
Sample records for g-quadruplex selective bisantrene

  1. Selectivity in ligand recognition of G-quadruplex loops. (United States)

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen


    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  2. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam


    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  3. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  4. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe. (United States)

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming


    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  5. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein


    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  6. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond


    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  7. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents. (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro


    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  8. Macrocyclic G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, M C; Ulven, Trond


    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  9. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro


    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  10. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte


    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  11. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex. (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung


    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  12. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  13. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation. (United States)

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela


    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Human telomeric G-quadruplex formation and highly selective fluorescence detection of toxic strontium ions. (United States)

    Qu, Konggang; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang


    Strontium ions play important roles in biological systems. The inhalation of strontium can cause severe respiratory difficulties, anaphylactic reaction and extreme tachycardia. Strontium can replace calcium in organisms, inhibit normal calcium absorption and induce strontium "rickets" in childhood. Thus, the development of sensitive and selective methods for the determination of trace amounts of Sr(2+) in aqueous media is of considerable importance for environmental and human health protection. A number of methodologies, such as X-ray energy dispersive spectrometry, inductively coupled argon plasma atomic emission spectroscopy (ICP-AES), atomic absorption spectrometry (AAS) and instrumental thermal neutron activation analysis, have been reported. However, these methods are somewhat complex, costly, time consuming and, especially, need special instruments. Thus, the design of convenient and inexpensive approaches for the sensitive and selective detection of Sr(2+) with rapid, easy manipulation is in ever-increasing demand. To the best of our knowledge, using DNA conformational change to detect Sr(2+) has not yet been reported. Herein we utilized thiazole orange (TO) as a signal reporter to devise a simple Sr(2+) detection assay based on Sr(2+) induced human telomeric DNA conformational change in the presence of SWNTs. The limit of detection is 10 nM Sr(2+) (0.87 μg L(-1)), far below 4 mg L(-1), the U.S. Federal threshold in drinking water defined by the U.S. EPA.

  15. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri


    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  16. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications (United States)


    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  17. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Yanhua Chen


    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  18. Effect of Urea on G-Quadruplex Stability. (United States)

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V


    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  19. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents. (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela


    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  20. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.


    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  1. Seven essential questions on G-quadruplexes. (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L


    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  2. G-quadruplexes as novel cis-elements controlling transcription during embryonic development. (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B


    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Simultaneous G-Quadruplex DNA Logic. (United States)

    Bader, Antoine; Cockroft, Scott L


    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.


    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016

  5. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression. (United States)

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee


    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent. (United States)

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun


    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  7. Efficient Long-Range Hole Transport Through G-Quadruplexes. (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei


    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Juan Hu


    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  9. Guanine base stacking in G-quadruplex nucleic acids (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân


    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  10. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities. (United States)

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo


    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  11. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents (United States)

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David


    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  12. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC


    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  13. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity (United States)

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao


    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  14. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    DEFF Research Database (Denmark)

    Porru, Manuela; Artuso, Simona; Salvati, Erica


    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  15. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Natalia Rizeq


    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  16. Studies of G-quadruplexes formed within self-assembled DNA mini-circles. (United States)

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon


    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  17. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention. (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B


    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  18. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  19. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene. (United States)

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui


    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments. (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu


    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  1. A multi-functional guanine derivative for studying the DNA G-quadruplex structure. (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan


    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  2. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang


    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  3. Local epigenetic reprogramming induced by G-quadruplex ligands (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar


    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  4. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou


    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  5. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel


    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  6. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin. (United States)

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin


    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. G-Quadruplexes influence pri-microRNA processing. (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre


    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  8. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise


    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  9. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  10. Experimental approaches to identify cellular G-quadruplex structures and functions. (United States)

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar


    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription. (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng


    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  12. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana


    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  13. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Directory of Open Access Journals (Sweden)

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  14. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo


    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  15. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.


    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  16. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons. (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S


    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  17. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes. (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij


    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells. (United States)

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G


    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  19. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue. (United States)

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo


    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J


    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  1. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration. (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis


    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  2. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch. (United States)

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu


    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  3. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua


    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  4. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan


    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  5. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis


    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  6. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.


    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  7. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  8. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.


    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  9. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin. (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey


    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  10. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex. (United States)

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke


    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  11. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří


    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  12. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku


    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  13. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.


    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  14. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes


    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij


    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  15. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.


    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  16. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân


    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  17. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis


    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  18. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Directory of Open Access Journals (Sweden)

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  19. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand. (United States)

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola


    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  20. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay. (United States)

    Sun, Daekyu; Hurley, Laurence H


    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  1. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine. (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân


    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)


    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  3. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond


    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  4. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad. (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân


    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi


    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  6. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  7. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure. (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki


    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard


    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  9. G-Quadruplexes in DNA Replication: A Problem or a Necessity? (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle


    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA. (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate


    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  11. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site (United States)

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki


    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  12. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.


    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  13. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression. (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi


    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome. (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân


    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan


    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  16. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents. (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos


    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  17. Intermolecular G-quadruplex structure-based fluorescent DNA detection system. (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin


    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection. (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia


    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  19. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction. (United States)

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng


    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  20. Treatment of relapsed or refractory acute leukemia in childhood with bisantrene combined with high dose aracytine. (United States)

    Leblanc, T; Deméocq, F; Leverger, G; Baruchel, A; Lemerle, S; Vannier, J P; Nelken, B; Guillot, T; Schaison, G


    Bisantrene is an anthracene derivative which has demonstrated activity in acute myeloblastic leukemia (AML) and in lymphoma. The present study was designed to assess the reinduction rate and toxicity of bisantrene (250 mg/m2/d x 5) associated with aracytine (100 mg/m2 twice a day x 5) in refractory and relapsed acute childhood leukemia. Patients who relapsed after bone marrow transplantation were eligible. Twenty-six children were included. Diagnoses were as follows: 13 AML, 9 acute lymphoblastic leukemia (ALL), and 4 undifferentiated leukemia (AUL). All patients had been very highly pretreated, especially with anthracyclines, and most of them were of poor prognosis. The overall response rate was 46% with a 95% confidence interval ranging from 27-65%. According to diagnosis, complete remission (CR) rates are: AML: 5/13, ALL: 5/9, and AUL: 2/4. Four children died, three from infection and one from acute lysis syndrome. The major toxicity was infection with grade 3 and 4 episodes occurring in 42% of patients. No significant cardiac toxicity was noted. Hepatic and renal toxicity was noted. Hepatic and renal toxicity were limited and transient. Bisantrene in association with aracytine is effective in both AML and ALL of childhood. Bisantrene should be evaluated with a five-day schedule in other pediatric malignancies. In children with acute leukemia previously treated with high dose aracytine, new combination regimen is warranted.

  1. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives. (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu


    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody. (United States)

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N


    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  3. DNA secondary structures: stability and function of G-quadruplex structures (United States)

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.


    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  4. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures. (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C


    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels


    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  6. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Aishwarya Prakash


    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  7. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques (United States)

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.


    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  8. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  9. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    Directory of Open Access Journals (Sweden)

    David Monchaud


    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  10. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  11. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology. (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân


    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  12. Mms1 is an assistant for regulating G-quadruplex DNA structures. (United States)

    Schwindt, Eike; Paeschke, Katrin


    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  13. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability. (United States)

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole


    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  14. RPA-mediated unfolding of systematically varying G-quadruplex structures. (United States)

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza


    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  15. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding (United States)

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza


    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  16. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication. (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang


    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  17. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo


    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  18. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing. (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo


    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  19. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance. (United States)

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja


    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  20. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Directory of Open Access Journals (Sweden)

    Vikas Yadav


    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  1. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding* (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang


    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  2. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification. (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân


    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2. (United States)

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik


    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  4. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control. (United States)

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng


    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  5. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  6. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR. (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L


    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  7. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail:; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail:


    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  8. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations. (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio


    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  9. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Directory of Open Access Journals (Sweden)

    Yunqiang Bian


    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  10. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data. (United States)

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano


    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  11. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus


    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  12. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai, E-mail:; Wang, Ke; Zhu, Xue; Xie, Minhao


    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

  13. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine. (United States)

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar


    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels. (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar


    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  15. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address

  16. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches. (United States)

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta


    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  17. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach. (United States)

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina


    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Directory of Open Access Journals (Sweden)

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  19. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra


    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  20. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification. (United States)

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping


    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk


    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  2. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography. (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin


    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  3. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification. (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong


    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  4. Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates. (United States)

    Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen


    A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes. (United States)

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua


    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  6. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction. (United States)

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can


    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.


    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  8. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA. (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng


    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  9. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang


    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  10. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain. (United States)

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun


    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod. (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu


    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  12. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection. (United States)

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo


    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  13. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory. (United States)

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V


    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  14. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation. (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal


    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  15. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome. (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A


    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  16. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens


    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  17. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci. (United States)

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A


    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  18. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching. (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu


    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures. (United States)

    Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro


    The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012

  20. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene. (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia


    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  1. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA. (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae


    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  2. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe. (United States)

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei


    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds. (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao


    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units. (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole


    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  5. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer. (United States)

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela


    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  6. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA. (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin


    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  7. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka


    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  8. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes. (United States)

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo


    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  9. Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome. (United States)

    Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang


    Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  10. Glucose oxidase-initiated cascade catalysis for sensitive impedimetric aptasensor based on metal-organic frameworks functionalized with Pt nanoparticles and hemin/G-quadruplex as mimicking peroxidases. (United States)

    Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju


    Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. The estimation of H-bond and metal ion-ligand interaction energies in the G-Quadruplex ⋯ Mn+ complexes (United States)

    Mostafavi, Najmeh; Ebrahimi, Ali


    In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.

  12. Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo. (United States)

    Hirashima, Kyotaro; Seimiya, Hiroyuki


    Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    DEFF Research Database (Denmark)

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia


    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  14. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction (United States)

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang


    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  15. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA


    Stoltenburg, Regina; Kraf?ikov?, Petra; V?glask?, Viktor; Strehlitz, Beate


    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting P...

  16. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase* (United States)

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.


    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  17. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins. (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E


    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  18. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Directory of Open Access Journals (Sweden)

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  19. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function? (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J


    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  20. Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture. (United States)

    Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao


    Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins. (United States)

    Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A


    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

  2. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex. (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi


    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA. (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun


    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA. (United States)

    Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun


    The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Selectivity of major isoquinoline alkaloids from Chelidonium majus towards telomeric G-quadruplex: A study using a transition-FRET (t-FRET) assay

    Czech Academy of Sciences Publication Activity Database

    Noureini, S.K.; Esmaeili, H.; Abachi, F.; Khiali, S.; Islam, Barira; Kuta, M.; Saboury, A.A.; Hoffillann, M.; Šponer, Jiří; Parkinson, G.; Haider, S.


    Roč. 1861, č. 8 (2017), s. 2020-2030 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : prostate-cancer cells * amber force-field * nucleic-acids Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  6. Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure. (United States)

    Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie


    An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc00361g Click here for additional data file. (United States)

    Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei


    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564

  8. Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

    DEFF Research Database (Denmark)

    Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong


    DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

  9. Transposable elements and G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovský, Eduard; Tokan, Viktor; Lexa, M.


    Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015

  10. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function? (United States)


    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  11. p53 binds human telomeric G-quadruplex in vitro

    Czech Academy of Sciences Publication Activity Database

    Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie


    Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016

  12. Targeting C-Myc Promoter: Helquats As Novel G-Quadruplex Stabilizing Ligands

    Czech Academy of Sciences Publication Activity Database

    Kužmová, Erika; Kozák, Jaroslav; Komárková, Veronika; Pytlík, R.; Teplý, Filip; Hájek, Miroslav


    Roč. 124, č. 21 (2014) ISSN 0006-4971. [Annual Meeting of the American Society of Hematology /56./. 06.12.2014-09.12.2014, San Francisco] Institutional support: RVO:61388963 Keywords : helquats * C-Myc * leukemia Subject RIV: CE - Biochemistry

  13. Conformations of Human Telomeric G-Quadruplex Studied Using a Nucleotide-Independent Nitroxide Label

    Czech Academy of Sciences Publication Activity Database

    Zhang, X.J.; Xu, C.X.; Di Felice, R.; Šponer, Jiří; Islam, B.; Stadlbauer, Petr; Ding, Y.; Mao, L.; Mao, Z.W.; Qin, P.Z.


    Roč. 55, č. 2 (2016), s. 360-372 ISSN 0006-2960 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : PARAMAGNETIC-RESONANCE SPECTROSCOPY * AMBER FORCE-FIELD * NUCLEIC-ACIDS Subject RIV: BO - Biophysics Impact factor: 2.938, year: 2016

  14. Synthesis of New DNA G-Quadruplex Constructs with Anthraquinone Insertions and Their Anticoagulant Activity

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard


    1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...

  15. G-quadruplex recognition activities of E. Coli MutS

    Directory of Open Access Journals (Sweden)

    Ehrat Edward A


    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  16. Wild-type p53 binds to MYC promoter G-quadruplex

    Czech Academy of Sciences Publication Activity Database

    Petr, Marek; Helma, Robert; Polášková, Alena; Krejci, Aneta; Dvořáková, Zuzana; Kejnovská, Iva; Navrátilová, Lucie; Adámik, Matěj; Vorlíčková, Michaela; Brázdová, Marie


    Roč. 36, OCT2016 (2016), č. článku e00397. ISSN 0144-8463 R&D Projects: GA ČR GA13-36108S; GA ČR GAP205/12/0466 Institutional support: RVO:68081707 Keywords : nuclease-hypersensitive element * c-terminal domain * gene-expression Subject RIV: BO - Biophysics Impact factor: 2.906, year: 2016

  17. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    DEFF Research Database (Denmark)

    Opazo, Felipe; Eiden, Laura; Hansen, Line


    cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target...

  18. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela


    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  19. BLM helicase suppresses recombination at G-quadruplex motifs in transcribed genes

    NARCIS (Netherlands)

    van Wietmarschen, Niek; Merzouk, Sarra; Halsema, Nancy; Spierings, Diana C J; Guryev, Victor; Lansdorp, Peter M


    Bloom syndrome is a cancer predisposition disorder caused by mutations in the BLM helicase gene. Cells from persons with Bloom syndrome exhibit striking genomic instability characterized by excessive sister chromatid exchange events (SCEs). We applied single-cell DNA template strand sequencing

  20. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.


    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  1. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing. (United States)

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P


    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  2. Stephen Neidle on cancer therapy and G-quadruplex inhibitors. Interview by Joanna De Souza. (United States)

    Neidle, Stephen


    Stephen Neidle was educated at Imperial College, London, where he graduated in chemistry and then proceeded to do a PhD in crystallography. After a period as an ICI Fellow, he joined the Biophysics Department at King's College, which ignited his interest in nucleic acid structural studies. He was appointed as one of the first Cancer Research Campaign Career Development Awardees, becoming a Life Fellow on moving to the Institute of Cancer Research. He was appointed to the Chair of Biophysics at the Institute of Cancer Research in 1990, and moved to the new Chair of Chemical Biology at the School of Pharmacy in the University of London in 2002, where he also directs the Cancer Research UK Biomolecular Structure Group. He is currently Chairman of the Chemical Biology Forum of the Royal Society of Chemistry, which is involved in developing the interface between chemistry and the life sciences. He will shortly assume the Directorship of the newly-established Centre for Cancer Medicines at the School. Stephen Neidle has received several awards for his work on drug-nucleic acid recognition and drug design, including the 2000 prize of the Biological and Medicinal Chemistry Sector of the Royal Society of Chemistry, and its 2002 Interdisciplinary Award. He was the 2004 Paul Ehrlich Lecturer of the French Societé de Chimie Therapeutique, and was recently awarded the 2004 Aventis Prize in Medicinal Chemistry.

  3. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Yodh, J.G.; Balci, H.


    Roč. 42, č. 18 (2014), 11528–11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation(US) 1430124 Institutional support: RVO:68378050 Keywords : Bloom helicase * ATP * Gquadruplex (GQ) structure * GQ destabilization Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  4. Novel molecular targets for kRAS downregulation: promoter G-quadruplexes (United States)


    proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with

  5. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor


    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  6. Bloom’s syndrome protein unfolding G-quadruplexes in two pathways (United States)

    Zhao, Zhen-Ye; Xu, Chun-Hua; Shi, Jing; Li, Jing-Hua; Ma, Jian-Bing; Jia, Qi; Ma, Dong-Fei; Li, Ming; Lu, Ying


    Not Available Project supported by the National Natural Science Foundation of China (Grant Nos. 11674382, 11574381, and 11574382) and the Key Research Program of Frontier Sciences, Chinese Academy of Sciences (Grant No. QYZDJ-SSW-SYS014).

  7. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir


    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  8. Highly sensitive and selective detection of Pb2+ using a turn-on fluorescent aptamer DNA silver nanoclusters sensor. (United States)

    Zhang, Baozhu; Wei, Chunying


    A novel turn-on fluorescent biosensor has been constructed using C-PS2.M-DNA-templated silver nanoclusters (Ag NCs) with an average diameter of about 1 nm. The proposed approach presents a low-toxic, simple, sensitive, and selective detection for Pb 2+ . The fluorescence intensity of C-PS2.M-DNA-Ag NCs enhances significantly in the presence of Pb 2+ , which is attributed to the special interaction between Pb 2+ and its aptamer DNA PS2.M. Pb 2+ induces the aptamer to form G-quadruplex and makes two darkish DNA/Ag NCs located at the 3' and 5' terminus close, resulting in the fluorescence light-up. Moreover, Pb 2+ can be detected as low as 3.0 nM within a good linear range from 5 to 50 nM (R = 0.9862). Furthermore, the application for detection of Pb 2+ in real water samples further demonstrates the reliability of the sensor. Thus, this sensor system shows a potential application for monitoring Pb 2+ in environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents

    Czech Academy of Sciences Publication Activity Database

    Belmonte-Reche, E.; Martínez-García, M.; Guédin, A.; Zuffo, M.; Arevalo-Ruiz, M.; Doria, F.; Campos-Salinas, J.; Maynadier, M.; Lopez-Rubio, J.J.; Freccero, M.; Mergny, Jean-Louis; Maria Perez-Victoria, J.; Carlos Morales, J.


    Roč. 61, č. 3 (2018), s. 1231-1240 ISSN 0022-2623 R&D Projects: GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : terminal repeat promoter * plasmodium-falciparum Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 6.259, year: 2016

  10. Circular Dichroism of G-Quadruplex: A Laboratory Experiment for the Study of Topology and Ligand Binding (United States)

    Carvalho, Josue´; Queiroz, João A.; Cruz, Carla


    Circular dichroism (CD) has emerged as one of the standard biophysical techniques for the study of guaninequadruplex (G4) folding, cation effect, and ligand binding. The utility of this technique is based on its robustness, ease of use, and requirement of only small quantities of nucleic acid. This experiment is also extendable to the classroom…

  11. Regulation of gene expression by the BLM helicase correlates with the presence of G-quadruplex DNA motifs

    DEFF Research Database (Denmark)

    Nguyen, Giang Huong; Tang, Weiliang; Robles, Ana I


    Bloom syndrome is a rare autosomal recessive disorder characterized by genetic instability and cancer predisposition, and caused by mutations in the gene encoding the Bloom syndrome, RecQ helicase-like (BLM) protein. To determine whether altered gene expression might be responsible for pathologic...

  12. Disintegration of cruciform and G-quadruplex structures during the course of helicase-dependent amplification (HDA). (United States)

    Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu


    Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression. (United States)

    Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S


    The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

  14. Aptamer-based turn-on fluorescent four-branched quaternary ammonium pyrazine probe for selective thrombin detection. (United States)

    Yan, Shengyong; Huang, Rong; Zhou, Yangyang; Zhang, Ming; Deng, Minggang; Wang, Xiaolin; Weng, Xiaocheng; Zhou, Xiang


    In this thrombin detection system, the bright fluorescence of TASPI is almost eliminated by the DNA aptamer TBA (turn-off); however, in the presence of thrombin, it specifically binds to TBA by folding unrestricted TBA into an anti-parallel G-quadruplex structure and then releasing TASPI molecules, resulting in vivid and facile fluorescence recovery (turn-on).

  15. Toehold-mediated strand displacement reaction triggered isothermal DNA amplification for highly sensitive and selective fluorescent detection of single-base mutation. (United States)

    Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei


    Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif. (United States)

    Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen


    A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

  17. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes. (United States)

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří


    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  18. Coarse-Grained Simulations Complemented by Atomistic Molecular Dynamics Provide New Insights into Folding and Unfolding of Human Telomeric G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Mazzanti, L.; Cragnolini, T.; Wales, D.J.; Derreumaux, P.; Pasquali, C.; Sponer, Jiri


    Roč. 12, č. 12 (2016), s. 6077-6097 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : particle mesh ewald * amber force-field * free-energy profiles * binding dna aptamer Subject RIV: BO - Biophysics Impact factor: 5.245, year: 2016

  19. On the interaction between [Ru(NH3)(6)](3+) and the G-quadruplex forming thrombin binding aptamer sequence

    Czech Academy of Sciences Publication Activity Database

    De Rache, A.; Doneux, T.; Kejnovská, Iva; Buess-Herman, C.


    Roč. 126, SEP 2013 (2013), s. 84-90 ISSN 0162-0134 Institutional support: RVO:68081707 Keywords : SELF-ASSEMBLED MONOLAYERS * DNA-MODIFIED SURFACES * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 3.274, year: 2013

  20. G quadruplex-based FRET probes with the thrombin-binding aptamer (TBA) sequence designed for the efficient fluorometric detection of the potassium ion. (United States)

    Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori


    The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.

  1. Synthesis and Characterization of thermo/pH-responsive Supramolecular G-Quadruplexes for the Construction of Supramolecular Hacky Sacks for Biorelevant Applications (United States)

    Negron Rios, Luis M.

