WorldWideScience

Sample records for g-quadruplex structure formed

  1. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  2. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

    Science.gov (United States)

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

    2017-08-01

    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  3. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Science.gov (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  4. Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

    Science.gov (United States)

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

    2016-10-13

    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  5. Experimental approaches to identify cellular G-quadruplex structures and functions.

    Science.gov (United States)

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

    2012-05-01

    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

    Science.gov (United States)

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

    2014-03-21

    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  8. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    Science.gov (United States)

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  9. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Science.gov (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  10. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  11. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Science.gov (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  12. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Science.gov (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    Science.gov (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Science.gov (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  15. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  16. DNA secondary structures: stability and function of G-quadruplex structures

    Science.gov (United States)

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  17. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  18. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  19. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    Science.gov (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  20. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    Science.gov (United States)

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  2. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Science.gov (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  3. RPA-mediated unfolding of systematically varying G-quadruplex structures.

    Science.gov (United States)

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

    2013-05-21

    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  4. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Directory of Open Access Journals (Sweden)

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  5. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  6. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

    Science.gov (United States)

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-01-01

    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  7. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    DEFF Research Database (Denmark)

    Porru, Manuela; Artuso, Simona; Salvati, Erica

    2015-01-01

    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  9. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  10. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Science.gov (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2018-06-01

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  11. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    Science.gov (United States)

    Schwindt, Eike; Paeschke, Katrin

    2017-11-02

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  12. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  13. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Science.gov (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  14. Macrocyclic G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, M C; Ulven, Trond

    2010-01-01

    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  15. Effect of Urea on G-Quadruplex Stability.

    Science.gov (United States)

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  16. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  17. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Science.gov (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  18. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  19. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    Science.gov (United States)

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  20. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  1. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  2. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  3. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Science.gov (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  4. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Science.gov (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  7. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Science.gov (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Science.gov (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  9. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    Science.gov (United States)

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  10. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  11. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Science.gov (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  12. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

    Science.gov (United States)

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

    2013-11-20

    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  13. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  14. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Science.gov (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  15. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  16. Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

    Science.gov (United States)

    Hirashima, Kyotaro; Seimiya, Hiroyuki

    2015-02-27

    Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

    Science.gov (United States)

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

    2013-05-01

    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  18. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  19. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

    Science.gov (United States)

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

    2018-10-05

    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Juan Hu

    2013-01-01

    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  1. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  2. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Science.gov (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  3. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  4. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Natalia Rizeq

    2017-12-01

    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  5. Disintegration of cruciform and G-quadruplex structures during the course of helicase-dependent amplification (HDA).

    Science.gov (United States)

    Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu

    2015-04-15

    Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  7. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  8. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

    Science.gov (United States)

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

    2009-01-01

    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  9. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

    Science.gov (United States)

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

    2018-05-01

    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  10. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  11. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  12. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Directory of Open Access Journals (Sweden)

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  13. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  14. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  15. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    Science.gov (United States)

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  16. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Aishwarya Prakash

    2011-01-01

    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  17. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    Science.gov (United States)

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  18. Selectivity in ligand recognition of G-quadruplex loops.

    Science.gov (United States)

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

    2009-03-03

    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  19. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  20. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    Science.gov (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  2. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Science.gov (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  3. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

    Science.gov (United States)

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2013-10-01

    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  4. Simultaneous G-Quadruplex DNA Logic.

    Science.gov (United States)

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    Science.gov (United States)

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  6. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Science.gov (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  7. Local epigenetic reprogramming induced by G-quadruplex ligands

    Science.gov (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  8. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  9. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Science.gov (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure.

    Science.gov (United States)

    Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie

    2018-06-01

    An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Science.gov (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  13. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

    Science.gov (United States)

    2015-01-01

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  14. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Directory of Open Access Journals (Sweden)

    Yunqiang Bian

    2014-04-01

    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  15. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

    Science.gov (United States)

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

    2012-09-19

    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  16. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

    Science.gov (United States)

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

    2013-10-01

    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  17. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  18. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  19. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    Science.gov (United States)

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Science.gov (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Science.gov (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  2. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Directory of Open Access Journals (Sweden)

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  3. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  4. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

    Science.gov (United States)

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-04-12

    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  5. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Science.gov (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  6. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  8. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

    Science.gov (United States)

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  9. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  10. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    OpenAIRE

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  11. G-Quadruplexes influence pri-microRNA processing.

    Science.gov (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  12. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

    Science.gov (United States)

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

    2013-01-01

    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  13. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  14. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

    Science.gov (United States)

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

    2017-01-01

    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  15. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Directory of Open Access Journals (Sweden)

    Vikas Yadav

    2017-07-01

    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  16. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  17. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  18. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

    Science.gov (United States)

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

    2018-06-01

    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  19. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    Science.gov (United States)

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  20. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    Science.gov (United States)

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  1. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Science.gov (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  2. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  3. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

    Science.gov (United States)

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

    2014-07-23

    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Science.gov (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  6. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Science.gov (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  7. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Science.gov (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  8. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  9. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  10. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    Science.gov (United States)

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Science.gov (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  13. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  14. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  15. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

    Science.gov (United States)

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

    2015-03-02

    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  17. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    Science.gov (United States)

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  19. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Science.gov (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  20. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  1. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Science.gov (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  2. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Science.gov (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  3. The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.

    2007-01-01

    Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

  4. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

    Science.gov (United States)

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

    2018-06-01

    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  5. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Science.gov (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Science.gov (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  7. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    Science.gov (United States)

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  8. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

    Science.gov (United States)

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

    2014-01-01

    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  9. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    Science.gov (United States)

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  10. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  11. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Science.gov (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  12. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  13. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Science.gov (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  14. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    Science.gov (United States)

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  15. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  16. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  17. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Science.gov (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  18. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  19. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Science.gov (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  20. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  1. p53 binds human telomeric G-quadruplex in vitro

    Czech Academy of Sciences Publication Activity Database

    Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016

  2. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

    Science.gov (United States)

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

    2016-03-02

    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  4. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

    Science.gov (United States)

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

    2016-01-15

    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates.

    Science.gov (United States)

    Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen

    2015-11-23

    A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

    Science.gov (United States)

    Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

    2018-03-09

    Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  8. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

    Science.gov (United States)

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

    2018-02-07

    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  9. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    Directory of Open Access Journals (Sweden)

    David Monchaud

    2010-01-01

    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  10. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Science.gov (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  11. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

    2009-01-01

    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  12. A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

    Science.gov (United States)

    Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

    2016-06-15

    The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

    2014-01-01

    The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

  14. Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence

    Science.gov (United States)

    Tawani, Arpita; Kumar, Amit

    2015-01-01

    Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543

  15. Glucose oxidase-initiated cascade catalysis for sensitive impedimetric aptasensor based on metal-organic frameworks functionalized with Pt nanoparticles and hemin/G-quadruplex as mimicking peroxidases.

    Science.gov (United States)

    Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju

    2017-12-15

    Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Science.gov (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  17. The estimation of H-bond and metal ion-ligand interaction energies in the G-Quadruplex ⋯ Mn+ complexes

    Science.gov (United States)

    Mostafavi, Najmeh; Ebrahimi, Ali

    2018-06-01

    In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.

  18. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    DEFF Research Database (Denmark)

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia

    2015-01-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  19. Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.

    Science.gov (United States)

    Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro

    2012-04-14

    The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012

  20. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

    2017-01-01

    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  1. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

    Science.gov (United States)

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

    2014-07-15

    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    Science.gov (United States)

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  3. G-quadruplex recognition activities of E. Coli MutS

    Directory of Open Access Journals (Sweden)

    Ehrat Edward A

    2012-07-01

    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  4. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

    Science.gov (United States)

    Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

    2015-05-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

  5. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

    Science.gov (United States)

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

    2014-09-01

    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

    Science.gov (United States)

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

    2015-08-04

    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  8. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Yodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), 11528–11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation(US) 1430124 Institutional support: RVO:68378050 Keywords : Bloom helicase * ATP * Gquadruplex (GQ) structure * GQ destabilization Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  9. Stephen Neidle on cancer therapy and G-quadruplex inhibitors. Interview by Joanna De Souza.

    Science.gov (United States)

    Neidle, Stephen

    2004-09-15

    Stephen Neidle was educated at Imperial College, London, where he graduated in chemistry and then proceeded to do a PhD in crystallography. After a period as an ICI Fellow, he joined the Biophysics Department at King's College, which ignited his interest in nucleic acid structural studies. He was appointed as one of the first Cancer Research Campaign Career Development Awardees, becoming a Life Fellow on moving to the Institute of Cancer Research. He was appointed to the Chair of Biophysics at the Institute of Cancer Research in 1990, and moved to the new Chair of Chemical Biology at the School of Pharmacy in the University of London in 2002, where he also directs the Cancer Research UK Biomolecular Structure Group. He is currently Chairman of the Chemical Biology Forum of the Royal Society of Chemistry, which is involved in developing the interface between chemistry and the life sciences. He will shortly assume the Directorship of the newly-established Centre for Cancer Medicines at the School. Stephen Neidle has received several awards for his work on drug-nucleic acid recognition and drug design, including the 2000 prize of the Biological and Medicinal Chemistry Sector of the Royal Society of Chemistry, and its 2002 Interdisciplinary Award. He was the 2004 Paul Ehrlich Lecturer of the French Societé de Chimie Therapeutique, and was recently awarded the 2004 Aventis Prize in Medicinal Chemistry.

  10. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  11. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Science.gov (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  13. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Yanhua Chen

    2016-05-01

    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  14. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

    Science.gov (United States)

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

    2015-01-28

    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  15. Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Science.gov (United States)

    Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang

    2015-01-01

    Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  16. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Directory of Open Access Journals (Sweden)

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  17. Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

    Science.gov (United States)

    Kocman, Vojč; Plavec, Janez

    2017-05-01

    Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

  18. Nanodiamond particles forming photonic structures

    International Nuclear Information System (INIS)

    Grichko, Varvara; Tyler, Talmage; Grishko, Victor I; Shenderova, Olga

    2008-01-01

    Colloid suspensions of irregularly shaped, highly charged detonation nanodiamond particles are found to have unexpected optical properties, similar to those of photonic crystals. This finding is all the more surprising since the particles used in this work are far more polydisperse than those typically forming photonic crystals. Intensely iridescent structures have been fabricated using the centrifugation of aqueous suspensions of nanodiamonds

  19. Nanodiamond particles forming photonic structures

    Energy Technology Data Exchange (ETDEWEB)

    Grichko, Varvara; Tyler, Talmage; Grishko, Victor I; Shenderova, Olga [International Technology Center, 8100 Brownleigh Drive, Suite 120, Raleigh, NC 27617 (United States)], E-mail: oshenderova@itc-inc.org

    2008-06-04

    Colloid suspensions of irregularly shaped, highly charged detonation nanodiamond particles are found to have unexpected optical properties, similar to those of photonic crystals. This finding is all the more surprising since the particles used in this work are far more polydisperse than those typically forming photonic crystals. Intensely iridescent structures have been fabricated using the centrifugation of aqueous suspensions of nanodiamonds.

  20. On the interaction between [Ru(NH3)(6)](3+) and the G-quadruplex forming thrombin binding aptamer sequence

    Czech Academy of Sciences Publication Activity Database

    De Rache, A.; Doneux, T.; Kejnovská, Iva; Buess-Herman, C.

    2013-01-01

    Roč. 126, SEP 2013 (2013), s. 84-90 ISSN 0162-0134 Institutional support: RVO:68081707 Keywords : SELF-ASSEMBLED MONOLAYERS * DNA-MODIFIED SURFACES * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 3.274, year: 2013

  1. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

    2015-08-05

    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

  2. C9orf72 nucleotide repeat structures initiate molecular cascades of disease.

    Science.gov (United States)

    Haeusler, Aaron R; Donnelly, Christopher J; Periz, Goran; Simko, Eric A J; Shaw, Patrick G; Kim, Min-Sik; Maragakis, Nicholas J; Troncoso, Juan C; Pandey, Akhilesh; Sattler, Rita; Rothstein, Jeffrey D; Wang, Jiou

    2014-03-13

    A hexanucleotide repeat expansion (HRE), (GGGGCC)n, in C9orf72 is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Here we identify a molecular mechanism by which structural polymorphism of the HRE leads to ALS/FTD pathology and defects. The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA•DNA hybrids (R-loops). The structural polymorphism causes a repeat-length-dependent accumulation of transcripts aborted in the HRE region. These transcribed repeats bind to ribonucleoproteins in a conformation-dependent manner. Specifically, nucleolin, an essential nucleolar protein, preferentially binds the HRE G-quadruplex, and patient cells show evidence of nucleolar stress. Our results demonstrate that distinct C9orf72 HRE structural polymorphism at both DNA and RNA levels initiates molecular cascades leading to ALS/FTD pathologies, and provide the basis for a mechanistic model for repeat-associated neurodegenerative diseases.

  3. Structural revisions of small molecules reported to cross-link G-quadruplex DNA in vivo reveal a repetitive assignment error in the literature

    Czech Academy of Sciences Publication Activity Database

    Reyes Gutierrez, Paul Eduardo; Kapal, Tomáš; Klepetářová, Blanka; Šaman, David; Pohl, Radek; Zawada, Zbigniew; Kužmová, Erika; Hájek, Miroslav; Teplý, Filip

    2016-01-01

    Roč. 6, Mar 23 (2016), č. článku 23499. ISSN 2045-2322 R&D Projects: GA ČR GA13-19213S; GA MŠk LO1302 Grant - others:AV ČR(CZ) M200551208 Institutional support: RVO:61388963 Keywords : 1,2-disubstituted benzimidazoles * chemical synthesis * promoter region Subject RIV: CC - Organic Chemistry Impact factor: 4.259, year: 2016 http://www.nature.com/articles/srep23499

  4. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-01-01

    Roč. 12, č. 4 (2016), s. 2000-2016 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : molecular-dynamics simulations * quantum-chemical computations * continuum solvation models Subject RIV: BO - Biophysics Impact factor: 5.245, year: 2016

  5. G quadruplex-based FRET probes with the thrombin-binding aptamer (TBA) sequence designed for the efficient fluorometric detection of the potassium ion.

    Science.gov (United States)

    Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori

    2006-11-01

    The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.

  6. Structural basis for IL-1α recognition by a modified DNA aptamer that specifically inhibits IL-1α signaling

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Xiaoming; Gelinas, Amy D.; von Carlowitz, Ira; Janjic, Nebojsa; Pyle, Anna Marie (Yale); (SomaLogic)

    2017-10-09

    IL-1α is an essential cytokine that contributes to inflammatory responses and is implicated in various forms of pathogenesis and cancer. Here we report a naphthyl modified DNA aptamer that specifically binds IL-1α and inhibits its signaling pathway. By solving the crystal structure of the IL-1α/aptamer, we provide a high-resolution structure of this critical cytokine and we reveal its functional interaction interface with high-affinity ligands. The non-helical aptamer, which represents a highly compact nucleic acid structure, contains a wealth of new conformational features, including an unknown form of G-quadruplex. The IL-1α/aptamer interface is composed of unusual polar and hydrophobic elements, along with an elaborate hydrogen bonding network that is mediated by sodium ion. IL-1α uses the same interface to interact with both the aptamer and its cognate receptor IL-1RI, thereby suggesting a novel route to immunomodulatory therapeutics.

  7. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc00361g Click here for additional data file.

    Science.gov (United States)

    Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei

    2017-01-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564

  8. Synthesis and Characterization of thermo/pH-responsive Supramolecular G-Quadruplexes for the Construction of Supramolecular Hacky Sacks for Biorelevant Applications

    Science.gov (United States)

    Negron Rios, Luis M.

    The impact of size, shape, and distribution of lipophilic regions on the surfaces of nanoscopic objects that are amphiphilic or patchy (such as proteins) are yet to be fully understood. One of the reasons for this is the lack of an appropriate model systems in which to probe this question. Our group has previously reported 2'-deoxyguanosine (8ArG) derivatives that self-assemble in aqueous media into discrete supramolecular hexadecamers that show the lower critical solution temperature (LCST) phenomenon. The LCST phenomenon is a convenient and rigorous strategy to measure the hydrophobicity of a system. Although these SGQs are potentially attractive for biomedical applications like drug-delivery, the narrow window of physiological temperatures complicates their implementation. This moved us to redesign the constituent 8ArG subunits to incorporate imidazole moieties that would lead to pH-responsive SGQs, working isothermally. Upon reaching a threshold temperature (Lower Critical Solution Temperature, LCST) at pH 7, these dual-responsive SGQs further self-assemble to form nano/micro hydrogel globules that we called them supramolecular hacky sacks (SHS). However, we can isolate kinetically stable versions of these SHS by lowering the ionic strength of the medium (i.e., from the molar to the millimolar range) in a process that we term "fixing the SHS", in which these SHS maintain their integrity (size and shape) and stability without the requirement of crosslinking agents. After structural characterization and in vitro studies of SHS, we performed encapsulation studies of DOX, rhodamine, dsDNA (F26T), thrombin binding aptamer (TBA) and dextran (3 kDa) Texas Red conjugate. Then we performed in vivo studies of cell internalization and drug delivery with neuroblastoma SY-SH5Y. The performed studies will bring new approaches for the development of new biotechnology for fundamental applications and the emerging of novel therapeutic agents for biomedical applications.

  9. Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

    DEFF Research Database (Denmark)

    Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

    2016-01-01

    DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

  10. Towards Free-Form Kinetic Structures

    DEFF Research Database (Denmark)

    Parigi, Dario; Kirkegaard, Poul Henning

    2012-01-01

    of pin-slot paths starting from the local displacements of element [2] [3]. In the design of kinetic structures, in particular when complex three dimensional and non regular configurations are involved, the functionality is frequently related to a global displacement capability of the assembly rather...... for the generation of free-form kinetic structures....

  11. Structural optimization of free-form reciprocal structures

    DEFF Research Database (Denmark)

    Parigi, Dario

    2014-01-01

    This paper presents an optimization algorithm for the design of structurally efficient free-form reciprocal structures. Because of the geometric complexity of reciprocal structures, only a few structural studies have been carried out so far, and we have a limited knowledge of the relation between...

  12. Structural information theory and visual form

    NARCIS (Netherlands)

    Leeuwenberg, E.L.J.; Kaernbach, C.; Schroeger, E.; Mueller, H.

    2003-01-01

    The paper attends to basic characteristics of visual form as approached by Structural information theory, or SIT, (Leeuwenberg, Van der Helm and Van Lier). The introduction provides a global survey of this approach. The main part of the paper focuses on three characteristics of SIT. Each one is made

  13. Transposable elements and G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovský, Eduard; Tokan, Viktor; Lexa, M.

    2015-01-01

    Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015

  14. FILAMENTARY STRUCTURE OF STAR-FORMING COMPLEXES

    International Nuclear Information System (INIS)

    Myers, Philip C.

    2009-01-01

    The nearest young stellar groups are associated with 'hubs' of column density exceeding 10 22 cm -2 , according to recent observations. These hubs radiate multiple 'filaments' of parsec length, having lower column density and fewer stars. Systems with many filaments tend to have parallel filaments with similar spacing. Such 'hub-filament structure' is associated with all of the nine young stellar groups within 300 pc, forming low-mass stars. Similar properties are seen in infrared dark clouds forming more massive stars. In a new model, an initial clump in a uniform medium is compressed into a self-gravitating, modulated layer. The outer layer resembles the modulated equilibrium of Schmid-Burgk with nearly parallel filaments. The filaments converge onto the compressed clump, which collapses to form stars with high efficiency. The initial medium and condensations have densities similar to those in nearby star-forming clouds and clumps. The predicted structures resemble observed hub-filament systems in their size, shape, and column density, and in the appearance of their filaments. These results suggest that HFS associated with young stellar groups may arise from compression of clumpy gas in molecular clouds.

  15. Forming of shape memory composite structures

    DEFF Research Database (Denmark)

    Santo, Loredana; Quadrini, Fabrizio; De Chiffre, Leonardo

    2013-01-01

    A new forming procedure was developed to produce shape memory composite structures having structural composite skins over a shape memory polymer core. Core material was obtained by solid state foaming of an epoxy polyester resin with remarkably shape memory properties. The composite skin consisted...... of a two-layer unidirectional thermoplastic composite (glass filled polypropylene). Skins were joined to the foamed core by hot compression without any adhesive: a very good adhesion was obtained as experimental tests confirmed. The structure of the foam core was investigated by means of computer axial...... tomography. Final shape memory composite panels were mechanically tested by three point bending before and after a shape memory step. This step consisted of a compression to reduce the panel thickness up to 60%. At the end of the bending test the panel shape was recovered by heating and a new memory step...

  16. Structural Encoding of Static Single Assignment Form

    DEFF Research Database (Denmark)

    Gal, Andreas; Probst, Christian; Franz, Michael

    2005-01-01

    Static Single Assignment (SSA) form is often used as an intermediate representation during code optimization in Java Virtual Machines. Recently, SSA has successfully been used for bytecode verification. However, constructing SSA at the code consumer is costly. SSAbased mobile code transport formats...... Java bytecode. While the resulting bytecode sequence can still be directly executed by traditional Virtual Machines, our novel VM can infer SSA form and confirm its safety with virtually no overhead....... have been shown to eliminate this cost by shifting SSA creation to the code producer. These new formats, however, are not backward compatible with the established Java class-file format. We propose a novel approach to transport SSA information implicitly through structural code properties of standard...

  17. Structure of Complex Verb Forms in Meiteilon

    Directory of Open Access Journals (Sweden)

    Lourembam Surjit Singh

    2016-12-01

    Full Text Available This piece of work proposes to descriptively investigate the structures of complex verbs in Meiteilon. The categorization of such verbs is based on the nature of semantic and syntactic functions of a lexeme or verbal lexeme. A lexeme or verbal lexeme in Meiteilon may have multifunctional properties in the nature of occurrence. Such lexical items can be co-occurred together in a phrase as single functional word. Specifically, in the co-occurrences of two lexical items, the first component of lexical items has different semantic and syntactic functions in comparison to semantic and syntactic functions of the second component of lexical items. Such co-occurrences of two lexical items are the forms of complex verb that are covered with the term complex predicate in this work. The investigation in constructing complex predicate is thoroughly presenting in this work. Keywords: Structures, complex verb, conjunct verb, compound verb, complex predicate

  18. Combustible structural composites and methods of forming combustible structural composites

    Science.gov (United States)

    Daniels, Michael A.; Heaps, Ronald J.; Steffler, Eric D.; Swank, W. David

    2013-04-02

    Combustible structural composites and methods of forming same are disclosed. In an embodiment, a combustible structural composite includes combustible material comprising a fuel metal and a metal oxide. The fuel metal is present in the combustible material at a weight ratio from 1:9 to 1:1 of the fuel metal to the metal oxide. The fuel metal and the metal oxide are capable of exothermically reacting upon application of energy at or above a threshold value to support self-sustaining combustion of the combustible material within the combustible structural composite. Structural-reinforcing fibers are present in the composite at a weight ratio from 1:20 to 10:1 of the structural-reinforcing fibers to the combustible material. Other embodiments and aspects are disclosed.

  19. METHODS OF FORMING THE STRUCTURE OF KNOWLEDGE

    Directory of Open Access Journals (Sweden)

    Tatyana A. Snegiryova

    2015-01-01

    Full Text Available The aim of the study is to describe the method of forming thestructure of knowledge of students on the basis of an integrated approach (expert, taxonomy and thesaurus and the presentation of the results of its use in the study of medical and biological physics at the Izhevsk State Medical Academy.Methods. The methods used in the work involve: an integrated approach that includes group expert method, developed by V. S. Cherepanov; taxonomy and thesaurus approach when creating a model of taxonomic structure of knowledge, as well as models of the formation of the knowledge structure.Results. The algorithm, stages and procedures of knowledge structure formation of trainees are considered in detail; the model of the given process is created; the technology of content selection of a teaching material due to the fixed time that has been released on studying of concrete discipline is shown.Scientific novelty and practical significance. Advantage of the proposed method and model of students’ knowledge structure formation consists in their flexibility: at certain adaptation they can be used while training to any discipline apart of its specificity and educational institution. Observance of all stages of the presented technology of content selection of a teaching material on the basis of an expert estimation will promote substantial increase of quality of training; make it possible to develop the unified method uniting the various points of view of teachers on knowledge formation of trainees.

  20. Structure of a Stable G-Hairpin

    Czech Academy of Sciences Publication Activity Database

    Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.

    2017-01-01

    Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded-dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016

  1. Forming the organizational structure for activities

    Directory of Open Access Journals (Sweden)

    U. S. Barash

    2013-04-01

    Full Text Available Purpose. Development of theoretical and methodological foundations of efficiency of freight cars operating companies in railway reform through improved management structure them. Methodology. A theoretical and methodological approach for building effective management structure of freight wagons operating companies of different ownership forms is proposed, its introduction will significantly reduce detention of cars on technical stations under loading operations and maintenance, and thereby to improve the quality parameters of rolling stock usage in reform conditions of Ukraine railway transport. Findings. An improved control mechanism of cargo transportation is developed, it is different from the existing by its adaptation to the conditions of the reformed sector and the organization of management companies which together with the Ukrainian Transport and Logistics Center (UTLC centralize management of all freight cars of domestic and foreign operating companies. Originality. It is proposed for management of cargo transportation in wagons operating companies of different ownership to organize a series of management companies that would have the right to dispose of universal cars of other domestic operating companies, being on leasehold basis, and to direct them to current and scheduled repairs by themselves; to organize the cargo transportation in wagons of domestic and foreign operating companies on a contractual terms, depending on the type and content of the contract, on the basis of additional contracts for a separate fee to perform current and scheduled repair of freight cars; the management company organizational structure is developed, it includes simultaneously two directions of activity: commercial and repair, it will reduce the stay time of rolling stock on the engineering stations during loading and in a non-operating park as far as this company will manage a significant part of the production cycle of the transportation process

  2. Tensegrity structures form, stability, and symmetry

    CERN Document Server

    Zhang, Jing Yao

    2015-01-01

    To facilitate a deeper understanding of tensegrity structures, this book focuses on their two key design problems: self-equilibrium analysis and stability investigation. In particular, high symmetry properties of the structures are extensively utilized. Conditions for self-equilibrium as well as super-stability of tensegrity structures are presented in detail. An analytical method and an efficient numerical method are given for self-equilibrium analysis of tensegrity structures: the analytical method deals with symmetric structures and the numerical method guarantees super-stability. Utilizing group representation theory, the text further provides analytical super-stability conditions for the structures that are of dihedral as well as tetrahedral symmetry. This book not only serves as a reference for engineers and scientists but is also a useful source for upper-level undergraduate and graduate students. Keeping this objective in mind, the presentation of the book is self-contained and detailed, with an abund...

  3. Forming foam structures with carbon foam substrates

    Science.gov (United States)

    Landingham, Richard L.; Satcher, Jr., Joe H.; Coronado, Paul R.; Baumann, Theodore F.

    2012-11-06

    The invention provides foams of desired cell sizes formed from metal or ceramic materials that coat the surfaces of carbon foams which are subsequently removed. For example, metal is located over a sol-gel foam monolith. The metal is melted to produce a metal/sol-gel composition. The sol-gel foam monolith is removed, leaving a metal foam.

  4. Rational design of fiber forming supramolecular structures

    Science.gov (United States)

    Wang, Benjamin K; Kanahara, Satoko M

    2016-01-01

    Recent strides in the development of multifunctional synthetic biomimetic materials through the self-assembly of multi-domain peptides and proteins over the past decade have been realized. Such engineered systems have wide-ranging application in bioengineering and medicine. This review focuses on fundamental fiber forming α-helical coiled-coil peptides, peptide amphiphiles, and amyloid-based self-assembling peptides; followed by higher order collagen- and elastin-mimetic peptides with an emphasis on chemical / biological characterization and biomimicry. PMID:27022140

  5. Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA

    Czech Academy of Sciences Publication Activity Database

    Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, R.; Vorlíčková, Michaela; Trantírek, L.

    2015-01-01

    Roč. 43, č. 9 (2015), s. 4733-4745 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA13-28310S; GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : NUCLEASE HYPERSENSITIVE ELEMENT * G-QUADRUPLEX STRUCTURES * I-MOTIF Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  6. New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.

    Science.gov (United States)

    Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni

    2018-02-10

    The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50  = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  7. A possible form of the pion's structure function

    International Nuclear Information System (INIS)

    Long Ming; Huang Tao

    1986-01-01

    The pion's structure function behaviour is discussed by using the Fock state expansion of the hadronic wave function in QCD in this paper. As an example, we employ a model wave function of the Fock state in the light-cone and assume a Regge behaviour of a weight function for higher Fock states, and we get a possible form of the pion's structure function. This form is consistent with experimental data of the pion's structure function

  8. Measuring the Thermophysical and Structural Properties of Glass-Forming and Quasicrystal-Forming Liquids

    Science.gov (United States)

    Hyers, Robert W.; Bradshaw, Richard C.; Rogers, Jan R.; Gangopadhyay, Anup K.; Kelton, Ken F.

    2006-01-01

    The thermophysical properties of glass-forming and quasicrystal-forming alloys show many interesting features in the undercooled liquid range. Some of the features in the thermophysical property curves are expected to reflect changes in the structure and coordination of the liquid. These measurements require containerless processing such as electrostatic levitation to access the undercooled liquid regime. An overview of the state of the art in measuring the thermophysical properties and structure of undercooled liquid glass-forming and quasicrystal-forming alloys will be presented, along with the status of current measurements.

  9. Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.

    Science.gov (United States)

    Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh

    2017-10-18

    G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  10. Personification in discourse: linguistic forms, conceptual structures and communicative functions.

    NARCIS (Netherlands)

    Dorst, A.G.

    2011-01-01

    Drawing on examples from a corpus of 14 excerpts from novels, this article aims to present a systematic investigation of the different linguistic forms, conceptual structures and communicative functions of personification in discourse. The Metaphor Identification Procedure (Pragglejaz Group, 2007)

  11. RPA prevents G-rich structure formation at lagging-strand telomeres to allow maintenance of chromosome ends.

    Science.gov (United States)

    Audry, Julien; Maestroni, Laetitia; Delagoutte, Emmanuelle; Gauthier, Tiphaine; Nakamura, Toru M; Gachet, Yannick; Saintomé, Carole; Géli, Vincent; Coulon, Stéphane

    2015-07-14

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in DNA replication, recombination, and repair. In fission yeast, the Rpa1-D223Y mutation provokes telomere shortening. Here, we show that this mutation impairs lagging-strand telomere replication and leads to the accumulation of secondary structures and recruitment of the homologous recombination factor Rad52. The presence of these secondary DNA structures correlates with reduced association of shelterin subunits Pot1 and Ccq1 at telomeres. Strikingly, heterologous expression of the budding yeast Pif1 known to efficiently unwind G-quadruplex rescues all the telomeric defects of the D223Y cells. Furthermore, in vitro data show that the identical D to Y mutation in human RPA specifically affects its ability to bind G-quadruplex. We propose that RPA prevents the formation of G-quadruplex structures at lagging-strand telomeres to promote shelterin association and facilitate telomerase action at telomeres. © 2015 The Authors.

  12. Does a Structured Data Collection Form Improve The Accuracy of ...

    African Journals Online (AJOL)

    and multiple etiologies for similar presentation. Standardized forms may harmonize the initial assessment, improve accuracy of diagnosis and enhance outcomes. Objectives: To determine the extent to which use of a structured data collection form (SDCF) affected the diagnostic accuracy of AAP. Methodology: A before and ...

  13. Form-finding of shell structures generated from physical models

    NARCIS (Netherlands)

    Li, Q.; Su, Y; Wu, Y; Borgart, A.; Rots, J.G.

    2017-01-01

    Vector form intrinsic finite element is a recently developed and promising numerical method for the analysis of complicated structural behavior. Taking the cable-link element as example, the framework of the vector form intrinsic finite element is explained first. Based on this, a constant strain

  14. Geometric structures associated with a simple Cartan 3-form

    Czech Academy of Sciences Publication Activity Database

    Le, Hong-Van

    2013-01-01

    Roč. 70, August (2013), s. 205-223 ISSN 0393-0440 Institutional support: RVO:67985840 Keywords : Cartan 3-form * multi-symplectic form * G-structure Subject RIV: BA - General Mathematics Impact factor: 0.797, year: 2013 http://www.sciencedirect.com/science/article/pii/S0393044013000740

  15. Structure, stability and behaviour of nucleic acids in ionic liquids

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Sugimoto, Naoki

    2014-01-01

    Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178

  16. Friction stir method for forming structures and materials

    Science.gov (United States)

    Feng, Zhili; David, Stan A.; Frederick, David Alan

    2011-11-22

    Processes for forming an enhanced material or structure are disclosed. The structure typically includes a preform that has a first common surface and a recess below the first common surface. A filler is added to the recess and seams are friction stir welded, and materials may be stir mixed.

  17. Transparent form-active system with structural glass

    NARCIS (Netherlands)

    Nikolaou, M.S.N.; Veer, F.A.; Eigenraam, P.

    2015-01-01

    Free-form transparent wide-span spatial structures which have being constructed so far, are based on the concept of three sets of components, the structural components, usually steel elements to ensure both compressive and tensional capacity; the glass cladding elements for expressing transparency;

  18. Nucleon structure functions, resonance form factors, and duality

    International Nuclear Information System (INIS)

    Davidovsky, V.V.; Struminsky, B.V.

    2003-01-01

    The behavior of nucleon structure functions in the resonance region is explored. For form factors that describe resonance production, expressions are obtained that are dependent on the photon virtuality Q 2 , which have a correct threshold behavior, and which take into account available experimental data on resonance decay. Resonance contributions to nucleon structure functions are calculated. The resulting expressions are used to investigate quark-hadron duality in electron-nucleon scattering by taking the example of the structure function F 2

  19. Ring and Volcano Structures Formed by a Metal Dipyrromethene Complex

    Energy Technology Data Exchange (ETDEWEB)

    Son, Seung Bae; Hahn, Jae Ryang [Chonbuk National Univ., Jeonju (Korea, Republic of); Miao, Qing; Shin, Jiyoung; Dolphin, David [Univ. of British Columbia, Columbia (Canada)

    2014-06-15

    Dichloromethane liquid droplets containing a cobalt dipyrromethene trimer deposited on a graphite surface were found to form coffee ring, toroid ring, or volcano dot structures due to the redistribution of the solute during solvent evaporation. The shapes and size distributions of the ring structures depended on the drying temperature. The shape differences were attributed to the fact that the solvent evaporation rate controlled the self-assembly process that yielded the coffee stain and pinhole structures.

  20. Structural disorder in metallic glass-forming liquids.

    Science.gov (United States)

    Pan, Shao-Peng; Feng, Shi-Dong; Wang, Li-Min; Qiao, Jun-Wei; Niu, Xiao-Feng; Dong, Bang-Shao; Wang, Wei-Min; Qin, Jing-Yu

    2016-06-09

    We investigated structural disorder by a new structural parameter, quasi-nearest atom (QNA), in atomistic configurations of eight metallic glass-forming systems generated through molecular dynamics simulations at various temperatures. Structural analysis reveals that the scaled distribution of the number of QNA appears to be an universal property of metallic liquids and the spatial distribution of the number of QNA displays to be clearly heterogeneous. Furthermore, the new parameter can be directly correlated with potential energy and structural relaxation at the atomic level. Some straightforward relationships between QNA and other properties (per-atom potential energy and α-relaxation time) are introduced to reflect structure-property relationship in metallic liquids. We believe that the new structural parameter can well reflect structure disorder in metallic liquids and play an important role in understanding various properties in metallic liquids.

  1. Calibrated and Interactive Modelling of Form-Active Hybrid Structures

    DEFF Research Database (Denmark)

    Quinn, Gregory; Holden Deleuran, Anders; Piker, Daniel

    2016-01-01

    Form-active hybrid structures (FAHS) couple two or more different structural elements of low self weight and low or negligible bending flexural stiffness (such as slender beams, cables and membranes) into one structural assembly of high global stiffness. They offer high load-bearing capacity...... software packages which introduce interruptions and data exchange issues in the modelling pipeline. The mechanical precision, stability and open software architecture of Kangaroo has facilitated the development of proof-of-concept modelling pipelines which tackle this challenge and enable powerful...... materially-informed sketching. Making use of a projection-based dynamic relaxation solver for structural analysis, explorative design has proven to be highly effective....

  2. Exploratory Topology Modelling of Form-Active Hybrid Structures

    DEFF Research Database (Denmark)

    Holden Deleuran, Anders; Pauly, Mark; Tamke, Martin

    2016-01-01

    The development of novel form-active hybrid structures (FAHS) is impeded by a lack of modelling tools that allow for exploratory topology modelling of shaped assemblies. We present a flexible and real-time computational design modelling pipeline developed for the exploratory modelling of FAHS...... that enables designers and engineers to iteratively construct and manipulate form-active hybrid assembly topology on the fly. The pipeline implements Kangaroo2's projection-based methods for modelling hybrid structures consisting of slender beams and cable networks. A selection of design modelling sketches...

