ indicating either the $W$ or the $Z$ boson. Final states with different number of leptons or photons and where, in many cases, at least one Higgs decays into a b-quark pair are studied using different jet reconstruction techniques which allow to optimize the signal acceptance for low or high Higgs boson transverse momentum. The most recent diboson resonance searches using LHC Run 2 data are described.
Purgason, Ashley; Mangala, Lingegowda; Zhang, Ye; Hamilton, Stanley; Wu, Honglu
2010-01-01
receiving only 2 Gy of protons. Tissue of the gastrointestinal tract was also homogenized and RNA was isolated for cDNA synthesis and real-time PCR analysis. Inspecting apoptotic lesions of the duodenum of the small intestine as an endpoint of damage did not reveal a radio-adaptive response in C57BL/6 mice at the four hour time point. Results of gene expression changes showed consistent up or down regulation of a number of genes for all of the exposure doses that may play a role in proton-induced apoptosis. Preliminary results of gene expression alterations as a result of gamma-irradiation revealed a wealth of genes involved in oxidative stress and antioxidant defense processes being up- or down-regulated only at the highest exposure dose of 6 Gy and the combined dose of 5 cGy with 6 Gy. Those animals undergoing only 5 cGy of gamma-irradiation showed very little modification of gene expression. Taken together these results lead us to conclude that protons cause more severe morphologic damage to the duodenum of the small intestine at a dose of 2 Gy than a higher dose of 6 Gy of gamma rays to the same organ. Both protons and gamma rays lead to significant variation in gene expression at high doses in the small intestine and these changes may provide insight into the mechanism of injury seen in the gastrointestinal tract following radiation exposure. Astronauts experiencing prolonged exposure to protons in the low Earth orbit and in deep space, and experiencing acute exposure to protons from solar particle events, may face biological consequences that will impact a mission s success. We will continue this work by studying, quantifying, and comparing damage due to protons and gamma rays in the small intestine as well as other organs in a time-dependent manner.
International Nuclear Information System (INIS)
Kheymits, M D; Leonov, A A; Zverev, V G; Galper, A M; Arkhangelskaya, I V; Arkhangelskiy, A I; Yurkin, Yu T; Bakaldin, A V; Suchkov, S I; Topchiev, N P; Dalkarov, O D
2016-01-01
The GAMMA-400 gamma-ray space-based telescope has as its main goals to measure cosmic γ-ray fluxes and the electron-positron cosmic-ray component produced, theoretically, in dark-matter-particles decay or annihilation processes, to search for discrete γ-ray sources and study them in detail, to examine the energy spectra of diffuse γ-rays — both galactic and extragalactic — and to study gamma-ray bursts (GRBs) and γ-rays from the active Sun. Scientific goals of GAMMA-400 telescope require fine angular resolution. The telescope is of a pair-production type. In the converter-tracker, the incident gamma-ray photon converts into electron-positron pair in the tungsten layer and then the tracks are detected by silicon- strip position-sensitive detectors. Multiple scattering processes become a significant obstacle in the incident-gamma direction reconstruction for energies below several gigaelectronvolts. The method of utilising this process to improve the resolution is proposed in the presented work. (paper)
Signal Network Analysis of Plant Genes Responding to Ionizing Radiation
International Nuclear Information System (INIS)
Kim, Dong Sub; Kim, Jinbaek; Kim, Sang Hoon
2012-12-01
In this project, we irradiated Arabidopsis plants with various doses of gamma-rays at the vegetative and reproductive stages to assess their radiation sensitivity. After the gene expression profiles and an analysis of the antioxidant response, we selected several Arabidopsis genes for uses of 'Radio marker genes (RMG)' and conducted over-expression and knock-down experiments to confirm the radio sensitivity. Based on these results, we applied two patents for the detection of two RMG (At3g28210 and At4g37990) and development of transgenic plants. Also, we developed a Genechip for use of high-throughput screening of Arabidopsis genes responding only to ionizing radiation and identified RMG to detect radiation leaks. Based on these results, we applied two patents associated with the use of Genechip for different types of radiation and different growth stages. Also, we conducted co-expression network study of specific expressed probes against gamma-ray stress and identified expressed patterns of duplicated genes formed by whole/500kb segmental genome duplication
Observations of the highest energy gamma-rays from gamma-ray bursts
International Nuclear Information System (INIS)
Dingus, Brenda L.
2001-01-01
EGRET has extended the highest energy observations of gamma-ray bursts to GeV gamma rays. Such high energies imply the fireball that is radiating the gamma-rays has a bulk Lorentz factor of several hundred. However, EGRET only detected a few gamma-ray bursts. GLAST will likely detect several hundred bursts and may extend the maximum energy to a few 100 GeV. Meanwhile new ground based detectors with sensitivity to gamma-ray bursts are beginning operation, and one recently reported evidence for TeV emission from a burst
Directory of Open Access Journals (Sweden)
Chang Li
2018-06-01
Full Text Available We generated helper-dependent HDAd5/35++ adenovirus vectors expressing CRISPR/Cas9 for potential hematopoietic stem cells (HSCs gene therapy of β-thalassemia and sickle cell disease through re-activation of fetal γ-globin expression (HDAd-globin-CRISPR. The process of CRISPR/Cas9 gene transfer using these vectors was not associated with death of human CD34+ cells and did not affect their in vitro expansion and erythroid differentiation. However, functional assays for primitive HSCs, e.g., multi-lineage progenitor colony formation and engraftment in irradiated NOD/Shi-scid/interleukin-2 receptor γ (IL-2Rγ null (NSG mice, revealed toxicity of HDAd-globin-CRISPR vectors related to the prolonged expression and activity of CRISPR/Cas9. To control the duration of CRISPR/Cas9 activity, we generated an HDAd5/35++ vector that expressed two anti-CRISPR (Acr peptides (AcrII4 and AcrII2 capable of binding to the CRISPR/Cas9 complex (HDAd-Acr. CD34+ cells that were sequentially infected with HDAd-CRISPR and HDAd-Acr engrafted at a significantly higher rate. Target site disruption frequencies in engrafted human cells were similar to those in pre-transplantation CD34+ cells, indicating that genome-edited primitive HSCs survived. In vitro differentiated HSCs isolated from transplanted mice demonstrated increased γ-globin expression as a result of genome editing. Our data indicate that the HDAd-Acr vector can be used as a tool to reduce HSC cytotoxicity of the CRISPR/Cas9 complex.
DEFF Research Database (Denmark)
Kiec-Wilk, B; Grzybowska-Galuszka, J; Polus, A
2010-01-01
The Jagged-Notch signalling, plays a crucial role in cell differentiation. Angiogenesis, is regulated by VEGF, bFGF as well as by the free fatty acid metabolites , which are regulators of transcription factors such as peroxisome proliferation activating receptors (PPARs). The study analyzed...... the signalling pathways involved in the regulation of Jagged-1/Notch-4 expression in endothelial cells (HUVECs) in response to VEGF, bFGF and PPAR-gamma exogenous activator - ciglitazone. HUVECs were incubated with investigated substances for 24 hours, with or without the presence of the MAP-kinases inhibitors...... were used. Jagged-1 and Notch-4 gene expression was determined using quantitative Real-Time PCR. The Jagged-1/Notch-4 protein expression was compared by flow cytometry, when the phosphorylation-dependent activation of kinases was estimated by Western-blot method. The opposite effect of VEGF, b...
Design and Performance of the GAMMA-400 Gamma-Ray Telescope for Dark Matter Searches
Galper, A. M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A. I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Fradkin, M. I.; Gusakov, Yu V.;
2012-01-01
The GAMMA-400 gamma-ray telescope is designed to measure the fluxes of gamma-rays and cosmic-ray electrons (+) positrons, which can be produced by annihilation or decay of the dark matter particles, as well as to survey the celestial sphere in order to study point and extended sources of gamma-rays, measure energy spectra of Galactic and extragalactic diffuse gamma-ray emission, gamma-ray bursts, and gamma-ray emission from the Sun. GAMMA-400 covers the energy range from 100 MeV to 3000 GeV. Its angular resolution is approximately 0.01deg (E(sub gamma) greater than 100 GeV), the energy resolution approximately 1% (E(sub gamma) greater than 10 GeV), and the proton rejection factor approximately 10(exp 6). GAMMA-400 will be installed on the Russian space platform Navigator. The beginning of observations is planned for 2018.
Intrasteric control of AMPK via the gamma1 subunit AMP allosteric regulatory site.
Adams, Julian; Chen, Zhi-Ping; Van Denderen, Bryce J W; Morton, Craig J; Parker, Michael W; Witters, Lee A; Stapleton, David; Kemp, Bruce E
2004-01-01
AMP-activated protein kinase (AMPK) is a alphabetagamma heterotrimer that is activated in response to both hormones and intracellular metabolic stress signals. AMPK is regulated by phosphorylation on the alpha subunit and by AMP allosteric control previously thought to be mediated by both alpha and gamma subunits. Here we present evidence that adjacent gamma subunit pairs of CBS repeat sequences (after Cystathionine Beta Synthase) form an AMP binding site related to, but distinct from the classical AMP binding site in phosphorylase, that can also bind ATP. The AMP binding site of the gamma(1) CBS1/CBS2 pair, modeled on the structures of the CBS sequences present in the inosine monophosphate dehydrogenase crystal structure, contains three arginine residues 70, 152, and 171 and His151. The yeast gamma homolog, snf4 contains a His151Gly substitution, and when this is introduced into gamma(1), AMP allosteric control is substantially lost and explains why the yeast snf1p/snf4p complex is insensitive to AMP. Arg70 in gamma(1) corresponds to the site of mutation in human gamma(2) and pig gamma(3) genes previously identified to cause an unusual cardiac phenotype and glycogen storage disease, respectively. Mutation of any of AMP binding site Arg residues to Gln substantially abolishes AMP allosteric control in expressed AMPK holoenzyme. The Arg/Gln mutations also suppress the previously described inhibitory properties of ATP and render the enzyme constitutively active. We propose that ATP acts as an intrasteric inhibitor by bridging the alpha and gamma subunits and that AMP functions to derepress AMPK activity.
International Nuclear Information System (INIS)
Serment Guerrero, J.H.
1992-01-01
The Sos - response in Escherichia coli is formed by several genes involved in mechanisms of tolerance and/or repair, and only activates when a DNA - damage appears. It is controlled by recA and lexA genes. In normal circumstances, LexA protein is linked in every Sos operators, blocking the transcription. When a DNA damage occurs, a Sos signal is generated, Rec A protein changes its normal functions, starts acting as a protease and cleaves Lex A, allowing the transcription of all Sos genes. This response can be quantified by means of Sos Chromo test, performed by Quillardet and Ofnung (1985). In using the Chromo test, it has been observed that the DNA damage made by gamma radiation in Escherichia coli depends on both the doses and the doses rate. It has been shown that the exposure of Escherichia coli PQ37 strain (uvrA) to low doses at low dose rate appears to retard the response, suggesting the action of a repair mechanism. (Brena 1990). In this work, we compare the response in Escherichia coli strains deficient in different mechanisms of repair and/or tolerance. It is observed the importance of rec N gene in the repair of DNA damage produced by gamma radiation. (Author)
Total Cross Section in $\\gamma\\gamma$ Collisions at LEP
Acciarri, M.; Adriani, O.; Aguilar-Benitez, M.; Alcaraz, J.; Alemanni, G.; Allaby, J.; Aloisio, A.; Alviggi, M.G.; Ambrosi, G.; Anderhub, H.; Andreev, Valery P.; Angelescu, T.; Anselmo, F.; Arefev, A.; Azemoon, T.; Aziz, T.; Bagnaia, P.; Bajo, A.; Baksay, L.; Balandras, A.; Baldew, S.V.; Banerjee, S.; Banerjee, Sw.; Barczyk, A.; Barillere, R.; Bartalini, P.; Basile, M.; Batalova, N.; Battiston, R.; Bay, A.; Becattini, F.; Becker, U.; Behner, F.; Bellucci, L.; Berbeco, R.; Berdugo, J.; Berges, P.; Bertucci, B.; Betev, B.L.; Bhattacharya, S.; Biasini, M.; Biland, A.; Blaising, J.J.; Blyth, S.C.; Bobbink, G.J.; Bohm, A.; Boldizsar, L.; Borgia, B.; Bourilkov, D.; Bourquin, M.; Braccini, S.; Branson, J.G.; Brochu, F.; Buffini, A.; Buijs, A.; Burger, J.D.; Burger, W.J.; Cai, X.D.; Capell, M.; Cara Romeo, G.; Carlino, G.; Cartacci, A.M.; Casaus, J.; Castellini, G.; Cavallari, F.; Cavallo, N.; Cecchi, C.; Cerrada, M.; Cesaroni, F.; Chamizo, M.; Chang, Y.H.; Chaturvedi, U.K.; Chemarin, M.; Chen, A.; Chen, G.; Chen, G.M.; Chen, H.F.; Chen, H.S.; Chiefari, G.; Cifarelli, L.; Cindolo, F.; Civinini, C.; Clare, I.; Clare, R.; Coignet, G.; Colino, N.; Costantini, S.; Cotorobai, F.; de la Cruz, B.; Csilling, A.; Cucciarelli, S.; Dai, T.S.; van Dalen, J.A.; D'Alessandro, R.; de Asmundis, R.; Deglon, P.; Degre, A.; Deiters, K.; della Volpe, D.; Delmeire, E.; Denes, P.; DeNotaristefani, F.; De Salvo, A.; Diemoz, M.; Dierckxsens, M.; van Dierendonck, D.; Dionisi, C.; Dittmar, M.; Dominguez, A.; Doria, A.; Dova, M.T.; Duchesneau, D.; Dufournaud, D.; Duinker, P.; El Mamouni, H.; Engler, A.; Eppling, F.J.; Erne, F.C.; Ewers, A.; Extermann, P.; Fabre, M.; Falagan, M.A.; Falciano, S.; Favara, A.; Fay, J.; Fedin, O.; Felcini, M.; Ferguson, T.; Fesefeldt, H.; Fiandrini, E.; Field, J.H.; Filthaut, F.; Fisher, P.H.; Fisk, I.; Forconi, G.; Freudenreich, K.; Furetta, C.; Galaktionov, Iouri; Ganguli, S.N.; Garcia-Abia, Pablo; Gataullin, M.; Gau, S.S.; Gentile, S.; Gheordanescu, N.; Giagu, S.; Gong, Z.F.; Grenier, Gerald Jean; Grimm, O.; Gruenewald, M.W.; Guida, M.; van Gulik, R.; Gupta, V.K.; Gurtu, A.; Gutay, L.J.; Haas, D.; Hasan, A.; Hatzifotiadou, D.; Hebbeker, T.; Herve, Alain; Hidas, P.; Hirschfelder, J.; Hofer, H.; Holzner, G.; Hoorani, H.; Hou, S.R.; Hu, Y.; Iashvili, I.; Jin, B.N.; Jones, Lawrence W.; de Jong, P.; Josa-Mutuberria, I.; Khan, R.A.; Kafer, D.; Kaur, M.; Kienzle-Focacci, M.N.; Kim, D.; Kim, J.K.; Kirkby, Jasper; Kiss, D.; Kittel, W.; Klimentov, A.; Konig, A.C.; Kopal, M.; Kopp, A.; Koutsenko, V.; Kraber, M.; Kraemer, R.W.; Krenz, W.; Kruger, A.; Kunin, A.; Ladron de Guevara, P.; Laktineh, I.; Landi, G.; Lebeau, M.; Lebedev, A.; Lebrun, P.; Lecomte, P.; Lecoq, P.; Le Coultre, P.; Lee, H.J.; Le Goff, J.M.; Leiste, R.; Levtchenko, P.; Li, C.; Likhoded, S.; Lin, C.H.; Lin, W.T.; Linde, F.L.; Lista, L.; Liu, Z.A.; Lohmann, W.; Longo, E.; Lu, Y.S.; Lubelsmeyer, K.; Luci, C.; Luckey, David; Lugnier, L.; Luminari, L.; Lustermann, W.; Ma, W.G.; Maity, M.; Malgeri, L.; Malinin, A.; Mana, C.; Mangeol, D.; Mans, J.; Marian, G.; Martin, J.P.; Marzano, F.; Mazumdar, K.; McNeil, R.R.; Mele, S.; Merola, L.; Meschini, M.; Metzger, W.J.; von der Mey, M.; Mihul, A.; Milcent, H.; Mirabelli, G.; Mnich, J.; Mohanty, G.B.; Moulik, T.; Muanza, G.S.; Muijs, A.J.M.; Musicar, B.; Musy, M.; Napolitano, M.; Nessi-Tedaldi, F.; Newman, H.; Niessen, T.; Nisati, A.; Kluge, Hannelies; Ofierzynski, R.; Organtini, G.; Oulianov, A.; Palomares, C.; Pandoulas, D.; Paoletti, S.; Paolucci, P.; Paramatti, R.; Park, H.K.; Park, I.H.; Passaleva, G.; Patricelli, S.; Paul, Thomas Cantzon; Pauluzzi, M.; Paus, C.; Pauss, F.; Pedace, M.; Pensotti, S.; Perret-Gallix, D.; Petersen, B.; Piccolo, D.; Pierella, F.; Pieri, M.; Piroue, P.A.; Pistolesi, E.; Plyaskin, V.; Pohl, M.; Pojidaev, V.; Postema, H.; Pothier, J.; Prokofev, D.O.; Prokofiev, D.; Quartieri, J.; Rahal-Callot, G.; Rahaman, M.A.; Raics, P.; Raja, N.; Ramelli, R.; Rancoita, P.G.; Ranieri, R.; Raspereza, A.; Raven, G.; Razis, P.; Ren, D.; Rescigno, M.; Reucroft, S.; Riemann, S.; Riles, Keith; Rodin, J.; Roe, B.P.; Romero, L.; Rosca, A.; Rosier-Lees, S.; Roth, Stefan; Rosenbleck, C.; Roux, B.; Rubio, J.A.; Ruggiero, G.; Rykaczewski, H.; Saremi, S.; Sarkar, S.; Salicio, J.; Sanchez, E.; Sanders, M.P.; Schafer, C.; Schegelsky, V.; Schmidt-Kaerst, S.; Schmitz, D.; Schopper, H.; Schotanus, D.J.; Schwering, G.; Sciacca, C.; Seganti, A.; Servoli, L.; Shevchenko, S.; Shivarov, N.; Shoutko, V.; Shumilov, E.; Shvorob, A.; Siedenburg, T.; Son, D.; Smith, B.; Spillantini, P.; Steuer, M.; Stickland, D.P.; Stone, A.; Stoyanov, B.; Straessner, A.; Sudhakar, K.; Sultanov, G.; Sun, L.Z.; Sushkov, S.; Suter, H.; Swain, J.D.; Szillasi, Z.; Sztaricskai, T.; Tang, X.W.; Tauscher, L.; Taylor, L.; Tellili, B.; Teyssier, D.; Timmermans, Charles; Ting, Samuel C.C.; Ting, S.M.; Tonwar, S.C.; Toth, J.; Tully, C.; Tung, K.L.; Uchida, Y.; Ulbricht, J.; Valente, E.; Vesztergombi, G.; Vetlitsky, I.; Vicinanza, D.; Viertel, G.; Villa, S.; Vivargent, M.; Vlachos, S.; Vodopianov, I.; Vogel, H.; Vogt, H.; Vorobev, I.; Vorobov, A.A.; Vorvolakos, A.; Wadhwa, M.; Wallraff, W.; Wang, M.; Wang, X.L.; Wang, Z.M.; Weber, A.; Weber, M.; Wienemann, P.; Wilkens, H.; Wu, S.X.; Wynhoff, S.; Xia, L.; Xu, Z.Z.; Yamamoto, J.; Yang, B.Z.; Yang, C.G.; Yang, H.J.; Yang, M.; Ye, J.B.; Yeh, S.C.; Zalite, A.; Zalite, Yu.; Zhang, Z.P.; Zhu, G.Y.; Zhu, R.Y.; Zichichi, A.; Zilizi, G.; Zimmermann, B.; Zoller, M.
2001-01-01
The reaction e+e- -> e+e- gamma* gamma* -> e+e- hadrons for quasi-real photons is studied using data from root(s) = 183 GeV up to 202 GeV. Results on the total cross sections sigma(e+e- -> e+e- hadrons) and sigma(+e- gamma* gamma* -> e+e- hadrons) are given for the two-photon centre-of-mass energies 5 GeV < Wgammagamma < 185 GeV. The total cross section of two real photons is described by a Regge parametrisation. We observe a steeper rise with the two-photon centre-of-mass energy as compared to the hadron-hadron and the photon-proton cross sections. The data are also compared to the expectations of different theoretical models.
International Nuclear Information System (INIS)
Broomhead, Laurent.
1980-01-01
The nuclear gamma astronomy is presented, in particular the Gamma Ray Observatory, an enormous eight tonnes machine fitted with gamma telescopes, scheduled for launching around 1985. It is thereby hoped to study the natural nuclear reactions which occur when stars explode [fr
DEFF Research Database (Denmark)
Ambye, L; Rasmussen, S; Fenger, Mogens
2005-01-01
The peroxisome proliferator-activated receptor gamma co-activator 1alpha (PGC-1alpha) is a novel transcriptional co-activator that holds an important role in lipid and glucose metabolism. PGC-1alpha is a candidate gene for the metabolic syndrome (MS) as well as type 2 diabetes. Recent studies...... related to this syndrome. The variant was examined, using PCR-RFLP, in the DanMONICA cohort comprising a population-based sample of 2349 subjects. MS was defined using the National Cholesterol Education Program -- Adult Treatment Panel III (NCEP-ATPIII) criteria. The allelic frequency of the Ser482 allele...... and insulin secretion, 24-ambulatory blood pressure or left ventricular mass index. In conclusion, the Gly482Ser polymorphism of the PGC-1alpha gene is not associated with the metabolic syndrome, related quantitative traits or cardiac hypertrophy among Danish Caucasian subjects...
Doubly heavy baryon production at {gamma}{gamma} collider
Energy Technology Data Exchange (ETDEWEB)
Li Shiyuan [Department of Physics, Shandong University, Jinan 250100 (China)]. E-mail: lishy@sdu.edu.cn; Si Zongguo [Department of Physics, Shandong University, Jinan 250100 (China)]. E-mail: zgsi@sdu.edu.cn; Yang Zhongjuan [Department of Physics, Shandong University, Jinan 250100 (China)]. E-mail: yangzhongjuan@mail.sdu.edu.cn
2007-05-10
The inclusive production of doubly heavy baryons {xi}{sub cc} and {xi}{sub bb} at {gamma}{gamma} collider is investigated. It is found that the contribution from the heavy quark pair QQ in color triplet and color sextet are important.
UV- and gamma-radiation sensitive mutants of Arabidopsis thaliana
International Nuclear Information System (INIS)
Jiang, C.Z.; Yen, C.N.; Cronin, K.; Mitchell, D.; Britt, A.B.