    The impact of size, shape, and distribution of lipophilic regions on the surfaces of nanoscopic objects that are amphiphilic or patchy (such as proteins) are yet to be fully understood. One of the reasons for this is the lack of an appropriate model systems in which to probe this question. Our group has previously reported 2'-deoxyguanosine (8ArG) derivatives that self-assemble in aqueous media into discrete supramolecular hexadecamers that show the lower critical solution temperature (LCST) phenomenon. The LCST phenomenon is a convenient and rigorous strategy to measure the hydrophobicity of a system. Although these SGQs are potentially attractive for biomedical applications like drug-delivery, the narrow window of physiological temperatures complicates their implementation. This moved us to redesign the constituent 8ArG subunits to incorporate imidazole moieties that would lead to pH-responsive SGQs, working isothermally. Upon reaching a threshold temperature (Lower Critical Solution Temperature, LCST) at pH 7, these dual-responsive SGQs further self-assemble to form nano/micro hydrogel globules that we called them supramolecular hacky sacks (SHS). However, we can isolate kinetically stable versions of these SHS by lowering the ionic strength of the medium (i.e., from the molar to the millimolar range) in a process that we term "fixing the SHS", in which these SHS maintain their integrity (size and shape) and stability without the requirement of crosslinking agents. After structural characterization and in vitro studies of SHS, we performed encapsulation studies of DOX, rhodamine, dsDNA (F26T), thrombin binding aptamer (TBA) and dextran (3 kDa) Texas Red conjugate. Then we performed in vivo studies of cell internalization and drug delivery with neuroblastoma SY-SH5Y. The performed studies will bring new approaches for the development of new biotechnology for fundamental applications and the emerging of novel therapeutic agents for biomedical applications.

  2. Structural revisions of small molecules reported to cross-link G-quadruplex DNA in vivo reveal a repetitive assignment error in the literature

    Czech Academy of Sciences Publication Activity Database

    Reyes Gutierrez, Paul Eduardo; Kapal, Tomáš; Klepetářová, Blanka; Šaman, David; Pohl, Radek; Zawada, Zbigniew; Kužmová, Erika; Hájek, Miroslav; Teplý, Filip


    Roč. 6, Mar 23 (2016), č. článku 23499. ISSN 2045-2322 R&D Projects: GA ČR GA13-19213S; GA MŠk LO1302 Grant - others:AV ČR(CZ) M200551208 Institutional support: RVO:61388963 Keywords : 1,2-disubstituted benzimidazoles * chemical synthesis * promoter region Subject RIV: CC - Organic Chemistry Impact factor: 4.259, year: 2016

  3. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří


    Roč. 12, č. 4 (2016), s. 2000-2016 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : molecular-dynamics simulations * quantum-chemical computations * continuum solvation models Subject RIV: BO - Biophysics Impact factor: 5.245, year: 2016

  4. Electrochemical and circular dichroism spectroscopic evidence of two types of interaction between [Ru(NH3)(6)](3+) and an elongated thrombin binding aptamer G-quadruplex

    Czech Academy of Sciences Publication Activity Database

    De Rache, A.; Kejnovská, Iva; Buess-Herman, C.; Doneux, T.


    Roč. 179, OCT 2015 (2015), s. 84-92 ISSN 0013-4686 Institutional support: RVO:68081707 Keywords : Biosensors * Thrombin binding aptamer * Hexaammineruthenium Subject RIV: BO - Biophysics Impact factor: 4.803, year: 2015

  5. [Selective mutism]. (United States)

    Ytzhak, A; Doron, Y; Lahat, E; Livne, A


    Selective mutism is an uncommon disorder in young children, in which they selectively don't speak in certain social situations, while being capable of speaking easily in other social situations. Many etiologies were proposed for selective mutism including psychodynamic, behavioral and familial etc. A developmental etiology that includes insights from all the above is gaining support. Accordingly, mild language impairment in a child with an anxiety trait may be at the root of developing selective mutism. The behavior will be reinforced by an avoidant pattern in the family. Early treatment and followup for children with selective mutism is important. The treatment includes non-pharmacological therapy (psychodynamic, behavioral and familial) and pharmacologic therapy--mainly selective serotonin reuptake inhibitors (SSRI).

  6. Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav


    A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

  7. The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.


    Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

  8. Site selection

    CERN Multimedia

    CERN PhotoLab


    To help resolve the problem of site selection for the proposed 300 GeV machine, the Council selected "three wise men" (left to right, J H Bannier of the Netherlands, A Chavanne of Switzerland and L K Boggild of Denmark).

  9. Benchmark selection

    DEFF Research Database (Denmark)

    Hougaard, Jens Leth; Tvede, Mich


    Within a production theoretic framework, this paper considers an axiomatic approach to benchmark selection. It is shown that two simple and weak axioms; efficiency and comprehensive monotonicity characterize a natural family of benchmarks which typically becomes unique. Further axioms are added...... in order to obtain a unique selection...

  10. Selective mutism. (United States)

    Hua, Alexandra; Major, Nili


    Selective mutism is a disorder in which an individual fails to speak in certain social situations though speaks normally in other settings. Most commonly, this disorder initially manifests when children fail to speak in school. Selective mutism results in significant social and academic impairment in those affected by it. This review will summarize the current understanding of selective mutism with regard to diagnosis, epidemiology, cause, prognosis, and treatment. Studies over the past 20 years have consistently demonstrated a strong relationship between selective mutism and anxiety, most notably social phobia. These findings have led to the recent reclassification of selective mutism as an anxiety disorder in the Diagnostic and Statistical Manual of Mental Disorders, 5th Edition. In addition to anxiety, several other factors have been implicated in the development of selective mutism, including communication delays and immigration/bilingualism, adding to the complexity of the disorder. In the past few years, several randomized studies have supported the efficacy of psychosocial interventions based on a graduated exposure to situations requiring verbal communication. Less data are available regarding the use of pharmacologic treatment, though there are some studies that suggest a potential benefit. Selective mutism is a disorder that typically emerges in early childhood and is currently conceptualized as an anxiety disorder. The development of selective mutism appears to result from the interplay of a variety of genetic, temperamental, environmental, and developmental factors. Although little has been published about selective mutism in the general pediatric literature, pediatric clinicians are in a position to play an important role in the early diagnosis and treatment of this debilitating condition.

  11. Selective oxidation

    International Nuclear Information System (INIS)

    Cortes Henao, Luis F.; Castro F, Carlos A.


    It is presented a revision and discussion about the characteristics and factors that relate activity and selectivity in the catalytic and not catalytic partial oxidation of methane and the effect of variables as the temperature, pressure and others in the methane conversion to methanol. It thinks about the zeolites use modified for the catalytic oxidation of natural gas

  12. Selective gossip

    NARCIS (Netherlands)

    Üstebay, D.; Castro, R.M.; Rabbat, M.


    Motivated by applications in compression and distributed transform coding, we propose a new gossip algorithm called Selective Gossip to efficiently compute sparse approximations of network data. We consider running parallel gossip algorithms on the elements of a vector of transform coefficients.

  13. Ricardian selection


    Finicelli, Andrea; Pagano, Patrizio; Sbracia, Massimo


    We analyze the foundations of the relationship between trade and total factor productivity (TFP) in the Ricardian model. Under general assumptions about the autarky distributions of industry productivities, trade openness raises TFP. This is due to the selection effect of international competition � driven by comparative advantages � which makes "some" high- and "many" low-productivity industries exit the market. We derive a model-based measure of this effect that requires only production...

  14. Selective Europeanization

    DEFF Research Database (Denmark)

    Hoch Jovanovic, Tamara; Lynggaard, Kennet


    and rules. The article examines the reasons for both resistance and selectiveness to Europeanization of the Danish minority policy through a “path dependency” perspective accentuating decision makers’ reluctance to deviate from existing institutional commitments, even in subsequently significantly altered...... political contexts at the European level. We further show how the “translation” of international norms to a domestic context has worked to reinforce the original institutional setup, dating back to the mid-1950s. The translation of European-level minority policy developed in the 1990s and 2000s works most...

  15. Selective Reproduction

    DEFF Research Database (Denmark)

    Svendsen, Mette N.


    This article employs a multi-species perspective in investigating how life's worth is negotiated in the field of neonatology in Denmark. It does so by comparing decision-making processes about human infants in the Danish neonatal intensive care unit with those associated with piglets who serve as...... as expectations within linear or predictive time frames are key markers in both sites. Exploring selective reproductive processes across human infants and research piglets can help us uncover aspects of the cultural production of viability that we would not otherwise see or acknowledge....

  16. EDITORIAL: Nanotechnological selection Nanotechnological selection (United States)

    Demming, Anna


    At the nanoscale measures can move from a mass-scale analogue calibration to counters of discrete units. The shift redefines the possible levels of control that can be achieved in a system if adequate selectivity can be imposed. As an example as ionic substances pass through nanoscale pores, the quantity of ions is low enough that the pore can contain either negative or positive ions. Yet precise control over this selectivity still raises difficulties. In this issue researchers address the challenge of how to regulate the ionic selectivity of negative and positive charges with the use of an external charge. The approach may be useful for controlling the behaviour, properties and chemical composition of liquids and has possible technical applications for nanofluidic field effect transistors [1]. Selectivity is a critical advantage in the administration of drugs. Nanoparticles functionalized with targeting moieties can allow delivery of anti-cancer drugs to tumour cells, whilst avoiding healthy cells and hence reducing some of the debilitating side effects of cancer treatments [2]. Researchers in Belarus and the US developed a new theranostic approach—combining therapy and diagnosis—to support the evident benefits of cellular selectivity that can be achieved when nanoparticles are applied in medicine [3]. Their process uses nanobubbles of photothermal vapour, referred to as plasmonic nanobubbles, generated by plasmonic excitations in gold nanoparticles conjugated to diagnosis-specific antibodies. The intracellular plasmonic nanobubbles are controlled by laser fluence so that the response can be tuned in individual living cells. Lower fluence allows non-invasive high-sensitive imaging for diagnosis and higher fluence can disrupt the cellular membrane for treatments. The selective response of carbon nanotubes to different gases has leant them to be used within various different types of sensors, as summarized in a review by researchers at the University of

  17. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target. (United States)

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N


    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  18. Cascaded strand displacement for non-enzymatic target recycling amplification and label-free electronic detection of microRNA from tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Kai; Dou, Baoting; Yang, Jianmei; Yuan, Ruo; Xiang, Yun, E-mail:


    The monitoring of microRNA (miRNA) expression levels is of great importance in cancer diagnosis. In the present work, based on two cascaded toehold-mediated strand displacement reactions (TSDRs), we have developed a label- and enzyme-free target recycling signal amplification approach for sensitive electronic detection of miRNA-21 from human breast cancer cells. The junction probes containing the locked G-quadruplex forming sequences are self-assembled on the senor surface. The presence of the target miRNA-21 initiates the first TSDR and results in the disassembly of the junction probes and the release of the active G-quadruplex forming sequences. Subsequently, the DNA fuel strand triggers the second TSDR and leads to cyclic reuse of the target miRNA-21. The cascaded TSDRs thus generate many active G-quadruplex forming sequences on the sensor surface, which associate with hemin to produce significantly amplified current response for sensitive detection of miRNA-21 at 1.15 fM. The sensor is also selective and can be employed to monitor miRNA-21 from human breast cancer cells. - Highlights: • Amplified and sensitive detection of microRNA from tumor cells is achieved. • Signal amplification is realized by two cascaded strand displacement reactions. • The developed sensor is selective and label-free without involving any enzymes.

  19. Selected writings

    CERN Document Server

    Galilei, Galileo


    'Philosophy is written in this great book which is continually open before our eyes - I mean the universe...' Galileo's astronomical discoveries changed the way we look at the world, and our place in the universe. Threatened by the Inquisition for daring to contradict the literal truth of the Bible, Galileo ignited a scientific revolution when he asserted that the Earth moves. This generous selection from his writings contains all the essential texts for a reader to appreciate his lasting significance. Mark Davie's new translation renders Galileo's vigorous Italian prose into clear modern English, while William R. Shea's version of the Latin Sidereal Message makes accessible the book that created a sensation in 1610 with its account of Galileo's observations using the newly invented telescope. All Galileo's contributions to the debate on science and religion are included, as well as key documents from his trial before the Inquisition in 1633. A lively introduction and clear notes give an overview of Galileo's...