  3. QuikForm: Intelligent deformation processing of structural alloys

    Energy Technology Data Exchange (ETDEWEB)

    Bourcier, R.J.; Wellman, G.W.

    1994-09-01

    There currently exists a critical need for tools to enhance the industrial competitiveness and agility of US industries involved in deformation processing of structural alloys. In response to this need, Sandia National Laboratories has embarked upon the QuikForm Initiative. The goal of this program is the development of computer-based tools to facilitate the design of deformation processing operations. The authors are currently focusing their efforts on the definition/development of a comprehensive system for the design of sheet metal stamping operations. The overall structure of the proposed QuikForm system is presented, and the focus of their thrust in each technical area is discussed.

  4. New forms of inequality and structures of glam-capitalism

    OpenAIRE

    IVANOV DMITRY

    2016-01-01

    The long history of capitalism can be interpreted as an evolution driven by permanently mutating socioeconomic structures. The article is devoted to new forms of inequality that emerged during the postindustrial phase of the capitalism evolution and increase the structural complexity of contemporary societies. The spatial configuration of inequality transforms while globalization has resulted not in the ‘world society’ but rather in a transnational network of the globality enclaves: the large...

  5. Decision structures in franchise systems of the plural form

    OpenAIRE

    Kranz, Sebastian; Lewin-Solomons, Shira B.

    2008-01-01

    Many successful franchise chains directly own a positive fraction of stores --- a structure referred to as plural form. We propose that this ownership structure is chosen as a commitment not to expropriate franchisees. The theoretical model is based on an empirical analysis of contract and interview data from the US fast-food sector and well known stylized facts: First, franchisees typically have strong contractual obligations to implement activities selected by the chain. Second, franchisees...

  6. Probabilistic Seismic Performance Model for Tunnel Form Concrete Building Structures

    Directory of Open Access Journals (Sweden)

    S. Bahram Beheshti Aval

    2016-12-01

    Full Text Available Despite widespread construction of mass-production houses with tunnel form structural system across the world, unfortunately no special seismic code is published for design of this type of construction. Through a literature survey, only a few studies are about the seismic behavior of this type of structural system. Thus based on reasonable numerical results, the seismic performance of structures constructed with this technique considering the effective factors on structural behavior is highly noteworthy in a seismic code development process. In addition, due to newness of this system and observed damages in past earthquakes, and especially random nature of future earthquakes, the importance of probabilistic approach and necessity of developing fragility curves in a next generation Performance Based Earthquake Engineering (PBEE frame work are important. In this study, the seismic behavior of 2, 5 and 10 story tunnel form structures with a regular plan is examined. First, the performance levels of these structures under the design earthquake (return period of 475 years with time history analysis and pushover method are assessed, and then through incremental dynamic analysis, fragility curves are extracted for different levels of damage in walls and spandrels. The results indicated that the case study structures have high capacity and strength and show appropriate seismic performance. Moreover, all three structures subjected were in immediate occupancy performance level.

  7. Form factors and structure functions of hadrons in parton model

    International Nuclear Information System (INIS)

    Volkonskij, N.Yu.

    1979-01-01

    The hadron charge form factors and their relation to the deep-inelastic lepton-production structure functions in the regions of asymptotically high and small momentum transfer Q 2 are studied. The nucleon and pion charge radii are calculated. The results of calculations are in good agreement with the experimental data. The K- and D-meson charge radii are estimated. In the region of asymptotically high Q 2 the possibility of Drell-Yan-West relation violation is analyzed. It is shown, that for pseudoscalar mesons this relation is violated. The relation between the proton and neutron form factor asymptotics is obtained

  8. Multi-Scalar Modelling for Free-form Timber Structures

    DEFF Research Database (Denmark)

    Poinet, Paul; Nicholas, Paul; Tamke, Martin

    2016-01-01

    .The research explores the design probe of free-form structures composed of glue-laminated timber beams and looks at the different types of data that need to be shared among each discipline and across multiple scales from which different levels of resolution can be defined. A particular focus lies...... in the segmentation strategy of glue-laminated timber structures that depend on structural requirements and the different types of constraints related to fabrication, transportation and assembly. Where current working practices decouple segmentation processes within a discrete digital workflow, this research aims...... and techniques as a means to work within a continuous design environment in which an abstract network of timber beams is iteratively updated through geometrical and structural optimizations at different levels of resolution....

  9. Salt-occluded zeolite waste forms: Crystal structures and transformability

    International Nuclear Information System (INIS)

    Richardson, J.W. Jr.

    1996-01-01

    Neutron diffraction studies of salt-occluded zeolite and zeolite/glass composite samples, simulating nuclear waste forms loaded with fission products, have revealed complex structures, with cations assuming the dual roles of charge compensation and occlusion (cluster formation). These clusters roughly fill the 6--8 angstrom diameter pores of the zeolites. Samples are prepared by equilibrating zeolite-A with complex molten Li, K, Cs, Sr, Ba, Y chloride salts, with compositions representative of anticipated waste systems. Samples prepared using zeolite 4A (which contains exclusively sodium cations) as starting material are observed to transform to sodalite, a denser aluminosilicate framework structure, while those prepared using zeolite 5A (sodium and calcium ions) more readily retain the zeolite-A structure. Because the sodalite framework pores are much smaller than those of zeolite-A, clusters are smaller and more rigorously confined, with a correspondingly lower capacity for waste containment. Details of the sodalite structures resulting from transformation of zeolite-A depend upon the precise composition of the original mixture. The enhanced resistance of salt-occluded zeolites prepared from zeolite 5A to sodalite transformation is thought to be related to differences in the complex chloride clusters present in these zeolite mixtures. Data relating processing conditions to resulting zeolite composition and structure can be used in the selection of processing parameters which lead to optimal waste forms

  10. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  11. Cellular structure formed by ion-implantation-induced point defect

    International Nuclear Information System (INIS)

    Nitta, N.; Taniwaki, M.; Hayashi, Y.; Yoshiie, T.

    2006-01-01

    The authors have found that a cellular defect structure is formed on the surface of Sn + ion implanted GaSb at a low temperature and proposed its formation mechanism based on the movement of the induced point defects. This research was carried out in order to examine the validity of the mechanism by clarifying the effect of the mobility of the point defects on the defect formation. The defect structure on the GaSb surfaces implanted at cryogenic temperature and room temperature was investigated by scanning electron microscopy (SEM) and cross-sectional transmission electron microscopy (TEM) observation. In the sample implanted at room temperature, the sponge-like structure (a pileup of voids) was formed and the cellular structure, as observed at a low temperature, did not develop. This behavior was explained by the high mobility of the vacancies during implantation at room temperature, and the proposed idea that the defect formation process is dominated by the induced point defects was confirmed

  12. Structure of the orthorhombic form of human inosine triphosphate pyrophosphatase

    International Nuclear Information System (INIS)

    Porta, Jason; Kolar, Carol; Kozmin, Stanislav G.; Pavlov, Youri I.; Borgstahl, Gloria E. O.

    2006-01-01

    X-ray crystallographic analysis of human inosine triphosphate pyrophosphohydrolase provided the secondary structure and active-site structure at 1.6 Å resolution in an orthorhombic crystal form. The structure gives a framework for future structure–function studies employing site-directed mutagenesis and for the identification of substrate/product-binding sites. The structure of human inosine triphosphate pyrophosphohydrolase (ITPA) has been determined using diffraction data to 1.6 Å resolution. ITPA contributes to the accurate replication of DNA by cleansing cellular dNTP pools of mutagenic nucleotide purine analogs such as dITP or dXTP. A similar high-resolution unpublished structure has been deposited in the Protein Data Bank from a monoclinic and pseudo-merohedrally twinned crystal. Here, cocrystallization of ITPA with a molar ratio of XTP appears to have improved the crystals by eliminating twinning and resulted in an orthorhombic space group. However, there was no evidence for bound XTP in the structure. Comparison with substrate-bound NTPase from a thermophilic organism predicts the movement of residues within helix α1, the loop before α6 and helix α7 to cap off the active site when substrate is bound

  13. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Science.gov (United States)

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  14. Catalyst support structure, catalyst including the structure, reactor including a catalyst, and methods of forming same

    Science.gov (United States)

    Van Norman, Staci A.; Aston, Victoria J.; Weimer, Alan W.

    2017-05-09

    Structures, catalysts, and reactors suitable for use for a variety of applications, including gas-to-liquid and coal-to-liquid processes and methods of forming the structures, catalysts, and reactors are disclosed. The catalyst material can be deposited onto an inner wall of a microtubular reactor and/or onto porous tungsten support structures using atomic layer deposition techniques.

  15. Nuclear reactor structural material forming less radioactive corrosion product

    International Nuclear Information System (INIS)

    Nakazawa, Hiroshi.

    1988-01-01

    Purpose: To provide nuclear reactor structural materials forming less radioactive corrosion products. Constitution: Ni-based alloys such as inconel alloy 718, 600 or inconel alloy 750 and 690 having excellent corrosion resistance and mechanical property even in coolants at high temperature and high pressure have generally been used as nuclear reactor structural materials. However, even such materials yield corrosion products being attacked by coolants circulating in the nuclear reactor, which produce by neutron irradiation radioactive corrosion products, that are deposited in primary circuit pipeways to constitute exposure sources. The present invention dissolves dissolves this problems by providing less activating nuclear reactor structural materials. That is, taking notice on the fact that Ni-58 contained generally by 68 % in Ni changes into Co-58 under irradiation of neutron thereby causing activation, the surface of nuclear reactor structural materials is applied with Ni plating by using Ni with a reduced content of Ni-58 isotopes. Accordingly, increase in the radiation level of the nuclear reactor structural materials can be inhibited. (K.M.)

  16. Microtunneling techniques to form an insitu barrier around existing structures

    International Nuclear Information System (INIS)

    Coller, P.J.; Abbott, D.G.

    1994-01-01

    The use of microtunneling techniques to construct underground structures has been available for many years. The technique, typically termed pipe roofing, is well proven and, to date, has been used principally to form underground access under existing structures where the use of cut and cover or conventional tunneling techniques was either impossible or too expensive. The first project involving the use of Iseki equipment, the first use of the pipe roofing technique as far as we are aware, was in 1971. This was followed by a number of projects in Japan, together with projects in Singapore and Hong Kong, totaling 12 projects. More recently, projects have been completed in Singapore and Japan and are currently in progress in Japan and Malaysia. This paper will briefly describe the use of the technique and the use of the new Iseki Unclemole for hard rock excavation to construct the largest pipe roof project ever undertaken in the world, together with other projects. The pipe roofing technique allows the construction of underground structures, in a variety of shapes and forms, by the use of remotely operated microtunnel machines. The paper will describe the potential application of this technique in the areas of hazardous and nuclear waste management

  17. Structuring free form verbal descriptions in equipment failure reports

    International Nuclear Information System (INIS)

    Huzdovich, J.

    1983-01-01

    Information is encoded for convenience in computer sort/search routines used to manage a large number of records. The codes in use for equipment failure reports are limited due to practical considerations, and this limitation forces the reporter to leave out information to satisfy the coding requirements. The free form verbal descriptions, as found in the Generating Availability Data System (GADS) and the Nuclear Plant Reliability Data System (NPRDS), allow for reporting of this non-codable information. A systematic approach to constructing the verbal description based on rules of grammar, especially syntax, results in a structured narrative suitable for computer data management schemes. In addition, the reporter has a full range of descriptive terminology and does not have to select subjectively from a predetermined, limited vocabulary to describe the event. This paper introduces a concept that places in perspective the integration of structured, formal reporting and free form verbal description. A second benefit of this structured narrative is the systematic development of failure mode/failure cause relationships in the event

  18. Nucleon Structure and Hyperon Form Factors from Lattice QCD.

    Energy Technology Data Exchange (ETDEWEB)

    Lin,H.W.

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point. to be 1.23(5), consistent with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(2G), consistent with the Adelaide-JLab Collaboration's result. The hyperon {Sigma} and {Xi} axial coupling constants are also performed for the first time in a lattice calculation, g{sub {Sigma}{Sigma}} = 0.441(14) and g{sub {Xi}{Xi}} = -0.277(11).

  19. Nucleon Structure and hyperon form factors from lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Huey-Wen

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point to be 1.23(5), consistant with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(26), consistent with the Adelaide-JLab Collaboration's result. The hyperon Sigma and Xi axial coupling constants are also performed for the first time in a lattice calculation, g_SigmaSigma = 0.441(14) and g_XiXi = -0.277(11).

  20. Structure of initial crystals formed during human amelogenesis

    Science.gov (United States)

    Cuisinier, F. J. G.; Voegel, J. C.; Yacaman, J.; Frank, R. M.

    1992-02-01

    X-ray diffraction analysis revealed only the existence of carbonated hydroxyapatite (c.HA) during amelogenesis, whereas conventional transmission electron microscopy investigations showed that developing enamel crystals have a ribbon-like habit. The described compositional changes could be an indication for the presence of minerals different from c.HA. However, the absence of identification of such a mineral shows the need of studies by high resolution electron microscopy (HREM) of initial formed human enamel crystals. We demonstrate the existence of two crystal families involved in the early stages of biomineralization: (a) nanometer-size particles which appeared as a precursor phase; (b) ribbon-like crystals, with a structure closely related to c.HA, which by a progressive thickening process tend to attain the mature enamel crystal habit.

  1. Cationic Phospholipids Forming Cubic Phases: Lipoplex Structure and Transfection Efficiency

    Energy Technology Data Exchange (ETDEWEB)

    Koynova, Rumiana; Wang, Li; MacDonald, Robert C. (NWU)

    2008-10-29

    The transfection activity and the phase behavior of two novel cationic O-alkyl-phosphatidylcholines, 1,2-dioleoyl-sn-glycero-3-hexylphosphocholine (C6-DOPC) and 1,2-dierucoyl-sn-glycero-3-ethylphosphocholine (di22:1-EPC), have been examined with the aim of more completely understanding the mechanism of lipid-mediated DNA delivery. Both lipids form cubic phases: C6-DOPC in the entire temperature range from -10 to 90 C, while di22:1-EPC exhibits an irreversible lamellar-cubic transition between 50 and 70 C on heating. The lipoplexes formed by C6-DOPC arrange into hexagonal phase, while the lipoplexes of di22:1-EPC are lamellar. Both lipids exhibit lower transfection activity than the lamellar-forming 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (EDOPC). Thus, for the studied cationic phospholipid-DNA systems, the lipoplex phase state is a factor that does not seem to correlate with transfection activity. The parameter that exhibits better correlation with the transfection activity within the present data set is the phase state of the lipid dispersion prior to the addition of DNA. Thus, the lamellar lipid dispersion (EDOPC) produces more efficient lipoplexes than the dispersion with coexisting lamellar and cubic aggregates (diC22:1-EPC), which is even more efficient than the purely cubic dispersions (C6-DOPC; diC22:1-EPC after heating). It could be inferred from these data and from previous research that cubic phase lipid aggregates are unlikely to be beneficial to transfection. The lack of correlation between the phase state of lipoplexes and their transfection activity observed within the present data set does not mean that lipid phase state is generally unimportant for lipofection: a viewpoint now emerging from our previous studies is that the critical factor in lipid-mediated transfection is the structural evolution of lipoplexes within the cell, upon interacting and mixing with cellular lipids.

  2. Cationic phospholipids forming cubic phases: lipoplex structure and transfection efficiency.

    Science.gov (United States)

    Koynova, Rumiana; Wang, Li; Macdonald, Robert C

    2008-01-01

    The transfection activity and the phase behavior of two novel cationic O-alkyl-phosphatidylcholines, 1,2-dioleoyl- sn-glycero-3-hexylphosphocholine (C6-DOPC) and 1,2-dierucoyl- sn-glycero-3-ethylphosphocholine (di22:1-EPC), have been examined with the aim of more completely understanding the mechanism of lipid-mediated DNA delivery. Both lipids form cubic phases: C6-DOPC in the entire temperature range from -10 to 90 degrees C, while di22:1-EPC exhibits an irreversible lamellar-cubic transition between 50 and 70 degrees C on heating. The lipoplexes formed by C6-DOPC arrange into hexagonal phase, while the lipoplexes of di22:1-EPC are lamellar. Both lipids exhibit lower transfection activity than the lamellar-forming 1,2-dioleoyl- sn-glycero-3-ethylphosphocholine (EDOPC). Thus, for the studied cationic phospholipid-DNA systems, the lipoplex phase state is a factor that does not seem to correlate with transfection activity. The parameter that exhibits better correlation with the transfection activity within the present data set is the phase state of the lipid dispersion prior to the addition of DNA. Thus, the lamellar lipid dispersion (EDOPC) produces more efficient lipoplexes than the dispersion with coexisting lamellar and cubic aggregates (diC22:1-EPC), which is even more efficient than the purely cubic dispersions (C6-DOPC; diC22:1-EPC after heating). It could be inferred from these data and from previous research that cubic phase lipid aggregates are unlikely to be beneficial to transfection. The lack of correlation between the phase state of lipoplexes and their transfection activity observed within the present data set does not mean that lipid phase state is generally unimportant for lipofection: a viewpoint now emerging from our previous studies is that the critical factor in lipid-mediated transfection is the structural evolution of lipoplexes within the cell, upon interacting and mixing with cellular lipids.

  3. THE STRUCTURE OF THE STAR-FORMING CLUSTER RCW 38

    Energy Technology Data Exchange (ETDEWEB)

    Winston, E. [ESA-ESTEC (SRE-SA), Keplerlaan 1, 2201 AZ Noordwijk ZH (Netherlands); Wolk, S. J.; Bourke, T. L.; Spitzbart, B. [Harvard Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Megeath, S. T. [Ritter Observatory, Department of Physics and Astronomy, University of Toledo, 2801 West Bancroft Avenue, Toledo, OH 43606 (United States); Gutermuth, R., E-mail: ewinston@rssd.esa.int [Five Colleges Astronomy Department, Smith College, Northampton, MA 01027 (United States)

    2011-12-20

    We present a study of the structure of the high-mass star-forming region RCW 38 and the spatial distribution of its young stellar population. Spitzer Infrared Array Camera (IRAC) photometry (3-8 {mu}m) is combined with Two Micron All Sky Survey near-IR data to identify young stellar objects (YSOs) by IR-excess emission from their circumstellar material. Chandra X-ray data are used to identify class III pre-main-sequence stars lacking circumstellar material. We identify 624 YSOs: 23 class 0/I and 90 flat spectrum protostars, 437 class II stars, and 74 class III stars. We also identify 29 (27 new) O star candidates over the IRAC field. Seventy-two stars exhibit IR-variability, including 7 class 0/I and 12 flat spectrum YSOs. A further 177 tentative candidates are identified by their location in the IRAC [3.6] versus [3.6]-[5.8] color-magnitude diagram. We find strong evidence of subclustering in the region. Three subclusters were identified surrounding the central cluster, with massive and variable stars in each subcluster. The central region shows evidence of distinct spatial distributions of the protostars and pre-main-sequence stars. A previously detected IR cluster, DB2001{sub O}bj36, has been established as a subcluster of RCW 38. This suggests that star formation in RCW 38 occurs over a more extended area than previously thought. The gas-to-dust ratio is examined using the X-ray derived hydrogen column density, N{sub H} and the K-band extinction, and found to be consistent with the diffuse interstellar medium, in contrast with Serpens and NGC 1333. We posit that the high photoionizing flux of massive stars in RCW 38 affects the agglomeration of the dust grains.

  4. Mycobacterium tuberculosis DinG is a structure-specific helicase that unwinds G4 DNA: implications for targeting G4 DNA as a novel therapeutic approach.

    Science.gov (United States)

    Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh

    2014-09-05

    The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Integrable couplings of relativistic Toda lattice systems in polynomial form and rational form, their hierarchies and bi-Hamiltonian structures

    Energy Technology Data Exchange (ETDEWEB)

    Xu Xixiang [College of Science, Shandong University of Science and Technology, Qingdao 266510 (China)], E-mail: xixiang_xu@yahoo.com.cn

    2009-10-02

    Integrable couplings of relativistic Toda lattice systems in polynomial form and rational form, and their hierarchies, are derived from a four-by-four discrete matrix eigenvalue problem. The bi-Hamiltonian structure for every integrable coupling in the two hierarchies obtained is established by means of the discrete variational identity. Ultimately, Liouvolle integrability of the obtained integrable couplings is demonstrated.

  6. Structure and applications of point form relativistic quantum mechanics

    International Nuclear Information System (INIS)

    Klink, W.H.

    2003-01-01

    The framework of point form relativistic quantum mechanics is used to construct mass and current operators for hadronic systems with finite degree of freedom. For the point form all of the interactions are in the four-momentum operator and, since Lorentz transformations are kinematic, the theory is manifestly covariant. In the Bakamjian-Thomas version of the point form the four-momentum operator is written as a product of the four-velocity operator and mass operator, where the mass operator is the sum of free and interacting mass operators. Interacting mass operators can be constructed from vertices, matrix elements of local field operators evaluated at the space-time point zero, where the states are eigenstates of the four-velocity. Applications include the study of the spectra and widths of vector mesons, viewed as bound states of quark-antiquark pairs. Besides mass operators, current operators are needed to compute form factors. Form factors are matrix elements of current operators on mass operator eigenstates and are often calculated with one-body current operators (in the point form this is called the point form spectator approximation); but in a properly relativistic theory there must also be many-body current operators. Minimal currents needed to satisfy current conservation in the presence of hadronic interactions (called dynamically determined currents) are shown to be easily calculated in the point form. (author)

  7. EXPLOSIVE FORMING – ECONOMICAL TECHNOLOGY FOR AEROSPACE STRUCTURES

    Directory of Open Access Journals (Sweden)

    Niculae MARIN

    2010-12-01

    Full Text Available The explosive forming represents a technological alternative for obtaining small-lot parts,with inexpensive and efficient manufacturing preparation. The explosive forming processing methodspresent a series of important advantages, being recommended for the wide-scale application in theaerospace industry. The economic benefit varies from case to case, independent from the part type,manufacturing series and user.

  8. EXPLOSIVE FORMING – ECONOMICAL TECHNOLOGY FOR AEROSPACE STRUCTURES

    OpenAIRE

    Niculae MARIN; Victor GHIZDAVU

    2010-01-01

    The explosive forming represents a technological alternative for obtaining small-lot parts,with inexpensive and efficient manufacturing preparation. The explosive forming processing methodspresent a series of important advantages, being recommended for the wide-scale application in theaerospace industry. The economic benefit varies from case to case, independent from the part type,manufacturing series and user.

  9. Hospital board structure: changing form and changing issues.

    Science.gov (United States)

    Tregoning, S

    2000-01-01

    Economic and social pressures are compelling many hospitals to consider their current board structure in an effort to position their hospital to meet changing demands. A national profile of the structures of hospital boards has been compiled from a questionnaire completed by hospital board representatives from both government and non-government sectors. Results show that hospital board structures are a hybrid of both philanthropic and corporate models. New structures may be required to meet future challenges. In developing new structures, consideration should be given to identifying the skills and processes required to undertake board business.

  10. Spatial and kinematic structure of Monoceros star-forming region

    Science.gov (United States)

    Costado, M. T.; Alfaro, E. J.

    2018-05-01

    The principal aim of this work is to study the velocity field in the Monoceros star-forming region using the radial velocity data available in the literature, as well as astrometric data from the Gaia first release. This region is a large star-forming complex formed by two associations named Monoceros OB1 and OB2. We have collected radial velocity data for more than 400 stars in the area of 8 × 12 deg2 and distance for more than 200 objects. We apply a clustering analysis in the subspace of the phase space formed by angular coordinates and radial velocity or distance data using the Spectrum of Kinematic Grouping methodology. We found four and three spatial groupings in radial velocity and distance variables, respectively, corresponding to the Local arm, the central clusters forming the associations and the Perseus arm, respectively.

  11. Effect of temperature on crack initiation in gas formed structures

    Energy Technology Data Exchange (ETDEWEB)

    Gohari, S.; Vrcelj, Z.; Sharifi, S.; Sharifishourabi, G.; Abadi, R. [Universiti Teknlogi Malaysia, Skudai (Malaysia)

    2013-12-15

    In the gas forming process, the work piece is formed by applying gas pressure. However, the gas pressure and the accompanying gas temperature can result in crack initiation and unstable crack growth. Thus, it is vital to determine the critical values of applied gas pressure and temperature to avoid crack and fracture failure. We studied the mechanism of fracture using an experimental approach and finite element simulations of a perfect aluminum sheet containing no inclusions and voids. The definition of crack was based on ductile damage mechanics. For inspection of initiation of crack and rupture in gas-metal forming, the ABAQUS/EXPLICIT simulation was used. In gas forming, the applied load is the pressure applied rather than the punching force. The results obtained from both the experimental approach and finite element simulations were compared. The effects of various parameters, such as temperature and gas pressure value on crack initiation, were taken into account.

  12. Crystal structure of inactive form of Rab3B

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wei [Hubei Key Laboratory of Genetic Regulation and Integrative Biology, College of Life Science, Huazhong Normal University, Wuhan 430079 (China); Shen, Yang [Structural Genomics Consortium, University of Toronto, 101 College St., Toronto, Ontario, Canada M5G 1L7 (Canada); Jiao, Ronghong [Department of Function Inspection, Hebei Provincial People' s Hospital, Shijiazhuang 050051 (China); Liu, Yanli; Deng, Lingfu [Hubei Key Laboratory of Genetic Regulation and Integrative Biology, College of Life Science, Huazhong Normal University, Wuhan 430079 (China); Qi, Chao, E-mail: qichao@mail.ccnu.edu.cn [Hubei Key Laboratory of Genetic Regulation and Integrative Biology, College of Life Science, Huazhong Normal University, Wuhan 430079 (China)

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer This is the first structural information of human Rab3B. Black-Right-Pointing-Pointer To provides a structural basis for the GDP/GTP switch in controlling the activity of Rab3. Black-Right-Pointing-Pointer The charge distribution of Rab3B indicates its unique roles in vesicular trafficking. -- Abstract: Rab proteins are the largest family of ras-related GTPases in eukaryotic cells. They act as directional molecular switches at membrane trafficking, including vesicle budding, cargo sorting, transport, tethering, and fusion. Here, we generated and crystallized the Rab3B:GDP complex. The structure of the complex was solved to 1.9 A resolution and the structural base comparison with other Rab3 members provides a structural basis for the GDP/GTP switch in controlling the activity of small GTPase. The comparison of charge distribution among the members of Rab3 also indicates their different roles in vesicular trafficking.

  13. Crystal structure of inactive form of Rab3B

    International Nuclear Information System (INIS)

    Zhang, Wei; Shen, Yang; Jiao, Ronghong; Liu, Yanli; Deng, Lingfu; Qi, Chao

    2012-01-01

    Highlights: ► This is the first structural information of human Rab3B. ► To provides a structural basis for the GDP/GTP switch in controlling the activity of Rab3. ► The charge distribution of Rab3B indicates its unique roles in vesicular trafficking. -- Abstract: Rab proteins are the largest family of ras-related GTPases in eukaryotic cells. They act as directional molecular switches at membrane trafficking, including vesicle budding, cargo sorting, transport, tethering, and fusion. Here, we generated and crystallized the Rab3B:GDP complex. The structure of the complex was solved to 1.9 Å resolution and the structural base comparison with other Rab3 members provides a structural basis for the GDP/GTP switch in controlling the activity of small GTPase. The comparison of charge distribution among the members of Rab3 also indicates their different roles in vesicular trafficking.

  14. Nucleon quark structure and strong meson-nucleon form factors

    International Nuclear Information System (INIS)

    Efimov, G.V.; Ivanov, M.A.

    1987-01-01

    The nucleon is considered as a three-quark system in virton-quark model. The main statistic properties of proton and neutron are calculated: magnetic moments, electromagnetic radii, G A /G V ratio in weak neutron decay. Strong meson-nucleon form factors which determine nucleon-nucleon potential are obtained as a function of squared transfer momentum of mesons. The results are compared with phenomenological form factors used for description of phases of NN-scattering in the one-boson-, exchange model

  15. Ectoparasites and endoparasites of fish form networks with different structures.

    Science.gov (United States)

    Bellay, S; DE Oliveira, E F; Almeida-Neto, M; Mello, M A R; Takemoto, R M; Luque, J L

    2015-06-01

    Hosts and parasites interact with each other in a variety of ways, and this diversity of interactions is reflected in the networks they form. To test for differences in interaction patterns of ecto- and endoparasites we analysed subnetworks formed by each kind of parasites and their host fish species in fish-parasite networks for 22 localities. We assessed the proportion of parasite species per host species, the relationship between parasite fauna composition and host taxonomy, connectance, nestedness and modularity of each subnetwork (n = 44). Furthermore, we evaluated the similarity in host species composition among modules in ecto- and endoparasite subnetworks. We found several differences between subnetworks of fish ecto- and endoparasites. The association with a higher number of host species observed among endoparasites resulted in higher connectance and nestedness, and lower values of modularity in their subnetworks than in those of ectoparasites. Taxonomically related host species tended to share ecto- or endoparasites with the same interaction intensity, but the species composition of hosts tended to differ between modules formed by ecto- and endoparasites. Our results suggest that different evolutionary and ecological processes are responsible for organizing the networks formed by ecto- and endoparasites and fish.

  16. THE STRUCTURAL EVOLUTION OF FORMING AND EARLY STAGE STAR CLUSTERS

    International Nuclear Information System (INIS)

    Jaehnig, Karl O.; Da Rio, Nicola; Tan, Jonathan C.

    2015-01-01

    We study the degree of angular substructure in the stellar position distribution of young members of Galactic star-forming regions, looking for correlations with distance from cluster center, surface number density of stars, and local dynamical age. To this end we adopt the catalog of members in 18 young (∼1-3 Myr) clusters from the Massive Young Star-Forming Complex Study in Infrared and X-ray Survey and the statistical analysis of the angular dispersion parameter, δ ADP, N . We find statistically significant correlation between δ ADP, N and physical projected distance from the center of the clusters, with the centers appearing smoother than the outskirts, consistent with more rapid dynamical processing on local dynamical, free-fall or orbital timescales. Similarly, smoother distributions are seen in regions of higher surface density, or older dynamical ages. These results indicate that dynamical processing that erases substructure is already well-advanced in young, sometimes still-forming, clusters. Such observations of the dissipation of substructure have the potential to constrain theoretical models of the dynamical evolution of young and forming clusters

  17. Efficient Design And Fabrication Of Free-Form Reciprocal Structures

    DEFF Research Database (Denmark)

    Parigi, Dario; Kirkegaard, Poul Henning

    2013-01-01

    Structures based on the principle of reciprocity have been autonomously studied and used since the antiquity on the basis of different needs and purposes. The application of the principle of reciprocity requires the presence of at least two elements, at the same time both supporting and being sup...

  18. Putting Encyclopaedia Knowledge into Structural Form: Finite State Transducers Approach

    Directory of Open Access Journals (Sweden)

    Pajić Vesna

    2011-06-01

    Full Text Available In biology and functional genomics in particular, understanding the dependence and interplay between different genome and ecological characteristics of organisms is a very challenging problem. There are some public databases which combine this kind of information, but there is still much more information about microbes and other organisms that reside in unstructured and semi-structured documents, such as encyclopaedias. In this paper we present a method for extracting information from semi-structured resources, such as encyclopaedias, based on finite state transducers, consisting of two clearly distinguished phases. The first phase strongly relies on the analysis of the document structure and it is used for locating records of data in the text. The second phase is based on the finite state transducers created for extracting the data, which can be modified so as to achieve the preferred efficiency and it is used for extracting the particular characteristic from the text. We show how the two phase method is applied to the text of the encyclopaedia “Systematic Bacteriology”. A fully structured database with genotype and phenotype characteristics of organisms has been created from the encyclopaedia unstructured descriptions.

  19. Crystallization and Characterization of Galdieria sulphuraria RUBISCO in Two Crystal Forms: Structural Phase Transition Observed in P21 Crystal Form

    Directory of Open Access Journals (Sweden)

    Boguslaw Stec

    2007-10-01

    Full Text Available We have isolated ribulose-1,5-bisphosphate-carboxylase/oxygenase (RUBISCOfrom the red algae Galdieria Sulphuraria. The protein crystallized in two different crystalforms, the I422 crystal form being obtained from high salt and the P21 crystal form beingobtained from lower concentration of salt and PEG. We report here the crystallization,preliminary stages of structure determination and the detection of the structural phasetransition in the P21 crystal form of G. sulphuraria RUBISCO. This red algae enzymebelongs to the hexadecameric class (L8S8 with an approximate molecular weight 0.6MDa.The phase transition in G. sulphuraria RUBISCO leads from two hexadecamers to a singlehexadecamer per asymmetric unit. The preservation of diffraction power in a phasetransition for such a large macromolecule is rare.

  20. Structure of noncoding RNA is a determinant of function of RNA binding proteins in transcriptional regulation

    Directory of Open Access Journals (Sweden)

    Oyoshi Takanori

    2012-01-01

    Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.

  1. Electronic structures of interfacial states formed at polymeric semiconductor heterojunctions

    Science.gov (United States)

    Huang, Ya-Shih; Westenhoff, Sebastian; Avilov, Igor; Sreearunothai, Paiboon; Hodgkiss, Justin M.; Deleener, Caroline; Friend, Richard H.; Beljonne, David

    2008-06-01

    Heterojunctions between organic semiconductors are central to the operation of light-emitting and photovoltaic diodes, providing respectively for electron-hole capture and separation. However, relatively little is known about the character of electronic excitations stable at the heterojunction. We have developed molecular models to study such interfacial excited electronic excitations that form at the heterojunction between model polymer donor and polymer acceptor systems: poly(9,9-dioctylfluorene-co-bis-N,N-(4-butylphenyl)-bis-N,N-phenyl-1,4-phenylenediamine) (PFB) with poly(9,9-dioctylfluorene-co-benzothiadiazole) (F8BT), and poly(9,9-dioctylfluorene-co-N-(4-butylphenyl)diphenylamine) (TFB) with F8BT. We find that for stable ground-state geometries the excited state has a strong charge-transfer character. Furthermore, when partly covalent, modelled radiative lifetimes (~10-7s) and off-chain axis polarization (30∘) match observed `exciplex' emission. Additionally for the PFB:F8BT blend, geometries with fully ionic character are also found, thus accounting for the low electroluminescence efficiency of this system.

  2. Anisotropy of magnetoviscous effect in structure-forming ferrofluids

    Science.gov (United States)

    Sreekumari, Aparna; Ilg, Patrick

    2015-07-01

    The magnetoviscous effect, change in viscosity with change in magnetic field strength, and the anisotropy of the magnetoviscous effect, change in viscosity with orientation of magnetic field, have been a focus of interest for four decades. A satisfactory understanding of the microscopic origin of anisotropy of the magnetoviscous effect in magnetic fluids is still a matter of debate and a field of intense research. Here, we present an extensive simulation study to understand the relation between the anisotropy of the magnetoviscous effect and the underlying change in microstructures of ferrofluids. Our results indicate that field-induced chainlike structures respond very differently depending on their orientation relative to the direction of an externally applied shear flow, which leads to a pronounced anisotropy of viscosity. In this work, we focus on three exemplary values of dipolar interaction strengths which correspond to weak, intermediate, and strong interactions between dipolar colloidal particles. We compare our simulation results with an experimental study on cobalt-based ferrofluids as well as with an existing theoretical model called the chain model. A nonmonotonic behavior in the anisotropy of the magnetoviscous effect is observed with increasing dipolar interaction strength and is explained in terms of microstructure formation.

  3. Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter

    Directory of Open Access Journals (Sweden)

    Yee Hooi Min

    2016-01-01

    Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.

  4. Extracting energy and structure properties of glass-forming liquids from structural relaxation time.

    Science.gov (United States)

    Wang, Lianwen

    2012-04-18

    A comprehensive examination of the kinetic liquid model (Wang et al 2010 J. Phys.: Condens. Matter 22 455104) is carried out by fitting the structural relaxation time of 26 different glass-forming liquids in a wide temperature range, including most of the well-studied materials. Careful analysis of the compiled reported data reveals that experimental inaccuracies should not be overlooked in any 'benchmark test' of relating theories or models (e.g. in Lunkenheimer et al 2010 Phys. Rev. E 81 051504). The procedure, accuracy, ability, and efficiency of the kinetic liquid model are discussed in detail and in comparison with other available fitting methods. In general, the kinetic liquid model could be verified by 17 of the 26 compiled data sets and can serve as a meaningful approximative method for analyzing these liquids. Nonetheless, further experimental examinations in a wide temperature range are needed and are called for. Through fitting, the microscopic details of these liquids are extracted, namely, the enthalpy, entropy, and cooperativity in structural relaxation, which may facilitate further quantitative analysis to both the liquidus and glassy states of these materials.

