WorldWideScience

Sample records for g-quadruplex structure formed

  1. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  2. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Science.gov (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  3. Experimental approaches to identify cellular G-quadruplex structures and functions.

    Science.gov (United States)

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

    2012-05-01

    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

    Science.gov (United States)

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

    2016-10-13

    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  5. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Science.gov (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  6. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Science.gov (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  7. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Science.gov (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    Science.gov (United States)

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  9. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

    Science.gov (United States)

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

    2017-08-01

    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  10. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  11. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

    Science.gov (United States)

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

    2014-03-21

    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  13. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Science.gov (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  14. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  15. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  16. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    Science.gov (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  17. Effect of Urea on G-Quadruplex Stability.

    Science.gov (United States)

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  18. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    Science.gov (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. DNA secondary structures: stability and function of G-quadruplex structures

    Science.gov (United States)

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  20. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    Science.gov (United States)

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  1. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Science.gov (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  3. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  4. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  5. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  6. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Directory of Open Access Journals (Sweden)

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  7. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  8. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  9. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

    Science.gov (United States)

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-01-01

    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  10. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  11. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    Science.gov (United States)

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  12. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  14. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  15. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  16. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Science.gov (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  17. Macrocyclic G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, M C; Ulven, Trond

    2010-01-01

    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  18. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Science.gov (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  19. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  20. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Juan Hu

    2013-01-01

    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  1. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  2. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Science.gov (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  3. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  4. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    Science.gov (United States)

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  5. Selectivity in ligand recognition of G-quadruplex loops.

    Science.gov (United States)

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

    2009-03-03

    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  6. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Science.gov (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  7. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Science.gov (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2018-06-01

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  8. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

    Science.gov (United States)

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

    2018-05-01

    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  9. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Directory of Open Access Journals (Sweden)

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  10. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Science.gov (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  11. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  12. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

    Science.gov (United States)

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

    2013-05-01

    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  13. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  14. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Science.gov (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  15. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    Science.gov (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  17. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

    Science.gov (United States)

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

    2013-01-01

    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  18. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  19. RPA-mediated unfolding of systematically varying G-quadruplex structures.

    Science.gov (United States)

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

    2013-05-21

    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  20. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  1. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Science.gov (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Science.gov (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  3. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Science.gov (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

    Science.gov (United States)

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

    2017-01-01

    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  5. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Directory of Open Access Journals (Sweden)

    Vikas Yadav

    2017-07-01

    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  6. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

    Science.gov (United States)

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

    2018-10-05

    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    Science.gov (United States)

    Schwindt, Eike; Paeschke, Katrin

    2017-11-02

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  8. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

    Science.gov (United States)

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

    2009-01-01

    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  9. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Directory of Open Access Journals (Sweden)

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  10. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Science.gov (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Directory of Open Access Journals (Sweden)

    Yunqiang Bian

    2014-04-01

    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  12. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Science.gov (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Aishwarya Prakash

    2011-01-01

    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  15. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  16. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Science.gov (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  17. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  18. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    Science.gov (United States)

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  19. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

    Science.gov (United States)

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2013-10-01

    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  20. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    Science.gov (United States)

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  1. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

    Science.gov (United States)

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

    2013-10-01

    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  2. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    OpenAIRE

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  3. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Science.gov (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  4. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  5. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  7. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  8. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

    Science.gov (United States)

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

    2012-09-19

    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  10. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Natalia Rizeq

    2017-12-01

    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  11. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Science.gov (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  12. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Science.gov (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  13. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  14. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    Science.gov (United States)

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  15. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    DEFF Research Database (Denmark)

    Porru, Manuela; Artuso, Simona; Salvati, Erica

    2015-01-01

    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  16. Local epigenetic reprogramming induced by G-quadruplex ligands

    Science.gov (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  17. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  18. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    Science.gov (United States)

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  19. Monovalent cation induced structural transitions in telomeric DNAs: G-DNA folding intermediates

    International Nuclear Information System (INIS)

    Hardin, C.C.; Watson, T.; Henderson, E.; Prosser, J.K.

    1991-01-01

    Telomeric DNA consists of G- and C-rich strands that are always polarized such that the G-rich strand extends past the 3' end of the duplex to form a 12-16-base overhang. These overhanging strands can self-associate in vitro to form intramolecular structures that have several unusual physical properties and at least one common feature, the presence of non-Watson-Crick G·G base pairs. The term G-DNA was coined for this class of structures. On the basis of gel electrophoresis, imino proton NMR, and circular dichroism (CD) results, the authors find that changing the counterions from sodium to potassium specifically induces conformational transitions in the G-rich telomeric DNA from Tetrahymena, d(T 2 G 4 ) 4 (TET4), which results in a change from the intramolecular species to an apparent multistranded structure, accompanied by an increase in the melting temperature of the base pairs of >25 degree, as monitored by loss of the imino proton NMR signals. They infer that the multistranded structure is a quadruplex. The results indicate that specific differences in ionic interactions can result in a switch in telomeric DNAs between intramolecular hairpin-like or quadruplex-containing species and intermolecular quadruplex structures, all of which involve G·G base pairing interaction. They propose a model in which duplex or hairpin forms of G-DNA are folding intermediates in the formation of either 1-, 2-, or 4-stranded quadruplex structures

  20. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Science.gov (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  1. Simultaneous G-Quadruplex DNA Logic.

    Science.gov (United States)

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Thermal stability of DNA quadruplex-duplex hybrids.

    Science.gov (United States)

    Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

    2014-01-14

    DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

  3. A twice-as-smart synthetic G-quartet: PyroTASQ is both a smart quadruplex ligand and a smart fluorescent probe.

    Science.gov (United States)

    Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David

    2014-09-03

    Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.

  4. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

    Science.gov (United States)

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

    2018-06-01

    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  5. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  6. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  7. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Science.gov (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  8. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

    Science.gov (United States)

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  9. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  10. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  11. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Science.gov (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

    Science.gov (United States)

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

    2016-03-02

    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Science.gov (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  14. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  15. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  16. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    Science.gov (United States)

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  17. G-quadruplex recognition activities of E. Coli MutS

    Directory of Open Access Journals (Sweden)

    Ehrat Edward A

    2012-07-01

    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  18. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

    Science.gov (United States)

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

    2014-07-23

    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  20. G-Quadruplexes influence pri-microRNA processing.

    Science.gov (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  1. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  3. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    Science.gov (United States)

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

    Science.gov (United States)

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

    2015-03-02

    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    Directory of Open Access Journals (Sweden)

    David Monchaud

    2010-01-01

    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  6. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    Science.gov (United States)

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  8. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  9. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  10. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

    Science.gov (United States)

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

    2013-11-20

    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  11. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Science.gov (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  12. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Science.gov (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  13. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  14. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    Science.gov (United States)

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  15. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Science.gov (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  16. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  17. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    Science.gov (United States)

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  18. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    Science.gov (United States)

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  19. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Directory of Open Access Journals (Sweden)

    Charlotte Rehm

    Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  20. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Science.gov (United States)

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  1. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Science.gov (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  2. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  3. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  4. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Science.gov (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  6. The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.

    2007-01-01

    Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

  7. Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.

    Science.gov (United States)

    Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek

    2015-06-22

    A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  9. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  10. Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.

    Directory of Open Access Journals (Sweden)

    Ezekiel Crenshaw

    Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

  11. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  12. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    Science.gov (United States)

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

    DEFF Research Database (Denmark)

    Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

    2016-01-01

    DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

  15. Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

    Science.gov (United States)

    Kocman, Vojč; Plavec, Janez

    2017-05-01

    Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

  16. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  17. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Science.gov (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  18. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Science.gov (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  19. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Science.gov (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  20. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Science.gov (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  1. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  2. Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

    Science.gov (United States)

    Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

    2018-02-01

    Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

    Science.gov (United States)

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

    2018-06-01

    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  4. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  5. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

    2009-01-01

    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  6. Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

    Science.gov (United States)

    Hirashima, Kyotaro; Seimiya, Hiroyuki

    2015-02-27

    Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. 6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

    Science.gov (United States)

    Marathias, V M; Sawicki, M J; Bolton, P H

    1999-07-15

    The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

  8. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

    Science.gov (United States)

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

    2014-07-15

    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Structure of a Stable G-Hairpin

    Czech Academy of Sciences Publication Activity Database

    Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.

    2017-01-01

    Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded-dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016

  10. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  11. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  12. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  13. A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

    Science.gov (United States)

    Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

    2016-06-15

    The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    Science.gov (United States)

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  15. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  16. DNA and RNA Quadruplex-Binding Proteins

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav

    2014-01-01

    Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014

  17. Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization

    Directory of Open Access Journals (Sweden)

    Victor Constantin Diculescu

    2010-01-01

    Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

  18. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Science.gov (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  19. RPA prevents G-rich structure formation at lagging-strand telomeres to allow maintenance of chromosome ends.

    Science.gov (United States)

    Audry, Julien; Maestroni, Laetitia; Delagoutte, Emmanuelle; Gauthier, Tiphaine; Nakamura, Toru M; Gachet, Yannick; Saintomé, Carole; Géli, Vincent; Coulon, Stéphane

    2015-07-14

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in DNA replication, recombination, and repair. In fission yeast, the Rpa1-D223Y mutation provokes telomere shortening. Here, we show that this mutation impairs lagging-strand telomere replication and leads to the accumulation of secondary structures and recruitment of the homologous recombination factor Rad52. The presence of these secondary DNA structures correlates with reduced association of shelterin subunits Pot1 and Ccq1 at telomeres. Strikingly, heterologous expression of the budding yeast Pif1 known to efficiently unwind G-quadruplex rescues all the telomeric defects of the D223Y cells. Furthermore, in vitro data show that the identical D to Y mutation in human RPA specifically affects its ability to bind G-quadruplex. We propose that RPA prevents the formation of G-quadruplex structures at lagging-strand telomeres to promote shelterin association and facilitate telomerase action at telomeres. © 2015 The Authors.

  20. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

    Science.gov (United States)

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

    2018-02-07

    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  1. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  2. Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates.

    Science.gov (United States)

    Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen

    2015-11-23

    A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

    Science.gov (United States)

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

    2016-01-15

    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

    Science.gov (United States)

    2015-01-01

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  5. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

    Science.gov (United States)

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

    2014-01-01

    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  6. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

    Science.gov (United States)

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

    2014-09-01

    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

    2017-01-01

    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  8. Isolation of deletion alleles by G4 DNA-induced mutagenesis

    NARCIS (Netherlands)

    Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel

    Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature

  9. Real-Time Study of the Interaction between G-Rich DNA Oligonucleotides and Lead Ion on DNA Tetrahedron-Functionalized Sensing Platform by Dual Polarization Interferometry.

    Science.gov (United States)

    Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong

    2017-11-29

    G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.

  10. New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

    2014-01-01

    The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

  11. Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

    Directory of Open Access Journals (Sweden)

    Bidisha Sengupta

    Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

  12. Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

    Science.gov (United States)

    Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

    2013-01-01

    Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

  13. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Science.gov (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  14. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Science.gov (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  15. Extended molecular dynamics of a c-kit promoter quadruplex

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

    2015-01-01

    Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  16. A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

    Science.gov (United States)

    Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

    2017-09-20

    Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

  17. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

    Science.gov (United States)

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

    2015-08-04

    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  18. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  19. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Mycobacterium tuberculosis DinG is a structure-specific helicase that unwinds G4 DNA: implications for targeting G4 DNA as a novel therapeutic approach.

    Science.gov (United States)

    Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh

    2014-09-05

    The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.

    Science.gov (United States)

    Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh

    2017-10-18

    G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  2. Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence

    Science.gov (United States)

    Tawani, Arpita; Kumar, Amit

    2015-01-01

    Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543

  3. Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

    Science.gov (United States)

    Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

    2018-03-09

    Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.

    Science.gov (United States)

    Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V

    2015-03-28

    Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.

  5. Examination of the effect of the annealing cation on higher order structures containing guanine or isoguanine repeats

    Science.gov (United States)

    Pierce, Sarah E.; Wang, Junmei; Jayawickramarajah, Janarthanan; Hamilton, Andrew D.; Brodbelt, Jennifer S.

    2010-01-01

    Isoguanine (2-oxo-6-amino-guanine), a natural but non-standard base, exhibits unique self-association properties compared to its isomer, guanine, and results in formation of different higher order DNA structures. In this work, the higher order structures formed by oligonucleotides containing guanine repeats or isoguanine repeats after annealing in solutions containing various cations are evaluated by electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy. The guanine-containing strand (G9) consistently formed quadruplexes upon annealing, whereas the isoguanine strand (Ig9) formed both pentaplexes and quadruplexes depending on the annealing cation. Quadruplex formation with G9 showed some dependence on the identity of the cation present during annealing with high relative quadruplex formation detected with six of ten cations. Analogous annealing experiments with Ig9 resulted in complex formation with all ten cations, and the majority of the resulting complexes were pentaplexes. CD results indicated most of the original complexes survived the desalting process necessary for ESI-MS analysis. In addition, several complexes, especially the pentaplexes, were found to be capable of cation exchange with ammonium ions. Ab initio calculations were conducted for isoguanine tetrads and pentads coordinated with all ten cations to predict the most energetically stable structures of the complexes in the gas phase. The observed preference of forming quadruplexes versus pentaplexes as a function of the coordinated cation can be interpreted by the calculated reaction energies of both the tetrads and pentads in combination with the distortion energies of tetrads. PMID:19746468

  6. Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.

    2017-01-01

    Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  7. Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

    Science.gov (United States)

    Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

    2010-08-21

    A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

  8. Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

    2009-01-01

    A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

  9. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Science.gov (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  10. Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela

    2009-01-01

    Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009

  11. Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons

    Czech Academy of Sciences Publication Activity Database

    Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris

    2014-01-01

    Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  12. High-resolution AFM structure of DNA G-wires in aqueous solution.

    Science.gov (United States)

    Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân

    2018-05-17

    We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.

  13. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    DEFF Research Database (Denmark)

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia

    2015-01-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  14. Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

    2017-01-01

    Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  15. Charge splitters and charge transport junctions based on guanine quadruplexes

    Science.gov (United States)

    Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

    2018-04-01

    Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

  16. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

    2017-01-01

    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  17. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

    Science.gov (United States)

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

    2015-01-28

    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  18. C9orf72 nucleotide repeat structures initiate molecular cascades of disease.

    Science.gov (United States)

    Haeusler, Aaron R; Donnelly, Christopher J; Periz, Goran; Simko, Eric A J; Shaw, Patrick G; Kim, Min-Sik; Maragakis, Nicholas J; Troncoso, Juan C; Pandey, Akhilesh; Sattler, Rita; Rothstein, Jeffrey D; Wang, Jiou

    2014-03-13

    A hexanucleotide repeat expansion (HRE), (GGGGCC)n, in C9orf72 is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Here we identify a molecular mechanism by which structural polymorphism of the HRE leads to ALS/FTD pathology and defects. The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA•DNA hybrids (R-loops). The structural polymorphism causes a repeat-length-dependent accumulation of transcripts aborted in the HRE region. These transcribed repeats bind to ribonucleoproteins in a conformation-dependent manner. Specifically, nucleolin, an essential nucleolar protein, preferentially binds the HRE G-quadruplex, and patient cells show evidence of nucleolar stress. Our results demonstrate that distinct C9orf72 HRE structural polymorphism at both DNA and RNA levels initiates molecular cascades leading to ALS/FTD pathologies, and provide the basis for a mechanistic model for repeat-associated neurodegenerative diseases.

  19. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Yanhua Chen

    2016-05-01

    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  20. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Science.gov (United States)

    Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

    2011-01-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

  1. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Science.gov (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  2. The estimation of H-bond and metal ion-ligand interaction energies in the G-Quadruplex ⋯ Mn+ complexes

    Science.gov (United States)

    Mostafavi, Najmeh; Ebrahimi, Ali

    2018-06-01

    In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.

  3. New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.

    Science.gov (United States)

    Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni

    2018-02-10

    The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50  = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  4. The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.

    Science.gov (United States)

    Zaccaria, F; Paragi, G; Fonseca Guerra, C

    2016-08-21

    The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.

  5. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

    Science.gov (United States)

    Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

    2011-12-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

  6. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

    Science.gov (United States)

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-04-12

    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  7. Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.

    Science.gov (United States)

    Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro

    2012-04-14

    The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012

  8. Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure.

    Science.gov (United States)

    Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie

    2018-06-01

    An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

    2015-08-05

    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

  10. Molecular recognition of naphthalene diimide ligands by telomeric quadruplex-DNA: the importance of the protonation state and mediated hydrogen bonds.

    Science.gov (United States)

    Spinello, A; Barone, G; Grunenberg, J

    2016-01-28

    In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.

  11. G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy.

    Directory of Open Access Journals (Sweden)

    Alexandro Membrino

    Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.

  12. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

    Science.gov (United States)

    Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

    2015-05-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

  13. Triplex intermediates in folding of human telomeric quadruplexes probed by microsecond-scale molecular dynamics simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří

    105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014

  14. A single thiazole orange molecule forms an exciplex in a DNA i-motif.

    Science.gov (United States)

    Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei

    2014-06-18

    A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.

  15. Can We Execute Reliable MM-PBSA Free Energy Computations of Relative Stabilities of Different Guanine Quadruplex Folds?

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří

    2016-01-01

    Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016

  16. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

    Science.gov (United States)

    Dhapola, Parashar; Chowdhury, Shantanu

    2016-01-01

    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

  17. Disintegration of cruciform and G-quadruplex structures during the course of helicase-dependent amplification (HDA).

    Science.gov (United States)

    Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu

    2015-04-15

    Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Backbone modified TBA analogues endowed with antiproliferative activity.

    Science.gov (United States)

    Esposito, Veronica; Russo, Annapina; Amato, Teresa; Varra, Michela; Vellecco, Valentina; Bucci, Mariarosaria; Russo, Giulia; Virgilio, Antonella; Galeone, Aldo

    2017-05-01

    The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. FANCJ couples replication past natural fork barriers with maintenance of chromatin structure.

    Science.gov (United States)

    Schwab, Rebekka A; Nieminuszczy, Jadwiga; Shin-ya, Kazuo; Niedzwiedz, Wojciech

    2013-04-01

    Defective DNA repair causes Fanconi anemia (FA), a rare childhood cancer-predisposing syndrome. At least 15 genes are known to be mutated in FA; however, their role in DNA repair remains unclear. Here, we show that the FANCJ helicase promotes DNA replication in trans by counteracting fork stalling on replication barriers, such as G4 quadruplex structures. Accordingly, stabilization of G4 quadruplexes in ΔFANCJ cells restricts fork movements, uncouples leading- and lagging-strand synthesis and generates small single-stranded DNA gaps behind the fork. Unexpectedly, we also discovered that FANCJ suppresses heterochromatin spreading by coupling fork movement through replication barriers with maintenance of chromatin structure. We propose that FANCJ plays an essential role in counteracting chromatin compaction associated with unscheduled replication fork stalling and restart, and suppresses tumorigenesis, at least partially, in this replication-specific manner.

  20. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression.

    Science.gov (United States)

    Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S

    2016-01-15

    The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

  1. Phenolic promiscuity in the cell nucleus--epigallocatechingallate (EGCG) and theaflavin-3,3'-digallate from green and black tea bind to model cell nuclear structures including histone proteins, double stranded DNA and telomeric quadruplex DNA.

    Science.gov (United States)

    Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai

    2013-02-01

    Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".

  2. HCMV gB shares structural and functional properties with gB proteins from other herpesviruses

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Sapna [Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111 (United States); Wisner, Todd W.; Johnson, David C. [Department of Molecular Microbiology and Immunology, Oregon Health and Sciences University, Portland, OR 97239 (United States); Heldwein, Ekaterina E., E-mail: katya.heldwein@tufts.edu [Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111 (United States)

    2013-01-20

    Glycoprotein B (gB) facilitates HCMV entry into cells by binding receptors and mediating membrane fusion. The crystal structures of gB ectodomains from HSV-1 and EBV are available, but little is known about the HCMV gB structure. Using multiangle light scattering and electron microscopy, we show here that HCMV gB ectodomain is a trimer with the overall shape similar to HSV-1 and EBV gB ectodomains. HCMV gB ectodomain forms rosettes similar to rosettes formed by EBV gB and the postfusion forms of other viral fusogens. Substitution of several bulky hydrophobic residues within the putative fusion loops with more hydrophilic residues reduced rosette formation and abolished cell fusion. We propose that like gB proteins from HSV-1 and EBV, HCMV gB has two internal hydrophobic fusion loops that likely interact with target membranes. Our work establishes structural and functional similarities between gB proteins from three subfamilies of herpesviruses.

  3. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA

    DEFF Research Database (Denmark)

    Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch

    2016-01-01

    of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...

  4. Improved Inhibition of Telomerase by Short Twisted Intercalating Nucleic Acids under Molecular Crowding Conditions

    DEFF Research Database (Denmark)

    Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich

    2012-01-01

    Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...

  5. Structural dynamics of thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG) quadruplex DNA studied by large-scale explicit solvent simulations

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří

    2010-01-01

    Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010

  6. Stability of Human Telomere Quadruplexes at High DNA Concentrations

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.

    2014-01-01

    Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014

  7. Glucose oxidase-initiated cascade catalysis for sensitive impedimetric aptasensor based on metal-organic frameworks functionalized with Pt nanoparticles and hemin/G-quadruplex as mimicking peroxidases.

    Science.gov (United States)

    Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju

    2017-12-15

    Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Ion Binding to Quadruplex DNA Stems. Comparison of MM and QM Descriptions Reveals Sizable Polarization Effects Not Included in Contemporary Simulations

    Czech Academy of Sciences Publication Activity Database

    Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří

    2014-01-01

    Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

  9. Remarks on Hamiltonian structures in G2-geometry

    International Nuclear Information System (INIS)

    Cho, Hyunjoo; Salur, Sema; Todd, A. J.

    2013-01-01

    In this article, we treat G 2 -geometry as a special case of multisymplectic geometry and make a number of remarks regarding Hamiltonian multivector fields and Hamiltonian differential forms on manifolds with an integrable G 2 -structure; in particular, we discuss existence and make a number of identifications of the spaces of Hamiltonian structures associated to the two multisymplectic structures associated to an integrable G 2 -structure. Along the way, we prove some results in multisymplectic geometry that are generalizations of results from symplectic geometry

  10. Thermodynamic and biological evaluation of a thrombin binding aptamer modified with several unlocked nucleic acid (UNA) monomers and a 2′-C-piperazino-UNA monomer

    DEFF Research Database (Denmark)

    Jensen, Troels B.; Henriksen, Jonas Rosager; Rasmussen, Bjarne E.

    2011-01-01

    Thrombin binding aptamer is a DNA 15-mer which forms a G-quadruplex structure and possess promising anticoagulant properties due to specific interactions with thrombin. Herein we present the influence of a single 2′-C-piperazino-UNA residue and UNA residues incorporated in several positions on th...

  11. Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

    Science.gov (United States)

    Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

    2015-01-01

    Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

  12. Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA

    Czech Academy of Sciences Publication Activity Database

    Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, R.; Vorlíčková, Michaela; Trantírek, L.

    2015-01-01

    Roč. 43, č. 9 (2015), s. 4733-4745 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA13-28310S; GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : NUCLEASE HYPERSENSITIVE ELEMENT * G-QUADRUPLEX STRUCTURES * I-MOTIF Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  13. Structural basis for IL-1α recognition by a modified DNA aptamer that specifically inhibits IL-1α signaling

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Xiaoming; Gelinas, Amy D.; von Carlowitz, Ira; Janjic, Nebojsa; Pyle, Anna Marie (Yale); (SomaLogic)

    2017-10-09

    IL-1α is an essential cytokine that contributes to inflammatory responses and is implicated in various forms of pathogenesis and cancer. Here we report a naphthyl modified DNA aptamer that specifically binds IL-1α and inhibits its signaling pathway. By solving the crystal structure of the IL-1α/aptamer, we provide a high-resolution structure of this critical cytokine and we reveal its functional interaction interface with high-affinity ligands. The non-helical aptamer, which represents a highly compact nucleic acid structure, contains a wealth of new conformational features, including an unknown form of G-quadruplex. The IL-1α/aptamer interface is composed of unusual polar and hydrophobic elements, along with an elaborate hydrogen bonding network that is mediated by sodium ion. IL-1α uses the same interface to interact with both the aptamer and its cognate receptor IL-1RI, thereby suggesting a novel route to immunomodulatory therapeutics.

  14. A self-consistent MoD-WM/MM structural refinement method: characterization of hydrogen bonding in the orytricha nova G-1uar

    Energy Technology Data Exchange (ETDEWEB)

    Batista, Enrique R [Los Alamos National Laboratory; Newcomer, Micharel B [YALE UNIV; Raggin, Christina M [YALE UNIV; Gascon, Jose A [YALE UNIV; Loria, J Patrick [YALE UNIV; Batista, Victor S [YALE UNIV

    2008-01-01

    This paper generalizes the MoD-QM/MM hybrid method, developed for ab initio computations of protein electrostatic potentials [Gasc6n, l.A.; Leung, S.S.F.; Batista, E.R.; Batista, V.S. J. Chem. Theory Comput. 2006,2, 175-186], as a practical algorithm for structural refinement of extended systems. The computational protocol involves a space-domain decomposition scheme for the formal fragmentation of extended systems into smaller, partially overlapping, molecular domains and the iterative self-consistent energy minimization of the constituent domains by relaxation of their geometry and electronic structure. The method accounts for mutual polarization of the molecular domains, modeled as Quantum-Mechanical (QM) layers embedded in the otherwise classical Molecular-Mechanics (MM) environment according to QM/MM hybrid methods. The method is applied to the description of benchmark models systems that allow for direct comparisons with full QM calculations, and subsequently applied to the structural characterization of the DNA Oxytricha nova Guanine quadruplex (G4). The resulting MoD-QM/MM structural model of the DNA G4 is compared to recently reported highresolution X-ray diffraction and NMR models, and partially validated by direct comparisons between {sup 1}H NMR chemical shifts that are highly sensitive to hydrogen-bonding and stacking interactions and the corresponding theoretical values obtained at the density functional theory DFT QM/MM (BH&H/6-31 G*:Amber) level in conjunction with the gauge independent atomic orbital (GIAO) method for the ab initio self consistent-field (SCF) calculation of NMR chemical shifts.

  15. Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.

    Science.gov (United States)

    Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar

    2010-06-01

    The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.

  16. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc00361g Click here for additional data file.

    Science.gov (United States)

    Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei

    2017-01-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564

  17. Internal circle uplifts, transversality and stratified G-structures

    Energy Technology Data Exchange (ETDEWEB)

    Babalic, Elena Mirela [Department of Theoretical Physics, National Institute of Physics and Nuclear Engineering,Str. Reactorului no.30, P.O.BOX MG-6, Postcode 077125, Bucharest-Magurele (Romania); Department of Physics, University of Craiova,13 Al. I. Cuza Str., Craiova 200585 (Romania); Lazaroiu, Calin Iuliu [Center for Geometry and Physics, Institute for Basic Science,Pohang 790-784 (Korea, Republic of)

    2015-11-24

    We study stratified G-structures in N=2 compactifications of M-theory on eight-manifolds M using the uplift to the auxiliary nine-manifold M̂=M×S{sup 1}. We show that the cosmooth generalized distribution D̂ on M̂ which arises in this formalism may have pointwise transverse or non-transverse intersection with the pull-back of the tangent bundle of M, a fact which is responsible for the subtle relation between the spinor stabilizers arising on M and M̂ and for the complicated stratified G-structure on M which we uncovered in previous work. We give a direct explanation of the latter in terms of the former and relate explicitly the defining forms of the SU(2) structure which exists on the generic locus U of M to the defining forms of the SU(3) structure which exists on an open subset Û of M̂, thus providing a dictionary between the eight- and nine-dimensional formalisms.

  18. NM23-H2 may play an indirect role in transcriptional activation of c-myc gene expression but does not cleave the nuclease hypersensitive element III1

    International Nuclear Information System (INIS)

    Dexheimer, Thomas S.; Carey, Steven S.; Zuohe, Song; Gokhale, Vijay M.; Hu, Xiaohui; Murata, Lauren B.; Maes, Estelle M.; Weichsel, Andrzej; Sun, Daekyu; Meuillet, Emmanuelle J.; Montfort, William R.; Hurley, Laurence H.

    2009-01-01

    The formation of G-quadruplex structures within the nuclease hypersensitive element (NHE) III 1 region of the c-myc promoter and the ability of these structures to repress c-myc transcription have been well established. However, just how these extremely stable DNA secondary structures are transformed to activate c-myc transcription is still unknown. NM23-H2/nucleoside diphosphate kinase B has been recognized as an activator of c-myc transcription via interactions with the NHE III 1 region of the c-myc gene promoter. Through the use of RNA interference, we confirmed the transcriptional regulatory role of NM23-H2. In addition, we find that further purification of NM23-H2 results in loss of the previously identified DNA strand cleavage activity, but retention of its DNA binding activity. NM23-H2 binds to both single-stranded guanine- and cytosine-rich strands of the c-myc NHE III 1 and, to a lesser extent, to a random single-stranded DNA template. However, it does not bind to or cleave the NHE III 1 in duplex form. Significantly, potassium ions and compounds that stabilize the G-quadruplex and i-motif structures have an inhibitory effect on NM23-H2 DNA-binding activity. Mutation of Arg 88 to Ala 88 (R88A) reduced both DNA and nucleotide binding but had minimal effect on the NM23-H2 crystal structure. On the basis of these data and molecular modeling studies, we have proposed a stepwise trapping-out of the NHE III 1 region in a single-stranded form, thus allowing single-stranded transcription factors to bind and activate c-myc transcription. Furthermore, this model provides a rationale for how the stabilization of the G-quadruplex or i-motif structures formed within the c-myc gene promoter region can inhibit NM23-H2 from activating c-myc gene expression.

  19. 75 FR 16492 - Agency Information Collection Activities: Form G-28, and Form G-28I, Revision of an Existing...

    Science.gov (United States)

    2010-04-01

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... Attorney. OMB Control No. 1615-0105. The Department of Homeland Security, U.S. Citizenship and Immigration... of Homeland Security sponsoring the collection: Form G-28, and Form G-28I. U.S. Citizenship and...

  20. RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.

    Science.gov (United States)

    Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J

    2012-05-11

    T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  2. Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří

    2004-01-01

    Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004

  3. Geometric structures associated with a simple Cartan 3-form

    Czech Academy of Sciences Publication Activity Database

    Le, Hong-Van

    2013-01-01

    Roč. 70, August (2013), s. 205-223 ISSN 0393-0440 Institutional support: RVO:67985840 Keywords : Cartan 3-form * multi-symplectic form * G-structure Subject RIV: BA - General Mathematics Impact factor: 0.797, year: 2013 http://www.sciencedirect.com/science/article/pii/S0393044013000740

  4. Structural Properties of G,T-Parallel Duplexes

    Directory of Open Access Journals (Sweden)

    Anna Aviñó

    2010-01-01

    Full Text Available The structure of G,T-parallel-stranded duplexes of DNA carrying similar amounts of adenine and guanine residues is studied by means of molecular dynamics (MD simulations and UV- and CD spectroscopies. In addition the impact of the substitution of adenine by 8-aminoadenine and guanine by 8-aminoguanine is analyzed. The presence of 8-aminoadenine and 8-aminoguanine stabilizes the parallel duplex structure. Binding of these oligonucleotides to their target polypyrimidine sequences to form the corresponding G,T-parallel triplex was not observed. Instead, when unmodified parallel-stranded duplexes were mixed with their polypyrimidine target, an interstrand Watson-Crick duplex was formed. As predicted by theoretical calculations parallel-stranded duplexes carrying 8-aminopurines did not bind to their target. The preference for the parallel-duplex over the Watson-Crick antiparallel duplex is attributed to the strong stabilization of the parallel duplex produced by the 8-aminopurines. Theoretical studies show that the isomorphism of the triads is crucial for the stability of the parallel triplex.

  5. 12 CFR 563g.7 - Form, content, and accounting.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Form, content, and accounting. 563g.7 Section... § 563g.7 Form, content, and accounting. (a) Form and content. Any offering circular or amendment filed... which they are made, not misleading. (b) Accounting requirements. To be declared effective an offering...

  6. Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding

    Czech Academy of Sciences Publication Activity Database

    Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela

    2014-01-01

    Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  7. Unfolding mechanism of thrombin-binding aptamer revealed by molecular dynamics simulation and Markov State Model.

    Science.gov (United States)

    Zeng, Xiaojun; Zhang, Liyun; Xiao, Xiuchan; Jiang, Yuanyuan; Guo, Yanzhi; Yu, Xinyan; Pu, Xuemei; Li, Menglong

    2016-04-05

    Thrombin-binding aptamer (TBA) with the sequence 5'GGTTGGTGTGGTTGG3' could fold into G-quadruplex, which correlates with functionally important genomic regionsis. However, unfolding mechanism involved in the structural stability of G-quadruplex has not been satisfactorily elucidated on experiments so far. Herein, we studied the unfolding pathway of TBA by a combination of molecular dynamics simulation (MD) and Markov State Model (MSM). Our results revealed that the unfolding of TBA is not a simple two-state process but proceeds along multiple pathways with multistate intermediates. One high flux confirms some observations from NMR experiment. Another high flux exhibits a different and simpler unfolding pathway with less intermediates. Two important intermediate states were identified. One is similar to the G-triplex reported in the folding of G-quadruplex, but lack of H-bonding between guanines in the upper plane. More importantly, another intermediate state acting as a connector to link the folding region and the unfolding one, was the first time identified, which exhibits higher population and stability than the G-triplex-like intermediate. These results will provide valuable information for extending our understanding the folding landscape of G-quadruplex formation.

  8. DNA Replication Dynamics of the GGGGCC Repeat of the C9orf72 Gene.

    Science.gov (United States)

    Thys, Ryan Griffin; Wang, Yuh-Hwa

    2015-11-27

    DNA has the ability to form a variety of secondary structures in addition to the normal B-form DNA, including hairpins and quadruplexes. These structures are implicated in a number of neurological diseases and cancer. Expansion of a GGGGCC repeat located at C9orf72 is associated with familial amyotrophic lateral sclerosis and frontotemporal dementia. This repeat expands from two to 24 copies in normal individuals to several hundreds or thousands of repeats in individuals with the disease. Biochemical studies have demonstrated that as little as four repeats have the ability to form a stable DNA secondary structure known as a G-quadruplex. Quadruplex structures have the ability to disrupt normal DNA processes such as DNA replication and transcription. Here we examine the role of GGGGCC repeat length and orientation on DNA replication using an SV40 replication system in human cells. Replication through GGGGCC repeats leads to a decrease in overall replication efficiency and an increase in instability in a length-dependent manner. Both repeat expansions and contractions are observed, and replication orientation is found to influence the propensity for expansions or contractions. The presence of replication stress, such as low-dose aphidicolin, diminishes replication efficiency but has no effect on instability. Two-dimensional gel electrophoresis analysis demonstrates a replication stall with as few as 20 GGGGCC repeats. These results suggest that replication of the GGGGCC repeat at C9orf72 is perturbed by the presence of expanded repeats, which has the potential to result in further expansion, leading to disease. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Thermodynamic, Anticoagulant, and Antiproliferative Properties of Thrombin Binding Aptamer Containing Novel UNA Derivative

    DEFF Research Database (Denmark)

    Kotkowiak, Weronika; Lisowiec-Wachnicka, Jolanta; Grynda, Jakub

    2018-01-01

    Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antipar......Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular......, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation......-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G...