1997-01-01
Arabidopsis seedlings repair UV-induced DNA damage via light-dependent and -independent pathways. The mechanism of the ''dark repair'' pathway is still unknown. To determine the number of genes required for dark repair and to investigate the substrate-specificity of this process we isolated mutants with enhanced sensitivity to UV radiation in the absence of photoreactivating light. Seven independently derived UV sensitive mutants were isolated from an EMS-mutagenized population. These fell into six complementation groups, two of which (UVR1 and UVH1) have previously been defined. Four of these mutants are defective in the dark repair of UV-induced pyrimidine [6-4] pyrimidinone dimers. These four mutant lines are sensitive to the growth-inhibitory effects of gamma radiation, suggesting that this repair pathway is also involved in the repair of some type of gamma-induced DNA damage product. The requirement for the coordinate action of several different gene products for effective repair of pyrimidine dimers, as well as the nonspecific nature of the repair activity, is consistent with nucleotide excision repair mechanisms previously described in Saccharomyces cerevisiae and nonplant higher eukaryotes and inconsistent with substrate-specific base excision repair mechanisms found in some bacteria, bacteriophage, and fungi. (author)
Qi, Guoyan; Liu, Peng; Gu, Shanshan; Yang, Hongxia; Dong, Huimin; Xue, Yinping
2018-04-01
Our study is aimed to explore the underlying genetic basis of myasthenia gravis. We collected a Chinese pedigree with myasthenia gravis, and whole-exome sequencing was performed on the two affected siblings and their parents. The candidate pathogenic gene was identified by bioinformatics filtering, which was further verified by Sanger sequencing. The homozygous mutation c.G40A (p.V14M) in interferon gamma receptor 1was identified. Moreover, the mutation was also detected in 3 cases of 44 sporadic myasthenia gravis patients. The p.V14M substitution in interferon gamma receptor 1 may affect the signal peptide function and the translocation on cell membrane, which could disrupt the binding of the ligand of interferon gamma and antibody production, contributing to myasthenia gravis susceptibility. We discovered that a rare variant c.G40A in interferon gamma receptor 1 potentially contributes to the myasthenia gravis pathogenesis. Further functional studies are needed to confirm the effect of the interferon gamma receptor 1 on the myasthenia gravis phenotype.
Lin, Jianfei; Chen, He; Luo, Ling; Lai, Yongrong; Xie, Wei; Kee, Kehkooi
2015-01-01
To correct a DNA mutation in the human genome for gene therapy, homology-directed repair (HDR) needs to be specific and have the lowest off-target effects to protect the human genome from deleterious mutations. Zinc finger nucleases, transcription activator-like effector nuclease (TALEN) and CRISPR-CAS9 systems have been engineered and used extensively to recognize and modify specific DNA sequences. Although TALEN and CRISPR/CAS9 could induce high levels of HDR in human cells, their genotoxicity was significantly higher. Here, we report the creation of a monomeric endonuclease that can recognize at least 33 bp by fusing the DNA-recognizing domain of TALEN (TALE) to a re-engineered homing endonuclease I-SceI. After sequentially re-engineering I-SceI to recognize 18 bp of the human β-globin sequence, the re-engineered I-SceI induced HDR in human cells. When the re-engineered I-SceI was fused to TALE (TALE-ISVB2), the chimeric endonuclease induced the same HDR rate at the human β-globin gene locus as that induced by TALEN, but significantly reduced genotoxicity. We further demonstrated that TALE-ISVB2 specifically targeted at the β-globin sequence in human hematopoietic stem cells. Therefore, this monomeric endonuclease has the potential to be used in therapeutic gene targeting in human cells. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
He, Sheng; Li, Jihui; Huang, Peng; Zhang, Shujie; Lin, Li; Zuo, Yangjin; Tian, Xiaoxian; Zheng, Chenguang; Qiu, Xiaoxia; Chen, Biyan
2018-01-01
Hb Bart's hydrops fetalis is the most severe and generally fatal clinical phenotype of α-thalassemia (α-thal), which is due to the deletion of all four functional α-globin genes of hemoglobin (Hb), resulting in no α-globin chain production (- -/- -). Homozygosity for the - - SEA (Southeast Asian) α-globin gene deletion is the main cause of the Hb Bart's hydrops fetalis in Asia, especially South China. Occasionally, other α 0 -thal deletions can also be found. In this study, we report a case with an atypical form of Hb Bart's hydrops fetalis that was caused by - - SEA and a large novel α 0 -thal deletion (- - GX ) (Guangxi). The fetus with Hb Bart's in our study presented fetal hydrops features in early gestation which was different from that of traditional Hb Bart's hydrops fetalis with a homozygous - - SEA deletion. The early onset of fetal hydrops is attributed to the decreased formation of embryonic Hb Portland (ζ2γ2), which is proposed as a candidate for reactivation in cases of severe α-thal. Our findings indicated that it was important to characterize new or rare mutations, and highlighted the significance of using ultrasonography to identify signs of Hb Bart's hydrops fetalis.
Energy Technology Data Exchange (ETDEWEB)
Oishi, Katsutaka, E-mail: k-ooishi@aist.go.jp [Biological Clock Research Group, Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki (Japan); Uchida, Daisuke [Biological Clock Research Group, Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki (Japan); Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki (Japan); Ohkura, Naoki [Department of Clinical Molecular Biology, Faculty of Pharmaceutical Sciences, Teikyo University, Sagamihara, Kanagawa (Japan); Horie, Shuichi [Department of Clinical Biochemistry, Kagawa Nutrition University, Sakado, Saitama (Japan)
2010-10-15
Research highlights: {yields} PPAR{alpha} deficiency augments a ketogenic diet-induced circadian PAI-1 expression. {yields} Hepatic expressions of PPAR{gamma} and PCG-1{alpha} are induced by a ketogenic diet. {yields} PPAR{gamma} antagonist attenuates a ketogenic diet-induced PAI-1 expression. {yields} Ketogenic diet advances the phase of circadian clock in a PPAR{alpha}-independent manner. -- Abstract: An increased level of plasminogen activator inhibitor-1 (PAI-1) is considered a risk factor for cardiovascular diseases, and PAI-1 gene expression is under the control of molecular circadian clocks in mammals. We recently showed that PAI-1 expression is augmented in a phase-advanced circadian manner in mice fed with a ketogenic diet (KD). To determine whether peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) is involved in hypofibrinolytic status induced by a KD, we examined the expression profiles of PAI-1 and circadian clock genes in PPAR{alpha}-null KD mice. Chronic administration of bezafibrate induced the PAI-1 gene expression in a PPAR{alpha}-dependent manner. Feeding with a KD augmented the circadian expression of PAI-1 mRNA in the hearts and livers of wild-type (WT) mice as previously described. The KD-induced mRNA expression of typical PPAR{alpha} target genes such as Cyp4A10 and FGF21 was damped in PPAR{alpha}-null mice. However, plasma PAI-1 concentrations were significantly more elevated in PPAR{alpha}-null KD mice in accordance with hepatic mRNA levels. These observations suggest that PPAR{alpha} activation is dispensable for KD-induced PAI-1 expression. We also found that hyperlipidemia, fatty liver, and the hepatic expressions of PPAR{gamma} and its coactivator PCG-1{alpha} were more effectively induced in PPAR{alpha}-null, than in WT mice on a KD. Furthermore, KD-induced hepatic PAI-1 expression was significantly suppressed by supplementation with bisphenol A diglycidyl ether, a PPAR{gamma} antagonist, in both WT and PPAR
Effect of selection and gamma-irradiation on fecundity in Tribolium castaneum
International Nuclear Information System (INIS)
Bhat, P.P.; Raheja, K.L.; Verma, S.B.
1981-01-01
In order to investigate the joint effect of selection and gamma irradiation on a polygenic trait like egg production in Tribolium castaneum, a 3 x 3 x 2 fractorial experiment with 3 levels of selection, viz. O, high (S 1 ), and low (S 2 ); 3 levels of irradiation, viz. 0,1 1500R (R 1 ) 2300R(R 2 ); and 2 replicates with 24 females in each cell, was set up. The data were collected on 721 females of parental generation subjected to selection and radiation and the subsequent progeny generation. A significant divergence of 11.6 eggs were observed due to high and low selection methods. There was no difference between control and R 1 radiation dose. The R 2 radiation dose depressed the egg production of the progeny significantly. There was a linear decrease in egg number in the progeny with an increase in dose level of radiation in parents; this is indicative of significant number of gene mutations effecting a quantitative trait like egg production. It is suggested that reduction in fecundity in the progeny of parents subjected to gamma-irradiation can possibly arise due to either (i) molecular rearrangement at a point on the chromosome leading to gene mutation or (ii) chromosome breakage with subsequent rearrangement of gene position or both. (author)
The effect of gamma radiation on recombination frequency in Caenorhabditis elegans
International Nuclear Information System (INIS)
Kim, J.S.; Rose, A.M.
1987-01-01
We have studied the effect of gamma radiation on recombination frequency for intervals across the cluster of linkage group I in Caenorhabditis elegans. Recombination frequency increased approximately twofold across the dpy-5-unc-13 interval after treatment with 2000 rads (1 rad = 10 mGy) of cobalt 60 gamma radiation. Several factors affecting the magnitude of the increase have been characterized. Recombination frequency increased more with higher doses of radiation. However, the increase in recombination frequency with increasing dose was accompanied by a reduced average number of progeny from radiation-treated individuals. The amount of the increase was affected by meiotic stage, age at the time of treatment (premeiotic), and radiation dose. The increase in recombination was detectable in the B brood and remained elevated for the remainder of egg production. X-chromosome nondisjunction was also increased by radiation treatment. A high frequency of the recombinant progeny produced with radiation treatment were sterile unlike their nonrecombinant siblings. When parameters affecting recombination frequency are held constant during treatment, chromosomal regions of high gene density on the meiotic map increased more (fourfold) than an adjacent region of low gene density (no increase). The greatest was across the dpy-14-unc-13 interval near the center of the gene cluster. These results may suggest that the physical length of DNA per map unit is greater within the cluster than outside
GammaSem Proceedings. A Nordic seminar for users of gamma spectrometry
Energy Technology Data Exchange (ETDEWEB)
Straalberg, E. (ed.) (Institute for Energy Technolgy (Norway)); Berg, K. (National Institute of Radiation Protection (Denmark)); Dowdall, M. (Norwegian Radiation Protection Authority (Norway)) (and others)
2010-11-15
The project GammaSem was proposed to the NKS in 2008. The aim of the project was to arrange two seminars for users of gamma spectrometry, in 2009 and 2010. The seminars were meant to provide a forum for discussions and sharing of information on practical issues concerning gamma spectrometry and initiate a network of gamma spectrometry users in the Nordic countries. Such a Nordic network should strengthen the collaboration between laboratories and improve all participants' competence in practical gamma spectrometry. Both seminars' focus was practical challenges met by the users themselves, rather than theoretical matters. Scientists and users of gamma spectrometry from all five Nordic countries were invited to the seminar, as well as scientist from the Baltic countries. A total of 65 people signed up for GammaSem 2010; representing 30 different universities, commercial companies, research institutes and authorities. The working group concept as presented at last year's GammaSem, has not worked out as intended. The reason for this is probably because most of the laboratories that signed up to join the working groups, signed up because they wanted to learn more about the different subjects. In combination with the fact that no funding was made available for the working groups, it was difficult to establish goals on what to achieve. None of the working groups applied for funding from the NKS (or elsewhere) to establish separate projects. There is a big need for more cooperation and for training within the field of gamma spectrometry. This fact has been proved through these two seminars, both by the many different topics that have been discussed, but also by the huge interest for participating in the suggested series of workshop. The GammaSem seminars have thus provided a much welcomed starting point for a broader Nordic collaboration. (Author)
GammaSem Proceedings. A Nordic seminar for users of gamma spectrometry
International Nuclear Information System (INIS)
Straelberg, E.; Berg, K.; Dowdall, M.
2010-11-01
The project GammaSem was proposed to the NKS in 2008. The aim of the project was to arrange two seminars for users of gamma spectrometry, in 2009 and 2010. The seminars were meant to provide a forum for discussions and sharing of information on practical issues concerning gamma spectrometry and initiate a network of gamma spectrometry users in the Nordic countries. Such a Nordic network should strengthen the collaboration between laboratories and improve all participants' competence in practical gamma spectrometry. Both seminars' focus was practical challenges met by the users themselves, rather than theoretical matters. Scientists and users of gamma spectrometry from all five Nordic countries were invited to the seminar, as well as scientist from the Baltic countries. A total of 65 people signed up for GammaSem 2010; representing 30 different universities, commercial companies, research institutes and authorities. The working group concept as presented at last year's GammaSem, has not worked out as intended. The reason for this is probably because most of the laboratories that signed up to join the working groups, signed up because they wanted to learn more about the different subjects. In combination with the fact that no funding was made available for the working groups, it was difficult to establish goals on what to achieve. None of the working groups applied for funding from the NKS (or elsewhere) to establish separate projects. There is a big need for more cooperation and for training within the field of gamma spectrometry. This fact has been proved through these two seminars, both by the many different topics that have been discussed, but also by the huge interest for participating in the suggested series of workshop. The GammaSem seminars have thus provided a much welcomed starting point for a broader Nordic collaboration. (Author)
DEFF Research Database (Denmark)
Pleidrup, Janne A.; Norup, Liselotte R.; Dalgaard, Tina S.
2014-01-01
In the poultry production industry, chickens with access to outdoor areas are exposed to a wide range of parasites e.g. the helminth Ascaridia galli. By real-time quantitative RTPCR, the relative gene expression of the T helper 1 (Th1) cytokine IFN-gamma, the T helper 2 (Th2) cytokine IL-13...... expression of jejunal IFN-gamma and IL-13 was observed. Finally, at the expected period of an adaptive immune response (days 14-21) a general decreased expression of IFN-gamma and TGF-beta 4 in spleen and IFN-gamma in jejunum was followed by a decreased expression of IFN-gamma and IL-10 at day 21 in caecal...
Study of the effect of HFE gene mutations on iron overload in ...
African Journals Online (AJOL)
Manal Michel Wilson
2015-03-04
Mar 4, 2015 ... The Egyptian Journal of Medical Human Genetics www.ejmhg.eg.net ... RDB, a panel of probes (n = 22) using the beta globin strip assay was used ... (20 pmol) of primer R and 5 ll (100 ng) of genomic extracted. DNA.
Genetic differences in hemoglobin function between highland and lowland deer mice
DEFF Research Database (Denmark)
Storz, Jay F.; Runck, Amy M.; Moriyama, Hideaki
2010-01-01
In high-altitude vertebrates, adaptive changes in blood–O2 affinity may be mediated by modifications of hemoglobin (Hb) structure that affect intrinsic O2 affinity and/or responsiveness to allosteric effectors that modulate Hb–O2 affinity. This mode of genotypic specialization is considered typical...... of mammalian species that are high-altitude natives. Here we investigated genetically based differences in Hb–O2 affinity between highland and lowland populations of the deer mouse (Peromyscus maniculatus), a generalist species that has the broadest altitudinal distribution of any North American mammal....... The results of a combined genetic and proteomic analysis revealed that deer mice harbor a high level of Hb isoform diversity that is attributable to allelic polymorphism at two tandemly duplicated -globin genes and two tandemly duplicated β-globin genes. This high level of isoHb diversity translates...
Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M
1992-04-01
The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.
Energy Technology Data Exchange (ETDEWEB)
Afanasev, A. [Continuous Electron Beam Accelerator Facility, Newport News, VA (United States)
1994-04-01
The author discusses possibilities to study {gamma}*{pi}{sup 0} and {gamma}*{eta} {r_arrow} {gamma} transition form factors at CEBAF energies. The author shows that for 4 GeV electron beam, these form factors can be measured at CEBAF for the 4-momentum transfers Q{sup 2} {le} 2.5 (GeV/c){sup 2} using virtual Compton scattering on the proton and nuclear target in the kinematic regime of low momentum transfers to the target. These measurements can be extended to Q{sup 2} {le} 4.0 (GeV/c){sup 2} using the electron beam with the energy 6 GeV.
Dwarf Rice Mutant Derived from 0.2 kGy Gamma Rays Irradiated Seeds of Atomita 4 Variety
International Nuclear Information System (INIS)
Sobrizal; Sutisna Sanjaya; Carkum; Mohamad Ismachin
2004-01-01
Dwarf rice mutant was obtained when Atomita 4 seeds were irradiated by 0.2 kGy gamma rays. The results of segregation analyses in F2 populations and F3 lines derived from reciprocal crosses of mutant and Atomita 4 suggested that the dwarf was controlled by a single recessive gene. This gene was not located on rice cytoplasmic genome but on nuclear genome. The gene for dwarf obtained in this study tentatively could be assumed as a new finding until the allelic relationships with other dwarf genes are verified. (author)
Achard, P; Aguilar-Benítez, M; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alviggi, M G; Anderhub, H; Andreev, V P; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Bajo, A; Baksay, G; Baksay, L; Baldew, S V; Banerjee, S; Banerjee, Sw; Barczyk, A; Barillère, R; Bartalini, P; Basile, M; Batalova, N; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Bellucci, L; Berbeco, R; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Biasini, M; Biglietti, M; Biland, A; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böhm, A; Boldizsar, L; Borgia, B; Bottai, S; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brochu, F; Burger, J D; Burger, W J; Cai, X D; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada, M; Chamizo-Llatas, M; Chang, Y H; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chiefari, G; Cifarelli, Luisa; Cindolo, F; Clare, I; Clare, R; Coignet, G; Colino, N; Costantini, S; de la Cruz, B; Cucciarelli, S; van Dalen, J A; De Asmundis, R; Déglon, P L; Debreczeni, J; Degré, A; Dehmelt, K; Deiters, K; Della Volpe, D; Delmeire, E; Denes, P; De Notaristefani, F; De Salvo, A; Diemoz, M; Dierckxsens, M; Dionisi, C; Dittmar, Michael; Doria, A; Dova, M T; Duchesneau, D; Echenard, B; Eline, A; El-Mamouni, H; Engler, A; Eppling, F J; Ewers, A; Extermann, Pierre; Falagán, M A; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, Marta; Ferguson, T; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Fisher, W; Fisk, I; Forconi, G; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gataullin, M; Gentile, S; Giagu, S; Gong, Z F; Grenier, G; Grimm, O; Grünewald, M W; Guida, M; van Gulik, R; Gupta, V K; Gurtu, A; Gutay, L J; Haas, D; Hakobyan, R S; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Hirschfelder, J; Hofer, H; Hohlmann, M; Holzner, G; Hou, S R; Hu, Y; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Käfer, D; Kaur, M; Kienzle-Focacci, M N; Kim, J K; Kirkby, Jasper; Kittel, E W; Klimentov, A; König, A C; Kopal, M; Koutsenko, V F; Kräber, M H; Krämer, R W; Krenz, W; Krüger, A; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Latt, J; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Le Goff, J M; Leiste, R; Levtchenko, M; Levchenko, P M; Li, C; Likhoded, S A; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lü, Y S; Lübelsmeyer, K; Luci, C; Luminari, L; Lustermann, W; Ma Wen Gan; Malgeri, L; Malinin, A; Maña, C; Mangeol, D J J; Mans, J; Martin, J P; Marzano, F; Mazumdar, K; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Mihul, A; Milcent, H; Mirabelli, G; Mnich, J; Mohanty, G B; Muanza, G S; Muijs, A J M; Musicar, B; Musy, M; Nagy, S; Natale, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Niessen, T; Nisati, A; Nowak, H; Ofierzynski, R A; Organtini, G; Palomares, C; Pandoulas, D; Paolucci, P; Paramatti, R; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Pedace, M; Pensotti, S; Perret-Gallix, D; Petersen, B; Piccolo, D; Pierella, F; Pioppi, M; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Pothier, J; Prokofiev, D O; Prokofev, D; Quartieri, J; Rahal-Callot, G; Rahaman, M A; Raics, P; Raja, N; Ramelli, R; Rancoita, P G; Ranieri, R; Raspereza, A V; Razis, P A; Ren, D; Rescigno, M; Reucroft, S; Riemann, S; Riles, K; Roe, B P; Romero, L; Rosca, A; Rosier-Lees, S; Roth, S; Rosenbleck, C; Roux, B; Rubio, Juan Antonio; Ruggiero, G; Rykaczewski, H; Sakharov, A; Saremi, S; Sarkar, S; Salicio, J; Sánchez, E; Sanders, M P; Schäfer, C; Shchegelskii, V; Schmidt-Kärst, S; Schmitz, D; Schopper, Herwig Franz; Schotanus, D J; Schwering, G; Sciacca, C; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shumilov, E; Shvorob, A V; Siedenburg, T; Son, D; Souga, C; Spillantini, P; Steuer, M; Stickland, D P; Stoyanov, B; Strässner, A; Sudhakar, K; Sultanov, G G; Sun, L Z; Sushkov, S V; Suter, H; Swain, J D; Szillási, Z; Tang, X W; Tarjan, P; Tauscher, Ludwig; Taylor, L; Tellili, B; Teyssier, D; Timmermans, C; Ting, Samuel C C; Ting, S M; Tonwar, S C; Tóth, J; Tully, C; Tung, K L; Ulbricht, J; Valente, E; Van de Walle, R T; Vásquez, R P; Veszpremi, V; Vesztergombi, G; Vetlitskii, I; Vicinanza, D; Viertel, Gert M; Villa, S; Vivargent, M; Vlachos, S; Vodopyanov, I; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Wadhwa, M; Wallraff, W; Wang, X L; Wang, Z M; Weber, M; Wienemann, P; Wilkens, H; Wynhoff, S; Xia, L; Xu, Z Z; Yamamoto, J; Yang, B Z; Yang, C G; Yang, H J; Yang, M; Yeh, S C; Zalite, A; Zalite, Yu; Zhang, Z P; Zhao, J; Zhu, G Y; Zhu, R Y; Zhuang, H L; Zichichi, A; Zimmermann, B; Zöller, M
2002-01-01
The cross section of the process e^+ e^- -> Z \\gamma\\gamma -> qq~ \\gamma \\gamma is measured with 215 pb^-1 of data collected with the L3 detector during the final LEP run at centre-of-mass energies around 205 GeV and 207 GeV. No deviation from the Standard Model expectation is observed. The full data sample of 713 pb^-1, collected above the Z resonance, is used to constrain the coefficients of anomalous quartic gauge boson couplings to: -0.02 GeV^-2 < a_0/\\Lambda^2 < 0.03 GeV^-2 and -0.07 GeV^-2 < a_c/\\Lambda^2 < 0.05 GeV^-2, at 95% confidence level.
Induction of sos response in Escherichia Coli cells by gamma rays
International Nuclear Information System (INIS)
Fuentes Lorenzo, J.L.; Padron Soler, E.; Martin Hernandez, G.; Perez Tamayo, N.; del Sol Abascal, E.R.; Almeida Varela, E.
1996-01-01
The kinetics of sos response induction in Escherichia Coli cells was studied by means of the gene fusion SfiA:LacZ. In these cells, the specific beta galactosidase activity and the cellular growth rate showed an exponential behaviour. The sensitivity of the GC 2181 starin to gamma irradiation is equal to Do -1= 0.00088/Gy. The beta galactosidase activity
Investigation of Gamma-aminobutyric acid (GABA A receptors genes and migraine susceptibility
Directory of Open Access Journals (Sweden)
Ciccodicola Alfredo
2008-12-01
Full Text Available Abstract Background Migraine is a neurological disorder characterized by recurrent attacks of severe headache, affecting around 12% of Caucasian populations. It is well known that migraine has a strong genetic component, although the number and type of genes involved is still unclear. Prior linkage studies have reported mapping of a migraine gene to chromosome Xq 24–28, a region containing a cluster of genes for GABA A receptors (GABRE, GABRA3, GABRQ, which are potential candidate genes for migraine. The GABA neurotransmitter has been implicated in migraine pathophysiology previously; however its exact role has not yet been established, although GABA receptors agonists have been the target of therapeutic developments. The aim of the present research is to investigate the role of the potential candidate genes reported on chromosome Xq 24–28 region in migraine susceptibility. In this study, we have focused on the subunit GABA A receptors type ε (GABRE and type θ (GABRQ genes and their involvement in migraine. Methods We have performed an association analysis in a large population of case-controls (275 unrelated Caucasian migraineurs versus 275 controls examining a set of 3 single nucleotide polymorphisms (SNPs in the coding region (exons 3, 5 and 9 of the GABRE gene and also the I478F coding variant of the GABRQ gene. Results Our study did not show any association between the examined SNPs in our test population (P > 0.05. Conclusion Although these particular GABA receptor genes did not show positive association, further studies are necessary to consider the role of other GABA receptor genes in migraine susceptibility.