  5. Polymorphism in phenobarbital: discovery of a new polymorph and crystal structure of elusive form V.

    Science.gov (United States)

    Roy, Saikat; Goud, N Rajesh; Matzger, Adam J

    2016-03-21

    This report highlights the discovery of a new polymorph of the anticonvulsant drug phenobarbital (PB) using polymer-induced heteronucleation (PIHn) and unravelling the crystal structure of the elusive form V. Both forms are characterized by structural, thermal and VT-Raman spectroscopy methods to elucidate phase transformation behavior and shed light on stability relationships.

  6. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Directory of Open Access Journals (Sweden)

    Charlotte Rehm

    Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  7. I-motif DNA structures are formed in the nuclei of human cells

    Science.gov (United States)

    Zeraati, Mahdi; Langley, David B.; Schofield, Peter; Moye, Aaron L.; Rouet, Romain; Hughes, William E.; Bryan, Tracy M.; Dinger, Marcel E.; Christ, Daniel

    2018-06-01

    Human genome function is underpinned by the primary storage of genetic information in canonical B-form DNA, with a second layer of DNA structure providing regulatory control. I-motif structures are thought to form in cytosine-rich regions of the genome and to have regulatory functions; however, in vivo evidence for the existence of such structures has so far remained elusive. Here we report the generation and characterization of an antibody fragment (iMab) that recognizes i-motif structures with high selectivity and affinity, enabling the detection of i-motifs in the nuclei of human cells. We demonstrate that the in vivo formation of such structures is cell-cycle and pH dependent. Furthermore, we provide evidence that i-motif structures are formed in regulatory regions of the human genome, including promoters and telomeric regions. Our results support the notion that i-motif structures provide key regulatory roles in the genome.

  8. Raman spectroscopy used for structural investigations of anodically formed ZrO2

    International Nuclear Information System (INIS)

    Koneska, Zagorka; Arsova, Irena

    2003-01-01

    The structure of the oxide formed on Zr(99% + Hf) with anodic oxidation at different potentials in 1 mol/dm 3 H 3 PO 4 and 2 mol/dm 3 KOH solutions were investigated using Raman spectroscopy. Normally the anodic oxides of Zr form only crystals. Under certain circumstances, amorphous anodic ZrO 2 can be observed. Amorphous phase is observed for the anodically formed zirconium oxides in H 3 PO 4 . The oxide formed in KOH at potential of 80 V, where sparks appears on the Zr electrode showed crystalline structure. (Original)

  9. Process for forming exoergic structures with the use of a plasma

    Science.gov (United States)

    Kelly, M.D.

    1987-05-29

    A method of forming exoergic structures, as well as exoergic structures produced by the method, is provided. The method comprises the steps of passing a plasma-forming gas through a plasma spray gun, forming a plasma spray, introducing exoergic material into the plasma spray and directing the plasma spray toward a substrate, and allowing the exoergic material to become molten in the plasma spray and to thereafter impinge on the substrate to form a solid mass of exoergic material, the shape of which corresponds to the shape of the substrate.

  10. Relating structural parameters to leachability in a glass-bonded ceramic waste form

    International Nuclear Information System (INIS)

    Frank, S. M.; Johnson, S. G.; Moschetti, T. L.

    1998-01-01

    Lattice parameters for a crystalline material can be obtained by several methods, notably by analyzing x-ray powder diffraction patterns. By utilizing a computer program to fit a pattern, one can follow the evolution or subtle changes in a structure of a crystalline species in different environments. This work involves such a study for an essential component of the ceramic waste form that is under development at Argonne National Laboratory. Zeolite 4A and zeolite 5A are used to produce two different types of waste forms: a glass-bonded sodalite and a glass-bonded zeolite, respectively. Changes in structure during production of the waste forms are discussed. Specific salt-loadings in the sodalite waste form are related to relative peak intensities of certain reflections in the XRD patterns. Structural parameters for the final waste forms will also be given and related to leachability under standard conditions

  11. Sediment concentration and bed form structures of Gulf of Cambay from remote sensing

    Digital Repository Service at National Institute of Oceanography (India)

    Kunte, P.D.

    period, the bottom currents pull sediment (sand) particles supplied by major and minor rivers, rolling along the Gulf bed. These sediments perhaps participate in the formation of bed form structures. The topography of the Gulf bottom comprises of numerous...

  12. Low resolution solution structure of the Apo form of Escherichia coli haemoglobin protease Hbp.

    NARCIS (Netherlands)

    scott, D.J.; Grossman, J.G.; Tame, J.R.H.; Byron, O.; Wilson, K.S.; Otto, B.R.

    2002-01-01

    We have studied the solution properties of the apo form of the haemoglobin protease or "haemoglobinase", Hbp, a principal component of an important iron acquisition system in pathogenic Escherichia coli. Experimental determination of secondary structure content from circular dichroism (CD)

  13. A Biomimetic Structural Form: Developing a Paradigm to Attain Vital Sustainability in Tall Architecture

    OpenAIRE

    Osama Al-Sehail

    2017-01-01

    This paper argues for sustainability as a necessity in the evolution of tall architecture. It provides a different mode for dealing with sustainability in tall architecture, taking into consideration the speciality of its typology. To this end, the article develops a Biomimetic Structural Form as a paradigm to attain Vital Sustainability. A Biomimetic Structural Form, which is derived from the amalgamation of biomimicry as an approach for sustainability defining nature as source of knowledge ...

  14. Structural studies of disordered Mg2NiH4 formed by mechanical grinding

    DEFF Research Database (Denmark)

    Rönnebro, Ewa; Jensen, Jens Oluf; Noréus, Dag

    1999-01-01

    The low temperature phase of Mg2NiH4 was mechanically ground in argon atmosphere. The ordered monoclinic structure was destroyed to form the disordered cubic structure, previously only found above 510 K. With a Guinier-Hagg X-ray camera the cell parameter was determined to be a=6.492(3) Angstrom....

  15. Structural and reduced-form modeling and forecasting with application to Armenia

    NARCIS (Netherlands)

    Poghosyan, K.

    2012-01-01

    The thesis deals with structural and reduced-form modeling and forecasting of key macroeconomic variables (real growth of GDP, inflation, exchange rate, and policy interest rate). The central part of the thesis (Chapters 2-4) consists of three chapters. Chapter 2 considers the structural DSGE model

  16. Linking structure to fragility in bulk metallic glass-forming liquids

    International Nuclear Information System (INIS)

    Wei, Shuai; Stolpe, Moritz; Gross, Oliver; Gallino, Isabella; Hembree, William; Busch, Ralf; Evenson, Zach; Bednarcik, Jozef; Kruzic, Jamie J.

    2015-01-01

    Using in-situ synchrotron X-ray scattering, we show that the structural evolution of various bulk metallic glass-forming liquids can be quantitatively connected to their viscosity behavior in the supercooled liquid near T g . The structural signature of fragility is identified as the temperature dependence of local dilatation on distinct key atomic length scales. A more fragile behavior results from a more pronounced thermally induced dilatation of the structure on a length scale of about 3 to 4 atomic diameters, coupled with shallower temperature dependence of structural changes in the nearest neighbor environment. These findings shed light on the structural origin of viscous slowdown during undercooling of bulk metallic glass-forming liquids and demonstrate the promise of predicting the properties of bulk metallic glasses from the atomic scale structure

  17. Linking structure to fragility in bulk metallic glass-forming liquids

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Shuai, E-mail: shuai.wei@asu.edu, E-mail: m.stolpe@mx.uni-saarland.de [Department of Materials Science and Engineering, Saarland University, Campus C63, 66123 Saarbrücken (Germany); Department of Chemistry and Biochemistry, Arizona State University, Tempe, Arizona 85287 (United States); Stolpe, Moritz, E-mail: shuai.wei@asu.edu, E-mail: m.stolpe@mx.uni-saarland.de; Gross, Oliver; Gallino, Isabella; Hembree, William; Busch, Ralf [Department of Materials Science and Engineering, Saarland University, Campus C63, 66123 Saarbrücken (Germany); Evenson, Zach [Department of Materials Science and Engineering, Saarland University, Campus C63, 66123 Saarbrücken (Germany); Institut für Materialphysik im Weltraum, Deutsches Zentrum für Luft- und Raumfahrt (DLR), 51170 Köln (Germany); Bednarcik, Jozef [Deutsches Elektronen-Synchrotron DESY, Notkestrasse 85, D-22603 Hamburg (Germany); Kruzic, Jamie J. [Material Science, School of Mechanical, Industrial, and Manufacturing Engineering, Oregon State University, Corvallis, Oregon 97331 (United States)

    2015-05-04

    Using in-situ synchrotron X-ray scattering, we show that the structural evolution of various bulk metallic glass-forming liquids can be quantitatively connected to their viscosity behavior in the supercooled liquid near T{sub g}. The structural signature of fragility is identified as the temperature dependence of local dilatation on distinct key atomic length scales. A more fragile behavior results from a more pronounced thermally induced dilatation of the structure on a length scale of about 3 to 4 atomic diameters, coupled with shallower temperature dependence of structural changes in the nearest neighbor environment. These findings shed light on the structural origin of viscous slowdown during undercooling of bulk metallic glass-forming liquids and demonstrate the promise of predicting the properties of bulk metallic glasses from the atomic scale structure.

  18. Features of ultrafine-grained structure forming in Zr-1Nb alloy

    Energy Technology Data Exchange (ETDEWEB)

    Stepanova, Ekaterina N.; Prosolov, Konstantin A. [National Research Tomsk Polytechnic University, Tomsk (Russian Federation); Grabovetskaya, Galina P.; Mishin, Ivan P. [Institute of Strength Physics and Materials Science of Siberian Branch of Russian Academy of Sciences, Tomsk (Russian Federation)

    2013-07-01

    Ultrafine-grained structure forming by the method combined reversible hydrogenation and hot pressing in Zr-1Nb alloy was investigated. Preliminary hydrogenation to concentrations of (0.14–0.4) % at 873 K is found to lead to yield strength decreasing in Zr-1Nb alloy during hot pressing by 1,5–2 times. During uniaxial compression at (70–72) % under isothermal conditions at a temperature of 873 K in Zr-1Nb alloy, hydrogenated to concentration of 0.22 %, homogeneous ultrafine grained structure with an average grain size of 0,4 P m was formed. Key words: zirconium alloy, ultrafine-grained structure, hydrogen.

  19. Methods of generalizing and classifying layer structures of a special form

    Energy Technology Data Exchange (ETDEWEB)

    Viktorova, N P

    1981-09-01

    An examination is made of the problem of classifying structures represented by weighted multilayer graphs of special form with connections between the vertices of each layer. The classification of structures of such a form is based on the construction of resolving sets of graphs as a result of generalization of the elements of the training sample of each class and the testing of whether an input object is isomorphic (with allowance for the weights) to the structures of the resolving set or not. 4 references.

  20. Thermodynamic and biological evaluation of a thrombin binding aptamer modified with several unlocked nucleic acid (UNA) monomers and a 2′-C-piperazino-UNA monomer

    DEFF Research Database (Denmark)

    Jensen, Troels B.; Henriksen, Jonas Rosager; Rasmussen, Bjarne E.

    2011-01-01

    Thrombin binding aptamer is a DNA 15-mer which forms a G-quadruplex structure and possess promising anticoagulant properties due to specific interactions with thrombin. Herein we present the influence of a single 2′-C-piperazino-UNA residue and UNA residues incorporated in several positions on th...

  1. Quantitative characterization of the atomic-scale structure of oxyhydroxides in rusts formed on steel surfaces

    International Nuclear Information System (INIS)

    Saito, M.; Suzuki, S.; Kimura, M.; Suzuki, T.; Kihira, H.; Waseda, Y.

    2005-01-01

    Quantitative X-ray structural analysis coupled with anomalous X-ray scattering has been used for characterizing the atomic-scale structure of rust formed on steel surfaces. Samples were prepared from rust layers formed on the surfaces of two commercial steels. X-ray scattered intensity profiles of the two samples showed that the rusts consisted mainly of two types of ferric oxyhydroxide, α-FeOOH and γ-FeOOH. The amounts of these rust components and the realistic atomic arrangements in the components were estimated by fitting both the ordinary and the environmental interference functions with a model structure calculated using the reverse Monte Carlo simulation technique. The two rust components were found to be the network structure formed by FeO 6 octahedral units, the network structure itself deviating from the ideal case. The present results also suggest that the structural analysis method using anomalous X-ray scattering and the reverse Monte Carlo technique is very successful in determining the atomic-scale structure of rusts formed on the steel surfaces

  2. An ontology-driven tool for structured data acquisition using Web forms.

    Science.gov (United States)

    Gonçalves, Rafael S; Tu, Samson W; Nyulas, Csongor I; Tierney, Michael J; Musen, Mark A

    2017-08-01

    Structured data acquisition is a common task that is widely performed in biomedicine. However, current solutions for this task are far from providing a means to structure data in such a way that it can be automatically employed in decision making (e.g., in our example application domain of clinical functional assessment, for determining eligibility for disability benefits) based on conclusions derived from acquired data (e.g., assessment of impaired motor function). To use data in these settings, we need it structured in a way that can be exploited by automated reasoning systems, for instance, in the Web Ontology Language (OWL); the de facto ontology language for the Web. We tackle the problem of generating Web-based assessment forms from OWL ontologies, and aggregating input gathered through these forms as an ontology of "semantically-enriched" form data that can be queried using an RDF query language, such as SPARQL. We developed an ontology-based structured data acquisition system, which we present through its specific application to the clinical functional assessment domain. We found that data gathered through our system is highly amenable to automatic analysis using queries. We demonstrated how ontologies can be used to help structuring Web-based forms and to semantically enrich the data elements of the acquired structured data. The ontologies associated with the enriched data elements enable automated inferences and provide a rich vocabulary for performing queries.

  3. Surface Structures Formed by a Copper(II Complex of Alkyl-Derivatized Indigo

    Directory of Open Access Journals (Sweden)

    Akinori Honda

    2016-10-01

    Full Text Available Assembled structures of dyes have great influence on their coloring function. For example, metal ions added in the dyeing process are known to prevent fading of color. Thus, we have investigated the influence of an addition of copper(II ion on the surface structure of alkyl-derivatized indigo. Scanning tunneling microscope (STM analysis revealed that the copper(II complexes of indigo formed orderly lamellar structures on a HOPG substrate. These lamellar structures of the complexes are found to be more stable than those of alkyl-derivatized indigos alone. Furthermore, 2D chirality was observed.

  4. Optofluidics-based DNA structure-competitive aptasensor for rapid on-site detection of lead(II) in an aquatic environment.

    Science.gov (United States)

    Long, Feng; Zhu, Anna; Wang, Hongchen

    2014-11-07

    Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Method for fabricating five-level microelectromechanical structures and microelectromechanical transmission formed

    Science.gov (United States)

    Rodgers, M. Steven; Sniegowski, Jeffry J.; Miller, Samuel L.; McWhorter, Paul J.

    2000-01-01

    A process for forming complex microelectromechanical (MEM) devices having five layers or levels of polysilicon, including four structural polysilicon layers wherein mechanical elements can be formed, and an underlying polysilicon layer forming a voltage reference plane. A particular type of MEM device that can be formed with the five-level polysilicon process is a MEM transmission for controlling or interlocking mechanical power transfer between an electrostatic motor and a self-assembling structure (e.g. a hinged pop-up mirror for use with an incident laser beam). The MEM transmission is based on an incomplete gear train and a bridging set of gears that can be moved into place to complete the gear train to enable power transfer. The MEM transmission has particular applications as a safety component for surety, and for this purpose can incorporate a pin-in-maze discriminator responsive to a coded input signal.

  6. Method for fabricating five-level microelectromechanical structures and microelectromechanical transmission formed

    Energy Technology Data Exchange (ETDEWEB)

    Rodgers, M.S.; Sniegowski, J.J.; Miller, S.L.; McWhorter, P.J.

    2000-07-04

    A process is disclosed for forming complex microelectromechanical (MEM) devices having five layers or levels of polysilicon, including four structural polysilicon layers wherein mechanical elements can be formed, and an underlying polysilicon layer forming a voltage reference plane. A particular type of MEM device that can be formed with the five-level polysilicon process is a MEM transmission for controlling or interlocking mechanical power transfer between an electrostatic motor and a self-assembling structure (e.g. a hinged pop-up mirror for use with an incident laser beam). The MEM transmission is based on an incomplete gear train and a bridging set of gears that can be moved into place to complete the gear train to enable power transfer. The MEM transmission has particular applications as a safety component for surety, and for this purpose can incorporate a pin-in-maze discriminator responsive to a coded input signal.

  7. Experiences of Social and Structural Forms of Stigma Among Chinese Immigrant Consumers with Psychosis.

    Science.gov (United States)

    Cheng, Zhen Hadassah; Tu, Ming-Che; Li, Vanessa A; Chang, Rachel W; Yang, Lawrence Hsin

    2015-12-01

    Chinese immigrants tend to rely on family and close community for support given their vulnerable societal position. Yet stigma, especially from structural and familial sources, may have a particularly harmful impact upon Chinese immigrants with psychosis. Using a descriptive analysis based upon grounded theory, we examined stigma experiences of 50 Chinese immigrant consumers with psychosis, paying particular attention to frequency, sources, and themes of social and structural stigma. Although past research indicates that family is a recipient of stigma, we found instead that family members were common perpetuators of social forms of stigma. We also found that perceptions of work deficit underlie many forms of stigma, suggesting this is "what matters most" in this community. Lack of financial resources and language barriers comprised most frequent forms of structural stigma. Anti-stigma efforts should aim to improve consumer's actual and perceived employability to target what is most meaningful in Chinese immigrant communities.

  8. Turbine airfoil with dual wall formed from inner and outer layers separated by a compliant structure

    Science.gov (United States)

    Campbell,; Christian X. , Morrison; Jay, A [Oviedo, FL

    2011-12-20

    A turbine airfoil usable in a turbine engine with a cooling system and a compliant dual wall configuration configured to enable thermal expansion between inner and outer layers while eliminating stress formation is disclosed. The compliant dual wall configuration may be formed a dual wall formed from inner and outer layers separated by a compliant structure. The compliant structure may be configured such that the outer layer may thermally expand without limitation by the inner layer. The compliant structure may be formed from a plurality of pedestals positioned generally parallel with each other. The pedestals may include a first foot attached to a first end of the pedestal and extending in a first direction aligned with the outer layer, and may include a second foot attached to a second end of the pedestal and extending in a second direction aligned with the inner layer.

  9. Organizational form, local market structure and corporate social performance in retail

    OpenAIRE

    Utgård, Jakob

    2015-01-01

    I study how organizational form and local market structure influence retail firms' corporate social performance (CSP). The theoretical model is based on agency theory, which in its origin focuses on the dyad between the principal and the agent. I extend this perspective and examine how characteristics of the environment outside the dyad influence the outcomes. Retail stores vary in their organizational form and thereby in their incentives to maximize profits. I hypothesize that the different ...

  10. Structure of the cleavage-activated prefusion form of the parainfluenza virus 5 fusion protein.

    Science.gov (United States)

    Welch, Brett D; Liu, Yuanyuan; Kors, Christopher A; Leser, George P; Jardetzky, Theodore S; Lamb, Robert A

    2012-10-09

    The paramyxovirus parainfluenza virus 5 (PIV5) enters cells by fusion of the viral envelope with the plasma membrane through the concerted action of the fusion (F) protein and the receptor binding protein hemagglutinin-neuraminidase. The F protein folds initially to form a trimeric metastable prefusion form that is triggered to undergo large-scale irreversible conformational changes to form the trimeric postfusion conformation. It is thought that F refolding couples the energy released with membrane fusion. The F protein is synthesized as a precursor (F0) that must be cleaved by a host protease to form a biologically active molecule, F1,F2. Cleavage of F protein is a prerequisite for fusion and virus infectivity. Cleavage creates a new N terminus on F1 that contains a hydrophobic region, known as the FP, which intercalates target membranes during F protein refolding. The crystal structure of the soluble ectodomain of the uncleaved form of PIV5 F is known; here we report the crystal structure of the cleavage-activated prefusion form of PIV5 F. The structure shows minimal movement of the residues adjacent to the protease cleavage site. Most of the hydrophobic FP residues are buried in the uncleaved F protein, and only F103 at the newly created N terminus becomes more solvent-accessible after cleavage. The conformational freedom of the charged arginine residues that compose the protease recognition site increases on cleavage of F protein.

  11. Research Status on Reinforcement Connection Form of Precast Concrete Shear Wall Structure

    Science.gov (United States)

    Zhang, Zhuangnan; Zhang, Yan

    2018-03-01

    With the rapid development of Chinese economy and the speeding up the process of urbanization, housing industrialization has been paid more and more attention. And the fabricated structure has been widely used in China. The key of precast concrete shear wall structure is the connection of precast components. The reinforcement connection can directly affect the entirety performance and seismic behavior of the structure. Different reinforcement connections have a great impact on the overall behavior of the structure. By studying the characteristics of the reinforcement connection forms used in the vertical connection and horizontal connection of precast concrete shear wall, it can provide reference for the research and development of the reinforcement connection forms in the future.

  12. The quadratic-form identity for constructing the Hamiltonian structure of integrable systems

    International Nuclear Information System (INIS)

    Guo Fukui; Zhang Yufeng

    2005-01-01

    A usual loop algebra, not necessarily the matrix form of the loop algebra A-tilde n-1 , is also made use of for constructing linear isospectral problems, whose compatibility conditions exhibit a zero-curvature equation from which integrable systems are derived. In order to look for the Hamiltonian structure of such integrable systems, a quadratic-form identity is created in the present paper whose special case is just the trace identity; that is, when taking the loop algebra A-tilde 1 , the quadratic-form identity presented in this paper is completely consistent with the trace identity

  13. The retro-GCN4 leucine zipper sequence forms a stable three-dimensional structure

    Science.gov (United States)

    Mittl, Peer R. E.; Deillon, Christine; Sargent, David; Liu, Niankun; Klauser, Stephan; Thomas, Richard M.; Gutte, Bernd; Grütter, Markus G.

    2000-01-01

    The question of whether a protein whose natural sequence is inverted adopts a stable fold is still under debate. We have determined the 2.1-Å crystal structure of the retro-GCN4 leucine zipper. In contrast to the two-stranded helical coiled-coil GCN4 leucine zipper, the retro-leucine zipper formed a very stable, parallel four-helix bundle, which now lends itself to further structural and functional studies. PMID:10716989

  14. Factor Structure and Psychometric Properties of the Young Schema Questionnaire (Short Form) in Chinese Undergraduate Students

    Science.gov (United States)

    Cui, Lixia; Lin, Wenwen; Oei, Tian P. S.

    2011-01-01

    This study investigated cross-cultural differences in the factor structure and psychometric properties of the Young Schema Questionnaire (short form; YSQ-SF). The participants were 712 Chinese undergraduate students. The total sample was randomly divided into two sub-samples. Exploratory Factor Analysis (EFA) was conducted on questionnaire results…

  15. The Morphology of Intermediate Structures Formed During Bainite Transformation in HSLA Steels

    Science.gov (United States)

    Seidurov, Mikhail N.; Kovalev, Sergey V.; Zubkov, Alexander S.

    2017-10-01

    The paper deals with the structure of bainite formed under the influence of thermal deformation cycles of welding in low-carbon bainitic class steels. Morphology features associated with the formation of mesoferrite and granular bainite determines the high cold resistance of welded joints.

  16. THE DECISION OF FORM FOR DIFFRACTIVE STRUCTURES IN THE PROBLEM OF SCATTERING OF RADIO WAVES.

    Directory of Open Access Journals (Sweden)

    A. P. Preobrazhensky

    2017-02-01

    Full Text Available This paper considers the problem of scattering of electromagnetic waves in different diffraction structures. The solution of the scattering problem is based on the method of integral equations. On diagrams of backscattering at various frequencies of the incident wave, the decision about the form of the object is carried out.

  17. Crystal Structure of the Oligomeric Form of Lassa Virus Matrix Protein Z.

    Science.gov (United States)

    Hastie, Kathryn M; Zandonatti, Michelle; Liu, Tong; Li, Sheng; Woods, Virgil L; Saphire, Erica Ollmann

    2016-05-01

    The arenavirus matrix protein Z is highly multifunctional and occurs in both monomeric and oligomeric forms. The crystal structure of a dodecamer of Z from Lassa virus, presented here, illustrates a ring-like structure with a highly basic center. Mutagenesis demonstrates that the dimeric interface within the dodecamer and a Lys-Trp-Lys triad at the center of the ring are important for oligomerization. This structure provides an additional template to explore the many functions of Z. The arenavirus Lassa virus causes hundreds of thousands of infections each year, many of which develop into fatal hemorrhagic fever. The arenavirus matrix protein Z is multifunctional, with at least four distinct roles. Z exists in both monomeric and oligomeric forms, each of which likely serves a specific function in the viral life cycle. Here we present the dodecameric form of Lassa virus Z and demonstrate that Z forms a "wreath" with a highly basic center. This structure and that of monomeric Z now provide a pair of critical templates by which the multiple roles of Z in the viral life cycle may be interpreted. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. A resource-based theory of market structure and organizational form

    NARCIS (Netherlands)

    van Witteloostuijn, A.; Boone, C.A.J.J.

    We argue that combining the insights from both the industrial organization and organizational ecology perspectives is likely to produce value added. We develop a resource-based theory of market structure, where resources pertain to the environmental assets (together forming the resource space)

  19. Structure, diversity and evolution of protein toxins from spore-forming entomopathogenic bacteria

    NARCIS (Netherlands)

    Maagd, de R.A.; Bravo, A.; Berry, C.; Crickmore, N.; Schnepf, H.E.

    2003-01-01

    Gram-positive spore-forming entomopathogenic bacteria can utilize a large variety of protein toxins to help them invade, infect, and finally kill their hosts, through their action on the insect midgut. These toxins belong to a number of homology groups containing a diversity of protein structures

  20. On the structure of the space of geometric product-form models

    NARCIS (Netherlands)

    Bayer, Nimrod; Boucherie, Richardus J.

    2002-01-01

    This article deals with Markovian models defined on a finite-dimensional discrete state space and possess a stationary state distribution of a product-form. We view the space of such models as a mathematical object and explore its structure. We focus on models on an orthant [script Z]+n, which are

  1. Fortuitous structure determination of ‘as-isolated’ Escherichia coli bacterioferritin in a novel crystal form

    International Nuclear Information System (INIS)

    Eerde, André van; Wolterink-van Loo, Suzanne; Oost, John van der; Dijkstra, Bauke W.

    2006-01-01

    E. coli bacterioferritin was crystallized in a novel crystal form from different conditions and the structure was solved. The crystals belonged to space group P2 1 3 and diffracted to a resolution of 2.5 Å. Escherichia coli bacterioferritin was serendipitously crystallized in a novel cubic crystal form and its structure could be determined to 2.5 Å resolution despite a high degree of merohedral twinning. This is the first report of crystallographic data on ‘as-isolated’ E. coli bacterioferritin. The ferroxidase active site contains positive difference density consistent with two metal ions that had co-purified with the protein. X-ray fluorescence studies suggest that the metal composition is different from that of previous structures and is a mix of zinc and native iron ions. The ferroxidase-centre configuration displays a similar flexibility as previously noted for other bacterioferritins

  2. Structure of a second crystal form of Bence-Jones protein Loc: Strikingly different domain associations in two crystal forms of a single protein

    International Nuclear Information System (INIS)

    Schiffer, M.; Ainsworth, C.; Xu, Z.B.; Carperos, W.; Olsen, K.; Solomon, A.; Stevens, F.J.; Chang, C.H.

    1989-01-01

    The authors have determined the structure of the immunoglobulin light-chain dimer Loc in a second crystal form that was grown from distilled water. The crystal structure was determined to 2.8-angstrom resolution; the R factor is 0.22. The two variable domains are related by local 2-fold axes and form an antigen binding pocket. The variable domain-variable domain interaction observed in this crystal form differs from the one exhibited by the protein when crystallized from ammonium sulfate in which the two variable domains formed a protrusion. The structure attained in the distilled water crystals is similar to, but not identical with, the one observed for the Mcg light-chain dimer in crystals grown from ammonium sulfate. Thus, two strikingly different structures were attained by this multisubunit protein in crystals grown under two different, commonly used, crystallization techniques. The quaternary interactions exhibited by the protein in the two crystal forms are sufficiently different to suggest fundamentally different interpretations of the structural basis for the function of this protein. This observation may have general implications regarding the use of single crystallographic determinations for detailed identification of structural and functional relationships. On the other hand, proteins whose structures can be altered by manipulation of crystallization conditions may provide useful systems for study of fundamental structural chemistry

  3. Co thin film with metastable bcc structure formed on GaAs(111 substrate

    Directory of Open Access Journals (Sweden)

    Minakawa Shigeyuki

    2014-07-01

    Full Text Available Co thin films are prepared on GaAs(111 substrates at temperatures ranging from room temperature to 600 ºC by radio-frequency magnetron sputtering. The growth behavior and the detailed resulting film structure are investigated by in-situ reflection high-energy electron diffraction and X-ray diffraction. In early stages of film growth at temperatures lower than 200 ºC, Co crystals with metastable A2 (bcc structure are formed, where the crystal structure is stabilized through hetero-epitaxial growth. With increasing the film thickness beyond 2 nm, the metastable structure starts to transform into more stable A1 (fcc structure through atomic displacements parallel to the A2{110} close-packed planes. The crystallographic orientation relationship between the A2 and the transformed A1 crystals is A1{111} || A2{110}. When the substrate temperature is higher than 400 ºC, Ga atoms of substrate diffuse into the Co films and a Co-Ga alloy with bcc-based ordered structure of B2 is formed.

  4. Self-selection in size and structure in argon clusters formed on amorphous carbon

    Energy Technology Data Exchange (ETDEWEB)

    Krainyukova, Nina V.; Waal, Benjamin W. van de

    2004-07-01

    Argon clusters formed on an amorphous carbon substrate as deposited from the vapor phase were studied by means of transmission high energy electron diffraction using the liquid helium cryostat. Electron diffractograms were analysed on the basis of assumption that there exist a cluster size distribution in samples formed on substrate and multi-shell structures such as icosahedra, decahedra, fcc and hcp were probed for different sizes up to {approx}15 000 atoms. The experimental data were considered as a result of a superposition of diffracted intensities from clusters of different sizes and structures. The comparative analysis was based on the R-factor minimization that was found to be equal to 0.014 for the best fit between experiment and modelling. The total size and structure distribution function shows the presence of 'non-crystallographic' structures such as icosahedra and decahedra with five-fold symmetry that was found to prevail and a smaller amount of fcc and hcp structures. Possible growth mechanisms as well as observed general tendency to self-selection in sizes and structures are presumably governed by confined pore-like geometry in an amorphous carbon substrate.

  5. Backbone modified TBA analogues endowed with antiproliferative activity.

    Science.gov (United States)

    Esposito, Veronica; Russo, Annapina; Amato, Teresa; Varra, Michela; Vellecco, Valentina; Bucci, Mariarosaria; Russo, Giulia; Virgilio, Antonella; Galeone, Aldo

    2017-05-01

    The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Structural origin of fractional Stokes-Einstein relation in glass-forming liquids.

    Science.gov (United States)

    Pan, Shaopeng; Wu, Z W; Wang, W H; Li, M Z; Xu, Limei

    2017-01-06

    In many glass-forming liquids, fractional Stokes-Einstein relation (SER) is observed above the glass transition temperature. However, the origin of such phenomenon remains elusive. Using molecular dynamics simulations, we investigate the break- down of SER and the onset of fractional SER in a model of metallic glass-forming liquid. We find that SER breaks down when the size of the largest cluster consisting of trapped atoms starts to increase sharply at which the largest cluster spans half of the simulations box along one direction, and the fractional SER starts to follows when the largest cluster percolates the entire system and forms 3-dimentional network structures. Further analysis based on the percolation theory also confirms that percolation occurs at the onset of the fractional SER. Our results directly link the breakdown of the SER with structure inhomogeneity and onset of the fraction SER with percolation of largest clusters, thus provide a possible picture for the break- down of SER and onset of fractional SER in glass-forming liquids, which is is important for the understanding of the dynamic properties in glass-forming liquids.

  7. Working Memory Training in the Form of Structured Games in Children with Attention Deficit Hyperactivity Disorder.

    Science.gov (United States)

    Khalili Kermani, Fatemeh; Mohammadi, Mohammad Reza; Yadegari, Fariba; Haresabadi, Fatemeh; Sadeghi, Seyed Mehdi

    2016-10-01

    Objective: In this study, a new training method of working memory (WM) was used in the form of structured games, and the effect of training was evaluated with a controlled design. The training method of WM in the form of structured games includes 20 sets of structured games that can improve WM and performance of executive functions. Method: Sixty children with attention deficit hyperactivity disorder (ADHD) aged 8.5 to 11.2 years (35 boys), using no stimulant medication were selected. We randomly assigned 30 participants to the experimental group and provided them with WM training. The training was in the form of structured games and was offered to the participants in two 60-minute sessions weekly for 12 weeks. Other participants were assigned to the control group, receiving no treatment. All the participants were also evaluated at follow-up 6 months later. The main measures were the Child Behavior Checklist (CBCL), the Digit Span and Symbol Search B subscale of the Wechsler Intelligence Scale for Children (WISC-IV); and scores of dictation and mathematics were used in terms of pre and post-test. Results: The results of the t-test revealed a significant improvement in the post-test measures as well as a significant reduction of parents' reports of inattentiveness, and improvement in academic performance in the experimental group. However, no significant changes were found in the control group. Conclusion : The academic and working memory improvements were primarily due to the training method of WM. Our findings suggest that the training method of WM in the form of structured games may be a practical method for treating children with ADHD, but it needs to be further investigated.

  8. Structural and optical properties of ZnO rods hydrothermally formed on polyethersulfone substrates

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Chang Mi; Jang, Jin Tak; Kim, Chang Yong; Ryu, Hyuk Hyun [Inje University, Gimhae (Korea, Republic of); Lee, Won Jae [Dong-Eui University, Busan (Korea, Republic of); Chang, Ji Ho [Korea Maritime University, Busan (Korea, Republic of); Son, Chang Sik [Silla University, Busan (Korea, Republic of); Choi, Hee Lack [Pukyong National University, Busan (Korea, Republic of)

    2012-06-15

    Various unique ZnO morphologies, such as cigar-like and belt-like structures and microrod and nanorod structures, were formed on flexible polyethersulfone (PES) substrates by using a low temperature hydrothermal route. The structural properties of ZnO depended highly on the precursor concentration. The effect of a thin ZnO seed layer deposited the on PES substrate by using atomic layer deposition on the structural and the optical properties of ZnO hydrothermally grown on the ZnO seed layer/PES substrates was studied. Field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), and photoluminescence (PL) measurements were employed to analyze the characteristics of hydrothermally-grown ZnO. The diameter of the ZnO nanorods grown on the ZnO seed layer/PES substrates increased with increasing precursor concentration from 0.025 to 0.125 M due to the Ostwald ripening process. ZnO hydrothermally-grown on the ZnO seed layer/PES substrates at a low precursor concentration showed better structural properties than ZnO formed without a seed layer. Well-formed ZnO nanorods deposited on the ZnO seed layer/PES substrates showed two PL peaks, one in the ultraviolet and the other in the visible region, whereas horizontally positioned ZnO formed on the PES substrate in the absence of a seed layer emitted only one broad PL peak in the violet region. The ZnO grown on PES substrates in this work can be used as high-quality transparent electrodes for solar cells fabricated on flexible substrates.

  9. Structural and optical properties of ZnO rods hydrothermally formed on polyethersulfone substrates

    International Nuclear Information System (INIS)

    Shin, Chang Mi; Jang, Jin Tak; Kim, Chang Yong; Ryu, Hyuk Hyun; Lee, Won Jae; Chang, Ji Ho; Son, Chang Sik; Choi, Hee Lack

    2012-01-01

    Various unique ZnO morphologies, such as cigar-like and belt-like structures and microrod and nanorod structures, were formed on flexible polyethersulfone (PES) substrates by using a low temperature hydrothermal route. The structural properties of ZnO depended highly on the precursor concentration. The effect of a thin ZnO seed layer deposited the on PES substrate by using atomic layer deposition on the structural and the optical properties of ZnO hydrothermally grown on the ZnO seed layer/PES substrates was studied. Field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), and photoluminescence (PL) measurements were employed to analyze the characteristics of hydrothermally-grown ZnO. The diameter of the ZnO nanorods grown on the ZnO seed layer/PES substrates increased with increasing precursor concentration from 0.025 to 0.125 M due to the Ostwald ripening process. ZnO hydrothermally-grown on the ZnO seed layer/PES substrates at a low precursor concentration showed better structural properties than ZnO formed without a seed layer. Well-formed ZnO nanorods deposited on the ZnO seed layer/PES substrates showed two PL peaks, one in the ultraviolet and the other in the visible region, whereas horizontally positioned ZnO formed on the PES substrate in the absence of a seed layer emitted only one broad PL peak in the violet region. The ZnO grown on PES substrates in this work can be used as high-quality transparent electrodes for solar cells fabricated on flexible substrates.