  10. Structure of noncoding RNA is a determinant of function of RNA binding proteins in transcriptional regulation

    Directory of Open Access Journals (Sweden)

    Oyoshi Takanori

    2012-01-01

    Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.

  11. 12 CFR 563g.20 - Form for securities sale report.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Form for securities sale report. 563g.20 Section 563g.20 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.20 Form for securities sale report. Office of Thrift Supervision, 1700 G Street, NW...

  12. Site specific replacements of a single loop nucleoside with a dibenzyl linker may switch the activity of TBA from anticoagulant to antiproliferative.

    Science.gov (United States)

    Scuotto, Maria; Rivieccio, Elisa; Varone, Alessia; Corda, Daniela; Bucci, Mariarosaria; Vellecco, Valentina; Cirino, Giuseppe; Virgilio, Antonella; Esposito, Veronica; Galeone, Aldo; Borbone, Nicola; Varra, Michela; Mayol, Luciano

    2015-09-18

    Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13. © Crown copyright 2015.

  13. VLBA DETERMINATION OF THE DISTANCE TO NEARBY STAR-FORMING REGIONS. III. HP TAU/G2 AND THE THREE-DIMENSIONAL STRUCTURE OF TAURUS

    International Nuclear Information System (INIS)

    Torres, Rosa M.; Loinard, Laurent; Rodriguez, Luis F.; Mioduszewski, Amy J.

    2009-01-01

    Using multiepoch Very Long Baseline Array (VLBA) observations, we have measured the trigonometric parallax of the weak-line T Tauri star HP Tau/G2 in Taurus. The best fit yields a distance of 161.2 ± 0.9 pc, suggesting that the eastern portion of Taurus (where HP Tau/G2 is located) corresponds to the far side of the complex. Previous VLBA observations have shown that T Tau, to the south of the complex, is at an intermediate distance of about 147 pc, whereas the region around L1495 corresponds to the near side at roughly 130 pc. Our observations of only four sources are still too coarse to enable a reliable determination of the three-dimensional structure of the entire Taurus star-forming complex. They do demonstrate, however, that VLBA observations of multiple sources in a given star-forming region have the potential not only to provide a very accurate estimate of its mean distance, but also to reveal its internal structure. The proper motion measurements obtained simultaneously with the parallax allowed us to study the kinematics of the young stars in Taurus. Combining the four observations available so far, we estimate the peculiar velocity of Taurus to be about 10.6 km s -1 almost completely in a direction parallel to the Galactic plane. Using our improved distance measurement, we have refined the determination of the position on the H-R diagram of HP Tau/G2, and of two other members of the HP Tau group (HP Tau itself and HP Tau/G3). Most pre-main-sequence evolutionary models predict significantly discrepant ages (by 5 Myr) for those three stars-expected to be coeval. Only in the models of Palla and Stahler do they fall on a single isochrone (at 3 Myr).

  14. An ontology-driven tool for structured data acquisition using Web forms.

    Science.gov (United States)

    Gonçalves, Rafael S; Tu, Samson W; Nyulas, Csongor I; Tierney, Michael J; Musen, Mark A

    2017-08-01

    Structured data acquisition is a common task that is widely performed in biomedicine. However, current solutions for this task are far from providing a means to structure data in such a way that it can be automatically employed in decision making (e.g., in our example application domain of clinical functional assessment, for determining eligibility for disability benefits) based on conclusions derived from acquired data (e.g., assessment of impaired motor function). To use data in these settings, we need it structured in a way that can be exploited by automated reasoning systems, for instance, in the Web Ontology Language (OWL); the de facto ontology language for the Web. We tackle the problem of generating Web-based assessment forms from OWL ontologies, and aggregating input gathered through these forms as an ontology of "semantically-enriched" form data that can be queried using an RDF query language, such as SPARQL. We developed an ontology-based structured data acquisition system, which we present through its specific application to the clinical functional assessment domain. We found that data gathered through our system is highly amenable to automatic analysis using queries. We demonstrated how ontologies can be used to help structuring Web-based forms and to semantically enrich the data elements of the acquired structured data. The ontologies associated with the enriched data elements enable automated inferences and provide a rich vocabulary for performing queries.

  15. Thermodynamic, Anticoagulant, and Antiproliferative Properties of Thrombin Binding Aptamer Containing Novel UNA Derivative

    Directory of Open Access Journals (Sweden)

    Weronika Kotkowiak

    2018-03-01

    Full Text Available Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation of a novel 4-thiouracil derivative of unlocked nucleic acid (UNA, as well as single incorporation of 4-thiouridine and all four canonical UNAs, was evaluated. The studies presented herein have shown that 4-thiouridine in RNA and UNA series, as well as all four canonical UNAs, can efficiently modulate G-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G-quadruplex anticoagulant properties. Noteworthy, some TBA variants, characterized by decreased ability to inhibit thrombin activity, possess significant antiproliferative properties reducing the viability of the HeLa cell line even by 95% at 10 μM concentration.

  16. Hairpins participating in folding of human telomeric sequence quadruplexes studied by standard and T-REMD simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří

    2016-01-01

    Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016

  17. Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Science.gov (United States)

    Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang

    2015-01-01

    Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  18. A sensitive electrochemical aptasensor for ATP detection based on exonuclease III-assisted signal amplification strategy.

    Science.gov (United States)

    Bao, Ting; Shu, Huawei; Wen, Wei; Zhang, Xiuhua; Wang, Shengfu

    2015-03-03

    A target-induced structure-switching electrochemical aptasensor for sensitive detection of ATP was successfully constructed which was based on exonuclease III-catalyzed target recycling for signal amplification. With the existence of ATP, methylene blue (MB) labeled hairpin DNA formed G-quadruplex with ATP, which led to conformational changes of the hairpin DNA and created catalytic cleavage sites for exonuclease III (Exo III). Then the structure-switching DNA hybridized with capture DNA which made MB close to electrode surface. Meanwhile, Exo III selectively digested aptamer from its 3'-end, thus G-quadruplex structure was destroyed and ATP was released for target recycling. The Exo III-assisted target recycling amplified electrochemical signal significantly. Fluorescence experiment was performed to confirm the structure-switching process of the hairpin DNA. In fluorescence experiment, AuNPs-aptamer conjugates were synthesized, AuNPs quenched fluorescence of MB, the target-induced structure-switching made Exo III digested aptamer, which restored fluorescence. Under optimized conditions, the proposed aptasensor showed a linear range of 0.1-20 nM with a detection limit of 34 pM. In addition, the proposed aptasensor had good stability and selectivity, offered promising choice for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Linking structure to fragility in bulk metallic glass-forming liquids

    International Nuclear Information System (INIS)

    Wei, Shuai; Stolpe, Moritz; Gross, Oliver; Gallino, Isabella; Hembree, William; Busch, Ralf; Evenson, Zach; Bednarcik, Jozef; Kruzic, Jamie J.

    2015-01-01

    Using in-situ synchrotron X-ray scattering, we show that the structural evolution of various bulk metallic glass-forming liquids can be quantitatively connected to their viscosity behavior in the supercooled liquid near T g . The structural signature of fragility is identified as the temperature dependence of local dilatation on distinct key atomic length scales. A more fragile behavior results from a more pronounced thermally induced dilatation of the structure on a length scale of about 3 to 4 atomic diameters, coupled with shallower temperature dependence of structural changes in the nearest neighbor environment. These findings shed light on the structural origin of viscous slowdown during undercooling of bulk metallic glass-forming liquids and demonstrate the promise of predicting the properties of bulk metallic glasses from the atomic scale structure

  20. Linking structure to fragility in bulk metallic glass-forming liquids

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Shuai, E-mail: shuai.wei@asu.edu, E-mail: m.stolpe@mx.uni-saarland.de [Department of Materials Science and Engineering, Saarland University, Campus C63, 66123 Saarbrücken (Germany); Department of Chemistry and Biochemistry, Arizona State University, Tempe, Arizona 85287 (United States); Stolpe, Moritz, E-mail: shuai.wei@asu.edu, E-mail: m.stolpe@mx.uni-saarland.de; Gross, Oliver; Gallino, Isabella; Hembree, William; Busch, Ralf [Department of Materials Science and Engineering, Saarland University, Campus C63, 66123 Saarbrücken (Germany); Evenson, Zach [Department of Materials Science and Engineering, Saarland University, Campus C63, 66123 Saarbrücken (Germany); Institut für Materialphysik im Weltraum, Deutsches Zentrum für Luft- und Raumfahrt (DLR), 51170 Köln (Germany); Bednarcik, Jozef [Deutsches Elektronen-Synchrotron DESY, Notkestrasse 85, D-22603 Hamburg (Germany); Kruzic, Jamie J. [Material Science, School of Mechanical, Industrial, and Manufacturing Engineering, Oregon State University, Corvallis, Oregon 97331 (United States)

    2015-05-04

    Using in-situ synchrotron X-ray scattering, we show that the structural evolution of various bulk metallic glass-forming liquids can be quantitatively connected to their viscosity behavior in the supercooled liquid near T{sub g}. The structural signature of fragility is identified as the temperature dependence of local dilatation on distinct key atomic length scales. A more fragile behavior results from a more pronounced thermally induced dilatation of the structure on a length scale of about 3 to 4 atomic diameters, coupled with shallower temperature dependence of structural changes in the nearest neighbor environment. These findings shed light on the structural origin of viscous slowdown during undercooling of bulk metallic glass-forming liquids and demonstrate the promise of predicting the properties of bulk metallic glasses from the atomic scale structure.

  1. 77 FR 50519 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

    Science.gov (United States)

    2012-08-21

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services [OMB Control Number 1615... Department of Homeland Security (DHS), U.S. Citizenship and Immigration Services (USCIS) will be submitting... collection: Forms G-325, G-325A, G-325B, and G-325C; U.S. Citizenship and Immigration Services (USCIS). (4...

  2. Crystallization and Characterization of Galdieria sulphuraria RUBISCO in Two Crystal Forms: Structural Phase Transition Observed in P21 Crystal Form

    Directory of Open Access Journals (Sweden)

    Boguslaw Stec

    2007-10-01

    Full Text Available We have isolated ribulose-1,5-bisphosphate-carboxylase/oxygenase (RUBISCOfrom the red algae Galdieria Sulphuraria. The protein crystallized in two different crystalforms, the I422 crystal form being obtained from high salt and the P21 crystal form beingobtained from lower concentration of salt and PEG. We report here the crystallization,preliminary stages of structure determination and the detection of the structural phasetransition in the P21 crystal form of G. sulphuraria RUBISCO. This red algae enzymebelongs to the hexadecameric class (L8S8 with an approximate molecular weight 0.6MDa.The phase transition in G. sulphuraria RUBISCO leads from two hexadecamers to a singlehexadecamer per asymmetric unit. The preservation of diffraction power in a phasetransition for such a large macromolecule is rare.

  3. Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.

    Science.gov (United States)

    Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu

    2018-08-01

    In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.

    Science.gov (United States)

    Scheibye-Knudsen, Morten; Tseng, Anne; Borch Jensen, Martin; Scheibye-Alsing, Karsten; Fang, Evandro Fei; Iyama, Teruaki; Bharti, Sanjay Kumar; Marosi, Krisztina; Froetscher, Lynn; Kassahun, Henok; Eckley, David Mark; Maul, Robert W; Bastian, Paul; De, Supriyo; Ghosh, Soumita; Nilsen, Hilde; Goldberg, Ilya G; Mattson, Mark P; Wilson, David M; Brosh, Robert M; Gorospe, Myriam; Bohr, Vilhelm A

    2016-11-01

    Cockayne syndrome is a neurodegenerative accelerated aging disorder caused by mutations in the CSA or CSB genes. Although the pathogenesis of Cockayne syndrome has remained elusive, recent work implicates mitochondrial dysfunction in the disease progression. Here, we present evidence that loss of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number of cell lines. Furthermore, machine-learning algorithms predict that diseases with defects in ribosomal DNA (rDNA) transcription have mitochondrial dysfunction, and, accordingly, this is found when factors involved in rDNA transcription are knocked down. Mechanistically, loss of CSA or CSB leads to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans In conclusion, this work supports a role for impaired ribosomal DNA transcription in Cockayne syndrome and suggests that transcription-coupled resolution of secondary structures may be a mechanism to repress spurious activation of a DNA damage response.

  5. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Directory of Open Access Journals (Sweden)

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  6. 76 FR 36618 - Proposed Collection; Comment Request for Form W-2G

    Science.gov (United States)

    2011-06-22

    ... W-2G AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments... Form W-2G, Certain Gambling Winnings. DATES: Written comments should be received on or before August 22... INFORMATION: Title: Certain Gambling Winnings. OMB Number: 1545-0238. Form Number: Form W-2G. Abstract...

  7. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.

    2011-01-01

    Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011

  8. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

    International Nuclear Information System (INIS)

    Revaud, D.

    2009-06-01

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  9. Cascaded strand displacement for non-enzymatic target recycling amplification and label-free electronic detection of microRNA from tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Kai; Dou, Baoting; Yang, Jianmei; Yuan, Ruo; Xiang, Yun, E-mail: yunatswu@swu.edu.cn

    2016-04-15

    The monitoring of microRNA (miRNA) expression levels is of great importance in cancer diagnosis. In the present work, based on two cascaded toehold-mediated strand displacement reactions (TSDRs), we have developed a label- and enzyme-free target recycling signal amplification approach for sensitive electronic detection of miRNA-21 from human breast cancer cells. The junction probes containing the locked G-quadruplex forming sequences are self-assembled on the senor surface. The presence of the target miRNA-21 initiates the first TSDR and results in the disassembly of the junction probes and the release of the active G-quadruplex forming sequences. Subsequently, the DNA fuel strand triggers the second TSDR and leads to cyclic reuse of the target miRNA-21. The cascaded TSDRs thus generate many active G-quadruplex forming sequences on the sensor surface, which associate with hemin to produce significantly amplified current response for sensitive detection of miRNA-21 at 1.15 fM. The sensor is also selective and can be employed to monitor miRNA-21 from human breast cancer cells. - Highlights: • Amplified and sensitive detection of microRNA from tumor cells is achieved. • Signal amplification is realized by two cascaded strand displacement reactions. • The developed sensor is selective and label-free without involving any enzymes.

  10. Quaternary structure of a G-protein-coupled receptor heterotetramer in complex with Gi and Gs.

    Science.gov (United States)

    Navarro, Gemma; Cordomí, Arnau; Zelman-Femiak, Monika; Brugarolas, Marc; Moreno, Estefania; Aguinaga, David; Perez-Benito, Laura; Cortés, Antoni; Casadó, Vicent; Mallol, Josefa; Canela, Enric I; Lluís, Carme; Pardo, Leonardo; García-Sáez, Ana J; McCormick, Peter J; Franco, Rafael

    2016-04-05

    G-protein-coupled receptors (GPCRs), in the form of monomers or homodimers that bind heterotrimeric G proteins, are fundamental in the transfer of extracellular stimuli to intracellular signaling pathways. Different GPCRs may also interact to form heteromers that are novel signaling units. Despite the exponential growth in the number of solved GPCR crystal structures, the structural properties of heteromers remain unknown. We used single-particle tracking experiments in cells expressing functional adenosine A1-A2A receptors fused to fluorescent proteins to show the loss of Brownian movement of the A1 receptor in the presence of the A2A receptor, and a preponderance of cell surface 2:2 receptor heteromers (dimer of dimers). Using computer modeling, aided by bioluminescence resonance energy transfer assays to monitor receptor homomerization and heteromerization and G-protein coupling, we predict the interacting interfaces and propose a quaternary structure of the GPCR tetramer in complex with two G proteins. The combination of results points to a molecular architecture formed by a rhombus-shaped heterotetramer, which is bound to two different interacting heterotrimeric G proteins (Gi and Gs). These novel results constitute an important advance in understanding the molecular intricacies involved in GPCR function.

  11. Substrate-Induced Allosteric Change in the Quaternary Structure of the Spermidine N-Acetyltransferase SpeG.

    Science.gov (United States)

    Filippova, Ekaterina V; Weigand, Steven; Osipiuk, Jerzy; Kiryukhina, Olga; Joachimiak, Andrzej; Anderson, Wayne F

    2015-11-06

    The spermidine N-acetyltransferase SpeG is a dodecameric enzyme that catalyzes the transfer of an acetyl group from acetyl coenzyme A to polyamines such as spermidine and spermine. SpeG has an allosteric polyamine-binding site and acetylating polyamines regulate their intracellular concentrations. The structures of SpeG from Vibrio cholerae in complexes with polyamines and cofactor have been characterized earlier. Here, we present the dodecameric structure of SpeG from V. cholerae in a ligand-free form in three different conformational states: open, intermediate and closed. All structures were crystallized in C2 space group symmetry and contain six monomers in the asymmetric unit cell. Two hexamers related by crystallographic 2-fold symmetry form the SpeG dodecamer. The open and intermediate states have a unique open dodecameric ring. This SpeG dodecamer is asymmetric except for the one 2-fold axis and is unlike any known dodecameric structure. Using a fluorescence thermal shift assay, size-exclusion chromatography with multi-angle light scattering, small-angle X-ray scattering analysis, negative-stain electron microscopy and structural analysis, we demonstrate that this unique open dodecameric state exists in solution. Our combined results indicate that polyamines trigger conformational changes and induce the symmetric closed dodecameric state of the protein when they bind to their allosteric sites. Copyright © 2015. Published by Elsevier Ltd.

  12. The Fab Conformations in the Solution Structure of Human Immunoglobulin G4 (IgG4) Restrict Access to Its Fc Region

    Science.gov (United States)

    Rayner, Lucy E.; Hui, Gar Kay; Gor, Jayesh; Heenan, Richard K.; Dalby, Paul A.; Perkins, Stephen J.

    2014-01-01

    Human IgG4 antibody shows therapeutically useful properties compared with the IgG1, IgG2, and IgG3 subclasses. Thus IgG4 does not activate complement and shows conformational variability. These properties are attributable to its hinge region, which is the shortest of the four IgG subclasses. Using high throughput scattering methods, we studied the solution structure of wild-type IgG4(Ser222) and a hinge mutant IgG4(Pro222) in different buffers and temperatures where the proline substitution suppresses the formation of half-antibody. Analytical ultracentrifugation showed that both IgG4 forms were principally monomeric with sedimentation coefficients s20,w0 of 6.6–6.8 S. A monomer-dimer equilibrium was observed in heavy water buffer at low temperature. Scattering showed that the x-ray radius of gyration Rg was unchanged with concentration in 50–250 mm NaCl buffers, whereas the neutron Rg values showed a concentration-dependent increase as the temperature decreased in heavy water buffers. The distance distribution curves (P(r)) revealed two peaks, M1 and M2, that shifted below 2 mg/ml to indicate concentration-dependent IgG4 structures in addition to IgG4 dimer formation at high concentration in heavy water. Constrained x-ray and neutron scattering modeling revealed asymmetric solution structures for IgG4(Ser222) with extended hinge structures. The IgG4(Pro222) structure was similar. Both IgG4 structures showed that their Fab regions were positioned close enough to the Fc region to restrict C1q binding. Our new molecular models for IgG4 explain its inability to activate complement and clarify aspects of its stability and function for therapeutic applications. PMID:24876381

  13. Structural optimization of free-form reciprocal structures

    DEFF Research Database (Denmark)

    Parigi, Dario

    2014-01-01

    This paper presents an optimization algorithm for the design of structurally efficient free-form reciprocal structures. Because of the geometric complexity of reciprocal structures, only a few structural studies have been carried out so far, and we have a limited knowledge of the relation between...

  14. 21 CFR 522.1696 - Penicillin G procaine implantation and injectable dosage forms.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Penicillin G procaine implantation and injectable dosage forms. 522.1696 Section 522.1696 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH... DOSAGE FORM NEW ANIMAL DRUGS § 522.1696 Penicillin G procaine implantation and injectable dosage forms. ...

  15. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

    Energy Technology Data Exchange (ETDEWEB)

    Revaud, D.

    2009-06-15

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  16. Mechanism of inhibition of HIV-1 integrase by G-tetrad-forming oligonucleotides in Vitro.

    Science.gov (United States)

    Jing, N; Marchand, C; Liu, J; Mitra, R; Hogan, M E; Pommier, Y

    2000-07-14

    The G-tetrad-forming oligonucleotides and have been identified as potent inhibitors of human immunodeficiency virus type 1 integrase (HIV-1 IN) activity (Rando, R. F., Ojwang, J., Elbaggari, A., Reyes, G. R., Tinder, R., McGrath, M. S., and Hogan, M. E. (1995) J. Biol. Chem. 270, 1754-1760; Mazumder, A., Neamati, N., Ojwang, J. O., Sunder, S., Rando, R. F., and Pommier, Y. (1996) Biochemistry 35, 13762-13771; Jing, N., and Hogan, M. E. (1998) J. Biol. Chem. 273, 34992-34999). To understand the inhibition of HIV-1 IN activity by the G-quartet inhibitors, we have designed the oligonucleotides and, composed of three and four G-quartets with stem lengths of 19 and 24 A, respectively. The fact that increasing the G-quartet stem length from 15 to 24 A kept inhibition of HIV-1 IN activity unchanged suggests that the binding interaction occurs between a GTGT loop domain of the G-quartet inhibitors and a catalytic site of HIV-1 IN, referred to as a face-to-face interaction. Docking the NMR structure of (Jing and Hogan (1998)) into the x-ray structure of the core domain of HIV-1 IN, HIV-1 IN-(51-209) (Maignan, S., Guilloteau, J.-P. , Qing, Z.-L., Clement-Mella, C., and Mikol, V. (1998) J. Mol. Biol. 282, 359-368), was performed using the GRAMM program. The statistical distributions of hydrogen bonding between HIV-1 IN and were obtained from the analyses of 1000 random docking structures. The docking results show a high probability of interaction between the GTGT loop residues of the G-quartet inhibitors and the catalytic site of HIV-1 IN, in agreement with the experimental observation.

  17. Structure, stability and behaviour of nucleic acids in ionic liquids

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Sugimoto, Naoki

    2014-01-01

    Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178

  18. Human IgG4: a structural perspective.

    Science.gov (United States)

    Davies, Anna M; Sutton, Brian J

    2015-11-01

    IgG4, the least represented human IgG subclass in serum, is an intriguing antibody with unique biological properties, such as the ability to undergo Fab-arm exchange and limit immune complex formation. The lack of effector functions, such as antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity, is desirable for therapeutic purposes. IgG4 plays a protective role in allergy by acting as a blocking antibody, and inhibiting mast cell degranulation, but a deleterious role in malignant melanoma, by impeding IgG1-mediated anti-tumor immunity. These findings highlight the importance of understanding the interaction between IgG4 and Fcγ receptors. Despite a wealth of structural information for the IgG1 subclass, including complexes with Fcγ receptors, and structures for intact antibodies, high-resolution crystal structures were not reported for IgG4-Fc until recently. Here, we highlight some of the biological properties of human IgG4, and review the recent crystal structures of IgG4-Fc. We discuss the unexpected conformations adopted by functionally important Cγ2 domain loops, and speculate about potential implications for the interaction between IgG4 and FcγRs. © 2015 The Authors. Immunological Reviews Published by John Wiley & Sons Ltd.

  19. G(2) Holonomy Spaces from Invariant Three-Forms

    OpenAIRE

    Brandhuber, Andreas

    2001-01-01

    We construct several new G(2) holonomy metrics that play an important role in recent studies of geometrical transitions in compactifications of M-theory to four dimensions. In type IIA string theory these metrics correspond to D6 branes wrapped on the three-cycle of the deformed conifold and the resolved conifold with two-form RR flux on the blown-up two-sphere, which are related by a conifold transition. We also study a G(2) metric that is related in type IIA to the line bundle over S^2 x S^...

  20. p53 binds human telomeric G-quadruplex in vitro

    Czech Academy of Sciences Publication Activity Database

    Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016

  1. Proton form factor ratio, μpGEP/GMP from double spin asymmetry

    Energy Technology Data Exchange (ETDEWEB)

    Habarakada Liyanage, Anusha Pushpakumari [Hampton Univ., Hampton, VA (United States)

    2013-08-01

    The form factors are fundamental properties of the nucleon representing the effect of its structure on its response to electromagnetic probes such as electrons. They are functions of the four-momentum transfer squared Q2 between the electron and the proton. This thesis reports the results of a new measurement of the ratio of the electric and magnetic form factors of the proton up to Q2 = 5.66 (GeV/c)2 using the double spin asymmetry with a polarized beam and target. Experiment E07-003 (SANE, Spin Asymmetries of the Nucleon Experiment) was carried out in Hall C at Jefferson Lab in 2009 to study the proton spin structure functions with a dynamically polarized ammonia target and longitudinally polarized electron beam. By detecting elastically scattered protons in the High-Momentum Spectrometer (HMS) in coincidence with the electrons in the Big Electron Telescope Array (BETA), elastic measurements were carried out in parallel. The elastic double spin asymmetry allows one to extract the proton electric to magnetic form factor ratio GpE/GpM at high-momentum transfer, Q2= 5.66 (GeV/c)2. In addition to the coincidence data, inclusively scattered electrons from the polarized ammonia target were detected by HMS, which allows to measure the beam-target asymmetry in the elastic region with the target spin nearly perpendicular to the momentum transfer, and to extract GpE/GpM at low Q2= 2.06 (GeV/c)2. This alternative measurement of GpE/GpM has verified and confirmed the dramatic discrepancy at high Q2 between the Rosenbluth and the recoil-polarization-transfer iv method with a different measurement technique and systematic uncertainties uncorrelated to those of the recoil-polarization measurements. The measurement of the form factor ratio at Q2 = 2

  2. Method for fabricating five-level microelectromechanical structures and microelectromechanical transmission formed

    Science.gov (United States)

    Rodgers, M. Steven; Sniegowski, Jeffry J.; Miller, Samuel L.; McWhorter, Paul J.

    2000-01-01

    A process for forming complex microelectromechanical (MEM) devices having five layers or levels of polysilicon, including four structural polysilicon layers wherein mechanical elements can be formed, and an underlying polysilicon layer forming a voltage reference plane. A particular type of MEM device that can be formed with the five-level polysilicon process is a MEM transmission for controlling or interlocking mechanical power transfer between an electrostatic motor and a self-assembling structure (e.g. a hinged pop-up mirror for use with an incident laser beam). The MEM transmission is based on an incomplete gear train and a bridging set of gears that can be moved into place to complete the gear train to enable power transfer. The MEM transmission has particular applications as a safety component for surety, and for this purpose can incorporate a pin-in-maze discriminator responsive to a coded input signal.

  3. Method for fabricating five-level microelectromechanical structures and microelectromechanical transmission formed

    Energy Technology Data Exchange (ETDEWEB)

    Rodgers, M.S.; Sniegowski, J.J.; Miller, S.L.; McWhorter, P.J.

    2000-07-04

    A process is disclosed for forming complex microelectromechanical (MEM) devices having five layers or levels of polysilicon, including four structural polysilicon layers wherein mechanical elements can be formed, and an underlying polysilicon layer forming a voltage reference plane. A particular type of MEM device that can be formed with the five-level polysilicon process is a MEM transmission for controlling or interlocking mechanical power transfer between an electrostatic motor and a self-assembling structure (e.g. a hinged pop-up mirror for use with an incident laser beam). The MEM transmission is based on an incomplete gear train and a bridging set of gears that can be moved into place to complete the gear train to enable power transfer. The MEM transmission has particular applications as a safety component for surety, and for this purpose can incorporate a pin-in-maze discriminator responsive to a coded input signal.

  4. Structures of the G81A mutant form of the active chimera of (S)-mandelate dehydrogenase and its complex with two of its substrates

    Energy Technology Data Exchange (ETDEWEB)

    Sukumar, Narayanasami [NE-CAT and Department of Chemistry and Chemical Biology, Cornell University, Building 436E, Argonne National Laboratory, Argonne, IL 60439 (United States); Dewanti, Asteriani [Department of Chemistry and Physics, Western Carolina University, Cullowhee, NC 28723 (United States); Merli, Angelo; Rossi, Gian Luigi [Department of Biochemistry and Molecular Biology, University of Parma, Parma (Italy); Mitra, Bharati [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Mathews, F. Scott, E-mail: mathews@biochem.wustl.edu [Department of Biochemistry and Molecular Biophysics, Washington University School of Medicine, St Louis, MO 63110 (United States); NE-CAT and Department of Chemistry and Chemical Biology, Cornell University, Building 436E, Argonne National Laboratory, Argonne, IL 60439 (United States)

    2009-06-01

    The crystal structure of the G81A mutant form of the chimera of (S)-mandelate dehydrogenase and of its complexes with two of its substrates reveal productive and non-productive modes of binding for the catalytic reaction. The structure also indicates the role of G81A in lowering the redox potential of the flavin co-factor leading to an ∼200-fold slower catalytic rate of substrate oxidation. (S)-Mandelate dehydrogenase (MDH) from Pseudomonas putida, a membrane-associated flavoenzyme, catalyzes the oxidation of (S)-mandelate to benzoylformate. Previously, the structure of a catalytically similar chimera, MDH-GOX2, rendered soluble by the replacement of its membrane-binding segment with the corresponding segment of glycolate oxidase (GOX), was determined and found to be highly similar to that of GOX except within the substituted segments. Subsequent attempts to cocrystallize MDH-GOX2 with substrate proved unsuccessful. However, the G81A mutants of MDH and of MDH-GOX2 displayed ∼100-fold lower reactivity with substrate and a modestly higher reactivity towards molecular oxygen. In order to understand the effect of the mutation and to identify the mode of substrate binding in MDH-GOX2, a crystallographic investigation of the G81A mutant of the MDH-GOX2 enzyme was initiated. The structures of ligand-free G81A mutant MDH-GOX2 and of its complexes with the substrates 2-hydroxyoctanoate and 2-hydroxy-3-indolelactate were determined at 1.6, 2.5 and 2.2 Å resolution, respectively. In the ligand-free G81A mutant protein, a sulfate anion previously found at the active site is displaced by the alanine side chain introduced by the mutation. 2-Hydroxyoctanoate binds in an apparently productive mode for subsequent reaction, while 2-hydroxy-3-indolelactate is bound to the enzyme in an apparently unproductive mode. The results of this investigation suggest that a lowering of the polarity of the flavin environment resulting from the displacement of nearby water molecules caused by

  5. Shedding lights on the flexible-armed porphyrins: Human telomeric G4 DNA interaction and cell photocytotoxicity research.

    Science.gov (United States)

    Sun, Xiang-Yu; Zhao, Ping; Jin, Shu-Fang; Liu, Min-Chao; Wang, Xia-Hong; Huang, Yu-Min; Cheng, Zhen-Feng; Yan, Si-Qi; Li, Yan-Yu; Chen, Ya-Qing; Zhong, Yan-Mei

    2017-08-01

    DNA polymorphism exerts a fascination on a large scientific community. Without crystallographic structural data, clarification of the binding modes between G-quadruplex (G4) and ligand (complex) is a challenging job. In the present work, three porphyrin compounds with different flexible carbon chains (arms) were designed, synthesized and characterized. Their binding, folding and stabilizing abilities to human telomeric G4 DNA structures were comparatively researched. Positive charges at the end of the flexible carbon chains seem to be favorable for the DNA-porphyrin interactions, which were evidenced by the spectral results and further confirmed by the molecular docking calculations. Biological function analysis demonstrated that these porphyrins show no substantial inhibition to Hela, A549 and BEL 7402 cancer cell lines under dark while exhibit broad inhibition under visible light. This significantly enhanced photocytotoxicity relative to the dark control is an essential property of photochemotherapeutic agents. The feature of the flexible arms emerges as critical influencing factors in the cell photocytotoxicity. Moreover, an ROS-mediated mitochondrial dysfunction pathway was suggested for the cell apoptosis induced by these flexible-armed porphyrins. It is found that the porphyrins with positive charges located at the end of the flexible arms represent an exciting opportunity for photochemotherapeutic anti-cancer drug design. Copyright © 2017. Published by Elsevier B.V.

  6. Strong preference of BRCA1 protein to topologically constrained non-B DNA structures

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fridrichova, Helena; Jagelská, Eva

    2016-01-01

    Roč. 17, JAN2016 (2016), č. článku 14. ISSN 1471-2199 R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : double-strand breaks * g-quadruplexes * c-myc Subject RIV: BO - Biophysics Impact factor: 1.939, year: 2016

  7. Crystal structure of an EAL domain in complex with reaction product 5'-pGpG.

    Directory of Open Access Journals (Sweden)

    Julien Robert-Paganin

    Full Text Available FimX is a large multidomain protein containing an EAL domain and involved in twitching motility in Pseudomonas aeruginosa. We present here two crystallographic structures of the EAL domain of FimX (residues 438-686: one of the apo form and the other of a complex with 5'-pGpG, the reaction product of the hydrolysis of c-di-GMP. In both crystal forms, the EAL domains form a dimer delimiting a large cavity encompassing the catalytic pockets. The ligand is trapped in this cavity by its sugar phosphate moiety. We confirmed by NMR that the guanine bases are not involved in the interaction in solution. We solved here the first structure of an EAL domain bound to the reaction product 5'-pGpG. Though isolated FimX EAL domain has a very low catalytic activity, which would not be significant compared to other catalytic EAL domains, the structure with the product of the reaction can provides some hints in the mechanism of hydrolysis of the c-di-GMP by EAL domains.

  8. Crystal structure of an EAL domain in complex with reaction product 5'-pGpG.

    Science.gov (United States)

    Robert-Paganin, Julien; Nonin-Lecomte, Sylvie; Réty, Stéphane

    2012-01-01

    FimX is a large multidomain protein containing an EAL domain and involved in twitching motility in Pseudomonas aeruginosa. We present here two crystallographic structures of the EAL domain of FimX (residues 438-686): one of the apo form and the other of a complex with 5'-pGpG, the reaction product of the hydrolysis of c-di-GMP. In both crystal forms, the EAL domains form a dimer delimiting a large cavity encompassing the catalytic pockets. The ligand is trapped in this cavity by its sugar phosphate moiety. We confirmed by NMR that the guanine bases are not involved in the interaction in solution. We solved here the first structure of an EAL domain bound to the reaction product 5'-pGpG. Though isolated FimX EAL domain has a very low catalytic activity, which would not be significant compared to other catalytic EAL domains, the structure with the product of the reaction can provides some hints in the mechanism of hydrolysis of the c-di-GMP by EAL domains.