QCD and $\\gamma\\,\\gamma$ studies at FCC-ee
Skands, Peter
2016-10-20
The Future Circular Collider (FCC) is a post-LHC project aiming at searches for physics beyond the SM in a new 80--100~km tunnel at CERN. Running in its first phase as a very-high-luminosity electron-positron collider (FCC-ee), it will provide unique possibilities for indirect searches of new phenomena through high-precision tests of the SM. In addition, by collecting tens of ab$^{-1}$ integrated luminosity in the range of center-of-mass energies $\\sqrt{s}$~=90--350~GeV, the FCC-ee also offers unique physics opportunities for precise measurements of QCD phenomena and of photon-photon collisions through, literally, billions of hadronic final states as well as unprecedented large fluxes of quasireal $\\gamma$'s radiated from the $\\rm e^+e^-$ beams. We succinctly summarize the FCC-ee perspectives for high-precision extractions of the QCD coupling, for detailed analyses of parton radiation and fragmentation, and for SM and BSM studies through $\\gamma\\gamma$ collisions.
Energy Technology Data Exchange (ETDEWEB)
Thacker, J
1986-05-01
DNA from 58 independent HPRT-deficient mutants of V79 hamster cells induced by ionizing radiation was analysed by Southern blot hybridization to a full-length hamster hprt cDNA. About half of the ..gamma..-ray-induced mutants (20/43) were apparently total gene deletions, because they lacked all functional hprt gene sequences hybridizing to the cDNA probe. Another 10 mutants showed various partial deletions and/or rearrangements of the hprt gene. The remaining 13 mutants showed no detectable change in comparison to the structure of the normal gene, which correlated well with previous characterization of these mutants indicating that most carry point mutations in the hprt gene. Thus, 70% or more of radiation-induced HPRT-deficient mutants arise through large genetic changes, especially deletions of all or part of the hprt gene. 16 references, 4 figures, 1 table.
Alexandre, D.; Chuchana, P.; Roncarolo, M. G.; Yssel, H.; Spits, H.; Lefranc, G.; Lefranc, M. P.
1991-01-01
Novel variable (V)--joining (J) gene rearrangements are described in the human T cell receptor gamma locus, in which, on the one hand, the V3 variable gene is joined to the heptamer--nonamer recombination signals of the J1 segment and, on the other hand, the J1 segment is joined to the V3
Directory of Open Access Journals (Sweden)
Bunlong eYim
2015-11-01
Full Text Available Replant disease (RD severely affects apple production in propagation tree nurseries and in fruit orchards worldwide. This study aimed to investigate the effects of soil disinfection treatments on plant growth and health in a biotest in two different RD soil types under greenhouse conditions and to link the plant growth status with the bacterial community composition at the time of plant sampling. In the biotest performed we observed that the aboveground growth of apple rootstock M26 plants after eight weeks was improved in the two RD soils either treated at 50 °C or with gamma irradiation compared to the untreated RD soils. Total community DNA was extracted from soil loosely adhering to the roots and quantitative real-time PCR revealed no pronounced differences in 16S rRNA gene copy numbers. 16S rRNA gene-based bacterial community analysis by denaturing gradient gel electrophoresis (DGGE and 454-pyrosequencing revealed significant differences in the bacterial community composition even after eight weeks of plant growth. In both soils, the treatments affected different phyla but only the relative abundance of Acidobacteria was reduced by both treatments. The genera Streptomyces, Bacillus, Paenibacillus and Sphingomonas had a higher relative abundance in both heat treated soils, whereas the relative abundance of Mucilaginibacter, Devosia and Rhodanobacter was increased in the gamma-irradiated soils and only the genus Phenylobacterium was increased in both treatments. The increased abundance of genera with potentially beneficial bacteria, i.e. potential degraders of phenolic compounds might have contributed to the improved plant growth in both treatments.
International Nuclear Information System (INIS)
Anaganti, Narasimha; Basu, Bhakti; Apte, Shree Kumar
2015-01-01
Deinococcus radiodurans is an extremophile that withstands lethal doses of several DNA damaging agents such as gamma irradiation, UV rays, desiccation and chemical mutagens. The organism responds to DNA damage by inducing expression of several DNA repair genes. At least 25 radiation inducible gene promoters harbour a 17 bp palindromic sequence known as radiation and desiccation response motif (RDRM) implicated in gamma radiation inducible gene expression. However, mechanistic details of gamma radiation-responsive up-regulation in gene expression remain enigmatic. The promoters of highly radiation induced genes ddrB (DR0070), gyrB (DR0906), gyrA (DR1913), a hypothetical gene (DR1143) and recA (DR2338) from D. radiodurans were cloned in a green fluorescence protein (GFP)-based promoter probe shuttle vector pKG and their promoter activity was assessed in both E. coli as well as in D. radiodurans. The gyrA, gyrB and DR1143 gene promoters were active in E. coli although ddrB and recA promoters showed very weak activity. In D. radiodurans, all the five promoters were induced several fold following 6 kGy gamma irradiation. Highest induction was observed for ddrB promoter (25 fold), followed by DR1143 promoter (15 fold). The induction in the activity of gyrB, gyrA and recA promoters was 5, 3 and 2 fold, respectively. To assess the role of RDRM, the 17 bp palindromic sequence was deleted from these promoters. The promoters devoid of RDRM sequence displayed increase in the basal expression activity, but the radiation-responsive induction in promoter activity was completely lost. The substitution of two conserved bases of RDRM sequence yielded decreased radiation induction of PDR0070 promoter. Deletion of 5 bases from 5'-end of PDR0070 RDRM increased basal promoter activity, but radiation induction was completely abolished. Replacement of RDRM with non specific sequence of PDR0070 resulted in loss of basal expression and radiation induction. The results demonstrate that
Sirunyan, A.M.; Adam, Wolfgang; Aşılar, Ece; Bergauer, Thomas; Brandstetter, Johannes; Brondolin, Erica; Dragicevic, Marko; Erö, Janos; Flechl, Martin; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hartl, Christian; Krammer, Natascha; Hrubec, Josef; Jeitler, Manfred; König, Axel; Krätschmer, Ilse; Liko, Dietrich; Matsushita, Takashi; Mikulec, Ivan; Rabady, Dinyar; Rad, Navid; Rahbaran, Babak; Rohringer, Herbert; Schieck, Jochen; Strauss, Josef; Waltenberger, Wolfgang; Wulz, Claudia-Elisabeth; Dvornikov, Oleg; Makarenko, Vladimir; Mossolov, Vladimir; Suarez Gonzalez, Juan; Zykunov, Vladimir; Shumeiko, Nikolai; Alderweireldt, Sara; De Wolf, Eddi A; Janssen, Xavier; Lauwers, Jasper; Van De Klundert, Merijn; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Van Spilbeeck, Alex; Abu Zeid, Shimaa; Blekman, Freya; D'Hondt, Jorgen; Daci, Nadir; De Bruyn, Isabelle; Deroover, Kevin; Lowette, Steven; Moortgat, Seth; Moreels, Lieselotte; Olbrechts, Annik; Python, Quentin; Skovpen, Kirill; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Parijs, Isis; Brun, Hugues; Clerbaux, Barbara; De Lentdecker, Gilles; Delannoy, Hugo; Fasanella, Giuseppe; Favart, Laurent; Goldouzian, Reza; Grebenyuk, Anastasia; Karapostoli, Georgia; Lenzi, Thomas; Léonard, Alexandre; Luetic, Jelena; Maerschalk, Thierry; Marinov, Andrey; Randle-conde, Aidan; Seva, Tomislav; Vander Velde, Catherine; Vanlaer, Pascal; Vannerom, David; Yonamine, Ryo; Zenoni, Florian; Zhang, Fengwangdong; Cornelis, Tom; Dobur, Didar; Fagot, Alexis; Gul, Muhammad; Khvastunov, Illia; Poyraz, Deniz; Salva Diblen, Sinem; Schöfbeck, Robert; Tytgat, Michael; Van Driessche, Ward; Verbeke, Willem; Zaganidis, Nicolas; Bakhshiansohi, Hamed; Bondu, Olivier; Brochet, Sébastien; Bruno, Giacomo; Caudron, Adrien; De Visscher, Simon; Delaere, Christophe; Delcourt, Martin; Francois, Brieuc; Giammanco, Andrea; Jafari, Abideh; Komm, Matthias; Krintiras, Georgios; Lemaitre, Vincent; Magitteri, Alessio; Mertens, Alexandre; Musich, Marco; Piotrzkowski, Krzysztof; Quertenmont, Loic; Vidal Marono, Miguel; Wertz, Sébastien; Beliy, Nikita; Aldá Júnior, Walter Luiz; Alves, Fábio Lúcio; Alves, Gilvan; Brito, Lucas; Hensel, Carsten; Moraes, Arthur; Pol, Maria Elena; Rebello Teles, Patricia; Belchior Batista Das Chagas, Ewerton; Carvalho, Wagner; Chinellato, Jose; Custódio, Analu; Melo Da Costa, Eliza; Da Silveira, Gustavo Gil; De Jesus Damiao, Dilson; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Huertas Guativa, Lina Milena; Malbouisson, Helena; Matos Figueiredo, Diego; Mora Herrera, Clemencia; Mundim, Luiz; Nogima, Helio; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Sznajder, Andre; Tonelli Manganote, Edmilson José; Torres Da Silva De Araujo, Felipe; Vilela Pereira, Antonio; Ahuja, Sudha; Bernardes, Cesar Augusto; Dogra, Sunil; Tomei, Thiago; De Moraes Gregores, Eduardo; Mercadante, Pedro G; Moon, Chang-Seong; Novaes, Sergio F; Padula, Sandra; Romero Abad, David; Ruiz Vargas, José Cupertino; Aleksandrov, Aleksandar; Hadjiiska, Roumyana; Iaydjiev, Plamen; Rodozov, Mircho; Stoykova, Stefka; Sultanov, Georgi; Shopova, Mariana; Dimitrov, Anton; Glushkov, Ivan; Litov, Leander; Pavlov, Borislav; Petkov, Peicho; Fang, Wenxing; Gao, Xuyang; Ahmad, Muhammad; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Chen, Mingshui; Chen, Ye; Cheng, Tongguang; Jiang, Chun-Hua; Leggat, Duncan; Liu, Zhenan; Romeo, Francesco; Ruan, Manqi; Shaheen, Sarmad Masood; Spiezia, Aniello; Tao, Junquan; Wang, Chunjie; Wang, Zheng; Yazgan, Efe; Zhang, Huaqiao; Zhao, Jingzhou; Ban, Yong; Chen, Geng; Li, Qiang; Liu, Shuai; Mao, Yajun; Qian, Si-Jin; Wang, Dayong; Xu, Zijun; Avila, Carlos; Cabrera, Andrés; Chaparro Sierra, Luisa Fernanda; Florez, Carlos; Gomez, Juan Pablo; González Hernández, Carlos Felipe; Ruiz Alvarez, José David; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Puljak, Ivica; Ribeiro Cipriano, Pedro M; Sculac, Toni; Antunovic, Zeljko; Kovac, Marko; Brigljevic, Vuko; Ferencek, Dinko; Kadija, Kreso; Mesic, Benjamin; Susa, Tatjana; Ather, Mohsan Waseem; Attikis, Alexandros; Mavromanolakis, Georgios; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A; Rykaczewski, Hans; Finger, Miroslav; Finger Jr, Michael; Carrera Jarrin, Edgar; El-khateeb, Esraa; Elgammal, Sherif; Mohamed, Amr; Kadastik, Mario; Perrini, Lucia; Raidal, Martti; Tiko, Andres; Veelken, Christian; Eerola, Paula; Pekkanen, Juska; Voutilainen, Mikko; Härkönen, Jaakko; Jarvinen, Terhi; Karimäki, Veikko; Kinnunen, Ritva; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Tuominiemi, Jorma; Tuovinen, Esa; Wendland, Lauri; Talvitie, Joonas; Tuuva, Tuure; Besancon, Marc; Couderc, Fabrice; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Favaro, Carlotta; Ferri, Federico; Ganjour, Serguei; Ghosh, Saranya; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Kucher, Inna; Locci, Elizabeth; Machet, Martina; Malcles, Julie; Rander, John; Rosowsky, André; Titov, Maksym; Abdulsalam, Abdulla; Antropov, Iurii; Baffioni, Stephanie; Beaudette, Florian; Busson, Philippe; Cadamuro, Luca; Chapon, Emilien; Charlot, Claude; Davignon, Olivier; Granier de Cassagnac, Raphael; Jo, Mihee; Lisniak, Stanislav; Lobanov, Artur; Miné, Philippe; Nguyen, Matthew; Ochando, Christophe; Ortona, Giacomo; Paganini, Pascal; Pigard, Philipp; Regnard, Simon; Salerno, Roberto; Sirois, Yves; Stahl Leiton, Andre Govinda; Strebler, Thomas; Yilmaz, Yetkin; Zabi, Alexandre; Zghiche, Amina; Agram, Jean-Laurent; Andrea, Jeremy; Bloch, Daniel; Brom, Jean-Marie; Buttignol, Michael; Chabert, Eric Christian; Chanon, Nicolas; Collard, Caroline; Conte, Eric; Coubez, Xavier; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Le Bihan, Anne-Catherine; Van Hove, Pierre; Gadrat, Sébastien; Beauceron, Stephanie; Bernet, Colin; Boudoul, Gaelle; Carrillo Montoya, Camilo Andres; Chierici, Roberto; Contardo, Didier; Courbon, Benoit; Depasse, Pierre; El Mamouni, Houmani; Fay, Jean; Finco, Linda; Gascon, Susan; Gouzevitch, Maxime; Grenier, Gérald; Ille, Bernard; Lagarde, Francois; Laktineh, Imad Baptiste; Lethuillier, Morgan; Mirabito, Laurent; Pequegnot, Anne-Laure; Perries, Stephane; Popov, Andrey; Sordini, Viola; Vander Donckt, Muriel; Verdier, Patrice; Viret, Sébastien; Khvedelidze, Arsen; Tsamalaidze, Zviad; Autermann, Christian; Beranek, Sarah; Feld, Lutz; Kiesel, Maximilian Knut; Klein, Katja; Lipinski, Martin; Preuten, Marius; Schomakers, Christian; Schulz, Johannes; Verlage, Tobias; Albert, Andreas; Brodski, Michael; Dietz-Laursonn, Erik; Duchardt, Deborah; Endres, Matthias; Erdmann, Martin; Erdweg, Sören; Esch, Thomas; Fischer, Robert; Güth, Andreas; Hamer, Matthias; Hebbeker, Thomas; Heidemann, Carsten; Hoepfner, Kerstin; Knutzen, Simon; Merschmeyer, Markus; Meyer, Arnd; Millet, Philipp; Mukherjee, Swagata; Olschewski, Mark; Padeken, Klaas; Pook, Tobias; Radziej, Markus; Reithler, Hans; Rieger, Marcel; Scheuch, Florian; Sonnenschein, Lars; Teyssier, Daniel; Thüer, Sebastian; Cherepanov, Vladimir; Flügge, Günter; Kargoll, Bastian; Kress, Thomas; Künsken, Andreas; Lingemann, Joschka; Müller, Thomas; Nehrkorn, Alexander; Nowack, Andreas; Pistone, Claudia; Pooth, Oliver; Stahl, Achim; Aldaya Martin, Maria; Arndt, Till; Asawatangtrakuldee, Chayanit; Beernaert, Kelly; Behnke, Olaf; Behrens, Ulf; Bin Anuar, Afiq Aizuddin; Borras, Kerstin; Campbell, Alan; Connor, Patrick; Contreras-Campana, Christian; Costanza, Francesco; Diez Pardos, Carmen; Dolinska, Ganna; Eckerlin, Guenter; Eckstein, Doris; Eichhorn, Thomas; Eren, Engin; Gallo, Elisabetta; Garay Garcia, Jasone; Geiser, Achim; Gizhko, Andrii; Grados Luyando, Juan Manuel; Grohsjean, Alexander; Gunnellini, Paolo; Harb, Ali; Hauk, Johannes; Hempel, Maria; Jung, Hannes; Kalogeropoulos, Alexis; Karacheban, Olena; Kasemann, Matthias; Keaveney, James; Kleinwort, Claus; Korol, Ievgen; Krücker, Dirk; Lange, Wolfgang; Lelek, Aleksandra; Lenz, Teresa; Leonard, Jessica; Lipka, Katerina; Lohmann, Wolfgang; Mankel, Rainer; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mittag, Gregor; Mnich, Joachim; Mussgiller, Andreas; Ntomari, Eleni; Pitzl, Daniel; Placakyte, Ringaile; Raspereza, Alexei; Roland, Benoit; Sahin, Mehmet Özgür; Saxena, Pooja; Schoerner-Sadenius, Thomas; Spannagel, Simon; Stefaniuk, Nazar; Van Onsem, Gerrit Patrick; Walsh, Roberval; Wissing, Christoph; Blobel, Volker; Centis Vignali, Matteo; Draeger, Arne-Rasmus; Dreyer, Torben; Garutti, Erika; Gonzalez, Daniel; Haller, Johannes; Hoffmann, Malte; Junkes, Alexandra; Klanner, Robert; Kogler, Roman; Kovalchuk, Nataliia; Kurz, Simon; Lapsien, Tobias; Marchesini, Ivan; Marconi, Daniele; Meyer, Mareike; Niedziela, Marek; Nowatschin, Dominik; Pantaleo, Felice; Peiffer, Thomas; Perieanu, Adrian; Scharf, Christian; Schleper, Peter; Schmidt, Alexander; Schumann, Svenja; Schwandt, Joern; Sonneveld, Jory; Stadie, Hartmut; Steinbrück, Georg; Stober, Fred-Markus Helmut; Stöver, Marc; Tholen, Heiner; Troendle, Daniel; Usai, Emanuele; Vanelderen, Lukas; Vanhoefer, Annika; Vormwald, Benedikt; Akbiyik, Melike; Barth, Christian; Baur, Sebastian; Baus, Colin; Berger, Joram; Butz, Erik; Caspart, René; Chwalek, Thorsten; Colombo, Fabio; De Boer, Wim; Dierlamm, Alexander; Fink, Simon; Freund, Benedikt; Friese, Raphael; Giffels, Manuel; Gilbert, Andrew; Goldenzweig, Pablo; Haitz, Dominik; Hartmann, Frank; Heindl, Stefan Michael; Husemann, Ulrich; Kassel, Florian; Katkov, Igor; Kudella, Simon; Mildner, Hannes; Mozer, Matthias Ulrich; Müller, Thomas; Plagge, Michael; Quast, Gunter; Rabbertz, Klaus; Röcker, Steffen; Roscher, Frank; Schröder, Matthias; Shvetsov, Ivan; Sieber, Georg; Simonis, Hans-Jürgen; Ulrich, Ralf; Wayand, Stefan; Weber, Marc; Weiler, Thomas; Williamson, Shawn; Wöhrmann, Clemens; Wolf, Roger; Anagnostou, Georgios; Daskalakis, Georgios; Geralis, Theodoros; Giakoumopoulou, Viktoria Athina; Kyriakis, Aristotelis; Loukas, Demetrios; Topsis-Giotis, Iasonas; Kesisoglou, Stilianos; Panagiotou, Apostolos; Saoulidou, Niki; Tziaferi, Eirini; Kousouris, Konstantinos; Evangelou, Ioannis; Flouris, Giannis; Foudas, Costas; Kokkas, Panagiotis; Loukas, Nikitas; Manthos, Nikolaos; Papadopoulos, Ioannis; Paradas, Evangelos; Triantis, Frixos A; Filipovic, Nicolas; Pasztor, Gabriella; Bencze, Gyorgy; Hajdu, Csaba; Horvath, Dezso; Sikler, Ferenc; Veszpremi, Viktor; Vesztergombi, Gyorgy; Zsigmond, Anna Julia; Beni, Noemi; Czellar, Sandor; Karancsi, János; Makovec, Alajos; Molnar, Jozsef; Szillasi, Zoltan; Bartók, Márton; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Choudhury, Somnath; Komaragiri, Jyothsna Rani; Bahinipati, Seema; Bhowmik, Sandeep; Mal, Prolay; Mandal, Koushik; Nayak, Aruna; Sahoo, Deepak Kumar; Sahoo, Niladribihari; Swain, Sanjay Kumar; Bansal, Sunil; Beri, Suman Bala; Bhatnagar, Vipin; Chawla, Ridhi; Bhawandeep, Bhawandeep; Kalsi, Amandeep Kaur; Kaur, Anterpreet; Kaur, Manjit; Kumar, Ramandeep; Kumari, Priyanka; Mehta, Ankita; Mittal, Monika; Singh, Jasbir; Walia, Genius; Kumar, Ashok; Bhardwaj, Ashutosh; Choudhary, Brajesh C; Garg, Rocky Bala; Keshri, Sumit; Kumar, Ajay; Malhotra, Shivali; Naimuddin, Md; Ranjan, Kirti; Sharma, Ramkrishna; Sharma, Varun; Bhattacharya, Rajarshi; Bhattacharya, Satyaki; Chatterjee, Kalyanmoy; Dey, Sourav; Dutt, Suneel; Dutta, Suchandra; Ghosh, Shamik; Majumdar, Nayana; Modak, Atanu; Mondal, Kuntal; Mukhopadhyay, Supratik; Nandan, Saswati; Purohit, Arnab; Roy, Ashim; Roy, Debarati; Roy Chowdhury, Suvankar; Sarkar, Subir; Sharan, Manoj; Thakur, Shalini; Behera, Prafulla Kumar; Chudasama, Ruchi; Dutta, Dipanwita; Jha, Vishwajeet; Kumar, Vineet; Mohanty, Ajit Kumar; Netrakanti, Pawan Kumar; Pant, Lalit Mohan; Shukla, Prashant; Topkar, Anita; Aziz, Tariq; Dugad, Shashikant; Kole, Gouranga; Mahakud, Bibhuprasad; Mitra, Soureek; Mohanty, Gagan Bihari; Parida, Bibhuti; Sur, Nairit; Sutar, Bajrang; Banerjee, Sudeshna; Dewanjee, Ram Krishna; Ganguly, Sanmay; Guchait, Monoranjan; Jain, Sandhya; Kumar, Sanjeev; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Sarkar, Tanmay; Wickramage, Nadeesha; Chauhan, Shubhanshu; Dube, Sourabh; Hegde, Vinay; Kapoor, Anshul; Kothekar, Kunal; Pandey, Shubham; Rane, Aditee; Sharma, Seema; Chenarani, Shirin; Eskandari Tadavani, Esmaeel; Etesami, Seyed Mohsen; Khakzad, Mohsen; Mohammadi Najafabadi, Mojtaba; Naseri, Mohsen; Paktinat Mehdiabadi, Saeid; Rezaei Hosseinabadi, Ferdos; Safarzadeh, Batool; Zeinali, Maryam; Felcini, Marta; Grunewald, Martin; Abbrescia, Marcello; Calabria, Cesare; Caputo, Claudio; Colaleo, Anna; Creanza, Donato; Cristella, Leonardo; De Filippis, Nicola; De Palma, Mauro; Fiore, Luigi; Iaselli, Giuseppe; Maggi, Giorgio; Maggi, Marcello; Miniello, Giorgia; My, Salvatore; Nuzzo, Salvatore; Pompili, Alexis; Pugliese, Gabriella; Radogna, Raffaella; Ranieri, Antonio; Selvaggi, Giovanna; Sharma, Archana; Silvestris, Lucia; Venditti, Rosamaria; Verwilligen, Piet; Abbiendi, Giovanni; Battilana, Carlo; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Brigliadori, Luca; Campanini, Renato; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Chhibra, Simranjit Singh; Codispoti, Giuseppe; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Grandi, Claudio; Guiducci, Luigi; Marcellini, Stefano; Masetti, Gianni; Montanari, Alessandro; Navarria, Francesco; Perrotta, Andrea; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gian Piero; Tosi, Nicolò; Albergo, Sebastiano; Costa, Salvatore; Di