  10. Novel dextran derivatives with unconventional structure formed in an efficient one-pot reaction.

    Science.gov (United States)

    Hotzel, Konrad; Heinze, Thomas

    2016-11-03

    An efficient one-pot synthesis of new dextran derivatives is described. The functional groups of β-alanine, i.e., the carboxyl- and amine group, are converted independently in one-step by iminium chloride to form products with a single substituent. The dextran N-[(dimethylamino)methylene]-β-alanine ester is formed selectively. The structure of the resulting polymers is unambiguously determined by means of NMR- and FTIR-spectroscopy and elemental analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. An efficient closed-form solution for acoustic emission source location in three-dimensional structures

    Directory of Open Access Journals (Sweden)

    Xibing Li

    2014-02-01

    Full Text Available This paper presents an efficient closed-form solution (ECS for acoustic emission(AE source location in three-dimensional structures using time difference of arrival (TDOA measurements from N receivers, N ≥ 6. The nonlinear location equations of TDOA are simplified to linear equations. The unique analytical solution of AE sources for unknown velocity system is obtained by solving the linear equations. The proposed ECS method successfully solved the problems of location errors resulting from measured deviations of velocity as well as the existence and multiplicity of solutions induced by calculations of square roots in existed close-form methods.

  12. Modelling and simulating the forming of new dry automated lay-up reinforcements for primary structures

    Science.gov (United States)

    Bouquerel, Laure; Moulin, Nicolas; Drapier, Sylvain; Boisse, Philippe; Beraud, Jean-Marc

    2017-10-01

    While weight has been so far the main driver for the development of prepreg based-composites solutions for aeronautics, a new weight-cost trade-off tends to drive choices for next-generation aircrafts. As a response, Hexcel has designed a new dry reinforcement type for aircraft primary structures, which combines the benefits of automation, out-of-autoclave process cost-effectiveness, and mechanical performances competitive to prepreg solutions: HiTape® is a unidirectional (UD) dry carbon reinforcement with thermoplastic veil on each side designed for aircraft primary structures [1-3]. One privileged process route for HiTape® in high volume automated processes consists in forming initially flat dry reinforcement stacks, before resin infusion [4] or injection. Simulation of the forming step aims at predicting the geometry and mechanical properties of the formed stack (so-called preform) for process optimisation. Extensive work has been carried out on prepreg and dry woven fabrics forming behaviour and simulation, but the interest for dry non-woven reinforcements has emerged more recently. Some work has been achieved on non crimp fabrics but studies on the forming behaviour of UDs are seldom and deal with UD prepregs only. Tension and bending in the fibre direction, along with inter-ply friction have been identified as the main mechanisms controlling the HiTape® response during forming. Bending has been characterised using a modified Peirce's flexometer [5] and inter-ply friction study is under development. Anisotropic hyperelastic constitutive models have been selected to represent the assumed decoupled deformation mechanisms. Model parameters are then identified from associated experimental results. For forming simulation, a continuous approach at the macroscopic scale has been selected first, and simulation is carried out in the Zset framework [6] using proper shell finite elements.

  13. Generating Free-Form Grid Truss Structures from 3D Scanned Point Clouds

    Directory of Open Access Journals (Sweden)

    Hui Ding

    2017-01-01

    Full Text Available Reconstruction, according to physical shape, is a novel way to generate free-form grid truss structures. 3D scanning is an effective means of acquiring physical form information and it generates dense point clouds on surfaces of objects. However, generating grid truss structures from point clouds is still a challenge. Based on the advancing front technique (AFT which is widely used in Finite Element Method (FEM, a scheme for generating grid truss structures from 3D scanned point clouds is proposed in this paper. Based on the characteristics of point cloud data, the search box is adopted to reduce the search space in grid generating. A front advancing procedure suit for point clouds is established. Delaunay method and Laplacian method are used to improve the quality of the generated grids, and an adjustment strategy that locates grid nodes at appointed places is proposed. Several examples of generating grid truss structures from 3D scanned point clouds of seashells are carried out to verify the proposed scheme. Physical models of the grid truss structures generated in the examples are manufactured by 3D print, which solidifies the feasibility of the scheme.

  14. Impact of growth temperature on the crystal habits, forms and structures of VO2 nanocrystals

    International Nuclear Information System (INIS)

    Loeffler, Stefan; Auer, Erwin; Lugstein, Alois; Bertagnolli, Emmerich; Weil, Matthias

    2011-01-01

    We investigated the impact of the process temperature on the habits, forms and crystal structure of VO 2 nanocrystals grown by a vapor-transport method on (0001) quartz substrates. Four distinct growth regimes were discerned: orthorhombic nanowires, sheets, hemispheres, and nanowires with a monoclinic structure. The nanostructures were characterized by scanning electron microscopy (SEM), X-ray diffraction (XRD), and transmission electron microscopy (TEM). I/V characterization of individual nanowires was enabled by Ti/Au contact formation via electron beam lithography and lift-off techniques. The expected metal-insulator transition (MIT) was found in monoclinic VO 2 nanowires. (orig.)

  15. Structure of massive star forming clumps from the Red MSX Source Survey

    Science.gov (United States)

    Figura, Charles C.; Urquhart, J. S.; Morgan, L.

    2014-01-01

    We present ammonia (1,1) and (2,2) emission maps of 61 high-mass star forming regions drawn from the Red MSX Source (RMS) Survey and observed with the Green Bank Telescope's K-Band Focal Plane Array. We use these observations to investigate the spatial distribution of the environmental conditions associated with this sample of embedded massive young stellar objects (MYSOs). Ammonia is an excellent high-density tracer of star-forming regions as its hyperfine structure allows relatively simple characterisation of the molecular environment. These maps are used to measure the column density, kinetic gas temperature distributions and velocity structure across these regions. We compare the distribution of these properties to that of the associated dust and mid-infrared emission traced by the ATLASGAL 870 micron emission maps and the Spitzer GLIMPSE IRAC images. We present a summary of these results and highlight some of more interesting finds.

  16. The effect of form pressure on the air void structure of SCC

    DEFF Research Database (Denmark)

    Jensen, Mikkel Vibæk; Hasholt, Marianne Tange; Geiker, Mette Rica

    2005-01-01

    The high workability of self-compacting concrete (SCC) invites to high casting rates. However, casting walls at high rate may result in large pressure at the bottom of the form and subsequently compression of the air voids. This paper deals with the influence of hydrostatic pressure during setting...... on the air void structure of hardened, air entrained SCC. The subject was examined through laboratory investigations of SCC with two different amounts of air entrainment. The condition in the form was simulated by using containers making it possible to cure concrete under various pressures corresponding...... to the bottom of castings of 0, 2, 4, and 6 meters height. The laboratory investigations were supplemented with data from two full-scale wall castings. The air void structure of the hardened concretes was determined on plane sections. The results indicate that the pressure related changes of the air void...

  17. Advances in Design and Fabrication of Free-Form Reciprocal Structures

    DEFF Research Database (Denmark)

    Parigi, Dario

    2016-01-01

    The paper presents the advances in design and fabrication of free-form Reciprocal Structures, and their application a during a one-week long workshop with the students of the 1st semester of the Master of Science in Architecture and Design, fall 2015, at Aalborg University. Two new factors were...... introduced and tested: a new version of the software Reciprocalizer, and an evolution of the Reciprocalizer Robot. The workshop didactic framework Performance Aided/Assisted Design (PAD) is presented....

  18. Study of the technology of the plasma nanostructuring of silicon to form highly efficient emission structures

    Energy Technology Data Exchange (ETDEWEB)

    Galperin, V. A.; Kitsyuk, E. P. [“Technological Center” Research-and-Production Company (Russian Federation); Pavlov, A. A. [Russian Academy of Sciences, Institute of Nanotechnologies in Microelectronics (Russian Federation); Shamanaev, A. A., E-mail: artemiy.shamanaev@tcen.ru [“Technological Center” Research-and-Production Company (Russian Federation)

    2015-12-15

    New methods for silicon nanostructuring and the possibility of raising the aspect ratios of the structures being formed are considered. It is shown that the technology developed relates to self-formation methods and is an efficient tool for improving the quality of field-emission cathodes based on carbon nanotubes (CNTs) by increasing the Si–CNT contact area and raising the efficiency of the heat sink.

  19. What Factors Affect Doctors' Hours Decisions: Comparing Structural Discrete Choice and Reduced-Form Approaches

    OpenAIRE

    Kalb, Guyonne; Kühnle, Daniel; Scott, Anthony; Cheng, Terence Chai; Jeon, Sung-Hee

    2015-01-01

    Few papers examine the pecuniary and non-pecuniary determinants of doctors' labour supply despite substantial predicted shortages in many OECD countries. We contribute to the literature by applying both a structural discrete choice and a reduced-form approach. Using detailed survey data for Australian physicians, we examine how these different modelling approaches affect estimated wage elasticities at the intensive margin. We show that all modelling approaches predict small negative wage elas...

  20. Structure of a new crystal form of human Hsp70 ATPase domain.

    Science.gov (United States)

    Osipiuk, J; Walsh, M A; Freeman, B C; Morimoto, R I; Joachimiak, A

    1999-05-01

    Hsp70 proteins are highly conserved proteins induced by heat shock and other stress conditions. An ATP-binding domain of human Hsp70 protein has been crystallized in two major morphological forms at pH 7.0 in the presence of PEG 8000 and CaCl2. Both crystal forms belong to the orthorhombic space group P212121, but show no resemblance in unit-cell parameters. Analysis of the crystal structures for both forms shows a 1-2 A shift of one of the subdomains of the protein. This conformational change could reflect a 'natural' flexibility of the protein which might be relevant to ATP binding and may facilitate the interaction of other proteins with Hsp70 protein.

  1. Structural and functional changes across the visual cortex of a patient with visual form agnosia.

    Science.gov (United States)

    Bridge, Holly; Thomas, Owen M; Minini, Loredana; Cavina-Pratesi, Cristiana; Milner, A David; Parker, Andrew J

    2013-07-31

    Loss of shape recognition in visual-form agnosia occurs without equivalent losses in the use of vision to guide actions, providing support for the hypothesis of two visual systems (for "perception" and "action"). The human individual DF received a toxic exposure to carbon monoxide some years ago, which resulted in a persisting visual-form agnosia that has been extensively characterized at the behavioral level. We conducted a detailed high-resolution MRI study of DF's cortex, combining structural and functional measurements. We present the first accurate quantification of the changes in thickness across DF's occipital cortex, finding the most substantial loss in the lateral occipital cortex (LOC). There are reduced white matter connections between LOC and other areas. Functional measures show pockets of activity that survive within structurally damaged areas. The topographic mapping of visual areas showed that ordered retinotopic maps were evident for DF in the ventral portions of visual cortical areas V1, V2, V3, and hV4. Although V1 shows evidence of topographic order in its dorsal portion, such maps could not be found in the dorsal parts of V2 and V3. We conclude that it is not possible to understand fully the deficits in object perception in visual-form agnosia without the exploitation of both structural and functional measurements. Our results also highlight for DF the cortical routes through which visual information is able to pass to support her well-documented abilities to use visual information to guide actions.

  2. Structural analysis of surface film on alloy 600 formed under environment of PWR primary water

    Energy Technology Data Exchange (ETDEWEB)

    Terachi, Takumi; Totsuka, Nobuo; Yamada, Takuyo; Nakagawa, Tomokazu [Inst. of Nuclear Safety System Inc., Mihama, Fukui (Japan); Deguchi, Hiroshi [Kansai Electric Power Co., Inc., Osaka (Japan); Horiuchi, Masaki; Oshitani, Masato [Kanden Kako Co., Ltd., Osaka (Japan)

    2002-09-01

    It has been shown by one of the present authors and so forth that PWSCC of alloy 600 relates to dissolved hydrogen concentration (DH) in water and oxide film structure. However, the mechanism of PWSCC has not been clear yet. Therefore, in order to investigate relationship between them, structural analysis of the oxide film formed under the environment of PWR primary water was carried out by using X-ray diffraction, the scanning electron microscope and the transmission electron microscope. Especially, to perform accurate analysis, the synchrotron orbital radiation with SPring-8 was tried to use for thin film X-ray diffraction measurement. From the results, observed are as follows: 1. the oxide film is mainly composed of NiO, under the condition without hydrogen. 2. In the environment of DH 2.75ppm, the oxide film forms thin spinel structures. 3. On the other hand, needlelike oxides are formed at DH 1ppm. For this reason, around 1ppm of DH there would be the boundary that stable NiO and spinel oxide generate, and it agrees with the peak range of the PWSCC susceptibility on hydrogen. From this, it is suggested that the boundary of NiO/spinel oxide affects the SCC susceptibility. (author)

  3. Structural study of salt forms of amides; paracetamol, benzamide and piperine

    Science.gov (United States)

    Kennedy, Alan R.; King, Nathan L. C.; Oswald, Iain D. H.; Rollo, David G.; Spiteri, Rebecca; Walls, Aiden

    2018-02-01

    Single crystal x-ray diffraction has been used to investigate the structures of six complexes containing O-atom protonated cations derived from the pharmaceutically relevant amides benzamide (BEN), paracetamol (PAR) and piperine (PIP). The structures of the salt forms [PAR(H)][SO3C6H4Cl], [BEN(H)][O3SC6H4Cl] and [BEN(H)][Br]·H2O are reported along with those of the hemi-halide salt forms [PAR(H)][I3]. PAR, [PIP(H)][I3]·PIP and [PIP(H)][I3]0·5[I]0.5. PIP. The structure of the cocrystal BEN. HOOCCH2Cl is also presented for comparison. The geometry of the amide group is found to systematically change upon protonation, with the Cdbnd O distance increasing and the Csbnd N distance decreasing. The hemi-halide species all feature strongly hydrogen bonded amide(H)/amide pairs. The amide group Cdbnd O and Csbnd N distances for both elements of each such pair are intermediate between those found for simple neutral amide and protonated amide forms. It was found that crystallising paracetamol from aqueous solutions containing Ba2+ ions gave orthorhombic paracetamol.

  4. First principles study of structural, electronic and optical properties of polymorphic forms of Rb 2Te

    Science.gov (United States)

    Alay-e-Abbas, S. M.; Shaukat, A.

    2011-05-01

    First-principles density functional theory calculations have been performed for structural, electronic and optical properties of three polymorphic forms of rubidium telluride. Our calculations show that the sequence of pressure induced phase transitions for Rb 2Te is Fm3¯m → Pnma → P6 3/mmc which is governed by the coordination numbers of the anions. From our calculated low transition pressure value for the Fm3¯m phase to the Pnma phase transition of Rb 2Te, the experimentally observed meta-stability of Fm3¯m phase at ambient conditions seems reasonable. The electronic band structure has been calculated for all the three phases and the change in the energy band gap is discussed for the transitioning phases. The energy band gaps obtained for the three phases of Rb 2Te decrease on going from the meta-stable phase to the high-pressure phases. Total and partial density of states for the polymorphs of Rb 2Te has been computed to elucidate the contribution of various atomic states on the electronic band structure. Furthermore, optical properties for all the polymorphic forms have been presented in form of the complex dielectric function.

  5. Structure and Oxidation of Pyrrole Adducts Formed between Aflatoxin B2a and Biological Amines.

    Science.gov (United States)

    Rushing, Blake R; Selim, Mustafa I

    2017-06-19

    Aflatoxin B 2a has been shown to bind to proteins through a dialdehyde intermediate under physiological conditions. The proposed structure of this adduct has been published showing a Schiff base interaction, but adequate verification using structural elucidation instrumental techniques has not been performed. In this work, we synthesized the aflatoxin B 2a amino acid adduct under alkaline conditions, and the formation of a new product was determined using high performance liquid chromatography-time-of-flight mass spectrometry. The resulting accurate mass was used to generate a novel proposed chemical structure of the adduct in which the dialdehyde forms a pyrrole ring with primary amines rather than the previously proposed Schiff base interaction. The pyrrole structure was confirmed using 1 H, 13 C, correlation spectroscopy, heteronuclear single quantum correlation, and heteronuclear multiple bond correlation NMR and tandem mass spectrometry. Reaction kinetics show that the reaction is overall second order and that the rate increases as pH increases. Additionally, this study shows for the first time that aflatoxin B 2a dialdehyde forms adducts with phosphatidylethanolamines and does so through pyrrole ring formation, which makes it the first aflatoxin-lipid adduct to be structurally identified. Furthermore, oxidation of the pyrrole adduct produced a product that was 16 m/z heavier. When the aflatoxin B 2a -lysine (ε) adduct was oxidized, it gave a product with an accurate mass, mass fragmentation pattern, and 1 H NMR spectrum that match aflatoxin B 1 -lysine, which suggest the transformation of the pyrrole ring to a pyrrolin-2-one ring. These data give new insight into the fate and chemical properties of biological adducts formed from aflatoxin B 2a as well as possible interferences with known aflatoxin B 1 exposure biomarkers.

  6. [Structure and evolution of the eukaryotic FANCJ-like proteins].

    Science.gov (United States)

    Wuhe, Jike; Zefeng, Wu; Sanhong, Fan; Xuguang, Xi

    2015-02-01

    The FANCJ-like protein family is a class of ATP-dependent helicases that can catalytically unwind duplex DNA along the 5'-3' direction. It is involved in the processes of DNA damage repair, homologous recombination and G-quadruplex DNA unwinding, and plays a critical role in maintaining genome integrity. In this study, we systemically analyzed FNACJ-like proteins from 47 eukaryotic species and discussed their sequences diversity, origin and evolution, motif organization patterns and spatial structure differences. Four members of FNACJ-like proteins, including XPD, CHL1, RTEL1 and FANCJ, were found in eukaryotes, but some of them were seriously deficient in most fungi and some insects. For example, the Zygomycota fungi lost RTEL1, Basidiomycota and Ascomycota fungi lost RTEL1 and FANCJ, and Diptera insect lost FANCJ. FANCJ-like proteins contain canonical motor domains HD1 and HD2, and the HD1 domain further integrates with three unique domains Fe-S, Arch and Extra-D. Fe-S and Arch domains are relatively conservative in all members of the family, but the Extra-D domain is lost in XPD and differs from one another in rest members. There are 7, 10 and 2 specific motifs found from the three unique domains respectively, while 5 and 12 specific motifs are found from HD1 and HD2 domains except the conserved motifs reported previously. By analyzing the arrangement pattern of these specific motifs, we found that RTEL1 and FANCJ are more closer and share two specific motifs Vb2 and Vc in HD2 domain, which are likely related with their G-quadruplex DNA unwinding activity. The evidence of evolution showed that FACNJ-like proteins were originated from a helicase, which has a HD1 domain inserted by extra Fe-S domain and Arch domain. By three continuous gene duplication events and followed specialization, eukaryotes finally possessed the current four members of FANCJ-like proteins.

  7. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

    International Nuclear Information System (INIS)

    Revaud, D.

    2009-06-01

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  8. A novel fungal fruiting structure formed by Aspergillus niger and Aspergillus carbonarius in grape berries.

    Science.gov (United States)

    Pisani, Cristina; Nguyen, Trang Thoaivan; Gubler, Walter Douglas

    2015-09-01

    Sour rot, is a pre-harvest disease that affects many grape varieties. Sour rot symptoms include initial berry cracking and breakdown of berry tissue. This is a disease complex with many filamentous fungi and bacteria involved, but is usually initiated by Aspergillus niger or Aspergillus carbonarius. Usually, by the time one sees the rot there are many other organisms involved and it is difficult to attribute the disease to one species. In this study two species of Aspergillus were shown to produce a previously unknown fruiting structure in infected berries. The nodulous morphology, bearing conidia, suggests them to be an 'everted polymorphic stroma'. This structure forms freely inside the berry pulp and assumes multiple shapes and sizes, sometimes sclerotium-like in form. It is composed of a mass of vegetative hyphae with or without tissue of the host containing spores or fruiting bodies bearing spores. Artificially inoculated berries placed in soil in winter showed the possible overwintering function of the fruiting body. Inoculated berry clusters on standing vines produced fruiting structures within 21 d post inoculation when wounds were made at veraison or after (July-September). Histological studies confirmed that the fruiting structure was indeed fungal tissue. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  9. The Open Form Inducer Approach for Structure-Based Drug Design.

    Directory of Open Access Journals (Sweden)

    Daniel Ken Inaoka

    Full Text Available Many open form (OF structures of drug targets were obtained a posteriori by analysis of co-crystals with inhibitors. Therefore, obtaining the OF structure of a drug target a priori will accelerate development of potent inhibitors. In addition to its small active site, Trypanosoma cruzi dihydroorotate dehydrogenase (TcDHODH is fully functional in its monomeric form, making drug design approaches targeting the active site and protein-protein interactions unrealistic. Therefore, a novel a priori approach was developed to determination the TcDHODH active site in OF. This approach consists of generating an "OF inducer" (predicted in silico to bind the target and cause steric repulsion with flexible regions proximal to the active site that force it open. We provide the first proof-of-concept of this approach by predicting and crystallizing TcDHODH in complex with an OF inducer, thereby obtaining the OF a priori with its subsequent use in designing potent and selective inhibitors. Fourteen co-crystal structures of TcDHODH with the designed inhibitors are presented herein. This approach has potential to encourage drug design against diseases where the molecular targets are such difficult proteins possessing small AS volume. This approach can be extended to study open/close conformation of proteins in general, the identification of allosteric pockets and inhibitors for other drug targets where conventional drug design approaches are not applicable, as well as the effective exploitation of the increasing number of protein structures deposited in Protein Data Bank.

  10. Superplastic Forming/Adhesive Bonding of Aluminum (SPF/AB) Multi-Sheet Structures

    Science.gov (United States)

    Wagner, John A. (Technical Monitor); Will, Jeff D.; Cotton, James D.

    2003-01-01

    A significant fraction of airframe structure consists of stiffened panels that are costly and difficult to fabricate. This program explored a potentially lower-cost processing route for producing such panels. The alternative process sought to apply concurrent superplastic forming and adhesive bonding of aluminum alloy sheets. Processing conditions were chosen to balance adequate superplasticity of the alloy with thermal stability of the adhesive. As a first objective, an air-quenchable, superplastic aluminum-lithium alloy and a low-volatile content, low-viscosity adhesive with compatible forming/curing cycles were identified. A four-sheet forming pack was assembled which consisted of a welded two-sheet core separated from the face sheets by a layer of adhesive. Despite some preliminary success, of over 30 forming trials none was completely successful. The main problem was inadequate superplasticity in the heat-affected zones of the rib welds, which generally fractured prior to completion of the forming cycle. The welds are a necessary component in producing internal ribs by the 'four-sheet' process. Other challenges, such as surface preparation and adhesive bonding, were adequately solved. But without the larger issue of tearing at the weld locations, complex panel fabrication by SPF/AB does not appear viable.

  11. Structural Determinants of Photoreactivity of Triplex Forming Oligonucleotides Conjugated to Psoralens

    Science.gov (United States)

    Krishnan, Rajagopal; Oh, Dennis H.

    2010-01-01

    Triplex-forming oligonucleotides (TFOs) with both DNA and 2′-O-methyl RNA backbones can direct psoralen photoadducts to specific DNA sequences. However, the functional consequences of these differing structures on psoralen photoreactivity are unknown. We designed TFO sequences with DNA and 2′-O-methyl RNA backbones conjugated to psoralen by 2-carbon linkers and examined their ability to bind and target damage to model DNA duplexes corresponding to sequences within the human HPRT gene. While TFO binding affinity was not dramatically affected by the type of backbone, psoralen photoreactivity was completely abrogated by the 2′-O-methyl RNA backbone. Photoreactivity was restored when the psoralen was conjugated to the RNA TFO via a 6-carbon linker. In contrast to the B-form DNA of triplexes formed by DNA TFOs, the CD spectra of triplexes formed with 2′-O-methyl RNA TFOs exhibited features of A-form DNA. These results indicate that 2′-O-methyl RNA TFOs induce a partial B-to-A transition in their target DNA sequences which may impair the photoreactivity of a conjugated psoralen and suggest that optimal design of TFOs to target DNA damage may require a balance between binding ability and drug reactivity. PMID:20725628

  12. Form and function: Perspectives on structural biology and resources for the future

    International Nuclear Information System (INIS)

    Vaughan, D.

    1990-12-01

    The purpose of this study is largely to explore and expand on the thesis that biological structures and their functions are suited to. Form indeed follows function and if we are to understand the workings of a living system, with all that such an understanding promises, we must first seek to describe the structure of its parts. Descriptions of a few achievements of structural biology lay the groundwork, but the substance of this booklet is a discussion of important questions yet unanswered and opportunities just beyond our grasp. The concluding pages then outline a course of action in which the Department of Energy would exercise its responsibility to develop the major resources needed to extend our reach and to answer some of those unanswered questions. 22 figs

  13. Revealing the Link between Structural Relaxation and Dynamic Heterogeneity in Glass-Forming Liquids.

    Science.gov (United States)

    Wang, Lijin; Xu, Ning; Wang, W H; Guan, Pengfei

    2018-03-23

    Despite the use of glasses for thousands of years, the nature of the glass transition is still mysterious. On approaching the glass transition, the growth of dynamic heterogeneity has long been thought to play a key role in explaining the abrupt slowdown of structural relaxation. However, it still remains elusive whether there is an underlying link between structural relaxation and dynamic heterogeneity. Here, we unravel the link by introducing a characteristic time scale hiding behind an identical dynamic heterogeneity for various model glass-forming liquids. We find that the time scale corresponds to the kinetic fragility of liquids. Moreover, it leads to scaling collapse of both the structural relaxation time and dynamic heterogeneity for all liquids studied, together with a characteristic temperature associated with the same dynamic heterogeneity. Our findings imply that studying the glass transition from the viewpoint of dynamic heterogeneity is more informative than expected.

  14. Infrared spectroscopy study of structural changes in glass-forming salol.

    Science.gov (United States)

    Baran, J; Davydova, N A

    2010-03-01

    We report the investigation of glass-forming salol upon different courses of the temperature changes from liquid to glass state and back using FT-IR spectroscopy measurements in the wide spectral and temperature ranges. The formation of the ordered clusters in supercooled liquid salol has been observed at 250 K. When the temperature is decreased further to 11 K these ordered clusters become an element of the glass structure. With increasing temperature to 270 K through the glass transition noticeable evolutions of the IR spectrum occurs up till the ordered clusters are developed into crystal. So produced crystal melts in the temperature range 300-310 K, that corresponds to the melting temperature of the metastable phase (Tmelt=302 K) . Thus, the crystalline structure of the ordered clusters corresponds to the structure of metastable phase and is monoclinic.

  15. Form and function: Perspectives on structural biology and resources for the future

    Energy Technology Data Exchange (ETDEWEB)

    Vaughan, D. (ed.)

    1990-12-01

    The purpose of this study is largely to explore and expand on the thesis that biological structures and their functions are suited to. Form indeed follows function and if we are to understand the workings of a living system, with all that such an understanding promises, we must first seek to describe the structure of its parts. Descriptions of a few achievements of structural biology lay the groundwork, but the substance of this booklet is a discussion of important questions yet unanswered and opportunities just beyond our grasp. The concluding pages then outline a course of action in which the Department of Energy would exercise its responsibility to develop the major resources needed to extend our reach and to answer some of those unanswered questions. 22 figs.

  16. Revealing the Link between Structural Relaxation and Dynamic Heterogeneity in Glass-Forming Liquids

    Science.gov (United States)

    Wang, Lijin; Xu, Ning; Wang, W. H.; Guan, Pengfei

    2018-03-01

    Despite the use of glasses for thousands of years, the nature of the glass transition is still mysterious. On approaching the glass transition, the growth of dynamic heterogeneity has long been thought to play a key role in explaining the abrupt slowdown of structural relaxation. However, it still remains elusive whether there is an underlying link between structural relaxation and dynamic heterogeneity. Here, we unravel the link by introducing a characteristic time scale hiding behind an identical dynamic heterogeneity for various model glass-forming liquids. We find that the time scale corresponds to the kinetic fragility of liquids. Moreover, it leads to scaling collapse of both the structural relaxation time and dynamic heterogeneity for all liquids studied, together with a characteristic temperature associated with the same dynamic heterogeneity. Our findings imply that studying the glass transition from the viewpoint of dynamic heterogeneity is more informative than expected.

  17. Referral letter with an attached structured reply form: Is it a solution for not getting replies

    Directory of Open Access Journals (Sweden)

    R. P. J. C. Ramanayake

    2013-01-01

    Full Text Available Background: Communication between primary care doctors and specialists/hospital doctors is vital for smooth functioning of a health care system. In many instances referral and reply letters are the sole means of communication between general practitioners and hospital doctors/specialists. Despite the obvious benefits to patient care, answers to referral letters are the exception worldwide. In Sri Lanka hand written conventional letters are used to refer patients and replies are scarce. Materials and Methods: This interventional study was designed to assess if attaching a structured reply form with the referral letter would increase the rate of replies/back-referrals. It was conducted at the Family Medicine Clinic of the Faculty of Medicine, University of Kelaniya. A structured referral letter (form was designed based on guide lines and literature and it was used for referral of patients for a period of six months. Similarly a structured reply form was also designed and both the referral letter and the reply letter were printed on A4 papers side by side and these were used for the next six months for referrals. Both letters had headings and space underneath to write details pertaining to the patient. A register was maintained to document the number of referrals and replies received during both phases. Patents were asked to return the reply letters if specialists/hospital doctors obliged to reply. Results: Total of 90 patients were referred using the structured referral form during 1st phase. 80 letters (with reply form attached were issued during the next six months. Patients were referred to eight different specialties. Not a single reply during the 1 st phase and there were six 6 (7.5% replies during the 2 nd phase. Discussion: This was an attempt to improve communication between specialists/hospital doctors and primary care doctors. Even though there was some improvement it was not satisfactory. A multicenter island wide study should be

  18. Discrete-time Calogero-Moser system and Lagrangian 1-form structure

    International Nuclear Information System (INIS)

    Yoo-Kong, Sikarin; Lobb, Sarah; Nijhoff, Frank

    2011-01-01

    We study the Lagrange formalism of the (rational) Calogero-Moser (CM) system, both in discrete time and continuous time, as a first example of a Lagrangian 1-form structure in the sense of the recent paper (Lobb and Nijhoff 2009 J. Phys. A: Math. Theor.42 454013). The discrete-time model of the CM system was established some time ago arising as a pole reduction of a semi-discrete version of the Kadomtsev-Petviashvili (KP) equation, and was shown to lead to an exactly integrable correspondence (multivalued map). In this paper, we present the full KP solution based on the commutativity of the discrete-time flows in the two discrete KP variables. The compatibility of the corresponding Lax matrices is shown to lead directly to the relevant closure relation on the level of the Lagrangians. Performing successive continuum limits on both the level of the KP equation and the level of the CM system, we establish the proper Lagrangian 1-form structure for the continuum case of the CM model. We use the example of the three-particle case to elucidate the implementation of the novel least-action principle, which was presented in Lobb and Nijhoff (2009), for the simpler case of Lagrangian 1-forms. (paper)

  19. Form and function in hillslope hydrology: in situ imaging and characterization of flow-relevant structures

    Directory of Open Access Journals (Sweden)

    C. Jackisch

    2017-07-01

    Full Text Available The study deals with the identification and characterization of rapid subsurface flow structures through pedo- and geo-physical measurements and irrigation experiments at the point, plot and hillslope scale. Our investigation of flow-relevant structures and hydrological responses refers to the general interplay of form and function, respectively. To obtain a holistic picture of the subsurface, a large set of different laboratory, exploratory and experimental methods was used at the different scales. For exploration these methods included drilled soil core profiles, in situ measurements of infiltration capacity and saturated hydraulic conductivity, and laboratory analyses of soil water retention and saturated hydraulic conductivity. The irrigation experiments at the plot scale were monitored through a combination of dye tracer, salt tracer, soil moisture dynamics, and 3-D time-lapse ground penetrating radar (GPR methods. At the hillslope scale the subsurface was explored by a 3-D GPR survey. A natural storm event and an irrigation experiment were monitored by a dense network of soil moisture observations and a cascade of 2-D time-lapse GPR trenches. We show that the shift between activated and non-activated state of the flow paths is needed to distinguish structures from overall heterogeneity. Pedo-physical analyses of point-scale samples are the basis for sub-scale structure inference. At the plot and hillslope scale 3-D and 2-D time-lapse GPR applications are successfully employed as non-invasive means to image subsurface response patterns and to identify flow-relevant paths. Tracer recovery and soil water responses from irrigation experiments deliver a consistent estimate of response velocities. The combined observation of form and function under active conditions provides the means to localize and characterize the structures (this study and the hydrological processes (companion study Angermann et al., 2017, this issue.

  20. Form and function in hillslope hydrology: in situ imaging and characterization of flow-relevant structures

    Science.gov (United States)

    Jackisch, Conrad; Angermann, Lisa; Allroggen, Niklas; Sprenger, Matthias; Blume, Theresa; Tronicke, Jens; Zehe, Erwin

    2017-07-01

    The study deals with the identification and characterization of rapid subsurface flow structures through pedo- and geo-physical measurements and irrigation experiments at the point, plot and hillslope scale. Our investigation of flow-relevant structures and hydrological responses refers to the general interplay of form and function, respectively. To obtain a holistic picture of the subsurface, a large set of different laboratory, exploratory and experimental methods was used at the different scales. For exploration these methods included drilled soil core profiles, in situ measurements of infiltration capacity and saturated hydraulic conductivity, and laboratory analyses of soil water retention and saturated hydraulic conductivity. The irrigation experiments at the plot scale were monitored through a combination of dye tracer, salt tracer, soil moisture dynamics, and 3-D time-lapse ground penetrating radar (GPR) methods. At the hillslope scale the subsurface was explored by a 3-D GPR survey. A natural storm event and an irrigation experiment were monitored by a dense network of soil moisture observations and a cascade of 2-D time-lapse GPR trenches. We show that the shift between activated and non-activated state of the flow paths is needed to distinguish structures from overall heterogeneity. Pedo-physical analyses of point-scale samples are the basis for sub-scale structure inference. At the plot and hillslope scale 3-D and 2-D time-lapse GPR applications are successfully employed as non-invasive means to image subsurface response patterns and to identify flow-relevant paths. Tracer recovery and soil water responses from irrigation experiments deliver a consistent estimate of response velocities. The combined observation of form and function under active conditions provides the means to localize and characterize the structures (this study) and the hydrological processes (companion study Angermann et al., 2017, this issue).

  1. Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

    Science.gov (United States)

    Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

    2018-02-01

    Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Structure of the active form of human origin recognition complex and its ATPase motor module

    Energy Technology Data Exchange (ETDEWEB)

    Tocilj, Ante; On, Kin Fan; Yuan, Zuanning; Sun, Jingchuan; Elkayam, Elad; Li, Huilin; Stillman, Bruce; Joshua-Tor, Leemor

    2017-01-23

    Binding of the Origin Recognition Complex (ORC) to origins of replication marks the first step in the initiation of replication of the genome in all eukaryotic cells. Here, we report the structure of the active form of human ORC determined by X-ray crystallography and cryo-electron microscopy. The complex is composed of an ORC1/4/5 motor module lobe in an organization reminiscent of the DNA polymerase clamp loader complexes. A second lobe contains the ORC2/3 subunits. The complex is organized as a double-layered shallow corkscrew, with the AAA+ and AAA+-like domains forming one layer, and the winged-helix domains (WHDs) forming a top layer. CDC6 fits easily between ORC1 and ORC2, completing the ring and the DNA-binding channel, forming an additional ATP hydrolysis site. Analysis of the ATPase activity of the complex provides a basis for understanding ORC activity as well as molecular defects observed in Meier-Gorlin Syndrome mutations.

  3. The structural bases of long-term anabiosis in non-spore-forming bacteria

    Science.gov (United States)

    Suzina, Natalia E.; Mulyukin, Andrey L.; Dmitriev, Vladimir V.; Nikolaev, Yury A.; Shorokhova, Anna P.; Bobkova, Yulia S.; Barinova, Ekaterina S.; Plakunov, Vladimir K.; El-Registan, Galina I.; Duda, Vitalii I.