  20. Site selection

    International Nuclear Information System (INIS)

    Olsen, C.W.


    The conditions and criteria for selecting a site for a nuclear weapons test at the Nevada Test Site are summarized. Factors considered are: (1) scheduling of drill rigs, (2) scheduling of site preparation (dirt work, auger hole, surface casing, cementing), (3) schedule of event (when are drill hole data needed), (4) depth range of proposed W.P., (5) geologic structure (faults, Pz contact, etc.), (6) stratigraphy (alluvium, location of Grouse Canyon Tuff, etc.), (7) material properties (particularly montmorillonite and CO 2 content), (8) water table depth, (9) potential drilling problems (caving), (10) adjacent collapse craters and chimneys, (11) adjacent expended but uncollapsed sites, (12) adjacent post-shot or other small diameter holes, (13) adjacent stockpile emplacement holes, (14) adjacent planned events (including LANL), (15) projected needs of Test Program for various DOB's and operational separations, and (16) optimal use of NTS real estate

  1. Selected papers

    CERN Document Server

    Elgot, Calvin C


    Cal Elgot was a very serious and thoughtful researcher, who with great determi­ nation attempted to find basic explanations for certain mathematical phenomena­ as the selection of papers in this volume well illustrate. His approach was, for the most part, rather finitist and constructivist, and he was inevitably drawn to studies of the process of computation. It seems to me that his early work on decision problems relating automata and logic, starting with his thesis under Roger Lyndon and continuing with joint work with Biichi, Wright, Copi, Rutledge, Mezei, and then later with Rabin, set the stage for his attack on the theory of computation through the abstract treatment of the notion of a machine. This is also apparent in his joint work with A. Robinson reproduced here and in his joint papers with John Shepherdson. Of course in the light of subsequent work on decision problems by Biichi, Rabin, Shelah, and many, many others, the subject has been placed on a completely different plane from what it was whe...

  2. Target recycling amplification for label-free and sensitive colorimetric detection of adenosine triphosphate based on un-modified aptamers and DNAzymes. (United States)

    Gong, Xue; Li, Jinfu; Zhou, Wenjiao; Xiang, Yun; Yuan, Ruo; Chai, Yaqin


    Based on target recycling amplification, the development of a new label-free, simple and sensitive colorimetric detection method for ATP by using un-modified aptamers and DNAzymes is described. The association of the model target molecules (ATP) with the corresponding aptamers of the dsDNA probes leads to the release of the G-quadruplex sequences. The ATP-bound aptamers can be further degraded by Exonuclease III to release ATP, which can again bind the aptamers of the dsDNA probes to initiate the target recycling amplification process. Due to this target recycling amplification, the amount of the released G-quadruplex sequences is significantly enhanced. Subsequently, these G-quadruplex sequences bind hemin to form numerous peroxidase mimicking DNAzymes, which cause substantially intensified color change of the probe solution for highly sensitive colorimetric detection of ATP down to the sub-nanomolar (0.33nM) level. Our method is highly selective toward ATP against other control molecules and can be performed in one single homogeneous solution, which makes our sensing approach hold great potential for sensitive colorimetric detection of other small molecules and proteins. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Social Selection and Religiously Selective Faith Schools (United States)

    Pettinger, Paul


    This article reviews recent research looking at the socio-economic profile of pupils at faith schools and the contribution religiously selective admission arrangements make. It finds that selection by faith leads to greater social segregation and is open to manipulation. It urges that such selection should end, making the state-funded school…

  4. Management Matters. Selection Policies (United States)

    Pappas, Marjorie L.


    One of the most important policy documents for a school library media center is the selection policy or the collection development policy. A well-developed selection policy provides a rationale for the selection decisions made by the school library media specialist. A selection policy represents the criteria against which a challenged book is…

  5. Officer Selection (la Selection des officiers)

    National Research Council Canada - National Science Library


    .... The theme of this workshop, officer selection, is an issue of central importance to the military forces of all countries, since it determines which individuals, with what characteristics, will...

  6. Economic Selection Theory

    DEFF Research Database (Denmark)

    Knudsen, Thorbjørn


    principles of variation, continuity and selection, it is argued that economic selection theory should mimic the causal structure of neo-Darwinian theory. Two of the most influential explanations of economic evolution, Alchian's and Nelson and Winter's, are used to illustrate how this could be achieved.......The present article provides a minimal description of the causal structure of economic selection theory and outlines how the internal selection dynamics of business organisations can be reconciled with selection in competitive markets. In addition to generic similarity in terms of the Darwinian...

  7. Selective Reproductive Technologies

    DEFF Research Database (Denmark)

    Gammeltoft, Tine; Wahlberg, Ayo


    From a historical perspective, selective reproduction is nothing new. Infanticide, abandonment, and selective neglect of children have a long history, and the widespread deployment of sterilization and forced abortion in the twentieth century has been well documented. Yet in recent decades select......, discussing how selective reproduction engages with issues of long-standing theoretical concern in anthropology, such as politics, kinship, gender, religion, globalization, and inequality....... (ARTs), what we term selective reproductive technologies (SRTs) are of a more specific nature: Rather than aiming to overcome infertility, they are used to prevent or allow the birth of certain kinds of children. This review highlights anthropological research into SRTs in different parts of the world...

  8. IT Project Selection

    DEFF Research Database (Denmark)

    Pedersen, Keld


    for initiation. Most of the research on project selection is normative, suggesting new methods, but available empirical studies indicate that many methods are seldom used in practice. This paper addresses the issue by providing increased understanding of IT project selection practice, thereby facilitating...... the development of methods that better fit current practice. The study is based on naturalistic decision-making theory and interviews with experienced project portfolio managers who, when selecting projects, primarily rely on political skills, experience and personal networks rather than on formal IT project......-selection methods, and these findings point to new areas for developing new methodological support for IT project selection....

  9. Restaurant Selection in Dublin


    Cullen, Frank


    The primary objective of this research was to investigate the selection process used by consumers when choosing a restaurant to dine. This study examined literature on consumer behaviour, restaurant selection, and decision-making, underpinning the contention that service quality is linked to the consumer’s selection of a restaurant. It supports the utility theories that consumers buy bundles of attributes that simultaneously combined represent a certain level of service quality at a certain p...

  10. Compressors selection and sizing

    CERN Document Server

    Brown, Royce N


    This practical reference provides in-depth information required to understand and properly estimate compressor capabilities and to select the proper designs. Engineers and students will gain a thorough understanding of compression principles, equipment, applications, selection, sizing, installation, and maintenance. The many examples clearly illustrate key aspects to help readers understand the ""real world"" of compressor technology.Compressors: Selection and Sizing, third edition is completely updated with new API standards. Additions requested by readers include a new section on di

  11. Delivery, Effect on Cell Viability, and Plasticity of Modified Aptamer Constructs

    DEFF Research Database (Denmark)

    Gissberg, Olof; Zaghloul, Eman M; Lundin, Karin E


    AS1411 is a g-quadruplex-forming aptamer capable of selectively entering cancer cells by nucleolin receptor-mediated uptake. In this study, we investigated the cell internalization properties and plasticity of AS1411 carrying different locked nucleic acid-containing cargo oligonucleotides (ONs......) for delivery into A549 and U2OS cells. We found that internalization efficiency is highly governed by ON cargo chemistry and composition since the inherent antitumor properties of AS1411 were lost when attached to a nontoxic ON, noTox. However, a toxic ON, Tox, demonstrated potent cytotoxicity after aptamer...

  12. Cryogenic Selective Surfaces (United States)

    National Aeronautics and Space Administration — Selective surfaces have wavelength dependent emissivity/absorption. These surfaces can be designed to reflect solar radiation, while maximizing infrared emittance,...

  13. Recruiter Selection Model

    National Research Council Canada - National Science Library

    Halstead, John B


    .... The research uses a combination of statistical learning, feature selection methods, and multivariate statistics to determine the better prediction function approximation with features obtained...

  14. Asbestos: selected cancers

    National Research Council Canada - National Science Library

    Institute of Medicine; Board on Population Health and Public Health Practice; Institute of Medicine; National Academy of Sciences


    ...: Selected Health Effects. This committee was charged with addressing whether asbestos exposure is causally related to adverse health consequences in addition to asbestosis, mesothelioma, and lung cancer. Asbestos...

  15. Women: A Select Bibliography. (United States)

    Kusnerz, Peggy A., Comp.; Pollack, Ann M., Comp.

    This select bibliography lists books, monographs, journals and newsletters which relate to feminism, women's studies, and other perspectives on women. Selections are organized by topic: general, bibliographies, art and literature, biography/autobiography, economics, education, family and marriage, history, politics and sex roles. Also included is…

  16. Sexual selection in Fungi

    NARCIS (Netherlands)

    Nieuwenhuis, B.P.S.


    Sexual selection is an important factor that drives evolution, in which fitness is increased, not by increasing survival or viability, but by acquiring more or better mates. Sexual selection favours traits that increase the ability of an individual to obtain more matings than other individuals

  17. Selection and training

    NARCIS (Netherlands)

    Sgobba, T.; Landon, L.B.; Marciacq, J.B.; Groen, E.L.; Tikhonov, N.; Torchia, F.


    Selection and training represent two means of ensuring flight crew members are qualified and prepared to perform safely and effectively in space. The first part of the chapter looks at astronaut selection beginning with the evolutionary changes in the US and Russian programs. A discussion of the

  18. Kin Selection - Mutation Balance

    DEFF Research Database (Denmark)

    Dyken, J. David Van; Linksvayer, Timothy Arnold; Wade, Michael J.


    selection-mutation balance, which provides an evolutionary null hypothesis for the statics and dynamics of cheating. When social interactions have linear fitness effects and Hamilton´s rule is satisfied, selection is never strong enough to eliminate recurrent cheater mutants from a population, but cheater...

  19. A Selective CPS Transformation

    DEFF Research Database (Denmark)

    Nielsen, Lasse Riechstein


    characterize this involvement as a control effect and we present a selective CPS transformation that makes functions and expressions continuation-passing if they have a control effect, and that leaves the rest of the program in direct style. We formalize this selective CPS transformation with an operational...

  20. Green Supplier Selection Criteria

    DEFF Research Database (Denmark)

    Nielsen, Izabela Ewa; Banaeian, Narges; Golinska, Paulina


    Green supplier selection (GSS) criteria arise from an organization inclination to respond to any existing trends in environmental issues related to business management and processes, so GSS is integrating environmental thinking into conventional supplier selection. This research is designed...... to determine prevalent general and environmental supplier selection criteria and develop a framework which can help decision makers to determine and prioritize suitable green supplier selection criteria (general and environmental). In this research we considered several parameters (evaluation objectives......) to establish suitable criteria for GSS such as their production type, requirements, policy and objectives instead of applying common criteria. At first a comprehensive and deep review on prevalent and green supplier selection literatures performed. Then several evaluation objectives defined to assess the green...

  1. Phenotypic selection in natural populations: what limits directional selection? (United States)

    Kingsolver, Joel G; Diamond, Sarah E


    Studies of phenotypic selection document directional selection in many natural populations. What factors reduce total directional selection and the cumulative evolutionary responses to selection? We combine two data sets for phenotypic selection, representing more than 4,600 distinct estimates of selection from 143 studies, to evaluate the potential roles of fitness trade-offs, indirect (correlated) selection, temporally varying selection, and stabilizing selection for reducing net directional selection and cumulative responses to selection. We detected little evidence that trade-offs among different fitness components reduced total directional selection in most study systems. Comparisons of selection gradients and selection differentials suggest that correlated selection frequently reduced total selection on size but not on other types of traits. The direction of selection on a trait often changes over time in many temporally replicated studies, but these fluctuations have limited impact in reducing cumulative directional selection in most study systems. Analyses of quadratic selection gradients indicated stabilizing selection on body size in at least some studies but provided little evidence that stabilizing selection is more common than disruptive selection for most traits or study systems. Our analyses provide little evidence that fitness trade-offs, correlated selection, or stabilizing selection strongly constrains the directional selection reported for most quantitative traits.