Mattia, Alessandro; Giordano, Ferdinando; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Russo, Lorenzo; Sguazzoni, Giacomo; Strom, Derek; Viliani, Lorenzo; Benussi, Luigi; Bianco, Stefano; Fabbri, Franco; Piccolo, Davide; Primavera, Federica; Calvelli, Valerio; Ferro, Fabrizio; Monge, Maria Roberta; Robutti, Enrico; Tosi, Silvano; Brianza, Luca; Brivio, Francesco; Ciriolo, Vincenzo; Dinardo, Mauro Emanuele; Fiorendi, Sara; Gennai, Simone; Ghezzi, Alessio; Govoni, Pietro; Malberti, Martina; Malvezzi, Sandra; Manzoni, Riccardo Andrea; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Pigazzini, Simone; Ragazzi, Stefano; Tabarelli de Fatis, Tommaso; Buontempo, Salvatore; Cavallo, Nicola; De Nardo, Guglielmo; Di Guida, Salvatore; Esposito, Marco; Fabozzi, Francesco; Fienga, Francesco; Iorio, Alberto Orso Maria; Lanza, Giuseppe; Lista, Luca; Meola, Sabino; Paolucci, Pierluigi; Sciacca, Crisostomo; Thyssen, Filip; Azzi, Patrizia; Bacchetta, Nicola; Benato, Lisa; Bisello, Dario; Boletti, Alessio; Carlin, Roberto; Checchia, Paolo; Dall'Osso, Martino; De Castro Manzano, Pablo; Dorigo, Tommaso; Gasparini, Fabrizio; Gasparini, Ugo; Gozzelino, Andrea; Lacaprara, Stefano; Margoni, Martino; Meneguzzo, Anna Teresa; Michelotto, Michele; Pazzini, Jacopo; Pozzobon, Nicola; Ronchese, Paolo; Rossin, Roberto; Simonetto, Franco; Torassa, Ezio; Ventura, Sandro; Zanetti, Marco; Zotto, Pierluigi; Braghieri, Alessandro; Fallavollita, Francesco; Magnani, Alice; Montagna, Paolo; Ratti, Sergio P; Re, Valerio; Ressegotti, Martina; Riccardi, Cristina; Salvini, Paola; Vai, Ilaria; Vitulo, Paolo; Alunni Solestizi, Luisa; Bilei, Gian Mario; Ciangottini, Diego; Fanò, Livio; Lariccia, Paolo; Leonardi, Roberto; Mantovani, Giancarlo; Mariani, Valentina; Menichelli, Mauro; Saha, Anirban; Santocchia, Attilio; Androsov, Konstantin; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Castaldi, Rino; Ciocci, Maria Agnese; Dell'Orso, Roberto; Fedi, Giacomo; Giassi, Alessandro; Grippo, Maria Teresa; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Rizzi, Andrea; Savoy-Navarro, Aurore; Spagnolo, Paolo; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; Cipriani, Marco; Del Re, Daniele; Diemoz, Marcella; Gelli, Simone; Longo, Egidio; Margaroli, Fabrizio; Marzocchi, Badder; Meridiani, Paolo; Organtini, Giovanni; Paramatti, Riccardo; Preiato, Federico; Rahatlou, Shahram; Rovelli, Chiara; Santanastasio, Francesco; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Bartosik, Nazar; Bellan, Riccardo; Biino, Cristina; Cartiglia, Nicolo; Cenna, Francesca; Costa, Marco; Covarelli, Roberto; Degano, Alessandro; Demaria, Natale; Kiani, Bilal; Mariotti, Chiara; Maselli, Silvia; Migliore, Ernesto; Monaco, Vincenzo; Monteil, Ennio; Monteno, Marco; Obertino, Maria Margherita; Pacher, Luca; Pastrone, Nadia; Pelliccioni, Mario; Pinna Angioni, Gian Luca; Ravera, Fabio; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Shchelina, Ksenia; Sola, Valentina; Solano, Ada; Staiano, Amedeo; Traczyk, Piotr; Belforte, Stefano; Casarsa, Massimo; Cossutti, Fabio; Della Ricca, Giuseppe; Zanetti, Anna; Kim, Dong Hee; Kim, Gui Nyun; Kim, Min Suk; Lee, Jeongeun; Lee, Sangeun; Lee, Seh Wook; Oh, Young Do; Sekmen, Sezen; Son, Dong-Chul; Yang, Yu Chul; Lee, Ari; Kim, Hyunchul; Brochero Cifuentes, Javier Andres; Goh, Junghwan; Kim, Tae Jeong; Cho, Sungwoong; Choi, Suyong; Go, Yeonju; Gyun, Dooyeon; Ha, Seungkyu; Hong, Byung-Sik; Jo, Youngkwon; Kim, Yongsun; Lee, Kisoo; Lee, Kyong Sei; Lee, Songkyo; Lim, Jaehoon; Park, Sung Keun; Roh, Youn; Almond, John; Kim, Junho; Lee, Haneol; Oh, Sung Bin; Radburn-Smith, Benjamin Charles; Seo, Seon-hee; Yang, Unki; Yoo, Hwi Dong; Yu, Geum Bong; Choi, Minkyoo; Kim, Hyunyong; Kim, Ji Hyun; Lee, Jason Sang Hun; Park, Inkyu; Ryu, Geonmo; Ryu, Min Sang; Choi, Young-Il; Hwang, Chanwook; Lee, Jongseok; Yu, Intae; Dudenas, Vytautas; Juodagalvis, Andrius; Vaitkus, Juozas; Ahmed, Ijaz; Ibrahim, Zainol Abidin; Md Ali, Mohd Adli Bin; Mohamad Idris, Faridah; Wan Abdullah, Wan Ahmad Tajuddin; Yusli, Mohd Nizam; Zolkapli, Zukhaimira; Castilla-Valdez, Heriberto; De La Cruz-Burelo, Eduard; Heredia-De La Cruz, Ivan; Lopez-Fernandez, Ricardo; Magaña Villalba, Ricardo; Mejia Guisao, Jhovanny; Sánchez Hernández, Alberto; Carrillo Moreno, Salvador; Oropeza Barrera, Cristina; Vazquez Valencia, Fabiola; Carpinteyro, Severiano; Pedraza, Isabel; Salazar Ibarguen, Humberto Antonio; Uribe Estrada, Cecilia; Morelos Pineda, Antonio; Krofcheck, David; Butler, Philip H; Ahmad, Ashfaq; Ahmad, Muhammad; Hassan, Qamar; Hoorani, Hafeez R; Khan, Wajid Ali; Saddique, Asif; Shah, Mehar Ali; Shoaib, Muhammad; Waqas, Muhammad; Bialkowska, Helena; Bluj, Michal; Boimska, Bożena; Frueboes, Tomasz; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Zalewski, Piotr; Bunkowski, Karol; Byszuk, Adrian; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Misiura, Maciej; Olszewski, Michal; Pyskir, Andrzej; Walczak, Marek; Bargassa, Pedrame; Beirão Da Cruz E Silva, Cristóvão; Calpas, Betty; Di Francesco, Agostino; Faccioli, Pietro; Gallinaro, Michele; Hollar, Jonathan; Leonardo, Nuno; Lloret Iglesias, Lara; Nemallapudi, Mythra Varun; Seixas, Joao; Toldaiev, Oleksii; Vadruccio, Daniele; Varela, Joao; Afanasiev, Serguei; Bunin, Pavel; Gavrilenko, Mikhail; Golutvin, Igor; Gorbunov, Ilya; Kamenev, Alexey; Karjavin, Vladimir; Lanev, Alexander; Malakhov, Alexander; Matveev, Viktor; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Shulha, Siarhei; Skatchkov, Nikolai; Smirnov, Vitaly; Voytishin, Nikolay; Zarubin, Anatoli; Chtchipounov, Leonid; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Kuznetsova, Ekaterina; Murzin, Victor; Oreshkin, Vadim; Sulimov, Valentin; Vorobyev, Alexey; Andreev, Yuri; Dermenev, Alexander; Gninenko, Sergei; Golubev, Nikolai; Karneyeu, Anton; Kirsanov, Mikhail; Krasnikov, Nikolai; Pashenkov, Anatoli; Tlisov, Danila; Toropin, Alexander; Epshteyn, Vladimir; Gavrilov, Vladimir; Lychkovskaya, Natalia; Popov, Vladimir; Pozdnyakov, Ivan; Safronov, Grigory; Spiridonov, Alexander; Toms, Maria; Vlasov, Evgueni; Zhokin, Alexander; Aushev, Tagir; Bylinkin, Alexander; Chadeeva, Marina; Rusinov, Vladimir; Tarkovskii, Evgenii; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Leonidov, Andrey; Terkulov, Adel; Baskakov, Alexey; Belyaev, Andrey; Boos, Edouard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Klyukhin, Vyacheslav; Kodolova, Olga; Lokhtin, Igor; Miagkov, Igor; Obraztsov, Stepan; Petrushanko, Sergey; Savrin, Viktor; Snigirev, Alexander; Blinov, Vladimir; Skovpen, Yuri; Shtol, Dmitry; Azhgirey, Igor; Bayshev, Igor; Bitioukov, Sergei; Elumakhov, Dmitry; Kachanov, Vassili; Kalinin, Alexey; Konstantinov, Dmitri; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Sobol, Andrei; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Cirkovic, Predrag; Devetak, Damir; Dordevic, Milos; Milosevic, Jovan; Rekovic, Vladimir; Alcaraz Maestre, Juan; Barrio Luna, Mar; Calvo, Enrique; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Delgado Peris, Antonio; Escalante Del Valle, Alberto; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M; Josa, Maria Isabel; Navarro De Martino, Eduardo; Pérez-Calero Yzquierdo, Antonio María; Puerta Pelayo, Jesus; Quintario Olmeda, Adrián; Redondo, Ignacio; Romero, Luciano; Senghi Soares, Mara; de Trocóniz, Jorge F; Missiroli, Marino; Moran, Dermot; Cuevas, Javier; Erice, Carlos; Fernandez Menendez, Javier; Gonzalez Caballero, Isidro; González Fernández, Juan Rodrigo; Palencia Cortezon, Enrique; Sanchez Cruz, Sergio; Suárez Andrés, Ignacio; Vischia, Pietro; Vizan Garcia, Jesus Manuel; Cabrillo, Iban Jose; Calderon, Alicia; Curras, Esteban; Fernandez, Marcos; Garcia-Ferrero, Juan; Gomez, Gervasio; Lopez Virto, Amparo; Marco, Jesus; Martinez Rivero, Celso; Matorras, Francisco; Piedra Gomez, Jonatan; Rodrigo, Teresa; Ruiz-Jimeno, Alberto; Scodellaro, Luca; Trevisani, Nicolò; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Baillon, Paul; Ball, Austin; Barney, David; Bloch, Philippe; Bocci, Andrea; Botta, Cristina; Camporesi, Tiziano; Castello, Roberto; Cepeda, Maria; Cerminara, Gianluca; Chen, Yi; Cimmino, Anna; D'Enterria, David; Dabrowski, Anne; Daponte, Vincenzo; David Tinoco Mendes, Andre; De Gruttola, Michele; De Roeck, Albert; Di Marco, Emanuele; Dobson, Marc; Dorney, Brian; Du Pree, Tristan; Dünser, Marc; Dupont, Niels; Elliott-Peisert, Anna; Everaerts, Pieter; Fartoukh, Stephane; Franzoni, Giovanni; Fulcher, Jonathan; Funk, Wolfgang; Gigi, Dominique; Gill, Karl; Girone, Maria; Glege, Frank; Gulhan, Doga; Gundacker, Stefan; Guthoff, Moritz; Harris, Philip; Hegeman, Jeroen; Innocente, Vincenzo; Janot, Patrick; Kieseler, Jan; Kirschenmann, Henning; Knünz, Valentin; Kornmayer, Andreas; Kortelainen, Matti J; Krammer, Manfred; Lange, Clemens; Lecoq, Paul; Lourenco, Carlos; Lucchini, Marco Toliman; Malgeri, Luca; Mannelli, Marcello; Martelli, Arabella; Meijers, Frans; Merlin, Jeremie Alexandre; Mersi, Stefano; Meschi, Emilio; Milenovic, Predrag; Moortgat, Filip; Morovic, Srecko; Mulders, Martijn; Neugebauer, Hannes; Orfanelli, Styliani; Orsini, Luciano; Pape, Luc; Perez, Emmanuel; Peruzzi, Marco; Petrilli, Achille; Petrucciani, Giovanni; Pfeiffer, Andreas; Pierini, Maurizio; Racz, Attila; Reis, Thomas; Rolandi, Gigi; Rovere, Marco; Sakulin, Hannes; Sauvan, Jean-Baptiste; Schäfer, Christoph; Schwick, Christoph; Seidel, Markus; Selvaggi, Michele; Sharma, Archana; Silva, Pedro; Sphicas, Paraskevas; Steggemann, Jan; Stoye, Markus; Takahashi, Yuta; Tosi, Mia; Treille, Daniel; Triossi, Andrea; Tsirou, Andromachi; Veckalns, Viesturs; Veres, Gabor Istvan; Verweij, Marta; Wardle, Nicholas; Wöhri, Hermine Katharina; Zagoździńska, Agnieszka; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; Kotlinski, Danek; Langenegger, Urs; Rohe, Tilman; Wiederkehr, Stephan Albert; Bachmair, Felix; Bäni, Lukas; Bianchini, Lorenzo; Casal, Bruno; Dissertori, Günther; Dittmar, Michael; Donegà, Mauro; Grab, Christoph; Heidegger, Constantin; Hits, Dmitry; Hoss, Jan; Kasieczka, Gregor; Lustermann, Werner; Mangano, Boris; Marionneau, Matthieu; Martinez Ruiz del Arbol, Pablo; Masciovecchio, Mario; Meinhard, Maren Tabea; Meister, Daniel; Micheli, Francesco; Musella, Pasquale; Nessi-Tedaldi, Francesca; Pandolfi, Francesco; Pata, Joosep; Pauss, Felicitas; Perrin, Gaël; Perrozzi, Luca; Quittnat, Milena; Rossini, Marco; Schönenberger, Myriam; Starodumov, Andrei; Tavolaro, Vittorio Raoul; Theofilatos, Konstantinos; Wallny, Rainer; Aarrestad, Thea Klaeboe; Amsler, Claude; Caminada, Lea; Canelli, Maria Florencia; De Cosa, Annapaola; Donato, Silvio; Galloni, Camilla; Hinzmann, Andreas; Hreus, Tomas; Kilminster, Benjamin; Ngadiuba, Jennifer; Pinna, Deborah; Rauco, Giorgia; Robmann, Peter; Salerno, Daniel; Seitz, Claudia; Yang, Yong; Zucchetta, Alberto; Candelise, Vieri; Doan, Thi Hien; Jain, Shilpi; Khurana, Raman; Konyushikhin, Maxim; Kuo, Chia-Ming; Lin, Willis; Pozdnyakov, Andrey; Yu, Shin-Shan; Kumar, Arun; Chang, Paoti; Chang, You-Hao; Chao, Yuan; Chen, Kai-Feng; Chen, Po-Hsun; Fiori, Francesco; Hou, George Wei-Shu; Hsiung, Yee; Liu, Yueh-Feng; Lu, Rong-Shyang; Miñano Moya, Mercedes; Paganis, Efstathios; Psallidas, Andreas; Tsai, Jui-fa; Asavapibhop, Burin; Singh, Gurpreet; Srimanobhas, Norraphat; Suwonjandee, Narumon; Adiguzel, Aytul; Boran, Fatma; Damarseckin, Serdal; Demiroglu, Zuhal Seyma; Dozen, Candan; Eskut, Eda; Girgis, Semiray; Gokbulut, Gul; Guler, Yalcin; Hos, Ilknur; Kangal, Evrim Ersin; Kara, Ozgun; Kayis Topaksu, Aysel; Kiminsu, Ugur; Oglakci, Mehmet; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Tali, Bayram; Turkcapar, Semra; Zorbakir, Ibrahim Soner; Zorbilmez, Caglar; Bilin, Bugra; Isildak, Bora; Karapinar, Guler; Yalvac, Metin; Zeyrek, Mehmet; Gülmez, Erhan; Kaya, Mithat; Kaya, Ozlem; Yetkin, Elif Asli; Yetkin, Taylan; Cakir, Altan; Cankocak, Kerem; Sen, Sercan; Grynyov, Boris; Levchuk, Leonid; Sorokin, Pavel; Aggleton, Robin; Ball, Fionn; Beck, Lana; Brooke, James John; Burns, Douglas; Clement, Emyr; Cussans, David; Flacher, Henning; Goldstein, Joel; Grimes, Mark; Heath, Greg P; Heath, Helen F; Jacob, Jeson; Kreczko, Lukasz; Lucas, Chris; Newbold, Dave M; Paramesvaran, Sudarshan; Poll, Anthony; Sakuma, Tai; Seif El Nasr-storey, Sarah; Smith, Dominic; Smith, Vincent J; Bell, Ken W; Belyaev, Alexander; Brew, Christopher; Brown, Robert M; Calligaris, Luigi; Cieri, Davide; Cockerill, David JA; Coughlan, John A; Harder, Kristian; Harper, Sam; Olaiya, Emmanuel; Petyt, David; Shepherd-Themistocleous, Claire; Thea, Alessandro; Tomalin, Ian R; Williams, Thomas; Baber, Mark; Bainbridge, Robert; Buchmuller, Oliver; Bundock, Aaron; Casasso, Stefano; Citron, Matthew; Colling, David; Corpe, Louie; Dauncey, Paul; Davies, Gavin; De Wit, Adinda; Della Negra, Michel; Di Maria, Riccardo; Dunne, Patrick; Elwood, Adam; Futyan, David; Haddad, Yacine; Hall, Geoffrey; Iles, Gregory; James, Thomas; Lane, Rebecca; Laner, Christian; Lyons, Louis; Magnan, Anne-Marie; Malik, Sarah; Mastrolorenzo, Luca; Nash, Jordan; Nikitenko, Alexander; Pela, Joao; Penning, Bjoern; Pesaresi, Mark; Raymond, David Mark; Richards, Alexander; Rose, Andrew; Scott, Edward; Seez, Christopher; Summers, Sioni; Tapper, Alexander; Uchida, Kirika; Vazquez Acosta, Monica; Virdee, Tejinder; Wright, Jack; Zenz, Seth Conrad; Cole, Joanne; Hobson, Peter R; Khan, Akram; Kyberd, Paul; Reid, Ivan; Symonds, Philip; Teodorescu, Liliana; Turner, Mark; Borzou, Ahmad; Call, Kenneth; Dittmann, Jay; Hatakeyama, Kenichi; Liu, Hongxuan; Pastika, Nathaniel; Bartek, Rachel; Dominguez, Aaron; Buccilli, Andrew; Cooper, Seth; Henderson, Conor; Rumerio, Paolo; West, Christopher; Arcaro, Daniel; Avetisyan, Aram; Bose, Tulika; Gastler, Daniel; Rankin, Dylan; Richardson, Clint; Rohlf, James; Sulak, Lawrence; Zou, David; Benelli, Gabriele; Cutts, David; Garabedian, Alex; Hakala, John; Heintz, Ulrich; Hogan, Julie Managan; Jesus, Orduna; Kwok, Ka Hei Martin; Laird, Edward; Landsberg, Greg; Mao, Zaixing; Narain, Meenakshi; Piperov, Stefan; Sagir, Sinan; Spencer, Eric; Syarif, Rizki; Breedon, Richard; Burns, Dustin; Calderon De La Barca Sanchez, Manuel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Conway, Rylan; Cox, Peter Timothy; Erbacher, Robin; Flores, Chad; Funk, Garrett; Gardner, Michael; Ko, Winston; Lander, Richard; Mclean, Christine; Mulhearn, Michael; Pellett, Dave; Pilot, Justin; Shalhout, Shalhout; Shi, Mengyao; Smith, John; Squires, Michael; Stolp, Dustin; Tos, Kyle; Tripathi, Mani; Bachtis, Michail; Bravo, Cameron; Cousins, Robert; Dasgupta, Abhigyan; Florent, Alice; Hauser, Jay; Ignatenko, Mikhail; Mccoll, Nickolas; Saltzberg, David; Schnaible, Christian; Valuev, Vyacheslav; Weber, Matthias; Bouvier, Elvire; Burt, Kira; Clare, Robert; Ellison, John Anthony; Gary, J William; Ghiasi Shirazi, Seyyed Mohammad Amin; Hanson, Gail; Heilman, Jesse; Jandir, Pawandeep; Kennedy, Elizabeth; Lacroix, Florent; Long, Owen Rosser; Olmedo Negrete, Manuel; Paneva, Mirena Ivova; Shrinivas, Amithabh; Si, Weinan; Wei, Hua; Wimpenny, Stephen; Yates, Brent; Branson, James G; Cerati, Giuseppe Benedetto; Cittolin, Sergio; Derdzinski, Mark; Gerosa, Raffaele; Holzner, André; Klein, Daniel; Krutelyov, Vyacheslav; Letts, James; Macneill, Ian; Olivito, Dominick; Padhi, Sanjay; Pieri, Marco; Sani, Matteo; Sharma, Vivek; Simon, Sean; Tadel, Matevz; Vartak, Adish; Wasserbaech, Steven; Welke, Charles; Wood, John; Würthwein, Frank; Yagil, Avraham; Zevi Della Porta, Giovanni; Amin, Nick; Bhandari, Rohan; Bradmiller-Feld, John; Campagnari, Claudio; Dishaw, Adam; Dutta, Valentina; Franco Sevilla, Manuel; George, Christopher; Golf, Frank; Gouskos, Loukas; Gran, Jason; Heller, Ryan; Incandela, Joe; Mullin, Sam Daniel; Ovcharova, Ana; Qu, Huilin; Richman, Jeffrey; Stuart, David; Suarez, Indara; Yoo, Jaehyeok; Anderson, Dustin; Bendavid, Joshua; Bornheim, Adolf; Bunn, Julian; Lawhorn, Jay Mathew; Mott, Alexander; Newman, Harvey B; Pena, Cristian; Spiropulu, Maria; Vlimant, Jean-Roch; Xie, Si; Zhu, Ren-Yuan; Andrews, Michael Benjamin; Ferguson, Thomas; Paulini, Manfred; Russ, James; Sun, Menglei; Vogel, Helmut; Vorobiev, Igor; Weinberg, Marc; Cumalat, John Perry; Ford, William T; Jensen, Frank; Johnson, Andrew; Krohn, Michael; Leontsinis, Stefanos; Mulholland, Troy; Stenson, Kevin; Wagner, Stephen Robert; Alexander, James; Chaves, Jorge; Chu, Jennifer; Dittmer, Susan; Mcdermott, Kevin; Mirman, Nathan; Patterson, Juliet Ritchie; Rinkevicius, Aurelijus; Ryd, Anders; Skinnari, Louise; Soffi, Livia; Tan, Shao Min; Tao, Zhengcheng; Thom, Julia; Tucker, Jordan; Wittich, Peter; Zientek, Margaret; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Apollinari, Giorgio; Apresyan, Artur; Banerjee, Sunanda; Bauerdick, Lothar AT; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C; Bolla, Gino; Burkett, Kevin; Butler, Joel Nathan; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Cremonesi, Matteo; Duarte, Javier; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gottschalk, Erik; Gray, Lindsey; Green, Dan; Grünendahl, Stefan; Gutsche, Oliver; Harris, Robert M; Hasegawa, Satoshi; Hirschauer, James; Hu, Zhen; Jayatilaka, Bodhitha; Jindariani, Sergo; Johnson, Marvin; Joshi, Umesh; Klima, Boaz; Kreis, Benjamin; Lammel, Stephan; Linacre, Jacob; Lincoln, Don; Lipton, Ron; Liu, Miaoyuan; Liu, Tiehui; Lopes De Sá, Rafael; Lykken, Joseph; Maeshima, Kaori; Magini, Nicolo; Marraffino, John Michael; Maruyama, Sho; Mason, David; McBride, Patricia; Merkel, Petra; Mrenna, Stephen; Nahn, Steve; O'Dell, Vivian; Pedro, Kevin; Prokofyev, Oleg; Rakness, Gregory; Ristori, Luciano; Sexton-Kennedy, Elizabeth; Soha, Aron; Spalding, William J; Spiegel, Leonard; Stoynev, Stoyan; Strait, James; Strobbe, Nadja; Taylor, Lucas; Tkaczyk, Slawek; Tran, Nhan Viet; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vernieri, Caterina; Verzocchi, Marco; Vidal, Richard; Wang, Michael; Weber, Hannsjoerg Artur; Whitbeck, Andrew; Wu, Yujun; Acosta, Darin; Avery, Paul; Bortignon, Pierluigi; Bourilkov, Dimitri; Brinkerhoff, Andrew; Carnes, Andrew; Carver, Matthew; Curry, David; Das, Souvik; Field, Richard D; Furic, Ivan-Kresimir; Konigsberg, Jacobo; Korytov, Andrey; Low, Jia Fu; Ma, Peisen; Matchev, Konstantin; Mei, Hualin; Mitselmakher, Guenakh; Rank, Douglas; Shchutska, Lesya; Sperka, David; Thomas, Laurent; Wang, Jian; Wang, Sean-Jiun; Yelton, John; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Ackert, Andrew; Adams, Todd; Askew, Andrew; Bein, Samuel; Hagopian, Sharon; Hagopian, Vasken; Johnson, Kurtis F; Kolberg, Ted; Perry, Thomas; Prosper, Harrison; Santra, Arka; Yohay, Rachel; Baarmand, Marc M; Bhopatkar, Vallary; Colafranceschi, Stefano; Hohlmann, Marcus; Noonan, Daniel; Roy, Titas; Yumiceva, Francisco; Adams, Mark Raymond; Apanasevich, Leonard; Berry, Douglas; Betts, Russell Richard; Cavanaugh, Richard; Chen, Xuan; Evdokimov, Olga; Gerber, Cecilia Elena; Hangal, Dhanush Anil; Hofman, David Jonathan; Jung, Kurt; Kamin, Jason; Sandoval Gonzalez, Irving Daniel; Trauger, Hallie; Varelas, Nikos; Wang, Hui; Wu, Zhenbin; Zhang, Jingyu; Bilki, Burak; Clarida, Warren; Dilsiz, Kamuran; Durgut, Süleyman; Gandrajula, Reddy Pratap; Haytmyradov, Maksat; Khristenko, Viktor; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Ogul, Hasan; Onel, Yasar; Ozok, Ferhat; Penzo, Aldo; Snyder, Christina; Tiras, Emrah; Wetzel, James; Yi, Kai; Blumenfeld, Barry; Cocoros, Alice; Eminizer, Nicholas; Fehling, David; Feng, Lei; Gritsan, Andrei; Maksimovic, Petar; Roskes, Jeffrey; Sarica, Ulascan; Swartz, Morris; Xiao, Meng; You, Can; Al-bataineh, Ayman; Baringer, Philip; Bean, Alice; Boren, Samuel; Bowen, James; Castle, James; Forthomme, Laurent; Khalil, Sadia; Kropivnitskaya, Anna; Majumder, Devdatta; Mcbrayer, William; Murray, Michael; Sanders, Stephen; Stringer, Robert; Tapia