    2006-01-01

    Peculiarities of the structural organization in non-spore-forming bacteria associated with long-term anabiosis were revealed both in laboratory cultures and in natural populations isolated from 1 3-Myr-old Eastern Siberian permafrost and tundra soil. Different advanced methods were used, including (a) high-resolution electron microscopy; (b) simulation of in situ conditions in the laboratory by varying the composition of growth medium and cultivation conditions; (c) low-temperature fractionation to isolate and concentrate microbial cells from natural soils; (d) comparative morphological analysis of microbial cells in model cultures and natural soils (in situ). Under laboratory conditions, the intense formation of resting cells by representatives of various taxa of eubacteria and halophilic archaea occurred in 2 9-month-old cultures grown in carbon-, nitrogen-, or phosphorus-limited media, in starved cell suspensions in the presence of sodium silicate, or on soil agar. Among resting cells, we revealed cystlike forms having a complicated structure and common features. These included a thick capsule; a thickened and multiprofile cell wall; the presence of large intramembrane particles on PF- and EF-fracture surfaces; fine-grained or lumpy cytoplasm; and a condensed nucleoid. The general morphological properties, ultrastructural organization, physiological features of cystlike cells, and their ability to germinate under the appropriate conditions suggest the existence of constitutive dormancy in non-spore-forming bacteria. It was found that the majority of microorganisms in permafrost and tundra soil are cystlike cells, very similar to those in laboratory cultures. Anabiotic (resting) cystlike cells are responsible for the survival of non-spore-formers in extreme Earth habitats and may be regarded as possible analogs of extraterrestrial forms of microbial life.

  4. Deuteron A(Q2) structure function and the neutron electric form factor

    International Nuclear Information System (INIS)

    Platchkov, S.; Amroun, A.; Auffret, S.; Cavedon, J.M.; Dreux, P.; Duclos, J.; Frois, B.; Goutte, D.; Hachemi, H.; Martino, J.

    1989-01-01

    We present new measurements of the deuteron A(Q 2 ) structure function in the momentum transfer region between 1 and 18 fm -2 . The accuracy of the data ranges from 2% to 6%. We investigate the sensitivity of A(Q 2 ) to the nucleon-nucleon interaction and to the neutron electric form factor G E n . Our analysis shows that below 20 fm -2 G E n can be inferred from these data with a significantly improved accuracy. The model dependence of this analysis is discussed

  5. Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank

    2011-01-01

    CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...

  6. Nucleon form factors and structure functions from Nf=2 Clover fermions

    International Nuclear Information System (INIS)

    Collins, S.; Goeckeler, M.; Haegler, P.

    2010-12-01

    We give an update on our ongoing efforts to compute the nucleon's form factors and moments of structure functions using N f =2 flavours of non-perturbatively improved Clover fermions. We focus on new results obtained on gauge configurations where the pseudo-scalar meson mass is in the range of 170-270 MeV. We compare our results with various estimates obtained from chiral effective theories since we have some overlap with the quark mass region where results from such theories are believed to be applicable. (orig.)

  7. Structure of haze forming proteins in white wines: Vitis vinifera thaumatin-like proteins.

    Science.gov (United States)

    Marangon, Matteo; Van Sluyter, Steven C; Waters, Elizabeth J; Menz, Robert I

    2014-01-01

    Grape thaumatin-like proteins (TLPs) play roles in plant-pathogen interactions and can cause protein haze in white wine unless removed prior to bottling. Different isoforms of TLPs have different hazing potential and aggregation behavior. Here we present the elucidation of the molecular structures of three grape TLPs that display different hazing potential. The three TLPs have very similar structures despite belonging to two different classes (F2/4JRU is a thaumatin-like protein while I/4L5H and H2/4MBT are VVTL1), and having different unfolding temperatures (56 vs. 62°C), with protein F2/4JRU being heat unstable and forming haze, while I/4L5H does not. These differences in properties are attributable to the conformation of a single loop and the amino acid composition of its flanking regions.

  8. The effects of topology on the structural, dynamic and mechanical properties of network-forming materials

    International Nuclear Information System (INIS)

    Wilson, Mark

    2012-01-01

    The effects of network topology on the static structural, mechanical and dynamic properties of MX 2 network-forming liquids (with tetrahedral short-range order) are discussed. The network topology is controlled via a single model parameter (the anion polarizability) which effectively constrains the inter-tetrahedral linkages in a physically transparent manner. Critically, it is found to control the balance between the stability of corner- and edge-sharing tetrahedra. A potential rigidity transformation is investigated. The vibrational density of states is investigated, using an instantaneous normal model analysis, as a function of both anion polarizability and temperature. A low frequency peak is seen to appear and is shown to be correlated with the fraction of cations which are linked through solely edge-sharing structural motifs. A modified effective mean atom coordination number is proposed which allows the appearance of the low frequency feature to be understood in terms of a mean field rigidity percolation threshold. (paper)

  9. Structural features of anodic oxide films formed on aluminum substrate coated with self-assembled microspheres

    International Nuclear Information System (INIS)

    Asoh, Hidetaka; Uchibori, Kota; Ono, Sachiko

    2009-01-01

    The structural features of anodic oxide films formed on an aluminum substrate coated with self-assembled microspheres were investigated by scanning electron microscopy and atomic force microscopy. In the first anodization in neutral solution, the growth of a barrier-type film was partially suppressed in the contact area between the spheres and the underlying aluminum substrate, resulting in the formation of ordered dimple arrays in an anodic oxide film. After the subsequent second anodization in acid solution at a voltage lower than that of the first anodization, nanopores were generated only within each dimple. The nanoporous region could be removed selectively by post-chemical etching using the difference in structural dimensions between the porous region and the surrounding barrier region. The mechanism of anodic oxide growth on the aluminum substrate coated with microspheres through multistep anodization is discussed.

  10. Structural features of anodic oxide films formed on aluminum substrate coated with self-assembled microspheres

    Energy Technology Data Exchange (ETDEWEB)

    Asoh, Hidetaka [Department of Applied Chemistry, Faculty of Engineering, Kogakuin University, 2665-1 Nakano, Hachioji, Tokyo 192-0015 (Japan)], E-mail: asoh@cc.kogakuin.ac.jp; Uchibori, Kota; Ono, Sachiko [Department of Applied Chemistry, Faculty of Engineering, Kogakuin University, 2665-1 Nakano, Hachioji, Tokyo 192-0015 (Japan)

    2009-07-15

    The structural features of anodic oxide films formed on an aluminum substrate coated with self-assembled microspheres were investigated by scanning electron microscopy and atomic force microscopy. In the first anodization in neutral solution, the growth of a barrier-type film was partially suppressed in the contact area between the spheres and the underlying aluminum substrate, resulting in the formation of ordered dimple arrays in an anodic oxide film. After the subsequent second anodization in acid solution at a voltage lower than that of the first anodization, nanopores were generated only within each dimple. The nanoporous region could be removed selectively by post-chemical etching using the difference in structural dimensions between the porous region and the surrounding barrier region. The mechanism of anodic oxide growth on the aluminum substrate coated with microspheres through multistep anodization is discussed.

  11. REMOTE WORK AS A PROMISING FORM OF LABOUR ORGANIZATION FOR RUSSIAN ENTREPRENEURIAL STRUCTURES

    Directory of Open Access Journals (Sweden)

    I. Gurova

    2016-01-01

    Full Text Available Remote work (telecommuting is one of the modern technologies of the organization of the labor process, which is not yet widely used in domestic practice. However, in times of crisis, when entrepreneurial structures seek for the maximum reduction of expenses, it can be a tool to address many of the pressing issues related to the most effective use of production and labor resources.The article discusses the features of the remote work on a world level and in our country, detected its strengths and weaknesses for the participants of labour relations, as well as revealed the potential of this form of labor organization for achievement of optimum balance between expenses and efficiency of entrepreneurial structures.

  12. Nur77 forms novel nuclear structures upon DNA damage that cause transcriptional arrest

    International Nuclear Information System (INIS)

    Leseleuc, Louis de; Denis, Francois

    2006-01-01

    The orphan nuclear receptor Nur77 has been implicated in both growth and apoptosis, and its function and activity can be modulated by cellular redistribution. Green fluorescent protein-tagged Nur77 was used to evaluate the role of Nur77 intracellular redistribution in response to genotoxic stress. Selected DNA damaging agents and transcription inhibition lead to rapid redistribution of Nur77 into nuclear structures distinct from conventional nuclear bodies. These nuclear bodies formed transiently were tightly bound to the nuclear matrix and conditions that lead to their appearance were associated with Nur77 transcriptional inhibition. The formation of Nur77 nuclear bodies might be involved in programmed cell death modulation upon exposure to DNA damaging agents that inhibit transcription by sequestrating this proapoptotic factor in dense nuclear structures

  13. Structure of haze forming proteins in white wines: Vitis vinifera thaumatin-like proteins.

    Directory of Open Access Journals (Sweden)

    Matteo Marangon

    Full Text Available Grape thaumatin-like proteins (TLPs play roles in plant-pathogen interactions and can cause protein haze in white wine unless removed prior to bottling. Different isoforms of TLPs have different hazing potential and aggregation behavior. Here we present the elucidation of the molecular structures of three grape TLPs that display different hazing potential. The three TLPs have very similar structures despite belonging to two different classes (F2/4JRU is a thaumatin-like protein while I/4L5H and H2/4MBT are VVTL1, and having different unfolding temperatures (56 vs. 62°C, with protein F2/4JRU being heat unstable and forming haze, while I/4L5H does not. These differences in properties are attributable to the conformation of a single loop and the amino acid composition of its flanking regions.

  14. Distinct atomic structures of the Ni-Nb metallic glasses formed by ion beam mixing

    International Nuclear Information System (INIS)

    Tai, K. P.; Wang, L. T.; Liu, B. X.

    2007-01-01

    Four Ni-Nb metallic glasses are obtained by ion beam mixing and their compositions are measured to be Ni 77 Nb 23 , Ni 55 Nb 45 , Ni 31 Nb 69 , and Ni 15 Nb 85 , respectively, suggesting that a composition range of 23-85 at. % of Nb is favored for metallic glass formation in the Ni-Nb system. Interestingly, diffraction analyses show that the structure of the Nb-based Ni 31 Nb 69 metallic glass is distinctly different from the structure of the Nb-based Ni 15 Nb 85 metallic glass, as the respective amorphous halos are located at 2θ≅38 and 39 deg. To explore an atomic scale description of the Ni-Nb metallic glasses, an n-body Ni-Nb potential is first constructed with an aid of the ab initio calculations and then applied to perform the molecular dynamics simulation. Simulation results determine not only the intrinsic glass forming range of the Ni-Nb system to be within 20-85 at. % of Nb, but also the exact atomic positions in the Ni-Nb metallic glasses. Through a statistical analysis of the determined atomic positions, a new dominant local packing unit is found in the Ni 15 Nb 85 metallic glass, i.e., an icositetrahedron with a coordination number to be around 14, while in Ni 31 Nb 69 metallic glasses, the dominant local packing unit is an icosahedron with a coordination number to be around 12, which has been reported for the other metallic glasses. In fact, with increasing the irradiation dose, the Ni 31 Nb 69 metallic glasses are formed through an intermediate state of face-centered-cubic-solid solution, whereas the Ni 15 Nb 85 metallic glass is through an intermediate state of body-centered-cubic-solid solution, suggesting that the structures of the constituent metals play an important role in governing the structural characteristics of the resultant metallic glasses

  15. Real-Time Study of the Interaction between G-Rich DNA Oligonucleotides and Lead Ion on DNA Tetrahedron-Functionalized Sensing Platform by Dual Polarization Interferometry.

    Science.gov (United States)

    Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong

    2017-11-29

    G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.

  16. Isolation and structural elucidation of tiamulin metabolites formed in liver microsomes of pigs.

    Science.gov (United States)

    Lykkeberg, Anne Kruse; Cornett, Claus; Halling-Sørensen, Bent; Hansen, Steen Honoré

    2006-09-18

    Although the antimicrobial tiamulin is extensively metabolized in pigs, the metabolism is not well investigated. In this work the NADPH dependent metabolism of tiamulin in liver microsomes from pigs has been studied. The tiamulin metabolites formed in the incubations were analysed using LC-MS, and three major metabolites were isolated using solid phase extraction and preparative HPLC. The final structure elucidations were performed by tandem mass spectrometry and (1)H and (13)C NMR. The structures of the metabolites were found to be 2beta-hydroxy-tiamulin, 8alpha-hydroxy-tiamulin and N-deethyl-tiamulin. In addition, the LC-MS chromatograms revealed two other minor metabolites. From their chromatography and from MS(2) analysis the structures were estimated to be 2beta-hydroxy-N-deethyl-tiamulin and 8alpha-hydroxy-N-deethyl-tiamulin, but the structures were not confirmed by NMR. In these studies approximately 20% of tiamulin was deethylated, 10% was hydroxylated in the 2beta-position and 7% was hydroxylated in the 8alpha-position. About 40% of tiamulin was metabolized during the incubation conditions used. The protein precipitation in the incubations was performed using perchloric acid, and the preparative purification was performed under alkaline conditions. Therefore, the stability of the metabolites under these conditions was studied. The metabolites were found to be stable in the acid solution, but under alkaline conditions, particularly at room temperature, the stability of especially 8alpha-hydroxy-tiamulin was considerably reduced (40% loss after 1 week).

  17. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

    Energy Technology Data Exchange (ETDEWEB)

    Revaud, D.

    2009-06-15

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  18. Structural predictor for nonlinear sheared dynamics in simple glass-forming liquids.

    Science.gov (United States)

    Ingebrigtsen, Trond S; Tanaka, Hajime

    2018-01-02

    Glass-forming liquids subjected to sufficiently strong shear universally exhibit striking nonlinear behavior; for example, a power-law decrease of the viscosity with increasing shear rate. This phenomenon has attracted considerable attention over the years from both fundamental and applicational viewpoints. However, the out-of-equilibrium and nonlinear nature of sheared fluids have made theoretical understanding of this phenomenon very challenging and thus slower to progress. We find here that the structural relaxation time as a function of the two-body excess entropy, calculated for the extensional axis of the shear flow, collapses onto the corresponding equilibrium curve for a wide range of pair potentials ranging from harsh repulsive to soft and finite. This two-body excess entropy collapse provides a powerful approach to predicting the dynamics of nonequilibrium liquids from their equilibrium counterparts. Furthermore, the two-body excess entropy scaling suggests that sheared dynamics is controlled purely by the liquid structure captured in the form of the two-body excess entropy along the extensional direction, shedding light on the perplexing mechanism behind shear thinning.

  19. Structural predictor for nonlinear sheared dynamics in simple glass-forming liquids

    Science.gov (United States)

    Ingebrigtsen, Trond S.; Tanaka, Hajime

    2018-01-01

    Glass-forming liquids subjected to sufficiently strong shear universally exhibit striking nonlinear behavior; for example, a power-law decrease of the viscosity with increasing shear rate. This phenomenon has attracted considerable attention over the years from both fundamental and applicational viewpoints. However, the out-of-equilibrium and nonlinear nature of sheared fluids have made theoretical understanding of this phenomenon very challenging and thus slower to progress. We find here that the structural relaxation time as a function of the two-body excess entropy, calculated for the extensional axis of the shear flow, collapses onto the corresponding equilibrium curve for a wide range of pair potentials ranging from harsh repulsive to soft and finite. This two-body excess entropy collapse provides a powerful approach to predicting the dynamics of nonequilibrium liquids from their equilibrium counterparts. Furthermore, the two-body excess entropy scaling suggests that sheared dynamics is controlled purely by the liquid structure captured in the form of the two-body excess entropy along the extensional direction, shedding light on the perplexing mechanism behind shear thinning.

  20. Optimizing structure of complex technical system by heterogeneous vector criterion in interval form

    Science.gov (United States)

    Lysenko, A. V.; Kochegarov, I. I.; Yurkov, N. K.; Grishko, A. K.

    2018-05-01

    The article examines the methods of development and multi-criteria choice of the preferred structural variant of the complex technical system at the early stages of its life cycle in the absence of sufficient knowledge of parameters and variables for optimizing this structure. The suggested methods takes into consideration the various fuzzy input data connected with the heterogeneous quality criteria of the designed system and the parameters set by their variation range. The suggested approach is based on the complex use of methods of interval analysis, fuzzy sets theory, and the decision-making theory. As a result, the method for normalizing heterogeneous quality criteria has been developed on the basis of establishing preference relations in the interval form. The method of building preferential relations in the interval form on the basis of the vector of heterogeneous quality criteria suggest the use of membership functions instead of the coefficients considering the criteria value. The former show the degree of proximity of the realization of the designed system to the efficient or Pareto optimal variants. The study analyzes the example of choosing the optimal variant for the complex system using heterogeneous quality criteria.

  1. Diverse supramolecular structures formed by self‐assembling proteins of the B acillus subtilis spore coat

    Science.gov (United States)

    Jiang, Shuo; Wan, Qiang; Krajcikova, Daniela; Tang, Jilin; Tzokov, Svetomir B.; Barak, Imrich

    2015-01-01

    Summary Bacterial spores (endospores), such as those of the pathogens C lostridium difficile and B acillus anthracis, are uniquely stable cell forms, highly resistant to harsh environmental insults. B acillus subtilis is the best studied spore‐former and we have used it to address the question of how the spore coat is assembled from multiple components to form a robust, protective superstructure. B . subtilis coat proteins (CotY, CotE, CotV and CotW) expressed in E scherichia coli can arrange intracellularly into highly stable macro‐structures through processes of self‐assembly. Using electron microscopy, we demonstrate the capacity of these proteins to generate ordered one‐dimensional fibres, two‐dimensional sheets and three‐dimensional stacks. In one case (CotY), the high degree of order favours strong, cooperative intracellular disulfide cross‐linking. Assemblies of this kind could form exquisitely adapted building blocks for higher‐order assembly across all spore‐formers. These physically robust arrayed units could also have novel applications in nano‐biotechnology processes. PMID:25872412

  2. Heterogeneous Seeding of a Prion Structure by a Generic Amyloid Form of the Fungal Prion-forming Domain HET-s(218-289)

    Energy Technology Data Exchange (ETDEWEB)

    Wan, William; Bian, Wen; McDonald, Michele; Kijac, Aleksandra; Wemmer, David E.; Stubbs, Gerald [UCB; (Vanderbilt); (LBNL)

    2013-11-13

    The fungal prion-forming domain HET-s(218–289) forms infectious amyloid fibrils at physiological pH that were shown by solid-state NMR to be assemblies of a two-rung β-solenoid structure. Under acidic conditions, HET-s(218–289) has been shown to form amyloid fibrils that have very low infectivity in vivo, but structural information about these fibrils has been very limited. We show by x-ray fiber diffraction that the HET-s(218–289) fibrils formed under acidic conditions have a stacked β-sheet architecture commonly found in short amyloidogenic peptides and denatured protein aggregates. At physiological pH, stacked β-sheet fibrils nucleate the formation of the infectious β-solenoid prions in a process of heterogeneous seeding, but do so with kinetic profiles distinct from those of spontaneous or homogeneous (seeded with infectious β-solenoid fibrils) fibrillization. Several serial passages of stacked β-sheet-seeded solutions lead to fibrillization kinetics similar to homogeneously seeded solutions. Our results directly show that structural mutation can occur between substantially different amyloid architectures, lending credence to the suggestion that the processes of strain adaptation and crossing species barriers are facilitated by structural mutation.

  3. Unique hyper-thermal composting process in Kagoshima City forms distinct bacterial community structures.

    Science.gov (United States)

    Tashiro, Yukihiro; Tabata, Hanae; Itahara, Asuka; Shimizu, Natsuki; Tashiro, Kosuke; Sakai, Kenji

    2016-11-01

    A unique compost, Satsuma soil, is produced from three types of wastewater sludge using hyper-thermal processes at temperatures much higher than that of general thermophilic processes in Kagoshima City, Japan. We analyzed the bacterial community structures of this hyper-thermal compost sample and other sludges and composts by a high-throughput barcoded pyrosequencing method targeting the 16S rRNA gene. In total, 621,076 reads were derived from 17 samples and filtered. Artificial sequences were deleted and the reads were clustered based on the operational taxonomic units (OTUs) at 97% similarity. Phylum-level analysis of the hyper-thermal compost revealed drastic changes of the sludge structures (each relative abundance) from Firmicutes (average 47.8%), Proteobacteria (average 22.3%), and Bacteroidetes (average 10.1%) to two main phyla including Firmicutes (73.6%) and Actinobacteria (25.0%) with less Proteobacteria (∼0.3%) and Bacteroidetes (∼0.1%). Furthermore, we determined the predominant species (each relative abundance) of the hyper-thermal compost including Firmicutes related to Staphylococcus cohnii (13.8%), Jeotgalicoccus coquinae (8.01%), and Staphylococcus lentus (5.96%), and Actinobacteria related to Corynebacterium stationis (6.41%), and found that these species were not predominant in wastewater sludge. In contrast, we did not observe any common structures among eight other composts produced, using the hyper-thermal composts as the inoculums, under thermophilic conditions from different materials. Principle coordinate analysis of the hyper-thermal compost indicated a large difference in bacterial community structures from material sludge and other composts. These results suggested that a distinct bacterial community structure was formed by hyper-thermal composting. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  4. Composition and molecular scale structure of nanophases formed by precipitation of biotite weathering products

    Science.gov (United States)

    Tamrat, Wuhib Zewde; Rose, Jérôme; Grauby, Olivier; Doelsch, Emmanuel; Levard, Clément; Chaurand, Perrine; Basile-Doelsch, Isabelle

    2018-05-01

    Because of their large surface area and reactivity, nanometric-size soil mineral phases have a high potential for soil organic matter stabilization, contaminant sorption or soil aggregation. In the literature, Fe and Al phases have been the main targets of batch-synthesized nanomineral studies while nano-aluminosilicates (Al and Si phases) have been mainly studied in Andic soils. In the present work, we synthesized secondary nanophases of Fe, Al and Si. To simulate a system as close as possible to soil conditions, we conducted laboratory simulations of the processes of (1) biotite alteration in acidic conditions producing a Al Si Fe Mg K leachate solution and (2) the following neoformation of secondary nanophases by titrating the leachate solution to pH 4.2, 5 and 7. The morphology of the nanophases, their size, crystallinity and chemistry were characterized by TEM-EDX on single particles and their local atomic structure by EXAFS (Extended X-ray Absorption Fine Structure) at the Fe absorption K-edge. The main nanophases formed were amorphous particles 10-60 nm in size whose composition (dominated by Fe and Si) was strongly controlled by the pH conditions at the end of the titration. At pH 4.2 and pH 7, the structure of the nanophases was dominated by the polymerization of Fe, which was hindered by Al, Si, Mg and K. Conversely, at pH 5, the polymerization of Fe was counteracted by precipitation of high amounts of Si. The synthetized nanophases were estimated to be rather analogous to nanophases formed in natural biotite-bearing soils. Because of their small size and potential high surface reactivity, the adsorption capacities of these nanophases with respect to the OM should be revisited in the framework of soil C storage.

  5. Crystalline structure of the marketed form of Rifampicin: a case of conformational and charge transfer polymorphism

    Science.gov (United States)

    de Pinho Pessoa Nogueira, Luciana; de Oliveira, Yara S.; de C. Fonseca, Jéssica; Costa, Wendell S.; Raffin, Fernanda N.; Ellena, Javier; Ayala, Alejandro Pedro

    2018-03-01

    Rifampicin is a semi-synthetic drug derived from rifamycin B, and currently integrates the fixed dose combination tablet formulations used in the treatment of tuberculosis. It is also used in the leprosy polychemotherapy and prophylaxis, which are diseases classified as neglected according to the World Health Organization. Rifampicin is a polymorphic drug and its desirable polymorphic form is labeled as II, being the main goal of this study the elucidation of its crystalline structure. Polymorph II is characterized by two molecules with different conformations in the asymmetric unit and the following lattice parameters: a = 14.0760 (10) Å, b = 17.5450 (10) Å, c = 17.5270 (10) Å, β = 92.15°. Differently to the previously reported structures, a charge transference from the hydroxyl group of the naphthoquinone of one conformer to the nitrogen of the piperazine group of the second conformer was observed. The relevance of the knowledge of this crystalline structure, which is the preferred polymorph for pharmaceutical formulations, was evidenced by analyzing raw materials with polymorphic mixtures. Thus, the results presented in this contribution close an old information gap allowing the complete solid-state characterization of rifampicin.

  6. ASSESSMENT FORM - NEW IMPROVEMENT OF ACTIONS: CONCENTRATION AND RESEARCH AREAS / CURRICULUM STRUCTURE / FUNDRAISING

    Directory of Open Access Journals (Sweden)

    Iracema MP Calderon

    Full Text Available Objective: This review aims to develop a critical and current analysis of the basic structure of a Postgraduate program for proposing improvement actions and new evaluation criteria. Method: To examine the items that are areas of concentration (AC, research lines (LP, research projects (PP, curricular structure and fundraising were consulted the Area Document, the 2013 Evaluation Report and the Assessment Sheets of Medicine III programs, evaluated in the 2010-2012 period. Results: Consistency is recommended especially among AC, LP and PP, with genuine link between activities and permanent teachers skills and based on structured curriculum in the education of the student. The Program Proposal interfere, and much, in qualifying a program. The curriculum should provide subsidy to the formation of the researcher, through the core subjects, and development of PP, being the concept of disciplines to support lines and research projects. Fundraise should be set out in research projects and in the CV-Lattes. The area recommended that at least 40-50% of permanent teachers present fundraising and the minimum 20-25% of these teachers to have productivity scholarship PQ / CNPq during the triennium. Conclusion: It is necessary to promote wide discussion and find a consensus denominator for these issues. The actions should contribute to the improvement of evaluation forms and certainly for the qualification of the programs but graduate.

  7. Cavitation structures formed during the rebound of a sphere from a wetted surface

    KAUST Repository

    Marston, Jeremy; Wang, Yong; Ng, Waikiong; Tan, Reginald; Thoroddsen, Sigurdur T

    2010-01-01

    We use high-speed imaging to observe the dynamics of cavitation, caused by the impact and subsequent rebound of a sphere from a solid surface covered with a thin layer of highly viscous liquid. We note marked qualitative differences between the cavitation structures with increase in viscosity, as well as between Newtonian and non-Newtonian liquids. The patterns observed are quite unexpected and intricate, appearing in concentric ring formations around the site of impact. In all cases, we identify a distinct radius from which the primary bubbles emanate. This radius is modelled with a modified form of Hertz contact theory. Within this radius, we show that some fine cavitation structure may exist or that it may be one large cavitation bubble. For the non-Newtonian fluids, we observe foam-like structures extending radially with diminishing bubble sizes with increase in radial position. Whereas for the Newtonian fluids, the opposite trend is observed with increasing bubble size for increasing radial position. Finally, we compare our experimental observations of cavitation to the maximum tension criterion proposed by Joseph (J Fluid Mech 366:367-378, 1998) showing that this provides the lower limit for the onset of cavitation in our experiments. © 2010 Springer-Verlag.

  8. Cavitation structures formed during the rebound of a sphere from a wetted surface

    KAUST Repository

    Marston, Jeremy

    2010-09-28

    We use high-speed imaging to observe the dynamics of cavitation, caused by the impact and subsequent rebound of a sphere from a solid surface covered with a thin layer of highly viscous liquid. We note marked qualitative differences between the cavitation structures with increase in viscosity, as well as between Newtonian and non-Newtonian liquids. The patterns observed are quite unexpected and intricate, appearing in concentric ring formations around the site of impact. In all cases, we identify a distinct radius from which the primary bubbles emanate. This radius is modelled with a modified form of Hertz contact theory. Within this radius, we show that some fine cavitation structure may exist or that it may be one large cavitation bubble. For the non-Newtonian fluids, we observe foam-like structures extending radially with diminishing bubble sizes with increase in radial position. Whereas for the Newtonian fluids, the opposite trend is observed with increasing bubble size for increasing radial position. Finally, we compare our experimental observations of cavitation to the maximum tension criterion proposed by Joseph (J Fluid Mech 366:367-378, 1998) showing that this provides the lower limit for the onset of cavitation in our experiments. © 2010 Springer-Verlag.

  9. Targeting C-Myc Promoter: Helquats As Novel G-Quadruplex Stabilizing Ligands

    Czech Academy of Sciences Publication Activity Database

    Kužmová, Erika; Kozák, Jaroslav; Komárková, Veronika; Pytlík, R.; Teplý, Filip; Hájek, Miroslav

    2014-01-01

    Roč. 124, č. 21 (2014) ISSN 0006-4971. [Annual Meeting of the American Society of Hematology /56./. 06.12.2014-09.12.2014, San Francisco] Institutional support: RVO:61388963 Keywords : helquats * C-Myc * leukemia Subject RIV: CE - Biochemistry

  10. Human telomeric G-quadruplex formation and highly selective fluorescence detection of toxic strontium ions.

    Science.gov (United States)

    Qu, Konggang; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang

    2012-03-01

    Strontium ions play important roles in biological systems. The inhalation of strontium can cause severe respiratory difficulties, anaphylactic reaction and extreme tachycardia. Strontium can replace calcium in organisms, inhibit normal calcium absorption and induce strontium "rickets" in childhood. Thus, the development of sensitive and selective methods for the determination of trace amounts of Sr(2+) in aqueous media is of considerable importance for environmental and human health protection. A number of methodologies, such as X-ray energy dispersive spectrometry, inductively coupled argon plasma atomic emission spectroscopy (ICP-AES), atomic absorption spectrometry (AAS) and instrumental thermal neutron activation analysis, have been reported. However, these methods are somewhat complex, costly, time consuming and, especially, need special instruments. Thus, the design of convenient and inexpensive approaches for the sensitive and selective detection of Sr(2+) with rapid, easy manipulation is in ever-increasing demand. To the best of our knowledge, using DNA conformational change to detect Sr(2+) has not yet been reported. Herein we utilized thiazole orange (TO) as a signal reporter to devise a simple Sr(2+) detection assay based on Sr(2+) induced human telomeric DNA conformational change in the presence of SWNTs. The limit of detection is 10 nM Sr(2+) (0.87 μg L(-1)), far below 4 mg L(-1), the U.S. Federal threshold in drinking water defined by the U.S. EPA.

  11. Conformations of Human Telomeric G-Quadruplex Studied Using a Nucleotide-Independent Nitroxide Label

    Czech Academy of Sciences Publication Activity Database

    Zhang, X.J.; Xu, C.X.; Di Felice, R.; Šponer, Jiří; Islam, B.; Stadlbauer, Petr; Ding, Y.; Mao, L.; Mao, Z.W.; Qin, P.Z.

    2016-01-01

    Roč. 55, č. 2 (2016), s. 360-372 ISSN 0006-2960 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : PARAMAGNETIC-RESONANCE SPECTROSCOPY * AMBER FORCE-FIELD * NUCLEIC-ACIDS Subject RIV: BO - Biophysics Impact factor: 2.938, year: 2016

  12. Synthesis of New DNA G-Quadruplex Constructs with Anthraquinone Insertions and Their Anticoagulant Activity

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2016-01-01

    1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...

  13. Wild-type p53 binds to MYC promoter G-quadruplex

    Czech Academy of Sciences Publication Activity Database

    Petr, Marek; Helma, Robert; Polášková, Alena; Krejci, Aneta; Dvořáková, Zuzana; Kejnovská, Iva; Navrátilová, Lucie; Adámik, Matěj; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 36, OCT2016 (2016), č. článku e00397. ISSN 0144-8463 R&D Projects: GA ČR GA13-36108S; GA ČR GAP205/12/0466 Institutional support: RVO:68081707 Keywords : nuclease-hypersensitive element * c-terminal domain * gene-expression Subject RIV: BO - Biophysics Impact factor: 2.906, year: 2016

  14. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    DEFF Research Database (Denmark)

    Opazo, Felipe; Eiden, Laura; Hansen, Line

    2015-01-01

    cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target...

  15. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

    2017-01-01

    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  16. BLM helicase suppresses recombination at G-quadruplex motifs in transcribed genes

    NARCIS (Netherlands)

    van Wietmarschen, Niek; Merzouk, Sarra; Halsema, Nancy; Spierings, Diana C J; Guryev, Victor; Lansdorp, Peter M

    2018-01-01

    Bloom syndrome is a cancer predisposition disorder caused by mutations in the BLM helicase gene. Cells from persons with Bloom syndrome exhibit striking genomic instability characterized by excessive sister chromatid exchange events (SCEs). We applied single-cell DNA template strand sequencing

  17. Novel molecular targets for kRAS downregulation: promoter G-quadruplexes

    Science.gov (United States)

    2016-11-01

    proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with

  18. Bloom’s syndrome protein unfolding G-quadruplexes in two pathways

    Science.gov (United States)

    Zhao, Zhen-Ye; Xu, Chun-Hua; Shi, Jing; Li, Jing-Hua; Ma, Jian-Bing; Jia, Qi; Ma, Dong-Fei; Li, Ming; Lu, Ying

    2017-08-01

    Not Available Project supported by the National Natural Science Foundation of China (Grant Nos. 11674382, 11574381, and 11574382) and the Key Research Program of Frontier Sciences, Chinese Academy of Sciences (Grant No. QYZDJ-SSW-SYS014).

  19. Resilin and chitinous cuticle form a composite structure for energy storage in jumping by froghopper insects

    Directory of Open Access Journals (Sweden)

    Shaw Stephen R

    2008-09-01

    Full Text Available Abstract Background Many insects jump by storing and releasing energy in elastic structures within their bodies. This allows them to release large amounts of energy in a very short time to jump at very high speeds. The fastest of the insect jumpers, the froghopper, uses a catapult-like elastic mechanism to achieve their jumping prowess in which energy, generated by the slow contraction of muscles, is released suddenly to power rapid and synchronous movements of the hind legs. How is this energy stored? Results The hind coxae of the froghopper are linked to the hinges of the ipsilateral hind wings by pleural arches, complex bow-shaped internal skeletal structures. They are built of chitinous cuticle and the rubber-like protein, resilin, which fluoresces bright blue when illuminated with ultra-violet light. The ventral and posterior end of this fluorescent region forms the thoracic part of the pivot with a hind coxa. No other structures in the thorax or hind legs show this blue fluorescence and it is not found in larvae which do not jump. Stimulating one trochanteral depressor muscle in a pattern that simulates its normal action, results in a distortion and forward movement of the posterior part of a pleural arch by 40 μm, but in natural jumping, the movement is at least 100 μm. Conclusion Calculations showed that the resilin itself could only store 1% to 2% of the energy required for jumping. The stiffer cuticular parts of the pleural arches could, however, easily meet all the energy storage needs. The composite structure therefore, combines the stiffness of the chitinous cuticle with the elasticity of resilin. Muscle contractions bend the chitinous cuticle with little deformation and therefore, store the energy needed for jumping, while the resilin rapidly returns its stored energy and thus restores the body to its original shape after a jump and allows repeated jumping.

  20. An Examination of the Structure of the Career Decision Self-Efficacy Scale (Short Form) among Italian High School Students

    Science.gov (United States)

    Presti, Alessandro Lo; Pace, Francesco; Mondo, Marina; Nota, Laura; Casarubia, Provvidenza; Ferrari, Lea; Betz, Nancy E.

    2013-01-01

    This study aims to evaluate the factor structure of Career Decision Self-Efficacy scale-short form in a sample of Italian high school adolescents. confirmatory factor analysis (CFA) was used to test the degree to which a one-factor structure and a five-factor structure provided the best fit. In view of available research the five-factor structure…

  1. Forming a structure of the CoNiFe alloys by X-ray irradiation

    Science.gov (United States)

    Valko, Natalia; Kasperovich, Andrey; Koltunowicz, Tomasz N.

    The experimental data of electrodeposition kinetics researches and structure formation of ternary CoNiFe alloys deposited onto low-carbon steel 08kp in the presence of X-rays are presented. Relations of deposit rate, current efficiencies, element and phase compositions of CoNiFe coatings formed from sulfate baths with respect to cathode current densities (0.5-3A/dm2), electrolyte composition and irradiation were obtained. It is shown that, the CoNiFe coatings deposited by the electrochemical method involving exposure of the X-rays are characterized by more perfect morphology surfaces with less developed surface geometry than reference coatings. The effect of the X-ray irradiation on the electrodeposition of CoNiFe coatings promotes formatting of alloys with increased electropositive component and modified phase composition.

  2. Evaluation of five years of nursing home inspection forms: structural and hygiene-related violation trends.

    Science.gov (United States)

    Avery, Chris; Humphrey, Charles; Balany, Jo Anne

    2014-11-01

    Health inspections are performed at nursing homes to identify and reduce risk and to help maintain a safe environment for nursing home residents. The study described in this article aimed to identify the most frequent violations, types of violations (hygiene or structural), and repeat violations in nursing home facilities during health inspections; and to determine if the age of the facility influenced inspection scores. Nursing home health inspection forms (N = 131) completed between 2005 and 2011 in Pitt County, North Carolina, were analyzed. Results indicated that 60% of all violations were hygiene-related and could possibly be corrected without significant financial investments by management. Significant correlations occurred between the total number of violations and the facility age (p = .003) and between the number of repeat violations and total violations (p < .001). The average inspection score for nursing homes could be increased by more than three points if sanitation practices were improved.