  9. Target recycling amplification for label-free and sensitive colorimetric detection of adenosine triphosphate based on un-modified aptamers and DNAzymes.

    Science.gov (United States)

    Gong, Xue; Li, Jinfu; Zhou, Wenjiao; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2014-05-30

    Based on target recycling amplification, the development of a new label-free, simple and sensitive colorimetric detection method for ATP by using un-modified aptamers and DNAzymes is described. The association of the model target molecules (ATP) with the corresponding aptamers of the dsDNA probes leads to the release of the G-quadruplex sequences. The ATP-bound aptamers can be further degraded by Exonuclease III to release ATP, which can again bind the aptamers of the dsDNA probes to initiate the target recycling amplification process. Due to this target recycling amplification, the amount of the released G-quadruplex sequences is significantly enhanced. Subsequently, these G-quadruplex sequences bind hemin to form numerous peroxidase mimicking DNAzymes, which cause substantially intensified color change of the probe solution for highly sensitive colorimetric detection of ATP down to the sub-nanomolar (0.33nM) level. Our method is highly selective toward ATP against other control molecules and can be performed in one single homogeneous solution, which makes our sensing approach hold great potential for sensitive colorimetric detection of other small molecules and proteins. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Novel molecular targets for kRAS downregulation: promoter G-quadruplexes

    Science.gov (United States)

    2016-11-01

    proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with

  11. Measurement of the Proton and Deuteron Spin Structure Functions G1 and G2

    Energy Technology Data Exchange (ETDEWEB)

    Tobias, Al

    2003-04-02

    The SLAC experiment E155 was a deep-inelastic scattering experiment that scattered polarized electrons off polarized proton and deuteron targets in the effort to measure precisely the proton and deuteron spin structure functions. The nucleon structure functions g{sub 1} and g{sub 2} are important quantities that help test our present models of nucleon structure. Such information can help quantify the constituent contributions to the nucleon spin. The structure functions g{sub 1}{sup p} and G{sub 1}{sup d} have been measured over the kinematic range 0.01 {le} x {le} 0.9 and 1 {le} Q{sup 2} {le} 40 GeV{sup 2} by scattering 48.4 GeV longitudinally polarized electrons off longitudinally polarized protons and deuterons. In addition, the structure functions g{sub 2}{sup p} and g{sub 2}{sup d} have been measured over the kinematic range 0.01 {le} x {le} 0.7 and 1 {le} Q{sup 2} {le} 17 GeV{sup 2} by scattering 38.8 GeV longitudinally polarized electrons off transversely polarized protons and deuterons. The measurements of g{sub 1} confirm the Bjorken sum rule and find the net quark polarization to be {Delta}{Sigma} = 0.23 {+-} 0.04 {+-} 0.6 while g{sub 2} is found to be consistent with the g{sub 2}{sup WW} model.

  12. Solution structures of α-conotoxin G1 determined by two-dimensional NMR spectroscopy

    International Nuclear Information System (INIS)

    Pardi, A.; Galdes, A.; Florance, J.; Maniconte, D.

    1989-01-01

    Two-dimensional NMR data have been used to generate solution structures of α-conotoxin G1, a potent peptide antagonist of the acetylcholine receptor. Structural information was obtained in the form of proton-proton internuclear distance constraints, and initial structures were produced with a distance geometry algorithm. Energetically more favorable structures were generated by using the distance geometry structures as input for a constrained energy minimization program. The results of both of these calculations indicate that the overall backbone conformation of the molecule is well-defined by the NMR data whereas the side-chain conformations are generally less well-defined. The main structural features derived from the NMR data were the presence of tight turns centered on residues Pro 5 and Arg 9 . The solution structures are compared with previous proposed models of conotoxin G1, and the NMR data are interpreted in conjunction with chemical modification studies and structural properties of other antagonists of the acetylcholine receptor to gain insight into structure-activity relationships in these peptide toxins

  13. Transposable elements and G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovský, Eduard; Tokan, Viktor; Lexa, M.

    2015-01-01

    Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015

  14. Nucleon Structure and Hyperon Form Factors from Lattice QCD.

    Energy Technology Data Exchange (ETDEWEB)

    Lin,H.W.

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point. to be 1.23(5), consistent with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(2G), consistent with the Adelaide-JLab Collaboration's result. The hyperon {Sigma} and {Xi} axial coupling constants are also performed for the first time in a lattice calculation, g{sub {Sigma}{Sigma}} = 0.441(14) and g{sub {Xi}{Xi}} = -0.277(11).

  15. Deuteron A(Q2) structure function and the neutron electric form factor

    International Nuclear Information System (INIS)

    Platchkov, S.; Amroun, A.; Auffret, S.; Cavedon, J.M.; Dreux, P.; Duclos, J.; Frois, B.; Goutte, D.; Hachemi, H.; Martino, J.

    1989-01-01

    We present new measurements of the deuteron A(Q 2 ) structure function in the momentum transfer region between 1 and 18 fm -2 . The accuracy of the data ranges from 2% to 6%. We investigate the sensitivity of A(Q 2 ) to the nucleon-nucleon interaction and to the neutron electric form factor G E n . Our analysis shows that below 20 fm -2 G E n can be inferred from these data with a significantly improved accuracy. The model dependence of this analysis is discussed

  16. A bouquet of DNA structures: Emerging diversity

    Directory of Open Access Journals (Sweden)

    Mahima Kaushik

    2016-03-01

    Full Text Available Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson–Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.

  17. A bouquet of DNA structures: Emerging diversity.

    Science.gov (United States)

    Kaushik, Mahima; Kaushik, Shikha; Roy, Kapil; Singh, Anju; Mahendru, Swati; Kumar, Mohan; Chaudhary, Swati; Ahmed, Saami; Kukreti, Shrikant

    2016-03-01

    Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson-Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.

  18. Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

    Science.gov (United States)

    2017-01-01

    We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322

  19. Optofluidics-based DNA structure-competitive aptasensor for rapid on-site detection of lead(II) in an aquatic environment.

    Science.gov (United States)

    Long, Feng; Zhu, Anna; Wang, Hongchen

    2014-11-07

    Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Structure of human ubiquitin-conjugating enzyme E2 G2 (UBE2G2/UBC7)

    International Nuclear Information System (INIS)

    Arai, Ryoichi; Yoshikawa, Seiko; Murayama, Kazutaka; Imai, Yuzuru; Takahashi, Ryosuke; Shirouzu, Mikako; Yokoyama, Shigeyuki

    2006-01-01

    The crystal structure of human UBE2G2/UBC7 was solved at 2.56 Å resolution. The superimposition of UBE2G2 on UbcH7 in a c-Cbl–UbcH7–ZAP70 ternary complex suggested that the two loop regions of UBE2G2 interact with the RING domain in a similar way as UbcH7. The human ubiquitin-conjugating enzyme E2 G2 (UBE2G2/UBC7) is involved in protein degradation, including a process known as endoplasmic reticulum-associated degradation (ERAD). The crystal structure of human UBE2G2/UBC7 was solved at 2.56 Å resolution. The UBE2G2 structure comprises a single domain consisting of an antiparallel β-sheet with four strands, five α-helices and two 3 10 -helices. Structural comparison of human UBE2G2 with yeast Ubc7 indicated that the overall structures are similar except for the long loop region and the C-terminal helix. Superimposition of UBE2G2 on UbcH7 in a c-Cbl–UbcH7–ZAP70 ternary complex suggested that the two loop regions of UBE2G2 interact with the RING domain in a similar way to UbcH7. In addition, the extra loop region of UBE2G2 may interact with the RING domain or its neighbouring region and may be involved in the binding specificity and stability

  1. Deconstructing IgG4-related disease involvement of midline structures: Comparison to common mimickers.

    Science.gov (United States)

    Lanzillotta, Marco; Campochiaro, Corrado; Trimarchi, Matteo; Arrigoni, Gianluigi; Gerevini, Simonetta; Milani, Raffaella; Bozzolo, Enrica; Biafora, Matteo; Venturini, Elena; Cicalese, Maria Pia; Stone, John H; Sabbadini, Maria Grazia; Della-Torre, Emanuel

    2017-07-01

    A series of destructive and tumefactive lesions of the midline structures have been recently added to the spectrum of IgG4-related disease (IgG4-RD). We examined the clinical, serological, endoscopic, radiological, and histological features that might be of utility in distinguishing IgG4-RD from other forms of inflammatory conditions with the potential to involve the sinonasal area and the oral cavity. We studied 11 consecutive patients with erosive and/or tumefactive lesions of the midline structures referred to our tertiary care center. All patients underwent serum IgG4 measurement, flow cytometry for circulating plasmablast counts, nasal endoscopy, radiological studies, and histological evaluation of tissue specimens. The histological studies included immunostaining studies to assess the number of IgG4 + plasma cells/HPF for calculation of the IgG4+/IgG + plasma cell ratio. Five patients with granulomatosis with polyangiitis (GPA), three with cocaine-induced midline destructive lesions (CIMDL), and three with IgG4-RD were studied. We found no clinical, endoscopic, or radiological findings specific for IgG4-RD. Increased serum IgG4 and plasmablasts levels were not specific for IgG4-RD. Rather, all 11 patients had elevated blood plasmablast concentrations, and several patients with GPA and CIMDL had elevated serum IgG4 levels. Storiform fibrosis and an IgG4+/IgG + plasma cell ratio >20% on histological examination, however, were observed only in patients with IgG4-RD. Histological examination of bioptic samples from the sinonasal area and oral cavity represents the mainstay for the diagnosis of IgG4-RD involvement of the midline structures.

  2. Isolated Mass-Forming IgG4-Related Cholangitis as an Initial Clinical Presentation of Systemic IgG4-Related Disease

    Directory of Open Access Journals (Sweden)

    Seokhwi Kim

    2016-07-01

    Full Text Available IgG4-related disease (IgG4-RD may involve multiple organs. Although it usually presents as diffuse organ involvement, localized mass-forming lesions have been occasionally encountered in pancreas. However, the same pattern has been seldom reported in biliary tract. A 61-year-old male showed a hilar bile duct mass with multiple enlarged lymph nodes in imaging studies and he underwent trisectionectomy under impression of cholangiocarcinoma. Gross examination revealed a mass-like lesion around hilar bile duct. Histopathologically, dense lymphoplasmacytic infiltration and storiform fibrosis were identified without evidence of malignancy. Immunohistochemical stain demonstrated rich IgG4-positive plasma cell infiltration. Follow-up imaging studies disclosed multiple enlarged lymph nodes with involvement of pancreas and perisplenic soft tissue. The lesions have been significantly reduced after steroid treatment, which suggests multi-organ involvement of systemic IgG4-RD. Here, we report an unusual localized mass-forming IgG4-related cholangitis as an initial presentation of IgG4-RD, which was biliary manifestation of systemic IgG4-related autoimmune disease.

  3. Towards Free-Form Kinetic Structures

    DEFF Research Database (Denmark)

    Parigi, Dario; Kirkegaard, Poul Henning

    2012-01-01

    of pin-slot paths starting from the local displacements of element [2] [3]. In the design of kinetic structures, in particular when complex three dimensional and non regular configurations are involved, the functionality is frequently related to a global displacement capability of the assembly rather...... for the generation of free-form kinetic structures....

  4. An enzyme-free strategy for ultrasensitive detection of adenosine using a multipurpose aptamer probe and malachite green.

    Science.gov (United States)

    Zhao, Hui; Wang, Yong-Sheng; Tang, Xian; Zhou, Bin; Xue, Jin-Hua; Liu, Hui; Liu, Shan-Du; Cao, Jin-Xiu; Li, Ming-Hui; Chen, Si-Han

    2015-08-05

    We report on an enzyme-free and label-free strategy for the ultrasensitive determination of adenosine. A novel multipurpose adenosine aptamer (MAAP) is designed, which serves as an effective target recognition probe and a capture probe for malachite green. In the presence of adenosine, the conformation of the MAAP is converted from a hairpin structure to a G-quadruplex. Upon addition of malachite green into this solution, a noticeable enhancement of resonance light scattering was observed. The signal response is directly proportional to the concentration of adenosine ranging from 75 pM to 2.2 nM with a detection limit of 23 pM, which was 100-10,000 folds lower than those obtained by previous reported methods. Moreover, this strategy has been applied successfully for detecting adenosine in human urine and blood samples, further proving its reliability. The mechanism of adenosine inducing MAAP to form a G-quadruplex was demonstrated by a series of control experiments. Such a MAAP probe can also be used to other strategies such as fluorescence or spectrophotometric ones. We suppose that this strategy can be expanded to develop a universal analytical platform for various target molecules in the biomedical field and clinical diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Measuring the Thermophysical and Structural Properties of Glass-Forming and Quasicrystal-Forming Liquids

    Science.gov (United States)

    Hyers, Robert W.; Bradshaw, Richard C.; Rogers, Jan R.; Gangopadhyay, Anup K.; Kelton, Ken F.

    2006-01-01

    The thermophysical properties of glass-forming and quasicrystal-forming alloys show many interesting features in the undercooled liquid range. Some of the features in the thermophysical property curves are expected to reflect changes in the structure and coordination of the liquid. These measurements require containerless processing such as electrostatic levitation to access the undercooled liquid regime. An overview of the state of the art in measuring the thermophysical properties and structure of undercooled liquid glass-forming and quasicrystal-forming alloys will be presented, along with the status of current measurements.

  6. Study on Electrochemical Insulin Sensing Utilizing a DNA Aptamer-Immobilized Gold Electrode

    Directory of Open Access Journals (Sweden)

    Izumi Kubo

    2015-07-01

    Full Text Available We investigated an insulin-sensing method by utilizing an insulin-binding aptamer IGA3, which forms an anti-parallel G-quadruplex with folded single strands. Spectroscopic observation indicates that some anti-parallel G-quadruplex bind hemin and show peroxidase activity. In this study, the peroxidase activity of IGA3 with hemin was confirmed by spectrophotometric measurements, i.e., the activity was three-times higher than hemin itself. IGA3 was then immobilized onto a gold electrode to determine its electrochemical activity. The peroxidase activity of the immobilized IGA3-hemin complex was determined by cyclic voltammetry, and a cathodic peak current of the electrode showed a dependence on the concentration of H2O2. The cathodic peak current of the IGA3-hemin complex decreased by binding it to insulin, and this decrease depended on the concentration of insulin.

  7. Complex DNA structures and structures of DNA complexes

    International Nuclear Information System (INIS)

    Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J.

    1994-01-01

    Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe 1 H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful

  8. Complex DNA structures and structures of DNA complexes

    Energy Technology Data Exchange (ETDEWEB)

    Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J. [Scripps Research Institute, La Jolla, CA (United States)

    1994-12-01

    Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe {sup 1}H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful.

  9. Crystal structure of the conserved herpesvirus fusion regulator complex gH—gL

    Energy Technology Data Exchange (ETDEWEB)

    Chowdary, Tirumala K.; Cairns, Tina M.; Atanasiu, Doina; Cohen, Gary H.; Eisenberg, Roselyn J.; Heldwein, Ekaterina E. [UPENN; (Tufts-MED)

    2015-02-09

    Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH–gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH–gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, we propose that gH–gL activates gB for fusion, possibly through direct binding. Formation of a gB–gH–gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB–gH–gL interface a promising antiviral target.

  10. Structures of the G85R Variant of SOD1 in Familial Amyotrophic Lateral Sclerosis

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Xiaohang; Antonyuk, Svetlana V.; Seetharaman, Sai V.; Whitson, Lisa J.; Taylor, Alexander B.; Holloway, Stephen P.; Strange, Richard W.; Doucette, Peter A.; Valentine, Joan Selverstone; Tiwari, Ashutosh; Hayward, Lawrence J.; Padua, Shelby; Cohlberg, Jeffrey A.; Hasnain, S. Samar; Hart, P. John (Texas-HSC); (Cal. State); (UMASS, MED); (UCLA); (Daresbury)

    2008-07-21

    Mutations in the gene encoding human copper-zinc superoxide dismutase (SOD1) cause a dominant form of the progressive neurodegenerative disease amyotrophic lateral sclerosis. Transgenic mice expressing the human G85R SOD1 variant develop paralytic symptoms concomitant with the appearance of SOD1-enriched proteinaceous inclusions in their neural tissues. The process(es) through which misfolding or aggregation of G85R SOD1 induces motor neuron toxicity is not understood. Here we present structures of the human G85R SOD1 variant determined by single crystal x-ray diffraction. Alterations in structure of the metal-binding loop elements relative to the wild type enzyme suggest a molecular basis for the metal ion deficiency of the G85R SOD1 protein observed in the central nervous system of transgenic mice and in purified recombinant G85R SOD1. These findings support the notion that metal-deficient and/or disulfide-reduced mutant SOD1 species contribute to toxicity in SOD1-linked amyotrophic lateral sclerosis.

  11. Nucleon Structure and hyperon form factors from lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Huey-Wen

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point to be 1.23(5), consistant with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(26), consistent with the Adelaide-JLab Collaboration's result. The hyperon Sigma and Xi axial coupling constants are also performed for the first time in a lattice calculation, g_SigmaSigma = 0.441(14) and g_XiXi = -0.277(11).

  12. Comparative studies on the structure and adhesion of setae in G. gecko and G. swinhonis

    Institute of Scientific and Technical Information of China (English)

    GUO; Ce; WANG; WenBo; YU; Min; DAI; ZhenDong

    2007-01-01

    Scanning electron microscopy (SEM) and histological techniques were used to observe and study the setae structures of two gecko species (G. gecko and G. swinhonis) and the relationships between these structures and the adhesive forces. The SEM results showed that the setae of these two species were densely distributed in an orderly fashion, and branched with curved tips. The setae of G. gecko had cluster structures, each cluster containing 4-6 setae whose terminal branches curved towards the center of the toes at ~ 10(°-), the tips of the branches like spatulae and densely arrayed at an interval of less than 0.2-0.3 μm. On the contrary, the branch tips in the setae of G. swinhonis were curled, and the terminal parts of setae curved towards the center of the toes at various angles. Usually the setae of these gecko species branch twice at the top at intervals greater than that of G. gecko. The histological observation found that inside the setae of these two species there were plenty of unevenly distributed contents, such as epithelia, fat cells, pigmental cells and muscle tissue, but no gland cells existed. The results of functional experiments suggested that modifying the structure of gecko's setae could reduce its adhesive ability dramatically, demonstrating the positive correlation between the structure of the gecko's setae and its adhesive ability. The above results provide important information in designing bio-mimic setae and bio-gecko robots.

  13. Synthesis and Characterization of thermo/pH-responsive Supramolecular G-Quadruplexes for the Construction of Supramolecular Hacky Sacks for Biorelevant Applications

    Science.gov (United States)

    Negron Rios, Luis M.

    The impact of size, shape, and distribution of lipophilic regions on the surfaces of nanoscopic objects that are amphiphilic or patchy (such as proteins) are yet to be fully understood. One of the reasons for this is the lack of an appropriate model systems in which to probe this question. Our group has previously reported 2'-deoxyguanosine (8ArG) derivatives that self-assemble in aqueous media into discrete supramolecular hexadecamers that show the lower critical solution temperature (LCST) phenomenon. The LCST phenomenon is a convenient and rigorous strategy to measure the hydrophobicity of a system. Although these SGQs are potentially attractive for biomedical applications like drug-delivery, the narrow window of physiological temperatures complicates their implementation. This moved us to redesign the constituent 8ArG subunits to incorporate imidazole moieties that would lead to pH-responsive SGQs, working isothermally. Upon reaching a threshold temperature (Lower Critical Solution Temperature, LCST) at pH 7, these dual-responsive SGQs further self-assemble to form nano/micro hydrogel globules that we called them supramolecular hacky sacks (SHS). However, we can isolate kinetically stable versions of these SHS by lowering the ionic strength of the medium (i.e., from the molar to the millimolar range) in a process that we term "fixing the SHS", in which these SHS maintain their integrity (size and shape) and stability without the requirement of crosslinking agents. After structural characterization and in vitro studies of SHS, we performed encapsulation studies of DOX, rhodamine, dsDNA (F26T), thrombin binding aptamer (TBA) and dextran (3 kDa) Texas Red conjugate. Then we performed in vivo studies of cell internalization and drug delivery with neuroblastoma SY-SH5Y. The performed studies will bring new approaches for the development of new biotechnology for fundamental applications and the emerging of novel therapeutic agents for biomedical applications.

  14. Crystal Structure of the Conserved Herpes Virus Fusion Regulator Complex gH–gL

    Energy Technology Data Exchange (ETDEWEB)

    Chowdary, T.; Cairns, T; Atanasiu, D; Cohen, G; Eisenberg, R; Heldwein, E

    2010-01-01

    Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH-gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH-gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, we propose that gH-gL activates gB for fusion, possibly through direct binding. Formation of a gB-gH-gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB-gH-gL interface a promising antiviral target.

  15. Crystal structure of the conserved herpes virus fusion regulator complex gH-gL

    Energy Technology Data Exchange (ETDEWEB)

    Chowdary, Tirumala K; Cairns, Tina M; Atanasiu, Doina; Cohen, Gary H; Eisenberg, Roselyn J; Heldwein, Ekaterina E [UPENN; (Tufts-MED)

    2010-09-13

    Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH-gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH-gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, we propose that gH-gL activates gB for fusion, possibly through direct binding. Formation of a gB-gH-gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB-gH-gL interface a promising antiviral target.

  16. Extracting energy and structure properties of glass-forming liquids from structural relaxation time.

    Science.gov (United States)

    Wang, Lianwen

    2012-04-18

    A comprehensive examination of the kinetic liquid model (Wang et al 2010 J. Phys.: Condens. Matter 22 455104) is carried out by fitting the structural relaxation time of 26 different glass-forming liquids in a wide temperature range, including most of the well-studied materials. Careful analysis of the compiled reported data reveals that experimental inaccuracies should not be overlooked in any 'benchmark test' of relating theories or models (e.g. in Lunkenheimer et al 2010 Phys. Rev. E 81 051504). The procedure, accuracy, ability, and efficiency of the kinetic liquid model are discussed in detail and in comparison with other available fitting methods. In general, the kinetic liquid model could be verified by 17 of the 26 compiled data sets and can serve as a meaningful approximative method for analyzing these liquids. Nonetheless, further experimental examinations in a wide temperature range are needed and are called for. Through fitting, the microscopic details of these liquids are extracted, namely, the enthalpy, entropy, and cooperativity in structural relaxation, which may facilitate further quantitative analysis to both the liquidus and glassy states of these materials.

  17. A possible form of the pion's structure function

    International Nuclear Information System (INIS)

    Long Ming; Huang Tao

    1986-01-01

    The pion's structure function behaviour is discussed by using the Fock state expansion of the hadronic wave function in QCD in this paper. As an example, we employ a model wave function of the Fock state in the light-cone and assume a Regge behaviour of a weight function for higher Fock states, and we get a possible form of the pion's structure function. This form is consistent with experimental data of the pion's structure function

  18. FILAMENTARY STRUCTURE OF STAR-FORMING COMPLEXES

    International Nuclear Information System (INIS)

    Myers, Philip C.

    2009-01-01

    The nearest young stellar groups are associated with 'hubs' of column density exceeding 10 22 cm -2 , according to recent observations. These hubs radiate multiple 'filaments' of parsec length, having lower column density and fewer stars. Systems with many filaments tend to have parallel filaments with similar spacing. Such 'hub-filament structure' is associated with all of the nine young stellar groups within 300 pc, forming low-mass stars. Similar properties are seen in infrared dark clouds forming more massive stars. In a new model, an initial clump in a uniform medium is compressed into a self-gravitating, modulated layer. The outer layer resembles the modulated equilibrium of Schmid-Burgk with nearly parallel filaments. The filaments converge onto the compressed clump, which collapses to form stars with high efficiency. The initial medium and condensations have densities similar to those in nearby star-forming clouds and clumps. The predicted structures resemble observed hub-filament systems in their size, shape, and column density, and in the appearance of their filaments. These results suggest that HFS associated with young stellar groups may arise from compression of clumpy gas in molecular clouds.

  19. Isolation and structure-function characterization of a signaling-active rhodopsin-G protein complex.

    Science.gov (United States)

    Gao, Yang; Westfield, Gerwin; Erickson, Jon W; Cerione, Richard A; Skiniotis, Georgios; Ramachandran, Sekar

    2017-08-25

    The visual photo-transduction cascade is a prototypical G protein-coupled receptor (GPCR) signaling system, in which light-activated rhodopsin (Rho*) is the GPCR catalyzing the exchange of GDP for GTP on the heterotrimeric G protein transducin (G T ). This results in the dissociation of G T into its component α T -GTP and β 1 γ 1 subunit complex. Structural information for the Rho*-G T complex will be essential for understanding the molecular mechanism of visual photo-transduction. Moreover, it will shed light on how GPCRs selectively couple to and activate their G protein signaling partners. Here, we report on the preparation of a stable detergent-solubilized complex between Rho* and a heterotrimer (G T *) comprising a Gα T /Gα i1 chimera (α T *) and β 1 γ 1 The complex was formed on native rod outer segment membranes upon light activation, solubilized in lauryl maltose neopentyl glycol, and purified with a combination of affinity and size-exclusion chromatography. We found that the complex is fully functional and that the stoichiometry of Rho* to Gα T * is 1:1. The molecular weight of the complex was calculated from small-angle X-ray scattering data and was in good agreement with a model consisting of one Rho* and one G T *. The complex was visualized by negative-stain electron microscopy, which revealed an architecture similar to that of the β 2 -adrenergic receptor-G S complex, including a flexible α T * helical domain. The stability and high yield of the purified complex should allow for further efforts toward obtaining a high-resolution structure of this important signaling complex. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Nucleon quark structure and strong meson-nucleon form factors

    International Nuclear Information System (INIS)

    Efimov, G.V.; Ivanov, M.A.

    1987-01-01

    The nucleon is considered as a three-quark system in virton-quark model. The main statistic properties of proton and neutron are calculated: magnetic moments, electromagnetic radii, G A /G V ratio in weak neutron decay. Strong meson-nucleon form factors which determine nucleon-nucleon potential are obtained as a function of squared transfer momentum of mesons. The results are compared with phenomenological form factors used for description of phases of NN-scattering in the one-boson-, exchange model

  1. C-V and G-V characteristics of ion-implanted MOS structures depending upon the geometrical structure of the implanted region

    International Nuclear Information System (INIS)

    Zohta, Y.

    1977-01-01

    It is found that the capacitance-voltage (C-V) and conductance-voltage (G-V) characteristics of MOS capacitors, into which ions of the opposite conductivity type are implanted, depend strongly upon the geometrical structure of the ion-implanted region. This phenomenon can be analyzed in terms of lateral current flow which connects an inversion layer formed in the ion-implanted region to a surrounding nonimplanted substrate. On the basis of this model, the C-V and G-V characteristics are calculated using a simple equivalent circuit, and general relationships inherent in this model are obtained. MOS capacitors with an ion-implanted layer of different geometries have been prepared to measure their C-V and G-V characteristics. Comparison of experimental measurements with theory substantiates the lateral current flow model

  2. [Structure and evolution of the eukaryotic FANCJ-like proteins].

    Science.gov (United States)

    Wuhe, Jike; Zefeng, Wu; Sanhong, Fan; Xuguang, Xi

    2015-02-01

    The FANCJ-like protein family is a class of ATP-dependent helicases that can catalytically unwind duplex DNA along the 5'-3' direction. It is involved in the processes of DNA damage repair, homologous recombination and G-quadruplex DNA unwinding, and plays a critical role in maintaining genome integrity. In this study, we systemically analyzed FNACJ-like proteins from 47 eukaryotic species and discussed their sequences diversity, origin and evolution, motif organization patterns and spatial structure differences. Four members of FNACJ-like proteins, including XPD, CHL1, RTEL1 and FANCJ, were found in eukaryotes, but some of them were seriously deficient in most fungi and some insects. For example, the Zygomycota fungi lost RTEL1, Basidiomycota and Ascomycota fungi lost RTEL1 and FANCJ, and Diptera insect lost FANCJ. FANCJ-like proteins contain canonical motor domains HD1 and HD2, and the HD1 domain further integrates with three unique domains Fe-S, Arch and Extra-D. Fe-S and Arch domains are relatively conservative in all members of the family, but the Extra-D domain is lost in XPD and differs from one another in rest members. There are 7, 10 and 2 specific motifs found from the three unique domains respectively, while 5 and 12 specific motifs are found from HD1 and HD2 domains except the conserved motifs reported previously. By analyzing the arrangement pattern of these specific motifs, we found that RTEL1 and FANCJ are more closer and share two specific motifs Vb2 and Vc in HD2 domain, which are likely related with their G-quadruplex DNA unwinding activity. The evidence of evolution showed that FACNJ-like proteins were originated from a helicase, which has a HD1 domain inserted by extra Fe-S domain and Arch domain. By three continuous gene duplication events and followed specialization, eukaryotes finally possessed the current four members of FANCJ-like proteins.

  3. Unusual glass-forming ability induced by changes in the local atomic structure in Ti-based bulk metallic glass

    International Nuclear Information System (INIS)

    Kim, Y C; Chang, H J; Kim, D H; Kim, W T; Cha, P R

    2007-01-01

    The effect of partial replacement of Cu by Be in Ti 50 Cu 32 Ni 15 Sn 3 alloy on the thermal properties, structure, and forming ability of an amorphous phase were investigated by differential scanning calorimetry (DSC), x-ray diffraction (XRD), extended x-ray absorption fine structure (EXAFS), and high-resolution transmission electron microscopy (HRTEM). Ti 50 Cu 25 Ni 15 Sn 3 Be 7 alloy shows enhanced glass-forming ability, enabling one to fabricate a fully amorphous bulk metallic glass sample 2 mm in diameter by injection casting. With the replacement, the supercooled liquid region ΔT x (= T x -T g , where T x is the crystallization temperature and T g is the glass transition temperature) decreased from 73 to 45 K and the reduced glass transition temperature T rg (= T g /T 1 , where T 1 is the liquidus temperature) increased from 0.53 to 0.57. The amorphous Ti 50 Cu 25 Ni 15 Sn 3 Be 7 phase showed a formation of short-range-ordered clusters 1-2 nm in size, which is attributed to the strong interaction between Ti and Be. The results show that ΔT x can be used as a thermal parameter reflecting the glass-forming ability of the alloy only when the phase formed during crystallization is the same as the phase competing with the glass transition during solidification

  4. A novel polyamine allosteric site of SpeG from Vibrio cholerae is revealed by its dodecameric structure.

    Science.gov (United States)

    Filippova, Ekaterina V; Kuhn, Misty L; Osipiuk, Jerzy; Kiryukhina, Olga; Joachimiak, Andrzej; Ballicora, Miguel A; Anderson, Wayne F

    2015-03-27

    Spermidine N-acetyltransferase, encoded by the gene speG, catalyzes the initial step in the degradation of polyamines and is a critical enzyme for determining the polyamine concentrations in bacteria. In Escherichia coli, studies have shown that SpeG is the enzyme responsible for acetylating spermidine under stress conditions and for preventing spermidine toxicity. Not all bacteria contain speG, and many bacterial pathogens have developed strategies to either acquire or silence it for pathogenesis. Here, we present thorough kinetic analyses combined with structural characterization of the VCA0947 SpeG enzyme from the important human pathogen Vibrio cholerae. Our studies revealed the unexpected presence of a previously unknown allosteric site and an unusual dodecameric structure for a member of the Gcn5-related N-acetyltransferase superfamily. We show that SpeG forms dodecamers in solution and in crystals and describe its three-dimensional structure in several ligand-free and liganded structures. Importantly, these structural data define the first view of a polyamine bound in an allosteric site of an N-acetyltransferase. Kinetic characterization of SpeG from V. cholerae showed that it acetylates spermidine and spermine. The behavior of this enzyme is complex and exhibits sigmoidal curves and substrate inhibition. We performed a detailed non-linear regression kinetic analysis to simultaneously fit families of substrate saturation curves to uncover a simple kinetic mechanism that explains the apparent complexity of this enzyme. Our results provide a fundamental understanding of the bacterial SpeG enzyme, which will be key toward understanding the regulation of polyamine levels in bacteria during pathogenesis. Copyright © 2015. Published by Elsevier Ltd.

  5. Shallow Boomerang-shaped Influenza Hemagglutinin G13A Mutant Structure Promotes Leaky Membrane Fusion*

    Science.gov (United States)

    Lai, Alex L.; Tamm, Lukas K.

    2010-01-01

    Our previous studies showed that an angled boomerang-shaped structure of the influenza hemagglutinin (HA) fusion domain is critical for virus entry into host cells by membrane fusion. Because the acute angle of ∼105° of the wild-type fusion domain promotes efficient non-leaky membrane fusion, we asked whether different angles would still support fusion and thus facilitate virus entry. Here, we show that the G13A fusion domain mutant produces a new leaky fusion phenotype. The mutant fusion domain structure was solved by NMR spectroscopy in a lipid environment at fusion pH. The mutant adopted a boomerang structure similar to that of wild type but with a shallower kink angle of ∼150°. G13A perturbed the structure of model membranes to a lesser degree than wild type but to a greater degree than non-fusogenic fusion domain mutants. The strength of G13A binding to lipid bilayers was also intermediate between that of wild type and non-fusogenic mutants. These membrane interactions provide a clear link between structure and function of influenza fusion domains: an acute angle is required to promote clean non-leaky fusion suitable for virus entry presumably by interaction of the fusion domain with the transmembrane domain deep in the lipid bilayer. A shallower angle perturbs the bilayer of the target membrane so that it becomes leaky and unable to form a clean fusion pore. Mutants with no fixed boomerang angle interacted with bilayers weakly and did not promote any fusion or membrane perturbation. PMID:20826788

  6. Transparent form-active system with structural glass

    NARCIS (Netherlands)

    Nikolaou, M.S.N.; Veer, F.A.; Eigenraam, P.

    2015-01-01

    Free-form transparent wide-span spatial structures which have being constructed so far, are based on the concept of three sets of components, the structural components, usually steel elements to ensure both compressive and tensional capacity; the glass cladding elements for expressing transparency;

  7. Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter

    Directory of Open Access Journals (Sweden)

    Yee Hooi Min

    2016-01-01

    Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.