Takaki, Daniel; Wang, Quan; Ivanov, Andrew; Kaadze, Ketino; Maravin, Yurii; Mohammadi, Abdollah; Saini, Lovedeep Kaur; Skhirtladze, Nikoloz; Toda, Sachiko; Rebassoo, Finn; Wright, Douglas; Anelli, Christopher; Baden, Drew; Baron, Owen; Belloni, Alberto; Calvert, Brian; Eno, Sarah Catherine; Ferraioli, Charles; Hadley, Nicholas John; Jabeen, Shabnam; Jeng, Geng-Yuan; Kellogg, Richard G; Kunkle, Joshua; Mignerey, Alice; Ricci-Tam, Francesca; Shin, Young Ho; Skuja, Andris; Tonjes, Marguerite; Tonwar, Suresh C; Abercrombie, Daniel; Allen, Brandon; Apyan, Aram; Azzolini, Virginia; Barbieri, Richard; Baty, Austin; Bi, Ran; Bierwagen, Katharina; Brandt, Stephanie; Busza, Wit; Cali, Ivan Amos; D'Alfonso, Mariarosaria; Demiragli, Zeynep; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hsu, Dylan; Iiyama, Yutaro; Innocenti, Gian Michele; Klute, Markus; Kovalskyi, Dmytro; Krajczar, Krisztian; Lai, Yue Shi; Lee, Yen-Jie; Levin, Andrew; Luckey, Paul David; Maier, Benedikt; Marini, Andrea Carlo; Mcginn, Christopher; Mironov, Camelia; Narayanan, Siddharth; Niu, Xinmei; Paus, Christoph; Roland, Christof; Roland, Gunther; Salfeld-Nebgen, Jakob; Stephans, George; Tatar, Kaya; Velicanu, Dragos; Wang, Jing; Wang, Ta-Wei; Wyslouch, Bolek; Benvenuti, Alberto; Chatterjee, Rajdeep Mohan; Evans, Andrew; Hansen, Peter; Kalafut, Sean; Kao, Shih-Chuan; Kubota, Yuichi; Lesko, Zachary; Mans, Jeremy; Nourbakhsh, Shervin; Ruckstuhl, Nicole; Rusack, Roger; Tambe, Norbert; Turkewitz, Jared; Acosta, John Gabriel; Oliveros, Sandra; Avdeeva, Ekaterina; Bloom, Kenneth; Claes, Daniel R; Fangmeier, Caleb; Gonzalez Suarez, Rebeca; Kamalieddin, Rami; Kravchenko, Ilya; Malta Rodrigues, Alan; Monroy, Jose; Siado, Joaquin Emilo; Snow, Gregory R; Stieger, Benjamin; Alyari, Maral; Dolen, James; Godshalk, Andrew; Harrington, Charles; Iashvili, Ia; Nguyen, Duong; Parker, Ashley; Rappoccio, Salvatore; Roozbahani, Bahareh; Alverson, George; Barberis, Emanuela; Hortiangtham, Apichart; Massironi, Andrea; Morse, David Michael; Nash, David; Orimoto, Toyoko; Teixeira De Lima, Rafael; Trocino, Daniele; Wang, Ren-Jie; Wood, Darien; Bhattacharya, Saptaparna; Charaf, Otman; Hahn, Kristan Allan; Mucia, Nicholas; Odell, Nathaniel; Pollack, Brian; Schmitt, Michael Henry; Sung, Kevin; Trovato, Marco; Velasco, Mayda; Dev, Nabarun; Hildreth, Michael; Hurtado Anampa, Kenyi; Jessop, Colin; Karmgard, Daniel John; Kellams, Nathan; Lannon, Kevin; Marinelli, Nancy; Meng, Fanbo; Mueller, Charles; Musienko, Yuri; Planer, Michael; Reinsvold, Allison; Ruchti, Randy; Rupprecht, Nathaniel; Smith, Geoffrey; Taroni, Silvia; Wayne, Mitchell; Wolf, Matthias; Woodard, Anna; Alimena, Juliette; Antonelli, Louis; Bylsma, Ben; Durkin, Lloyd Stanley; Flowers, Sean; Francis, Brian; Hart, Andrew; Hill, Christopher; Ji, Weifeng; Liu, Bingxuan; Luo, Wuming; Puigh, Darren; Winer, Brian L; Wulsin, Howard Wells; Cooperstein, Stephane; Driga, Olga; Elmer, Peter; Hardenbrook, Joshua; Hebda, Philip; Lange, David; Luo, Jingyu; Marlow, Daniel; Medvedeva, Tatiana; Mei, Kelvin; Ojalvo, Isabel; Olsen, James; Palmer, Christopher; Piroué, Pierre; Stickland, David; Svyatkovskiy, Alexey; Tully, Christopher; Malik, Sudhir; Barker, Anthony; Barnes, Virgil E; Folgueras, Santiago; Gutay, Laszlo; Jha, Manoj; Jones, Matthew; Jung, Andreas Werner; Khatiwada, Ajeeta; Miller, David Harry; Neumeister, Norbert; Schulte, Jan-Frederik; Sun, Jian; Wang, Fuqiang; Xie, Wei; Parashar, Neeti; Stupak, John; Adair, Antony; Akgun, Bora; Chen, Zhenyu; Ecklund, Karl Matthew; Geurts, Frank JM; Guilbaud, Maxime; Li, Wei; Michlin, Benjamin; Northup, Michael; Padley, Brian Paul; Roberts, Jay; Rorie, Jamal; Tu, Zhoudunming; Zabel, James; Betchart, Burton; Bodek, Arie; de Barbaro, Pawel; Demina, Regina; Duh, Yi-ting; Ferbel, Thomas; Galanti, Mario; Garcia-Bellido, Aran; Han, Jiyeon; Hindrichs, Otto; Khukhunaishvili, Aleko; Lo, Kin Ho; Tan, Ping; Verzetti, Mauro; Agapitos, Antonis; Chou, John Paul; Gershtein, Yuri; Gómez Espinosa, Tirso Alejandro; Halkiadakis, Eva; Heindl, Maximilian; Hughes, Elliot; Kaplan, Steven; Kunnawalkam Elayavalli, Raghav; Kyriacou, Savvas; Lath, Amitabh; Montalvo, Roy; Nash, Kevin; Osherson, Marc; Saka, Halil; Salur, Sevil; Schnetzer, Steve; Sheffield, David; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Thomassen, Peter; Walker, Matthew; Delannoy, Andrés G; Foerster, Mark; Heideman, Joseph; Riley, Grant; Rose, Keith; Spanier, Stefan; Thapa, Krishna; Bouhali, Othmane; Celik, Ali; Dalchenko, Mykhailo; De Mattia, Marco; Delgado, Andrea; Dildick, Sven; Eusebi, Ricardo; Gilmore, Jason; Huang, Tao; Juska, Evaldas; Kamon, Teruki; Mueller, Ryan; Pakhotin, Yuriy; Patel, Rishi; Perloff, Alexx; Perniè, Luca; Rathjens, Denis; Safonov, Alexei; Tatarinov, Aysen; Ulmer, Keith; Akchurin, Nural; Damgov, Jordan; De Guio, Federico; Dragoiu, Cosmin; Dudero, Phillip Russell; Faulkner, James; Gurpinar, Emine; Kunori, Shuichi; Lamichhane, Kamal; Lee, Sung Won; Libeiro, Terence; Peltola, Timo; Undleeb, Sonaina; Volobouev, Igor; Wang, Zhixing; Greene, Senta; Gurrola, Alfredo; Janjam, Ravi; Johns, Willard; Maguire, Charles; Melo, Andrew; Ni, Hong; Sheldon, Paul; Tuo, Shengquan; Velkovska, Julia; Xu, Qiao; Arenton, Michael Wayne; Barria, Patrizia; Cox, Bradley; Hirosky, Robert; Ledovskoy, Alexander; Li, Hengne; Neu, Christopher; Sinthuprasith, Tutanon; Sun, Xin; Wang, Yanchu; Wolfe, Evan; Xia, Fan; Clarke, Christopher; Harr, Robert; Karchin, Paul Edmund; Sturdy, Jared; Zaleski, Shawn; Belknap, Donald; Buchanan, James; Caillol, Cécile; Dasu, Sridhara; Dodd, Laura; Duric, Senka; Gomber, Bhawna; Grothe, Monika; Herndon, Matthew; Hervé, Alain; Hussain, Usama; Klabbers, Pamela; Lanaro, Armando; Levine, Aaron; Long, Kenneth; Loveless, Richard; Pierro, Giuseppe Antonio; Polese, Giovanni; Ruggles, Tyler; Savin, Alexander; Smith, Nicholas; Smith, Wesley H; Taylor, Devin; Woods, Nathaniel
2017-10-11
Measurements are presented of $ \\mathrm{ W \\gamma\\gamma } $ and $ \\mathrm{ Z \\gamma\\gamma } $ production in proton-proton collisions. Fiducial cross sections are reported based on a data sample corresponding to an integrated luminosity of 19.4 fb$^{-1}$ collected with the CMS detector at a center-of-mass energy of 8 TeV. Signal is identified through the $\\mathrm{ W } \\to \\ell\
Reactor gamma spectrometry: status
International Nuclear Information System (INIS)
Gold, R.; Kaiser, B.J.
1979-01-01
Current work is described for Compton Recoil Gamma-Ray Spectrometry including developments in experimental technique as well as recent reactor spectrometry measurements. The current status of the method is described concerning gamma spectromoetry probe design and response characteristics. Emphasis is given to gamma spectrometry work in US LWR and BR programs. Gamma spectrometry in BR environments are outlined by focussing on start-up plans for the Fast Test Reactor (FTR). Gamma spectrometry results are presented for a LWR pressure vessel mockup in the Poolside Critical Assembly (PCA) at Oak Ridge National Laboratory
Problems of calibrating measuring instruments for selective gamma-gamma logging
International Nuclear Information System (INIS)
Daniel, J.; Smolarova, H.
1977-01-01
Quantitative determination of copper content in the Novoveska Huta chalcopyrite deposit is described using selective gamma-gamma logging. Factors influencing the calibration quality are discussed. (author)
Clinical applications of gamma delta T cells with multivalent immunity
Directory of Open Access Journals (Sweden)
Drew C Deniger
2014-12-01
Full Text Available Gamma delta T cells hold promise for adoptive immunotherapy because of their reactivity to bacteria, viruses, and tumors. However, these cells represent a small fraction (1-5% of the peripheral T-cell pool and require activation and propagation to achieve clinical benefit. Aminobisphosphonates specifically expand the Vgamma9Vdelta2 subset of gamma delta T cells and have been used in clinical trials of cancer where objective responses were detected. The Vgamma9Vdelta2 TCR heterodimer binds multiple ligands and results in a multivalent attack by a monoclonal T cell population. Alternatively, populations of gamma delta T cells with oligoclonal or polyclonal TCR repertoire could be infused for broad-range specificity. However, this goal has been restricted by a lack of applicable expansion protocols for non-Vgamma9Vdelta2 cells. Recent advances using immobilized antigens, agonistic monoclonal antibodies (mAbs, tumor-derived artificial antigen presenting cells (aAPC, or combinations of activating mAbs and aAPC have been successful in expanding gamma delta T cells with oligoclonal or polyclonal TCR repertoires. Immobilized MHC Class-I chain-related A was a stimulus for gamma delta T cells expressing TCRdelta1 isotypes, and plate-bound activating antibodies have expanded Vdelta1 and Vdelta2 cells ex vivo. Clinically-sufficient quantities of TCRdelta1, TCRdelta2, and TCRdelta1negTCRdelta2neg have been produced following co-culture on aAPC, and these subsets displayed differences in memory phenotype and reactivity to tumors in vitro and in vivo. Gamma delta T cells are also amenable to genetic modification as evidenced by introduction of alpha beta TCRs, chimeric antigen receptors (CARs, and drug-resistance genes. This represents a promising future for the clinical application of oligoclonal or polyclonal gamma delta T cells in autologous and allogeneic settings that builds on current trials testing the safety and efficacy of Vgamma9Vdelta2 T cells.
Energy Technology Data Exchange (ETDEWEB)
Lim, Chan Ju; Lee, Ha Yeon; Kim, Woong Bom; Ahmad, Raza; Moon, Jae Sun; Kwon, Suk Yoon [Korea Research Institute of Beoscience and Biotechnology, Daejeon (Korea, Republic of); Kim, Dong Sub [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)
2010-09-15
Bacterial blight is one of the most serious diseases of rice (Oryza sativa L.), and it has been known that Xanthomonas oryzae pv. oryzae (Xoo) causes this disease symptom. To develop resistance rice cultivars against Xoo, 3,000 lines of M{sub 3}, which were irradiated with gamma ray, were tested by 'scissor-dip method' primarily, and 191 putative resistant lines were selected. In M{sub 4} generation, these lines were screened again with various ways such as measuring of symptom of bacterial blight in leaf, number of tiller, fresh weight, and phenotypic segregation ratio in next generation. Finally, six resistance lines were selected. RT-PCR analysis revealed that these lines displayed high level of R-genes such as Xa21, Pi36, and Pi-ta. These results indicate that mutations by gamma ray cause disruptions of regulatory signal transduction systems of these R-genes. Furthermore, these selected mutants could be useful for the development of rice cultivar resistant to Xoo.
Gamma--gamma directional correlations and coincidence studies in /sup 154/Gd
Energy Technology Data Exchange (ETDEWEB)
Gupta, J B; Gupta, S L; Hamilton, J H; Ramayya, A V [Vanderbilt Univ., Nashville, Tenn. (USA). Dept. of Physics; Delhi Univ. (India). Ramjas Coll.)
1977-06-01
The intensities, placements and E2/M1 mixing ratios of transitions in the decay of /sup 154/Eu have been carefully studied to provide accurate data for microscopic calculations. Coincidence relationships in thhe decay of /sup 154/Eu have been studied extensively with a multiparameter ..gamma..-..gamma.. coincidence system with two large volume Ge(Li) detectors. Spectra in coincidence with twenty energy gates were analyzed. Twenty-nine new coincidence relationships were established and confirmed most, but not all, of several levels previously assigned by energy fits only. From an analysis of coincidence spectra and singles spectra with a 18% efficiency Ge(Li) detector new information on the gamma-ray intensities were obtained. Precise values of the E2/M1 mixing ratios of transitions from the gamma- and beta-vibrational bands to the g.s. band have been determined from ..gamma..-..gamma.. directional correlation measurements with a NaI(Tl)-Ge(Li) detector coincidence system. Mixing ratios were obtained for a number of other transitions including those from KPI = 0/sup -/ and 2+ bands from direct and skipped cascade correlations.
Directory of Open Access Journals (Sweden)
Hannu Olkkonen
2013-01-01
Full Text Available In this work we introduce a new family of splines termed as gamma splines for continuous signal approximation and multiresolution analysis. The gamma splines are born by -times convolution of the exponential by itself. We study the properties of the discrete gamma splines in signal interpolation and approximation. We prove that the gamma splines obey the two-scale equation based on the polyphase decomposition. to introduce the shift invariant gamma spline wavelet transform for tree structured subscale analysis of asymmetric signal waveforms and for systems with asymmetric impulse response. Especially we consider the applications in biomedical signal analysis (EEG, ECG, and EMG. Finally, we discuss the suitability of the gamma spline signal processing in embedded VLSI environment.
A normalisation for the four - detector system for gamma - gamma angular correlation studies
International Nuclear Information System (INIS)
Kiang, G.C.; Chen, C.H.; Niu, W.F.
1994-01-01
A normalisation method for the multiple - HPGe - detector system is described. The system consists of four coaxial HPGe detectors with a CAMAC event - by - event data acquisition system, enabling to measure six gamma -gamma coincidences of angles simultaneously. An application for gamma - gamma correlation studies of Kr 82 is presented and discussed. 3 figs., 6 refs. (author)
A method to describe inelastic gamma field distribution in neutron gamma density logging.
Zhang, Feng; Zhang, Quanying; Liu, Juntao; Wang, Xinguang; Wu, He; Jia, Wenbao; Ti, Yongzhou; Qiu, Fei; Zhang, Xiaoyang
2017-11-01
Pulsed neutron gamma density logging (NGD) is of great significance for radioprotection and density measurement in LWD, however, the current methods have difficulty in quantitative calculation and single factor analysis for the inelastic gamma field distribution. In order to clarify the NGD mechanism, a new method is developed to describe the inelastic gamma field distribution. Based on the fast-neutron scattering and gamma attenuation, the inelastic gamma field distribution is characterized by the inelastic scattering cross section, fast-neutron scattering free path, formation density and other parameters. And the contribution of formation parameters on the field distribution is quantitatively analyzed. The results shows the contribution of density attenuation is opposite to that of inelastic scattering cross section and fast-neutron scattering free path. And as the detector-spacing increases, the density attenuation gradually plays a dominant role in the gamma field distribution, which means large detector-spacing is more favorable for the density measurement. Besides, the relationship of density sensitivity and detector spacing was studied according to this gamma field distribution, therefore, the spacing of near and far gamma ray detector is determined. The research provides theoretical guidance for the tool parameter design and density determination of pulsed neutron gamma density logging technique. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Lea Hošnjak
Full Text Available Gammapapillomavirus (Gamma-PV is a diverse and rapidly expanding PV-genus, currently consisting of 76 fully characterized human papillomavirus (HPV types. In this study, DNA genomes of two novel HPV types, HPV179 and HPV184, obtained from two distinct facial verrucae vulgares specimens of a 64 year-old renal-transplant recipient, were fully cloned, sequenced and characterized. HPV179 and HPV184 genomes comprise 7,228-bp and 7,324-bp, respectively, and contain four early (E1, E2, E6 and E7 and two late genes (L1 and L2; the non-coding region is typically positioned between L1 and E6 genes. Phylogenetic analysis of the L1 nucleotide sequence placed both novel types within the Gamma-PV genus: HPV179 was classified as a novel member of species Gamma-15, additionally containing HPV135 and HPV146, while HPV184 was classified as a single member of a novel species Gamma-25. HPV179 and HPV184 type-specific quantitative real-time PCRs were further developed and used in combination with human beta-globin gene quantitative real-time PCR to determine the prevalence and viral load of the novel types in the patient's facial warts and several follow-up skin specimens, and in a representative collection, a total of 569 samples, of HPV-associated benign and malignant neoplasms, hair follicles and anal and oral mucosa specimens obtained from immunocompetent individuals. HPV179 and HPV184 viral loads in patients' facial warts were estimated to be 2,463 and 3,200 genome copies per single cell, respectively, suggesting their active role in the development of common warts in organ-transplant recipients. In addition, in this particular patient, both novel types had established a persistent infection of the skin for more than four years. Among immunocompetent individuals, HPV179 was further detected in low-copy numbers in a few skin specimens, indicating its cutaneous tissue tropism, while HPV184 was further detected in low-copy numbers in one mucosal and a few skin
Directory of Open Access Journals (Sweden)
Carla Maria Meireles
1999-09-01
Full Text Available The genus Alouatta (howler monkeys is the most widely distributed of New World primates, and has been arranged in three species groups: the Central American Alouatta palliata group and the South American Alouatta seniculus and Alouatta caraya groups. While the latter is monotypic, the A. seniculus group encompasses at least three species (A. seniculus, A. belzebul and A. fusca. In the present study, approximately 600 base pairs of the g1-globin pseudogene were sequenced in the four Brazilian species (A. seniculus, A. belzebul, A. fusca and A. caraya. Maximum parsimony and maximum likelihood methods yielded phylogenetic trees with the same arrangement: {A. caraya [A. seniculus (A. fusca, A. belzebul]}. The most parsimonious tree had bootstrap values greater than 82% for all groupings, and strength of grouping values of at least 2, supporting the sister clade of A. fusca and A. belzebul. The study also confirmed the presence of a 150-base pair Alu insertion element and a 1.8-kb deletion in the g1-globin pseudogene in A. fusca, features found previously in the remaining three species. The cladistic classification based on molecular data agrees with those of morphological studies, with the monospecific A. caraya group being clearly differentiated from the A. seniculus group.Os guaribas, do gênero Alouatta, que são os primatas do Novo Mundo com maior distribuição geográfica, têm sido colocados em três grupos de espécies: o grupo Alouatta palliata da América central, e os grupos sulamericanos Alouatta seniculus e Alouatta caraya. Este último é monotípico, mas o grupo A. seniculus inclui pelo menos três espécies (A. seniculus, A. belzebul e A. fusca. Neste estudo, foram seqüenciados aproximadamente 600 pares de base do pseudogene globina g1 nas quatro espécies brasileiras (A. seniculus, A. belzebul, A. fusca e A. caraya. Os métodos de máxima parcimônia e máxima verossimilhança produziram árvores filogenéticas com o mesmo arranjo
International Nuclear Information System (INIS)
Abou-Sereih, N.A.; Sahab, A.F.; El-Fiki, A.A.M.