  3. Structure of zinc particles formed by condensation for transportation to an analytic device

    Energy Technology Data Exchange (ETDEWEB)

    Barone, T.; Wochele, J.; Ludwig, C.; Schuler, A.J.; Ketterer, B.

    2002-03-01

    Aerosol containing small particles with homogeneous structural characteristics are desired for analysis in Inductively Coupled Plasma Optical Emission Spectrometer (ICP-OES). To investigate heavy metal evaporation behaviour during thermal treatment a laboratory on-line elemental analyzer has been developed. The analyzer consists of a Condensation Interface (CI) for the generation of aerosols and an ICP-OES as detector. The settings at the CI can strongly influence the particle formation, and therefore the quality of the measurements. To improve the method preliminary experiments were conducted to investigate the characteristics of zinc particles formed in the evaporation/condensation process. System conditions, such as vaporization temperature, carrier gas, and flow rate, were varied to investigate their influence on particle size, homogeneity and shape. The experiments suggest that particles vary most with temperature, lower vaporization temperatures resulted in the formation of smaller particles. (author)

  4. Field-aligned plasma-potential structure formed by local electron cyclotron resonance

    International Nuclear Information System (INIS)

    Hatakeyama, Rikizo; Kaneko, Toshiro; Sato, Noriyoshi

    2001-01-01

    The significance of basic experiments on field-aligned plasma-potential structure formed by local electron cyclotron resonance (ECR) is claimed based on the historical development of the investigation on electric double layer and electrostatic potential confinement of open-ended fusion-oriented plasmas. In the presence of a single ECR point in simple mirror-type configurations of magnetic field, a potential dip (thermal barrier) appears around this point, being followed by a subsequent potential hump (plug potential) along a collisionless plasma flow. The observed phenomenon gives a clear-cut physics to the formation of field-aligned plug potential with thermal barrier, which is closely related to the double layer formation triggered by a negative dip. (author)

  5. Structural investigation of the spinel phase formed in fuel CRUD before and after zinc injection

    International Nuclear Information System (INIS)

    Chen, J.

    2002-01-01

    Spinel phase is an important constituent of fuel CRUD. Since it can accommodate 60 Co in its crystal structure, its stability in reactor water environment is crucial for the radioactivity control in LWR plants. With increasing curiosity about zinc injection technology, the mechanism of the interaction of zinc with the spinel has drawn much attention. This paper describes the crystal and microstructures of spinel phase in the fuel CRUD collected on four fuel rods of 1- and 5-cycle, respectively, from Barsebaeck 2 BWR before and after zinc injection operation. High precision X-ray powder diffraction technique has been applied to identify the phase compositions of fuel CRUD and to measure the cell length of the spinel phase formed. The results show that, after about 1-cycle zinc injection operation, the tenacious CRUD formed on the fresh fuel rod contains defective zinc oxide, in addition to hematite and spinel as commonly seen. Moreover, the phase ratio of spinel to hematite is much increased. The cell length of the spinel is increased accordingly, which is the direct evidence for the presence of zinc in the spinel structure. For the 5-cycle rod, however, neither zinc oxide nor any change in the phase ratio has been detected. The cell length of the spinel has been increased, in a less degree, however, as compared to that for the 1-cycle rod. The cell lengths of spinel are similar in both tenacious and loose CRUD layers, indicating that zinc was able to easily penetrate through the tenacious CRUD layer. (authors)

  6. The Structure of the Nearby Giant Star-Forming Region 30 Doradus

    Science.gov (United States)

    Pellegrini, Eric; Baldwin, Jack; Hanson, Margaret; Ferland, Gary; Troland, Thomas

    2007-08-01

    The rates of star formation and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study of these processes in the two nearest giant star-forming regions, 30 Doradus and NGC 3603, as an aide in understanding the nature of Giant Extragalactic H II Regions, starbursts, and Ultra-Luminous IR Galaxies. We recently completed our observations of NGC 3603. Here we request 2 nights on the Blanco telescope to obtain a dense grid of optical long-slit spectra criss- crossing 30 Dor. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3800 different spots in the nebula. We also request 3 nights on SOAR to take K-band long slit spectra covering H^+ Br(gamma) and several H_2 lines across three representative edge-on ionization fronts in 30 Dor. The IR spectra will be taken in locations also covered by the optical spectra, and will tell us about the structure, pressure support and heating mechanisms in the photo-dissociation regions (PDRs) at these points. Either half of this project can stand on its own, but both parts together will permit the PI to complete his PhD thesis.

  7. Structure of a hexameric form of RadA recombinase from Methanococcus voltae

    International Nuclear Information System (INIS)

    Du, Liqin; Luo, Yu

    2012-01-01

    Hexameric rings of RadA recombinase from M. voltae have been crystallized. Structural comparisons suggest that homologues of RadA tend to form double-ringed assemblies. Archaeal RadA proteins are close homologues of eukaryal Rad51 and DMC1 proteins and are remote homologues of bacterial RecA proteins. For the repair of double-stranded breaks in DNA, these recombinases promote a pivotal strand-exchange reaction between homologous single-stranded and double-stranded DNA substrates. This DNA-repair function also plays a key role in the resistance of cancer cells to chemotherapy and radiotherapy and in the resistance of bacterial cells to antibiotics. A hexameric form of a truncated Methanococcus voltae RadA protein devoid of its small N-terminal domain has been crystallized. The RadA hexamers further assemble into two-ringed assemblies. Similar assemblies can be observed in the crystals of Pyrococcus furiosus RadA and Homo sapiens DMC1. In all of these two-ringed assemblies the DNA-interacting L1 region of each protomer points inward towards the centre, creating a highly positively charged locus. The electrostatic characteristics of the central channels can be utilized in the design of novel recombinase inhibitors

  8. The use of quadratic forms in the calculation of ground state electronic structures

    International Nuclear Information System (INIS)

    Keller, Jaime; Weinberger, Peter

    2006-01-01

    There are many examples in theoretical physics where a fundamental quantity can be considered a quadratic form ρ=Σ i ρ i =vertical bar Ψ vertical bar 2 and the corresponding linear form Ψ=Σ i ψ i is highly relevant for the physical problem under study. This, in particular, is the case of the density and the wave function in quantum mechanics. In the study of N-identical-fermion systems we have the additional feature that Ψ is a function of the 3N configuration space coordinates and ρ is defined in three-dimensional real space. For many-electron systems in the ground state the wave function and the Hamiltonian are to be expressed in terms of the configuration space (CS), a replica of real space for each electron. Here we present a geometric formulation of the CS, of the wave function, of the density, and of the Hamiltonian to compute the electronic structure of the system. Then, using the new geometric notation and the indistinguishability and equivalence of the electrons, we obtain an alternative computational method for the ground state of the system. We present the method and discuss its usefulness and relation to other approaches

  9. Phytosterol Profiles of Common Foods and Estimated Natural Intake of Different Structures and Forms in China.

    Science.gov (United States)

    Wang, Mengmeng; Huang, Weisu; Hu, Yinzhou; Zhang, Liangxiao; Shao, Yafang; Wang, Meng; Zhang, Fang; Zhao, Ziyan; Mei, Xiaohong; Li, Tao; Wang, Donghui; Liang, Ying; Li, Jing; Huang, Yining; Zhang, Liuquan; Xu, Tao; Song, Huaxin; Zhong, Yongheng; Lu, Baiyi

    2018-03-21

    Phytosterols are well-known for their cholesterol-lowering effects, and the structures and forms of phytosterols affect their bioactivity. We aimed to illustrate the phytosterol profiles in common foods and estimate their natural intake in five geographical regions and among different age groups in China. In total, 12 phytosterols in free and esterified forms of 119 foods from five regions across China were examined using gas chromatography-mass spectrometry. Then, the dietary intake of phytosterols was calculated combined with the dietary foods intake data of Chinese people. The total phytosterol content was highest in vegetable oils (150.4-1230.9 mg/100 g), followed by legumes (129.6-275.6 mg/100 g), nuts (18.9-255.2 mg/100 g), and cereals (11.9-93.8 mg/100 g). Vegetables and fruits contained lower contents of total phytosterols. Phytosterols were mainly esterified in most common foods except in nuts. The predominant phytosterols were β-sitosterol, campesterol, and stigmasterol, all of which belonged to plant sterols and 4-desmethylsterols. Total phytosterol intake varied across different regions, ranging between 257.7 and 473.7 mg/standard-person (sp)/day, with the highest intake in Beijing, followed by Hangzhou, Wuhan, Chongqing, and Guangzhou. However, phytosterol proportion was similar across regions, with β-sitosterol accounting for 46.5-50.3% of the natural intake. Phytosterol intake was mainly constituted by plant sterols and 4-desmethylsterols in esterified form (61.9-74.6%). At the age of 2-70 years, phytosterol intake ranged from 154.3 mg/day to 348.0 mg/day in the national scale.

  10. Structured printed referral letter (form letter; saves time and improves communication

    Directory of Open Access Journals (Sweden)

    R.P.J.C. Ramanayake

    2013-01-01

    Full Text Available Referral of patients to hospitals, specialists and other institutions is an essential part of primary health care. Patients are referred to specialists when investigation or therapeutic options are exhausted in primary care or when opinion or advice is needed from them. Referral has considerable implications for patients, health care system and health care costs. Good communication between primary and secondary care is essential for the smooth running of any health care system. Referral and reply letters are the sole means of communication between doctors most of the time and breakdown in communication could lead to poor continuity of care, delayed diagnoses, polypharmacy, increased litigation risk and unnecessary testing. A referral letter also helps to avoid patient dissatisfaction and loss of confidence in family physician. Studies of referral letters have reported that specialists are dissatisfied with their quality and content. Inclusion of letter writing skills in the medical curriculum, peer assessment and feedback have shown to improve the quality of referral letters. . Form letters have shown to enhance information content and communication in referral process. In Sri Lanka referral letters are usually hand written and frequent complaints are that these letters do not contain adequate information and retrieval of information is a problem due to poor legibility and clarity. Sometimes Primary care doctors refer patients to hospitals and specialists with only verbal instructions. To address these short comings this form letter was introduced. Based on the guidelines and systematic review of published articles, items of information to be included were decided. Printed forms of the letter are kept in the practice and the doctor has to just fill up relevant information under each heading. The objectives of introducing this structured referral letter was to improve the quality and standard of referral letters and save time for both general

  11. The plant economics spectrum is structured by leaf habits and growth forms across subtropical species.

    Science.gov (United States)

    Zhao, Yan-Tao; Ali, Arshad; Yan, En-Rong

    2017-02-01

    The plant economics spectrum that integrates the combination of leaf and wood syndromes provides a useful framework for the examination of species strategies at the whole-plant level. However, it remains unclear how species that differ in leaf habits and growth forms are integrated within the plant economics spectrum in subtropical forests. We measured five leaf and six wood traits across 58 subtropical plant species, which represented two leaf habits (evergreen vs deciduous) and two growth forms (tree vs shrub) in eastern China. Principal component analysis (PCA) was employed separately to construct the leaf (LES), wood (WES) and whole-plant (WPES) economics spectra. Leaf and wood traits are highly intra- and intercorrelated, thus defining not only the LES and WES, but also a WPES. Multi-trait variations in PCAs revealed that the traits which were representative of the acquisitive strategy, i.e., cheap tissue investment and rapid returns on that investment, were clustered at one end, while traits that represented the conservative strategy, i.e., expensive tissue investment and slower returns, were clustered at other end in each of the axes of the leaf and wood syndromes (PC1-axis) and the plant height strategy (PC2-axis). The local WPES, LES and WES were tightly correlated with each other. Evergreens shaped the conservative side, while deciduous species structured the acquisitive side of the WPES and LES. With respect to plant height strategies, trees formulated the acquisitive side and shrub species made up the conservative side of the WPES, LES and WES. In conclusion, our results suggested that the LES and WES were coordinated to a WPES for subtropical species. The finding of this local spectrum of plant form and function would be beneficial for modeling nutrient fluxes and species compositions in the changing climate, but also for understanding species strategies in an evolutionary context. © The Author 2016. Published by Oxford University Press. All rights

  12. Medicinal Chemistry Projects Requiring Imaginative Structure-Based Drug Design Methods.

    Science.gov (United States)

    Moitessier, Nicolas; Pottel, Joshua; Therrien, Eric; Englebienne, Pablo; Liu, Zhaomin; Tomberg, Anna; Corbeil, Christopher R

    2016-09-20

    cytochrome P450 enzymes (CYPs)-for toxicology studies-the program Impacts was derived from Fitted and helped us to reveal a complex metabolism with unforeseen stereocenter isomerizations. These efforts, combined with those of other docking software developers, have strengthened our understanding of the complex drug-protein binding process while providing the medicinal chemistry community with useful tools that have led to drug discoveries. In this Account, we describe our contributions over the past 15 years-within their historical context-to the design of drug candidates, including BACE-1 inhibitors, POP covalent inhibitors, G-quadruplex binders, and aminoglycosides binding to nucleic acids. We also remark the necessary developments of docking programs, specifically Fitted, that enabled structure-based design to flourish and yielded multiple fruitful, rational medicinal chemistry campaigns.

  13. STRUCTURAL AND FUNCTIONAL MODEL OF FORMING INFORMATIONAL COMPETENCE OF TECHNICAL UNIVERSITY STUDENTS

    Directory of Open Access Journals (Sweden)

    Taras Ostapchuk

    2016-11-01

    Full Text Available The article elaborates and analyses the structural and functional model of formation of information competence of technical university students. The system and mutual relationships between its elements are revealed. It is found out that the presence of the target structure of the proposed model, process and result-evaluative blocks ensure its functioning and the opportunity to optimize the learning process for technical school students’ information training. It is established that the formation of technical university students’ information competence based on components such as motivational value, as well as operational activity, cognitive, and reflexive one. These criteria (motivation, operational and activity, cognitive, reflective, indexes and levels (reproductive, technologized, constructive forming technical university students’ information competence are disclosed. Expediency of complex organizational and educational conditions in the stages of information competence is justified. The complex organizational and pedagogical conditions include: orientation in the organization and implementation of class work for technical university students’ positive value treatment; the issue of forming professionalism; informatization of educational and socio-cultural environment of higher technical educational institutions; orientation of technical university students’ training to the demands of European and international standards on information competence as a factor in the formation of competitiveness at the labor market; introducing a special course curriculum that will provide competence formation due to the use of information technology in professional activities. Forms (lecture, visualization, problem lecture, combined lecture, scientific online conference, recitals, excursions, etc., tools (computer lab, multimedia projector, interactive whiteboard, multimedia technology (audio, video, the Internet technologies; social networks, etc

  14. Pathologizing poverty: new forms of diagnosis, disability, and structural stigma under welfare reform.

    Science.gov (United States)

    Hansen, Helena; Bourgois, Philippe; Drucker, Ernest

    2014-02-01

    In 1996 the U.S. severely restricted public support for low income people, ending "welfare as we know it." This led to dramatic increases in medicalized forms of support for indigent people, who increasingly rely on disability benefits justified by psychiatric diagnoses of chronic mental illness. We present case studies drawn from ethnographic data involving daily participant-observation between 2005 and 2012 in public clinics and impoverished neighborhoods in New York City, to describe the subjective experience of structural stigma imposed by the increasing medicalization of public support for the poor through a diagnosis of permanent mental disability. In some cases, disability benefits enable recipients to fulfill important social roles (sustaining a vulnerable household and promoting stable parenting). The status of family members who receive a monthly disability check improves within their kin and neighborhood-based networks, counterbalancing the felt stigma of being identified by doctors as "crazy". When a diagnosis of mental pathology becomes a valuable survival strategy constituting the basis for fulfillment of household responsibilities, stigmatizing processes are structurally altered. Through the decades, the stigmatized labels applied to the poor have shifted: from being a symptom of racial weakness, to the culture of poverty, and now to permanent medical pathology. The neoliberal bureaucratic requirement that the poor must repeatedly prove their "disabled" status through therapy and psychotropic medication appears to be generating a national and policy-maker discourse condemning SSI malingerers, resurrecting the 16th century specter of the "unworthy poor". Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Core-Shell Double Gyroid Structure Formed by Linear ABC Terpolymer Thin Films.

    Science.gov (United States)

    Antoine, Ségolène; Aissou, Karim; Mumtaz, Muhammad; Telitel, Siham; Pécastaings, Gilles; Wirotius, Anne-Laure; Brochon, Cyril; Cloutet, Eric; Fleury, Guillaume; Hadziioannou, Georges

    2018-05-01

    The synthesis and self-assembly in thin-film configuration of linear ABC triblock terpolymer chains consisting of polystyrene (PS), poly(2-vinylpyridine) (P2VP), and polyisoprene (PI) are described. For that purpose, a hydroxyl-terminated PS-b-P2VP (45 kg mol -1 ) building block and a carboxyl-terminated PI (9 kg mol -1 ) are first separately prepared by anionic polymerization, and then are coupled via a Steglich esterification reaction. This quantitative and metal-free catalyst synthesis route reveals to be very interesting since functionalization and purification steps are straightforward, and well-defined terpolymers are produced. A solvent vapor annealing (SVA) process is used to promote the self-assembly of frustrated PS-b-P2VP-b-PI chains into a thin-film core-shell double gyroid (Q 230 , space group: Ia3¯d) structure. As terraces are formed within PS-b-P2VP-b-PI thin films during the SVA process under a CHCl 3 vapor, different plane orientations of the Q 230 structure ((211), (110), (111), and (100)) are observed at the polymer-air interface depending on the film thickness. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Complexing in the systems of thorium tetrabromide-alkali metal bromide and structure of formed compounds

    International Nuclear Information System (INIS)

    Gershanovich, A.Ya.; Suglobova, I.G.

    1981-01-01

    Phase diagrams of the ThBr 4 -MBr binary systems (M=Na, K, Rb, Cs) are obtained using the methods of thermographic and X-ray phase analyses. Congruently melting compounds of the M 2 ThBr 6 form (M=K, Rb, Cs) with melting temperatures of 635, 650 and 680 deg C, respectively, and the NaThBr 5 decomposing in the solid phase reaction at 356 deg C, realized in the systems. The presence of eutectic points is established, their composition and melting temperatures are determined. Roentgenograms of all compounds prepared by the polycrystal method are obtained. K 2 ThBr 6 and Rb 2 ThBr 6 crystallize in the hexagonal crystal system (Rb 2 MnF 6 structure type) with 2 formula units in the lattice cell. The parameters of the K 2 ThBr 6 cell are a=0.752 nm, c=1.180 nm. The cell parameters of the Rb 2 ThBr 6 cell are a=0.758 nm, c=1.224 nm. The Cs 2 ThBr 6 has a pseudocubic tetragonal structure with 4 formula units in a cell. Parameters of the Cs 2 ThBr 6 cell are a=1.137 nm; c=1.069 nm [ru

  17. Assembly of alginate microfibers to form a helical structure using micromanipulation with a magnetic field

    International Nuclear Information System (INIS)

    Sun, Tao; Huang, Qiang; Shi, Qing; Wang, Huaping; Li, Pengyun; Fukuda, Toshio; Hu, Chengzhi; Nakajima, Masahiro

    2016-01-01

    Helical structures assembled using alginate microfibers have a promising spatial architecture mimicking in vivo vessels for culturing vascular cells. However, the helical structure can only be assembled at the macroscale, since a microassembly-based approach has not yet been developed. In this paper, we propose a magnetic-field-based micromanipulation method to fabricate a helical microstructure. By microfluidic spinning, alginate microfibers encapsulating magnetic nanoparticles are synthesized to enable the control of an electromagnetic needle (EMN). We developed a microrobotic system to actuate a micropipette to fix a free end of the microfiber, and then move the EMN to reel the microfiber around a micropillar. The motion of the EMN is guided using an upright microscope and a side-view camera. Because of the limitation of operation space, a spacer sleeve was designed to keep the tip of the EMN attracted to the microfiber, and simultaneously to keep the other part of the EMN isolated from the microfiber. To ensure the availability of the microfiber for continuously coiling, we enable the EMN tip to slide on the surface of the microfiber without changing the tensioning of the microfiber for positioning control. Furthermore, stable and repeatable micromanipulation was achieved to form multi-turn microfiber coils based on the motion planning of the EMN. Finally, we successfully fabricated a helical microstructure that can be applied in vascular tissue engineering in the future. (paper)

  18. High density liquid structure enhancement in glass forming aqueous solution of LiCl

    Science.gov (United States)

    Camisasca, G.; De Marzio, M.; Rovere, M.; Gallo, P.

    2018-06-01

    We investigate using molecular dynamics simulations the dynamical and structural properties of LiCl:6H2O aqueous solution upon supercooling. This ionic solution is a glass forming liquid of relevant interest in connection with the study of the anomalies of supercooled water. The LiCl:6H2O solution is easily supercooled and the liquid state can be maintained over a large decreasing temperature range. We performed simulations from ambient to 200 K in order to investigate how the presence of the salt modifies the behavior of supercooled water. The study of the relaxation time of the self-density correlation function shows that the system follows the prediction of the mode coupling theory and behaves like a fragile liquid in all the range explored. The analysis of the changes in the water structure induced by the salt shows that while the salt preserves the water hydrogen bonds in the system, it strongly affects the tetrahedral hydrogen bond network. Following the interpretation of the anomalies of water in terms of a two-state model, the modifications of the oxygen radial distribution function and the angular distribution function of the hydrogen bonds in water indicate that LiCl has the role of enhancing the high density liquid component of water with respect to the low density component. This is in agreement with recent experiments on aqueous ionic solutions.

  19. STRUCTURES OF LOCAL GALAXIES COMPARED TO HIGH-REDSHIFT STAR-FORMING GALAXIES

    International Nuclear Information System (INIS)

    Petty, Sara M.; De Mello, DuIlia F.; Gallagher, John S.; Gardner, Jonathan P.; Lotz, Jennifer M.; Matt Mountain, C.; Smith, Linda J.

    2009-01-01

    The rest-frame far-ultraviolet morphologies of eight nearby interacting and starburst galaxies (Arp 269, M 82, Mrk 8, NGC 520, NGC 1068, NGC 3079, NGC 3310, and NGC 7673) are compared with 54 galaxies at z ∼ 1.5 and 46 galaxies at z ∼ 4 observed in the Great Observatories Origins Deep Survey (GOODS) taken with the Advanced Camera for Surveys onboard the Hubble Space Telescope. The nearby sample is artificially redshifted to z ∼ 1.5 and 4 by applying luminosity and size scaling. We compare the simulated galaxy morphologies to real z ∼ 1.5 and 4 UV-bright galaxy morphologies. We calculate the Gini coefficient (G), the second-order moment of the brightest 20% of the galaxy's flux (M 20 ), and the Sersic index (n). We explore the use of nonparametric methods with two-dimensional profile fitting and find the combination of M 20 with n an efficient method to classify galaxies as having merger, exponential disk, or bulge-like morphologies. When classified according to G and M 20 20/30% of real/simulated galaxies at z ∼ 1.5 and 37/12% at z ∼ 4 have bulge-like morphologies. The rest have merger-like or intermediate distributions. Alternatively, when classified according to the Sersic index, 70% of the z ∼ 1.5 and z ∼ 4 real galaxies are exponential disks or bulge-like with n>0.8, and ∼ 30% of the real galaxies are classified as mergers. The artificially redshifted galaxies have n values with ∼ 35% bulge or exponential at z ∼ 1.5 and 4. Therefore, ∼ 20%-30% of Lyman-break galaxies have structures similar to local starburst mergers, and may be driven by similar processes. We assume merger-like or clumpy star-forming galaxies in the GOODS field have morphological structure with values n 20 > - 1.7. We conclude that Mrk 8, NGC 3079, and NGC 7673 have structures similar to those of merger-like and clumpy star-forming galaxies observed at z ∼ 1.5 and 4.

  20. Structures of butyl ions formed by electron impact ionization of isomeric butyl halides and alkanes

    International Nuclear Information System (INIS)

    Shold, D.M.; Ausloos, P.

    1978-01-01

    Using a pulsed ion cyclotron resonance (ICR) spectrometer, it is demonstrated that at pressures of about 10 -6 Torr and at observation times ranging from 10 -3 to 0.5 s, isobutane, neopentane, 2,2-dimethylbutane, isobutyl halides, and tert-butyl halides form C 4 H 9 + ions having the tertiary structure. In n-alkanes, 2-methylbutane, 3-methylpentane, n-butyl halides, and sec-butyl halides, both sec-C 4 H 9 + and t-C 4 H 9 + ions are observed, the sec-C 4 H 9 + ions surviving without rearrangement for at least 0.1 s. However, in the case of the halides, a collision-induced isomerization of the sec-C 4 H 9 + to the t-C 4 H 9 + ions occurs. The efficiency of this process increases with the basicity of the alkyl halide. Radiolysis experiments carried out at atmospheric pressures indicate, in agreement with ICR and solution experiments, that at times as short as 10 -10 s the majority of the i-C 4 H 9 + ions from isobutyl bromide rearrange to the t-C 4 H 9 + structure. On the other hand, in the radiolysis of both n-hexane and 3-methylpentane, the abundance of t-C 4 H 9 + relative to sec-C 4 H 9 + is substantially smaller than that observed in the ICR experiments, and decreases with decreasing collision interval. It is suggested that about 90% of the i-C 4 H 9 + can rearrange to t-C 4 H 9 + by simple 1,2-hydride shift without involving secondary or protonated methylcyclopropane structures as intermediates. 4 figures, 2 tables

  1. Investigation of the structure of debris beds formed from fuel rods fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Duc-Hanh; Fichot, Florian; Topin, Vincent, E-mail: vincent.topin@irsn.fr

    2017-03-15

    This paper is a study of debris beds that can form in the core of a nuclear power plant under severe accident conditions. Such beds are formed of fragments of pellets and cladding remnants, as observed in the TMI-2 core. Many important issues are related with the morphology of those debris beds: are they coolable in case of water injection and how does molten corium progress through them if they are not coolable? The answers to those questions depend on the structure of the debris bed: porosity, number and arrangement of particles. In order to obtain relevant information, a numerical simulation of the formation of the debris bed is proposed. It relies on a granular approach of the type called “Contact Dynamics” to simulate the collapse of debris and their accumulation. Two different schemes of fuel pellet fragmentation are considered and simulations for different degrees of fragmentation of the pellets are performed. The results show that the number of axial cracks on fuel pellets strongly influences the final porosity of the debris bed. Porosities vary between 31% (less coolable cases) and 45% (similar to TMI-2 observations), with a most probable configuration around 41%. The specific surface of the bed is also evaluated. In the last part, a simple model is used to estimate the impact of the variation in geometry of the numeric debris beds on their flow properties. We show that the permeability and passability can vary respectively with a range of 30% and 15% depending on the number of fragment per pellet. The other benefits of the approach are finally discussed. Among them, the possibility to print 3D samples from the calculated images of debris beds appears as a promising perspective to perform experiments with realistic debris beds.

  2. Process and structures for fabrication of solar cells with laser ablation steps to form contact holes

    Science.gov (United States)

    Harley, Gabriel; Smith, David D; Dennis, Tim; Waldhauer, Ann; Kim, Taeseok; Cousins, Peter John

    2013-11-19

    Contact holes of solar cells are formed by laser ablation to accomodate various solar cell designs. Use of a laser to form the contact holes is facilitated by replacing films formed on the diffusion regions with a film that has substantially uniform thickness. Contact holes may be formed to deep diffusion regions to increase the laser ablation process margins. The laser configuration may be tailored to form contact holes through dielectric films of varying thickness.

  3. Trigonometric parallaxes of high mass star forming regions: the structure and kinematics of the Milky Way

    Energy Technology Data Exchange (ETDEWEB)

    Reid, M. J.; Dame, T. M. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Menten, K. M.; Brunthaler, A.; Wu, Y.; Zhang, B.; Sanna, A.; Sato, M.; Choi, Y. K.; Immer, K. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Zheng, X. W. [Department of Astronomy, Nanjing University Nanjing 210093 (China); Xu, Y. [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China); Hachisuka, K. [Shanghai Astronomical Observatory, 80 Nandan Rd., Shanghai (China); Moscadelli, L. [Arcetri Observatory, Firenze (Italy); Rygl, K. L. J. [European Space Agency (ESA-ESTEC), Keplerlaan 1, P.O. Box 299, 2200 AG, Noordwijk (Netherlands); Bartkiewicz, A. [Centre for Astronomy, Faculty of Physics, Astronomy and Informatics, Nicolaus Copernicus University, Grudziadzka 5, 87-100 Torun (Poland)

    2014-03-10

    Over 100 trigonometric parallaxes and proper motions for masers associated with young, high-mass stars have been measured with the Bar and Spiral Structure Legacy Survey, a Very Long Baseline Array key science project, the European VLBI Network, and the Japanese VLBI Exploration of Radio Astrometry project. These measurements provide strong evidence for the existence of spiral arms in the Milky Way, accurately locating many arm segments and yielding spiral pitch angles ranging from about 7° to 20°. The widths of spiral arms increase with distance from the Galactic center. Fitting axially symmetric models of the Milky Way with the three-dimensional position and velocity information and conservative priors for the solar and average source peculiar motions, we estimate the distance to the Galactic center, R {sub 0}, to be 8.34 ± 0.16 kpc, a circular rotation speed at the Sun, Θ{sub 0}, to be 240 ± 8 km s{sup –1}, and a rotation curve that is nearly flat (i.e., a slope of –0.2 ± 0.4 km s{sup –1} kpc{sup –1}) between Galactocentric radii of ≈5 and 16 kpc. Assuming a 'universal' spiral galaxy form for the rotation curve, we estimate the thin disk scale length to be 2.44 ± 0.16 kpc. With this large data set, the parameters R {sub 0} and Θ{sub 0} are no longer highly correlated and are relatively insensitive to different forms of the rotation curve. If one adopts a theoretically motivated prior that high-mass star forming regions are in nearly circular Galactic orbits, we estimate a global solar motion component in the direction of Galactic rotation, V {sub ☉} = 14.6 ± 5.0 km s{sup –1}. While Θ{sub 0} and V {sub ☉} are significantly correlated, the sum of these parameters is well constrained, Θ{sub 0} + V {sub ☉} = 255.2 ± 5.1 km s{sup –1}, as is the angular speed of the Sun in its orbit about the Galactic center, (Θ{sub 0} + V {sub ☉})/R {sub 0} = 30.57 ± 0.43 km s{sup –1} kpc{sup –1}. These parameters improve the accuracy

  4. Cavitation structures formed during the collision of a sphere with an ultra-viscous wetted surface

    KAUST Repository

    Mansoor, Mohammad M.

    2016-05-05

    We investigate the inception of cavitation and resulting structures when a sphere collides with a solid surface covered with a layer of non-Newtonian liquid having a kinematic viscosity of up to (Formula presented.) cSt. We show the existence of shear-stress-induced cavitation during sphere approach towards the base wall (i.e. the pressurization stage) in ultra-viscous films using a synchronized dual-view high-speed imaging system. For the experimental parameters employed, liquids having viscoelastic properties of (Formula presented.) are shown to enable sphere rebound without any prior contact with the solid wall. Cavitation by depressurization (i.e. during rebound) in such non-contact cases is observed to onset after a noticeable delay from when the minimum gap distance is reached. Also, the cavities created originate from remnant bubbles, being the remains of the primary bubble entrapment formed by the lubrication pressure of the air during film entry. Cases where physical contact occurs (contact cases) in 10 000 cSt (Formula presented.) cSt films produce cavities attached to the base wall, which extend into an hourglass shape. In contrast, strikingly different structures occur in the most viscous liquids due to the disproportionality in radial expansion and longitudinal extension along the cavity length. Horizontal shear rates calculated using particle image velocimetry (PIV) measurements show the apparent fluid viscosity to vary substantially as the sphere approaches and rebounds away from the base wall. A theoretical model based on the lubrication assumption is solved for the squeeze flow in the regime identified for shear-induced cavity events, to investigate the criterion for cavity inception in further detail. © 2016 Cambridge University Press

  5. Cavitation structures formed during the collision of a sphere with an ultra-viscous wetted surface

    KAUST Repository

    Mansoor, Mohammad M.; Marston, J. O.; Uddin, J.; Christopher, G.; Zhang, Z.; Thoroddsen, Sigurdur T

    2016-01-01

    We investigate the inception of cavitation and resulting structures when a sphere collides with a solid surface covered with a layer of non-Newtonian liquid having a kinematic viscosity of up to (Formula presented.) cSt. We show the existence of shear-stress-induced cavitation during sphere approach towards the base wall (i.e. the pressurization stage) in ultra-viscous films using a synchronized dual-view high-speed imaging system. For the experimental parameters employed, liquids having viscoelastic properties of (Formula presented.) are shown to enable sphere rebound without any prior contact with the solid wall. Cavitation by depressurization (i.e. during rebound) in such non-contact cases is observed to onset after a noticeable delay from when the minimum gap distance is reached. Also, the cavities created originate from remnant bubbles, being the remains of the primary bubble entrapment formed by the lubrication pressure of the air during film entry. Cases where physical contact occurs (contact cases) in 10 000 cSt (Formula presented.) cSt films produce cavities attached to the base wall, which extend into an hourglass shape. In contrast, strikingly different structures occur in the most viscous liquids due to the disproportionality in radial expansion and longitudinal extension along the cavity length. Horizontal shear rates calculated using particle image velocimetry (PIV) measurements show the apparent fluid viscosity to vary substantially as the sphere approaches and rebounds away from the base wall. A theoretical model based on the lubrication assumption is solved for the squeeze flow in the regime identified for shear-induced cavity events, to investigate the criterion for cavity inception in further detail. © 2016 Cambridge University Press

  6. Structural and functional characteristics of myocard in patients with different forms of atrial fibrillation

    Directory of Open Access Journals (Sweden)

    L. I. Vasilyeva

    2015-02-01

    Full Text Available Aim. To study structural and functional characteristics of myocard in patients with different forms of atrial fibrillation. Atrial fibrillation is the most prevalent arrhythmia in clinical practice. Atrial fibrillation is a progressive disease: the duration of paroxysms increases over time and paroxysmal atrial fibrillation transforms to persistent, the last one becomes refractory to pharmacological and electrical cardioversion in time and transforms to permanent. So assessment of myocardial remodeling in patients with persistent and permanent atrial fibrillation is very actual. Methods and results. According to the aim of the study 133 patients with persistent atrial fibrillation and 100 patients with permanent atrial fibrillation were included into the study. Echocardiographic parameters of left and right atria function were studied. Conclusion. It was found that patients with persistent and permanent atrial fibrillation are characterized with both left and right atrias remodeling. Remodeling of the atrias is less pronounced in patients with permanent atrial fibrillation in comparison with persistent atrial fibrillation patients and arrhythmia recurrence.

  7. Design and strength evaluation of structural joint made by electro-magnetic forming (EMF)

    International Nuclear Information System (INIS)

    Park, Young-Bae; Oh, Soo-Ik; Kim, Heon-Young

    2004-01-01

    Recently, weight reduction of vehicles has been of great interest, and consequently, the use of low-density materials in the automotive industry is increasing every year. Materials should not be substituted such a way that material of component parts is simply changed because there is a problem in achieving stiffness and strength. To achieve these requirements, the automobile should be redesigned totally. Aluminum spaceframe is rapidly being adopted as a body structure for accommodating lightness, stiffness and strength requirement. In aluminum spaceframe manufacturing, it is often required to join aluminum tube. But there are few suitable methods for joining aluminum tube, so that much interest has been focused on testing suitable joining methods. Joining by electromagnetic forming(EMF) can be useful method in joining aluminum tube, which offers some advantages compared with the conventional joining method. In this paper, joining by EMF was investigated as a pre-study for applying an automotive spaceframe. Finite element simulations and strength tests were performed to analyze the influence of geometric parameters on joint strength. Based on these results, configurations of axial joint and torque joint were suggested and guidelines for designing EMF joint were established

  8. Structure and fertilizer properties of byproducts formed in the synthesis of EDDHA.

    Science.gov (United States)

    Hernández-Apaolaza, Lourdes; García-Marco, Sonia; Nadal, Paloma; Lucena, Juan J; Sierra, Miguel A; Gómez-Gallego, Mar; Ramírez-López, Pedro; Escudero, Rosa

    2006-06-14

    The synthesis of commercial EDDHA produces o,o-EDDHA as the main reaction product, together with a mixture of regioisomers (o,p-EDDHA and p,p-EDDHA) and other unknown byproducts also able to complex Fe3+. These compounds have been obtained by direct synthesis, and their structures have been determined by ESI-MS analysis as oligomeric EDDHA-like products, formed by polysubstitution in the phenolic rings. Short-term experiments show that the iron complexes of samples enriched in these oligomeric byproducts have adequate stability in solution, but a significant amount of them is lost after interaction with soils and soil materials. Mildly chlorotic cucumber plants are able to reduce iron better from o,p-EDDHA/Fe3+ than from the iron complexes of the oligomeric byproducts. In hydroponics, the chlorotic soybean susceptible plants have a lower potential for Fe absorption from these byproducts than from o,o-EDDHA/Fe3+ and from o,p-EDDHA/Fe3+. In the studied conditions, the iron chelates of EDDHA byproducts do not have the long-lasting effect shown by o,o-EDDHA/Fe3+ and present a less efficient fast-action effect than the o,p-EDDHA/Fe3+.