  2. Simulation of selected genealogies. (United States)

    Slade, P F


    Algorithms for generating genealogies with selection conditional on the sample configuration of n genes in one-locus, two-allele haploid and diploid models are presented. Enhanced integro-recursions using the ancestral selection graph, introduced by S. M. Krone and C. Neuhauser (1997, Theor. Popul. Biol. 51, 210-237), which is the non-neutral analogue of the coalescent, enables accessible simulation of the embedded genealogy. A Monte Carlo simulation scheme based on that of R. C. Griffiths and S. Tavaré (1996, Math. Comput. Modelling 23, 141-158), is adopted to consider the estimation of ancestral times under selection. Simulations show that selection alters the expected depth of the conditional ancestral trees, depending on a mutation-selection balance. As a consequence, branch lengths are shown to be an ineffective criterion for detecting the presence of selection. Several examples are given which quantify the effects of selection on the conditional expected time to the most recent common ancestor. Copyright 2000 Academic Press.

  3. Range Selection and Median

    DEFF Research Database (Denmark)

    Jørgensen, Allan Grønlund; Larsen, Kasper Green


    and several natural special cases thereof. The rst special case is known as range median, which arises when k is xed to b(j 􀀀 i + 1)=2c. The second case, denoted prex selection, arises when i is xed to 0. Finally, we also consider the bounded rank prex selection problem and the xed rank range......Range selection is the problem of preprocessing an input array A of n unique integers, such that given a query (i; j; k), one can report the k'th smallest integer in the subarray A[i];A[i+1]; : : : ;A[j]. In this paper we consider static data structures in the word-RAM for range selection...... selection problem. In the former, data structures must support prex selection queries under the assumption that k for some value n given at construction time, while in the latter, data structures must support range selection queries where k is xed beforehand for all queries. We prove cell probe lower bounds...

  4. Label-free colorimetric detection of Hg²⁺ based on Hg²⁺-triggered exonuclease III-assisted target recycling and DNAzyme amplification. (United States)

    Ren, Wang; Zhang, Ying; Huang, Wei Tao; Li, Nian Bing; Luo, Hong Qun


    This work reported a label-free colorimetric assay for sensitive detection of Hg(2+) based on Hg(2+)-triggered hairpin DNA probe (H-DNA) termini-binding and exonuclease Ш (Exo Ш)-assisted target recycling, as well as hemin/G-quadruplex (DNAzyme) signal amplification. The specific binding of free Hg(2+) with the thymine-thymine (T-T) mismatches termini of H-DNA could immediately trigger the Exo Ш digestion, and then set free G-quadruplex segments and Hg(2+). The Exo Ш impellent recycling of ultratrace Hg(2+) produced numerous G-quadruplexes. The corresponding DNAzymes catalyzed efficiently the H2O2-mediated oxidation of the ABTS(2-) to the colored product in the presence of hemin. Using the color change as the output signal, and the Exo Ш-aided Hg(2+) recycling and DNAzyme as the signal amplifier, the ultrasensitive assay system successfully achieved visual detection of Hg(2+) as low as 1.0 nM by the naked eye, and was suitable for field monitoring. The calibration curve was linear in the range of 50.0 pM to 20.0 nM for Hg(2+) (R=0.9962) with a detection limit of 10.0 pM. Moreover, this proposed strategy showed excellent selectivity, portability and low-cost, and was successfully applied to colorimetric detection of Hg(2+) in laboratory tap water and Jialing river water samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Universal, colorimetric microRNA detection strategy based on target-catalyzed toehold-mediated strand displacement reaction (United States)

    Park, Yeonkyung; Lee, Chang Yeol; Kang, Shinyoung; Kim, Hansol; Park, Ki Soo; Park, Hyun Gyu


    In this work, we developed a novel, label-free, and enzyme-free strategy for the colorimetric detection of microRNA (miRNA), which relies on a target-catalyzed toehold-mediated strand displacement (TMSD) reaction. The system employs a detection probe that specifically binds to the target miRNA and sequentially releases a catalyst strand (CS) intended to trigger the subsequent TMSD reaction. Thus, the presence of target miRNA releases the CS that mediates the formation of an active G-quadruplex DNAzyme which is initially caged and inactivated by a blocker strand. In addition, a fuel strand that is supplemented for the recycling of the CS promotes another TMSD reaction, consequently generating a large number of active G-quadruplex DNAzymes. As a result, a distinct colorimetric signal is produced by the ABTS oxidation promoted by the peroxidase mimicking activity of the released G-quadruplex DNAzymes. Based on this novel strategy, we successfully detected miR-141, a promising biomarker for human prostate cancer, with high selectivity. The diagnostic capability of this system was also demonstrated by reliably determining target miR-141 in human serum, showing its great potential towards real clinical applications. Importantly, the proposed approach is composed of separate target recognition and signal transduction modules. Thus, it could be extended to analyze different target miRNAs by simply redesigning the detection probe while keeping the same signal transduction module as a universal signal amplification unit, which was successfully demonstrated by analyzing another target miRNA, let-7d.

  6. A Label-Free and Sensitive Fluorescent Qualitative Assay for Bisphenol A Based on Rolling Circle Amplification/Exonuclease III-Combined Cascade Amplification. (United States)

    Li, Xia; Song, Juan; Xue, Qing-Wang; You, Fu-Heng; Lu, Xia; Kong, Yan-Cong; Ma, Shu-Yi; Jiang, Wei; Li, Chen-Zhong


    Bisphenol A (BPA) detection in drinking water and food packaging materials has attracted much attention since the discovery that BPA can interfere with normal physiological processes and cause adverse health effects. Here, we constructed a label-free aptamer fluorescent assay for selective and sensitive detection of BPA based on the rolling circle amplification (RCA)/Exonuclease III (Exo III)-combined cascade amplification strategy. First, the duplex DNA probe (RP) with anti-BPA aptamer and trigger sequence was designed for BPA recognition and signal amplification. Next, under the action of BPA, the trigger probe was liberated from RP to initiate RCA reaction as primary amplification. Subsequently, the RCA products were used to trigger Exo III assisted secondary amplification with the help of hairpin probes, producing plenty of "G-quadruplex" in lantern-like structures. Finally, the continuously enriched "G-quadruplex lanterns" were lightened by zinc(II)-protoporphyrin IX (ZnPPIX) generating enhanced fluorescence signals. By integrating the primary RCA and secondary Exo III mediated cascade amplification strategy, this method displayed an excellent sensitivity with the detection limits of 5.4 × 10 -17 M. In addition, the anti-BPA aptamer exhibits high recognition ability with BPA, guaranteeing the specificity of detection. The reporter signal probe (G-quadruplex with ZnPPIX) provides a label-free fluorescence signals readout without complicated labeling procedures, making the method simple in design and cost-effective in operation. Moreover, environmental samples analysis was also performed, suggesting that our strategy was reliable and had a great potential application in environmental monitoring.

  7. Selection of Celebrity Endorsers

    DEFF Research Database (Denmark)

    Hollensen, Svend; Schimmelpfennig, Christian


    several candidates by means of subtle evaluation procedures. Design/methodology/approach – A case study research has been carried out among companies experienced in celebrity endorsements to learn more about the endorser selection process in practise. Based on these cases theory is inductively developed......Purpose - This research aims at shedding some light on the various avenues marketers can undertake until finally an endorsement contract is signed. The focus of the study lies on verifying the generally held assumption that endorser selection is usually taken care of by creative agencies, vetting....... Findings – Our research suggests that generally held assumption that endorsers being selected and thoroughly vetted by a creative agency may not be universally valid. A normative model to illustrate the continuum of the selection process in practise is suggested and the two polar case studies (Swiss brand...

  8. Feature Selection by Reordering

    Czech Academy of Sciences Publication Activity Database

    Jiřina, Marcel; Jiřina jr., M.


    Roč. 2, č. 1 (2005), s. 155-161 ISSN 1738-6438 Institutional research plan: CEZ:AV0Z10300504 Keywords : feature selection * data reduction * ordering of features Subject RIV: BA - General Mathematics

  9. Selective information sampling

    Directory of Open Access Journals (Sweden)

    Peter A. F. Fraser-Mackenzie


    Full Text Available This study investigates the amount and valence of information selected during single item evaluation. One hundred and thirty-five participants evaluated a cell phone by reading hypothetical customers reports. Some participants were first asked to provide a preliminary rating based on a picture of the phone and some technical specifications. The participants who were given the customer reports only after they made a preliminary rating exhibited valence bias in their selection of customers reports. In contrast, the participants that did not make an initial rating sought subsequent information in a more balanced, albeit still selective, manner. The preliminary raters used the least amount of information in their final decision, resulting in faster decision times. The study appears to support the notion that selective exposure is utilized in order to develop cognitive coherence.


    Directory of Open Access Journals (Sweden)

    Piotr FOLĘGA


    Full Text Available The variety of types and sizes currently in production harmonic drive is a problem in their rational choice. Properly selected harmonic drive must meet certain requirements during operation, and achieve the anticipated service life. The paper discusses the problems associated with the selection of the harmonic drive. It also presents the algorithm correct choice of harmonic drive. The main objective of this study was to develop a computer program that allows the correct choice of harmonic drive by developed algorithm.

  11. Spectrally selective glazings

    Energy Technology Data Exchange (ETDEWEB)



    Spectrally selective glazing is window glass that permits some portions of the solar spectrum to enter a building while blocking others. This high-performance glazing admits as much daylight as possible while preventing transmission of as much solar heat as possible. By controlling solar heat gains in summer, preventing loss of interior heat in winter, and allowing occupants to reduce electric lighting use by making maximum use of daylight, spectrally selective glazing significantly reduces building energy consumption and peak demand. Because new spectrally selective glazings can have a virtually clear appearance, they admit more daylight and permit much brighter, more open views to the outside while still providing the solar control of the dark, reflective energy-efficient glass of the past. This Federal Technology Alert provides detailed information and procedures for Federal energy managers to consider spectrally selective glazings. The principle of spectrally selective glazings is explained. Benefits related to energy efficiency and other architectural criteria are delineated. Guidelines are provided for appropriate application of spectrally selective glazing, and step-by-step instructions are given for estimating energy savings. Case studies are also presented to illustrate actual costs and energy savings. Current manufacturers, technology users, and references for further reading are included for users who have questions not fully addressed here.

  12. Selection in artistic gymnastics

    Directory of Open Access Journals (Sweden)

    Maria Olaru


    Full Text Available This study envisages the analysis of the specific aspects of the selection process in artistic gymnastics, focusing particularly onthe selection of Romania’s recent years. In our opinion, the shift to a cone of darkness of the artistic gymnastics, an extremelypopular sport in our country 20 years ago, is also based on and the orientation of children to other fields – unfortunately manyof them outside sports and physical activities in general. In the present study, we shall present the stages of the artisticgymnastics, as its importance in the subsequent performances has been proven a long time ago. The plethora of qualities andskills which are necessary to select a child for gymnastics and those that this sport develops when performed as a spare timeactivity. The case studied in this endeavour is the one of the main centers for gymnast recruitment in Romania; the attentionpaid by the trainers to the selection for this sport makes the data regarding the number of children involved to increase oncemore. This is a satisfactory fact as it is a well-known fact that a wide range primary selection sets a serious basis for thesecondary selection, and the third, respectively, envisaging the future performance and concurrently ensures the involvementof more children in a physical activity that will prepare them, both physically and mentally for a healthy life.