  8. Structural characterization of the Man5 glycoform of human IgG3 Fc

    Energy Technology Data Exchange (ETDEWEB)

    Shah, Ishan S.; Lovell, Scott; Mehzabeen, Nurjahan; Battaile, Kevin P.; Tolbert, Thomas J. (Kansas); (HWMRI)

    2017-12-01

    Immunoglobulin G (IgG) consists of four subclasses in humans: IgG1, IgG2, IgG3 and IgG4, which are highly conserved but have unique differences that result in subclass-specific effector functions. Though IgG1 is the most extensively studied IgG subclass, study of other subclasses is important to understand overall immune function and for development of new therapeutics. When compared to IgG1, IgG3 exhibits a similar binding profile to Fcγ receptors and stronger activation of complement. All IgG subclasses are glycosylated at N297, which is required for Fcγ receptor and C1q complement binding as well as maintaining optimal Fc conformation. We have determined the crystal structure of homogenously glycosylated human IgG3 Fc with a GlcNAc2Man5 (Man5) high mannose glycoform at 1.8 Å resolution and compared its structural features with published structures from the other IgG subclasses. Although the overall structure of IgG3 Fc is similar to that of other subclasses, some structural perturbations based on sequence differences were revealed. For instance, the presence of R435 in IgG3 (and H435 in the other IgG subclasses) has been implicated to result in IgG3-specific properties related to binding to protein A, protein G and the neonatal Fc receptor (FcRn). The IgG3 Fc structure helps to explain some of these differences. Additionally, protein-glycan contacts observed in the crystal structure appear to correlate with IgG3 affinity for Fcγ receptors as shown by binding studies with IgG3 Fc glycoforms. Finally, this IgG3 Fc structure provides a template for further studies aimed at engineering the Fc for specific gain of function.

  9. Structure and stability of small Li2 +(X2Σ+ g )-Xen (n = 1-6) clusters

    Science.gov (United States)

    Saidi, Sameh; Ghanmi, Chedli; Berriche, Hamid

    2014-04-01

    We have studied the structure and stability of the Li2 +(X2Σ+ g )Xe n ( n = 1-6) clusters for special symmetry groups. The potential energy surfaces of these clusters, are described using an accurate ab initio approach based on non-empirical pseudopotential, parameterized l-dependent polarization potential and analytic potential forms for the Li+Xe and Xe-Xe interactions. The pseudopotential technique has reduced the number of active electrons of Li2 +(X2Σ+ g )-Xe n ( n = 1-6) clusters to only one electron, the Li valence electron. The core-core interactions for Li+Xe are included using accurate CCSD(T) potential fitted using the analytical form of Tang and Toennies. For the Xe-Xe potential interactions we have used the analytical form of Lennard Jones (LJ6 - 12). The potential energy surfaces of the Li2 +(X2Σ+ g )Xe n ( n = 1-6) clusters are performed for a fixed distance of the Li2 +(X2Σ+ g ) alkali dimer, its equilibrium distance. They are used to extract information on the stability of the Li2 +(X2Σ+ g Xe n ( n = 1-6) clusters. For each n, the stability of the different isomers is examined by comparing their potential energy surfaces. Moreover, we have determined the quantum energies ( D 0), the zero-point-energies (ZPE) and the ZPE%. To our best knowledge, there are neither experimental nor theoretical works realized for the Li2 +(X2Σ+ g Xe n ( n = 1-6) clusters, our results are presented for the first time.

  10. G-LoSA for Prediction of Protein-Ligand Binding Sites and Structures.

    Science.gov (United States)

    Lee, Hui Sun; Im, Wonpil

    2017-01-01

    Recent advances in high-throughput structure determination and computational protein structure prediction have significantly enriched the universe of protein structure. However, there is still a large gap between the number of available protein structures and that of proteins with annotated function in high accuracy. Computational structure-based protein function prediction has emerged to reduce this knowledge gap. The identification of a ligand binding site and its structure is critical to the determination of a protein's molecular function. We present a computational methodology for predicting small molecule ligand binding site and ligand structure using G-LoSA, our protein local structure alignment and similarity measurement tool. All the computational procedures described here can be easily implemented using G-LoSA Toolkit, a package of standalone software programs and preprocessed PDB structure libraries. G-LoSA and G-LoSA Toolkit are freely available to academic users at http://compbio.lehigh.edu/GLoSA . We also illustrate a case study to show the potential of our template-based approach harnessing G-LoSA for protein function prediction.

  11. Aptamer-based turn-on fluorescent four-branched quaternary ammonium pyrazine probe for selective thrombin detection.

    Science.gov (United States)

    Yan, Shengyong; Huang, Rong; Zhou, Yangyang; Zhang, Ming; Deng, Minggang; Wang, Xiaolin; Weng, Xiaocheng; Zhou, Xiang

    2011-01-28

    In this thrombin detection system, the bright fluorescence of TASPI is almost eliminated by the DNA aptamer TBA (turn-off); however, in the presence of thrombin, it specifically binds to TBA by folding unrestricted TBA into an anti-parallel G-quadruplex structure and then releasing TASPI molecules, resulting in vivid and facile fluorescence recovery (turn-on).

  12. Structural basis of genomic RNA (gRNA) dimerization and packaging determinants of mouse mammary tumor virus (MMTV).

    Science.gov (United States)

    Aktar, Suriya J; Vivet-Boudou, Valérie; Ali, Lizna M; Jabeen, Ayesha; Kalloush, Rawan M; Richer, Delphine; Mustafa, Farah; Marquet, Roland; Rizvi, Tahir A

    2014-11-14

    One of the hallmarks of retroviral life cycle is the efficient and specific packaging of two copies of retroviral gRNA in the form of a non-covalent RNA dimer by the assembling virions. It is becoming increasingly clear that the process of dimerization is closely linked with gRNA packaging, and in some retroviruses, the latter depends on the former. Earlier mutational analysis of the 5' end of the MMTV genome indicated that MMTV gRNA packaging determinants comprise sequences both within the 5' untranslated region (5' UTR) and the beginning of gag. The RNA secondary structure of MMTV gRNA packaging sequences was elucidated employing selective 2'hydroxyl acylation analyzed by primer extension (SHAPE). SHAPE analyses revealed the presence of a U5/Gag long-range interaction (U5/Gag LRI), not predicted by minimum free-energy structure predictions that potentially stabilizes the global structure of this region. Structure conservation along with base-pair covariations between different strains of MMTV further supported the SHAPE-validated model. The 5' region of the MMTV gRNA contains multiple palindromic (pal) sequences that could initiate intermolecular interaction during RNA dimerization. In vitro RNA dimerization, SHAPE analysis, and structure prediction approaches on a series of pal mutants revealed that MMTV RNA utilizes a palindromic point of contact to initiate intermolecular interactions between two gRNAs, leading to dimerization. This contact point resides within pal II (5' CGGCCG 3') at the 5' UTR and contains a canonical "GC" dyad and therefore likely constitutes the MMTV RNA dimerization initiation site (DIS). Further analyses of these pal mutants employing in vivo genetic approaches indicate that pal II, as well as pal sequences located in the primer binding site (PBS) are both required for efficient MMTV gRNA packaging. Employing structural prediction, biochemical, and genetic approaches, we show that pal II functions as a primary point of contact between

  13. Nanodiamond particles forming photonic structures

    International Nuclear Information System (INIS)

    Grichko, Varvara; Tyler, Talmage; Grishko, Victor I; Shenderova, Olga

    2008-01-01

    Colloid suspensions of irregularly shaped, highly charged detonation nanodiamond particles are found to have unexpected optical properties, similar to those of photonic crystals. This finding is all the more surprising since the particles used in this work are far more polydisperse than those typically forming photonic crystals. Intensely iridescent structures have been fabricated using the centrifugation of aqueous suspensions of nanodiamonds

  14. Nanodiamond particles forming photonic structures

    Energy Technology Data Exchange (ETDEWEB)

    Grichko, Varvara; Tyler, Talmage; Grishko, Victor I; Shenderova, Olga [International Technology Center, 8100 Brownleigh Drive, Suite 120, Raleigh, NC 27617 (United States)], E-mail: oshenderova@itc-inc.org

    2008-06-04

    Colloid suspensions of irregularly shaped, highly charged detonation nanodiamond particles are found to have unexpected optical properties, similar to those of photonic crystals. This finding is all the more surprising since the particles used in this work are far more polydisperse than those typically forming photonic crystals. Intensely iridescent structures have been fabricated using the centrifugation of aqueous suspensions of nanodiamonds.

  15. STRUCTURES OF LOCAL GALAXIES COMPARED TO HIGH-REDSHIFT STAR-FORMING GALAXIES

    International Nuclear Information System (INIS)

    Petty, Sara M.; De Mello, DuIlia F.; Gallagher, John S.; Gardner, Jonathan P.; Lotz, Jennifer M.; Matt Mountain, C.; Smith, Linda J.

    2009-01-01

    The rest-frame far-ultraviolet morphologies of eight nearby interacting and starburst galaxies (Arp 269, M 82, Mrk 8, NGC 520, NGC 1068, NGC 3079, NGC 3310, and NGC 7673) are compared with 54 galaxies at z ∼ 1.5 and 46 galaxies at z ∼ 4 observed in the Great Observatories Origins Deep Survey (GOODS) taken with the Advanced Camera for Surveys onboard the Hubble Space Telescope. The nearby sample is artificially redshifted to z ∼ 1.5 and 4 by applying luminosity and size scaling. We compare the simulated galaxy morphologies to real z ∼ 1.5 and 4 UV-bright galaxy morphologies. We calculate the Gini coefficient (G), the second-order moment of the brightest 20% of the galaxy's flux (M 20 ), and the Sersic index (n). We explore the use of nonparametric methods with two-dimensional profile fitting and find the combination of M 20 with n an efficient method to classify galaxies as having merger, exponential disk, or bulge-like morphologies. When classified according to G and M 20 20/30% of real/simulated galaxies at z ∼ 1.5 and 37/12% at z ∼ 4 have bulge-like morphologies. The rest have merger-like or intermediate distributions. Alternatively, when classified according to the Sersic index, 70% of the z ∼ 1.5 and z ∼ 4 real galaxies are exponential disks or bulge-like with n>0.8, and ∼ 30% of the real galaxies are classified as mergers. The artificially redshifted galaxies have n values with ∼ 35% bulge or exponential at z ∼ 1.5 and 4. Therefore, ∼ 20%-30% of Lyman-break galaxies have structures similar to local starburst mergers, and may be driven by similar processes. We assume merger-like or clumpy star-forming galaxies in the GOODS field have morphological structure with values n 20 > - 1.7. We conclude that Mrk 8, NGC 3079, and NGC 7673 have structures similar to those of merger-like and clumpy star-forming galaxies observed at z ∼ 1.5 and 4.

  16. Combustible structural composites and methods of forming combustible structural composites

    Science.gov (United States)

    Daniels, Michael A.; Heaps, Ronald J.; Steffler, Eric D.; Swank, W. David

    2013-04-02

    Combustible structural composites and methods of forming same are disclosed. In an embodiment, a combustible structural composite includes combustible material comprising a fuel metal and a metal oxide. The fuel metal is present in the combustible material at a weight ratio from 1:9 to 1:1 of the fuel metal to the metal oxide. The fuel metal and the metal oxide are capable of exothermically reacting upon application of energy at or above a threshold value to support self-sustaining combustion of the combustible material within the combustible structural composite. Structural-reinforcing fibers are present in the composite at a weight ratio from 1:20 to 10:1 of the structural-reinforcing fibers to the combustible material. Other embodiments and aspects are disclosed.

  17. Structural information theory and visual form

    NARCIS (Netherlands)

    Leeuwenberg, E.L.J.; Kaernbach, C.; Schroeger, E.; Mueller, H.

    2003-01-01

    The paper attends to basic characteristics of visual form as approached by Structural information theory, or SIT, (Leeuwenberg, Van der Helm and Van Lier). The introduction provides a global survey of this approach. The main part of the paper focuses on three characteristics of SIT. Each one is made

  18. Exploratory Topology Modelling of Form-Active Hybrid Structures

    DEFF Research Database (Denmark)

    Holden Deleuran, Anders; Pauly, Mark; Tamke, Martin

    2016-01-01

    The development of novel form-active hybrid structures (FAHS) is impeded by a lack of modelling tools that allow for exploratory topology modelling of shaped assemblies. We present a flexible and real-time computational design modelling pipeline developed for the exploratory modelling of FAHS...... that enables designers and engineers to iteratively construct and manipulate form-active hybrid assembly topology on the fly. The pipeline implements Kangaroo2's projection-based methods for modelling hybrid structures consisting of slender beams and cable networks. A selection of design modelling sketches...

  19. Thrombin–aptamer recognition: a revealed ambiguity

    OpenAIRE

    Russo Krauss, Irene; Merlino, Antonello; Giancola, Concetta; Randazzo, Antonio; Mazzarella, Lelio; Sica, Filomena

    2011-01-01

    Aptamers are structured oligonucleotides that recognize molecular targets and can function as direct protein inhibitors. The best-known example is the thrombin-binding aptamer, TBA, a single-stranded 15-mer DNA that inhibits the activity of thrombin, the key enzyme of coagulation cascade. TBA folds as a G-quadruplex structure, as proved by its NMR structure. The X-ray structure of the complex between TBA and human α-thrombin was solved at 2.9-Å resolution, but did not provide details of the a...

  20. Structural and Functional Analysis of Campylobacter jejuni PseG: a Udp-sugarhydrolase from the Pseudaminic Acid Biosynthetic Pathway

    Energy Technology Data Exchange (ETDEWEB)

    E Rangarajan; A Proteau; Q Cui; S Logan; Z Potetinova; D Whitfield; E Purisima; M Cygler; A Matte; et al.

    2011-12-31

    Flagella of the bacteria Helicobacter pylori and Campylobacter jejuni are important virulence determinants, whose proper assembly and function are dependent upon glycosylation at multiple positions by sialic acid-like sugars, such as 5,7-diacetamido-3,5,7,9-tetradeoxy-l-glycero-l-manno-nonulosonic acid (pseudaminic acid (Pse)). The fourth enzymatic step in the pseudaminic acid pathway, the hydrolysis of UDP-2,4-diacetamido-2,4,6-trideoxy-{beta}-l-altropyranose to generate 2,4-diacetamido-2,4,6-trideoxy-l-altropyranose, is performed by the nucleotide sugar hydrolase PseG. To better understand the molecular basis of the PseG catalytic reaction, we have determined the crystal structures of C. jejuni PseG in apo-form and as a complex with its UDP product at 1.8 and 1.85 {angstrom} resolution, respectively. In addition, molecular modeling was utilized to provide insight into the structure of the PseG-substrate complex. This modeling identifies a His{sup 17}-coordinated water molecule as the putative nucleophile and suggests the UDP-sugar substrate adopts a twist-boat conformation upon binding to PseG, enhancing the exposure of the anomeric bond cleaved and favoring inversion at C-1. Furthermore, based on these structures a series of amino acid substitution derivatives were constructed, altering residues within the active site, and each was kinetically characterized to examine its contribution to PseG catalysis. In conjunction with structural comparisons, the almost complete inactivation of the PseG H17F and H17L derivatives suggests that His{sup 17} functions as an active site base, thereby activating the nucleophilic water molecule for attack of the anomeric C-O bond of the UDP-sugar. As the PseG structure reveals similarity to those of glycosyltransferase family-28 members, in particular that of Escherichia coli MurG, these findings may also be of relevance for the mechanistic understanding of this important enzyme family.

  1. Conjoint Forming - Technologies for Simultaneous Forming and Joining

    International Nuclear Information System (INIS)

    Groche, P; Wohletz, S; Mann, A; Krech, M; Monnerjahn, V

    2016-01-01

    The market demand for new products optimized for e. g. lightweight applications or smart components leads to new challenges in production engineering. Hybrid structures represent one promising approach. They aim at higher product performance by using a suitable combination of different materials. The developments of hybrid structures stimulate the research on joining of dissimilar materials. Since they allow for joining dissimilar materials without external heating technologies based on joining by plastic deformation seem to be of special attractiveness. The paper at hand discusses the conjoint forming approach. This approach combines forming and joining in one process. Two or more workpieces are joined while at least one workpiece is plastically deformed. After presenting the fundamental joining mechanisms, the conjoint forming approach is discussed comprehensively. Examples of conjoint processes demonstrate the effectiveness and reveal the underlying phenomena. (paper)

  2. Structure-based drug design for G protein-coupled receptors.

    Science.gov (United States)

    Congreve, Miles; Dias, João M; Marshall, Fiona H

    2014-01-01

    Our understanding of the structural biology of G protein-coupled receptors has undergone a transformation over the past 5 years. New protein-ligand complexes are described almost monthly in high profile journals. Appreciation of how small molecules and natural ligands bind to their receptors has the potential to impact enormously how medicinal chemists approach this major class of receptor targets. An outline of the key topics in this field and some recent examples of structure- and fragment-based drug design are described. A table is presented with example views of each G protein-coupled receptor for which there is a published X-ray structure, including interactions with small molecule antagonists, partial and full agonists. The possible implications of these new data for drug design are discussed. © 2014 Elsevier B.V. All rights reserved.

  3. Structural disorder in metallic glass-forming liquids.

    Science.gov (United States)

    Pan, Shao-Peng; Feng, Shi-Dong; Wang, Li-Min; Qiao, Jun-Wei; Niu, Xiao-Feng; Dong, Bang-Shao; Wang, Wei-Min; Qin, Jing-Yu

    2016-06-09

    We investigated structural disorder by a new structural parameter, quasi-nearest atom (QNA), in atomistic configurations of eight metallic glass-forming systems generated through molecular dynamics simulations at various temperatures. Structural analysis reveals that the scaled distribution of the number of QNA appears to be an universal property of metallic liquids and the spatial distribution of the number of QNA displays to be clearly heterogeneous. Furthermore, the new parameter can be directly correlated with potential energy and structural relaxation at the atomic level. Some straightforward relationships between QNA and other properties (per-atom potential energy and α-relaxation time) are introduced to reflect structure-property relationship in metallic liquids. We believe that the new structural parameter can well reflect structure disorder in metallic liquids and play an important role in understanding various properties in metallic liquids.

  4. Overcoming natural replication barriers: differential helicase requirements.

    Science.gov (United States)

    Anand, Ranjith P; Shah, Kartik A; Niu, Hengyao; Sung, Patrick; Mirkin, Sergei M; Freudenreich, Catherine H

    2012-02-01

    DNA sequences that form secondary structures or bind protein complexes are known barriers to replication and potential inducers of genome instability. In order to determine which helicases facilitate DNA replication across these barriers, we analyzed fork progression through them in wild-type and mutant yeast cells, using 2-dimensional gel-electrophoretic analysis of the replication intermediates. We show that the Srs2 protein facilitates replication of hairpin-forming CGG/CCG repeats and prevents chromosome fragility at the repeat, whereas it does not affect replication of G-quadruplex forming sequences or a protein-bound repeat. Srs2 helicase activity is required for hairpin unwinding and fork progression. Also, the PCNA binding domain of Srs2 is required for its in vivo role of replication through hairpins. In contrast, the absence of Sgs1 or Pif1 helicases did not inhibit replication through structural barriers, though Pif1 did facilitate replication of a telomeric protein barrier. Interestingly, replication through a protein barrier but not a DNA structure barrier was modulated by nucleotide pool levels, illuminating a different mechanism by which cells can regulate fork progression through protein-mediated stall sites. Our analyses reveal fundamental differences in the replication of DNA structural versus protein barriers, with Srs2 helicase activity exclusively required for fork progression through hairpin structures.

  5. Post-UV colony-forming ability of normal fibroblast strains and of the xeroderma pigmentosum group G strain

    International Nuclear Information System (INIS)

    Barrett, S.F.; Tarone, R.E.; Moshell, A.N.; Ganges, M.B.; Robbins, J.H.

    1981-01-01

    In xeroderma pigmentosum, an inherited disorder of defective DNA repair, post-uv colony-forming ability of fibroblasts from patients in complementation groups A through F correlates with the patients' neurological status. The first xeroderma pigmentosum patient assigned to the recently discovered group G had the neurological abnormalities of XP. Researchers have determined the post-uv colony-forming ability of cultured fibroblasts from this patient and from 5 more control donors. Log-phase fibroblasts were irradiated with 254 nm uv light from a germicidal lamp, trypsinized, and replated at known densities. After 2 to 4 weeks' incubation the cells were fixed, stained and scored for colony formation. The strains' post-uv colony-forming ability curves were obtained by plotting the log of the percent remaining post-uv colony-forming ability as a function of the uv dose. The post-uv colony-forming ability of 2 of the 5 new normal strains was in the previously defined control donor zone, but that of the other 3 extended down to the level of the most resistant xeroderma pigmentosum strain. The post-uv colony-forming ability curve of the group G fibroblasts was not significantly different from the curves of the group D fibroblast strains from patients with clinical histories similar to that of the group G patient

  6. Dynamic DNA binding, junction recognition and G4 melting activity underlie the telomeric and genome-wide roles of human CST.

    Science.gov (United States)

    Bhattacharjee, Anukana; Wang, Yongyao; Diao, Jiajie; Price, Carolyn M

    2017-12-01

    Human CST (CTC1-STN1-TEN1) is a ssDNA-binding complex that helps resolve replication problems both at telomeres and genome-wide. CST resembles Replication Protein A (RPA) in that the two complexes harbor comparable arrays of OB-folds and have structurally similar small subunits. However, the overall architecture and functions of CST and RPA are distinct. Currently, the mechanism underlying CST action at diverse replication issues remains unclear. To clarify CST mechanism, we examined the capacity of CST to bind and resolve DNA structures found at sites of CST activity. We show that CST binds preferentially to ss-dsDNA junctions, an activity that can explain the incremental nature of telomeric C-strand synthesis following telomerase action. We also show that CST unfolds G-quadruplex structures, thus providing a mechanism for CST to facilitate replication through telomeres and other GC-rich regions. Finally, smFRET analysis indicates that CST binding to ssDNA is dynamic with CST complexes undergoing concentration-dependent self-displacement. These findings support an RPA-based model where dissociation and re-association of individual OB-folds allow CST to mediate loading and unloading of partner proteins to facilitate various aspects of telomere replication and genome-wide resolution of replication stress. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Friction stir method for forming structures and materials

    Science.gov (United States)

    Feng, Zhili; David, Stan A.; Frederick, David Alan

    2011-11-22

    Processes for forming an enhanced material or structure are disclosed. The structure typically includes a preform that has a first common surface and a recess below the first common surface. A filler is added to the recess and seams are friction stir welded, and materials may be stir mixed.

  8. Structure of UreG/UreF/UreH Complex Reveals How Urease Accessory Proteins Facilitate Maturation of Helicobacter pylori Urease

    Science.gov (United States)

    Fong, Yu Hang; Wong, Ho Chun; Yuen, Man Hon; Lau, Pak Ho; Chen, Yu Wai; Wong, Kam-Bo

    2013-01-01

    Urease is a metalloenzyme essential for the survival of Helicobacter pylori in acidic gastric environment. Maturation of urease involves carbamylation of Lys219 and insertion of two nickel ions at its active site. This process requires GTP hydrolysis and the formation of a preactivation complex consisting of apo-urease and urease accessory proteins UreF, UreH, and UreG. UreF and UreH form a complex to recruit UreG, which is a SIMIBI class GTPase, to the preactivation complex. We report here the crystal structure of the UreG/UreF/UreH complex, which illustrates how UreF and UreH facilitate dimerization of UreG, and assembles its metal binding site by juxtaposing two invariant Cys66-Pro67-His68 metal binding motif at the interface to form the (UreG/UreF/UreH)2 complex. Interaction studies revealed that addition of nickel and GTP to the UreG/UreF/UreH complex releases a UreG dimer that binds a nickel ion at the dimeric interface. Substitution of Cys66 and His68 with alanine abolishes the formation of the nickel-charged UreG dimer. This nickel-charged UreG dimer can activate urease in vitro in the presence of the UreF/UreH complex. Static light scattering and atomic absorption spectroscopy measurements demonstrated that the nickel-charged UreG dimer, upon GTP hydrolysis, reverts to its monomeric form and releases nickel to urease. Based on our results, we propose a mechanism on how urease accessory proteins facilitate maturation of urease. PMID:24115911

  9. Structural Analysis of Botulinum Neurotoxin Type G Receptor Binding

    Energy Technology Data Exchange (ETDEWEB)

    Schmitt, John; Karalewitz, Andrew; Benefield, Desire A.; Mushrush, Darren J.; Pruitt, Rory N.; Spiller, Benjamin W.; Barbieri, Joseph T.; Lacy, D. Borden (Vanderbilt); (MCW)

    2010-10-19

    Botulinum neurotoxin (BoNT) binds peripheral neurons at the neuromuscular junction through a dual-receptor mechanism that includes interactions with ganglioside and protein receptors. The receptor identities vary depending on BoNT serotype (A-G). BoNT/B and BoNT/G bind the luminal domains of synaptotagmin I and II, homologous synaptic vesicle proteins. We observe conditions under which BoNT/B binds both Syt isoforms, but BoNT/G binds only SytI. Both serotypes bind ganglioside G{sub T1b}. The BoNT/G receptor-binding domain crystal structure provides a context for examining these binding interactions and a platform for understanding the physiological relevance of different Syt receptor isoforms in vivo.

  10. QuikForm: Intelligent deformation processing of structural alloys

    Energy Technology Data Exchange (ETDEWEB)

    Bourcier, R.J.; Wellman, G.W.

    1994-09-01

    There currently exists a critical need for tools to enhance the industrial competitiveness and agility of US industries involved in deformation processing of structural alloys. In response to this need, Sandia National Laboratories has embarked upon the QuikForm Initiative. The goal of this program is the development of computer-based tools to facilitate the design of deformation processing operations. The authors are currently focusing their efforts on the definition/development of a comprehensive system for the design of sheet metal stamping operations. The overall structure of the proposed QuikForm system is presented, and the focus of their thrust in each technical area is discussed.

  11. A soluble form of Epstein-Barr virus gH/gL inhibits EBV-induced membrane fusion and does not function in fusion

    Energy Technology Data Exchange (ETDEWEB)

    Rowe, Cynthia L. [Department of Microbiology and Immunology, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611 (United States); Connolly, Sarah A. [Department of Health Sciences, DePaul University, Chicago, IL 60614 (United States); Chen, Jia [Department of Microbiology and Immunology, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611 (United States); Jardetzky, Theodore S. [Department of Structural Biology, Stanford University School of Medicine, 371 Serra Mall, Stanford, CA 94305 (United States); Longnecker, Richard, E-mail: r-longnecker@northwestern.edu [Department of Microbiology and Immunology, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611 (United States)

    2013-02-05

    We investigated whether soluble EBV gH/gL (sgH/gL) functions in fusion and made a series of truncations of gH/gL domains based on the gH/gL crystal structure. We found sgH/gL failed to mediate cell-cell fusion both when co-expressed with the other entry glycoproteins and when added exogenously to fusion assays. Interestingly, sgH/gL inhibited cell-cell fusion in a dose dependent manner when co-expressed. sgH/gL from HSV was unable to inhibit EBV fusion, suggesting the inhibition was specific to EBV gH/gL. sgH/gL stably binds gp42, but not gB nor gH/gL. The domain mutants, DI/gL, DI-II/gL and DI-II-III/gL were unable to bind gp42. Instead, DI-II/gL, DI-II-III/gL and sgH/gL but not DI/gL decreased the expression of gp42, resulting in decreased overall fusion. Overall, our results suggest that domain IV may be required for proper folding and the transmembrane domain and cytoplasmic tail of EBV gH/gL are required for the most efficient fusion.

  12. Triple helical polynucleotidic structures: an FTIR study of the C+ .G. Ctriplet.

    Science.gov (United States)

    Akhebat, A; Dagneaux, C; Liquier, J; Taillandier, E

    1992-12-01

    Triple helixes containing one homopurine poly dG or poly rG strand and two homopyrimidine poly dC or poly rC strands have been prepared and studied by FTIR spectroscopy in H2O and D2O solutions. The spectra are discussed by comparison with those of the corresponding third strands (auto associated or not) and of double stranded poly dG.poly dC and poly rG.poly rC in the same concentration range and salt conditions. The triplex formation is characterized by the study of the base-base interactions reflected by changes in the spectral domain involving the in-plane double bond vibrations of the bases. Modifications of the initial duplex conformation (A family form for poly rG.poly rC, B family form for poly dG.poly dC) when the triplex is formed have been investigated. Two spectral domains (950-800 and 1450-1350 cm-1) containing absorption bands markers of the N and S type sugar geometries have been extensively studied. The spectra of the triplexes prepared starting with a double helix containing only riboses (poly rC+.poly rG.poly rC and poly dC+.poly rG.poly rC) as well as that of poly rC+.poly dG.poly dC present exclusively markers of the North type geometry of the sugars. On the contrary in the case of the poly dC+.poly dG.poly dC triplex both N and S type sugars are shown to coexist. The FTIR spectra allow us to propose that in this case the sugars of the purine (poly dG) strand adopt the S type geometry.

  13. Synthesis, structural studies and biological properties of new TBA analogues containing an acyclic nucleotide.

    Science.gov (United States)

    Coppola, Teresa; Varra, Michela; Oliviero, Giorgia; Galeone, Aldo; D'Isa, Giuliana; Mayol, Luciano; Morelli, Elena; Bucci, Maria-Rosaria; Vellecco, Valentina; Cirino, Giuseppe; Borbone, Nicola

    2008-09-01

    A new modified acyclic nucleoside, namely N(1)-(3-hydroxy-2-hydroxymethyl-2-methylpropyl)-thymidine, was synthesized and transformed into a building block useful for oligonucleotide (ON) automated synthesis. A series of modified thrombin binding aptamers (TBAs) in which the new acyclic nucleoside replaces, one at the time, the thymidine residues were then synthesized and characterized by UV, CD, MS, and (1)H NMR. The biological activity of the resulting TBAs was tested by Prothrombin Time assay (PT assay) and by purified fibrinogen clotting assay. From a structural point of view, nearly all the new TBA analogues show a similar behavior as the unmodified counterpart, being able to fold into a bimolecular or monomolecular quadruplex structure depending on the nature of monovalent cations (sodium or potassium) coordinated in the quadruplex core. From the comparison of structural and biological data, some important structure-activity relationships emerged, particularly when the modification involved the TT loops. In agreement with previous studies we found that the folding ability of TBA analogues is more affected by modifications involving positions 4 and 13, rather than positions 3 and 12. On the other hand, the highest anti-thrombin activities were detected for aptamers containing the modification at T13 or T12 positions, thus indicating that the effects produced by the introduction of the acyclic nucleoside on the biological activity are not tightly connected with structure stabilities. It is noteworthy that the modification at T7 produces an ON being more stable and active than the natural TBA.

  14. Crystal structure and thermal expansion of the low- and high-temperature forms of BaMIV(PO4)2 compounds (M=Ti, Zr, Hf and Sn)

    International Nuclear Information System (INIS)

    Bregiroux, D.; Popa, K.; Jardin, R.; Raison, P.E.; Wallez, G.; Quarton, M.; Brunelli, M.; Ferrero, C.; Caciuffo, R.

    2009-01-01

    The crystal structure of β-BaZr(PO 4 ) 2 , archetype of the high-temperature forms of BaM(PO 4 ) 2 phosphates (with M=Ti, Zr, Hf and Sn), has been solved ab initio by Rietveld analysis from synchrotron X-ray powder diffraction data. The phase transition appears as a topotactic modification of the monoclinic (S.G. C2/m) lamellar α-structure into a trigonal one (S.G. P3-barm1) through a simple mechanism involving the unfolding of the [Zr(PO 4 ) 2 ] n 2- layers. The thermal expansion is very anisotropic (e.g., -4.1 i -6 K -1 in the case of α-BaZr(PO 4 ) 2 ) and quite different in the two forms, as a consequence of symmetry. It stems from a complex combination of several mechanisms, involving bridging oxygen rocking in M-O-P linkages, and 'bond thermal expansion'. - Graphical abstract: The layered high-temperature form of BaM(PO 4 ) 2 , only expands along the c-axis.

  15. A Label-Free and Sensitive Fluorescent Qualitative Assay for Bisphenol A Based on Rolling Circle Amplification/Exonuclease III-Combined Cascade Amplification.

    Science.gov (United States)

    Li, Xia; Song, Juan; Xue, Qing-Wang; You, Fu-Heng; Lu, Xia; Kong, Yan-Cong; Ma, Shu-Yi; Jiang, Wei; Li, Chen-Zhong

    2016-10-21

    Bisphenol A (BPA) detection in drinking water and food packaging materials has attracted much attention since the discovery that BPA can interfere with normal physiological processes and cause adverse health effects. Here, we constructed a label-free aptamer fluorescent assay for selective and sensitive detection of BPA based on the rolling circle amplification (RCA)/Exonuclease III (Exo III)-combined cascade amplification strategy. First, the duplex DNA probe (RP) with anti-BPA aptamer and trigger sequence was designed for BPA recognition and signal amplification. Next, under the action of BPA, the trigger probe was liberated from RP to initiate RCA reaction as primary amplification. Subsequently, the RCA products were used to trigger Exo III assisted secondary amplification with the help of hairpin probes, producing plenty of "G-quadruplex" in lantern-like structures. Finally, the continuously enriched "G-quadruplex lanterns" were lightened by zinc(II)-protoporphyrin IX (ZnPPIX) generating enhanced fluorescence signals. By integrating the primary RCA and secondary Exo III mediated cascade amplification strategy, this method displayed an excellent sensitivity with the detection limits of 5.4 × 10 -17 M. In addition, the anti-BPA aptamer exhibits high recognition ability with BPA, guaranteeing the specificity of detection. The reporter signal probe (G-quadruplex with ZnPPIX) provides a label-free fluorescence signals readout without complicated labeling procedures, making the method simple in design and cost-effective in operation. Moreover, environmental samples analysis was also performed, suggesting that our strategy was reliable and had a great potential application in environmental monitoring.