1998-01-01
Three important fungi and the major myco toxins were isolated from different food and feed products. The effect of gamma irradiation on genome structures and its relation to the production of myco toxin were also investigated. The percentage of auxotrophic mutants and its relation to the production of myco toxin, when the strains were treated with gamma irradiation (o.1, 0.2, 0.3 and 0.4 kgy), were determined. In general, gamma radiation resulted in high percentage of mutation at 0.4 kgy and the production of mycotoxin decreased greatly or inhibited by 0.1, 0.2, 0.3 and 0.4 kgy due to change in the genetic construction of genes responsible for mycotoxin production
On the possible effects of gluon number fluctuations on {gamma}{gamma} collisions at high energies
Energy Technology Data Exchange (ETDEWEB)
Goncalves, V. P.; De Santana Amaral, J. T. [Instituto de Fisica e Matematica, Universidade Federal de Pelotas, Caixa Postal 354, 96010-900, Pelotas, RS (Brazil)
2013-03-25
We investigate the effects of the fluctuations on the total {gamma}{gamma}, {gamma}*{gamma}* cross sections and the real photon structure function F{sup {gamma}}{sub 2}(x,Q{sup 2}), considering a saturation phenomenological model for the dipole-dipole cross section and scattering amplitude with fluctuations included.
Triggering $B_s^0 \\to \\gamma\\gamma$ at LHCb
Benson, Sean
2018-01-01
The trigger strategy used in the search for the $B_s^0 \\to \\gamma\\gamma$ decay in Run 2 is described. A sample of data is also provided, corresponding to 80 pb$^{−1}$ of diphoton candidates collected in 2015.
Quality Protein Maize (QPM) is a hard kernel variant of the high-lysine mutant, opaque-2. Using gamma irradiation, we created opaque QPM variants to identify opaque-2 modifier genes and to investigate deletion mutagenesis combined with Illumina sequencing as a maize functional genomics tool. A K0326...
A gene-environment study of cytoglobin in the human and rat hippocampus
DEFF Research Database (Denmark)
Hundahl, Christian Ansgar; Elfving, Betina; Müller, Heidi Kaastrup
2013-01-01
Cytoglobin (Cygb) was discovered a decade ago as the fourth vertebrate heme-globin. The function of Cygb is still unknown, but accumulating evidence from in vitro studies point to a putative role in scavenging of reactive oxygen species and nitric oxide metabolism and in vivo studies have shown C......NOS) in the rat hippocampus; 3) The effect of chronic restraint stress (CRS) on Cygb and nNOS expression.......Cytoglobin (Cygb) was discovered a decade ago as the fourth vertebrate heme-globin. The function of Cygb is still unknown, but accumulating evidence from in vitro studies point to a putative role in scavenging of reactive oxygen species and nitric oxide metabolism and in vivo studies have shown...... Cygb to be up regulated by hypoxic stress. This study addresses three main questions related to Cygb expression in the hippocampus: 1) Is the rat hippocampus a valid neuroanatomical model for the human hippocampus; 2) What is the degree of co-expression of Cygb and neuronal nitric oxide synthase (n...
International Nuclear Information System (INIS)
Fichtel, C.E.
1975-01-01
The first certain detection of celestial high energy gamma rays came from a satellite experiment flown on the third Orbiting Solar Observatory (OSO-111). A Gamma ray spark chamber telescope with substantively greater sensitivity and angular resolution (a few degrees) flown on the second Small Astronomy Satellite (SAS-II) has now provided a better picture of the gamma ray sky, and particularly the galactic plane and pulsars. This paper will summarize the present picture of gamma ray astronomy as it has developed at this conference from measurements made with experiments carried out on balloons, those remaining on the ground, and ones flown on satellites. (orig.) [de
Dedoussis, George V; Vidra, Nikoleta; Butler, Johannah; Papoutsakis, Constantina; Yannakoulia, Mary; Hirschhorn, Joel N; Lyon, Helen N; Vidra, Nikoletta
BACKGROUND: Variation in the peroxisome-proliferator-activated receptor gamma (PPARgamma) gene has been reported to alter the risk for adiposity in adults. METHODS: We investigated the gender related association between the Pro12Ala variant (rs1801282) in obesity and insulin resistance traits in 794
DEFF Research Database (Denmark)
Desch, Michael; Schreiber, Andrea; Schweda, Frank
2010-01-01
We recently found that endogenous (free fatty acids) and pharmacological (thiazolidinediones) agonists of nuclear receptor Peroxisome proliferator-activated receptor (PPAR)gamma stimulate renin transcription. In addition, the renin gene was identified as a direct target of PPARgamma. The mouse re...
GammaLog Playback 1.0 - mobile gamma ray spectrometry software
International Nuclear Information System (INIS)
Watson, R.J.; Smethurst, M.A.
2011-01-01
The Geological Survey of Norway (NGU) operates a mobile gamma ray spectrometer system which can be used in nuclear emergency situations to determine the location and type of orphan sources, or the extent and type of fallout contamination. The system consists of a 20 litre (16 litre downward and 4 litre upward looking) RSX-5 NaI detector and spectrometer, and can be mounted in fixed wing aircraft, helicopters, or vans/cars as appropriate. NGU has developed its own data acquisition and analysis software for this system. GammaLog (Smethurst 2005) controls the acquisition, display, and storage of data from the spectrometer, and performs real-time data analysis including estimation of dose rates and fallout concentrations, and separation of geological and anthropogenic components of the signal. The latter is particularly important where the geological radioisotope signal varies strongly from one place to another, and makes it easier to locate and identify anthropogenic sources which might otherwise be difficult to separate from the geological background signal. A modified version of GammaLog has been developed, GammaLog Playback, which allows the replay of previously acquired GammaLog datasets, while performing similar processing and display as the GammaLog acquisition software. This allows datasets to be reviewed and compared in the field or during post-survey analysis to help plan subsequent measurement strategies.(Au)
Vallée, Alexandre; Lecarpentier, Yves; Guillevin, Rémy; Vallée, Jean-Noël
2018-03-23
Entropy production rate is increased by several metabolic and thermodynamics abnormalities in neurodegenerative diseases (NDs). Irreversible processes are quantified by changes in the entropy production rate. This review is focused on the opposing interactions observed in NDs between the canonical WNT/beta-catenin pathway and PPAR gamma and their metabolic and thermodynamic implications. In amyotrophic lateral sclerosis and Huntington's disease, WNT/beta-catenin pathway is upregulated, whereas PPAR gamma is downregulated. In Alzheimer's disease and Parkinson's disease, WNT/beta-catenin pathway is downregulated while PPAR gamma is upregulated. The dysregulation of the canonical WNT/beta-catenin pathway is responsible for the modification of thermodynamics behaviors of metabolic enzymes. Upregulation of WNT/beta-catenin pathway leads to aerobic glycolysis, named Warburg effect, through activated enzymes, such as glucose transporter (Glut), pyruvate kinase M2 (PKM2), pyruvate dehydrogenase kinase 1(PDK1), monocarboxylate lactate transporter 1 (MCT-1), lactic dehydrogenase kinase-A (LDH-A) and inactivation of pyruvate dehydrogenase complex (PDH). Downregulation of WNT/beta-catenin pathway leads to oxidative stress and cell death through inactivation of Glut, PKM2, PDK1, MCT-1, LDH-A but activation of PDH. In addition, in NDs, PPAR gamma is dysregulated, whereas it contributes to the regulation of several key circadian genes. NDs show many dysregulation in the mediation of circadian clock genes and so of circadian rhythms. Thermodynamics rhythms operate far-from-equilibrium and partly regulate interactions between WNT/beta-catenin pathway and PPAR gamma. In NDs, metabolism, thermodynamics and circadian rhythms are tightly interrelated.
Block, Martin M
2002-01-01
Using an eikonal structure for the scattering amplitude, factorization theorems for nucleon-nucleon, gamma p and gamma gamma scattering at high energies have been derived, using only some very general assumptions. Using a QCD-inspired eikonal analysis of nucleon-nucleon scattering, we present here experimental confirmation for factorization of cross sections, nuclear slope parameters B and rho -values (ratio of real to imaginary portion of forward scattering amplitudes), showing that: 1) the three factorization theorems of Block and Kaidalov [2000] hold, 2) the additive quark model holds to approximately=1%, and 3) vector dominance holds to better than approximately=4%. Predictions for the total cross section, elastic cross section and other forward scattering parameters at the LHC (14 TeV) are given. (12 refs).
Gamma spectrometry on MANITU 271-01 gamma scan wires
International Nuclear Information System (INIS)
Dassel, G.; Buurveld, H.A.; Minkema, J.
1994-08-01
A series of irradiation experiments (271-series) is being performed of the sustain programme for material development and characterization of the NET (Next European Torus). In the framework of the first irradiation experiment 271-01, with irradiation up to 0.2 dpa, four gamma scan wires have been examined by gamma scanning. The purpose of the gamma scan wires (GSW) is to get information about the neutron fluence distribution in the capsules during irradiation. In the stainless steel wires the nuclides Co-58, Mu-54, Fe-59 and Co-60 are produced, are characteristic for fast and thermal neutron reactions. (orig./HP)
Pang, Wanrong; Sun, Lei; Long, Ju; Weng, Xunjin; Ye, Xuehe; Wang, Junjie; Liao, Yan; Tang, Weijun; Fan, Zuqian; Wu, Suping; Song, Chuanlu; Wei, Xiaoying; Zhang, Chenghong
2016-06-01
The 2.4 kb (or -α(2.4)) deletion in the α-globin gene cluster (NG_000006.1) is an α(+)-thalassemia (α(+)-thal) allele. The molecular basis of -α(2.4) is a deletion from 36860 to 39251 of the α-globin gene cluster. It was reported by three research groups in 2005, 2012 and 2014, respectively. In routine thalassemia screening studies by this research group, we found an individual with the -α(2.4)/αα genotype and an Hb H (β4) disease patient whose genotype was - -(SEA)/-α(2.4). Samples from the parents of the carrier of the -α(2.4)/αα genotype were collected to perform pedigree analysis, and the proband's mother's genotype was diagnosed to be - -(SEA)/-α(2.4). The research revealed that the -α(2.4) allele exists in the population of southern Guangxi, People's Republic of China.
Directory of Open Access Journals (Sweden)
Olivier Humbert
2018-03-01
Full Text Available Reactivation of fetal hemoglobin (HbF is a promising approach for the treatment of β-hemoglobinopathies and the targeting of genes involved in HbF regulation is under intensive investigation. Here, we established a nonhuman primate (NHP transplantation model to evaluate hematopoietic stem cell (HSC-based gene editing strategies aimed at reactivating HbF. We first characterized the transient HbF induction to autologous HSC transplantation in pigtailed macaques, which was comparable in duration and amplitude to that of human patients. After validating function of the HbF repressor BCL11A in NHPs, we transplanted a pigtailed macaque with CD34+ cells electroporated with TALE nuclease mRNA targeting the BCL11A coding sequence. In vivo gene editing levels were low, but some BCL11A deletions were detected as late as 200 days post-transplantation. HbF production, as determined by F-cell staining and γ-globin expression, was slightly increased in this animal as compared to transplant controls. We also provided proof-of-concept results for the selection of edited NHP CD34+ cells in culture following integration of the P140K/MGMT cassette at the BCL11A locus. In summary, the NHP model described here will allow the testing of novel therapeutic approaches for hemoglobinopathies and should facilitate clinical translation.
Energy Technology Data Exchange (ETDEWEB)
Stinnett, Jacob [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Venkataraman, Ram [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)
2017-09-13
The objective of this training is to explain the origin of x-rays and gamma rays, gamma ray interactions with matter, detectors and electronics used in gamma ray-spectrometry, and features of a gamma-ray spectrum for nuclear material that is safeguarded.
Liu, Rui; Zhang, Haiyang; Zhang, Yan; Li, Shuang; Wang, Xinyi; Wang, Xia; Wang, Cheng; Liu, Bin; Zen, Ke; Zhang, Chen-Yu; Zhang, Chunni; Ba, Yi
2017-04-01
Peroxisome proliferator-activated receptor gamma coactivator-1 alpha plays a crucial role in regulating the biosynthesis of mitochondria, which is closely linked to the energy metabolism in various tumors. This study investigated the regulatory role of peroxisome proliferator-activated receptor gamma coactivator-1 alpha in the pathogenesis of hepatocellular carcinoma. In this study, the changes of peroxisome proliferator-activated receptor gamma coactivator-1 alpha messenger RNA levels between normal human liver and hepatocellular carcinoma tissue were examined by quantitative reverse transcription polymerase chain reaction. Knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by RNA interference in the human liver cell line L02, while overexpression of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha complementary DNA in the human hepatocarcinoma cell line HepG2. Cellular morphological changes were observed via optical and electron microscopy. Cellular apoptosis was determined by Hoechst 33258 staining. In addition, the expression levels of 21,400 genes in tissues and cells were detected by microarray. It was shown that peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression was significantly downregulated in hepatocellular carcinoma compared with normal liver tissues. After knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression in L02 cells, cells reverted to immature and dedifferentiated morphology exhibiting cancerous tendency. Apoptosis occurred in the HepG2 cells after transfection by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha. Microarray analysis showed consistent results. The results suggest that peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor
Dynamic gamma knife radiosurgery
International Nuclear Information System (INIS)
Luan Shuang; Swanson, Nathan; Chen Zhe; Ma Lijun
2009-01-01
Gamma knife has been the treatment of choice for various brain tumors and functional disorders. Current gamma knife radiosurgery is planned in a 'ball-packing' approach and delivered in a 'step-and-shoot' manner, i.e. it aims to 'pack' the different sized spherical high-dose volumes (called 'shots') into a tumor volume. We have developed a dynamic scheme for gamma knife radiosurgery based on the concept of 'dose-painting' to take advantage of the new robotic patient positioning system on the latest Gamma Knife C(TM) and Perfexion(TM) units. In our scheme, the spherical high dose volume created by the gamma knife unit will be viewed as a 3D spherical 'paintbrush', and treatment planning reduces to finding the best route of this 'paintbrush' to 'paint' a 3D tumor volume. Under our dose-painting concept, gamma knife radiosurgery becomes dynamic, where the patient moves continuously under the robotic positioning system. We have implemented a fully automatic dynamic gamma knife radiosurgery treatment planning system, where the inverse planning problem is solved as a traveling salesman problem combined with constrained least-square optimizations. We have also carried out experimental studies of dynamic gamma knife radiosurgery and showed the following. (1) Dynamic gamma knife radiosurgery is ideally suited for fully automatic inverse planning, where high quality radiosurgery plans can be obtained in minutes of computation. (2) Dynamic radiosurgery plans are more conformal than step-and-shoot plans and can maintain a steep dose gradient (around 13% per mm) between the target tumor volume and the surrounding critical structures. (3) It is possible to prescribe multiple isodose lines with dynamic gamma knife radiosurgery, so that the treatment can cover the periphery of the target volume while escalating the dose for high tumor burden regions. (4) With dynamic gamma knife radiosurgery, one can obtain a family of plans representing a tradeoff between the delivery time and
Exclusive production of pion pairs in {gamma}*{gamma} collisions at Large Q{sup 2}
Energy Technology Data Exchange (ETDEWEB)
Diehl, M.
2000-03-15
The authors perform a QCD analysis of the exclusive production of two mesons in {gamma}*{gamma} collisions in the kinematical domain of large photon virtuality Q and small hadronic invariant mass W. This reaction is dominated by a scale invariant mechanism which factorizes into a perturbative subprocess, {gamma}*{gamma} {r{underscore}arrow} q{anti q} or {gamma}*{gamma} {r{underscore}arrow} gg, and a generalized two-meson distribution amplitude. The authors develop in detail the phenomenology of this process at e{sup +}e{sup {minus}} colliders. Using a simple model for the two-pion distribution amplitude, based on its general properties, the authors estimate the cross section for the kinematics accessible at BABAR, BELLE, CLEO and LEP.
Collimatorless imaging of gamma rays with help of gamma-ray tracking
Marel, J V D
2001-01-01
In many gamma-ray detector systems that are built for imaging purposes Compton scattered photons are suppressed as much as possible. However, the information from photons that scattered inside a detector system can be used to reconstruct the tracks of the photons with help of gamma-ray tracking. Estimates of the incident directions of the photons can be made and an image can be created. Examples of potential applications for this technique are the use as a gamma-camera in medical imaging (e.g. SPECT) or as a detector for PET. Due to the omission of collimators, much higher detection efficiencies can be achieved, reducing the doses required for an image. A gamma-ray tracking method, called backtracking, has been developed for nuclear spectroscopy. The method tracks gamma-rays originating from a point source in the center of a spherical detector system consisting of position-sensitive germanium detectors. This method can also be used as a tracking technique for imaging of an unknown source distribution. With he...
Determination of transcriptional units and gene products from the ftsA region of Escherichia coli.
Lutkenhaus, J F; Wu, H C
1980-01-01
Lambda transducing phage gamma 16-2 carries the genes envA, ftsZ, ftsA, ddl, and murC and directs the synthesis of six unique proteins in ultraviolet-irradiated cells. Various derivatives of gamma 16-2 carrying smaller segments of the bacterial deoxyribonucleic acid have also been analyzed for their capacity to direct protein synthesis in ultraviolet-irradiated cells. These results, in combination with genetic results, have allowed the gene product of each of these genes to be assigned. In addition, an unidentified gene was located counterclockwise to murC between murC and murF. Analysis of the direction of transcription indicates that murC, ddl, ftsA, and ftsZ are transcribed clockwise on the Escherichia coli genetic map, and envA is transcribed counterclockwise. In addition, it is shown that each of the genes envA, ftsZ, and ftsA can be expressed independently. Images PMID:6447690
Localization of the gamma-radiation sources using the gamma-visor
Directory of Open Access Journals (Sweden)
Ivanov Kirill E.
2008-01-01
Full Text Available The search of the main gamma-radiation sources at the site of the temporary storage of solid radioactive wastes was carried out. The relative absorbed dose rates were measured for some of the gamma-sources before and after the rehabilitation procedures. The effectiveness of the rehabilitation procedures in the years 2006-2007 was evaluated qualitatively and quantitatively. The decrease of radiation background at the site of the temporary storage of the solid radioactive wastes after the rehabilitation procedures allowed localizing the new gamma-source.
Localization of the gamma-radiation sources using the gamma-visor
International Nuclear Information System (INIS)
Ivanov, K. E.; Ponomaryev-Stepnoi, N. N.; Stepennov, B. S.; Teterin, Y. A.; Teterin, A. Y.; Kharitonov, V. V.
2008-01-01
The search of the main gamma-radiation sources at the site of the temporary storage of solid radioactive wastes was carried out. The relative absorbed dose rates were measured for some of the gamma-sources before and after the rehabilitation procedures. The effectiveness of the rehabilitation procedures in the years 2006-2007 was evaluated qualitatively and quantitatively. The decrease of radiation background at the site of the temporary storage of the solid radioactive wastes after the rehabilitation procedures al lowed localizing the new gamma-source. (author)
Energy Technology Data Exchange (ETDEWEB)
Kumar, Ashok; Soni, S K; Pancholi, S K; Gupta, S L [Delhi Univ. (India). Dept. of Physics and Astrophysics
1976-10-01
The results are presented of measuring the differential perturbed angular ..gamma gamma..-correlations for the ..gamma.. 1063.62 - ..gamma.. 569.67 keV cascade in /sup 207/Bi. The results obtained are analyzed and compared with data of other authors.
Reactivation of fetal hemoglobin in thalassemia and sickle cell disease
Directory of Open Access Journals (Sweden)
Sandro Eridani
2014-09-01
Full Text Available Considerable attention has been recently devoted to mechanisms involved in the perinatal hemoglobin switch, as it was long ago established that the survival of fetal hemoglobin (HbF production in significant amount can reduce the severity of the clinical course in severe disorders like β-thalassemia and sickle cell disease (SCD. For instance, when β-thalassemia is associated with hereditary persistence of fetal hemoglobin (HPFH the disease takes a mild course, labeled as thalassemia intermedia. The same clinical amelioration occurs for the association between HPFH and SCD. As for the mechanism of this effect, some information has been obtained from the study of natural mutations at the human β-globin locus in patients with increased HbF, like the Corfu thalassemia mutations. Important evidence came from the discovery that drugs capable of improving the clinical picture of SCD, like decitabine ad hydroxycarbamide, are acting through the reactivation, to some extent, of HbF synthesis. The study of the mechanism of action of these compounds was followed by the identification of some genetic determinants, which promote this event. In particular, among a few genetic factors involved in this process, the most relevant appears the BCL11A gene, which is now credited to be able to silence γ-globin genes in the perinatal period by interaction with several erythroid-specific transcription factors and is actually considered as a barrier to HbF reactivation by known HbF inducing agents. Epigenetics is also a player in the process, mainly through DNA demethylation. This is certified by the recent demonstration that hypomethylating agents such as 5-azacytidine and decitabine, the first compounds used for HbF induction by pharmacology, act as irreversible inhibitors of demethyltransferase enzymes. Great interest has also been raised by the finding that several micro-RNAs, which act as negative regulators of gene expression, have been implicated in the
International Nuclear Information System (INIS)
Lindgren, E.
1974-01-01
The author makes a survey of his experience in sterilization and sterility control of medical products. At present three different methods are used, steamsterilization, gassterilizing and gammasterilizing. The investments and costs for gamma radiation is presented and a comparison of the costs for gamma- and gassterilization including sterility control is made. (M.S.)
Kristie, T M; Roizman, B
1986-01-01
Herpes simplex virus type 1 genes form at least five groups (alpha, beta 1, beta 2, gamma 1, and gamma 2) whose expression is coordinately regulated and sequentially ordered in a cascade fashion. Previous studies have shown that functional alpha 4 gene product is essential for the transition from alpha to beta protein synthesis and have suggested that alpha 4 gene expression is autoregulatory. We have previously reported that labeled DNA fragments containing promoter-regulatory domains of thr...
Multiple hard interactions in $\\gamma\\gamma$ and $\\gamma$p physics at LEP and HERA
Butterworth, J.M.; Seymour, M.H.; Storrow, J.K.; Walker, R.
1995-01-01
At e^+e^- and ep colliders, the large fluxes of almost on-shell photons accompanying the lepton beams lead to the photoproduction of jets. As the centre-of-mass energy is increased, regions of smaller x in the parton densities are explored and these are regions of high parton density. As a result, the probability for more than one hard partonic scattering occurring in a single \\gamma \\gamma or \\gamma p collision can become significant. This effect has been simulated using an eikonal prescription combined with the HERWIG Monte Carlo program. The possible effects of multiple hard interactions on event shapes and jet cross sections have been studied in this framework at a range of energies relevant to HERA and LEPII. The results indicate that the effects could be significant.
Energy Technology Data Exchange (ETDEWEB)
Ichimiya, Tsutomu [Japan Radioisotope Association, Tokyo (Japan); Narita, Tsutomu; Kitao, Kensuke
1998-03-01
A quick index to {gamma}-rays and X-rays from natural radionuclides is presented. In the list, {gamma}-rays are arranged in order of increasing energy. The list also contains {gamma}-rays from radioactive nuclides produced in a germanium detector and its surrounding materials by interaction with cosmic neutrons, as well as direct {gamma}-rays from interaction with the neutrons. Artificial radioactive nuclides emitting {gamma}-rays with same or near energy value as that of the natural {gamma}-rays and X-rays are also listed. In appendix, {gamma}-ray spectra from a rock, uranium ore, thorium, monazite and uraninite and also background spectra obtained with germanium detectors placed in iron or lead shield have been given. The list is designed for use in {gamma}-ray spectroscopy under the conditions of highly natural background, such as in-situ environmental radiation monitoring or low-level activity measurements, with a germanium detector. (author)
GammaSem Proceedings - A Nordic seminar for users of gamma spectrometry
International Nuclear Information System (INIS)
Nunez, P.; Klemola, S.; Nielsen, Sven P.; Palsson, S.E.; Israelson, C.