  13. A twice-as-smart synthetic G-quartet: PyroTASQ is both a smart quadruplex ligand and a smart fluorescent probe. (United States)

    Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David


    Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.

  14. Nuclear site selection studies

    International Nuclear Information System (INIS)

    Gharib, A.; Zohoorian Izadpanah, A.A.; Iranmanesh, H.


    It is of special importance, especially from the nuclear safety viewpoint, to select suitable sites for different nuclear structures with the considered future activities. Site selection sometimes involves high costs not necessarily for merely selecting of site but for some preliminary measures to be taken so as the site may have the necessary characteristics. The more suitable the natural characteristics of the site for the considered project, the more successful and efficient the project, the lower the project costs and the longer the project operation period. If so, the project will cause the growth of public culture and sustainable socioeconomic development. This paper is the result of the conclusion of numerous massive reports of this activity in the preliminary phase based on theories, practices and the related safety principles on this ground as well as the application of data and information of the past and a glance to the future. The conception of need for a site for medium structures and nuclear research projects and how to perform this process are presented step by step here with a scientific approach to its selection during the investigations. In this study, it is practically described how the site is selected, by determining and defining the characteristics of research and nuclear projects with medium structures and also its fitting to the optimum site. The discovered sites typically involve the best advantages in technical and economic aspects and no particular contrast with the concerned structures

  15. The site selection process

    International Nuclear Information System (INIS)

    Kittel, J.H.


    One of the most arduous tasks associated with the management of radioactive wastes is the siting of new disposal facilities. Experience has shown that the performance of the disposal facility during and after disposal operations is critically dependent on the characteristics of the site itself. The site selection process consists of defining needs and objectives, identifying geographic regions of interest, screening and selecting candidate sites, collecting data on the candidate sites, and finally selecting the preferred site. Before the site selection procedures can be implemented, however, a formal legal system must be in place that defines broad objectives and, most importantly, clearly establishes responsibilities and accompanying authorities for the decision-making steps in the procedure. Site selection authorities should make every effort to develop trust and credibility with the public, local officials, and the news media. The responsibilities of supporting agencies must also be spelled out. Finally, a stable funding arrangement must be established so that activities such as data collection can proceed without interruption. Several examples, both international and within the US, are given

  16. High Selectivity Oxygen Delignification

    Energy Technology Data Exchange (ETDEWEB)

    Lucian A. Lucia


    Project Objective: The objectives of this project are as follows: (1) Examine the physical and chemical characteristics of a partner mill pre- and post-oxygen delignified pulp and compare them to lab generated oxygen delignified pulps; (2) Apply the chemical selectivity enhancement system to the partner pre-oxygen delignified pulps under mill conditions (with and without any predetermined amounts of carryover) to determine how efficiently viscosity is preserved, how well selectivity is enhanced, if strength is improved, measure any yield differences and/or bleachability differences; and (3) Initiate a mill scale oxygen delignification run using the selectivity enhancement agent, collect the mill data, analyze it, and propose any future plans for implementation.

  17. Selective-imaging camera (United States)

    Szu, Harold; Hsu, Charles; Landa, Joseph; Cha, Jae H.; Krapels, Keith A.


    How can we design cameras that image selectively in Full Electro-Magnetic (FEM) spectra? Without selective imaging, we cannot use, for example, ordinary tourist cameras to see through fire, smoke, or other obscurants contributing to creating a Visually Degraded Environment (VDE). This paper addresses a possible new design of selective-imaging cameras at firmware level. The design is consistent with physics of the irreversible thermodynamics of Boltzmann's molecular entropy. It enables imaging in appropriate FEM spectra for sensing through the VDE, and displaying in color spectra for Human Visual System (HVS). We sense within the spectra the largest entropy value of obscurants such as fire, smoke, etc. Then we apply a smart firmware implementation of Blind Sources Separation (BSS) to separate all entropy sources associated with specific Kelvin temperatures. Finally, we recompose the scene using specific RGB colors constrained by the HVS, by up/down shifting Planck spectra at each pixel and time.

  18. Antecedent Selection for Sluicing

    DEFF Research Database (Denmark)

    Anand, Pranav; Hardt, Daniel


    Sluicing is an elliptical process where the majority of a question can go unpronounced as long as there is a salient antecedent in previous discourse. This paper considers the task of antecedent selection: finding the correct antecedent for a given case of sluicing. We argue that both syntactic...... and discourse relationships are important in antecedent selection, and we construct linguistically sophisticated features that describe the relevant relationships. We also define features that describe the relation of the content of the antecedent and the sluice type. We develop a linear model which achieves...... accuracy of 72.4%, a substantial improvement over a strong manually constructed baseline. Feature analysis confirms that both syntactic and discourse features are important in antecedent selection....

  19. Selective retina therapy (SRT)

    International Nuclear Information System (INIS)

    Brinkmann, R.; Birngruber, R.


    Selective Retina Therapy (SRT) is a new and very gentle laser method developed at the Medical Laser Center Luebeck. It is currently investigated clinically in order to treat retinal disorders associated with a decreased function of the retinal pigment epithelium (RPE). SRT is designed to selectively effect the RPE while sparing the neural retina and the photoreceptors as well as the choroid. Aim of the therapy is the rejuvenation of the RPE in the treated areas, which should ideally lead to a long term metabolic increase at the chorio-retinal junction. In contrast to conventional laser photocoagulation, which is associated with a complete thermal necrosis of the treated site, SRT completely retains full vision. This paper reviews the methods and mechanisms behind selective RPE effects and reports the first clinical results. An online dosimetry technique to visualize the ophthalmoscopically invisible effects is introduced. (orig.)

  20. Autonomous component carrier selection

    DEFF Research Database (Denmark)

    Garcia, Luis Guilherme Uzeda; Pedersen, Klaus; Mogensen, Preben


    management and efficient system operation. Due to the expected large number of user-deployed cells, centralized network planning becomes unpractical and new scalable alternatives must be sought. In this article, we propose a fully distributed and scalable solution to the interference management problem...... in local areas, basing our study case on LTE-Advanced. We present extensive network simulation results to demonstrate that a simple and robust interference management scheme, called autonomous component carrier selection allows each cell to select the most attractive frequency configuration; improving...... the experience of all users and not just the few best ones; while overall cell capacity is not compromised....

  1. Ion-selective electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Mikhelson, Konstantin N. [St. Petersburg State Univ. (Russian Federation). Ion-Selective Electrode Laboratory


    Ion-selective electrodes (ISEs) have a wide range of applications in clinical, environmental, food and pharmaceutical analysis as well as further uses in chemistry and life sciences. Based on his profound experience as a researcher in ISEs and a course instructor, the author summarizes current knowledge for advanced teaching and training purposes with a particular focus on ionophore-based ISEs. Coverage includes the basics of measuring with ISEs, essential membrane potential theory and a comprehensive overview of the various classes of ion-selective electrodes. The principles of constructing ISEs are outlined, and the transfer of methods into routine analysis is considered.

  2. [Treatment of selective mutism]. (United States)

    Melfsen, Siebke; Warnke, Andreas


    Selective mutism is a communication disorder of childhood in which the child does not speak in specific social situations despite the ability to speak in other situations. A literature review was completed in order to provide practical guidelines for the assessment and treatment of children with selective mutism. There are many different behavioral approaches in the treatment of this disorder, e.g. contingency management, shaping, stimulus fading, escape-avoidance, self-modeling, learning theory approaches. A clearer diagnostic understanding of the disorder as part of anxiety or oppositional disorders needs to be realized prior to generalize an effective treatment for this disorder.

  3. Ion-selective electrodes

    CERN Document Server

    Mikhelson, Konstantin N


    Ion-selective electrodes (ISEs) have a wide range of applications in clinical, environmental, food and pharmaceutical analysis as well as further uses in chemistry and life sciences. Based on his profound experience as a researcher in ISEs and a course instructor, the author summarizes current knowledge for advanced teaching and training purposes with a particular focus on ionophore-based ISEs. Coverage includes the basics of measuring with ISEs, essential membrane potential theory and a comprehensive overview of the various classes of ion-selective electrodes. The principles of constructing I

  4. Book Catalogs; Selected References. (United States)

    Brandhorst, Wesley T.

    The 116 citations on book catalogs are divided into the following two main sections: (1) Selected References, in alphabetic sequence by personal or institutional author and (2) Anonymous Entries, in alphabetic sequence by title. One hundred and seven of the citations cover the years 1960 through March 1969. There are five scattered citations in…

  5. Reinventing Natural Selection (United States)

    Geraedts, Caspar L.; Boersma, Kerst Th.


    Although many research studies report students' Lamarckian misconceptions, only a few studies present learning and teaching strategies that focus on the successful development of the concept of natural selection. The learning and teaching strategy for upper secondary students (aged 15-16) presented in this study conducted in The Netherlands is…

  6. Selection and Serial Entrepreneurs

    DEFF Research Database (Denmark)

    Chen, Jing


    There is substantial evidence that serial entrepreneurs outperform de novo entrepreneurs. But is this positive association between prior experience and performance the result of learning by doing or of selection on ability? This paper proposes a strategy that combines the fixed-effects model and IV...... when the analysis focuses on founding new startups in sectors closely related to entrepreneurs' previous ventures....

  7. Selection and Serial Entrepreneurs

    DEFF Research Database (Denmark)

    Chen, Jing


    Although it has been broadly evidenced that entrepreneurial experience plays a substantial role in the emergence of serial entrepreneurship, the debate is still going on about whether this relationship should be attributed to learning by doing or instead be explained by selection on ability. This...

  8. Floors: Selection and Maintenance. (United States)

    Berkeley, Bernard

    Flooring for institutional, commercial, and industrial use is described with regard to its selection, care, and maintenance. The following flooring and subflooring material categories are discussed--(1) resilient floor coverings, (2) carpeting, (3) masonry floors, (4) wood floors, and (5) "formed-in-place floors". The properties, problems,…

  9. Selectively reflective transparent sheets (United States)

    Waché, Rémi; Florescu, Marian; Sweeney, Stephen J.; Clowes, Steven K.


    We investigate the possibility to selectively reflect certain wavelengths while maintaining the optical properties on other spectral ranges. This is of particular interest for transparent materials, which for specific applications may require high reflectivity at pre-determined frequencies. Although there exist currently techniques such as coatings to produce selective reflection, this work focuses on new approaches for mass production of polyethylene sheets which incorporate either additives or surface patterning for selective reflection between 8 to 13 μ m. Typical additives used to produce a greenhouse effect in plastics include particles such as clays, silica or hydroxide materials. However, the absorption of thermal radiation is less efficient than the decrease of emissivity as it can be compared with the inclusion of Lambertian materials. Photonic band gap engineering by the periodic structuring of metamaterials is known in nature for producing the vivid bright colors in certain organisms via strong wavelength-selective reflection. Research to artificially engineer such structures has mainly focused on wavelengths in the visible and near infrared. However few studies to date have been carried out to investigate the properties of metastructures in the mid infrared range even though the patterning of microstructure is easier to achieve. We present preliminary results on the diffuse reflectivity using FDTD simulations and analyze the technical feasibility of these approaches.

  10. Selective Mutism: Phenomenological Characteristics. (United States)

    Ford, Mary Ann; Sladeczek, Ingrid E.; Carlson, John; Kratochwill, Thomas R.