  9. Laser micromachining of screen-printed graphene for forming electrode structures

    International Nuclear Information System (INIS)

    Chang, Tien-Li; Chen, Zhao-Chi; Tseng, Shih-Feng

    2016-01-01

    Highlights: • Homogeneous graphene films were prepared by the screen-printing process. • Optimal single-line ablation was performed by ultraviolet nanosecond laser pulses. • Influence of ablation parameters on graphene/glass substrate was clarified. • Electrical measurements of ablated graphene-based device can be investigated. - Abstract: There has been increasing research interest in electronic applications of graphene-based devices fabricated using electrode patterning techniques. This study presents a laser ablation technique along with a screen printing process for fabricating graphene patterns on a glass substrate. First, homogeneous multilayer films on the glass substrate are coated with graphene ink by using the screen printing process. Subsequently, optimal ablation was performed using an ultraviolet nanosecond laser, and the effective number of pulses decreased with an increase in the scanning speed and a decrease in the overlapping rate. Here, the pulsed overlap of a laser spot was determined to be approximately 90% for 75 pulses at a scanning speed of 250 mm/s. Experimental results showed continuous single-line ablation along the laser scanning path in the graphene films. Furthermore, linear current–voltage (I–V) curves showed the multilayer graphene characteristics of ablated devices for forming electrode structures.

  10. The Structure and Form of Folksonomy Tags: The Road to the Public Library Catalog

    Directory of Open Access Journals (Sweden)

    Louise F. Spiteri

    2007-09-01

    Full Text Available This article examines the linguistic structure of folksonomy tags collected over a thirty-day period from the daily tag logs of Del.icio.us, Furl, and Technorati. The tags were evaluated against the National Information Standards Organization (NISO guidelines for the construction of controlled vocabularies. The results indicate that the tags correspond closely to the NISO guidelines pertaining to types of concepts expressed, the predominance of single terms and nouns, and the use of recognized spelling. Problem areas pertain to the inconsistent use of count nouns and the incidence of ambiguous tags in the form of homographs, abbreviations, and acronyms. With the addition of guidelines to the construction of unambiguous tags and links to useful external reference sources, folksonomies could serve as a powerful, flexible tool for increasing the user-friendliness and interactivity of public library catalogs, and also may be useful for encouraging other activities, such as informal online communities of readers and user-driven readers’ advisory services.

  11. Ag nanoparticles formed by femtosecond pulse laser ablation in water: self-assembled fractal structures

    Energy Technology Data Exchange (ETDEWEB)

    Santillán, Jesica M. J. [CONICET La Plata-CIC, Centro de Investigaciones Ópticas (CIOp) (Argentina); Fernández van Raap, Marcela B., E-mail: raap@fisica.unlp.edu.ar; Mendoza Zélis, Pedro; Coral, Diego [CONICET, Instituto de Física La Plata (IFLP) (Argentina); Muraca, Diego [Universidade Estadual de Campinas, Instituto de Física “Gleb Wataghin” (IFGW) (Brazil); Schinca, Daniel C.; Scaffardi, Lucía B., E-mail: lucias@ciop.unlp.edu.ar [CONICET La Plata-CIC, Centro de Investigaciones Ópticas (CIOp) (Argentina)

    2015-02-15

    We report for the first time on the formation of self-assembled fractals of spherical Ag nanoparticles (Nps) fabricated by femtosecond pulse laser ablation of a solid silver target in water. Fractal structures grew both in two and three Euclidean dimensions (d). Ramified-fractal assemblies of 2 nm height and 5–14 μm large, decorated with Ag Nps of 3 nm size, were obtained in a 2d geometry when highly diluted drops of colloidal suspension were dried at a fast heating rate over a mica substrate. When less-diluted drops were dried at slow heating rate, isolated single Nps or rosette-like structures were formed. Fractal aggregates about 31 nm size in 3d geometry were observed in the as-prepared colloidal suspension. Electron diffraction and optical extinction spectroscopy (OES) analyses performed on the samples confirmed the presence of Ag and Ag{sub 2}O. The analysis of the optical extinction spectrum, using the electrostatic approximation of Mie theory for small spheres, showed the existence of Ag bare core, Ag–Ag{sub 2}O and air–Ag core–shell Nps, Ag–Ag{sub 2}O being the most frequent type [69 % relative abundance (r.a.)]. Core-size and shell-thickness distribution was derived from OES. In situ scattering measurements of the Ag colloidal suspension, carried out by small-angle X-ray scattering, indicate a mass fractal composed of packaged 〈D{sub SAXS}〉 = (5 ± 1) nm particles and fractal dimension d{sub f} = 2.5. Ex situ atomic force microscopy imaging displayed well-ramified structures, which, analyzed with box-counting method, yield a fractal dimension d{sub f} = 1.67. The growing behavior of these 2d and 3d self-assembled fractals is consistent with the diffusion-limited aggregation model.

  12. Structure of the Unbound Form of HIV-1 Subtype A Protease: Comparison with Unbound Forms of Proteases from other HIV Subtypes

    Energy Technology Data Exchange (ETDEWEB)

    Robbins, Arthur H.; Coman, Roxana M.; Bracho-Sanchez, Edith; Fernandez, Marty A.; Gilliland, C.Taylor; Li, Mi; Agbandje-McKenna, Mavis; Wlodawer, Alexander; Dunn, Ben M.; McKenna, Robert (NCI); (Florida)

    2010-03-12

    The crystal structure of the unbound form of HIV-1 subtype A protease (PR) has been determined to 1.7 {angstrom} resolution and refined as a homodimer in the hexagonal space group P6{sub 1} to an R{sub cryst} of 20.5%. The structure is similar in overall shape and fold to the previously determined subtype B, C and F PRs. The major differences lie in the conformation of the flap region. The flaps in the crystal structures of the unbound subtype B and C PRs, which were crystallized in tetragonal space groups, are either semi-open or wide open. In the present structure of subtype A PR the flaps are found in the closed position, a conformation that would be more anticipated in the structure of HIV protease complexed with an inhibitor. The amino-acid differences between the subtypes and their respective crystal space groups are discussed in terms of the differences in the flap conformations.

  13. Effect of the strange axial form factor on structure functions for neutral current neutrino scattering in the quasielastic region

    International Nuclear Information System (INIS)

    Kim, Kyungsik

    2011-01-01

    We study the effect of the strange axial form factor on various structure functions for the neutral reaction of neutrino-nucleus scattering in the quasielastic region within the framework of a relativistic single particle model. We use 12 C as the target nucleus, and the incident neutrino energy range is between 150 MeV and 1.5 GeV. The structure functions are extracted at a fixed three momentum transfer and energy transfer by using the intrinsic helicity of neutrino. While the effect of the strange axial form factor is very small, the effect on various structure functions is exhibited explicitly.

  14. An Integrated Modelling and Toolpathing Approach for a Frameless Stressed Skin Structure, Fabricated Using Robotic Incremental Sheet Forming

    DEFF Research Database (Denmark)

    Nicholas, Paul; Stasiuk, David; Nørgaard, Esben Clausen

    2016-01-01

    with performance implications at material, element and structural scales. This paper briefly presents ISF as a method of fabrication, and introduces the context of structures where the skin plays an integral role. It describes the development of an integrated approach for the modelling and fabrication of Stressed...... Skins, an incrementally formed sheet metal structure. The paper then focus upon the use of prototypes and empirical testing as means to inform digital models about fabrication and material parameters including: material forming limits and thinning; the parameterisation of macro and meso simulations...

  15. The emergence of shared leadership in newly-formed teams with an initial structure of vertical leadership: A longitudinal analysis

    OpenAIRE

    Fransen, Katrien; Delvaux, Ellen; Mesquita, Batja; Van Puyenbroeck, Stef

    2018-01-01

    The importance of high-quality leadership for team effectiveness is widely recognized, with recent viewpoints arguing shared leadership to be a more powerful predictor than vertical leadership. To identify changes in leadership structures over time, we longitudinally tracked the leadership structure of 27 newly-formed teams (N = 195), all having an initial structure of vertical leadership. Our findings demonstrated that the average team leadership strengthened over the course of the 24-week p...

  16. Phenotypic and Causal Structure of Conduct Disorder in the Broader Context of Prevalent Forms of Psychopathology

    Science.gov (United States)

    Lahey, Benjamin B.; Waldman, Irwin D.

    2011-01-01

    Background A better understanding of the nature and etiology of conduct disorder (CD) can inform nosology and vice-versa. We posit that any prevalent form of psychopathology, including CD, can be best understood if it is studied in the context of other correlated forms of child and adolescent psychopathology using formal models to guide inquiry. Methods Review of both cross-sectional and longitudinal studies of the place of CD in the phenotypic and causal structure of prevalent psychopathology, with an emphasis on similarities and differences between CD and oppositional defiant disorder (ODD). Papers were located using Web of Science by topic searches with no restriction on year of publication. Results Although some important nosologic questions remain unanswered, the dimensional phenotype of CD is well defined. CD differs from other disorders in its correlates, associated impairment, and course. Nonetheless, it is robustly correlated with many other prevalent dimensions of psychopathology both concurrently and predictively, including both other “externalizing” disorders and some “internalizing” disorders. Based on emerging evidence, we hypothesize that these concurrent and predictive correlations result primarily from widespread genetic pleiotropy, with some genetic factors nonspecifically influencing risk for multiple correlated dimensions of psychopathology. In contrast, environmental influences mostly act to differentiate dimensions of psychopathology from one another both concurrently and over time. CD and ODD share half of their genetic influences, but their genetic etiologies are distinct in other ways. Unlike most other dimensions of psychopathology, half of the genetic influences on CD appear to be unique to CD. In contrast, ODD broadly shares nearly all of its genetic influences with other disorders and has little unique genetic variance. Conclusions CD is a relatively distinct syndrome at both phenotypic and etiologic levels, but much is revealed

  17. Structural Basis of a Thiol-Disulfide Oxidoreductase in the Hedgehog-Forming Actinobacterium Corynebacterium matruchotii.

    Science.gov (United States)

    Luong, Truc Thanh; Tirgar, Reyhaneh; Reardon-Robinson, Melissa E; Joachimiak, Andrzej; Osipiuk, Jerzy; Ton-That, Hung

    2018-05-01

    The actinobacterium Corynebacterium matruchotii has been implicated in nucleation of oral microbial consortia leading to biofilm formation. Due to the lack of genetic tools, little is known about basic cellular processes, including protein secretion and folding, in this organism. We report here a survey of the C. matruchotii genome, which encodes a large number of exported proteins containing paired cysteine residues, and identified an oxidoreductase that is highly homologous to the Corynebacterium diphtheriae thiol-disulfide oxidoreductase MdbA (MdbA Cd ). Crystallization studies uncovered that the 1.2-Å resolution structure of C. matruchotii MdbA (MdbA Cm ) possesses two conserved features found in actinobacterial MdbA enzymes, a thioredoxin-like fold and an extended α-helical domain. By reconstituting the disulfide bond-forming machine in vitro , we demonstrated that MdbA Cm catalyzes disulfide bond formation within the actinobacterial pilin FimA. A new gene deletion method supported that mdbA is essential in C. matruchotii Remarkably, heterologous expression of MdbA Cm in the C. diphtheriae Δ mdbA mutant rescued its known defects in cell growth and morphology, toxin production, and pilus assembly, and this thiol-disulfide oxidoreductase activity required the catalytic motif CXXC. Altogether, the results suggest that MdbA Cm is a major thiol-disulfide oxidoreductase, which likely mediates posttranslocational protein folding in C. matruchotii by a mechanism that is conserved in Actinobacteria IMPORTANCE The actinobacterium Corynebacterium matruchotii has been implicated in the development of oral biofilms or dental plaque; however, little is known about the basic cellular processes in this organism. We report here a high-resolution structure of a C. matruchotii oxidoreductase that is highly homologous to the Corynebacterium diphtheriae thiol-disulfide oxidoreductase MdbA. By biochemical analysis, we demonstrated that C. matruchotii MdbA catalyzes disulfide

  18. Structures, Compositions, and Activities of Live Shewanella Biofilms Formed on Graphite Electrodes in Electrochemical Flow Cells.

    Science.gov (United States)

    Kitayama, Miho; Koga, Ryota; Kasai, Takuya; Kouzuma, Atsushi; Watanabe, Kazuya

    2017-09-01

    An electrochemical flow cell equipped with a graphite working electrode (WE) at the bottom was inoculated with Shewanella oneidensis MR-1 expressing an anaerobic fluorescent protein, and biofilm formation on the WE was observed over time during current generation at WE potentials of +0.4 and 0 V (versus standard hydrogen electrodes), under electrolyte-flow conditions. Electrochemical analyses suggested the presence of unique electron-transfer mechanisms in the +0.4-V biofilm. Microscopic analyses revealed that, in contrast to aerobic biofilms, current-generating biofilm (at +0.4 V) was thin and flat (∼10 μm in thickness), and cells were evenly and densely distributed in the biofilm. In contrast, cells were unevenly distributed in biofilm formed at 0 V. In situ fluorescence staining and biofilm recovery experiments showed that the amounts of extracellular polysaccharides (EPSs) in the +0.4-V biofilm were much smaller than those in the aerobic and 0-V biofilms, suggesting that Shewanella cells suppress the production of EPSs at +0.4 V under flow conditions. We suggest that Shewanella cells perceive electrode potentials and modulate the structure and composition of biofilms to efficiently transfer electrons to electrodes. IMPORTANCE A promising application of microbial fuel cells (MFCs) is to save energy in wastewater treatment. Since current is generated in these MFCs by biofilm microbes under horizontal flows of wastewater, it is important to understand the mechanisms for biofilm formation and current generation under water-flow conditions. Although massive work has been done to analyze the molecular mechanisms for current generation by model exoelectrogenic bacteria, such as Shewanella oneidensis , limited information is available regarding the formation of current-generating biofilms over time under water-flow conditions. The present study developed electrochemical flow cells and used them to examine the electrochemical and structural features of current

  19. A new crystal form of Aspergillus oryzae catechol oxidase and evaluation of copper site structures in coupled binuclear copper enzymes.

    Science.gov (United States)

    Penttinen, Leena; Rutanen, Chiara; Saloheimo, Markku; Kruus, Kristiina; Rouvinen, Juha; Hakulinen, Nina

    2018-01-01

    Coupled binuclear copper (CBC) enzymes have a conserved type 3 copper site that binds molecular oxygen to oxidize various mono- and diphenolic compounds. In this study, we found a new crystal form of catechol oxidase from Aspergillus oryzae (AoCO4) and solved two new structures from two different crystals at 1.8-Å and at 2.5-Å resolutions. These structures showed different copper site forms (met/deoxy and deoxy) and also differed from the copper site observed in the previously solved structure of AoCO4. We also analysed the electron density maps of all of the 56 CBC enzyme structures available in the protein data bank (PDB) and found that many of the published structures have vague copper sites. Some of the copper sites were then re-refined to find a better fit to the observed electron density. General problems in the refinement of metalloproteins and metal centres are discussed.

  20. A new crystal form of Aspergillus oryzae catechol oxidase and evaluation of copper site structures in coupled binuclear copper enzymes.

    Directory of Open Access Journals (Sweden)

    Leena Penttinen

    Full Text Available Coupled binuclear copper (CBC enzymes have a conserved type 3 copper site that binds molecular oxygen to oxidize various mono- and diphenolic compounds. In this study, we found a new crystal form of catechol oxidase from Aspergillus oryzae (AoCO4 and solved two new structures from two different crystals at 1.8-Å and at 2.5-Å resolutions. These structures showed different copper site forms (met/deoxy and deoxy and also differed from the copper site observed in the previously solved structure of AoCO4. We also analysed the electron density maps of all of the 56 CBC enzyme structures available in the protein data bank (PDB and found that many of the published structures have vague copper sites. Some of the copper sites were then re-refined to find a better fit to the observed electron density. General problems in the refinement of metalloproteins and metal centres are discussed.

  1. Incremental electrohydraulic forming - A new approach for the manufacture of structured multifunctional sheet metal blanks

    Science.gov (United States)

    Djakow, Eugen; Springer, Robert; Homberg, Werner; Piper, Mark; Tran, Julian; Zibart, Alexander; Kenig, Eugeny

    2017-10-01

    Electrohydraulic Forming (EHF) processes permit the production of complex, sharp-edged geometries even when high-strength materials are used. Unfortunately, the forming zone is often limited as compared to other sheet metal forming processes. The use of a special industrial-robot-based tool setup and an incremental process strategy could provide a promising solution for this problem. This paper describes such an innovative approach using an electrohydraulic incremental forming machine, which can be employed to manufacture the large multifunctional and complex part geometries in steel, aluminium, magnesium and reinforced plastic that are employed in lightweight constructions or heating elements.

  2. Improved Inhibition of Telomerase by Short Twisted Intercalating Nucleic Acids under Molecular Crowding Conditions

    DEFF Research Database (Denmark)

    Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich

    2012-01-01

    Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...

  3. Structural Origin of the Enhanced Glass-Forming Ability Induced by Microalloying Y in the ZrCuAl Alloy

    Directory of Open Access Journals (Sweden)

    Gu-Qing Guo

    2016-03-01

    Full Text Available In this work, the structural origin of the enhanced glass-forming ability induced by microalloying Y in a ZrCuAl multicomponent system is studied by performing synchrotron radiation experiments combined with simulations. It is revealed that the addition of Y leads to the optimization of local structures, including: (1 more Zr-centered and Y-centered icosahedral-like clusters occur in the microstructure; (2 the atomic packing efficiency inside clusters and the regularity of clusters are both enhanced. These structural optimizations help to stabilize the amorphous structure in the ZrCuAlY system, and lead to a high glass-forming ability (GFA. The present work provides an understanding of GFAs in multicomponent alloys and will shed light on the development of more metallic glasses with high GFAs.

  4. Chemical and Charge Imbalance Induced by Radionuclide Decay: Effects on Waste Form Structure

    Energy Technology Data Exchange (ETDEWEB)

    Van Ginhoven, Renee M.; Jaffe, John E.; Jiang, Weilin; Strachan, Denis M.

    2011-04-01

    This is a milestone document covering the activities to validate theoretical calculations with experimental data for the effect of the decay of 90Sr to 90Zr on materials properties. This was done for a surragate waste form strontium titanate.

  5. Charge form factors and alpha-cluster internal structure of 12C

    International Nuclear Information System (INIS)

    Luk'yanov, V.K.; Zemlyanaya, E.V.; Kadrev, D.N.; Antonov, A.N.; Spasova, K.; Anagnostatos, G.S.; Ginis, P.; Giapitzakis, J.

    1999-01-01

    The transition densities and form factors of 0 + , 2 + , and 3 - states in 12 C are calculated in alpha-cluster model using the triangle frame with clusters in the vertices. The wave functions of nucleons in the alpha clusters are taken as they were obtained in the framework of the models used for the description of the 4 He form factor and momentum distribution which are based on the one-body density matrix construction. They contain effects of the short-range NN correlations, as well as the d-shell admixtures in 4 He. Calculations and the comparison with the experimental data show that visible effects on the form and magnitude of the 12 C form factors take place, especially at relatively large momentum transfers

  6. The Use of Explosive Forming for Fastening and Joining Structural and Pressure Components

    Science.gov (United States)

    Schroeder, J. W.

    1985-01-01

    Explosive expansion of tubes into tubesheets has been used for over 20 years in the fabrication and repair of shell and tube heat exchangers. The use of explosives to perform these expansions has offered several distinct advantages over other methods. First, the process is fast and economical and can be performed with minimal training of personnel. Secondly, explosive forming does not cause the deleterious metallurgical effects which often result from other forming operations. In addition, the process can be performed remotely without the need for sophisticated handling equipment. The expansion of tubes into tubesheets is only one of many possible fastening and joining applications for which explosive forming can be used to achieve highly successful results. The explosive forming process and where it has been used are described. In addition, some possible adaptations to other joining applications are identified and discussed.

  7. Exploring the role of cognitive and structural forms of social capital in ...

    African Journals Online (AJOL)

    The article presents a synthesis of data from three village case studies focusing on how structural and cognitive social capital may have influenced the progression of the HIV epidemic in the Kagera region of Tanzania. Grounded theory was used to develop a theoretical model describing the possible links between structural ...

  8. Synthesis, structure and complex forming ability of phosphorylated derivatives of heterocyclic compounds

    International Nuclear Information System (INIS)

    Babaev, B.N.

    2004-01-01

    Full text: The derivatives of acids of phosphorus, due to variety of properties, are a subject of numerous researches. Now it is known, that the derivatives of acids of phosphorus apart from insect, neurotoxic, antienzym and other kinds of physiological activity have also complex forming properties. As extra gents of noble metals particularly are analyzed by the derivatives of dithio phosphor of acids although organ phosphorus compounds with one nuclear of sulfur make extraction properties. Therefore, with the purpose of detection of effective extra gents of ions of argentum the phosphorylated derivatives of heterogeneous ring compounds were synthesized: Ph(RO)P(O)Cl + HOCH(CH 3 )CH 2 -R ' -> Ph(RO)P(O)OCH(CH 3 )CH 2 -R ' + HCl. R C 2 H 5 - C 6 H 13 , R ' = a piperidine, morpholine, anabasine Structure of the obtained connections is confirmed by the results IR -, Pm- and mass- spectrometry. In an IR-spectrum O-hexyl-O - [piperidynoisopropyl] phenylphosphonate has lines of absorption bands of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1260, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In an IR-spectrum O-pentyl-[anabasinoisopropyl] phenylphosphonate has lines of absorption bands of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1250, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In a spectrum PMR about O-pentyl-[morpholyniisopropyl] phenylphosphonate in the field of a weak field (7, 18-7, 29 p.m.) the multiplet about tones of phenyl group is watched. Me tin proton resonate at 4,66 m.d.as multiplet The signals O-CH 2 of protons of morpholinic cycle appear at 3,58 m.d.. 4H) by the way of triplet. The protons N-CH 2 (6H) three methylene groups will derivate a composite multiple at 2, 10-2, 70 m.d.. The signal of metil group's protons (3H) is watched at 1,15m.d.as doublet. Final metal group resonates at 0, 87 p.m. Six of C-CH 2 of groups give a complex signal in the field of 1, 2-1, 8 m.d. The obtained connections

  9. Laser rapid forming technology of high-performance dense metal components with complex structure

    Science.gov (United States)

    Huang, Weidong; Chen, Jing; Li, Yanming; Lin, Xin

    2005-01-01

    Laser rapid forming (LRF) is a new and advanced manufacturing technology that has been developed on the basis of combining high power laser cladding technology with rapid prototyping (RP) to realize net shape forming of high performance dense metal components without dies. Recently we have developed a set of LRF equipment. LRF experiments were carried out on the equipment to investigate the influences of processing parameters on forming characterizations systematically with the cladding powder materials as titanium alloys, superalloys, stainless steel, and copper alloys. The microstructure of laser formed components is made up of columnar grains or columnar dendrites which grow epitaxially from the substrate since the solid components were prepared layer by layer additionally. The result of mechanical testing proved that the mechanical properties of laser formed samples are similar to or even over that of forging and much better than that of casting. It is shown in this paper that LRF technology is providing a new solution for some difficult processing problems in the high tech field of aviation, spaceflight and automobile industries.

  10. Mechanical properties of regular hexahedral lattice structure formed by selective laser melting

    International Nuclear Information System (INIS)

    Sun, Jianfeng; Yang, Yongqiang; Wang, Di

    2013-01-01

    The Ti–6Al–4V lattice structure is widely used in the aerospace field. This research first designs a regular hexahedral unit, processes the lattice structure composed of the Ti–6Al–4V units by selective laser melting technology, obtains the experimental fracture load and the compression deformation of them through compression tests, then conducts a simulation of the unit and the lattice structure through ANSYS to analyze the failure point. Later, according to the force condition of the point, the model of maximum load is built, through which the analytical formula of the fracture load of the unit and the lattice structure are obtained. The results of groups of experiments demonstrate that there exists an exponential relationship between the practical fracture load and the porosity of the lattice structure. There also exists a trigonometric function relationship between the compression deformation and the porosity of the lattice structure. The fracture analysis indicates that fracture of the units and lattice structure is brittle fracture due to cleavage fracture. (paper)

  11. Structural evidence for the partially oxidized dipyrromethene and dipyrromethanone forms of the cofactor of porphobilinogen deaminase: structures of the Bacillus megaterium enzyme at near-atomic resolution

    International Nuclear Information System (INIS)

    Azim, N.; Deery, E.; Warren, M. J.; Wolfenden, B. A. A.; Erskine, P.; Cooper, J. B.; Coker, A.; Wood, S. P.; Akhtar, M.

    2014-01-01

    The enzyme porphobilinogen deaminase (PBGD; hydroxymethylbilane synthase; EC 2.5.1.61) catalyses a key early step in the biosynthesis of tetrapyrroles in which four molecules of the monopyrrole porphobilinogen are condensed to form a linear tetrapyrrole. Two near-atomic resolution structures of PBGD from B. megaterium are reported that demonstrate the time-dependent accumulation of partially oxidized forms of the cofactor, including one that possesses a tetrahedral C atom in the terminal pyrrole ring. The enzyme porphobilinogen deaminase (PBGD; hydroxymethylbilane synthase; EC 2.5.1.61) catalyses an early step of the tetrapyrrole-biosynthesis pathway in which four molecules of the monopyrrole porphobilinogen are condensed to form a linear tetrapyrrole. The enzyme possesses a dipyrromethane cofactor, which is covalently linked by a thioether bridge to an invariant cysteine residue (Cys241 in the Bacillus megaterium enzyme). The cofactor is extended during the reaction by the sequential addition of the four substrate molecules, which are released as a linear tetrapyrrole product. Expression in Escherichia coli of a His-tagged form of B. megaterium PBGD has permitted the X-ray analysis of the enzyme from this species at high resolution, showing that the cofactor becomes progressively oxidized to the dipyrromethene and dipyrromethanone forms. In previously solved PBGD structures, the oxidized cofactor is in the dipyromethenone form, in which both pyrrole rings are approximately coplanar. In contrast, the oxidized cofactor in the B. megaterium enzyme appears to be in the dipyrromethanone form, in which the C atom at the bridging α-position of the outer pyrrole ring is very clearly in a tetrahedral configuration. It is suggested that the pink colour of the freshly purified protein is owing to the presence of the dipyrromethene form of the cofactor which, in the structure reported here, adopts the same conformation as the fully reduced dipyrromethane form

  12. Environment as a basis for the design of advertising structures by forming

    Science.gov (United States)

    Khmelevsky, Y. P.; Seryakov, V. A.; Mamontov, G. Y.; Tsarenko, D. T.

    2017-01-01

    A few different neighbouring styles of architectural forms are quite frequent in the cities of great historical past. As a result, a designer or architect has to solve the complex problem while designing the objects within such environment, i.e. one has to fit them naturally into the existing site development. Often, form making is found to be hard, due to the fact that the existing architectural forms of totally different stylistic execution coexist in the visual proximity. Presently, placement of the advertising bills in urban environment is both an urgent and debatable issue. On the one hand, advertising providers are keen to present their product bigger and brighter, on the other hand, the overall and eye-catching exhibition stands can be disharmonious with the surrounding architectural ensemble of the city. This situation is relevant for every cultural city.

  13. Relativistic instant-form approach to the structure of two-body composite systems

    International Nuclear Information System (INIS)

    Krutov, A.F.; Troitsky, V.E.

    2002-01-01

    An approach to the electroweak properties of two-particle composite systems is developed. The approach is based on the use of the instant form of relativistic Hamiltonian dynamics. The main feature of this approach is the method of construction of the matrix element of the electroweak current operator. The electroweak current matrix element satisfies the relativistic covariance conditions and in the case of the electromagnetic current also the conservation law automatically. The properties of the system as well as the approximations are formulated in terms of form factors. The approach makes it possible to formulate relativistic impulse approximation in such a way that the Lorentz covariance of the current is ensured. In the electromagnetic case the current conservation law is also ensured. Our approach gives good results for the pion electromagnetic form factor in the whole range of momentum transfers available for experiments at present time, as well as for the lepton decay constant of pions

  14. Production of Curved Precast Concrete Elements for Shell Structures and Free-form Architecture using the Flexible Mould Method

    NARCIS (Netherlands)

    Schipper, H.R.; Grünewald, S.; Eigenraam, P.; Raghunath, P.; Kok, M.A.D.

    2014-01-01

    Free-form buildings tend to be expensive. By optimizing the production process, economical and well-performing precast concrete structures can be manufactured. In this paper, a method is presented that allows producing highly accurate double curved-elements without the need for milling two expensive

  15. Ability of nitrones of various structures to control the radical polymerization of styrene mediated by in situ formed nitroxides.

    NARCIS (Netherlands)

    Sciannamea, V.; Guerrero-Sanchez, C.A.; Schubert, U.S.; Catala, J.-M.; Jerome, R.; Detrembleur, C.

    2005-01-01

    The ability of several nitrones to control the radical polymerization of styrene at 110 °C has been investigated by high-throughput experimentation. The nitrone/free radical initiator pair dictates the structure of the nitroxide and the alkoxyamine formed in situ, which determines the position of

  16. Relativity, Symmetry, and the Structure of Quantum Theory, Volume 2; Point form relativistic quantum mechanics

    Science.gov (United States)

    Klink, William H.; Schweiger, Wolfgang

    2018-03-01

    This book covers relativistic quantum theory from the point of view of a particle theory, based on the irreducible representations of the Poincaré group, the group that expresses the symmetry of Einstein relativity. There are several ways of formulating such a theory; this book develops what is called relativistic point form quantum mechanics, which, unlike quantum field theory, deals with a fixed number of particles in a relativistically invariant way. A chapter is devoted to applications of point form quantum mechanics to nuclear physics.

  17. Advanced Structures and Compositions for 3D Forming of Cellulosic Fibers

    OpenAIRE

    Khakalo, Alexey

    2017-01-01

    The objective of this thesis was to systematically investigate strategies to endow fiber-based materials with toughness and formability. Bio-based polymers and green treatments were applied to develop 3D packaging structures. Formability, the material's ability for three-dimensional shaping, was achieved by plastic deformations in paper structures that were defect-free in terms of appearance and functionality. A set of methods to improve paper toughness was explored, including: (a) combined m...

  18. The capital structure impact on forming company’s accounting policy

    OpenAIRE

    Česnavičiūtė, Giedrė

    2011-01-01

    KEWORDS: Accounting policy, accounting policy choice, disclosure of accounting policies, capital structure, financial leverage, legitimacy theory, agency theory, signal theory, stakeholder theory. The optimal structure of the capital has a huge impact assuring its goals and financial stability. The company’s appropriate situation of financial condition depends on the accounting policies formation as well. In this paper there was made the investigation of correlation of company’s capital struc...

  19. METHODICAL APPROACHES TO FORMING INNOVATIVE PROJECT AND ENTERPRISE MANAGEMENT ORGANIZATIONAL STRUCTURES

    Directory of Open Access Journals (Sweden)

    A. O. Baklanov

    2011-01-01

    Full Text Available The following principles are discussed as methodical bases of the choice of innovative project and enterprise management organizational structures: hierarchism, bureaucratization, adhocratie, tent organization, lean business engineering, rational organization, amorphous organization, teaching organization. Conditions that complicate industrial and technological processes influence enterprise management process dynamics. The variety of existing types of organizational structures is determined by industrial, economic, psychological and social conditions.

  20. Conditional activation of associative semantic structures:forming and transmitting impressions of personality

    OpenAIRE

    Nunes, Ludmila Duarte da Silva

    2012-01-01

    Tese de doutoramento, Psicologia (Cognição Social), Universidade de Lisboa, Faculdade de Psicologia, 2012 In the presented line of research we intended to systematically study the importance of memory to the formation and transmission of impressions of personality. We consider that impressions of personality are grounded in associative structures (e.g., Asch, 1946), which should be prone to similar memory distortions that other associative memory structures are (e.g., Roediger& McDermott, ...

  1. Structural biologists capture detailed image of gene regulator’s fleeting form | Center for Cancer Research

    Science.gov (United States)

    Using an ultrafast, high-intensity radiation source called an X-ray free-electron laser (XFEL), scientists have captured an atomic-level picture of an RNA structure called a riboswitch as it reorganizes itself to regulate protein production. The structure they visualized has never before been seen, and likely exists for only milliseconds after the riboswitch first encounters its activating molecule.  Read more...  

  2. Characterization of bainitic/martensitic structures formed in isothermal treatments below the M

    NARCIS (Netherlands)

    Navarro Lopez, A.; Hidalgo Garcia, J.; Sietsma, J.; Santofimia Navarro, M.J.

    2017-01-01

    Advanced Multiphase High Strength Steels are generally obtained by applying isothermal treatments around the martensite start temperature (Ms). Previous investigations have shown that bainitic ferrite can form from austenite in isothermal treatments below Ms, where its

  3. On the crystalline structures of iron oxides formed during the removal process of iron in water

    International Nuclear Information System (INIS)

    Cho, Bongyeon; Fujita, Kenji; Oda, Katsuro; Ino, Hiromitsu

    1993-01-01

    The iron oxide samples collected from both filtration and batch reactors were analysed by X-ray diffraction and Moessbauer spectroscopy. In the filtration of water containing iron, the oxidized form of iron was determined to be ferrihydrite. In contrast, in the batch experiment without filtration, iron was oxidized to microcrystalline goethite. (orig.)

  4. Development of millimeter-wave accelerating structures using precision metal forming technology

    Energy Technology Data Exchange (ETDEWEB)

    None

    2003-06-03

    High gradients in radio-frequency (RF) driven accelerators require short wavelengths that have the concomitant requirements of small feature size and high tolerances, 1-2 {micro}m for millimeter wavelengths. Precision metal-forming stampling has the promise of meeting those tolerances with high production rates. This STI will evaluate that promise.

  5. Methods of forming and using porous structures for energy efficient separation of light gases by capillary condensation

    Science.gov (United States)

    Calamur, Narasimhan; Carrera, Martin E.; Devlin, David J.; Archuleta, Tom

    2000-01-01

    The present invention relates to an improved method and apparatus for separating one or more condensable compounds from a mixture of two or more gases of differing volatilities by capillary fractionation in a membrane-type apparatus, and a method of forming porous structures therefor. More particularly, the invention includes methods of forming and using an apparatus consisting, at least in part, of a porous structure having capillary-type passages extending between a plurality of small openings on the first side and larger openings on a second side of the structure, the passages being adapted to permit a condensed liquid to flow therethrough substantially by capillary forces, whereby vapors from the mixture are condensed, at least in part, and substantially in and adjacent to the openings on the first side, and are caused to flow in a condensed liquid state, substantially in the absence of vapor, from the openings on the first side to the openings on the second side.

  6. DO22-(Cu,Ni)3Sn intermetallic compound nanolayer formed in Cu/Sn-nanolayer/Ni structures

    International Nuclear Information System (INIS)

    Liu Lilin; Huang, Haiyou; Fu Ran; Liu Deming; Zhang Tongyi

    2009-01-01

    The present work conducts crystal characterization by High Resolution Transmission Electron Microscopy (HRTEM) on Cu/Sn-nanolayer/Ni sandwich structures associated with the use of Energy Dispersive X-ray (EDX) analysis. The results show that DO 22 -(Cu,Ni) 3 Sn intermetallic compound (IMC) ordered structure is formed in the sandwich structures at the as-electrodeposited state. The formed DO 22 -(Cu,Ni) 3 Sn IMC is a homogeneous layer with a thickness about 10 nm. The DO 22 -(Cu,Ni) 3 Sn IMC nanolayer is stable during annealing at 250 deg. C for 810 min. The formation and stabilization of the metastable DO 22 -(Cu,Ni) 3 Sn IMC nanolayer are attributed to the less strain energy induced by lattice mismatch between the DO 22 IMC and fcc Cu crystals in comparison with that between the equilibrium DO 3 IMC and fcc Cu crystals.