  16. Structure models of G72, the product of a susceptibility gene to schizophrenia.

    Science.gov (United States)

    Kato, Yusuke; Fukui, Kiyoshi

    2017-02-01

    The G72 gene is one of the most susceptible genes to schizophrenia and is contained exclusively in the genomes of primates. The product of the G72 gene modulates the activity of D-amino acid oxidase (DAO) and is a small protein prone to aggregate, which hampers its structural studies. In addition, lack of a known structure of a homologue makes it difficult to use the homology modelling method for the prediction of the structure. Thus, we first developed a hybrid ab initio approach for small proteins prior to the prediction of the structure of G72. The approach uses three known ab initio algorithms. To evaluate the hybrid approach, we tested our prediction of the structure of the amino acid sequences whose structures were already solved and compared the predicted structures with the experimentally solved structures. Based on these comparisons, the average accuracy of our approach was calculated to be ∼5 Å. We then applied the approach to the sequence of G72 and successfully predicted the structures of the N- and C-terminal domains (ND and CD, respectively) of G72. The predicted structures of ND and CD were similar to membrane-bound proteins and adaptor proteins, respectively. © The Authors 2016. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  17. MAZ-binding G4-decoy with locked nucleic acid and twisted intercalating nucleic acid modifications suppresses KRAS in pancreatic cancer cells and delays tumor growth in mice

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Zorzet, Sonia; Rapozzi, Valentina

    2013-01-01

    and stability, two polycyclic aromatic hydrocarbon units (TINA or AMANY) were inserted internally, to cap the quadruplex. The most active G4-decoy (2998), which had two para-TINAs, strongly suppressed KRAS expression in Panc-1 cells. It also repressed their metabolic activity (IC50 = 520 nM), and it inhibited...... cell growth and colony formation by activating apoptosis. We finally injected 2998 and control oligonucleotides 5153, 5154 (2 nmol/mouse) intratumorally in SCID mice bearing a Panc-1 xenograft. After three treatments, 2998 reduced tumor xenograft growth by 64% compared with control and increased...

  18. Forming of shape memory composite structures

    DEFF Research Database (Denmark)

    Santo, Loredana; Quadrini, Fabrizio; De Chiffre, Leonardo

    2013-01-01

    A new forming procedure was developed to produce shape memory composite structures having structural composite skins over a shape memory polymer core. Core material was obtained by solid state foaming of an epoxy polyester resin with remarkably shape memory properties. The composite skin consisted...... of a two-layer unidirectional thermoplastic composite (glass filled polypropylene). Skins were joined to the foamed core by hot compression without any adhesive: a very good adhesion was obtained as experimental tests confirmed. The structure of the foam core was investigated by means of computer axial...... tomography. Final shape memory composite panels were mechanically tested by three point bending before and after a shape memory step. This step consisted of a compression to reduce the panel thickness up to 60%. At the end of the bending test the panel shape was recovered by heating and a new memory step...

  19. The spin-dependent structure function g1 of the deuteron

    International Nuclear Information System (INIS)

    Bueltmann, S.

    1996-01-01

    Results on the spin-dependent structure function g 1 d of the deuteron measured by the Spin Muon Collaboration at CERN are presented. They are based on deep-inelastic scattering of 190 GeV polarized muons off a polarized deuteron target in the kinematic range of 0.003 ≤ x Bj ≤ 0.7 and 1 GeV 2 ≤ Q 2 ≤ 60 GeV 2 . The structure function is found to be negative for small values of x Bj , while the proton structure function g 1 p measured earlier by the SMC is positive over the whole x Bj -range. The Bjorken sum rule is in good agreement with the first moments of the structure functions, while the Ellis-Jaffe sum rule is violated by more than three standard deviations for the deuteron measurement. (author)

  20. Phytosterol Profiles of Common Foods and Estimated Natural Intake of Different Structures and Forms in China.

    Science.gov (United States)

    Wang, Mengmeng; Huang, Weisu; Hu, Yinzhou; Zhang, Liangxiao; Shao, Yafang; Wang, Meng; Zhang, Fang; Zhao, Ziyan; Mei, Xiaohong; Li, Tao; Wang, Donghui; Liang, Ying; Li, Jing; Huang, Yining; Zhang, Liuquan; Xu, Tao; Song, Huaxin; Zhong, Yongheng; Lu, Baiyi

    2018-03-21

    Phytosterols are well-known for their cholesterol-lowering effects, and the structures and forms of phytosterols affect their bioactivity. We aimed to illustrate the phytosterol profiles in common foods and estimate their natural intake in five geographical regions and among different age groups in China. In total, 12 phytosterols in free and esterified forms of 119 foods from five regions across China were examined using gas chromatography-mass spectrometry. Then, the dietary intake of phytosterols was calculated combined with the dietary foods intake data of Chinese people. The total phytosterol content was highest in vegetable oils (150.4-1230.9 mg/100 g), followed by legumes (129.6-275.6 mg/100 g), nuts (18.9-255.2 mg/100 g), and cereals (11.9-93.8 mg/100 g). Vegetables and fruits contained lower contents of total phytosterols. Phytosterols were mainly esterified in most common foods except in nuts. The predominant phytosterols were β-sitosterol, campesterol, and stigmasterol, all of which belonged to plant sterols and 4-desmethylsterols. Total phytosterol intake varied across different regions, ranging between 257.7 and 473.7 mg/standard-person (sp)/day, with the highest intake in Beijing, followed by Hangzhou, Wuhan, Chongqing, and Guangzhou. However, phytosterol proportion was similar across regions, with β-sitosterol accounting for 46.5-50.3% of the natural intake. Phytosterol intake was mainly constituted by plant sterols and 4-desmethylsterols in esterified form (61.9-74.6%). At the age of 2-70 years, phytosterol intake ranged from 154.3 mg/day to 348.0 mg/day in the national scale.

  1. Metastable He2- ions formed by two-electron attachment to the excited He2+ Σg+ (1σg22σg1) core

    International Nuclear Information System (INIS)

    Adamowicz, L.; Pluta, T.

    1991-01-01

    Four metastable states (1 4 Π u , 2 4 Π u , 4 Φ u , and 4 I u ), resulting from two-electron attachments to the excited He 2 + core ( 2 Σ g + ), are characterized using the numerical Hartree-Fock method. It is determined that such metastable states are formed when both valence electrons are placed into equally diffused orbitals, which have bonding charter, and whose angular momentum quantum numbers do not differ by more than 1

  2. Structural studies of the 5'-phenazinium-tethered matched and G-A-mismatched DNA duplexes by NMR spectroscopy.

    Science.gov (United States)

    Maltseva, T; Sandström, A; Ivanova, I M; Sergeyev, D S; Zarytova, V F; Chattopadhyaya, J

    1993-05-01

    The mechanism through which modified oligo-DNA analogues act as antisense repressors at the transcriptional and translational level of gene expression is based on the information content in the nucleotide sequence which is determined by the specific base pairing. The efficiency of such action is largely determined by the stability of the duplex formed between the oligonucleotide reagent and the target sequence and also by the mismatched base pairing, such as G-A, that occurs during replication or recombination. We herein report that the phenazinium (Pzn)-tethered matched duplex p(d(TGTTTGGC)):(Pzn)-p(d(CCAAACA)) (III) (Tm = 50 degrees C) has a much larger stability than the parent matched duplex p(d(TGTTTGGC)):p(d(CCAAACA)) (I) (Tm = 30 degrees C). On the other hand, the Pzn-tethered G-A-mismatched duplex p(d(TGTTTGGC)):(Pzn)-p(d(ACAAACA)) (IV) (Tm = 34 degrees C) is only slightly more stable than its parent mismatched duplex p(d(TGTTTGGC)):p(d(ACAAACA)) (Tm = 25 degrees C). A detailed 500 MHz NMR study and constrained MD refinements of NMR-derived structures have been undertaken for the DNA duplexes (I), (II), (III) and (IV) in order to understand the structural basis of stabilization of Pzn-tethered matched DNA duplex (delta Tm = 20 degrees C) compared to mismatched duplex (delta Tm = 9 degrees C). Assignment of the 1H-NMR (500 MHz) spectra of the duplexes has been carried out by 2D NOESY, HOHAHA and DQF-COSY experiments. The torsion angles have been extracted from the J-coupling constants obtained by simulation of most of the DQF-COSY cross-peaks using program SMART. The solution structure of the duplexes were assessed by an iterative hybride relaxation matrix method (MORASS) combined with NOESY distances and torsion angles restrained molecular dynamics (MD) using program Amber 4.0. The standard Amber 4.0 force-field parameters were used for the oligonucleotide in conjunction with the new parameters for Pzn residue which was obtained by full geometry

  3. Form-finding of shell structures generated from physical models

    NARCIS (Netherlands)

    Li, Q.; Su, Y; Wu, Y; Borgart, A.; Rots, J.G.

    2017-01-01

    Vector form intrinsic finite element is a recently developed and promising numerical method for the analysis of complicated structural behavior. Taking the cable-link element as example, the framework of the vector form intrinsic finite element is explained first. Based on this, a constant strain

  4. Nucleon structure functions, resonance form factors, and duality

    International Nuclear Information System (INIS)

    Davidovsky, V.V.; Struminsky, B.V.

    2003-01-01

    The behavior of nucleon structure functions in the resonance region is explored. For form factors that describe resonance production, expressions are obtained that are dependent on the photon virtuality Q 2 , which have a correct threshold behavior, and which take into account available experimental data on resonance decay. Resonance contributions to nucleon structure functions are calculated. The resulting expressions are used to investigate quark-hadron duality in electron-nucleon scattering by taking the example of the structure function F 2

  5. An ir study of M(1-propanethiol)2Ni(CN)4.G (M=Cd,Ni and G=benzene) clathrates

    International Nuclear Information System (INIS)

    Kartal, Z.; Tuerkoz, D.; Bahceli, S.

    2004-01-01

    Two Hofmann-propanethiol-type clathrates of the for M(1-propanethiol) 2 Ni(CN) 4 .G (M=Cd or Ni; G = benzene) have been prepared in the powder form. The 1-propanethiol (1-PT) molecules provide the cavities in which the quest benzene molecules in clathrate structure ar accommodated. The infrared investigations of the obtained clathrates indicate that these compounds are similar in structure to the other Hofmann-type clathrates (Authors)

  6. Process for forming exoergic structures with the use of a plasma

    Science.gov (United States)

    Kelly, M.D.

    1987-05-29

    A method of forming exoergic structures, as well as exoergic structures produced by the method, is provided. The method comprises the steps of passing a plasma-forming gas through a plasma spray gun, forming a plasma spray, introducing exoergic material into the plasma spray and directing the plasma spray toward a substrate, and allowing the exoergic material to become molten in the plasma spray and to thereafter impinge on the substrate to form a solid mass of exoergic material, the shape of which corresponds to the shape of the substrate.

  7. 12 CFR Appendix G to Part 226 - Open-End Model Forms and Clauses

    Science.gov (United States)

    2010-01-01

    ... property or services that you purchased with a credit card, and you have tried in good faith to correct the... merchant, or if we mailed you the advertisement for the property or services. G-3(A)—Long-Form Billing... have tried in good faith to correct the problem with the merchant, you may have the right not to pay...

  8. Using ALMA to Resolve the Nature of the Early Star-Forming Large-Scale Structure G073

    Science.gov (United States)

    Hill, R.; Kneissl, R.; Polletta, M.; Clarenc, B.; Dole, H. A.; Nesvadba, N. P. H.; Scott, D.; Béthermin, M.; Lagache, G.; Montier, L.

    2017-07-01

    Galaxy clusters at large redshift are key targets for understanding the nature of the early Universe, yet locating them has proven to be very challenging. Recently, a large sample of over 2000 high-z candidate structures have been found using Planck's all-sky submillimetre maps, and a subset of 234 have been followed up with Herschel-SPIRE, which showed that the emission can be attributed to large far-infrared overdensities. However, the individual galaxies giving rise to the emission seen by Planck and Herschel have not yet been resolved nor characterized, so we do not yet know whether these sources are the progenitors of present-day, massive galaxy clusters. In an attempt to address this, we targeted the eight brightest Herschel-SPIRE peaks in the centre of the Planck peak G073.4-57.5 using ALMA at 1.3 mm, and complemented these observations with multi-wavelength data from Spitzer-IRAC at 3.6 and 4.5 μm and from CFHT-WIRCam at 1.2 and 2.2 μm. We also utilize data on G073.4-57.5 at 850 μm from JCMT's SCUBA-2 instrument. We detect a total of 18 millimetre galaxies brighter than 0.3mJy in 2.4arcmin2. In every case we are able to match these to their NIR counterparts, and while the most significant SCUBA-2 sources are not included in the ALMA pointings, we find an 8σ detection when stacking the ALMA source positions in the 850 μm data. We derive photometric redshifts, IR luminosities, star-formation rates, stellar masses, dust temperatures, and dust masses; the photometric redshifts are concentrated around z ≃ 1 and z ≃ 2 and the NIR colours show a "red" sequence, while the star-formation rates indicate that three of the galaxies are "starbursts". Serendipitous CO line detections of two of the galaxies appear to match their photometric redshifts with z = 2.05. We find that the ALMA source density is 8-30 times higher than average background estimates, and thus also larger than seen in typical "proto-cluster" fields. The evidence seems to be indicating the

  9. Nitrogen-containing bisphosphonate induces a newly discovered hematopoietic structure in the omentum of an anemic mouse model by stimulating G-CSF production.

    Science.gov (United States)

    Otsuka, Hirotada; Yagi, Hideki; Endo, Yasuo; Soeta, Satoshi; Nonaka, Naoko; Nakamura, Masanori

    2017-02-01

    We previously reported that the injection of nitrogen-containing bisphosphonate (NBP) induced the site of erythropoiesis to shift from the bone marrow (BM) to the spleen. Our previous study established a severely anemic mouse model that was treated with a combination of NBP with phenylhydrazine (PHZ), which induced newly discovered hematopoietic organs in the omentum. No reports have shown that new hematopoietic organs form under any condition. We characterized the structures and factors related to the formation of these new organs. Splenectomized mice were treated with NBP to inhibit erythropoiesis in the BM and then injected with PHZ to induce hemolytic anemia. The mice showed severe anemia and wine-colored structures appeared in the omentum. Some hematopoietic cells, including megakaryocytes, and well-developed sinuses were observed in these structures. Numerous TER119-positive erythroblasts were located with cells positive for PCNA, a cell proliferation marker. C-kit-positive cells were detected and mRNAs related to hematopoiesis were expressed in these structures. Moreover, TER119-positive erythroblasts emerged and formed clusters and hematopoiesis-related factors were detected in the omentum of mice treated with NBP and PHZ. The levels of G-CSF in the serum and hematopoietic progenitor cells (HPCs) in the peripheral blood were increased upon treatment with both NBP and PHZ. These results suggest that the induced hematopoietic structures act as the sites of erythropoiesis and that NBP-induced G-CSF production causes HPC mobilization, homing and colonization in the omentum because they constitutively express some factors, including SDF-1; thus, the newly discovered hematopoietic structure in this study might be formed.

  10. Cellular structure formed by ion-implantation-induced point defect

    International Nuclear Information System (INIS)

    Nitta, N.; Taniwaki, M.; Hayashi, Y.; Yoshiie, T.

    2006-01-01

    The authors have found that a cellular defect structure is formed on the surface of Sn + ion implanted GaSb at a low temperature and proposed its formation mechanism based on the movement of the induced point defects. This research was carried out in order to examine the validity of the mechanism by clarifying the effect of the mobility of the point defects on the defect formation. The defect structure on the GaSb surfaces implanted at cryogenic temperature and room temperature was investigated by scanning electron microscopy (SEM) and cross-sectional transmission electron microscopy (TEM) observation. In the sample implanted at room temperature, the sponge-like structure (a pileup of voids) was formed and the cellular structure, as observed at a low temperature, did not develop. This behavior was explained by the high mobility of the vacancies during implantation at room temperature, and the proposed idea that the defect formation process is dominated by the induced point defects was confirmed

  11. Synthesis of New DNA G-Quadruplex Constructs with Anthraquinone Insertions and Their Anticoagulant Activity

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2016-01-01

    1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...

  12. Characterization of the oligosaccharide structure of human glycosylated prolactin (G-hPRL) native and recombinant

    International Nuclear Information System (INIS)

    Marcos Vinicius Nucci Capone

    2013-01-01

    Human prolactin (hPRL) is a polypeptide hormone secreted by the anterior pituitary under the regulation of the hypothalamus, involved in a variety of biological processes such as mammary gland development and lactation. The recombinant product is important in medical diagnosis and treatment of failure of lactation. This hormone may occur in the form of non-glycosylated protein (NGhPRL) and glycosylated (G-hPRL) with molecular weights of approximately 23 and 25 kilodalton (kDa), respectively; has a single N-glycosylation site located at asparagine (Asn) position 31, which is partially occupied, thus being a particularly interesting model of glycosylation. The biological activity of G-hPRL is lower compared to NG-hPRL (~4 times) and its physiological function is not well defined: the portion of carbohydrate appears to have an important role in the hormone biosynthesis, secretion, biological activity, and plasma survival of the hormone. The main objective of this study was to compare the structures of N-glycans present in glycosylated pituitary prolactin (G-hPRL-NHPP) with those present in the recombinant. To obtain the recombinant G-hPRL the production was performed in laboratory scale from Chinese hamster ovary cells (CHO), genetically modified and adapted to growth in suspension. Cycloheximide (CHX), whose main effect was to increase the ratio G-hPRL/NG-hPRL from 5% to 38% was added to the culture medium, thereby facilitating the purification of G-hPRL. The G-hPRL was purified in two steps, a cation exchanger followed by a purification by reversed-phase high performance liquid chromatography (RP-HPLC) which demonstrated the efficient separation of the two isoforms of hPRL. Recombinant G-hPRL-IPEN was well characterized by several techniques confirming its purity and biological activity, including comparisons with other reference preparation of pituitary origin purchased from the N ational Hormone & Peptide Program (NHPPU. S.) . The composition of N-glycans present

  13. Membrane-localized extra-large G proteins and Gbg of the heterotrimeric G proteins form functional complexes engaged in plant immunity in Arabidopsis.

    Science.gov (United States)

    Maruta, Natsumi; Trusov, Yuri; Brenya, Eric; Parekh, Urvi; Botella, José Ramón

    2015-03-01

    In animals, heterotrimeric G proteins, comprising Ga, Gb, and Gg subunits, are molecular switches whose function tightly depends on Ga and Gbg interaction. Intriguingly, in Arabidopsis (Arabidopsis thaliana), multiple defense responses involve Gbg, but not Ga. We report here that the Gbg dimer directly partners with extra-large G proteins (XLGs) to mediate plant immunity. Arabidopsis mutants deficient in XLGs, Gb, and Gg are similarly compromised in several pathogen defense responses, including disease development and production of reactive oxygen species. Genetic analysis of double, triple, and quadruple mutants confirmed that XLGs and Gbg functionally interact in the same defense signaling pathways. In addition, mutations in XLG2 suppressed the seedling lethal and cell death phenotypes of BRASSINOSTEROID INSENSITIVE1-associated receptor kinase1-interacting receptor-like kinase1 mutants in an identical way as reported for Arabidopsis Gb-deficient mutants. Yeast (Saccharomyces cerevisiae) three-hybrid and bimolecular fluorescent complementation assays revealed that XLG2 physically interacts with all three possible Gbg dimers at the plasma membrane. Phylogenetic analysis indicated a close relationship between XLGs and plant Ga subunits, placing the divergence point at the dawn of land plant evolution. Based on these findings, we conclude that XLGs form functional complexes with Gbg dimers, although the mechanism of action of these complexes, including activation/deactivation, must be radically different form the one used by the canonical Ga subunit and are not likely to share the same receptors. Accordingly, XLGs expand the repertoire of heterotrimeric G proteins in plants and reveal a higher level of diversity in heterotrimeric G protein signaling.

  14. Photoconversion changes bilin chromophore conjugation and protein secondary structure in the violet/orange cyanobacteriochrome NpF2164g3' [corrected].

    Science.gov (United States)

    Lim, Sunghyuk; Rockwell, Nathan C; Martin, Shelley S; Dallas, Jerry L; Lagarias, J Clark; Ames, James B

    2014-06-01

    Cyanobacteriochromes (CBCRs) are cyanobacterial photoreceptors distantly related to phytochromes. All CBCRs examined to date utilize a conserved Cys residue to form a covalent thioether linkage to the bilin chromophore. In the insert-Cys CBCR subfamily, a second conserved Cys can covalently link to the bilin C10 methine bridge, allowing detection of near-UV to blue light. The best understood insert-Cys CBCR is the violet/orange CBCR NpF2164g3 from Nostoc punctiforme, which has a stable second linkage in the violet-absorbing dark state. Photoconversion of NpF2164g3 leads to elimination of the second linkage and formation of an orange-absorbing photoproduct. We recently reported NMR chemical shift assignments for the orange-absorbing photoproduct state of NpF2164g3. We here present equivalent information for its violet-absorbing dark state. In both photostates, NpF2164g3 is monomeric in solution and regions containing the two conserved Cys residues essential for photoconversion are structurally disordered. In contrast to blue light receptors such as phototropin, NpF2164g3 is less structurally ordered in the dark state than in the photoproduct. The insert-Cys insertion loop and C-terminal helix exhibit light-dependent structural changes. Moreover, a motif containing an Asp residue also found in other CBCRs and in phytochromes adopts a random-coil structure in the dark state but a stable α-helix structure in the photoproduct. NMR analysis of the chromophore is consistent with a less ordered dark state, with A-ring resonances only resolved in the photoproduct. The C10 atom of the bilin chromophore exhibits a drastic change in chemical shift upon photoconversion, changing from 34.5 ppm (methylene) in the dark state to 115 ppm (methine) in the light-activated state. Our results provide structural insight into the two-Cys photocycle of NpF2164g3 and the structurally diverse mechanisms used for light perception by the larger phytochrome superfamily.

  15. Crystal structure and thermal expansion of the low- and high-temperature forms of Ba MIV(PO 4) 2 compounds ( M=Ti, Zr, Hf and Sn)

    Science.gov (United States)

    Bregiroux, D.; Popa, K.; Jardin, R.; Raison, P. E.; Wallez, G.; Quarton, M.; Brunelli, M.; Ferrero, C.; Caciuffo, R.

    2009-05-01

    The crystal structure of β-BaZr(PO 4) 2, archetype of the high-temperature forms of Ba M(PO 4) 2 phosphates (with M=Ti, Zr, Hf and Sn), has been solved ab initio by Rietveld analysis from synchrotron X-ray powder diffraction data. The phase transition appears as a topotactic modification of the monoclinic (S.G. C2/m) lamellar α-structure into a trigonal one (S.G. P3¯m1) through a simple mechanism involving the unfolding of the [Zr)]n2- layers. The thermal expansion is very anisotropic (e.g., -4.1< α i<34.0×10 -6 K -1 in the case of α-BaZr(PO 4) 2) and quite different in the two forms, as a consequence of symmetry. It stems from a complex combination of several mechanisms, involving bridging oxygen rocking in M-O-P linkages, and "bond thermal expansion".

  16. I-motif DNA structures are formed in the nuclei of human cells

    Science.gov (United States)

    Zeraati, Mahdi; Langley, David B.; Schofield, Peter; Moye, Aaron L.; Rouet, Romain; Hughes, William E.; Bryan, Tracy M.; Dinger, Marcel E.; Christ, Daniel

    2018-06-01

    Human genome function is underpinned by the primary storage of genetic information in canonical B-form DNA, with a second layer of DNA structure providing regulatory control. I-motif structures are thought to form in cytosine-rich regions of the genome and to have regulatory functions; however, in vivo evidence for the existence of such structures has so far remained elusive. Here we report the generation and characterization of an antibody fragment (iMab) that recognizes i-motif structures with high selectivity and affinity, enabling the detection of i-motifs in the nuclei of human cells. We demonstrate that the in vivo formation of such structures is cell-cycle and pH dependent. Furthermore, we provide evidence that i-motif structures are formed in regulatory regions of the human genome, including promoters and telomeric regions. Our results support the notion that i-motif structures provide key regulatory roles in the genome.

  17. On the interaction between [Ru(NH3)(6)](3+) and the G-quadruplex forming thrombin binding aptamer sequence

    Czech Academy of Sciences Publication Activity Database

    De Rache, A.; Doneux, T.; Kejnovská, Iva; Buess-Herman, C.

    2013-01-01

    Roč. 126, SEP 2013 (2013), s. 84-90 ISSN 0162-0134 Institutional support: RVO:68081707 Keywords : SELF-ASSEMBLED MONOLAYERS * DNA-MODIFIED SURFACES * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 3.274, year: 2013

  18. A sensitive electrochemical aptasensor based on palladium nanoparticles decorated graphene–molybdenum disulfide flower-like nanocomposites and enzymatic signal amplification

    Energy Technology Data Exchange (ETDEWEB)

    Jing, Pei; Yi, Huayu; Xue, Shuyan; Chai, Yaqin; Yuan, Ruo; Xu, Wenju, E-mail: xwju@swu.edu.cn

    2015-01-01

    Highlights: • PDDA–G–MoS{sub 2} nanoflowers were firstly used for the fabrication of thrombin aptasensor. • MoS{sub 2} was adopted to enhance the surface area of graphene and accelerate the electron transfer. • GOD, PdNPs and hemin/G-quadruplex could amplify the electrochemical signal through synergetic catalysis. • The proposed aptasensor displayed an improved sensitivity. - Abstract: In the present study, with the aggregated advantages of graphene and molybdenum disulfide (MoS{sub 2}), we prepared poly(diallyldimethylammonium chloride)–graphene/molybdenum disulfide (PDDA–G–MoS{sub 2}) nanocomposites with flower-like structure, large surface area and excellent conductivity. Furthermore, an advanced sandwich-type electrochemical assay for sensitive detection of thrombin (TB) was fabricated using palladium nanoparticles decorated PDDA–G–MoS{sub 2} (PdNPs/PDDA–G–MoS{sub 2}) as nanocarriers, which were functionalized by hemin/G-quadruplex, glucose oxidase (GOD), and toluidine blue (Tb) as redox probes. The signal amplification strategy was achieved as follows: Firstly, the immobilized GOD could effectively catalyze the oxidation of glucose to gluconolactone, coupling with the reduction of the dissolved oxygen to H{sub 2}O{sub 2}. Then, both PdNPs and hemin/G-quadruplex acting as hydrogen peroxide (HRP)-mimicking enzyme could further catalyze the reduction of H{sub 2}O{sub 2}, resulting in significant electrochemical signal amplification. So the proposed aptasensor showed high sensitivity with a wide dynamic linear range of 0.0001 to 40 nM and a relatively low detection limit of 0.062 pM for TB determination. The strategy showed huge potential of application in protein detection and disease diagnosis.

  19. 29 CFR Appendix G to Part 825 - Certification of Qualifying Exigency for Military Family Leave (Form WH-384)

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Certification of Qualifying Exigency for Military Family Leave (Form WH-384) G Appendix G to Part 825 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR OTHER LAWS THE FAMILY AND MEDICAL LEAVE ACT OF 1993 Pt. 825, App. G...

  20. 76 FR 53929 - Agency Information Collection Activities: Form G-639, Revision of a Currently Approved...

    Science.gov (United States)

    2011-08-30

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... Act Request. * * * * * The Department of Homeland Security, U.S. Citizenship and Immigration Services... sponsoring the collection: Form G-639; U.S. Citizenship and Immigration Services (USCIS). (4) Affected public...

  1. A novel strategy for dual-channel detection of metallothioneins and mercury based on the conformational switching of functional chimera aptamer.

    Science.gov (United States)

    Tang, Xian; Wang, Yong-Sheng; Xue, Jin-Hua; Zhou, Bin; Cao, Jin-Xiu; Chen, Si-Han; Li, Ming-Hui; Wang, Xiao-Feng; Zhu, Yu-Feng; Huang, Yan-Qin

    2015-03-25

    A novel strategy for dual-channel detection of metallothioneins (MTs) and Hg(2+) has been proposed. In the absence of Hg(2+), the functional chimera aptamer (FCA) designed can form an intact G-quadruplex with flexibility, which was demonstrated to have peroxidase-like activities upon hemin binding. In the presence of Hg(2+), the formation of T-Hg(2+)-T complex results in the conformational switching of FCA, which lost the peroxidase-like activities and cannot catalyze the oxidation of ABTS by H2O2. Upon addition of MTs in this solution, MTs could interact with Hg(2+) to form a MTs-Hg(2+) complex, leading to the recovery of the G-quadruplex DNAzyme. The color and absorbance of the sensing system were also changed accordingly. In the optimizing condition, ΔA was directly proportional to the concentration ranging from 8.84 nM to 1.0 μM for Hg(2+), and 7.82 nM to 0.462 μM for MTs with the detection limits of 2.65 nM and 2.34 nM, respectively. The proposed dual-channel method avoids the label steps in common methods, and allows direct analysis of the samples without costly instruments, and is reliable, inexpensive and sensitive. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. IIB backgrounds with five-form flux

    International Nuclear Information System (INIS)

    Gran, U.; Gutowski, J.; Papadopoulos, G.

    2008-01-01

    We investigate all N=2 supersymmetric IIB supergravity backgrounds with non-vanishing five-form flux. The Killing spinors have stability subgroups Spin(7) x R 8 , SU(4) x R 8 and G 2 . In the SU(4) x R 8 case, two different types of geometry arise depending on whether the Killing spinors are generic or pure. In both cases, the backgrounds admit a null Killing vector field which leaves invariant the SU(4) x R 8 structure, and an almost complex structure in the directions transverse to the lightcone. In the generic case, the twist of the vector field is trivial but the almost complex structure is non-integrable, while in the pure case the twist is non-trivial but the almost complex structure is integrable and associated with a relatively balanced Hermitian structure. The G 2 backgrounds admit a time-like Killing vector field and two spacelike closed one-forms, and the seven directions transverse to these admit a co-symplectic G 2 structure. The Spin(7) x R 8 backgrounds are pp-waves propagating in an eight-dimensional manifold with holonomy Spin(7). In addition we show that all the supersymmetric solutions of simple five-dimensional supergravity with a time-like Killing vector field, which include the AdS 5 black holes, lift to SU(4) x R 8 pure Killing spinor IIB backgrounds. We also show that the LLM solution is associated with a co-symplectic co-homogeneity one G 2 manifold which has principal orbit S 3 xS 3

  3. Euler angles for G2

    International Nuclear Information System (INIS)

    Cacciatori, Sergio L.; Cerchiai, Bianca L.; Della Vedova, Alberto; Ortenzi, Giovanni; Scotti, Antonio

    2005-01-01

    We provide a simple coordinatization for the group G 2 , which is analogous to the Euler coordinatization for SU(2). We show how to obtain the general element of the group in a form emphasizing the structure of the fibration of G 2 with fiber SO(4) and base H, the variety of quaternionic subalgebras of octonions. In particular this allows us to obtain a simple expression for the Haar measure on G 2 . Moreover, as a by-product it yields a concrete realization and an Einstein metric for H

  4. Methods of generalizing and classifying layer structures of a special form

    Energy Technology Data Exchange (ETDEWEB)

    Viktorova, N P

    1981-09-01

    An examination is made of the problem of classifying structures represented by weighted multilayer graphs of special form with connections between the vertices of each layer. The classification of structures of such a form is based on the construction of resolving sets of graphs as a result of generalization of the elements of the training sample of each class and the testing of whether an input object is isomorphic (with allowance for the weights) to the structures of the resolving set or not. 4 references.

  5. 75 FR 47822 - Agency Information Collection Activities: Form G-639, Extension of a Currently Approved...

    Science.gov (United States)

    2010-08-09

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... Act Request; OMB Control No. 1615- 0102. The Department of Homeland Security, U.S. Citizenship and... Department of Homeland Security sponsoring the collection: Form G-639; U.S. Citizenship and Immigration...

  6. A Generalized Form of Context-Dependent Psychophysiological Interactions (gPPI): A Comparison to Standard Approaches

    Science.gov (United States)

    McLaren, Donald G.; Ries, Michele L.; Xu, Guofan; Johnson, Sterling C.

    2012-01-01

    Functional MRI (fMRI) allows one to study task-related regional responses and task-dependent connectivity analysis using psychophysiological interaction (PPI) methods. The latter affords the additional opportunity to understand how brain regions interact in a task-dependent manner. The current implementation of PPI in Statistical Parametric Mapping (SPM8) is configured primarily to assess connectivity differences between two task conditions, when in practice fMRI tasks frequently employ more than two conditions. Here we evaluate how a generalized form of context-dependent PPI (gPPI; http://www.nitrc.org/projects/gppi), which is configured to automatically accommodate more than two task conditions in the same PPI model by spanning the entire experimental space, compares to the standard implementation in SPM8. These comparisons are made using both simulations and an empirical dataset. In the simulated dataset, we compare the interaction beta estimates to their expected values and model fit using the Akaike Information Criterion (AIC). We found that interaction beta estimates in gPPI were robust to different simulated data models, were not different from the expected beta value, and had better model fits than when using standard PPI (sPPI) methods. In the empirical dataset, we compare the model fit of the gPPI approach to sPPI. We found that the gPPI approach improved model fit compared to sPPI. There were several regions that became non-significant with gPPI. These regions all showed significantly better model fits with gPPI. Also, there were several regions where task-dependent connectivity was only detected using gPPI methods, also with improved model fit. Regions that were detected with all methods had more similar model fits. These results suggest that gPPI may have greater sensitivity and specificity than standard implementation in SPM. This notion is tempered slightly as there is no gold standard; however, data simulations with a known outcome support our

  7. R-ChIP Using Inactive RNase H Reveals Dynamic Coupling of R-loops with Transcriptional Pausing at Gene Promoters.

    Science.gov (United States)

    Chen, Liang; Chen, Jia-Yu; Zhang, Xuan; Gu, Ying; Xiao, Rui; Shao, Changwei; Tang, Peng; Qian, Hao; Luo, Daji; Li, Hairi; Zhou, Yu; Zhang, Dong-Er; Fu, Xiang-Dong

    2017-11-16

    R-loop, a three-stranded RNA/DNA structure, has been linked to induced genome instability and regulated gene expression. To enable precision analysis of R-loops in vivo, we develop an RNase-H-based approach; this reveals predominant R-loop formation near gene promoters with strong G/C skew and propensity to form G-quadruplex in non-template DNA, corroborating with all biochemically established properties of R-loops. Transcription perturbation experiments further indicate that R-loop induction correlates to transcriptional pausing. Interestingly, we note that most mapped R-loops are each linked to a nearby free RNA end; by using a ribozyme to co-transcriptionally cleave nascent RNA, we demonstrate that such a free RNA end coupled with a G/C-skewed sequence is necessary and sufficient to induce R-loop. These findings provide a topological solution for RNA invasion into duplex DNA and suggest an order for R-loop initiation and elongation in an opposite direction to that previously proposed. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Structural Encoding of Static Single Assignment Form

    DEFF Research Database (Denmark)

    Gal, Andreas; Probst, Christian; Franz, Michael

    2005-01-01

    Static Single Assignment (SSA) form is often used as an intermediate representation during code optimization in Java Virtual Machines. Recently, SSA has successfully been used for bytecode verification. However, constructing SSA at the code consumer is costly. SSAbased mobile code transport formats...... Java bytecode. While the resulting bytecode sequence can still be directly executed by traditional Virtual Machines, our novel VM can infer SSA form and confirm its safety with virtually no overhead....... have been shown to eliminate this cost by shifting SSA creation to the code producer. These new formats, however, are not backward compatible with the established Java class-file format. We propose a novel approach to transport SSA information implicitly through structural code properties of standard...