    To explore factors related to selective mutism (SM), a survey of persons (N=153, including 135 children) with SM was undertaken. Three theoretical assumptions are supported: (1) variant talking behaviors prior to identification of SM; (2) link between SM and social anxiety; (3) potential link between temperament and SM. (EMK)

  11. Selected Resources and Bibliography (United States)

    New Directions for Higher Education, 2011


    This chapter provides an annotated bibliography of resources pertaining to international branch campuses (IBCs). This collection of references has been selected to represent the breadth of emerging scholarship on cross-border higher education and is intended to provide further resources on a range of concerns surrounding cross-border higher…

  12. Selecting Personal Computers. (United States)

    Djang, Philipp A.


    Describes a Multiple Criteria Decision Analysis Approach for the selection of personal computers that combines the capabilities of Analytic Hierarchy Process and Integer Goal Programing. An example of how decision makers can use this approach to determine what kind of personal computers and how many of each type to purchase is given. (nine…

  13. Monitoring selected arthropods (United States)

    R. Chris Stanton; David J. Horn; Foster F. Purrington; John W. Peacock; Eric H. Metzler


    Arthropod populations were sampled in four study areas in southern Ohio in 1995 to document patterns of arthropod diversity and establish a baseline dataset for long-term monitoring in mixed-oak forests. Pitfall, Malaise, and blacklight traps were operated in 12 treatment units from May through September. Several insect groups were selected for detailed study due to...

  14. Selecting a silvicultural system (United States)

    Richard M. Godman


    Sometimes a name creates a problem. The name of a silvicultural system usually refers to the way a stand is cut to get regeneration-"single tree selection"-for example. Trouble is, the name suggests that the regeneration cut will be the first treatment applied to the stand. Not so. We are now mostly making "intermediate" cuts in our Lake States...

  15. Selecting and evoking innovators

    DEFF Research Database (Denmark)

    Kanstrup, Anne Marie; Christiansen, Ellen


    prepared for and conducted selection of and collaboration with innovators. The outcome was successful in the sense that the innovators produced excellent foundation for conceptual interaction design by creating mock-ups and explanations incarnating their preferences, attitudes and habits. By referring...

  16. Selecting the Right Software. (United States)

    Shearn, Joseph


    Selection of administrative software requires analyzing present needs and, to meet future needs, choosing software that will function with a more powerful computer system. Other important factors to include are a professional system demonstration, maintenance and training, and financial considerations that allow leasing or renting alternatives.…

  17. Logic and Natural selection

    Czech Academy of Sciences Publication Activity Database

    Peregrin, Jaroslav


    Roč. 4, č. 2 (2010), s. 207-223 ISSN 1661-8297 R&D Projects: GA ČR(CZ) GAP401/10/1279 Institutional research plan: CEZ:AV0Z9009908 Keywords : logic * natural selection * modus potens * inferentialism Subject RIV: AA - Philosophy ; Religion

  18. Selecting Lower Priced Items. (United States)

    Kleinert, Harold L.; And Others


    A program used to teach moderately to severely mentally handicapped students to select the lower priced items in actual shopping activities is described. Through a five-phase process, students are taught to compare prices themselves as well as take into consideration variations in the sizes of containers and varying product weights. (VW)

  19. Natural Selection and Morality

    Directory of Open Access Journals (Sweden)

    Alejandro Rosas


    Full Text Available Resumen:En este ensayo abordo los intentos, relativamente recientes, de dar una explicación de la moralidad como adaptación por selección natural. Mi exposición tiene una introducción y cuatro partes: en la primera explico en qué consiste la paradoja del altruismo biológico. En la segunda expongo la solución que apela a la selección de grupos, recientemente resurgida; la solución que presuntamente aplicó Charles Darwin cuando formuló sus reflexiones biológicas sobre la moralidad humana. En la tercera expongo la solución sociobiológica, que opta por negar que la selección natural pueda explicar directamente la moralidad humana. La moralidad se presenta más bien como opuesta a la naturaleza diseñada por selección natural. En la cuarta parte desarrollo brevemente una explicación de la moralidad como adaptación que beneficia a los individuos. No opone la moralidad a la naturaleza, ni apela a la selección de grupos. Se sirve de un mecanismo de selección que opera a través de preferencias en la interacción social.Abstract:In this essay, I address recent attempts to account for morality as an adaptation due to natural selection. After a brief introduction, my exposition has four sections. I first explain the paradox of biological altruism. Second, I explain the solution to the paradox in terms of group selection. This solution was presumably applied by Darwin himself as he discussed human morality, and it has experienced a recent revival, though it remains suspicious to most biologists. In the third section I offer a socio-biological solution that opts for denying that morality can be explained by any form of natural selection. Morality is opposed to human nature as designed by natural selection. In the fourth, I argue for an explanation in terms of individual selection. It does not oppose morality to nature, and does not need the workings of group selection; rather, it operates through the agents’ psychological preferences

  20. Selective vulnerability in brain hypoxia

    DEFF Research Database (Denmark)

    Cervos-Navarro, J.; Diemer, Nils Henrik


    Neuropathology, selective vulnerability, brain hypoxia, vascular factors, excitotoxicity, ion homeostasis......Neuropathology, selective vulnerability, brain hypoxia, vascular factors, excitotoxicity, ion homeostasis...

  1. Subset selection in regression

    CERN Document Server

    Miller, Alan


    Originally published in 1990, the first edition of Subset Selection in Regression filled a significant gap in the literature, and its critical and popular success has continued for more than a decade. Thoroughly revised to reflect progress in theory, methods, and computing power, the second edition promises to continue that tradition. The author has thoroughly updated each chapter, incorporated new material on recent developments, and included more examples and references. New in the Second Edition:A separate chapter on Bayesian methodsComplete revision of the chapter on estimationA major example from the field of near infrared spectroscopyMore emphasis on cross-validationGreater focus on bootstrappingStochastic algorithms for finding good subsets from large numbers of predictors when an exhaustive search is not feasible Software available on the Internet for implementing many of the algorithms presentedMore examplesSubset Selection in Regression, Second Edition remains dedicated to the techniques for fitting...

  2. Uruguay; 2011 Selected Issues


    International Monetary Fund


    This 2011 Article IV Consultation—Selected Issues paper focuses on estimating potential output and the output gap and spillovers from agriculture in the case of Uruguay. It introduces additional economic information and theory to estimate potential output, shedding some light on the discussion of current monetary and fiscal policies. The objective is to take advantage of economic data to disentangle the most recent economic performance by introducing multivariate techniques. The paper also pr...

  3. Unsupervised Feature Subset Selection

    DEFF Research Database (Denmark)

    Søndberg-Madsen, Nicolaj; Thomsen, C.; Pena, Jose


    This paper studies filter and hybrid filter-wrapper feature subset selection for unsupervised learning (data clustering). We constrain the search for the best feature subset by scoring the dependence of every feature on the rest of the features, conjecturing that these scores discriminate some ir...... irrelevant features. We report experimental results on artificial and real data for unsupervised learning of naive Bayes models. Both the filter and hybrid approaches perform satisfactorily....

  4. Malaysia; Selected Issues


    International Monetary Fund


    This Selected Issues paper on Malaysia highlights quantitative assessment of additional measures required during the medium term to achieve fiscal targets. The authorities aim to lower the budget deficit to about 3 percent of GDP by 2015, down from 4.0 percent in 2013, and to balance the budget by 2020. It suggests that ranking fiscal instruments under different fiscal policy goals can help policymakers identify the composition of fiscal adjustment based on their preferences. By combining ran...

  5. Quantum interaction. Selected papers

    Energy Technology Data Exchange (ETDEWEB)

    Atmanspacher, Harald [Eidgenoessische Technische Hochschule, Zurich (Switzerland); Haven, Emmanuel [Leicester Univ. (United Kingdom). School of Management; Kitto, Kirsty [Queensland Univ. of Technology, Brisbane, QLD (Australia); Raine, Derek (ed.) [Leicester Univ. (United Kingdom). Centre for Interdisciplinary Science


    This book constitutes the refereed proceedings of the 7th International Conference on Quantum Interaction, QI 2013, held in Leicester, UK, in July 2013. The 31 papers presented in this book were carefully selected from numerous submissions. The papers cover various topics on quantum interaction and revolve around four themes: information processing/retrieval/semantic representation and logic; cognition and decision making; finance/economics and social structures and biological systems.

  6. Nuclear energy. Selective bibliography

    International Nuclear Information System (INIS)


    This bibliography gathers articles and books from the French National Library about civil nuclear energy, its related risks, and its perspectives of evolution: general overview (figures, legal framework, actors and markets, policies); what price for nuclear energy (environmental and health risks, financing, non-proliferation policy); future of nuclear energy in energy policies (nuclear energy versus other energies, nuclear phase-out); web sites selection

  7. Automatic LOD selection


    Forsman, Isabelle


    In this paper a method to automatically generate transition distances for LOD, improving image stability and performance is presented. Three different methods were tested all measuring the change between two level of details using the spatial frequency. The methods were implemented as an optional pre-processing step in order to determine the transition distances from multiple view directions. During run-time both view direction based selection and the furthest distance for each direction was ...

  8. New Zealand; Selected Issues


    International Monetary Fund


    This Selected Issues paper conducts a comparative analysis of the main determinants of GDP per capita growth in New Zealand and in other OECD countries to assess the relative importance of macroeconomic factors, institutional settings, and geographical location in New Zealand’s growth performance during the last 30 years. The estimation results find strong support for the view that geographical isolation has significantly hampered growth in New Zealand. The paper also reviews the internationa...

  9. Norway; Selected Issues


    International Monetary Fund


    This Selected Issues paper analyzes inflation in Norway with a view to shedding light on this surprising development and the possible near-term course of inflation, using statistical and econometric analyses. The paper reviews recent developments of monetary policy and inflation in Norway, applies statistical and econometric tools to identify factors influencing inflation, and describes the implications of the analysis for policymaking. Using data for six advanced small open economies explici...

  10. Energy transition. Selective bibliography

    International Nuclear Information System (INIS)


    At the occasion of the promulgation on August 17, 2015 of law no. 2015-992 relative to energy transition, this bibliography reviews the legal, economical and political aspects of the recent evolutions in the energy domain. Basic and synthetic documents are listed first. Then follow documents dealing with: general data, energy models, sustainable agriculture, green technologies, energy conservation, waste processing, renewable energy sources, sustainable cities and buildings. The bibliography ends with a selection of relevant web sites

  11. Selection, Training and Simulation (United States)


    most Neck training, Altitudetehamber, PBG, Gas nixtures, Trampoline , important in flying. In years to come we will have a Statoergometer, Raling...superagile world, are mentioned neck, more if X-tra head worn equipment is used put below. a lot of stress to this system. In addition stress will 6-6 be...acceleration Pilot selection criteria like body-type, heart-cerebral forces, mainly head to foot (Gz). The heart itself is distance, vagal and sympathetic nerve

  12. Quantum interaction. Selected papers

    International Nuclear Information System (INIS)

    Atmanspacher, Harald; Haven, Emmanuel; Raine, Derek


    This book constitutes the refereed proceedings of the 7th International Conference on Quantum Interaction, QI 2013, held in Leicester, UK, in July 2013. The 31 papers presented in this book were carefully selected from numerous submissions. The papers cover various topics on quantum interaction and revolve around four themes: information processing/retrieval/semantic representation and logic; cognition and decision making; finance/economics and social structures and biological systems.