  7. Evolution and mechanism of the periodical structures formed on Ti plate under femtosecond laser irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Dong, E-mail: ld20501@126.com; Chen, Chuansong, E-mail: chencs@sdnu.edu.cn; Man, Baoyuan, E-mail: byman@sdnu.edu.cn; Meng, Xue; Sun, Yanna, E-mail: sunyuannaa@163.com; Li, Feifei

    2016-08-15

    Highlights: • Investigate the evolution and succession of three types of fs-laser induced periodic surface structures (FLIPSSs). • Achieve the laser processing window of each type of the FLIPSS. • Explain the formation and evolvement of the ripple structure in the respective of surface plasma wave (SPW). • Ascribe the interaction between the transmitted laser and the reflected laser at the two surfaces of the biconvex lens to the formation of ring structure. - Abstract: This work investigates the femtosencond laser (fs-laser) induced periodical surface structures (FLIPSS) on titanium plate including the concentric rings, microgrooves and subwavelength ripples. The evolution of the three types of the structures at different laser fluence and shot number is investigated experimentally in detail. The competition mechanisms exist among the different FLIPSS. A processing window for each resulting FLIPSS is obtained. In order to give an overall understanding of the FLIPSS, the formation mechanisms of each type of FLIPSS are discussed. The formation of the ripples is well explained by the propagating of the surface plasma wave (SPW) on the air/Ti interface. The evolutions of the ripple distribution are well understood according to this model as well. It is concluded that the interaction of the scattered wave of the laser light with the surface wave is concluded to give rise to the microgroove structure. According to our observation, the shape of the concentric rings does not change with the variation of the laser fluence and pulse number. The structure could be originated from the optical interference between the transmitted and reflected laser beams by the two surfaces of the biconvex lens. This investigation could not only make a further understanding of the formations of FLIPSS but also provide the possibility to control the surface morphologies in laser processing.

  8. Structure and properties of cerium oxides in bulk and nanoparticulate forms

    International Nuclear Information System (INIS)

    Gangopadhyay, Shruba; Frolov, Dmitry D.; Masunov, Artëm E.; Seal, Sudipta

    2014-01-01

    The experimental and computational studies on the cerium oxide nanoparticles, as well as stoichiometric phases of bulk ceria are reviewed. Based on structural similarities of these phases in hexagonal aspect, electroneutral and non-polar pentalayers are identified as building blocks of type A sesquioxide structure. The idealized core/shell structure of the ceria nanoparticles is described as dioxide core covered by a single pentalayer of sesquioxide, which explains the exceptional stability of subsurface vacancies in nanoceria. The density functional theory (DFT) predictions of the lattice parameters and elastic moduli for the Ce(IV) and Ce(III) oxides at the hybrid DFT level are also presented. The calculated values for both compounds agree with available experimental data and allow predicting changes in the lattice parameter with decreasing size of the nanoparticles. The lattice parameter is calculated as equilibrium between contraction of sesquioxide structure in the core, and expansion of dioxide structure in the shell of the nanoparticle. This is consistent with available XRD data on ceria NPs obtained in mild aqueous conditions. The core/shell model, however, breaks down when applied to the size dependence of lattice parameter in NPs obtained by the laser ablation techniques

  9. The structural and phase state formed in construction titanium alloy by radial forging

    Energy Technology Data Exchange (ETDEWEB)

    Shlyakhova, Galina V.; Danilov, Vladimir I.; Orlova, Dina V.; Zuev, Lev B. [Institute of Strength Physics and Materials Science SB RAS, Tomsk (Russian Federation); Zavodchikov, Aleksandr S. [Perm State Technical University, Perm (Russian Federation)

    2011-07-01

    The feasibility of rod manufacture from construction titanium alloy using radial forging on a high duty machine SXK16 was investigated. The investigations were carried on for titanium rod samples using the methods of metallography, electron transmission microscophy and X-ray analysis. The results obtained are described herein. It is found that radial forging results in the formation of homogeneous fine-grained structure.Using radial forging process, high-quality items are produced. As-worked material has submicrocrystalline globular structure and an optimal α:β phase ratio. Besides, the technology is more cost-effective relative to conventional flow charts. Key words: forging, titanium alloy, fine-grain structure, substructure, pore size.

  10. Process for growing a film epitaxially upon an oxide surface and structures formed with the process

    Science.gov (United States)

    McKee, Rodney A.; Walker, Frederick J.

    1995-01-01

    A process and structure wherein a film comprised of a perovskite or a spinel is built epitaxially upon a surface, such as an alkaline earth oxide surface, involves the epitaxial build up of alternating constituent metal oxide planes of the perovskite or spinel. The first layer of metal oxide built upon the surface includes a metal element which provides a small cation in the crystalline structure of the perovskite or spinel, and the second layer of metal oxide built upon the surface includes a metal element which provides a large cation in the crystalline structure of the perovskite or spinel. The layering sequence involved in the film build up reduces problems which would otherwise result from the interfacial electrostatics at the first atomic layers, and these oxides can be stabilized as commensurate thin films at a unit cell thickness or grown with high crystal quality to thicknesses of 0.5-0.7 .mu.m for optical device applications.

  11. Form Exploration of Folded Plate Timber Structures based on Performance Criteria

    DEFF Research Database (Denmark)

    Falk, Andreas; Buelow, Peter Von

    2011-01-01

    This paper presents an explorative study on applications of cross-laminated timber (CLT) elements in shell structures. Previous studies of plate tensegrity, folded plate roofs interacting with stabilising steel-based systems and studies inspired by origami show a widening range of possibilities...... to develop timber-based shells. Steadily rising interest in rationality during pre-fabrication, transport and on-site construction in contemporary industrialised production increases the competitiveness of CLT-based elements and systems and the architectural applications are getting more common and more...... experimental. Folded plate structures which are the focus of this paper present several issues of structural importance – potential mechanisms, subdivision of surfaces etc. – and the hereby presented study aims at exploring developed typologies, using computer tools for developed optimisation procedures...

  12. Crystal structures of the free and inhibited forms of plasmepsin I (PMI) from Plasmodium falciparum.

    Science.gov (United States)

    Bhaumik, Prasenjit; Horimoto, Yasumi; Xiao, Huogen; Miura, Takuya; Hidaka, Koushi; Kiso, Yoshiaki; Wlodawer, Alexander; Yada, Rickey Y; Gustchina, Alla

    2011-07-01

    Plasmepsin I (PMI) is one of the four vacuolar pepsin-like proteases responsible for hemoglobin degradation by the malarial parasite Plasmodium falciparum, and the only one with no crystal structure reported to date. Due to substantial functional redundancy of these enzymes, lack of inhibition of even a single plasmepsin can defeat efforts in creating effective antiparasitic agents. We have now solved crystal structures of the recombinant PMI as apoenzyme and in complex with the potent peptidic inhibitor, KNI-10006, at the resolution of 2.4 and 3.1Å, respectively. The apoenzyme crystallized in the orthorhombic space group P2(1)2(1)2(1) with two molecules in the asymmetric unit and the structure has been refined to the final R-factor of 20.7%. The KNI-10006 bound enzyme crystallized in the tetragonal space group P4(3) with four molecules in the asymmetric unit and the structure has been refined to the final R-factor of 21.1%. In the PMI-KNI-10006 complex, the inhibitors were bound identically to all four enzyme molecules, with the opposite directionality of the main chain of KNI-10006 relative to the direction of the enzyme substrates. Such a mode of binding of inhibitors containing an allophenylnorstatine-dimethylthioproline insert in the P1-P1' positions, previously reported in a complex with PMIV, demonstrates the importance of satisfying the requirements for the proper positioning of the functional groups in the mechanism-based inhibitors towards the catalytic machinery of aspartic proteases, as opposed to binding driven solely by the specificity of the individual enzymes. A comparison of the structure of the PMI-KNI-10006 complex with the structures of other vacuolar plasmepsins identified the important differences between them and may help in the design of specific inhibitors targeting the individual enzymes. Published by Elsevier Inc.

  13. Generation of forming limit bands for ultra-high-strength steels in car body structures

    Science.gov (United States)

    Bayat, Hamid Reza; Sarkar, Sayantan; Italiano, Francesco; Bach, Aleksandar; Wulfinghoff, Stephan; Reese, Stefanie

    2018-05-01

    The application of ultra-high-strength steels in safety-related automotive components has led to higher safety levels as well as weight reduction. Nevertheless, this class of advanced high-strength steels (AHSS) show material scatter due to its manufacturing processes. To address this problem in advance, it is of significance not only to model the failure of the sheet metal but also to specify a band for the necking regime. The former is described by a forming limit curve (FLC), whereas a forming limit band (FLB) introduces the upper and lower bounds for the permissible strains. The objective of the present work is to generate a robust prediction of the strain-based failure of the sheet metal during a car crash. The FLCs are generated numerically applying a modified Marciniak-Kuczynski (MK) model, where the existence of an angled groove is mandatory. This assures to obtain the maximum admissible strain. In addition, a zero extension angle is utilized for the left hand side of the FLC (tension-compression). The material scatter is captured in experiments and applied in the hardening relations. Necking strains are recorded experimentally by a digital image correlation based system (ARAMIS). Later, they are fit into the FLC based on an inhomogeneity parameter fi from the MK model. In order to generate a theoretical FLB, first a statistical approach is exploited to take the experimental data into consideration. Eventually, the forming limit band distinguishes between safe, necking and failed regions.

  14. An Assessment of Binary Metallic Glasses: Correlations Between Structure, Glass Forming Ability and Stability (Preprint)

    Science.gov (United States)

    2011-07-01

    volume (via indentation, relaxation or positron annihilation ) are expected to significantly clarify structural descriptions. Further insights may be... applicability of the concept of smaller spheres filling the interstices of larger spheres diminishes with decreasing difference in size, the efficient...alloys observed by Mossbauer spectroscopy and calorimetry’, Rapidly Quenched Metals, Proc. 4th International Conference on Rapidly Quenched Metals

  15. Improvement of formability for fabricating thin continuously corrugated structures in sheet metal forming process

    International Nuclear Information System (INIS)

    Choi, Sung Woo; Park, Sang Hu; Park, Seong Hun; Ha, Man Yeong; Jeong, Ho Seung; Cho, Jong Rae

    2012-01-01

    A stamping process is widely used for fabricating various sheet metal parts for vehicles, airplanes, and electronic devices by the merit of low processing cost and high productivity. Recently, the use of thin sheets with a corrugated structure for sheet metal parts has rapidly increased for use in energy management devices, such as heat exchangers, separators in fuel cells, and many others. However, it is not easy to make thin corrugated structures directly using a single step stamping process due to their geometrical complexity and very thin thickness. To solve this problem, a multi step stamping (MSS) process that includes a heat treatment process to improve formability is proposed in this work: the sequential process is the initial stamping, heat treatment, and final shaping. By the proposed method, we achieved successful results in fabricating thin corrugated structures with an average thickness of 75μm and increased formability of about 31% compared to the single step stamping process. Such structures can be used in a plate-type heat exchanger requiring low weight and a compact shape

  16. Weak form of Stokes-Dirac structures and geometric discretization of port-Hamiltonian systems

    Science.gov (United States)

    Kotyczka, Paul; Maschke, Bernhard; Lefèvre, Laurent

    2018-05-01

    We present the mixed Galerkin discretization of distributed parameter port-Hamiltonian systems. On the prototypical example of hyperbolic systems of two conservation laws in arbitrary spatial dimension, we derive the main contributions: (i) A weak formulation of the underlying geometric (Stokes-Dirac) structure with a segmented boundary according to the causality of the boundary ports. (ii) The geometric approximation of the Stokes-Dirac structure by a finite-dimensional Dirac structure is realized using a mixed Galerkin approach and power-preserving linear maps, which define minimal discrete power variables. (iii) With a consistent approximation of the Hamiltonian, we obtain finite-dimensional port-Hamiltonian state space models. By the degrees of freedom in the power-preserving maps, the resulting family of structure-preserving schemes allows for trade-offs between centered approximations and upwinding. We illustrate the method on the example of Whitney finite elements on a 2D simplicial triangulation and compare the eigenvalue approximation in 1D with a related approach.

  17. Structure and properties of fixed joints formed by ultrasonic-assisted friction-stir welding

    Energy Technology Data Exchange (ETDEWEB)

    Fortuna, S. V., E-mail: s-fortuna@ispms.ru; Ivanov, K. V., E-mail: ikv@ispms.ru; Eliseev, A. A., E-mail: alan@ispms.ru [Institute of Strength Physics and Materials ScienceTomsk, 634055 (Russian Federation); Tarasov, S. Yu., E-mail: tsy@ispms.ru; Ivanov, A. N., E-mail: ivan@ispms.ru; Rubtsov, V. E., E-mail: rvy@ispms.ru; Kolubaev, E. A., E-mail: eak@ispms.ru [Institute of Strength Physics and Materials ScienceTomsk, 634055 (Russian Federation); National Research Tomsk Polytechnic University, Tomsk, 634050 (Russian Federation)

    2015-10-27

    This paper deals with structure and properties of aluminum alloy 7475 and its joints obtained by friction stir welding including under ultrasonic action. Microhardness measurements show that ultrasonic action increases strength properties of the joints. Optical and transmission electron microscopy reveals that this effect is related to the precipitation of tertiary coherent S-and T-phase particles.

  18. The general form of the relaxation of a purely interfacial energy for structured deformations

    Czech Academy of Sciences Publication Activity Database

    Šilhavý, Miroslav

    2017-01-01

    Roč. 5, č. 2 (2017), s. 191-215 ISSN 2326-7186 Institutional support: RVO:67985840 Keywords : structured deformations * relaxation * subadditive envelope * interfacial energy Subject RIV: BA - General Mathematics OBOR OECD: Applied mathematics http://msp.org/memocs/2017/5-2/p04.xhtml

  19. Data Structuring and Modeling of Dental Documentation in a Form of Interactive Dental Cross

    Czech Academy of Sciences Publication Activity Database

    Dostálová, T.; Zvárová, Jana; Seydlová, M.; Teuberová, Z.; Pieš, Martin; Hanzlíček, Petr

    2007-01-01

    Roč. 5, č. 3 (2007), s. 288-290 ISSN 1881-4581 R&D Projects: GA AV ČR 1ET200300413 Institutional research plan: CEZ:AV0Z10300504 Keywords : electronic health record * structured data entry Subject RIV: IN - Informatics, Computer Science

  20. Innovative Forms of Regional Structural Policy in Europe: the Role of Dominant Concepts and Knowledge Flows

    NARCIS (Netherlands)

    Lagendijk, A.

    1999-01-01

    The last decade has witnessed a revival of regional structural policy in the Western world. The new style of policy-making which has emerged differs markedly from the top-down distributional models that dominated the post-war period, but is also more pro-active than the hands-off approach of the

  1. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  2. Structure and interactions of a malarial vaccine candidate, AMA1, form the parasite plasmodium falciparum

    International Nuclear Information System (INIS)

    Miles, L.A.; Keizer, D.W.; Hodder, A.N.; Nair, M.; Hinds, M.G.; Norton, R.S.; Li, F.; Foley, M.; Coley, A.; Anders, R.F.

    2001-01-01

    Full text: Apical membrane antigen 1 (AMA1), a merozoite surface protein found in all species of Plasmodium and other apicomplexan parasites, is a strong candidate for inclusion in a malarial vaccine. Recombinant AMA1 protected against P. fragile in monkeys and P. chabaudi adami in mice. P. falciparum AMA1 which has a 62-kDa ectodomain consisting of three disulphide-stabilised domains, is a target of antibodies that inhibit merozoite invasion in vitro. Here we describe the solution structure of domain III (14 kDa), determined by NMR on 15 N- and 13 C/ 15 N-labelled samples. It has a well-defined disulphide-stabilised core interrupted by a disordered loop, and both the N- and C-terminal regions of the molecule are unstructured. The structured region includes all three disulphide bonds. Naturally-occurring mutations across 11 different P falciparum strains that are located far apart in the sequence cluster around the disulphide core in the 3D structure of domain III, suggesting that this region contains the major epitopes recognised by neutralising antibodies. Consistent with this, the disulphide-bond stabilised conformation of the ectodomain was essential for protection, as the antigen was not an effective vaccine after reduction and alkylation. Peptides have been found by phage display that bind to AMA1 and block merozoite invasion of erythrocytes. We have investigated their solution structures and interaction with full-length AMA1 ectodomain in an effort to understand the structure-function relationships of this important vaccine candidate

  3. Closed-form critical earthquake response of elastic-plastic structures on compliant ground under near-fault ground motions

    Directory of Open Access Journals (Sweden)

    Kotaro eKojima

    2016-01-01

    Full Text Available The double impulse is introduced as a substitute of the fling-step near-fault ground motion. A closed-form solution of the elastic-plastic response of a structure on compliant (flexible ground by the ‘critical double impulse’ is derived for the first time based on the solution for the corresponding structure with fixed base. As in the case of fixed-base model, only the free-vibration appears under such double impulse and the energy approach plays an important role in the derivation of the closed-form solution of a complicated elastic-plastic response on compliant ground. It is remarkable that no iteration is needed in the derivation of the critical elastic-plastic response. It is shown via the closed-form expression that, in the case of a smaller input level of double impulse to the structural strength, as the ground stiffness becomes larger, the maximum plastic deformation becomes larger. On the other hand, in the case of a larger input level of double impulse to the structural strength, as the ground stiffness becomes smaller, the maximum plastic deformation becomes larger. The criticality and validity of the proposed theory are investigated through the comparison with the response analysis to the corresponding one-cycle sinusoidal input as a representative of the fling-step near-fault ground motion. The applicability of the proposed theory to actual recorded pulse-type ground motions is also discussed.

  4. Structure analysis of aluminium silicon manganese nitride precipitates formed in grain-oriented electrical steels

    International Nuclear Information System (INIS)

    Bernier, Nicolas; Xhoffer, Chris; Van De Putte, Tom; Galceran, Montserrat; Godet, Stéphane

    2013-01-01

    We report a detailed structural and chemical characterisation of aluminium silicon manganese nitrides that act as grain growth inhibitors in industrially processed grain-oriented (GO) electrical steels. The compounds are characterised using energy dispersive X-ray spectrometry (EDX) and energy filtered transmission electron microscopy (EFTEM), while their crystal structures are analysed using X-ray diffraction (XRD) and TEM in electron diffraction (ED), dark-field, high-resolution and automated crystallographic orientation mapping (ACOM) modes. The chemical bonding character is determined using electron energy loss spectroscopy (EELS). Despite the wide variation in composition, all the precipitates exhibit a hexagonal close-packed (h.c.p.) crystal structure and lattice parameters of aluminium nitride. The EDX measurement of ∼ 900 stoichiometrically different precipitates indicates intermediate structures between pure aluminium nitride and pure silicon manganese nitride, with a constant Si/Mn atomic ratio of ∼ 4. It is demonstrated that aluminium and silicon are interchangeably precipitated with the same local arrangement, while both Mn 2+ and Mn 3+ are incorporated in the h.c.p. silicon nitride interstitial sites. The oxidation of the silicon manganese nitrides most likely originates from the incorporation of oxygen during the decarburisation annealing process, thus creating extended planar defects such as stacking faults and inversion domain boundaries. The chemical composition of the inhibitors may be written as (AlN) x (SiMn 0.25 N y O z ) 1−x with x ranging from 0 to 1. - Highlights: • We study the structure of (Al,Si,Mn)N inhibitors in grain oriented electrical steels. • Inhibitors have the hexagonal close-packed symmetry with lattice parameters of AlN. • Inhibitors are intermediate structures between pure AlN and (Si,Mn)N with Si/Mn ∼ 4. • Al and Si share the same local arrangement; Mn is incorporated in both Mn 2+ and Mn 3+ . • Oxygen

  5. Isolation and structural elucidation of tiamulin metabolites formed in liver microsomes of pigs

    DEFF Research Database (Denmark)

    Lykkeberg, Anne Kruse; Cornett, Claus; Halling-Sørensen, Bent

    2006-01-01

    Although the antimicrobial tiamulin is extensively metabolized in pigs, the metabolism is not well investigated. In this work the NADPH dependent metabolism of tiamulin in liver microsomes from pigs has been studied. The tiamulin metabolites formed in the incubations were analysed using LC-MS, an...... 20% of tiamulin was deethylated, 10% was hydroxylated in the 2beta-position and 7% was hydroxylated in the 8alpha-position. About 40% of tiamulin was metabolized during the incubation conditions used. The protein precipitation in the incubations was performed using perchloric acid...

  6. [Incidence of anaplastic tumor in structure of other histologic forms of the thyroid gland cancer].

    Science.gov (United States)

    Vinnik, Iu A; Gorbenko, V N; Vas'ko, A R; Kikhtenko, E V; Gargin, V V

    2014-01-01

    The degrees of invasiveness, proliferative activity, morphofunctional activity of nuclei in the thyroidal gland tumors were studied, while analyzing material, obtained in 1343 patients, suffering thyroidal gland cancer (THGC) and operated on in 2000-2013 yrs. Morphological point quantity of malignancy (as a criterion of the tumor progression grade) and mitotic activity in cellular population were determined in various kinds of THGC. Undifferentiated (anaplastic carcinoma) type of THGC is the most malignant one. There were determined a spindle-like, giant-cell and squamous-cell forms of undifferentiated THGC. The presence of sites of differentiated cancer in 33% of histological preparations witnesses the interrelationship with the earlier existed pathological process.

  7. Extreme value predictions and critical wave episodes for marine structures by FORM

    DEFF Research Database (Denmark)

    Jensen, Jørgen Juncher

    2007-01-01

    The aim of the present paper is to advocate for a very effective stochastic procedure, based on the First Order Reliability Method (FORM), for extreme value predictions related to wave induced loads. Three different applications will be illustrated. The first deals with a jack-up rig where second...... order stochastic waves are included in the analysis. The second application is parametric roll motions of ships. Finally, the motion of a TLP floating foundation for an offshore wind turbine is analysed taking into account large motions....

  8. Extreme value predictions and critical wave episodes for marine structures by FORM

    DEFF Research Database (Denmark)

    Jensen, Jørgen Juncher

    2008-01-01

    The aim of the present paper is to advocate for a very effective stochastic procedure, based on the First Order Reliability Method (FORM), for extreme value predictions related to wave induced loads. Three different applications will be illustrated. The first deals with a jack-up rig where second...... order stochastic waves are included in the analysis. The second application is parametric roll motions of ships. Finally, the motion of a TLP floating foundation for an offshore wind turbine is analysed taking into account large motions....

  9. Tubular House - Form Follows Technology, Concrete Shell Structure with Inner Thermal Insulation

    Science.gov (United States)

    Idem, Robert; Kleczek, Paweł; Pawłowski, Krzysztof; Chudoba, Piotr

    2017-10-01

    The aim of this paper is the theoretical analysis of the possibilities and limitations of using an unconventional technology and the original architectural form stemming from it - the building with external construction and internal insulation. In Central European climatic conditions, the traditional solution for the walls of heated buildings relies on using external thermal insulation. This stems from building physics: it prevents interstitial condensation of water vapour in the wall. Internal insulation is used exceptionally. This is done e.g. in historical buildings undergoing thermal modernization (due to the impossibility of interfering with facade). In such cases, a thermal insulation layer is used on the internal wall surface, along with an additional layer of vapour barrier. The concept of building concerns the intentional usage of an internal insulation. In this case, the construction is a tight external reinforced concrete shell. The architectural form of such building is strongly interrelated with the technology, which was used to build it. The paper presents the essence of this concept in descriptive and drawing form. The basic elements of such building are described (the external construction, the internal insulation and ventilation). As a case study, authors present a project of a residential building along with the description of the applied materials and installation solutions, and the results obtained from thermal, humidity and energetic calculations. The discussion presents the advantages and disadvantages of the proposed concept. The basic advantage of this solution is potentially low building cost. This stems from minimizing the ground works, the simplicity of the joints and the outer finish, as well as from the possibility of prefabrication of the elements. The continuity of the thermal insulation allows to reduce the amount of thermal bridges. The applied technology and form are applicable most of all for small buildings, due to limited

  10. Reproducible and recyclable SERS substrates: Flower-like Ag structures with concave surfaces formed by electrodeposition

    Science.gov (United States)

    Bian, Juncao; Shu, Shiwei; Li, Jianfu; Huang, Chao; Li, Yang Yang; Zhang, Rui-Qin

    2015-04-01

    Direct synthesis of three-dimensional Ag structures on solid substrates for the purposes of producing reproducible and recyclable surface-enhanced Raman scattering (SERS) applications remains challenging. In this work, flower-like Ag structures with concave surfaces (FACS) were successfully electrodeposited onto ITO glass using the double-potentiostatic method. The FACS, with an enhancement factor of the order of 108, exhibited a SERS signal intensity 3.3 times stronger than that measured from Ag nanostructures without concave surfaces. A cleaning procedure involving lengthy immersion of the sample in ethanol and KNO3 was proposed to recycle the substrate and confirmed by using rhodamine 6G, adenine, and 4-aminothiophenol as target molecules. The findings can help to advance the practical applications of Ag nanostructure-based SERS substrates.

  11. Crystal Structure of Tetragonal Form of La2NiO4+x

    Science.gov (United States)

    Kajitani, Tsuyoshi; Hosoya, Syoichi; Hirabayashi, Makoto; Fukuda, Tsuguo; Onozuka, Takashi

    1989-10-01

    The crystal structure of the title oxide was studied by means of the X-ray and neutron single crystal diffraction measurements. At room temperature, the tetragonal crystal structure is P42/ncm-type (No. 138), which is one of the subgroup of the space group I4/mmm. The lattice parameters of a sample annealed and slowly cooled in oxygen atmosphere from 673 K are a{=}b{=}5.4640(1) Å and c{=}12.6719(2) Å, while the oxygen content, x{=}0.10(4), was determined from obtained neutron data. The title oxide undergoes a tetragonal (P42/ncm)/tetragonal (I4/mmm) phase transition at about 560 K. The transition temperature is almost identical both in the annealed and as-grown crystals.

  12. Crystal structure of the low-temperature forms of cesium and rubidium orthophosphates

    International Nuclear Information System (INIS)

    Voronin, V.I.; Proskurina, N.V.; Goshchitskij, B.N.; Berger, I.F.; Sheptyakov, D.V.; Burmakin, E.I.; Stroev, S.S.; Shekhtman, G.Sh.

    2008-01-01

    Making use of the neutron diffraction data base Rietveld method one for the first time determined and made more clear the crystal structure of the low-temperature modifications of Cs 3 PO 4 cesium and Rb 3 PO 4 rubidium orthophosphates. Cs 3 PO 4 and Rb 3 PO 4 were found to be isostructural one as to K 3 PO 4 . The structure is a rhombic one (Pnma, Z=4 sp.gr.) with the following elementary cell parameters: a = 1.23177(6) nm, b=0.88948(4) nm, c=0.64197(3) nm and a = 1.17362(2) nm, b=0.81046(1) nm, c=0.615167(9) nm for Cs 3 PO 4 and Rb 3 PO 4 respectively [ru

  13. Small angle neutron scattering form polymer melts: structural investigation and phase behaviour

    International Nuclear Information System (INIS)

    Ertugrul, O.

    2004-01-01

    The Small-Angle Neutron Scattering (SANS) techniques have been used to study the structural properties and phase behavior of polymer melts. A model based on Random Phase Approximation (RPA) is proposed to predict the experimental data. By fitting the model to data we could be able to obtain radius of gyration (a measure of size of a polymer) and phase transition for the sample. (author)

  14. Dynamical, structural and chemical heterogeneities in a binary metallic glass-forming liquid

    Science.gov (United States)

    Puosi, F.; Jakse, N.; Pasturel, A.

    2018-04-01

    As it approaches the glass transition, particle motion in liquids becomes highly heterogeneous and regions with virtually no mobility coexist with liquid-like domains. This complex dynamic is believed to be responsible for different phenomena including non-exponential relaxation and the breakdown of the Stokes-Einstein relation. Understanding the relationships between dynamical heterogeneities and local structure in metallic liquids and glasses is a major scientific challenge. Here we use classical molecular dynamics simulations to study the atomic dynamics and microscopic structure of Cu50Zr50 alloy in the supercooling regime. Dynamical heterogeneities are identified via an isoconfigurational analysis. We demonstrate the transition from isolated to clustering low mobility with decreasing temperature. These slow clusters, whose sizes grow upon cooling, are also associated with concentration fluctuations, characterized by a Zr-enriched phase, with a composition CuZr2 . In addition, a structural analysis of slow clusters based on Voronoi tessellation evidences an increase with respect of the bulk system of the fraction of Cu atoms having a local icosahedral order. These results are in agreement with the consolidated scenario of the relevant role played by icosahedral order in the dynamic slowing-down in supercooled metal alloys.

  15. Hybrid structures formed by homo- and heteroleptic aliphatic dicarboxylates of lead with 2-D inorganic connectivity

    International Nuclear Information System (INIS)

    Thirumurugan, A.; Rao, C.N.R.

    2008-01-01

    Three-dimensional homoleptic (single type of ligand) lead dicarboxylates with hybrid structures involving Pb-O-Pb linkages of the compositions, Pb(C 5 H 6 O 4 ), I, and Pb(C 6 H 8 O 4 ), II and III, have been synthesized and characterized. Three-dimensional heteroleptic (mixed ligands) lead dicarboxylates of the formulae, Pb 2 (C 2 O 4 )(C 4 H 4 O 4 ), IV and Pb 2 (C 2 O 4 )(C 6 H 8 O 4 ), V, with hybrid structures involving Pb-O-Pb linkages have also been prepared and characterized along with a novel two-dimensional lead nitrate-oxalate of the composition, (OPb 2 ) 2 (C 2 O 4 )(NO 3 ) 2 , VI. In all these dicarboxylates, there is two-dimensional inorganic connectivity and the lead (II) cation has hemi- or holo-directed coordination geometry. Depending upon the torsional angle and the coordination mode of the dicarboxylate anions as well as the geometry of the lead (II) cations, these hybrid compounds exhibit two types of two-dimensional inorganic connectivities. - Graphical abstract: Three homoleptic and two heteroleptic three-dimensional lead aliphatic dicarboxylates along with a novel two-dimensional lead nitrate-oxalate with hybrid structures involving Pb-O-Pb linkages have been synthesized and charecterized. In all these dicarboxylates, there is two-dimensional inorganic connectivity. The lead (II) cation has hemi- or holo-directed coordination geometry

  16. Plate-impact loading of cellular structures formed by selective laser melting

    International Nuclear Information System (INIS)

    Winter, R E; Cotton, M; Harris, E J; Maw, J R; Chapman, D J; Eakins, D E; McShane, G

    2014-01-01

    Porous materials are of great interest because of improved energy absorption over their solid counterparts. Their properties, however, have been difficult to optimize. Additive manufacturing has emerged as a potential technique to closely define the structure and properties of porous components, i.e. density, strut width and pore size; however, the behaviour of these materials at very high impact energies remains largely unexplored. We describe an initial study of the dynamic compression response of lattice materials fabricated through additive manufacturing. Lattices consisting of an array of intersecting stainless steel rods were fabricated into discs using selective laser melting. The resulting discs were impacted against solid stainless steel targets at velocities ranging from 300 to 700 m s −1 using a gas gun. Continuum CTH simulations were performed to identify key features in the measured wave profiles, while 3D simulations, in which the individual cells were modelled, revealed details of microscale deformation during collapse of the lattice structure. The validated computer models have been used to provide an understanding of the deformation processes in the cellular samples. The study supports the optimization of cellular structures for application as energy absorbers. (paper)

  17. Modelling size and structure of nanoparticles formed from drying of submicron solution aerosols

    International Nuclear Information System (INIS)

    Bandyopadhyay, Arpan A.; Pawar, Amol A.; Venkataraman, Chandra; Mehra, Anurag

    2015-01-01

    Drying of submicron solution aerosols, under controlled conditions, has been explored to prepare nanoparticles for drug delivery applications. A computational model of solution drop evaporation is developed to study the evolution of solute gradients inside the drop and predict the size and shell thickness of precipitating nanoparticles. The model considers evaporation as a two-stage process involving droplet shrinkage and shell growth. It was corroborated that droplet evaporation rate controls the solute distribution within a droplet and the resulting particle structure (solid or shell type). At higher gas temperatures, rapid build-up of solute near drop surface from high evaporation rates results in early attainment of critical supersaturation solubility and a steeper solute gradient, which favours formation of larger, shell-type particles. At lower gas temperatures, formation of smaller, solid nanoparticles is indicated. The computed size and shell thickness are in good agreement with experimentally prepared lipid nanoparticles. This study indicates that solid or shell structure of precipitated nanoparticles is strongly affected by evaporation rate, while initial solute concentration in the precursor solution and atomized droplet size affect shell thickness. For the gas temperatures considered, evaporative cooling leads to droplet temperature below the melting point of the lipid solute. Thus, we conclude that control over nanoparticle size and structure, of thermolabile precursor materials suitable for drug delivery, can be achieved by controlling evaporation rates, through selection of aerosol processing conditions

  18. Modelling size and structure of nanoparticles formed from drying of submicron solution aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Bandyopadhyay, Arpan A.; Pawar, Amol A.; Venkataraman, Chandra; Mehra, Anurag, E-mail: mehra@iitb.ac.in [Indian Institute of Technology Bombay, Department of Chemical Engineering (India)

    2015-01-15

    Drying of submicron solution aerosols, under controlled conditions, has been explored to prepare nanoparticles for drug delivery applications. A computational model of solution drop evaporation is developed to study the evolution of solute gradients inside the drop and predict the size and shell thickness of precipitating nanoparticles. The model considers evaporation as a two-stage process involving droplet shrinkage and shell growth. It was corroborated that droplet evaporation rate controls the solute distribution within a droplet and the resulting particle structure (solid or shell type). At higher gas temperatures, rapid build-up of solute near drop surface from high evaporation rates results in early attainment of critical supersaturation solubility and a steeper solute gradient, which favours formation of larger, shell-type particles. At lower gas temperatures, formation of smaller, solid nanoparticles is indicated. The computed size and shell thickness are in good agreement with experimentally prepared lipid nanoparticles. This study indicates that solid or shell structure of precipitated nanoparticles is strongly affected by evaporation rate, while initial solute concentration in the precursor solution and atomized droplet size affect shell thickness. For the gas temperatures considered, evaporative cooling leads to droplet temperature below the melting point of the lipid solute. Thus, we conclude that control over nanoparticle size and structure, of thermolabile precursor materials suitable for drug delivery, can be achieved by controlling evaporation rates, through selection of aerosol processing conditions.

  19. Synthesis and new structure shaping mechanism of silica particles formed at high pH

    International Nuclear Information System (INIS)

    Zhang, Henan; Zhao, Yu; Akins, Daniel L.

    2012-01-01

    For the sol–gel synthesis of silica particles under high pH catalytic conditions (pH>12) in water/ethanol solvent, we have deduced that the competing dynamics of chemical etching and sol–gel process can explain the types of silica particles formed and their morphologies. We have demonstrated that emulsion droplets that are generated by adding tetraethyl orthosilicate (TEOS) to a water–ethanol solution serve as soft templates for hollow spherical silica (1–2 μm). And if the emulsion is converted by the sol–gel process, one finds that suspended solid silica spheres of diameter of ∼900 nm are formed. Moreover, several other factors are found to play fundamental roles in determining the final morphologies of silica particles, such as by variation of the pH (in our case, using OH – ) to a level where condensation dominates; by changing the volume ratios of water/ethanol; and using an emulsifier (specifically, CTAB) - Graphical abstract: “Local chemical etching” and sol–gel process have been proposed to interpret the control of morphologies of silica particles through varying initial pHs in syntheses. Highlights: ► Different initial pHs in our syntheses provides morphological control of silica particles. ► “Local chemical etching” and sol–gel process describes the formation of silica spheres. ► The formation of emulsions generates hollow silica particles.

  20. Structural study of anodic films formed on aluminum in nitric acid electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Yakovleva, N.M.; Anicai, L.; Yakovlev, A.N.; Dima, L.; Khanina, E.Ya.; Buda, M.; Chupakhina, E.A

    2002-09-02

    The paper presents the results of investigations of porous Al anodic films formed in HNO{sub 3} electrolytes carried out by means of electrochemical techniques and X-ray diffraction as well as scanning electron microscopy (SEM). It was assumed that both electrochemical formation of a porous oxide and anodic dissolution of metal take place at Al/oxide interface at the same time. The analysis of short-range order (SRO) parameters for relatively high current density, 1x10{sup 3} A/m{sup 2}, and anodizing time, 10 min, leads to the conclusion that films mainly consist of amorphous alumina with {gamma}'-Al{sub 2}O{sub 3}-like SRO and a small amount ({approx}10%) of amorphous aluminum oxyhydroxide. SEM investigation of the films revealed strong dependence of the surface relief on different applied forming conditions. This marked change in the surface relief is discussed taking into account the relatively complex behavior of Al during anodization in HNO{sub 3} electrolytes, that involves both electrochemical growth and dissolution processes of anodic film associated with an electrochemical dissolution of aluminum substrate.