  9. Multi-Scalar Modelling for Free-form Timber Structures

    DEFF Research Database (Denmark)

    Poinet, Paul; Nicholas, Paul; Tamke, Martin

    2016-01-01

    .The research explores the design probe of free-form structures composed of glue-laminated timber beams and looks at the different types of data that need to be shared among each discipline and across multiple scales from which different levels of resolution can be defined. A particular focus lies...... in the segmentation strategy of glue-laminated timber structures that depend on structural requirements and the different types of constraints related to fabrication, transportation and assembly. Where current working practices decouple segmentation processes within a discrete digital workflow, this research aims...... and techniques as a means to work within a continuous design environment in which an abstract network of timber beams is iteratively updated through geometrical and structural optimizations at different levels of resolution....

  10. Relating structural parameters to leachability in a glass-bonded ceramic waste form

    International Nuclear Information System (INIS)

    Frank, S. M.; Johnson, S. G.; Moschetti, T. L.

    1998-01-01

    Lattice parameters for a crystalline material can be obtained by several methods, notably by analyzing x-ray powder diffraction patterns. By utilizing a computer program to fit a pattern, one can follow the evolution or subtle changes in a structure of a crystalline species in different environments. This work involves such a study for an essential component of the ceramic waste form that is under development at Argonne National Laboratory. Zeolite 4A and zeolite 5A are used to produce two different types of waste forms: a glass-bonded sodalite and a glass-bonded zeolite, respectively. Changes in structure during production of the waste forms are discussed. Specific salt-loadings in the sodalite waste form are related to relative peak intensities of certain reflections in the XRD patterns. Structural parameters for the final waste forms will also be given and related to leachability under standard conditions

  11. Raman spectroscopy used for structural investigations of anodically formed ZrO2

    International Nuclear Information System (INIS)

    Koneska, Zagorka; Arsova, Irena

    2003-01-01

    The structure of the oxide formed on Zr(99% + Hf) with anodic oxidation at different potentials in 1 mol/dm 3 H 3 PO 4 and 2 mol/dm 3 KOH solutions were investigated using Raman spectroscopy. Normally the anodic oxides of Zr form only crystals. Under certain circumstances, amorphous anodic ZrO 2 can be observed. Amorphous phase is observed for the anodically formed zirconium oxides in H 3 PO 4 . The oxide formed in KOH at potential of 80 V, where sparks appears on the Zr electrode showed crystalline structure. (Original)

  12. The distribution of warm gas in the G327.3-0.6 star forming region

    NARCIS (Netherlands)

    Leurini, S.; Wyrowski, F.; van der Tak, F.; Herpin, F.; Herschel WISH Team, [Unknown

    Water is a key molecule for determining the physical chemical structure of star forming regions because of its large abundance variations between warm and cold regions. As a part of the HIFI-led Key Program WISH (P.I. E. van Dishoeck), we are mapping six massive star forming region in different H2O

  13. Yang-Mills solutions and Spin(7)-instantons on cylinders over coset spaces with G2-structure

    International Nuclear Information System (INIS)

    Haupt, Alexander S.

    2016-01-01

    We study g-valued Yang-Mills fields on cylinders Z(G/H)=ℝ×G/H, where G/H is a compact seven-dimensional coset space with G 2 -structure, g is the Lie algebra of G, and Z(G/H) inherits a Spin(7)-structure. After imposing a general G-invariance condition, Yang-Mills theory with torsion on Z(G/H) reduces to Newtonian mechanics of a point particle moving in ℝ n under the influence of some quartic potential and possibly additional constraints. The kinematics and dynamics depends on the chosen coset space. We consider in detail three coset spaces with nearly parallel G 2 -structure and four coset spaces with SU(3)-structure. For each case, we analyze the critical points of the potential and present a range of finite-energy solutions. We also study a higher-dimensional analog of the instanton equation. Its solutions yield G-invariant Spin(7)-instanton configurations on Z(G/H), which are special cases of Yang-Mills configurations with torsion.

  14. G-autonomy of EEG recordings of psychotic patients undergoing the primitive expression form of dance therapy

    Science.gov (United States)

    Ventouras, E.-C.; Lardi, I.; Dimitriou, S.; Margariti, A.; Chondraki, P.; Kalatzis, I.; Economou, N.-T.; Tsekou, H.; Paparrigopoulos, T.; Ktonas, P. Y.

    2015-09-01

    Primitive expression (PE) is a form of dance therapy (DT) that involves an interaction of ethologically and socially based forms which are supplied for re-enactment. Brain connectivity has been measured in electroencephalographic (EEG) data of patients with schizophrenia undergoing PE DT, using the correlation coefficient and mutual information. These parameters do not measure the existence or absence of directionality in the connectivity. The present study investigates the use of the G-autonomy measure of EEG electrode voltages of the same group of schizophrenic patients. G-autonomy is a measure of the “autonomy” of a system. It indicates the degree by which prediction of the system's future evolution is enhanced by taking into account its own past states, in comparison to predictions based on past states of a set of external variables. In the present research, “own” past states refer to voltage values in the time series recorded at a specific electrode and “external” variables refer to the voltage values recorded at other electrodes. Indication is provided for an acute effect of early-stage PE DT expressed by the augmentation of G-autonomy in the delta rhythm and an acute effect of late- stage PE DT expressed by the reduction of G-autonomy in the theta and alpha rhythms.

  15. 12 CFR Appendix G to Part 360 - Deposit-Customer Join File Structure

    Science.gov (United States)

    2010-01-01

    ..._Code Relationship CodeThe code indicating how the customer is related to the account. Possible values... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Deposit-Customer Join File Structure G Appendix... GENERAL POLICY RESOLUTION AND RECEIVERSHIP RULES Pt. 360, App. G Appendix G to Part 360—Deposit-Customer...

  16. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Yodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), 11528–11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation(US) 1430124 Institutional support: RVO:68378050 Keywords : Bloom helicase * ATP * Gquadruplex (GQ) structure * GQ destabilization Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  17. Does a Structured Data Collection Form Improve The Accuracy of ...

    African Journals Online (AJOL)

    and multiple etiologies for similar presentation. Standardized forms may harmonize the initial assessment, improve accuracy of diagnosis and enhance outcomes. Objectives: To determine the extent to which use of a structured data collection form (SDCF) affected the diagnostic accuracy of AAP. Methodology: A before and ...

  18. G protein-membrane interactions II: Effect of G protein-linked lipids on membrane structure and G protein-membrane interactions.

    Science.gov (United States)

    Casas, Jesús; Ibarguren, Maitane; Álvarez, Rafael; Terés, Silvia; Lladó, Victoria; Piotto, Stefano P; Concilio, Simona; Busquets, Xavier; López, David J; Escribá, Pablo V

    2017-09-01

    G proteins often bear myristoyl, palmitoyl and isoprenyl moieties, which favor their association with the membrane and their accumulation in G Protein Coupled Receptor-rich microdomains. These lipids influence the biophysical properties of membranes and thereby modulate G protein binding to bilayers. In this context, we showed here that geranylgeraniol, but neither myristate nor palmitate, increased the inverted hexagonal (H II ) phase propensity of phosphatidylethanolamine-containing membranes. While myristate and palmitate preferentially associated with phosphatidylcholine membranes, geranylgeraniol favored nonlamellar-prone membranes. In addition, Gαi 1 monomers had a higher affinity for lamellar phases, while Gβγ and Gαβγ showed a marked preference for nonlamellar prone membranes. Moreover, geranylgeraniol enhanced the binding of G protein dimers and trimers to phosphatidylethanolamine-containing membranes, yet it decreased that of monomers. By contrast, both myristate and palmitate increased the Gαi 1 preference for lamellar membranes. Palmitoylation reinforced the binding of the monomer to PC membranes and myristoylation decreased its binding to PE-enriched bilayer. Finally, binding of dimers and trimers to lamellar-prone membranes was decreased by palmitate and myristate, but it was increased in nonlamellar-prone bilayers. These results demonstrate that co/post-translational G protein lipid modifications regulate the membrane lipid structure and that they influence the physico-chemical properties of membranes, which in part explains why G protein subunits sort to different plasma membrane domains. This article is part of a Special Issue entitled: Membrane Lipid Therapy: Drugs Targeting Biomembranes edited by Pablo V. Escribá. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Graphene heat dissipating structure

    Science.gov (United States)

    Washburn, Cody M.; Lambert, Timothy N.; Wheeler, David R.; Rodenbeck, Christopher T.; Railkar, Tarak A.

    2017-08-01

    Various technologies presented herein relate to forming one or more heat dissipating structures (e.g., heat spreaders and/or heat sinks) on a substrate, wherein the substrate forms part of an electronic component. The heat dissipating structures are formed from graphene, with advantage being taken of the high thermal conductivity of graphene. The graphene (e.g., in flake form) is attached to a diazonium molecule, and further, the diazonium molecule is utilized to attach the graphene to material forming the substrate. A surface of the substrate is treated to comprise oxide-containing regions and also oxide-free regions having underlying silicon exposed. The diazonium molecule attaches to the oxide-free regions, wherein the diazonium molecule bonds (e.g., covalently) to the exposed silicon. Attachment of the diazonium plus graphene molecule is optionally repeated to enable formation of a heat dissipating structure of a required height.

  20. X-ray structure of the mammalian GIRK2-βγ G-protein complex

    Energy Technology Data Exchange (ETDEWEB)

    Whorton, Matthew R.; MacKinnon, Roderick [Rockefeller

    2013-07-30

    G-protein-gated inward rectifier K+ (GIRK) channels allow neurotransmitters, through G-protein-coupled receptor stimulation, to control cellular electrical excitability. In cardiac and neuronal cells this control regulates heart rate and neural circuit activity, respectively. Here we present the 3.5Å resolution crystal structure of the mammalian GIRK2 channel in complex with βγ G-protein subunits, the central signalling complex that links G-protein-coupled receptor stimulation to K+ channel activity. Short-range atomic and long-range electrostatic interactions stabilize four βγ G-protein subunits at the interfaces between four K+ channel subunits, inducing a pre-open state of the channel. The pre-open state exhibits a conformation that is intermediate between the closed conformation and the open conformation of the constitutively active mutant. The resultant structural picture is compatible with ‘membrane delimited’ activation of GIRK channels by G proteins and the characteristic burst kinetics of channel gating. The structures also permit a conceptual understanding of how the signalling lipid phosphatidylinositol-4,5-bisphosphate (PIP2) and intracellular Na+ ions participate in multi-ligand regulation of GIRK channels.

  1. Crystal structure of the human beta2 adrenergic G-protein-coupled receptor

    DEFF Research Database (Denmark)

    Rasmussen, Søren Gøgsig Faarup; Choi, Hee-Jung; Rosenbaum, Daniel M

    2007-01-01

    Structural analysis of G-protein-coupled receptors (GPCRs) for hormones and neurotransmitters has been hindered by their low natural abundance, inherent structural flexibility, and instability in detergent solutions. Here we report a structure of the human beta2 adrenoceptor (beta2AR), which was ...

  2. G2S: A web-service for annotating genomic variants on 3D protein structures.

    Science.gov (United States)

    Wang, Juexin; Sheridan, Robert; Sumer, S Onur; Schultz, Nikolaus; Xu, Dong; Gao, Jianjiong

    2018-01-27

    Accurately mapping and annotating genomic locations on 3D protein structures is a key step in structure-based analysis of genomic variants detected by recent large-scale sequencing efforts. There are several mapping resources currently available, but none of them provides a web API (Application Programming Interface) that support programmatic access. We present G2S, a real-time web API that provides automated mapping of genomic variants on 3D protein structures. G2S can align genomic locations of variants, protein locations, or protein sequences to protein structures and retrieve the mapped residues from structures. G2S API uses REST-inspired design conception and it can be used by various clients such as web browsers, command terminals, programming languages and other bioinformatics tools for bringing 3D structures into genomic variant analysis. The webserver and source codes are freely available at https://g2s.genomenexus.org. g2s@genomenexus.org. Supplementary data are available at Bioinformatics online. © The Author (2018). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  3. Crystal structure of an eIF4G-like protein from Danio rerio

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Euiyoung; Bitto, Eduard; Bingman, Craig A.; McCoy, Jason G.; Wesenberg, Gary E.; Phillips, Jr., George N. (UW)

    2012-04-18

    The gene LOC 91917 Danio rerio (zebrafish) encodes a protein annotated in the UniProt knowledgebase as the middle domain of eukaryotic initiation factor 4G domain containing protein b (MIF4Gdb). Its molecular weight is 25.8 kDa, and it comprises 222 amino acid residues. BLAST searches revealed homologues of D. rerio MIF4Gdb in many eukaryotes including humans. The homologue sand MIF4Gdb were identified as members of the Pfam family, MIF4G (PF2854), which is named after the middle domain of eukaryotic initiation factor 4G (eIF4G). eIF4G is a component of eukaryotic translational initiation complex, and contains binding sites for other initiation factors, suggesting its critical role in translational initiation. The MIF4G domain also occurs in several other proteins involved in RNA metabolism, including the Nonsense-mediated mRNA decay 2 protein (NMD2/UPF2), and the nuclear cap-binding protein 80-kDa subunit (CBP80). Sequence and structure analysis of the MIF4G domains in many proteins indicate that the domain assumes an all helical fold and has tandem repeated motifs. The zebrafish protein described here has homology to domains of other proteins variously referred to as NIC-containing proteins (NMD2, eIF4G, CBP80). The biological function of D. rerio MIF4Gdb has not yet been experimentally characterized, and the annotation is based on amino acid sequence comparison. D. rerio MIF4Gdb did not share more than 25% sequence identity with any protein for which the three-dimensional structure is known and was selected as a target for structure determination by the Center for Eukaryotic Structural Genomics (CESG). Here, they report the crystal structure of D. rerio MIF4Gdb (UniGene code Dr.79360, UniProt code Q5EAQ1, CESG target number GO.79294).

  4. One-step synthesis of g-C{sub 3}N{sub 4} hierarchical porous structure nanosheets with dramatic ultraviolet light photocatalytic activity

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Jing; Wang, Yong; Huang, Jianfeng, E-mail: huangjfsust@126.com; Cao, Liyun; Li, Jiayin; Hai, Guojuan; Bai, Zhe

    2016-12-15

    Highlights: • g-C{sub 3}N{sub 4} nanosheets with hierarchical porous structure were synthesized via one step. • The band gap of the nanosheets was wider and investigated in detail. • The nanosheets can degrade almost all of the RhB within 9 min. • The photocurrent of the nanosheets is 5.97 times as high as that of the P-25. - Abstract: Graphitic carbon nitride (g-C{sub 3}N{sub 4}) nanosheets with hierarchical porous structure were synthesized via one-step thermal condensation-oxidation process. The microstructure of g-C{sub 3}N{sub 4} was characterized to explain the dramatic ultraviolet light photocatalytic activity. The results showed that g-C{sub 3}N{sub 4} hierarchical aggregates were assembled by nanosheets with a length of 1–2 μm and a thickness of 20–30 nm. And the N{sub 2}-adsorption/desorption isotherms further informed the presence of fissure form mesoporous structure. An enhanced photocurrent of 37.2 μA was obtained, which is almost 5 times higher than that of P-25. Besides, the g-C{sub 3}N{sub 4} nanosheets displayed the degradation of Rhodamine B with 99.4% removal efficiency in only 9 min. Such highly photocatalytic activity could be attributed to the nano platelet morphology which improves electron transport ability along the in-plane direction. In addition, the hierarchical porous structure adapted a wider band gap of C{sub 3}N{sub 4}. Therefore, the photoinduced electron-hole pairs have a stronger oxidation-reduction potential for photocatalysis.

  5. Quantum chemical studies on molecular structural conformations and hydrated forms of salicylamide and O-hydroxybenzoyl cyanide

    Science.gov (United States)

    Anandan, K.; Kolandaivel, P.; Kumaresan, R.

    Ab initio and density functional theory (DFT) methods have been employed to study the molecular structural conformations and hydrated forms of both salicylamide (SAM) and O-hydroxybenzoyl cyanide (OHBC). Molecular geometries and energetics have been obtained in the gaseous phase by employing the Møller-Plesset type 2 MP2/6-311G(2d,2p) and B3LYP/6-311G(2d,2p) levels of theory. The presence of an electron-releasing group (SAM) leads to an increase in the energy of the molecular system, while the presence of an electron-withdrawing group (OHBC) drastically decreases the energy. Chemical reactivity parameters (η and μ) have been calculated using the energy values of the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) obtained at the Hartree-Fock (HF)/6-311G(2d,2p) level of theory for all the conformers and the principle of maximum hardness (MHP) has been tested. The condensed Fukui functions have been calculated using the atomic charges obtained through the natural bond orbital (NBO) analysis scheme for all the optimized structures at the B3LYP/6-311G(2d,2p) level of theory, and the most reactive sites of the molecules have been identified. Nuclear magnetic resonance (NMR) studies have been carried out at the B3LYP/6-311G(2d,2p) level of theory for all the conformers in the gaseous phase on the basis of the method of Cheeseman and coworkers. The calculated chemical shift values have been used to discuss the delocalization activity of the electron clouds. The dimeric structures of the most stable conformers of both SAM and OHBC in the gaseous phase have been optimized at the B3LYP/6-311G(2d,2p) level of theory, and the interaction energies have been calculated. The most stable conformers of both compounds bear an intramolecular hydrogen bond, which gives rise to the formation of a pseudo-aromatic ring. These conformers have been allowed to interact with the water molecule. Special emphasis has been given to analysis of the

  6. Hydrophobic radical influence on structure and vibration spectra of zwitter-ionic forms of glycine and alanine in condensed state

    International Nuclear Information System (INIS)

    Ten, G.N.; Kadrov, D.M.; Baranov, V.I.

    2014-01-01

    Structure and vibrational spectra of the zwitter-ionic forms of glycine and alanine in water solution and solid state have been calculated in the B3LYP/6-311++G(d,p) approximation. The environment influence has been taken into account by two methods: the self-consistent reaction field (SCRF) method and one of modeling the glycine and alanine complexes with molecules of water. The structure, energy and spectral properties have been determined which allow establishing an influence of the hydrophobic radical on the glycine and alanine ability to form the hydrogen bonds. It is shown by comparison with experiment that for the calculation of vibrational (IR and Raman) spectra of the zwitter-ionic forms of glycine and alanine in the condensed states they must be surrounded with three molecules of water, one of which is located between the N + H 3 and COO - ionic groups. The value of energy necessary to form the Ala complexes with water compared to Gly ones is 56.47 and 12.55 kcal/mol higher in the case of the complex formation with 1and 3 molecules of water, respectively, located between bipolar groups. (authors)

  7. Assembling of G-strands into novel tetra-molecular parallel G4-DNA nanostructures using avidin-biotin recognition.

    Science.gov (United States)

    Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B

    2008-09-01

    We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.

  8. G-LoSA: An efficient computational tool for local structure-centric biological studies and drug design.

    Science.gov (United States)

    Lee, Hui Sun; Im, Wonpil

    2016-04-01

    Molecular recognition by protein mostly occurs in a local region on the protein surface. Thus, an efficient computational method for accurate characterization of protein local structural conservation is necessary to better understand biology and drug design. We present a novel local structure alignment tool, G-LoSA. G-LoSA aligns protein local structures in a sequence order independent way and provides a GA-score, a chemical feature-based and size-independent structure similarity score. Our benchmark validation shows the robust performance of G-LoSA to the local structures of diverse sizes and characteristics, demonstrating its universal applicability to local structure-centric comparative biology studies. In particular, G-LoSA is highly effective in detecting conserved local regions on the entire surface of a given protein. In addition, the applications of G-LoSA to identifying template ligands and predicting ligand and protein binding sites illustrate its strong potential for computer-aided drug design. We hope that G-LoSA can be a useful computational method for exploring interesting biological problems through large-scale comparison of protein local structures and facilitating drug discovery research and development. G-LoSA is freely available to academic users at http://im.compbio.ku.edu/GLoSA/. © 2016 The Protein Society.

  9. SU-G-JeP3-04: Estimating 4D CBCT from Prior Information and Extremely Limited Angle Projections Using Structural PCA and Weighted Free-Form Deformation

    International Nuclear Information System (INIS)

    Harris, W; Yin, F; Zhang, Y; Ren, L

    2016-01-01

    Purpose: To investigate the feasibility of using structure-based principal component analysis (PCA) motion-modeling and weighted free-form deformation to estimate on-board 4D-CBCT using prior information and extremely limited angle projections for potential 4D target verification of lung radiotherapy. Methods: A technique for lung 4D-CBCT reconstruction has been previously developed using a deformation field map (DFM)-based strategy. In the previous method, each phase of the 4D-CBCT was generated by deforming a prior CT volume. The DFM was solved by a motion-model extracted by global PCA and a free-form deformation (GMM-FD) technique, using data fidelity constraint and the deformation energy minimization. In this study, a new structural-PCA method was developed to build a structural motion-model (SMM) by accounting for potential relative motion pattern changes between different anatomical structures from simulation to treatment. The motion model extracted from planning 4DCT was divided into two structures: tumor and body excluding tumor, and the parameters of both structures were optimized together. Weighted free-form deformation (WFD) was employed afterwards to introduce flexibility in adjusting the weightings of different structures in the data fidelity constraint based on clinical interests. XCAT (computerized patient model) simulation with a 30 mm diameter lesion was simulated with various anatomical and respirational changes from planning 4D-CT to onboard volume. The estimation accuracy was evaluated by the Volume-Percent-Difference (VPD)/Center-of-Mass-Shift (COMS) between lesions in the estimated and “ground-truth” on board 4D-CBCT. Results: Among 6 different XCAT scenarios corresponding to respirational and anatomical changes from planning CT to on-board using single 30° on-board projections, the VPD/COMS for SMM-WFD was reduced to 10.64±3.04%/1.20±0.45mm from 21.72±9.24%/1.80±0.53mm for GMM-FD. Using 15° orthogonal projections, the VPD/COMS was

  10. SU-G-JeP3-04: Estimating 4D CBCT from Prior Information and Extremely Limited Angle Projections Using Structural PCA and Weighted Free-Form Deformation

    Energy Technology Data Exchange (ETDEWEB)

    Harris, W; Yin, F; Zhang, Y; Ren, L [Duke University Medical Center, Durham, NC (United States)

    2016-06-15

    Purpose: To investigate the feasibility of using structure-based principal component analysis (PCA) motion-modeling and weighted free-form deformation to estimate on-board 4D-CBCT using prior information and extremely limited angle projections for potential 4D target verification of lung radiotherapy. Methods: A technique for lung 4D-CBCT reconstruction has been previously developed using a deformation field map (DFM)-based strategy. In the previous method, each phase of the 4D-CBCT was generated by deforming a prior CT volume. The DFM was solved by a motion-model extracted by global PCA and a free-form deformation (GMM-FD) technique, using data fidelity constraint and the deformation energy minimization. In this study, a new structural-PCA method was developed to build a structural motion-model (SMM) by accounting for potential relative motion pattern changes between different anatomical structures from simulation to treatment. The motion model extracted from planning 4DCT was divided into two structures: tumor and body excluding tumor, and the parameters of both structures were optimized together. Weighted free-form deformation (WFD) was employed afterwards to introduce flexibility in adjusting the weightings of different structures in the data fidelity constraint based on clinical interests. XCAT (computerized patient model) simulation with a 30 mm diameter lesion was simulated with various anatomical and respirational changes from planning 4D-CT to onboard volume. The estimation accuracy was evaluated by the Volume-Percent-Difference (VPD)/Center-of-Mass-Shift (COMS) between lesions in the estimated and “ground-truth” on board 4D-CBCT. Results: Among 6 different XCAT scenarios corresponding to respirational and anatomical changes from planning CT to on-board using single 30° on-board projections, the VPD/COMS for SMM-WFD was reduced to 10.64±3.04%/1.20±0.45mm from 21.72±9.24%/1.80±0.53mm for GMM-FD. Using 15° orthogonal projections, the VPD/COMS was

  11. Differential forms theory and practice

    CERN Document Server

    Weintraub, Steven H

    2014-01-01

    Differential forms are utilized as a mathematical technique to help students, researchers, and engineers analyze and interpret problems where abstract spaces and structures are concerned, and when questions of shape, size, and relative positions are involved. Differential Forms has gained high recognition in the mathematical and scientific community as a powerful computational tool in solving research problems and simplifying very abstract problems through mathematical analysis on a computer. Differential Forms, 2nd Edition, is a solid resource for students and professionals needing a solid g

  12. Salt-occluded zeolite waste forms: Crystal structures and transformability

    International Nuclear Information System (INIS)

    Richardson, J.W. Jr.

    1996-01-01

    Neutron diffraction studies of salt-occluded zeolite and zeolite/glass composite samples, simulating nuclear waste forms loaded with fission products, have revealed complex structures, with cations assuming the dual roles of charge compensation and occlusion (cluster formation). These clusters roughly fill the 6--8 angstrom diameter pores of the zeolites. Samples are prepared by equilibrating zeolite-A with complex molten Li, K, Cs, Sr, Ba, Y chloride salts, with compositions representative of anticipated waste systems. Samples prepared using zeolite 4A (which contains exclusively sodium cations) as starting material are observed to transform to sodalite, a denser aluminosilicate framework structure, while those prepared using zeolite 5A (sodium and calcium ions) more readily retain the zeolite-A structure. Because the sodalite framework pores are much smaller than those of zeolite-A, clusters are smaller and more rigorously confined, with a correspondingly lower capacity for waste containment. Details of the sodalite structures resulting from transformation of zeolite-A depend upon the precise composition of the original mixture. The enhanced resistance of salt-occluded zeolites prepared from zeolite 5A to sodalite transformation is thought to be related to differences in the complex chloride clusters present in these zeolite mixtures. Data relating processing conditions to resulting zeolite composition and structure can be used in the selection of processing parameters which lead to optimal waste forms

  13. Calibrated and Interactive Modelling of Form-Active Hybrid Structures

    DEFF Research Database (Denmark)

    Quinn, Gregory; Holden Deleuran, Anders; Piker, Daniel

    2016-01-01

    Form-active hybrid structures (FAHS) couple two or more different structural elements of low self weight and low or negligible bending flexural stiffness (such as slender beams, cables and membranes) into one structural assembly of high global stiffness. They offer high load-bearing capacity...... software packages which introduce interruptions and data exchange issues in the modelling pipeline. The mechanical precision, stability and open software architecture of Kangaroo has facilitated the development of proof-of-concept modelling pipelines which tackle this challenge and enable powerful...... materially-informed sketching. Making use of a projection-based dynamic relaxation solver for structural analysis, explorative design has proven to be highly effective....

  14. Probabilistic Seismic Performance Model for Tunnel Form Concrete Building Structures

    Directory of Open Access Journals (Sweden)

    S. Bahram Beheshti Aval

    2016-12-01

    Full Text Available Despite widespread construction of mass-production houses with tunnel form structural system across the world, unfortunately no special seismic code is published for design of this type of construction. Through a literature survey, only a few studies are about the seismic behavior of this type of structural system. Thus based on reasonable numerical results, the seismic performance of structures constructed with this technique considering the effective factors on structural behavior is highly noteworthy in a seismic code development process. In addition, due to newness of this system and observed damages in past earthquakes, and especially random nature of future earthquakes, the importance of probabilistic approach and necessity of developing fragility curves in a next generation Performance Based Earthquake Engineering (PBEE frame work are important. In this study, the seismic behavior of 2, 5 and 10 story tunnel form structures with a regular plan is examined. First, the performance levels of these structures under the design earthquake (return period of 475 years with time history analysis and pushover method are assessed, and then through incremental dynamic analysis, fragility curves are extracted for different levels of damage in walls and spandrels. The results indicated that the case study structures have high capacity and strength and show appropriate seismic performance. Moreover, all three structures subjected were in immediate occupancy performance level.

  15. Features of ultrafine-grained structure forming in Zr-1Nb alloy

    Energy Technology Data Exchange (ETDEWEB)

    Stepanova, Ekaterina N.; Prosolov, Konstantin A. [National Research Tomsk Polytechnic University, Tomsk (Russian Federation); Grabovetskaya, Galina P.; Mishin, Ivan P. [Institute of Strength Physics and Materials Science of Siberian Branch of Russian Academy of Sciences, Tomsk (Russian Federation)

    2013-07-01

    Ultrafine-grained structure forming by the method combined reversible hydrogenation and hot pressing in Zr-1Nb alloy was investigated. Preliminary hydrogenation to concentrations of (0.14–0.4) % at 873 K is found to lead to yield strength decreasing in Zr-1Nb alloy during hot pressing by 1,5–2 times. During uniaxial compression at (70–72) % under isothermal conditions at a temperature of 873 K in Zr-1Nb alloy, hydrogenated to concentration of 0.22 %, homogeneous ultrafine grained structure with an average grain size of 0,4 P m was formed. Key words: zirconium alloy, ultrafine-grained structure, hydrogen.

  16. Structuring free form verbal descriptions in equipment failure reports

    International Nuclear Information System (INIS)

    Huzdovich, J.

    1983-01-01

    Information is encoded for convenience in computer sort/search routines used to manage a large number of records. The codes in use for equipment failure reports are limited due to practical considerations, and this limitation forces the reporter to leave out information to satisfy the coding requirements. The free form verbal descriptions, as found in the Generating Availability Data System (GADS) and the Nuclear Plant Reliability Data System (NPRDS), allow for reporting of this non-codable information. A systematic approach to constructing the verbal description based on rules of grammar, especially syntax, results in a structured narrative suitable for computer data management schemes. In addition, the reporter has a full range of descriptive terminology and does not have to select subjectively from a predetermined, limited vocabulary to describe the event. This paper introduces a concept that places in perspective the integration of structured, formal reporting and free form verbal description. A second benefit of this structured narrative is the systematic development of failure mode/failure cause relationships in the event

  17. PARALLAXES FOR W49N AND G048.60+0.02: DISTANT STAR FORMING REGIONS IN THE PERSEUS SPIRAL ARM

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, B.; Menten, K. M.; Brunthaler, A. [Max-Plank-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Reid, M. J.; Dame, T. M. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Zheng, X. W. [Department of Astronomy, Nanjing University, Nanjing 210093 (China); Xu, Y. [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)

    2013-09-20

    We report trigonometric parallax measurements of 22 GHz H{sub 2}O masers in two massive star-forming regions from Very Long Baseline Array observations as part of the Bar and Spiral Structure Legacy Survey. The distances of 11.11{sup +0.79}{sub -0.69} kpc to W49N (G043.16+0.01) and 10.75{sup +0.61}{sub -0.55} kpc to G048.60+0.02 locate them in a distant section of the Perseus arm near the solar circle in the first Galactic quadrant. This allows us to locate accurately the inner portion of the Perseus arm for the first time. Combining the present results with sources measured in the outer portion of the arm in the second and third quadrants yields a global pitch angle of 9.°5 ± 1.°3 for the Perseus arm. We have found almost no H{sub 2}O maser sources in the Perseus arm for 50°

  18. Top-down holographic G-structure glueball spectroscopy at (N)LO in N and finite coupling

    International Nuclear Information System (INIS)

    Sil, Karunava; Yadav, Vikas; Misra, Aalok

    2017-01-01

    The top-down type IIB holographic dual of large-N thermal QCD as constructed in Mia et al. (Nucl Phys B 839:187, 2010) involving a fluxed resolved warped deformed conifold, its delocalized type IIA Strominger-Yau-Zaslow-mirror (SYZ-mirror) as well as its M-theory uplift constructed in Dhuria and Misra (JHEP 1311:001, 2013) - both in the finite coupling g s G 2 -structure in Sil and Misra (Nucl Phys B 910:754, 2016). Glueballs spectra in the finite-gauge-coupling limit (and not just large 't Hooft coupling limit) - a limit expected to be directly relevant to strongly coupled systems at finite temperature such as QGP (Natsuume in String theory and quark-gluon plasma, 2007) - has thus far been missing in the literature. In this paper, we fill this gap by calculating the masses of the 0 ++ , 0 -+ , 0 -- , 1 ++ , 2 ++ ('glueball') states (which correspond to fluctuations in the dilaton or complexified two-forms or appropriate metric components) in the aforementioned backgrounds of G-structure in the 'MQGP' limit of Dhuria and Misra (JHEP 1311:001, 2013). We use WKB quantization conditions on one hand and impose Neumann/Dirichlet boundary conditions at an IR cut-off ('r 0 ')/horizon radius ('r h ') on the solutions to the equations of motion on the other hand. We find that the former technique produces results closer to the lattice results. We also discuss the r h = 0 limits of all calculations. In this context we also calculate the 0 ++ , 0 -- , 1 ++ , 2 ++ glueball masses up to Next to Leading Order (NLO) in N and find a (g s M 2 )/(N)(g s N f )-suppression similar to and further validating semi-universality of NLO corrections to transport coefficients, observed in Sil and Misra (Eur Phys J C 76(11):618, 2016). (orig.)

  19. Top-down holographic G-structure glueball spectroscopy at (N)LO in N and finite coupling

    Science.gov (United States)

    Sil, Karunava; Yadav, Vikas; Misra, Aalok

    2017-06-01

    The top-down type IIB holographic dual of large- N thermal QCD as constructed in Mia et al. (Nucl Phys B 839:187, 2010) involving a fluxed resolved warped deformed conifold, its delocalized type IIA Strominger-Yau-Zaslow-mirror (SYZ-mirror) as well as its M-theory uplift constructed in Dhuria and Misra (JHEP 1311:001, 2013) - both in the finite coupling (g_s ˜ \\limits ^{Misra (JHEP 1311:001, 2013) - were shown explicitly to possess a local SU(3)/G_2-structure in Sil and Misra (Nucl Phys B 910:754, 2016). Glueballs spectra in the finite-gauge-coupling limit (and not just large 't Hooft coupling limit) - a limit expected to be directly relevant to strongly coupled systems at finite temperature such as QGP (Natsuume in String theory and quark-gluon plasma, 2007) - has thus far been missing in the literature. In this paper, we fill this gap by calculating the masses of the 0^{++}, 0^{-+},0^{{-}{-}}, 1^{++}, 2^{++} (`glueball') states (which correspond to fluctuations in the dilaton or complexified two-forms or appropriate metric components) in the aforementioned backgrounds of G-structure in the `MQGP' limit of Dhuria and Misra (JHEP 1311:001, 2013). We use WKB quantization conditions on one hand and impose Neumann/Dirichlet boundary conditions at an IR cut-off (`r_0')/horizon radius (`r_h') on the solutions to the equations of motion on the other hand. We find that the former technique produces results closer to the lattice results. We also discuss the r_h=0 limits of all calculations. In this context we also calculate the 0^{++}, 0^{{-}{-}},1^{++}, 2^{++} glueball masses up to Next to Leading Order (NLO) in N and find a g_sM^2/N(g_sN_f)-suppression similar to and further validating semi-universality of NLO corrections to transport coefficients, observed in Sil and Misra (Eur Phys J C 76(11):618, 2016).