2010-03-01
The project GammaSem was proposed to provide a forum for discussions and sharing of information on practical issues concerning gamma spectrometry and to establish a network of users of gamma spectrometry in the Nordic countries, thereby strengthening the collaboration and improving all participants' competence in practical gamma spectrometry. The seminars' focus was practical challenges met by the users themselves, rather than theoretical matters. Scientists and users of gamma spectrometry from all five Nordic countries were invited to the seminar, as well as scientist from the Baltic countries. A total of 75 people participated; representing 34 different universities, commercial companies, research institutes and also all Nordic authorities. During the seminar several key issues for follow-up were identified and working groups for addressing the identified problems were established. The working groups were: 1) Uncertainties and detections of limits 2) True summing coincidence 3) Monte Carlo simulations and efficiency transfer 4) Absorption (density corrections and geometries) 5) Mobile gamma spectrometry systems 6) Nuclear forensics (on special samples and special parts of the spectra). The identified topics will form the basis for the agenda of the next seminar in 2010. There, the different working groups will be invited to present their ideas/solutions to the relevant problems. (author)
GammaSem Proceedings - A Nordic seminar for users of gamma spectrometry
Energy Technology Data Exchange (ETDEWEB)
Nunez, P. (ed.) (Institute for Energy Technology (IFE) (Norway)); Klemola, S. (Radiation and Nuclear Safety Authority (STUK) (Finland)); Nielsen, Sven P. (Technical Univ. of Denmark, Risoe National Lab. for Sustainable Energy. Roskilde (Denmark)); Palsson, S.E. (Icelandic Radiation Safety Authority (IS)); Israelson, C. (National Institute of Radiation Protection (Denmark))
2010-03-15
The project GammaSem was proposed to provide a forum for discussions and sharing of information on practical issues concerning gamma spectrometry and to establish a network of users of gamma spectrometry in the Nordic countries, thereby strengthening the collaboration and improving all participants' competence in practical gamma spectrometry. The seminars' focus was practical challenges met by the users themselves, rather than theoretical matters. Scientists and users of gamma spectrometry from all five Nordic countries were invited to the seminar, as well as scientist from the Baltic countries. A total of 75 people participated; representing 34 different universities, commercial companies, research institutes and also all Nordic authorities. During the seminar several key issues for follow-up were identified and working groups for addressing the identified problems were established. The working groups were: 1) Uncertainties and detections of limits 2) True summing coincidence 3) Monte Carlo simulations and efficiency transfer 4) Absorption (density corrections and geometries) 5) Mobile gamma spectrometry systems 6) Nuclear forensics (on special samples and special parts of the spectra). The identified topics will form the basis for the agenda of the next seminar in 2010. There, the different working groups will be invited to present their ideas/solutions to the relevant problems. (author)
Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan
2014-01-01
Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a substitution of Phe for Leu at position 91 of α1-globin chain, originally described in individual of unknown ethnic background. This article addresses the interaction of Hb Grey Lynn with a non-deletional α(+)-thalassemia found in Thailand, a hitherto un-described condition. The proband was adult Thai woman referred for investigation of mild anemia with Hb 90 g/L. Hb analyses using low pressure liquid chromatography raised a suspicion of abnormal Hb presence, which was failed to demonstrate by cellulose acetate electrophoresis and capillary electrophoresis. DNA sequencing identified a CTT (Leu) to TTT (Phe) mutation at codon 91 corresponding to the Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1) on α1-globin gene and a C deletion between codons 36 and 37 on α2-globin gene causing α(+)-thalassemia. As compared to those observed in a compound heterozygote for Hb Grey Lynn / α(0)-thalassemia reported previously, higher MCV (81.7 fL) and MCH (26.3 pg) values with a lower level of Hb Grey Lynn (19.7%) were observed in the proband. The normochromic normocytic anemia observed could be due to the interaction of Hb Grey Lynn with α(+)-thalassemia. The two mutations could be identified using PCR-RFLP and allele-specific PCR assays developed.
Lauw, F. N.; Simpson, A. J.; Prins, J. M.; van Deventer, S. J.; Chaowagul, W.; White, N. J.; van der Poll, T.
2000-01-01
Gamma interferon (IFN-gamma)-inducible protein 10 (IP-10) and monokine induced by IFN-gamma (Mig) are related CXC chemokines which bind to the CXCR3 receptor and specifically target activated T lymphocytes and natural killer (NK) cells. The production of IP-10 and Mig by various cell types in vitro
Experiment list: SRX1098180 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available ensitivity source_name=Cultured K562 cells || transduced gene=dCas9-KRAB || grna target=globin HS2 enhancer ...is=Leukemia Chronic Myelogenous 106502015,0.0,52.4,0 GSM1824418: dCas9 KRAB rep2; Homo sapiens; DNase-Hypers
Use of γ-irradiated pollen for the gene transfer in Petunia
International Nuclear Information System (INIS)
Andrejchenko, S.V.; Grodzinskij, D.M.
1986-01-01
Possibility of using gamma-irradiated pollen for the gene transfer in Petunia is shown. Occurrence of gametic transformation provided not only the gene integration and expression but also their transfer to the daughter generations. The described methodical approach to construction of the plant eucariotic cell genome is based not only on its simplicity but also on the fact that gamma-radiation doses of 1000 Gy and higher have no desorganizing effect on the chromatine structure in such a degree that its transcription activity is completely lost. Besides, selective inactivation of the locus radiation in the pollen genome is much assisted by their different radioresistance. Though the gene transfer by gametic transformation is mostly irregular but its probability may be increased by the correct selection of the pollen irradiation dose in a range in which the growth of pollen tube before ovary is conserved and reparation of one-strand and two-strand DNA breaks preventing chromatine fragmentation is suppressed
Thompson, David
2012-01-01
Gamma rays reveal extreme, nonthermal conditions in the Universe. The Fermi Gamma-ray Space Telescope has been exploring the gamma-ray sky for more than four years, enabling a search for powerful transients like gamma-ray bursts, novae, solar flares, and flaring active galactic nuclei, as well as long-term studies including pulsars, binary systems, supernova remnants, and searches for predicted sources of gamma rays such as dark matter annihilation. Some results include a stringent limit on Lorentz invariance derived from a gamma-ray burst, unexpected gamma-ray variability from the Crab Nebula, a huge gamma-ray structure associated with the center of our galaxy, surprising behavior from some gamma-ray binary systems, and a possible constraint on some WIMP models for dark matter.
Fabrication of gamma sources using the neutron-gamma reactions of 238Pu13C
International Nuclear Information System (INIS)
Solinhac, I.; Maillard, C.; Donnet, L.
2004-01-01
A production campaign for 238 Pu 13 C sources with gamma fluence ranging from 2500 to 4500 gamma/s/4π at 6.13 MeV was carried out in 2002 in Atalante. An experimental study was undertaken to prepare the 238 PuC mixture, which is the most delicate step. This procedure is described together with the other steps in the source fabrication process: purification of a plutonium oxide batch, preparation of a nitric solution of 238 Pu, measurement of the gamma fluence of the PuC mixture before and after insertion into each of the two stainless steel capsules that constitute a PuN 2 O package, welding of the second envelope followed by leak testing, final measurement of the gamma fluence of the sealed source. This PuC sources fabrication procedure is effective: all the sources include the required gamma activity with an uncertainty on the gamma fluence of less than 10%. (authors)
A scale invariant clustering of genes on human chromosome 7
Directory of Open Access Journals (Sweden)
Kendal Wayne S
2004-01-01
Full Text Available Abstract Background Vertebrate genes often appear to cluster within the background of nontranscribed genomic DNA. Here an analysis of the physical distribution of gene structures on human chromosome 7 was performed to confirm the presence of clustering, and to elucidate possible underlying statistical and biological mechanisms. Results Clustering of genes was confirmed by virtue of a variance of the number of genes per unit physical length that exceeded the respective mean. Further evidence for clustering came from a power function relationship between the variance and mean that possessed an exponent of 1.51. This power function implied that the spatial distribution of genes on chromosome 7 was scale invariant, and that the underlying statistical distribution had a Poisson-gamma (PG form. A PG distribution for the spatial scattering of genes was validated by stringent comparisons of both the predicted variance to mean power function and its cumulative distribution function to data derived from chromosome 7. Conclusion The PG distribution was consistent with at least two different biological models: In the microrearrangement model, the number of genes per unit length of chromosome represented the contribution of a random number of smaller chromosomal segments that had originated by random breakage and reconstruction of more primitive chromosomes. Each of these smaller segments would have necessarily contained (on average a gamma distributed number of genes. In the gene cluster model, genes would be scattered randomly to begin with. Over evolutionary timescales, tandem duplication, mutation, insertion, deletion and rearrangement could act at these gene sites through a stochastic birth death and immigration process to yield a PG distribution. On the basis of the gene position data alone it was not possible to identify the biological model which best explained the observed clustering. However, the underlying PG statistical model implicated neutral
Measurement of the Charm Production Cross Section in gamma gamma Collisions at LEP
Acciarri, M.; Adriani, O.; Aguilar-Benitez, M.; Alcaraz, J.; Alemanni, G.; Allaby, J.; Aloisio, A.; Alviggi, M.G.; Ambrosi, G.; Anderhub, H.; Andreev, Valery P.; Angelescu, T.; Anselmo, F.; Arefev, A.; Azemoon, T.; Aziz, T.; Bagnaia, P.; Bajo, A.; Baksay, L.; Balandras, A.; Baldew, S.V.; Banerjee, S.; Banerjee, Sw.; Barczyk, A.; Barillere, R.; Bartalini, P.; Basile, M.; Batalova, N.; Battiston, R.; Bay, A.; Becattini, F.; Becker, U.; Behner, F.; Bellucci, L.; Berbeco, R.; Berdugo, J.; Berges, P.; Bertucci, B.; Betev, B.L.; Bhattacharya, S.; Biasini, M.; Biland, A.; Blaising, J.J.; Blyth, S.C.; Bobbink, G.J.; Bohm, A.; Boldizsar, L.; Borgia, B.; Bourilkov, D.; Bourquin, M.; Braccini, S.; Branson, J.G.; Brochu, F.; Buffini, A.; Buijs, A.; Burger, J.D.; Burger, W.J.; Cai, X.D.; Capell, M.; Cara Romeo, G.; Carlino, G.; Cartacci, A.M.; Casaus, J.; Castellini, G.; Cavallari, F.; Cavallo, N.; Cecchi, C.; Cerrada, M.; Cesaroni, F.; Chamizo, M.; Chang, Y.H.; Chaturvedi, U.K.; Chemarin, M.; Chen, A.; Chen, G.; Chen, G.M.; Chen, H.F.; Chen, H.S.; Chiefari, G.; Cifarelli, L.; Cindolo, F.; Civinini, C.; Clare, I.; Clare, R.; Coignet, G.; Colino, N.; Costantini, S.; Cotorobai, F.; de la Cruz, B.; Csilling, A.; Cucciarelli, S.; Dai, T.S.; van Dalen, J.A.; D'Alessandro, R.; de Asmundis, R.; Deglon, P.; Degre, A.; Deiters, K.; della Volpe, D.; Delmeire, E.; Denes, P.; DeNotaristefani, F.; De Salvo, A.; Diemoz, M.; Dierckxsens, M.; van Dierendonck, D.; Dionisi, C.; Dittmar, M.; Dominguez, A.; Doria, A.; Dova, M.T.; Duchesneau, D.; Dufournaud, D.; Duinker, P.; El Mamouni, H.; Engler, A.; Eppling, F.J.; Erne, F.C.; Ewers, A.; Extermann, P.; Fabre, M.; Falagan, M.A.; Falciano, S.; Favara, A.; Fay, J.; Fedin, O.; Felcini, M.; Ferguson, T.; Fesefeldt, H.; Fiandrini, E.; Field, J.H.; Filthaut, F.; Fisher, P.H.; Fisk, I.; Forconi, G.; Freudenreich, K.; Furetta, C.; Galaktionov, Iouri; Ganguli, S.N.; Garcia-Abia, Pablo; Gataullin, M.; Gau, S.S.; Gentile, S.; Gheordanescu, N.; Giagu, S.; Gong, Z.F.; Grenier, Gerald Jean; Grimm, O.; Gruenewald, M.W.; Guida, M.; van Gulik, R.; Gupta, V.K.; Gurtu, A.; Gutay, L.J.; Haas, D.; Hasan, A.; Hatzifotiadou, D.; Hebbeker, T.; Herve, Alain; Hidas, P.; Hirschfelder, J.; Hofer, H.; Holzner, G.; Hoorani, H.; Hou, S.R.; Hu, Y.; Iashvili, I.; Jin, B.N.; Jones, Lawrence W.; de Jong, P.; Josa-Mutuberria, I.; Khan, R.A.; Kafer, D.; Kaur, M.; Kienzle-Focacci, M.N.; Kim, D.; Kim, J.K.; Kirkby, Jasper; Kiss, D.; Kittel, W.; Klimentov, A.; Konig, A.C.; Kopal, M.; Kopp, A.; Koutsenko, V.; Kraber, M.; Kraemer, R.W.; Krenz, W.; Kruger, A.; Kunin, A.; Ladron de Guevara, P.; Laktineh, I.; Landi, G.; Lebeau, M.; Lebedev, A.; Lebrun, P.; Lecomte, P.; Lecoq, P.; Le Coultre, P.; Lee, H.J.; Le Goff, J.M.; Leiste, R.; Levtchenko, P.; Li, C.; Likhoded, S.; Lin, C.H.; Lin, W.T.; Linde, F.L.; Lista, L.; Liu, Z.A.; Lohmann, W.; Longo, E.; Lu, Y.S.; Lubelsmeyer, K.; Luci, C.; Luckey, David; Lugnier, L.; Luminari, L.; Lustermann, W.; Ma, W.G.; Maity, M.; Malgeri, L.; Malinin, A.; Mana, C.; Mangeol, D.; Mans, J.; Marian, G.; Martin, J.P.; Marzano, F.; Mazumdar, K.; McNeil, R.R.; Mele, S.; Merola, L.; Meschini, M.; Metzger, W.J.; von der Mey, M.; Mihul, A.; Milcent, H.; Mirabelli, G.; Mnich, J.; Mohanty, G.B.; Moulik, T.; Muanza, G.S.; Muijs, A.J.M.; Musicar, B.; Musy, M.; Napolitano, M.; Nessi-Tedaldi, F.; Newman, H.; Niessen, T.; Nisati, A.; Kluge, Hannelies; Ofierzynski, R.; Organtini, G.; Oulianov, A.; Palomares, C.; Pandoulas, D.; Paoletti, S.; Paolucci, P.; Paramatti, R.; Park, H.K.; Park, I.H.; Passaleva, G.; Patricelli, S.; Paul, Thomas Cantzon; Pauluzzi, M.; Paus, C.; Pauss, F.; Pedace, M.; Pensotti, S.; Perret-Gallix, D.; Petersen, B.; Piccolo, D.; Pierella, F.; Pieri, M.; Piroue, P.A.; Pistolesi, E.; Plyaskin, V.; Pohl, M.; Pojidaev, V.; Postema, H.; Pothier, J.; Prokofev, D.O.; Prokofiev, D.; Quartieri, J.; Rahal-Callot, G.; Rahaman, M.A.; Raics, P.; Raja, N.; Ramelli, R.; Rancoita, P.G.; Ranieri, R.; Raspereza, A.; Raven, G.; Razis, P.; Ren, D.; Rescigno, M.; Reucroft, S.; Riemann, S.; Riles, Keith; Rodin, J.; Roe, B.P.; Romero, L.; Rosca, A.; Rosier-Lees, S.; Roth, Stefan; Rosenbleck, C.; Roux, B.; Rubio, J.A.; Ruggiero, G.; Rykaczewski, H.; Saremi, S.; Sarkar, S.; Salicio, J.; Sanchez, E.; Sanders, M.P.; Schafer, C.; Schegelsky, V.; Schmidt-Kaerst, S.; Schmitz, D.; Schopper, H.; Schotanus, D.J.; Schwering, G.; Sciacca, C.; Seganti, A.; Servoli, L.; Shevchenko, S.; Shivarov, N.; Shoutko, V.; Shumilov, E.; Shvorob, A.; Siedenburg, T.; Son, D.; Smith, B.; Spillantini, P.; Steuer, M.; Stickland, D.P.; Stone, A.; Stoyanov, B.; Straessner, A.; Sudhakar, K.; Sultanov, G.; Sun, L.Z.; Sushkov, S.; Suter, H.; Swain, J.D.; Szillasi, Z.; Sztaricskai, T.; Tang, X.W.; Tauscher, L.; Taylor, L.; Tellili, B.; Teyssier, D.; Timmermans, Charles; Ting, Samuel C.C.; Ting, S.M.; Tonwar, S.C.; Toth, J.; Tully, C.; Tung, K.L.; Uchida, Y.; Ulbricht, J.; Valente, E.; Vesztergombi, G.; Vetlitsky, I.; Vicinanza, D.; Viertel, G.; Villa, S.; Vivargent, M.; Vlachos, S.; Vodopianov, I.; Vogel, H.; Vogt, H.; Vorobev, I.; Vorobov, A.A.; Vorvolakos, A.; Wadhwa, M.; Wallraff, W.; Wang, M.; Wang, X.L.; Wang, Z.M.; Weber, A.; Weber, M.; Wienemann, P.; Wilkens, H.; Wu, S.X.; Wynhoff, S.; Xia, L.; Xu, Z.Z.; Yamamoto, J.; Yang, B.Z.; Yang, C.G.; Yang, H.J.; Yang, M.; Ye, J.B.; Yeh, S.C.; Zalite, A.; Zalite, Yu.; Zhang, Z.P.; Zhu, G.Y.; Zhu, R.Y.; Zichichi, A.; Zilizi, G.; Zimmermann, B.; Zoller, M.
2001-01-01
Open charm production in gamma-gamma collisions is studied with data collected at e+e- centre-of-mass energies from 189 GeV to 202 GeV corresponding to a total integrated luminosity of 410 pb-1. The charm cross section sigma(gamma gamma ---> c c~ X) is measured for the first time as a function of the two-photon centre-of-mass energy in the interval from 5 GeV to 70 GeV and is compared to NLO QCD calculations.
Upper limits on the branching ratios $\\tau$ --> $\\mu\\gamma$ and $\\tau$ --> e$\\gamma$
Abreu, P; Adye, T; Agasi, E; Ajinenko, I; Aleksan, Roy; Alekseev, G D; Allport, P P; Almehed, S; Alvsvaag, S J; Amaldi, Ugo; Amato, S; Andreazza, A; Andrieux, M L; Antilogus, P; Apel, W D; Arnoud, Y; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barão, F; Barate, R; Barbiellini, Guido; Bardin, Dimitri Yuri; Barker, G J; Baroncelli, A; Bärring, O; Barrio, J A; Bartl, Walter; Bates, M J; Battaglia, Marco; Baubillier, M; Baudot, J; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Benvenuti, Alberto C; Berggren, M; Bertrand, D; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bloch, D; Blume, M; Blyth, S; Bocci, V; Bolognese, T; Bonesini, M; Bonivento, W; Booth, P S L; Borisov, G; Bosio, C; Bosworth, S; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Bricman, C; Brillault, L; Brown, R C A; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Buys, A; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Cankocak, K; Cao, F; Carena, F; Carrilho, P; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Cerrito, L; Chabaud, V; Chapkin, M M; Charpentier, P; Chaussard, L; Chauveau, J; Checchia, P; Chelkov, G A; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Cindro, V; Collins, P; Contreras, J L; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; Dahl-Jensen, Erik; Dahm, J; D'Almagne, B; Dam, M; Damgaard, G; Daum, A; Dauncey, P D; Davenport, Martyn; Da Silva, W; Defoix, C; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; De Boeck, H; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; De Saint-Jean, C; Dijkstra, H; Di Ciaccio, Lucia; Djama, F; Dolbeau, J; Dönszelmann, M; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Dufour, Y; Dupont, F; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Elsing, M; Engel, J P; Ershaidat, N; Erzen, B; Espirito-Santo, M C; Falk, E; Fassouliotis, D; Feindt, Michael; Ferrer, A; Filippas-Tassos, A; Firestone, A; Fischer, P A; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frenkiel, P; Fries, D E C; Frodesen, A G; Frühwirth, R; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Gibbs, M; Gokieli, R; Golob, B; Gopal, Gian P; Gorn, L; Górski, M; Guz, Yu; Gracco, Valerio; Graziani, E; Grosdidier, G; Gunnarsson, P; Günther, M; Guy, J; Haedinger, U; Hahn, F; Hahn, M; Hahn, S; Hajduk, Z; Hallgren, A; Hamacher, K; Hao, W; Harris, F J; Hedberg, V; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Higón, E; Hilke, Hans Jürgen; Hill, T S; Holmgren, S O; Holt, P J; Holthuizen, D J; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Ioannou, P; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, Christian; Juillot, P; Kaiser, M; Kapusta, F; Karlsson, M; Karvelas, E; Katsanevas, S; Katsoufis, E C; Keränen, R; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klein, H; Klovning, A; Kluit, P M; Köhne, J H; Köne, B; Kokkinias, P; Koratzinos, M; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Kramer, P H; Krammer, Manfred; Kreuter, C; Królikowski, J; Kronkvist, I J; Krumshtein, Z; Krupinski, W; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Laktineh, I; Lamblot, S; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Lapin, V; Last, I; Laugier, J P; Lauhakangas, R; Ledroit, F; Lefébure, V; Legan, C K; Leitner, R; Lemoigne, Y; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Liko, D; Lindner, R; Lipniacka, A; Lippi, I; Lörstad, B; Lokajícek, M; Loken, J G; López, J M; López-Fernandez, A; López-Aguera, M A; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J N; Maehlum, G; Maio, A; Malychev, V; Mandl, F; Marco, J; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Maron, T; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Marvik, K; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; Medbo, J; Meroni, C; Meyer, W T; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Morettini, P; Müller, H; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Negri, P; Némécek, S; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Niss, P; Nomerotski, A; Normand, Ainsley; Oberschulte-Beckmann, W; Obraztsov, V F; Olshevskii, A G; Orava, Risto; Österberg, K; Ouraou, A; Paganini, P; Paganoni, M; Pagès, P; Palka, H; Papadopoulou, T D; Pape, L; Parkes, C; Parodi, F; Passeri, A; Pegoraro, M; Peralta, L; Pernegger, H; Pernicka, Manfred; Perrotta, A; Petridou, C; Petrolini, A; Phillips, H T; Piana, G; Pierre, F; Pimenta, M; Pindo, M; Plaszczynski, S; Podobrin, O; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Prest, M; Privitera, P; Pukhaeva, N; Pullia, Antonio; Radojicic, D; Ragazzi, S; Rahmani, H; Rames, J; Ratoff, P N; Read, A L; Reale, M; Rebecchi, P; Redaelli, N G; Regler, Meinhard; Reid, D; Renton, P B; Resvanis, L K; Richard, F; Richardson, J; Rídky, J; Rinaudo, G; Ripp, I; Romero, A; Roncagliolo, I; Ronchese, P; Roos, L; Rosenberg, E I; Rosso, E; Roudeau, Patrick; Rovelli, T; Rückstuhl, W; Ruhlmann-Kleider, V; Ruiz, A; Rybicki, K; Saarikko, H; Sacquin, Yu; Sadovskii, A; Sajot, G; Salt, J; Sánchez, J; Sannino, M; Schneider, H; Schyns, M A E; Sciolla, G; Scuri, F; Sedykh, Yu; Segar, A M; Seitz, A; Sekulin, R L; Shellard, R C; Siccama, I; Siegrist, P; Simonetti, S; Simonetto, F; Sissakian, A N; Sitár, B; Skaali, T B; Smadja, G; Smirnov, N; Smirnova, O G; Smith, G R; Sosnowski, R; Souza-Santos, D; Spassoff, Tz; Spiriti, E; Sponholz, P; Squarcia, S; Stanescu, C; Stapnes, Steinar; Stavitski, I; Stepaniak, K; Stichelbaut, F; Stocchi, A; Strauss, J; Strub, R; Stugu, B; Szczekowski, M; Szeptycka, M; Tabarelli de Fatis, T; Tavernet, J P; Chikilev, O G; Tilquin, A; Timmermans, J; Tkatchev, L G; Todorov, T; Toet, D Z; Tomaradze, A G; Tomé, B; Tortora, L; Tranströmer, G; Treille, D; Trischuk, W; Tristram, G; Trombini, A; Troncon, C; Tsirou, A L; Turluer, M L; Tyapkin, I A; Tyndel, M; Tzamarias, S; Überschär, B; Ullaland, O; Uvarov, V; Valenti, G; Vallazza, E; Van der Velde, C; van Apeldoorn, G W; van Dam, P; Van Doninck, W K; Van Eldik, J; Vassilopoulos, N; Vegni, G; Ventura, L; Venus, W A; Verbeure, F; Verlato, M; Vertogradov, L S; Vilanova, D; Vincent, P; Vitale, L; Vlasov, E; Vodopyanov, A S; Vrba, V; Wahlen, H; Walck, C; Weierstall, M; Weilhammer, Peter; Wetherell, Alan M; Wicke, D; Wickens, J H; Wielers, M; Wilkinson, G R; Williams, W S C; Winter, M; Witek, M; Woschnagg, K; Yip, K; Yushchenko, O P; Zach, F; Zacharatou-Jarlskog, C; Zaitsev, A; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zevgolatakos, E; Zimin, N I; Zito, M; Zontar, D; Zuberi, R; Zucchelli, G C; Zumerle, G
1995-01-01
The DELPHI collaboration has searched for lepton flavour violating decays \\tau \\rightarrow \\mu \\gamma and \\tau \\rightarrow e \\gamma using a data sample of about 70~pb^{-1} of integrated luminosity corresponding to 81 000 produced \\tau^+ \\tau^- events. No candidates were found for either of the two modes. This yields branching ratio upper limits of \\rm{B}( \\tau \\rightarrow e \\gamma ) < 1.1 \\times 10^{-4} and \\rm{B} ( \\tau \\rightarrow \\mu \\gamma) < 6.2 \\times 10^{-5} at 90\\% confidence level.