  20. Conditional activation of associative semantic structures:forming and transmitting impressions of personality

    OpenAIRE

    Nunes, Ludmila Duarte da Silva

    2012-01-01

    Tese de doutoramento, Psicologia (Cognição Social), Universidade de Lisboa, Faculdade de Psicologia, 2012 In the presented line of research we intended to systematically study the importance of memory to the formation and transmission of impressions of personality. We consider that impressions of personality are grounded in associative structures (e.g., Asch, 1946), which should be prone to similar memory distortions that other associative memory structures are (e.g., Roediger& McDermott, ...

  1. Structure of a second crystal form of Bence-Jones protein Loc: Strikingly different domain associations in two crystal forms of a single protein

    International Nuclear Information System (INIS)

    Schiffer, M.; Ainsworth, C.; Xu, Z.B.; Carperos, W.; Olsen, K.; Solomon, A.; Stevens, F.J.; Chang, C.H.

    1989-01-01

    The authors have determined the structure of the immunoglobulin light-chain dimer Loc in a second crystal form that was grown from distilled water. The crystal structure was determined to 2.8-angstrom resolution; the R factor is 0.22. The two variable domains are related by local 2-fold axes and form an antigen binding pocket. The variable domain-variable domain interaction observed in this crystal form differs from the one exhibited by the protein when crystallized from ammonium sulfate in which the two variable domains formed a protrusion. The structure attained in the distilled water crystals is similar to, but not identical with, the one observed for the Mcg light-chain dimer in crystals grown from ammonium sulfate. Thus, two strikingly different structures were attained by this multisubunit protein in crystals grown under two different, commonly used, crystallization techniques. The quaternary interactions exhibited by the protein in the two crystal forms are sufficiently different to suggest fundamentally different interpretations of the structural basis for the function of this protein. This observation may have general implications regarding the use of single crystallographic determinations for detailed identification of structural and functional relationships. On the other hand, proteins whose structures can be altered by manipulation of crystallization conditions may provide useful systems for study of fundamental structural chemistry

  2. Stephen Neidle on cancer therapy and G-quadruplex inhibitors. Interview by Joanna De Souza.

    Science.gov (United States)

    Neidle, Stephen

    2004-09-15

    Stephen Neidle was educated at Imperial College, London, where he graduated in chemistry and then proceeded to do a PhD in crystallography. After a period as an ICI Fellow, he joined the Biophysics Department at King's College, which ignited his interest in nucleic acid structural studies. He was appointed as one of the first Cancer Research Campaign Career Development Awardees, becoming a Life Fellow on moving to the Institute of Cancer Research. He was appointed to the Chair of Biophysics at the Institute of Cancer Research in 1990, and moved to the new Chair of Chemical Biology at the School of Pharmacy in the University of London in 2002, where he also directs the Cancer Research UK Biomolecular Structure Group. He is currently Chairman of the Chemical Biology Forum of the Royal Society of Chemistry, which is involved in developing the interface between chemistry and the life sciences. He will shortly assume the Directorship of the newly-established Centre for Cancer Medicines at the School. Stephen Neidle has received several awards for his work on drug-nucleic acid recognition and drug design, including the 2000 prize of the Biological and Medicinal Chemistry Sector of the Royal Society of Chemistry, and its 2002 Interdisciplinary Award. He was the 2004 Paul Ehrlich Lecturer of the French Societé de Chimie Therapeutique, and was recently awarded the 2004 Aventis Prize in Medicinal Chemistry.

  3. Structural insight into the rearrangement of the switch I region in GTP-bound G12A K-Ras

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Shenyuan; Long, Brian N.; Boris, Gabriel H.; Chen, Anqi; Ni, Shuisong; Kennedy, Michael A.

    2017-11-10

    K-Ras, a molecular switch that regulates cell growth, apoptosis and metabolism, is activated when it undergoes a conformation change upon binding GTP and is deactivated following the hydrolysis of GTP to GDP. Hydrolysis of GTP in water is accelerated by coordination to K-Ras, where GTP adopts a high-energy conformation approaching the transition state. The G12A mutation reduces intrinsic K-Ras GTP hydrolysis by an unexplained mechanism. Here, crystal structures of G12A K-Ras in complex with GDP, GTP, GTPγS and GppNHp, and of Q61A K-Ras in complex with GDP, are reported. In the G12A K-Ras–GTP complex, the switch I region undergoes a significant reorganization such that the Tyr32 side chain points towards the GTP-binding pocket and forms a hydrogen bond to the GTP γ-phosphate, effectively stabilizing GTP in its precatalytic state, increasing the activation energy required to reach the transition state and contributing to the reduced intrinsic GTPase activity of G12A K-Ras mutants.

  4. New forms of inequality and structures of glam-capitalism

    OpenAIRE

    IVANOV DMITRY

    2016-01-01

    The long history of capitalism can be interpreted as an evolution driven by permanently mutating socioeconomic structures. The article is devoted to new forms of inequality that emerged during the postindustrial phase of the capitalism evolution and increase the structural complexity of contemporary societies. The spatial configuration of inequality transforms while globalization has resulted not in the ‘world society’ but rather in a transnational network of the globality enclaves: the large...

  5. Decision structures in franchise systems of the plural form

    OpenAIRE

    Kranz, Sebastian; Lewin-Solomons, Shira B.

    2008-01-01

    Many successful franchise chains directly own a positive fraction of stores --- a structure referred to as plural form. We propose that this ownership structure is chosen as a commitment not to expropriate franchisees. The theoretical model is based on an empirical analysis of contract and interview data from the US fast-food sector and well known stylized facts: First, franchisees typically have strong contractual obligations to implement activities selected by the chain. Second, franchisees...

  6. Circular Dichroism of G-Quadruplex: A Laboratory Experiment for the Study of Topology and Ligand Binding

    Science.gov (United States)

    Carvalho, Josue´; Queiroz, João A.; Cruz, Carla

    2017-01-01

    Circular dichroism (CD) has emerged as one of the standard biophysical techniques for the study of guaninequadruplex (G4) folding, cation effect, and ligand binding. The utility of this technique is based on its robustness, ease of use, and requirement of only small quantities of nucleic acid. This experiment is also extendable to the classroom…

  7. G-protein-coupled receptor structures were not built in a day.

    Science.gov (United States)

    Blois, Tracy M; Bowie, James U

    2009-07-01

    Among the most exciting recent developments in structural biology is the structure determination of G-protein-coupled receptors (GPCRs), which comprise the largest class of membrane proteins in mammalian cells and have enormous importance for disease and drug development. The GPCR structures are perhaps the most visible examples of a nascent revolution in membrane protein structure determination. Like other major milestones in science, however, such as the sequencing of the human genome, these achievements were built on a hidden foundation of technological developments. Here, we describe some of the methods that are fueling the membrane protein structure revolution and have enabled the determination of the current GPCR structures, along with new techniques that may lead to future structures.

  8. Crystal Structure of the Oligomeric Form of Lassa Virus Matrix Protein Z.

    Science.gov (United States)

    Hastie, Kathryn M; Zandonatti, Michelle; Liu, Tong; Li, Sheng; Woods, Virgil L; Saphire, Erica Ollmann

    2016-05-01

    The arenavirus matrix protein Z is highly multifunctional and occurs in both monomeric and oligomeric forms. The crystal structure of a dodecamer of Z from Lassa virus, presented here, illustrates a ring-like structure with a highly basic center. Mutagenesis demonstrates that the dimeric interface within the dodecamer and a Lys-Trp-Lys triad at the center of the ring are important for oligomerization. This structure provides an additional template to explore the many functions of Z. The arenavirus Lassa virus causes hundreds of thousands of infections each year, many of which develop into fatal hemorrhagic fever. The arenavirus matrix protein Z is multifunctional, with at least four distinct roles. Z exists in both monomeric and oligomeric forms, each of which likely serves a specific function in the viral life cycle. Here we present the dodecameric form of Lassa virus Z and demonstrate that Z forms a "wreath" with a highly basic center. This structure and that of monomeric Z now provide a pair of critical templates by which the multiple roles of Z in the viral life cycle may be interpreted. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  9. Ring and Volcano Structures Formed by a Metal Dipyrromethene Complex

    Energy Technology Data Exchange (ETDEWEB)

    Son, Seung Bae; Hahn, Jae Ryang [Chonbuk National Univ., Jeonju (Korea, Republic of); Miao, Qing; Shin, Jiyoung; Dolphin, David [Univ. of British Columbia, Columbia (Canada)

    2014-06-15

    Dichloromethane liquid droplets containing a cobalt dipyrromethene trimer deposited on a graphite surface were found to form coffee ring, toroid ring, or volcano dot structures due to the redistribution of the solute during solvent evaporation. The shapes and size distributions of the ring structures depended on the drying temperature. The shape differences were attributed to the fact that the solvent evaporation rate controlled the self-assembly process that yielded the coffee stain and pinhole structures.

  10. Catalyst support structure, catalyst including the structure, reactor including a catalyst, and methods of forming same

    Science.gov (United States)

    Van Norman, Staci A.; Aston, Victoria J.; Weimer, Alan W.

    2017-05-09

    Structures, catalysts, and reactors suitable for use for a variety of applications, including gas-to-liquid and coal-to-liquid processes and methods of forming the structures, catalysts, and reactors are disclosed. The catalyst material can be deposited onto an inner wall of a microtubular reactor and/or onto porous tungsten support structures using atomic layer deposition techniques.

  11. 77 FR 12071 - Agency Information Collection Activities: Form G-28, Revision of a Currently Approved Information...

    Science.gov (United States)

    2012-02-28

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... as Attorney or Accredited Representative. The Department of Homeland Security, U.S. Citizenship and...: Form G-28. U.S. Citizenship and Immigration Services. (4) Affected public who will be asked or required...

  12. Substrate-Induced Allosteric Change in the Quaternary Structure of the Spermidine N-Acetyltransferase SpeG

    OpenAIRE

    Filippova, Ekaterina V.; Weigand, Steven; Osipiuk, Jerzy; Kiryukhina, Olga; Joachimiak, Andrzej; Anderson, Wayne F.

    2015-01-01

    The spermidine N-acetyltransferase SpeG is a dodecameric enzyme that catalyzes the transfer of an acetyl group from acetyl-coenzyme A to polyamines such as spermidine and spermine. SpeG has an allosteric polyamine-binding site and acetylating polyamines regulates their intracellular concentrations. The structures of SpeG from Vibrio cholerae in complexes with polyamines and cofactor have been characterized earlier. Here, we present the dodecameric structure of SpeG from V. cholerae in a ligan...

  13. Structural origin of fractional Stokes-Einstein relation in glass-forming liquids.

    Science.gov (United States)

    Pan, Shaopeng; Wu, Z W; Wang, W H; Li, M Z; Xu, Limei

    2017-01-06

    In many glass-forming liquids, fractional Stokes-Einstein relation (SER) is observed above the glass transition temperature. However, the origin of such phenomenon remains elusive. Using molecular dynamics simulations, we investigate the break- down of SER and the onset of fractional SER in a model of metallic glass-forming liquid. We find that SER breaks down when the size of the largest cluster consisting of trapped atoms starts to increase sharply at which the largest cluster spans half of the simulations box along one direction, and the fractional SER starts to follows when the largest cluster percolates the entire system and forms 3-dimentional network structures. Further analysis based on the percolation theory also confirms that percolation occurs at the onset of the fractional SER. Our results directly link the breakdown of the SER with structure inhomogeneity and onset of the fraction SER with percolation of largest clusters, thus provide a possible picture for the break- down of SER and onset of fractional SER in glass-forming liquids, which is is important for the understanding of the dynamic properties in glass-forming liquids.

  14. G+C content dominates intrinsic nucleosome occupancy

    Directory of Open Access Journals (Sweden)

    Hughes Timothy R

    2009-12-01

    Full Text Available Abstract Background The relative preference of nucleosomes to form on individual DNA sequences plays a major role in genome packaging. A wide variety of DNA sequence features are believed to influence nucleosome formation, including periodic dinucleotide signals, poly-A stretches and other short motifs, and sequence properties that influence DNA structure, including base content. It was recently shown by Kaplan et al. that a probabilistic model using composition of all 5-mers within a nucleosome-sized tiling window accurately predicts intrinsic nucleosome occupancy across an entire genome in vitro. However, the model is complicated, and it is not clear which specific DNA sequence properties are most important for intrinsic nucleosome-forming preferences. Results We find that a simple linear combination of only 14 simple DNA sequence attributes (G+C content, two transformations of dinucleotide composition, and the frequency of eleven 4-bp sequences explains nucleosome occupancy in vitro and in vivo in a manner comparable to the Kaplan model. G+C content and frequency of AAAA are the most important features. G+C content is dominant, alone explaining ~50% of the variation in nucleosome occupancy in vitro. Conclusions Our findings provide a dramatically simplified means to predict and understand intrinsic nucleosome occupancy. G+C content may dominate because it both reduces frequency of poly-A-like stretches and correlates with many other DNA structural characteristics. Since G+C content is enriched or depleted at many types of features in diverse eukaryotic genomes, our results suggest that variation in nucleotide composition may have a widespread and direct influence on chromatin structure.

  15. A Flexible Frame Structure for 5G Wide Area

    DEFF Research Database (Denmark)

    Pedersen, Klaus I.; Frederiksen, Frank; Berardinelli, Gilberto

    2015-01-01

    In this paper we present a 5G frame structure designed for efficient support of users with highly diverse service requirements, including mobile broadband (MBB) data, mission critical communication (MCC), and massive machine communication (MMC). The proposed solution encompasses flexible multiple...... transmission, as well as efficient time-frequency inter-cell interference coordination. Numerical results are presented, including simple comparison against LTE....

  16. Research Status on Reinforcement Connection Form of Precast Concrete Shear Wall Structure

    Science.gov (United States)

    Zhang, Zhuangnan; Zhang, Yan

    2018-03-01

    With the rapid development of Chinese economy and the speeding up the process of urbanization, housing industrialization has been paid more and more attention. And the fabricated structure has been widely used in China. The key of precast concrete shear wall structure is the connection of precast components. The reinforcement connection can directly affect the entirety performance and seismic behavior of the structure. Different reinforcement connections have a great impact on the overall behavior of the structure. By studying the characteristics of the reinforcement connection forms used in the vertical connection and horizontal connection of precast concrete shear wall, it can provide reference for the research and development of the reinforcement connection forms in the future.

  17. The G2 spinorial geometry of supersymmetric IIB backgrounds

    International Nuclear Information System (INIS)

    Gran, U; Gutowski, J; Papadopoulos, G

    2006-01-01

    We solve the Killing spinor equations of supersymmetric IIB backgrounds which admit one supersymmetry and the Killing spinor has stability subgroup G 2 in Spin(9, 1) x U(1). We find that such backgrounds admit a timelike Killing vector field and the geometric structure of the spacetime reduces from Spin(9, 1) x U(1) to G 2 . We determine the type of G 2 structure that the spacetime admits by computing the covariant derivatives of the spacetime forms associated with the Killing spinor bilinears. We also solve the Killing spinor equations of backgrounds with two supersymmetries and Spin(7) x R 8 -invariant spinors, and four supersymmetries with SU(4) x R 8 - and with G 2 -invariant spinors. We show that the Killing spinor equations factorize in two sets, one involving the geometry and the 5-form flux, and the other the 3-form flux and the scalars. In the Spin(7) x R 8 and SU(4) x R 8 cases, the spacetime admits a parallel null vector field and so the spacetime metric can be locally described in terms of Penrose coordinates adapted to the associated rotation free, null, geodesic congruence. The transverse space of the congruence is a Spin(7) and a SU(4) holonomy manifold, respectively. In the G 2 case, all the fluxes vanish and the spacetime is the product of a three-dimensional Minkowski space with a holonomy G 2 manifold

  18. The crystal structure of Giardia duodenalis 14-3-3 in the apo form: when protein post-translational modifications make the difference.

    KAUST Repository

    Fiorillo, Annarita

    2014-03-21

    The 14-3-3s are a family of dimeric evolutionary conserved pSer/pThr binding proteins that play a key role in multiple biological processes by interacting with a plethora of client proteins. Giardia duodenalis is a flagellated protozoan that affects millions of people worldwide causing an acute and chronic diarrheal disease. The single giardial 14-3-3 isoform (g14-3-3), unique in the 14-3-3 family, needs the constitutive phosphorylation of Thr214 and the polyglycylation of its C-terminus to be fully functional in vivo. Alteration of the phosphorylation and polyglycylation status affects the parasite differentiation into the cyst stage. To further investigate the role of these post-translational modifications, the crystal structure of the g14-3-3 was solved in the unmodified apo form. Oligomers of g14-3-3 were observed due to domain swapping events at the protein C-terminus. The formation of filaments was supported by TEM. Mutational analysis, in combination with native PAGE and chemical cross-linking, proved that polyglycylation prevents oligomerization. In silico phosphorylation and molecular dynamics simulations supported a structural role for the phosphorylation of Thr214 in promoting target binding. Our findings highlight unique structural features of g14-3-3 opening novel perspectives on the evolutionary history of this protein family and envisaging the possibility to develop anti-giardial drugs targeting g14-3-3.

  19. The crystal structure of Giardia duodenalis 14-3-3 in the apo form: when protein post-translational modifications make the difference.

    Directory of Open Access Journals (Sweden)

    Annarita Fiorillo

    Full Text Available The 14-3-3s are a family of dimeric evolutionary conserved pSer/pThr binding proteins that play a key role in multiple biological processes by interacting with a plethora of client proteins. Giardia duodenalis is a flagellated protozoan that affects millions of people worldwide causing an acute and chronic diarrheal disease. The single giardial 14-3-3 isoform (g14-3-3, unique in the 14-3-3 family, needs the constitutive phosphorylation of Thr214 and the polyglycylation of its C-terminus to be fully functional in vivo. Alteration of the phosphorylation and polyglycylation status affects the parasite differentiation into the cyst stage. To further investigate the role of these post-translational modifications, the crystal structure of the g14-3-3 was solved in the unmodified apo form. Oligomers of g14-3-3 were observed due to domain swapping events at the protein C-terminus. The formation of filaments was supported by TEM. Mutational analysis, in combination with native PAGE and chemical cross-linking, proved that polyglycylation prevents oligomerization. In silico phosphorylation and molecular dynamics simulations supported a structural role for the phosphorylation of Thr214 in promoting target binding. Our findings highlight unique structural features of g14-3-3 opening novel perspectives on the evolutionary history of this protein family and envisaging the possibility to develop anti-giardial drugs targeting g14-3-3.

  20. The crystal structure of Giardia duodenalis 14-3-3 in the apo form: when protein post-translational modifications make the difference.

    KAUST Repository

    Fiorillo, Annarita; di Marino, Daniele; Bertuccini, Lucia; Via, Allegra; Pozio, Edoardo; Camerini, Serena; Ilari, Andrea; Lalle, Marco

    2014-01-01

    The 14-3-3s are a family of dimeric evolutionary conserved pSer/pThr binding proteins that play a key role in multiple biological processes by interacting with a plethora of client proteins. Giardia duodenalis is a flagellated protozoan that affects millions of people worldwide causing an acute and chronic diarrheal disease. The single giardial 14-3-3 isoform (g14-3-3), unique in the 14-3-3 family, needs the constitutive phosphorylation of Thr214 and the polyglycylation of its C-terminus to be fully functional in vivo. Alteration of the phosphorylation and polyglycylation status affects the parasite differentiation into the cyst stage. To further investigate the role of these post-translational modifications, the crystal structure of the g14-3-3 was solved in the unmodified apo form. Oligomers of g14-3-3 were observed due to domain swapping events at the protein C-terminus. The formation of filaments was supported by TEM. Mutational analysis, in combination with native PAGE and chemical cross-linking, proved that polyglycylation prevents oligomerization. In silico phosphorylation and molecular dynamics simulations supported a structural role for the phosphorylation of Thr214 in promoting target binding. Our findings highlight unique structural features of g14-3-3 opening novel perspectives on the evolutionary history of this protein family and envisaging the possibility to develop anti-giardial drugs targeting g14-3-3.

  1. The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution.

    OpenAIRE

    Czworkowski, J; Wang, J; Steitz, T A; Moore, P B

    1994-01-01

    Elongation factor G (EF-G) catalyzes the translocation step of protein synthesis in bacteria, and like the other bacterial elongation factor, EF-Tu--whose structure is already known--it is a member of the GTPase superfamily. We have determined the crystal structure of EF-G--GDP from Thermus thermophilus. It is an elongated molecule whose large, N-terminal domain resembles the G domain of EF-Tu, except for a 90 residue insert, which covers a surface that is involved in nucleotide exchange in E...

  2. Heterogeneous Seeding of a Prion Structure by a Generic Amyloid Form of the Fungal Prion-forming Domain HET-s(218-289)

    Energy Technology Data Exchange (ETDEWEB)

    Wan, William; Bian, Wen; McDonald, Michele; Kijac, Aleksandra; Wemmer, David E.; Stubbs, Gerald [UCB; (Vanderbilt); (LBNL)

    2013-11-13

    The fungal prion-forming domain HET-s(218–289) forms infectious amyloid fibrils at physiological pH that were shown by solid-state NMR to be assemblies of a two-rung β-solenoid structure. Under acidic conditions, HET-s(218–289) has been shown to form amyloid fibrils that have very low infectivity in vivo, but structural information about these fibrils has been very limited. We show by x-ray fiber diffraction that the HET-s(218–289) fibrils formed under acidic conditions have a stacked β-sheet architecture commonly found in short amyloidogenic peptides and denatured protein aggregates. At physiological pH, stacked β-sheet fibrils nucleate the formation of the infectious β-solenoid prions in a process of heterogeneous seeding, but do so with kinetic profiles distinct from those of spontaneous or homogeneous (seeded with infectious β-solenoid fibrils) fibrillization. Several serial passages of stacked β-sheet-seeded solutions lead to fibrillization kinetics similar to homogeneously seeded solutions. Our results directly show that structural mutation can occur between substantially different amyloid architectures, lending credence to the suggestion that the processes of strain adaptation and crossing species barriers are facilitated by structural mutation.

  3. Characterization of the oligosaccharide structure of human glycosylated prolactin (G-hPRL) native and recombinant; Caracterizacao da estrutura oligossacaridica de prolactina glicosilada humana (G-hPRL) nativa e recombinante

    Energy Technology Data Exchange (ETDEWEB)

    Marcos Vinicius Nucci Capone

    2013-07-01

    Human prolactin (hPRL) is a polypeptide hormone secreted by the anterior pituitary under the regulation of the hypothalamus, involved in a variety of biological processes such as mammary gland development and lactation. The recombinant product is important in medical diagnosis and treatment of failure of lactation. This hormone may occur in the form of non-glycosylated protein (NGhPRL) and glycosylated (G-hPRL) with molecular weights of approximately 23 and 25 kilodalton (kDa), respectively; has a single N-glycosylation site located at asparagine (Asn) position 31, which is partially occupied, thus being a particularly interesting model of glycosylation. The biological activity of G-hPRL is lower compared to NG-hPRL (~4 times) and its physiological function is not well defined: the portion of carbohydrate appears to have an important role in the hormone biosynthesis, secretion, biological activity, and plasma survival of the hormone. The main objective of this study was to compare the structures of N-glycans present in glycosylated pituitary prolactin (G-hPRL-NHPP) with those present in the recombinant. To obtain the recombinant G-hPRL the production was performed in laboratory scale from Chinese hamster ovary cells (CHO), genetically modified and adapted to growth in suspension. Cycloheximide (CHX), whose main effect was to increase the ratio G-hPRL/NG-hPRL from 5% to 38% was added to the culture medium, thereby facilitating the purification of G-hPRL. The G-hPRL was purified in two steps, a cation exchanger followed by a purification by reversed-phase high performance liquid chromatography (RP-HPLC) which demonstrated the efficient separation of the two isoforms of hPRL. Recombinant G-hPRL-IPEN was well characterized by several techniques confirming its purity and biological activity, including comparisons with other reference preparation of pituitary origin purchased from the {sup N}ational Hormone & Peptide Program (NHPPU. S.){sup .} The composition of N

  4. When Heterotrimeric G Proteins Are Not Activated by G Protein-Coupled Receptors: Structural Insights and Evolutionary Conservation.

    Science.gov (United States)

    DiGiacomo, Vincent; Marivin, Arthur; Garcia-Marcos, Mikel

    2018-01-23

    Heterotrimeric G proteins are signal-transducing switches conserved across eukaryotes. In humans, they work as critical mediators of intercellular communication in the context of virtually any physiological process. While G protein regulation by G protein-coupled receptors (GPCRs) is well-established and has received much attention, it has become recently evident that heterotrimeric G proteins can also be activated by cytoplasmic proteins. However, this alternative mechanism of G protein regulation remains far less studied than GPCR-mediated signaling. This Viewpoint focuses on recent advances in the characterization of a group of nonreceptor proteins that contain a sequence dubbed the "Gα-binding and -activating (GBA) motif". So far, four proteins present in mammals [GIV (also known as Girdin), DAPLE, CALNUC, and NUCB2] and one protein in Caenorhabditis elegans (GBAS-1) have been described as possessing a functional GBA motif. The GBA motif confers guanine nucleotide exchange factor activity on Gαi subunits in vitro and activates G protein signaling in cells. The importance of this mechanism of signal transduction is highlighted by the fact that its dysregulation underlies human diseases, such as cancer, which has made the proteins attractive new candidates for therapeutic intervention. Here we discuss recent discoveries on the structural basis of GBA-mediated activation of G proteins and its evolutionary conservation and compare them with the better-studied mechanism mediated by GPCRs.

  5. Structures composing protein domains.

    Science.gov (United States)

    Kubrycht, Jaroslav; Sigler, Karel; Souček, Pavel; Hudeček, Jiří

    2013-08-01

    This review summarizes available data concerning intradomain structures (IS) such as functionally important amino acid residues, short linear motifs, conserved or disordered regions, peptide repeats, broadly occurring secondary structures or folds, etc. IS form structural features (units or elements) necessary for interactions with proteins or non-peptidic ligands, enzyme reactions and some structural properties of proteins. These features have often been related to a single structural level (e.g. primary structure) mostly requiring certain structural context of other levels (e.g. secondary structures or supersecondary folds) as follows also from some examples reported or demonstrated here. In addition, we deal with some functionally important dynamic properties of IS (e.g. flexibility and different forms of accessibility), and more special dynamic changes of IS during enzyme reactions and allosteric regulation. Selected notes concern also some experimental methods, still more necessary tools of bioinformatic processing and clinically interesting relationships. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  6. Delivery, Effect on Cell Viability, and Plasticity of Modified Aptamer Constructs

    DEFF Research Database (Denmark)

    Gissberg, Olof; Zaghloul, Eman M; Lundin, Karin E

    2016-01-01

    AS1411 is a g-quadruplex-forming aptamer capable of selectively entering cancer cells by nucleolin receptor-mediated uptake. In this study, we investigated the cell internalization properties and plasticity of AS1411 carrying different locked nucleic acid-containing cargo oligonucleotides (ONs......) for delivery into A549 and U2OS cells. We found that internalization efficiency is highly governed by ON cargo chemistry and composition since the inherent antitumor properties of AS1411 were lost when attached to a nontoxic ON, noTox. However, a toxic ON, Tox, demonstrated potent cytotoxicity after aptamer...

  7. Crystal Structure of a Lipid G Protein-Coupled Receptor

    Energy Technology Data Exchange (ETDEWEB)

    Hanson, Michael A; Roth, Christopher B; Jo, Euijung; Griffith, Mark T; Scott, Fiona L; Reinhart, Greg; Desale, Hans; Clemons, Bryan; Cahalan, Stuart M; Schuerer, Stephan C; Sanna, M Germana; Han, Gye Won; Kuhn, Peter; Rosen, Hugh; Stevens, Raymond C [Scripps; (Receptos)

    2012-03-01

    The lyso-phospholipid sphingosine 1-phosphate modulates lymphocyte trafficking, endothelial development and integrity, heart rate, and vascular tone and maturation by activating G protein-coupled sphingosine 1-phosphate receptors. Here, we present the crystal structure of the sphingosine 1-phosphate receptor 1 fused to T4-lysozyme (S1P1-T4L) in complex with an antagonist sphingolipid mimic. Extracellular access to the binding pocket is occluded by the amino terminus and extracellular loops of the receptor. Access is gained by ligands entering laterally between helices I and VII within the transmembrane region of the receptor. This structure, along with mutagenesis, agonist structure-activity relationship data, and modeling, provides a detailed view of the molecular recognition and requirement for hydrophobic volume that activates S1P1, resulting in the modulation of immune and stromal cell responses.

  8. A Molecular Dynamics Study on RAGE-Aβ42 Interaction and the Influence of G82S RAGE Polymorphism on Aβ Interaction

    Directory of Open Access Journals (Sweden)

    Sreeram Krishnan

    2015-12-01

    Full Text Available Interaction of amyloid peptides (Aβ with receptor for advanced glycation end products (RAGE elicits an inflammatory response and augments Alzheimer's disease (AD pathology. The present study was aimed to analyse the interactions of different forms of Aβ42 peptide with ligand binding domain of normal and G82S RAGE and their possible consequences in AD pathology. The structures of RAGE ectodomain (3CJJ, monomeric forms of Aβ42 - 1IYT (apolar and 1Z0Q (polar and fibrillar (2BEG were obtained from PDB. The structure of G82 and S82 RAGE was generated using SWISS MODEL. SIFT and PolyPhen analysis was performed to predict the phenotypic and functional effect of the amino acid substitution. The G82 and S82 variant structures were simulated in GROMACS and the 10 lowest energy structures were docked with different forms of Aβ42 using CLUSPRO in antibody mode. The lowest energy docked structure was further simulated for 5 ns. The structures corresponding to 0-5 ns were taken and the amino acid interactions were generated using PDBSUM. SIFT analysis indicated that G82S SNP had a tolerating effect on the structure of protein but polyphen predicted a probable damaging effect. Highest binding score was obtained with 2BEG docked with both G82 RAGE (-375.84 ± 7.425 Kcal/mol and G82S variant (-391.09 ± 13.391 Kcal/mol indicating that the fibrillar form showed better interaction. Compared to G82 RAGE, the S82 variant showed better interaction to all three forms of Aβ42. The results of study indicate that RAGE interacted better with fibrillar form of Aβ42 peptide and G82S mutation enhanced the binding affinity of RAGE towards amyloid peptides leading to enhanced inflammatory response.

  9. Environmental effects on the structure of the G-matrix.

    Science.gov (United States)

    Wood, Corlett W; Brodie, Edmund D

    2015-11-01

    Genetic correlations between traits determine the multivariate response to selection in the short term, and thereby play a causal role in evolutionary change. Although individual studies have documented environmentally induced changes in genetic correlations, the nature and extent of environmental effects on multivariate genetic architecture across species and environments remain largely uncharacterized. We reviewed the literature for estimates of the genetic variance-covariance (G) matrix in multiple environments, and compared differences in G between environments to the divergence in G between conspecific populations (measured in a common garden). We found that the predicted evolutionary trajectory differed as strongly between environments as it did between populations. Between-environment differences in the underlying structure of G (total genetic variance and the relative magnitude and orientation of genetic correlations) were equal to or greater than between-population differences. Neither environmental novelty, nor the difference in mean phenotype predicted these differences in G. Our results suggest that environmental effects on multivariate genetic architecture may be comparable to the divergence that accumulates over dozens or hundreds of generations between populations. We outline avenues of future research to address the limitations of existing data and characterize the extent to which lability in genetic correlations shapes evolution in changing environments. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

  10. Structural and reduced-form modeling and forecasting with application to Armenia

    NARCIS (Netherlands)

    Poghosyan, K.

    2012-01-01

    The thesis deals with structural and reduced-form modeling and forecasting of key macroeconomic variables (real growth of GDP, inflation, exchange rate, and policy interest rate). The central part of the thesis (Chapters 2-4) consists of three chapters. Chapter 2 considers the structural DSGE model

  11. Structural optimization and structure-functional selectivity relationship studies of G protein-biased EP2 receptor agonists.

    Science.gov (United States)

    Ogawa, Seiji; Watanabe, Toshihide; Moriyuki, Kazumi; Goto, Yoshikazu; Yamane, Shinsaku; Watanabe, Akio; Tsuboi, Kazuma; Kinoshita, Atsushi; Okada, Takuya; Takeda, Hiroyuki; Tani, Kousuke; Maruyama, Toru

    2016-05-15

    The modification of the novel G protein-biased EP2 agonist 1 has been investigated to improve its G protein activity and develop a better understanding of its structure-functional selectivity relationship (SFSR). The optimization of the substituents on the phenyl ring of 1, followed by the inversion of the hydroxyl group on the cyclopentane moiety led to compound 9, which showed a 100-fold increase in its G protein activity compared with 1 without any increase in β-arrestin recruitment. Furthermore, SFSR studies revealed that the combination of meta and para substituents on the phenyl moiety was crucial to the functional selectivity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Production, structural characterization and gel forming property of a new exopolysaccharide produced by Agrobacterium HX1126 using glycerol or d-mannitol as substrate.

    Science.gov (United States)

    Liu, Yongmei; Gu, Qiuya; Ofosu, Fred Kwame; Yu, Xiaobin

    2016-01-20

    A strain Agrobacterium HX1126 was isolated from soil sample near the canal in Wuxi. Glycerol was used as carbon source for the production of a new exopolysaccharide which was named PGHX. PGHX composed mainly of galactose, with lower amounts of arabinose and aminogalactose. It was found that this strain could use d-mannitol as carbon source to produce PGHX too. A method for the preparation of crude PGHX was proposed and the crude PGHX can be formed in a gel formation when 30 g/L was put into the boiling water for 10 min, with an achieved gel strength of 957 g/cm(2). The concentration of proteins in the crude product was considered to be an important parameter which directly influence the gel forming property. The highest production of PGHX (24.9 g/L) was obtained under the nitrogen depletion condition. The structure of the product was confirmed by NMR and FTIR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Structure of Complex Verb Forms in Meiteilon

    Directory of Open Access Journals (Sweden)

    Lourembam Surjit Singh

    2016-12-01

    Full Text Available This piece of work proposes to descriptively investigate the structures of complex verbs in Meiteilon. The categorization of such verbs is based on the nature of semantic and syntactic functions of a lexeme or verbal lexeme. A lexeme or verbal lexeme in Meiteilon may have multifunctional properties in the nature of occurrence. Such lexical items can be co-occurred together in a phrase as single functional word. Specifically, in the co-occurrences of two lexical items, the first component of lexical items has different semantic and syntactic functions in comparison to semantic and syntactic functions of the second component of lexical items. Such co-occurrences of two lexical items are the forms of complex verb that are covered with the term complex predicate in this work. The investigation in constructing complex predicate is thoroughly presenting in this work. Keywords: Structures, complex verb, conjunct verb, compound verb, complex predicate

  14. Top-down holographic G-structure glueball spectroscopy at (N)LO in N and finite coupling

    Energy Technology Data Exchange (ETDEWEB)

    Sil, Karunava; Yadav, Vikas; Misra, Aalok [Indian Institute of Technology, Department of Physics, Roorkee, Uttaranchal (India)

    2017-06-15

    The top-down type IIB holographic dual of large-N thermal QCD as constructed in Mia et al. (Nucl Phys B 839:187, 2010) involving a fluxed resolved warped deformed conifold, its delocalized type IIA Strominger-Yau-Zaslow-mirror (SYZ-mirror) as well as its M-theory uplift constructed in Dhuria and Misra (JHEP 1311:001, 2013) - both in the finite coupling g{sub s} G{sub 2}-structure in Sil and Misra (Nucl Phys B 910:754, 2016). Glueballs spectra in the finite-gauge-coupling limit (and not just large 't Hooft coupling limit) - a limit expected to be directly relevant to strongly coupled systems at finite temperature such as QGP (Natsuume in String theory and quark-gluon plasma, 2007) - has thus far been missing in the literature. In this paper, we fill this gap by calculating the masses of the 0{sup ++}, 0{sup -+}, 0{sup --}, 1{sup ++}, 2{sup ++} ('glueball') states (which correspond to fluctuations in the dilaton or complexified two-forms or appropriate metric components) in the aforementioned backgrounds of G-structure in the 'MQGP' limit of Dhuria and Misra (JHEP 1311:001, 2013). We use WKB quantization conditions on one hand and impose Neumann/Dirichlet boundary conditions at an IR cut-off ('r{sub 0}')/horizon radius ('r{sub h}') on the solutions to the equations of motion on the other hand. We find that the former technique produces results closer to the lattice results. We also discuss the r{sub h} = 0 limits of all calculations. In this context we also calculate the 0{sup ++}, 0{sup --}, 1{sup ++}, 2{sup ++} glueball masses up to Next to Leading Order (NLO) in N and find a (g{sub s}M{sup 2})/(N)(g{sub s}N{sub f})-suppression similar to and further validating semi-universality of NLO corrections to transport coefficients, observed in Sil and Misra (Eur Phys J C 76(11):618, 2016). (orig.)

  15. G{sub 2}-structures and quantization of non-geometric M-theory backgrounds

    Energy Technology Data Exchange (ETDEWEB)

    Kupriyanov, Vladislav G. [Centro de Matemática, Computação e Cognição, Universidade de Federal do ABC,Santo André, SP (Brazil); Tomsk State University,Tomsk (Russian Federation); Szabo, Richard J. [Department of Mathematics, Heriot-Watt University,Colin Maclaurin Building, Riccarton, Edinburgh EH14 4AS (United Kingdom); Maxwell Institute for Mathematical Sciences,Edinburgh (United Kingdom); The Higgs Centre for Theoretical Physics,Edinburgh (United Kingdom)

    2017-02-20

    We describe the quantization of a four-dimensional locally non-geometric M-theory background dual to a twisted three-torus by deriving a phase space star product for deformation quantization of quasi-Poisson brackets related to the nonassociative algebra of octonions. The construction is based on a choice of G{sub 2}-structure which defines a nonassociative deformation of the addition law on the seven-dimensional vector space of Fourier momenta. We demonstrate explicitly that this star product reduces to that of the three-dimensional parabolic constant R-flux model in the contraction of M-theory to string theory, and use it to derive quantum phase space uncertainty relations as well as triproducts for the nonassociative geometry of the four-dimensional configuration space. By extending the G{sub 2}-structure to a Spin(7)-structure, we propose a 3-algebra structure on the full eight-dimensional M2-brane phase space which reduces to the quasi-Poisson algebra after imposing a particular gauge constraint, and whose deformation quantisation simultaneously encompasses both the phase space star products and the configuration space triproducts. We demonstrate how these structures naturally fit in with previous occurences of 3-algebras in M-theory.

  16. Extended Gamma-Ray Emission from the G25.0+0.0 Region: A Star-forming Region Powered by the Newly Found OB Association?

    Energy Technology Data Exchange (ETDEWEB)

    Katsuta, J. [Department of Physical Sciences, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Uchiyama, Y. [Rikkyo University, Nishi-Ikebukuro, Toshima-ku, Tokyo 171-8501 (Japan); Funk, S., E-mail: katsuta@hep01.hepl.hiroshima-u.ac.jp [Erlangen Centre for Astroparticle Physics, D-91058 Erlangen (Germany)

    2017-04-20

    We report a study of extended γ -ray emission with the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope , which is likely to be the second case of a γ -ray detection from a star-forming region (SFR) in our Galaxy. The LAT source is located in the G25 region, 1.°7 × 2.°1 around ( l , b ) = (25.°0, 0.°0). The γ -ray emission is found to be composed of two extended sources and one pointlike source. The extended sources have similar sizes of about 1.°4 × 0.°6. An ∼0.°4 diameter subregion of one has a photon index of Γ = 1.53 ± 0.15, and is spatially coincident with HESS J1837−069, likely a pulsar wind nebula. The other parts of the extended sources have a photon index of Γ = 2.1 ± 0.2 without significant spectral curvature. Given their spatial and spectral properties, they have no clear associations with sources at other wavelengths. Their γ -ray properties are similar to those of the Cygnus cocoon SFR, the only firmly established γ -ray detection of an SFR in the Galaxy. Indeed, we find bubble-like structures of atomic and molecular gas in G25, which may be created by a putative OB association/cluster. The γ -ray emitting regions appear confined in the bubble-like structure; similar properties are also found in the Cygnus cocoon. In addition, using observations with the XMM-Newton , we find a candidate young massive OB association/cluster G25.18+0.26 in the G25 region. We propose that the extended γ -ray emission in G25 is associated with an SFR driven by G25.18+0.26. Based on this scenario, we discuss possible acceleration processes in the SFR and compare them with the Cygnus cocoon.

  17. Structural study of salt forms of amides; paracetamol, benzamide and piperine

    Science.gov (United States)

    Kennedy, Alan R.; King, Nathan L. C.; Oswald, Iain D. H.; Rollo, David G.; Spiteri, Rebecca; Walls, Aiden

    2018-02-01

    Single crystal x-ray diffraction has been used to investigate the structures of six complexes containing O-atom protonated cations derived from the pharmaceutically relevant amides benzamide (BEN), paracetamol (PAR) and piperine (PIP). The structures of the salt forms [PAR(H)][SO3C6H4Cl], [BEN(H)][O3SC6H4Cl] and [BEN(H)][Br]·H2O are reported along with those of the hemi-halide salt forms [PAR(H)][I3]. PAR, [PIP(H)][I3]·PIP and [PIP(H)][I3]0·5[I]0.5. PIP. The structure of the cocrystal BEN. HOOCCH2Cl is also presented for comparison. The geometry of the amide group is found to systematically change upon protonation, with the Cdbnd O distance increasing and the Csbnd N distance decreasing. The hemi-halide species all feature strongly hydrogen bonded amide(H)/amide pairs. The amide group Cdbnd O and Csbnd N distances for both elements of each such pair are intermediate between those found for simple neutral amide and protonated amide forms. It was found that crystallising paracetamol from aqueous solutions containing Ba2+ ions gave orthorhombic paracetamol.

  18. A Precision Measurement of the Spin Structure Function G(2)(P)

    Energy Technology Data Exchange (ETDEWEB)

    Benmouna, N

    2004-01-05

    The spin structure function g{sub 2}(x,Q{sup 2}) and the virtual photon asymmetry A{sub 2}(x,Q{sup 2}) were measured for the proton using deep inelastic scattering. The experiment was conducted at the Stanford Linear Accelerator Center (SLAC), where longitudinally polarized electrons at 29.1 and 32.3 GeV were scattered from a transversely polarized NH{sub 3} target. Large data sets were accumulated using three independent spectrometers covering a kinematic range 0.02 {le} x {le} 0.8 and 1 {le} Q{sup 2} {le} 20 (GeV/c){sup 2}. This new data is the first data precise enough to distinguish between current models for the proton. The structure function g{sub 2}{sup p} was found to be reasonably consistent with the twist-2 Wandzura-Wilczek calculation. The Q{sup 2} dependence of g{sub 2} approximately follows the Q{sup 2} dependence of g{sub 2}{sup WW}, although the data are not precise enough to rule out no Q{sup 2} dependence. The absolute value for A{sub 2}{sup p} was found to be significantly smaller than the Soffer limit over the measured range. The virtual photon asymmetry A{sub 2} was also found to be inconsistent with zero over much of the measured range.

  19. Exploring the formation and electronic structure properties of the g-C3N4 nanoribbon with density functional theory.

    Science.gov (United States)

    Wu, Hong-Zhang; Zhong, Qing-Hua; Bandaru, Sateesh; Liu, Jin; Lau, Woon Ming; Li, Li-Li; Wang, Zhenling

    2018-04-18

    The optical properties and condensation degree (structure) of polymeric g-C 3 N 4 depend strongly on the process temperature. For polymeric g-C 3 N 4 , its structure and condensation degree depend on the structure of molecular strand(s). Here, the formation and electronic structure properties of the g-C 3 N 4 nanoribbon are investigated by studying the polymerization and crystallinity of molecular strand(s) employing first-principle density functional theory. The calculations show that the width of the molecular strand has a significant effect on the electronic structure of polymerized and crystallized g-C 3 N 4 nanoribbons, a conclusion which would be indirect evidence that the electronic structure depends on the structure of g-C 3 N 4 . The edge shape also has a distinct effect on the electronic structure of the crystallized g-C 3 N 4 nanoribbon. Furthermore, the conductive band minimum and valence band maximum of the polymeric g-C 3 N 4 nanoribbon show a strong localization, which is in good agreement with the quasi-monomer characters. In addition, molecular strands prefer to grow along the planar direction on graphene. These results provide new insight on the properties of the g-C 3 N 4 nanoribbon and the relationship between the structure and properties of g-C 3 N 4 .

  20. Quantitative characterization of the atomic-scale structure of oxyhydroxides in rusts formed on steel surfaces

    International Nuclear Information System (INIS)

    Saito, M.; Suzuki, S.; Kimura, M.; Suzuki, T.; Kihira, H.; Waseda, Y.

    2005-01-01

    Quantitative X-ray structural analysis coupled with anomalous X-ray scattering has been used for characterizing the atomic-scale structure of rust formed on steel surfaces. Samples were prepared from rust layers formed on the surfaces of two commercial steels. X-ray scattered intensity profiles of the two samples showed that the rusts consisted mainly of two types of ferric oxyhydroxide, α-FeOOH and γ-FeOOH. The amounts of these rust components and the realistic atomic arrangements in the components were estimated by fitting both the ordinary and the environmental interference functions with a model structure calculated using the reverse Monte Carlo simulation technique. The two rust components were found to be the network structure formed by FeO 6 octahedral units, the network structure itself deviating from the ideal case. The present results also suggest that the structural analysis method using anomalous X-ray scattering and the reverse Monte Carlo technique is very successful in determining the atomic-scale structure of rusts formed on the steel surfaces

  1. Hyperfine structure in 229gTh3+ as a probe of the 229gTh→ 229mTh nuclear excitation energy.

    Science.gov (United States)

    Beloy, K

    2014-02-14

    We identify a potential means to extract the 229gTh→ 229mTh nuclear excitation energy from precision microwave spectroscopy of the 5F(5/2,7/2) hyperfine manifolds in the ion 229gTh3+. The hyperfine interaction mixes this ground fine structure doublet with states of the nuclear isomer, introducing small but observable shifts to the hyperfine sublevels. We demonstrate how accurate atomic structure calculations may be combined with the measurement of the hyperfine intervals to quantify the effects of this mixing. Further knowledge of the magnetic dipole decay rate of the isomer, as recently reported, allows an indirect determination of the nuclear excitation energy.

  2. Integrable couplings of relativistic Toda lattice systems in polynomial form and rational form, their hierarchies and bi-Hamiltonian structures

    Energy Technology Data Exchange (ETDEWEB)

    Xu Xixiang [College of Science, Shandong University of Science and Technology, Qingdao 266510 (China)], E-mail: xixiang_xu@yahoo.com.cn

    2009-10-02

    Integrable couplings of relativistic Toda lattice systems in polynomial form and rational form, and their hierarchies, are derived from a four-by-four discrete matrix eigenvalue problem. The bi-Hamiltonian structure for every integrable coupling in the two hierarchies obtained is established by means of the discrete variational identity. Ultimately, Liouvolle integrability of the obtained integrable couplings is demonstrated.

  3. G2-structures for N  =  1 supersymmetric AdS4 solutions of M-theory

    Science.gov (United States)

    Grigorian, Sergey

    2018-04-01

    We study the N  =  1 supersymmetric solutions of D  =  11 supergravity obtained as a warped product of four-dimensional anti-de Sitter space with a seven-dimensional Riemannian manifold M. Using the octonion bundle structure on M we reformulate the Killing spinor equations in terms of sections of the octonion bundle on M. The solutions then define a single complexified G 2-structure on M or equivalently two real G 2-structures. We then study the torsion of these G 2-structures and the relationships between them.

  4. Genetic Susceptibility to Cardiac and Digestive Clinical Forms of Chronic Chagas Disease: Involvement of the CCR5 59029 A/G Polymorphism.

    Science.gov (United States)

    de Oliveira, Amanda Priscila; Bernardo, Cássia Rubia; Camargo, Ana Vitória da Silveira; Ronchi, Luiz Sérgio; Borim, Aldenis Albaneze; de Mattos, Cinara Cássia Brandão; de Campos Júnior, Eumildo; Castiglioni, Lílian; Netinho, João Gomes; Cavasini, Carlos Eugênio; Bestetti, Reinaldo Bulgarelli; de Mattos, Luiz Carlos

    2015-01-01

    The clinical manifestations of chronic Chagas disease include the cardiac form of the disease and the digestive form. Not all the factors that act in the variable clinical course of this disease are known. This study investigated whether the CCR5Δ32 (rs333) and CCR5 59029 A/G (promoter region--rs1799987) polymorphisms of the CCR5 gene are associated with different clinical forms of chronic Chagas disease and with the severity of left ventricular systolic dysfunction in patients with chronic Chagas heart disease (CCHD). The antibodies anti-T. cruzi were identified by ELISA. PCR and PCR-RFLP were used to identify the CCR5Δ32 and CCR5 59029 A/G polymorphisms. The chi-square test was used to compare variables between groups. There was a higher frequency of the AA genotype in patients with CCHD compared with patients with the digestive form of the disease and the control group. The results also showed a high frequency of the AG genotype in patients with the digestive form of the disease compared to the other groups. The results of this study show that the CCR5Δ32 polymorphism does not seem to influence the different clinical manifestations of Chagas disease but there is involvement of the CCR5 59029 A/G polymorphism in susceptibility to the different forms of chronic Chagas disease. Besides, these polymorphisms do not influence left ventricular systolic dysfunction in patients with CCHD.

  5. Genetic Susceptibility to Cardiac and Digestive Clinical Forms of Chronic Chagas Disease: Involvement of the CCR5 59029 A/G Polymorphism.

    Directory of Open Access Journals (Sweden)

    Amanda Priscila de Oliveira

    Full Text Available The clinical manifestations of chronic Chagas disease include the cardiac form of the disease and the digestive form. Not all the factors that act in the variable clinical course of this disease are known. This study investigated whether the CCR5Δ32 (rs333 and CCR5 59029 A/G (promoter region--rs1799987 polymorphisms of the CCR5 gene are associated with different clinical forms of chronic Chagas disease and with the severity of left ventricular systolic dysfunction in patients with chronic Chagas heart disease (CCHD. The antibodies anti-T. cruzi were identified by ELISA. PCR and PCR-RFLP were used to identify the CCR5Δ32 and CCR5 59029 A/G polymorphisms. The chi-square test was used to compare variables between groups. There was a higher frequency of the AA genotype in patients with CCHD compared with patients with the digestive form of the disease and the control group. The results also showed a high frequency of the AG genotype in patients with the digestive form of the disease compared to the other groups. The results of this study show that the CCR5Δ32 polymorphism does not seem to influence the different clinical manifestations of Chagas disease but there is involvement of the CCR5 59029 A/G polymorphism in susceptibility to the different forms of chronic Chagas disease. Besides, these polymorphisms do not influence left ventricular systolic dysfunction in patients with CCHD.

  6. Antagonism of immunostimulatory CpG-oligodeoxynucleotides by quinacrine, chloroquine, and structurally related compounds.

    Science.gov (United States)

    Macfarlane, D E; Manzel, L

    1998-02-01

    Phosphorothioate oligodeoxynucleotides containing CpG (CpG-ODN) activate immune responses. We report that quinacrine, chloroquine, and structurally related compounds completely inhibit the antiapoptotic effect of CpG-ODN on WEHI 231 murine B lymphoma cells and inhibit CpG-ODN-induced secretion of IL-6 by WEHI 231. They also inhibit IL-6 synthesis and thymidine uptake by human unfractionated PBMC induced by CpG-ODN. The compounds did not inhibit LPS-induced responses. Half-maximal inhibition required 10 nM quinacrine or 100 nM chloroquine. Inhibition was noncompetitive with respect to CpG-ODN. Quinine, quinidine, and primaquine were much less powerful. Quinacrine was effective even when added after the CpG-ODN. Near-toxic concentrations of ammonia plus bafilomycin A1 (used to inhibit vesicular acidification) did not reduce the efficacy of the quinacrine, but the effects of both quinacrine and chloroquine were enhanced by inhibition of the multidrug resistance efflux pump by verapamil. Agents that bind to DNA, including propidium iodide, Hoechst dye 33258, and coralyne chloride did not inhibit CpG-ODN effect, nor did 4-bromophenacyl bromide, an inhibitor of phospholipase A2. Examination of the structure-activity relationship of seventy 4-aminoquinoline and 9-aminoacridine analogues reveals that increased activity was conferred by bulky hydrophobic substituents on positions 2 and 6 of the quinoline nucleus. No correlation was found between published antimalarial activity and ability to block CpG-ODN-induced effects. These results are discussed in the light of the ability of quinacrine and chloroquine to induce remission of rheumatoid arthritis and lupus erythematosus.

  7. Personification in discourse: linguistic forms, conceptual structures and communicative functions.

    NARCIS (Netherlands)

    Dorst, A.G.

    2011-01-01

    Drawing on examples from a corpus of 14 excerpts from novels, this article aims to present a systematic investigation of the different linguistic forms, conceptual structures and communicative functions of personification in discourse. The Metaphor Identification Procedure (Pragglejaz Group, 2007)

  8. THE SPITZER SURVEY OF STELLAR STRUCTURE IN GALAXIES (S4G): MULTI-COMPONENT DECOMPOSITION STRATEGIES AND DATA RELEASE

    International Nuclear Information System (INIS)

    Salo, Heikki; Laurikainen, Eija; Laine, Jarkko; Comerón, Sebastien; Gadotti, Dimitri A.; Kim, Taehyun; Buta, Ron; Sheth, Kartik; Muñoz-Mateos, Juan Carlos; Zaritsky, Dennis; Hinz, Joannah L.; Ho, Luis; Knapen, Johan; Cisternas, Mauricio; Athanassoula, E.; Bosma, Albert; Laine, Seppo; Regan, Michael; De Paz, Armando Gil; Menendez-Delmestre, Karin

    2015-01-01

    The Spitzer Survey of Stellar Structure in Galaxies (S 4 G) is a deep 3.6 and 4.5 μm imaging survey of 2352 nearby (<40 Mpc) galaxies. We describe the S 4 G data analysis pipeline 4, which is dedicated to two-dimensional structural surface brightness decompositions of 3.6 μm images, using GALFIT3.0. Besides automatic 1-component Sérsic fits, and 2-component Sérsic bulge + exponential disk fits, we present human-supervised multi-component decompositions, which include, when judged appropriate, a central point source, bulge, disk, and bar components. Comparison of the fitted parameters indicates that multi-component models are needed to obtain reliable estimates for the bulge Sérsic index and bulge-to-total light ratio (B/T), confirming earlier results. Here, we describe the preparations of input data done for decompositions, give examples of our decomposition strategy, and describe the data products released via IRSA and via our web page (www.oulu.fi/astronomy/S4G-PIPELINE4/MAIN). These products include all the input data and decomposition files in electronic form, making it easy to extend the decompositions to suit specific science purposes. We also provide our IDL-based visualization tools (GALFIDL) developed for displaying/running GALFIT-decompositions, as well as our mask editing procedure (MASK-EDIT) used in data preparation. A detailed analysis of the bulge, disk, and bar parameters derived from multi-component decompositions will be published separately

  9. Are c.436G>A mutations less severe forms of Lafora disease? A case report

    Directory of Open Access Journals (Sweden)

    Hélène-Marie Lanoiselée

    2014-01-01

    Full Text Available Lafora disease is a form of progressive myoclonic epilepsy with autosomal recessive transmission. Two genes have been identified so far: EPM2A and NHLRC1, and a third gene, concerning a pediatric onset subform, has been recently proposed. We report the case of a 23-year-old woman of Turkish origin with an unusual disease course. Clinical onset was at the age of 19 years with tonic–clonic seizures, followed by cognitive impairment; EEG was in favor of Lafora disease, and the mutation c.436G>A (a missense mutation substituting aspartic acid in asparagine in the NHLRC1 gene confirmed this diagnosis. After 5 years of evolution, the patient only has moderate cognitive impairment. Some NHLRC1 mutations, particularly c.436G>A, are associated with a slower clinical course, but there are conflicting data in the literature. This case strengthens the hypothesis that the c.436G>A mutation in the NHLRC1 gene leads to less severe phenotypes and late-onset disease.

  10. Functional fluorescent protein insertions in herpes simplex virus gB report on gB conformation before and after execution of membrane fusion.

    Directory of Open Access Journals (Sweden)

    John R Gallagher

    2014-09-01

    Full Text Available Entry of herpes simplex virus (HSV into a target cell requires complex interactions and conformational changes by viral glycoproteins gD, gH/gL, and gB. During viral entry, gB transitions from a prefusion to a postfusion conformation, driving fusion of the viral envelope with the host cell membrane. While the structure of postfusion gB is known, the prefusion conformation of gB remains elusive. As the prefusion conformation of gB is a critical target for neutralizing antibodies, we set out to describe its structure by making genetic insertions of fluorescent proteins (FP throughout the gB ectodomain. We created gB constructs with FP insertions in each of the three globular domains of gB. Among 21 FP insertion constructs, we found 8 that allowed gB to remain membrane fusion competent. Due to the size of an FP, regions in gB that tolerate FP insertion must be solvent exposed. Two FP insertion mutants were cell-surface expressed but non-functional, while FP insertions located in the crown were not surface expressed. This is the first report of placing a fluorescent protein insertion within a structural domain of a functional viral fusion protein, and our results are consistent with a model of prefusion HSV gB constructed from the prefusion VSV G crystal structure. Additionally, we found that functional FP insertions from two different structural domains could be combined to create a functional form of gB labeled with both CFP and YFP. FRET was measured with this construct, and we found that when co-expressed with gH/gL, the FRET signal from gB was significantly different from the construct containing CFP alone, as well as gB found in syncytia, indicating that this construct and others of similar design are likely to be powerful tools to monitor the conformation of gB in any model system accessible to light microscopy.

  11. Measurement of the proton spin structure function g1p

    International Nuclear Information System (INIS)

    Pussieux, T.

    1994-10-01

    In order to check the Bjorken sum rule and confirm the EMC surprising conclusion on the spin structure of the proton, the measurement of the spin structure function of the proton has been performed by the Spin Muon Collaboration via the polarized muon nucleon deep inelastic scattering. The results of the 1993 run are presented within a kinematical range of 0.003 2 = 10 GeV 2 . The first moment of the polarized spin structure function g 1 p is found to be two standard deviations below the Ellis-Jaffe sum rule. Assuming SU(3) for hyperons β decays, the quark spin contribution to the proton spin is extracted. Combining all available data on proton, neutron and deuton, The Bjorken sum rule is confirmed within 10%. (author). 25 refs., 3 figs., 2 tabs

  12. Nuclear reactor structural material forming less radioactive corrosion product

    International Nuclear Information System (INIS)

    Nakazawa, Hiroshi.

    1988-01-01

    Purpose: To provide nuclear reactor structural materials forming less radioactive corrosion products. Constitution: Ni-based alloys such as inconel alloy 718, 600 or inconel alloy 750 and 690 having excellent corrosion resistance and mechanical property even in coolants at high temperature and high pressure have generally been used as nuclear reactor structural materials. However, even such materials yield corrosion products being attacked by coolants circulating in the nuclear reactor, which produce by neutron irradiation radioactive corrosion products, that are deposited in primary circuit pipeways to constitute exposure sources. The present invention dissolves dissolves this problems by providing less activating nuclear reactor structural materials. That is, taking notice on the fact that Ni-58 contained generally by 68 % in Ni changes into Co-58 under irradiation of neutron thereby causing activation, the surface of nuclear reactor structural materials is applied with Ni plating by using Ni with a reduced content of Ni-58 isotopes. Accordingly, increase in the radiation level of the nuclear reactor structural materials can be inhibited. (K.M.)

  13. Human telomeric G-quadruplex formation and highly selective fluorescence detection of toxic strontium ions.

    Science.gov (United States)

    Qu, Konggang; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang

    2012-03-01

    Strontium ions play important roles in biological systems. The inhalation of strontium can cause severe respiratory difficulties, anaphylactic reaction and extreme tachycardia. Strontium can replace calcium in organisms, inhibit normal calcium absorption and induce strontium "rickets" in childhood. Thus, the development of sensitive and selective methods for the determination of trace amounts of Sr(2+) in aqueous media is of considerable importance for environmental and human health protection. A number of methodologies, such as X-ray energy dispersive spectrometry, inductively coupled argon plasma atomic emission spectroscopy (ICP-AES), atomic absorption spectrometry (AAS) and instrumental thermal neutron activation analysis, have been reported. However, these methods are somewhat complex, costly, time consuming and, especially, need special instruments. Thus, the design of convenient and inexpensive approaches for the sensitive and selective detection of Sr(2+) with rapid, easy manipulation is in ever-increasing demand. To the best of our knowledge, using DNA conformational change to detect Sr(2+) has not yet been reported. Herein we utilized thiazole orange (TO) as a signal reporter to devise a simple Sr(2+) detection assay based on Sr(2+) induced human telomeric DNA conformational change in the presence of SWNTs. The limit of detection is 10 nM Sr(2+) (0.87 μg L(-1)), far below 4 mg L(-1), the U.S. Federal threshold in drinking water defined by the U.S. EPA.

  14. A resource-based theory of market structure and organizational form

    NARCIS (Netherlands)

    van Witteloostuijn, A.; Boone, C.A.J.J.

    We argue that combining the insights from both the industrial organization and organizational ecology perspectives is likely to produce value added. We develop a resource-based theory of market structure, where resources pertain to the environmental assets (together forming the resource space)

  15. A Massive Shell of Supernova-formed Dust in SNR G54.1+0.3

    Energy Technology Data Exchange (ETDEWEB)

    Temim, Tea [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Dwek, Eli; Arendt, Richard G. [Observational Cosmology Lab, Code 665, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Borkowski, Kazimierz J.; Reynolds, Stephen P. [North Carolina State University, Raleigh, NC 27695 (United States); Slane, Patrick; Raymond, John C. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Gelfand, Joseph D. [New York University, Abu Dhabi (United Arab Emirates)

    2017-02-10

    While theoretical models of dust condensation predict that most refractory elements produced in core-collapse supernovae (SNe) efficiently condense into dust, a large quantity of dust has so far only been observed in SN 1987A. We present an analysis of observations from the Spitzer Space Telescope , Herschel Space Observatory , Stratospheric Observatory for Infrared Astronomy, and AKARI of the infrared shell surrounding the pulsar wind nebula in the supernova remnant G54.1+0.3. We attribute a distinctive spectral feature at 21 μ m to a magnesium silicate grain species that has been invoked in modeling the ejecta-condensed dust in Cas A, which exhibits the same spectral signature. If this species is responsible for producing the observed spectral feature and accounts for a significant fraction of the observed infrared continuum, we find that it would be the dominant constituent of the dust in G54.1+0.3, with possible secondary contributions from other compositions, such as carbon, silicate, or alumina grains. The total mass of SN-formed dust required by this model is at least 0.3 M {sub ⊙}. We discuss how these results may be affected by varying dust grain properties and self-consistent grain heating models. The spatial distribution of the dust mass and temperature in G54.1+0.3 confirms the scenario in which the SN-formed dust has not yet been processed by the SN reverse shock and is being heated by stars belonging to a cluster in which the SN progenitor exploded. The dust mass and composition suggest a progenitor mass of 16–27 M {sub ⊙} and imply a high dust condensation efficiency, similar to that found for Cas A and SN 1987A. The study provides another example of significant dust formation in a Type IIP SN explosion and sheds light on the properties of pristine SN-condensed dust.

  16. Classification of compact homogeneous spaces with invariant G(2)-structures

    Czech Academy of Sciences Publication Activity Database

    Le, Hong-Van; Munir, M.

    2012-01-01

    Roč. 12, č. 2 (2012), s. 303-328 ISSN 1615-715X R&D Projects: GA AV ČR IAA100190701 Institutional support: RVO:67985840 Keywords : compact homogeneous space * G(2)-structure Subject RIV: BA - General Mathematics Impact factor: 0.371, year: 2012 http://www.degruyter.com/view/j/advg.2012.12.issue-2/advgeom.2011.054/advgeom.2011.054. xml

  17. Colorimetric determination of staphylococcal enterotoxin B via DNAzyme-guided growth of gold nanoparticles

    International Nuclear Information System (INIS)

    Zhou, Dandan; Chen, Hui; Xie, Guoming; Cao, Xianqing; Chen, Xueping; Zhang, Xing

    2016-01-01

    The authors describe a colorimetric method for the determination of the staphylococcal enterotoxin B (SEB) that also allows for visual readout. The assay is based on the growth of gold nanoparticles (AuNPs) mediated by a hemin/G-quadruplex DNAzyme which generates a color change from red to blue in the presence of SEB. The method is enzyme-free and does not require a label. The kinetics of the formation of the AuNPs is controlled by the hemin/G-quadruplex DNAzyme and this is key to the signal generation mechanism. In the presence of SEB, the reactions between aptamer and target modulated the amount of single probe G strands that form DNAzyme capable of consuming hydrogen peroxide. The growth process of AuNPs is influenced by the resulting concentration of H 2 O 2 and leads to the color change. Under optimal conditions, a linear relationship exists between absorbance and SEB concentration in the range from 0.1 to 500 pg·mL -1 which covers the clinically relevant range. In case of visual detection, the lower limit of detection is 1 pg·mL −1 . The assay described here is sensitive, comparably inexpensive and can detect SEB rapidly without the need for sophisticated equipment. In our perception, the method has a wide scope in that it may be adapted to various nucleic acids, proteins and other biomolecules if respective aptamers are available. (author)

  18. The spin dependent structure function g1 of the deuteron and the proton

    International Nuclear Information System (INIS)

    Klostermann, L.

    1995-01-01

    This thesis presents a study on the spin structure of the nucleon, via deep inelastic scattering (DIS) of polarised nuons on polarised proton and deuterium targets. The work was done in the Spin Muon Collaboration (SMC) at CERN in Geneva. From the asymmetry in the scattering cross section for nucleon and lepton spins parallel and anti-parallel, one con determine the spin dependent structure function g 1 , which contains information on the quark and gluon spin distribution functions. The interpretation in the frame work of the quark parton model (QPM) of earlier results on g 1 p by the European Muon Collaboration (EMC), gave an indication that only a small fraction of the proton spin, compatible with zero, is carried by the spins of the constituent quarks. The SMC was set up to check this unexpected result with improved accuracy, and to combine measurements of g 1 p and g 1 d to test a fundamental sum rule in quantum chromodynamics (QCD), the Bjorken sum rule. (orig./WL)

  19. Rheological and structural characterisation of film-forming solutions and biodegradable edible film made from kefiran as affected by various plasticizer types.

    Science.gov (United States)

    Ghasemlou, Mehran; Khodaiyan, Faramarz; Oromiehie, Abdulrasoul

    2011-11-01

    The rheological properties of kefiran film-forming solutions, as well as the structural characterisation of the resulting films, were investigated as a function of various plasticizer types. The behaviours of the storage (G') and loss (G″) moduli as a function of frequency were typical of gel-like material, with the G' higher than the G″. Kefiran-based films, which may find application as edible films, were prepared by a casting and solvent-evaporation method. Possible interaction between the adjacent chains in the kefiran polymer and various plasticizers was proven by Fourier-transform infrared spectroscopy (FT-IR). The crystallinity of plasticized kefiran film was also analysed using X-ray diffraction (XRD); this revealed an amorphous-crystalline structure. These results were explained by the film's microstructure, which was analysed by atomic force microscopy (AFM) and scanning electron microscopy (SEM). The present study has helped determine possible interactions of kefiran, plasticizer and water molecules in determining film properties. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. "SP-G", a putative new surfactant protein--tissue localization and 3D structure.

    Directory of Open Access Journals (Sweden)

    Felix Rausch

    Full Text Available Surfactant proteins (SP are well known from human lung. These proteins assist the formation of a monolayer of surface-active phospholipids at the liquid-air interface of the alveolar lining, play a major role in lowering the surface tension of interfaces, and have functions in innate and adaptive immune defense. During recent years it became obvious that SPs are also part of other tissues and fluids such as tear fluid, gingiva, saliva, the nasolacrimal system, and kidney. Recently, a putative new surfactant protein (SFTA2 or SP-G was identified, which has no sequence or structural identity to the already know surfactant proteins. In this work, computational chemistry and molecular-biological methods were combined to localize and characterize SP-G. With the help of a protein structure model, specific antibodies were obtained which allowed the detection of SP-G not only on mRNA but also on protein level. The localization of this protein in different human tissues, sequence based prediction tools for posttranslational modifications and molecular dynamic simulations reveal that SP-G has physicochemical properties similar to the already known surfactant proteins B and C. This includes also the possibility of interactions with lipid systems and with that, a potential surface-regulatory feature of SP-G. In conclusion, the results indicate SP-G as a new surfactant protein which represents an until now unknown surfactant protein class.