Multiple Gamma-Ray Detection Capability of a CeBr3 Detector for Gamma Spectroscopy
Directory of Open Access Journals (Sweden)
A. A. Naqvi
2017-01-01
Full Text Available The newly developed cerium tribromide (CeBr3 detector has reduced intrinsic gamma-ray activity with gamma energy restricted to 1400–2200 keV energy range. This narrower region of background gamma rays allows the CeBr3 detector to detect more than one gamma ray to analyze the gamma-ray spectrum. Use of multiple gamma-ray intensities in elemental analysis instead of a single one improves the accuracy of the estimated results. Multigamma-ray detection capability of a cylindrical 75 mm × 75 mm (diameter × height CeBr3 detector has been tested by analyzing the chlorine concentration in water samples using eight chlorine prompt gamma rays over 517 to 8578 keV energies utilizing a D-D portable neutron generator-based PGNAA setup and measuring the corresponding minimum detection limit (MDC of chlorine. The measured MDC of chlorine for gamma rays with 517–8578 keV energies varies from 0.07 ± 0.02 wt% to 0.80 ± 0.24. The best value of MDC was measured to be 0.07 ± 0.02 wt% for 788 keV gamma rays. The experimental results are in good agreement with Monte Carlo calculations. The study has shown excellent detection capabilities of the CeBr3 detector for eight prompt gamma rays over 517–8578 keV energy range without significant background interference.
Soldatov, Evgeny; The ATLAS collaboration
2016-01-01
The production of Z bosons with one or two isolated high energy photons is studied using pp collisions at 8 TeV. The analyses use a data sample with an integrated luminosity of 20.3 $fb^{-1}$ collected by the ATLAS detector during the 2012 LHC data taking. The $Z\\gamma$ and $Z\\gamma\\gamma$ production cross sections are measured with leptonic (ee, $\\mu\\mu$, $\
Energy Technology Data Exchange (ETDEWEB)
Antipov, Yu.M. [Institute for High Energy Physics, Protvino (Russian Federation); Artamonov, A.V. [Institute for High Energy Physics, Protvino (Russian Federation); Batarin, V.A. [Institute for High Energy Physics, Protvino (Russian Federation); Vavilov, D.V. [Institute for High Energy Physics, Protvino (Russian Federation); Victorov, V.A. [Institute for High Energy Physics, Protvino (Russian Federation); Eroshin, O.V. [Institute for High Energy Physics, Protvino (Russian Federation); Golovkin, S.V. [Institute for High Energy Physics, Protvino (Russian Federation); Gorin, Yu.P. [Institute for High Energy Physics, Protvino (Russian Federation); Kolganov, V.Z. [Institute of Theoretical and Experimental Physics, Moscow (Russian Federation); Kozhevnikov, A.P. [Institute for High Energy Physics, Protvino (Russian Federation); Konstantinov, A.S. [Institute for High Energy Physics, Protvino (Russian Federation); Kubarovsky, V.P. [Institute for High Energy Physics, Protvino (Russian Federation); Kurshetsov, V.F. [Institute for High Energy Physics, Protvino (Russian Federation); Landsberg, L.G. [Institute for High Energy Physics, Protvino (Russian Federation)]. E-mail: lgl@mx.ihep.su; Leontiev, V.M. [Institute for High Energy Physics, Protvino (Russian Federation); Lomkatsi, G.S. [Institute of Theoretical and Experimental Physics, Moscow (Russian Federation); Molchanov, V.V. [Institute for High Energy Physics, Protvino (Russian Federation)]. E-mail: molchanov@mx.ihep.su; Mukhin, V.A. [Institute for High Energy Physics, Protvino (Russian Federation); Nilov, A.F. [Institute of Theoretical and Experimental Physics, Moscow (Russian Federation); Patalakha, D.I. [Institute for High Energy Physics, Protvino (Russian Federation); Petrenko, S.V. [Institute for High Energy Physics, Protvino (Russian Federation); Smolyankin, V.T. [Institute of Theoretical and Experimental Physics, Moscow (Russian Federation)
2004-12-16
The radiative decay {lambda}(1520)->{lambda}{gamma} was measured directly in the study of the exclusive diffractive-like reaction p+N->{lambda}(1520)K{sup +}+N, {lambda}(1520)->{lambda}{gamma} with the SPHINX spectrometer. The values of the branching and partial width of this radiative decay were obtained: BR[{lambda}(1520)->{lambda}{gamma}]=(1.02+/-0.21(stat)+/-0.15(syst))x10{sup -2} and {gamma}[{lambda}(1520)->{lambda}{gamma}]=159+/-33(stat)+/-26(syst)-bar keV.
Dynamic gamma knife radiosurgery
Energy Technology Data Exchange (ETDEWEB)
Luan Shuang; Swanson, Nathan; Chen Zhe [Department of Computer Science, University of New Mexico, Albuquerque, NM 87131 (United States); Ma Lijun [Department of Radiation Oncology, University of California San Francisco, San Francisco, CA 94143 (United States)], E-mail: sluan@cs.unm.edu, E-mail: nate@cs.unm.edu, E-mail: zchen@cs.unm.edu, E-mail: lijunma@radonc.ucsf.edu
2009-03-21
Gamma knife has been the treatment of choice for various brain tumors and functional disorders. Current gamma knife radiosurgery is planned in a 'ball-packing' approach and delivered in a 'step-and-shoot' manner, i.e. it aims to 'pack' the different sized spherical high-dose volumes (called 'shots') into a tumor volume. We have developed a dynamic scheme for gamma knife radiosurgery based on the concept of 'dose-painting' to take advantage of the new robotic patient positioning system on the latest Gamma Knife C(TM) and Perfexion(TM) units. In our scheme, the spherical high dose volume created by the gamma knife unit will be viewed as a 3D spherical 'paintbrush', and treatment planning reduces to finding the best route of this 'paintbrush' to 'paint' a 3D tumor volume. Under our dose-painting concept, gamma knife radiosurgery becomes dynamic, where the patient moves continuously under the robotic positioning system. We have implemented a fully automatic dynamic gamma knife radiosurgery treatment planning system, where the inverse planning problem is solved as a traveling salesman problem combined with constrained least-square optimizations. We have also carried out experimental studies of dynamic gamma knife radiosurgery and showed the following. (1) Dynamic gamma knife radiosurgery is ideally suited for fully automatic inverse planning, where high quality radiosurgery plans can be obtained in minutes of computation. (2) Dynamic radiosurgery plans are more conformal than step-and-shoot plans and can maintain a steep dose gradient (around 13% per mm) between the target tumor volume and the surrounding critical structures. (3) It is possible to prescribe multiple isodose lines with dynamic gamma knife radiosurgery, so that the treatment can cover the periphery of the target volume while escalating the dose for high tumor burden regions. (4) With dynamic gamma knife radiosurgery, one can
International Nuclear Information System (INIS)
Ehstulin, I.V.
1980-01-01
A brief consideration is being given to the history of cosmic gamma burst discovery and modern knowledge of their properties. The time dependence of gamma bursts is described and their possible sources are discussed
Applied gamma-ray spectrometry
Dams, R; Crouthamel, Carl E
1970-01-01
Applied Gamma-Ray Spectrometry covers real life application of the gamma-ray and the devices used in their experimental studies. This book is organized into 9 chapters, and starts with discussions of the various decay processes, the possible interaction mechanisms of gamma radiation with matter, and the intrinsic and extrinsic variables, which affect the observed gamma-ray and X-ray spectra. The subsequent chapters deal with the properties and fabrication of scintillation detectors, semiconductor detectors, and proportional gas counters. These chapters present some of the most widely utilized
DEFF Research Database (Denmark)
Geisler, C
1992-01-01
surface expression of the Ti/CD3 complex. Transfection of the wild-type CD3-gamma gene into JGN reconstituted expression of functional Ti/CD3 complexes, and analysis of T cell lines producing different amounts of CD3-gamma indicated that CD3-gamma and CD3-delta competed for the binding to CD3-epsilon.......The TCR consists of the Ti alpha beta heterodimer and the associated CD3 chains, CD3 gamma delta epsilon zeta 2 or zeta eta. The structural relationships between the subunits of the Ti/CD3 complex are still not fully understood. To explore the roles of the individual CD3 chains for the assembly......, intracellular processing, and expression of the TCR, mutants of the T cell line Jurkat were isolated. One variant, JGN, was found to produce all the Ti/CD3 components with the exception of CD3-gamma. The results indicate that: 1) the tetrameric form (Ti alpha beta-CD3 delta epsilon) of the Ti/CD3 complex...
Cosmical sources of gamma radiation
Energy Technology Data Exchange (ETDEWEB)
Kuchowicz, B [Warsaw Univ. (Poland)
1974-01-01
A brief historical outline of the X-ray and ..gamma..-ray astronomies is given first, then a summary of the recent status of X-ray astronomy follows. Further chapters include information on ..gamma..-ray sources in the solar system, in our Galaxy, and beyond it. In discussing linear gamma spectra attention is paid to the possibility of studying explosive nucleo-synthesis by observation of gamma lines from supernova remnants, etc. Questions of the isotropic gamma background are discussed at the end of the survey.
Effect of low-dose gamma radiation on HIV replication in human peripheral blood mononuclear cells
Energy Technology Data Exchange (ETDEWEB)
Xu, Y. [British Columbia Centre for Excellence in HIV/AIDS, British Columbia (Canada); Conway, B. [British Columbia Centre for Excellence in HIV/AIDS, British Columbia (Canada)]|[British Columbia Centre for Excellence in HIV/AIDS, British Columbia (Canada). Dept. of Medicine; Montaner, J.S.G. [British Columbia Centre for Excellence in HIV/AIDS, British Columbia (Canada)]|[British Columbia Centre for Excellence in HIV/AIDS, British Columbia (Canada). Dept. of Medicine]|[Canadian HIV Trials Network, Vancouver (Canada); O`Shaughnessy, M.V. [British Columbia Centre for Excellence in HIV/AIDS, British Columbia (Canada)]|[British Columbia Centre for Excellence in HIV/AIDS, British Columbia (Canada). Faculty of Medicine]|[Canadian HIV Trials Network, Vancouver (Canada); Greenstock, C.L. [AECL Research, Chalk River, Ontario (Canada). Radiation Biology and Health Physics Branch
1996-08-01
Recent studies have demonstrated that UV light and x-irradiation enhance human immunodeficiency virus (HIV) gene expression. There are few published data on related effects of {gamma}-radiation. This may be of clinical relevance, as radiotherapy has been used extensively for the treatment of acquired immunodeficiency syndrome associated conditions. We have studied the effects of {gamma}-radiation on HIV replication in mono-nuclear cells (MC). These cells were obtained from five seronegative healthy donors, exposed to 0-200 cGy {gamma}-radiation, stimulated with phytohemagglutinin-P (PHA-P) for 24 h, infected with a laboratory strain of HIV (HTLV-IIIB, multiplicity of infection = 0.001), then carried in culture for 14 days. Overall, when considering p24 antigen levels on days 7 and 11 in cultures established from cells exposed to 50 cGy, the maximal levels were significantly higher than those measured in the parallel control cultures taken as a whole (P < 0.05), with viral replication enhanced as much as 1000-fold in one case. No significant cytotoxicity was observed following exposure to doses up to 50 cGy. The mechanism of the observed effect remains unknown but may relate to direct gene activation and/or free radical generation, leading to such activation. To date, there is no evidence that viral stimulation occurs following therapeutic radiation in a clinical setting. (author).
Quantitative analysis of gene-specific DNA damage in human spermatozoa
International Nuclear Information System (INIS)
Sawyer, Dennis E.; Mercer, Belinda G.; Wiklendt, Agnieszka M.; Aitken, R. John
2003-01-01
Recent studies have suggested that human spermatozoa are highly susceptible to DNA damage induced by oxidative stress. However, a detailed analysis of the precise nature of this damage and the extent to which it affects the mitochondrial and nuclear genomes has not been reported. To induce DNA damage, human spermatozoa were treated in vitro with hydrogen peroxide (H 2 O 2 ; 0-5 mM) or iron (as Fe(II)SO 4 , 0-500 μM). Quantitative PCR (QPCR) was used to measure DNA damage in individual nuclear genes (hprt, β-pol and β-globin) and mitochondrial DNA. Single strand breaks were also assessed by alkaline gel electrophoresis. H 2 O 2 was found to be genotoxic toward spermatozoa at concentrations as high as 1.25 mM, but DNA damage was not detected in these cells with lower concentrations of H 2 O 2 . The mitochondrial genome of human spermatozoa was significantly (P 2 O 2 -induced DNA damage than the nuclear genome. However, both nDNA and mtDNA in human spermatozoa were significantly (P<0.001) more resistant to damage than DNA from a variety of cell lines of germ cell and myoblastoid origin. Interestingly, significant DNA damage was also not detected in human spermatozoa treated with iron. These studies report, for the first time, quantitative measurements of DNA damage in specific genes of male germ cells, and challenge the commonly held belief that human spermatozoa are particularly vulnerable to DNA damage
Dubey, J P; Verma, S K; Dunams, D; Calero-Bernal, R; Rosenthal, B M
2015-11-01
The North American opossum (Didelphis virginiana) is the definitive host for at least three named species of Sarcocystis: Sarcocystis falcatula, Sarcocystis neurona and Sarcocystis speeri. The South American opossums (Didelphis albiventris, Didelphis marsupialis and Didelphis aurita) are definitive hosts for S. falcatula and S. lindsayi. The sporocysts of these Sarcocystis species are similar morphologically. They are also not easily distinguished genetically because of the difficulties of DNA extraction from sporocysts and availability of distinguishing genetic markers. Some of these species can be distinguished by bioassay; S. neurona and S. speeri are infective to gamma interferon gene knockout (KO) mice, but not to budgerigars (Melopsittacus undulatus); whereas S. falcatula and S. lindsayi are infective to budgerigars but not to KO mice. The natural intermediate host of S. speeri is unknown. In the present study, development of sarcocysts of S. speeri in the KO mice is described. Sarcocysts were first seen at 12 days post-inoculation (p.i.), and they became macroscopic (up to 4 mm long) by 25 days p.i. The structure of the sarcocyst wall did not change from the time bradyzoites had formed at 50-220 days p.i. Sarcocysts contained unique villar protrusions, 'type 38'. The polymerase chain reaction amplifications and sequences analysis of three nuclear loci (18S rRNA, 28S rRNA and ITS1) and two mitochondrial loci (cox1 and cytb) of S. speeri isolate from an Argentinean opossum (D. albiventris) confirmed its membership among species of Sarcocystis and indicated an especially close relationship to another parasite in this genus that employs opossums as its definitive host, S. neurona. These results should be useful in finding natural intermediate host of S. speeri.
Directory of Open Access Journals (Sweden)
Alexandra Agapidou
2018-01-01
Full Text Available Beta thalassemia dominant results from mutations in the β globin chain gene resulting in the production of elongated, highly unstable beta globin chains. Several such mutations have been described and in a heterozygous state they may confer a phenotype more severe than that of β thalassemia trait and lead to a clinical syndrome of thalassemia intermedia and its associated complications such as extramedullary hemopoiesis, bone disease, endocrinopathies and iron overload even in the absence of transfusion. In this report we present a case of double heterozygocity for HbC and β thalassemia dominant leading to a series of complications that were treated successfully once the correct diagnosis was made.
Energy Technology Data Exchange (ETDEWEB)
Pottier, R; Berger, R [Commissariat a l' Energie Atomique, Centre d' Etudes Nucleaires de Fontenay-aux-Roses, 92 (France)
1966-06-01
A procedure is described for the qualitative and quantitative spectrographic analysis of radioactive sources containing two alpha-gamma emitters having the same alpha energy or two beta-gamma emitters having the same gamma energy. The main apparatus is a multichannel pulse-height analyzer including a coincidence circuit. The principle of the method, the synoptic scheme, the electronic device, the type of sources, and the precautions to be taken or the corrections to take into account are reported. The results obtained in solving the three following problems are discussed as examples of applications of the method: analysis of {sup 241}Am in alpha-gamma sources containing {sup 238}Pu; analysis of {sup 237}Np in beta-gamma sources containing {sup 239}Pu; and analysis of {sup 106}Ru-{sup 106}Rh in beta-gamma sources containing {sup 95}Zr-{sup 95}Nb. (authors) [French] Dans ce. rapport, on presente une methode d'analyse spectrographique qualitative et quantitative de sources radioactives contenant deux emetteurs alpha-gamma de meme energie alpha et deux emetteurs beta-gamma de meme energie gamma. L'organe principal est un analyseur d'amplitude a 400 canaux comprenant un circuit de coincidence. On decrit le principe de la methode, le schema synoptique, l'appareillage, le type des sources, les precautions a prendre ou les corrections a faire. On discute les resultats obtenus dans la solution des trois problemes suivants traites a titre d'application de la methode: 1. analyse d'americium 241 en presence de plutonium 238; 2. analyse de neptunium 237 en presence de plutonium 239; 3. analyse de ruthenium 106-rhodium 106 en presence de zirconium 95-niobium 95. (auteurs)
Effects of gamma radiations on some aspects of the biology of salmonella
International Nuclear Information System (INIS)
Ben Miloud, Najla
2007-01-01
This work aimed at the study of the effect of gamma radiation on certain aspects of the biology of Salmonella, few works joined this type and gamma radiations. The lethal effect of ionizing radiations was associated at other bacterial types, to an oxidative stress due to the presence of reactive spices of oxygen and leading to deteriorations of membrane cells, proteins and nucleic acids.Thus, we proceeded to an analysis of the viability of four Salmonella serovars subject to different radiation doses going from 0.5 to 2 KGy. The results showed a viability reduction dose dependent with a differential behavior, statistically significant. In order to detect possible radio induced changes at the restriction site of the enzymes XbaI and BlnI usually used for the typing of Salmonella, we carried out a DNA restriction profile analyse of the four serovars by pulsed filed gel electrophoresis. The results showed that no change appeared on the level of these restriction sites for the used enzymes following an irradiation of 2KGy. The study of the sensitivity of Salmonella to antibiotics after a gamma radiation showed that gamma radiation has increased the sensitivity of Salmonella isolates to porin associated antibiotics. Statistical analyses showed that the effect of different irradiation dose treatment on the antibiotic sensitivity is increasingly significant. The irradiation didn't induce modifications of the sensitivity to other antibiotics, probably because of their nature, of their penetration mode inside the cell or their action way. To tray to explain the differential behavior of different serovars to irradiation. We analyzed by Quantitative real time PCR (RT- PCR), the expression level of the ARNm of the genes KATN (catalase non-hemique), DNAK (protein of thermal shock), RNA polymerase as well as of the 16S rRNA. The results showed either a repression or an induction of certain genes under the effect of an irradiation of 2 KGy. (Author)
New stage in high-energy gamma-ray studies with GAMMA-400 after Fermi-LAT
Directory of Open Access Journals (Sweden)
Topchiev N.P.
2017-01-01
Full Text Available Fermi-LAT has made a significant contribution to the study of high-energy gamma-ray diffuse emission and the observations of 3000 discrete sources. However, one third of all gamma-ray sources (both galactic and extragalactic are unidentified, the data on the diffuse gamma-ray emission should be clarified, and signatures of dark matter particles in the high-energy gamma-ray range are not observed up to now. GAMMA-400, the currently developing gamma-ray telescope, will have angular (∼0.01∘ at 100 GeV and energy (∼1% at 100 GeV resolutions in the energy range of 10–1000 GeV which are better than Fermi-LAT (as well as ground gamma-ray telescopes by a factor of 5–10. It will observe some regions of the Universe (such as the Galactic Center, Fermi Bubbles, Crab, Cygnus, etc. in a highly elliptic orbit (without shading the telescope by the Earth continuously for a long time. It will allow us to identify many discrete sources, to clarify the structure of extended sources, to specify the data on the diffuse emission, and to resolve gamma rays from dark matter particles.
Analysis of copper-nickel ores by gamma-gamma method in ore enrichment works
International Nuclear Information System (INIS)
Bol'shakov, A.Yu.; Tovstenko, Yu.G.; Chinskij, E.B.; Eliseev, G.I.
1973-01-01
The paper presents experimental data on continuous gamma-gamma assay of copper-nickel ores on conveyor belts and of dry discrete samples of classifier overflow at the enrichment plants of the Pechenganikel' group. The relative errors are given of the results of comparison of two-hour rapid analyses and shift and 24-hour chemical analyses of classifier overflow samples with the figures for gamma-gamma assay. The factors affecting the accuracy of the latter technique are elucidated. Practical recommendations are given on the use of this technique at the above enrichment plants. (author)
Top quark electric dipole and Z gamma gamma couplings at a photon collider
Poulose, P
2001-01-01
Effect of the top quark electric dipole coupling and the Z gamma gamma coupling is studied in the pair production of top quark at a photon collider using CP-violating asymmetries. Our results show that with a photon collider of geometrical luminosity of 20 fb sup - sup 1 it is possible to put limits of the order of 0.1 on the Z gamma gamma coupling and about 2.5x10 sup - sup 1 sup 7 e cm on the top quark electric dipole coupling using these asymmetries.