  13. A sensitive electrochemical aptasensor for ATP detection based on exonuclease III-assisted signal amplification strategy. (United States)

    Bao, Ting; Shu, Huawei; Wen, Wei; Zhang, Xiuhua; Wang, Shengfu


    A target-induced structure-switching electrochemical aptasensor for sensitive detection of ATP was successfully constructed which was based on exonuclease III-catalyzed target recycling for signal amplification. With the existence of ATP, methylene blue (MB) labeled hairpin DNA formed G-quadruplex with ATP, which led to conformational changes of the hairpin DNA and created catalytic cleavage sites for exonuclease III (Exo III). Then the structure-switching DNA hybridized with capture DNA which made MB close to electrode surface. Meanwhile, Exo III selectively digested aptamer from its 3'-end, thus G-quadruplex structure was destroyed and ATP was released for target recycling. The Exo III-assisted target recycling amplified electrochemical signal significantly. Fluorescence experiment was performed to confirm the structure-switching process of the hairpin DNA. In fluorescence experiment, AuNPs-aptamer conjugates were synthesized, AuNPs quenched fluorescence of MB, the target-induced structure-switching made Exo III digested aptamer, which restored fluorescence. Under optimized conditions, the proposed aptasensor showed a linear range of 0.1-20 nM with a detection limit of 34 pM. In addition, the proposed aptasensor had good stability and selectivity, offered promising choice for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Burglar Target Selection (United States)

    Townsley, Michael; Bernasco, Wim; Ruiter, Stijn; Johnson, Shane D.; White, Gentry; Baum, Scott


    Objectives: This study builds on research undertaken by Bernasco and Nieuwbeerta and explores the generalizability of a theoretically derived offender target selection model in three cross-national study regions. Methods: Taking a discrete spatial choice approach, we estimate the impact of both environment- and offender-level factors on residential burglary placement in the Netherlands, the United Kingdom, and Australia. Combining cleared burglary data from all study regions in a single statistical model, we make statistical comparisons between environments. Results: In all three study regions, the likelihood an offender selects an area for burglary is positively influenced by proximity to their home, the proportion of easily accessible targets, and the total number of targets available. Furthermore, in two of the three study regions, juvenile offenders under the legal driving age are significantly more influenced by target proximity than adult offenders. Post hoc tests indicate the magnitudes of these impacts vary significantly between study regions. Conclusions: While burglary target selection strategies are consistent with opportunity-based explanations of offending, the impact of environmental context is significant. As such, the approach undertaken in combining observations from multiple study regions may aid criminology scholars in assessing the generalizability of observed findings across multiple environments. PMID:25866418

  15. Decommissioning strategy selection

    International Nuclear Information System (INIS)

    Warnecke, E.


    At the end of their useful life nuclear facilities have to be decommissioned. The strategy selection on how to decommission a facility is a highly important decision at the very beginning of decommissioning planning. Basically, a facility may be subject to (a) immediate dismantling; (b) deferred dismantling after a period of ''safe enclosure'' or (c) entombment where a facility is turned into a near surface disposal facility. The first two strategies are normally applied. The third one may be accepted in countries without significant nuclear activities and hence without disposal facilities for radioactive waste. A large number of factors has to be taken into account when a decision on the decommissioning strategy is being made. Many of the factors cannot be quantified. They may be qualitative or subject to public opinion which may change with time. At present, a trend can be observed towards immediate dismantling of nuclear facilities, mainly because it is associated with less uncertainty, less local impact, a better public acceptance, and the availability of operational expertise and know how. A detailed evaluation of the various factors relevant to strategy selection and a few examples showing the situation regarding decommissioning strategy in a number of selected countries are presented in the following article. (orig.)

  16. Selective coronary scintigraphy

    International Nuclear Information System (INIS)

    Gambini, D.-J.


    Isotopic techniques occupy a leading place amongst examinations practicable on coronary patients because of their reliability and the safety and simplicity of their use. The present work reviews the possible applications of selective coronary scintigraphy in pathology. After a brief discussion on scintigraphy, isotopic techniques for myocardium research, coronarography and other methods to study local myocardium perfusion the theoretical bases for the use of the exploration are studied, the techniques and methods employed are reported and the results discussed. Coronary scintigraphy consists of selective injection in the two coronary arteries previously catheterized during a coronarography, of two different populations of microspheres labelled with two physically short-lived indicators: 15μ 99m Tc-labelled serumalbumin microspheres, 10 to 15μ In-labelled siderophiline microspheres. Various studies have shown the complete harmlessness of the exploration when certain precautions are taken regarding the size and number of the spheres. The microspheres disperse into the downstream arterial territory proportionally to the number of capillaries present in the different parts of the irrigated region, and are temporarily stopped in the precapillaries. The preparation of the different images needed to interpret the Face and OAG examination for the left coronary, then for the right coronary, is carried out at the end of the coronarography and lasts about 45 minutes. It is also possible by selective injection in the aorta-coronary bridges to judge their functional condition by observation of the regions they irrigate. 56 patients of the Necker hospital cardiological clinic have been examined [fr

  17. Selecting Sums in Arrays

    DEFF Research Database (Denmark)

    Brodal, Gerth Stølting; Jørgensen, Allan Grønlund


    In an array of n numbers each of the \\binomn2+nUnknown control sequence '\\binom' contiguous subarrays define a sum. In this paper we focus on algorithms for selecting and reporting maximal sums from an array of numbers. First, we consider the problem of reporting k subarrays inducing the k largest...... sums among all subarrays of length at least l and at most u. For this problem we design an optimal O(n + k) time algorithm. Secondly, we consider the problem of selecting a subarray storing the k’th largest sum. For this problem we prove a time bound of Θ(n · max {1,log(k/n)}) by describing...... an algorithm with this running time and by proving a matching lower bound. Finally, we combine the ideas and obtain an O(n· max {1,log(k/n)}) time algorithm that selects a subarray storing the k’th largest sum among all subarrays of length at least l and at most u....

  18. Economic Indicators Selected Countries. (United States)


    DEFENCE I ECONOMIC INDICATORS SELECTED COUNTRIES DECEMBER QUARTER 1987 . ’-H ISSUED BY MANPOWER POLICY & STRATEGIES BRANCH " "’ :.S S ’,1l f ,am -m mW...100 Sour:e: Main Economic Indicators (OECD) Manufactured Basic Metal Year Goods Chemicals Metals Products 1980 100 100 100 100 1981 110 117 102 107...Earnings of all 1982 1986 7.4 Male Employees (a) Aug 1986 Aug 1987 4.8 Hourly Wace Rates 3 1979 1987 lt.2 Garden Island 1983 1987 6.7 Dockyards Dec

  19. Saudi Arabia; Selected Issues


    International Monetary Fund


    This Selected Issues paper on Saudi Arabia assesses Saudi Arabia’s role in the oil market and global economy. Saudi Arabia, the world’s largest producer and exporter of oil, has long played a systemically important role in the global oil market. Short-term fluctuations in Saudi Arabia’s oil production have partially reflected attempts to stabilize the global oil market. Saudi Arabia has on several occasions used its systemic role to raise production to fill global demand gaps created by large...

  20. The Daily Selection

    DEFF Research Database (Denmark)

    Skjold, Else


    In this PhD thesis, The Daily Selection, I will be addressing the overall question of how research on wardrobes can contribute to a more effective connection between the production and the consumption of dress objects. The thesis builds on exemplary studies of people in their wardrobes....... As such, the parts, when taken as a whole, represent an evolving process through which my overall research questions are being filtered and reflected. My scholarly approach builds on the fusing of fashion and dress research and design research, in this way closing a gap between dress practice as...

  1. Fungicide selective for basidiomycetes. (United States)

    Edgington, L V; Walton, G S; Miller, P M


    Concentrations of 2,3-dihydro-5-carboxanilido-6-methyl-1,4-oxathiin lower than 8 parts per million prevented mycelial growth of a number of Basidiomycetes. By contrast, mycelial growth of various other fungi-Phycomycetes, Ascomycetes, and Deuteromycetes-was 50 percent inhibited only by concentrations of 32 ppm or higher. Two exceptions to this pattern of selective fungitoxicity were found:an isolate of Rhizoctonia solani was not as sensitive as other Basidiomycetes, and the deuteromycete Verticillium alboatrum was inhibited by lower concentrations than affected other fungi in this group. Spore germination of two Basidiomycetes, Uromyces phaseoli and Ustilago nuda, was inhibited 95 percent or more at 10 ppm.

  2. Selective protection. Selektivschutz

    Energy Technology Data Exchange (ETDEWEB)


    TC 2, ''Transmission and distribution of electrical energy'', held its meeting on selective protection on 16/17 March 1983 at Nuremberg. The main reason for the development of computerized protective systems is their ability to solve a wide range of tasks using only a few, high-integrated systems, i.e. on the software side instead of the hardware side. At the meeting, experts from industrial companies and public utilities reviewed the status and trends of protective systems engineering. Scientific studies and operating experience were presented. Separate abstracts were prepared for 2 papers in this conference proceedings volume.

  3. Selected misdemeanors against monuments

    Directory of Open Access Journals (Sweden)

    Agata Klimczyk


    Full Text Available The aim of the work is to present selected aspects misdemeanors against monuments and the possibility of counteracting them.The author has used: the method of legal analysis  and literature study.  It was moved, among others issues in which cases occur misconduct, when and  what measures can be taken to prevent it. The aim of this paper is to present the matter directly. Attention  also was paid to the role The Provincial Monuments Conservator  and the Minister of Culture and National Heritage.

  4. Scope selection and control

    International Nuclear Information System (INIS)

    Guglielmi, F.


    OPG is preparing for a 4-unit refurbishment program at Darlington later in this decade. Key efforts underway include the selection of the right refurbishment scope that will allow Darlington to achieve top-decile performance post-refurbishment. For this to be possible, it is imperative that (1) plant/equipment condition be well understood, (2) post-refurbishment performance objectives be clearly defined, and (3) regulatory and other risks be carefully assessed and mitigated. Significant engineering, operations and maintenance support is required to complete this phase of the project cycle.

  5. Frequency selective bolometers

    DEFF Research Database (Denmark)

    Kowitt, M.S.; Fixsen, D.J.; Goldin, A.


    We propose a concept for radiometry in the millimeter, the submillimeter, and the far-IR spectral regions, the frequency selective bolometer (FSB). This system uses a bolometer as a coupled element of a tuned quasi-optical interference filter in which the absorption, the transmission......-dimensional transmission-line model. Instruments based on FSB technology should have several advantages over current multiband bolometric radiometers including smaller and more compact cryogenic optics; reduced demands on cryostat size and weight, high coupling efficiency, minimum constraints on the geometry in the focal...

  6. Selected cerium phase diagrams

    International Nuclear Information System (INIS)

    Gschneidner, K.A. Jr.; Verkade, M.E.


    A compilation of cerium alloy phase equilibria data based on the most reliable information available is presented. The binary systems selected are those of cerium with each of the following twenty nine elements which might be commonly found in steels: Al, Sb, As, Bi, Ca, C, Cr, Co, Nb, Cu, Fe, Pb, Mg, Mn, Mo, Ni, N, O, P, Se, Si, Ag, S, Te, Sn, Ti, W, and Zn. A brief discussion, a summary of crystal lattice parameters where applicable, and a list of references is included for each element surveyed. (U.S.)

  7. Broadband network selection issues (United States)

    Leimer, Michael E.


    Selecting the best network for a given cable or telephone company provider is not as obvious as it appears. The cost and performance trades between Hybrid Fiber Coax (HFC), Fiber to the Curb (FTTC) and Asymmetric Digital Subscriber Line networks lead to very different choices based on the existing plant and the expected interactive subscriber usage model. This paper presents some of the issues and trades that drive network selection. The majority of the Interactive Television trials currently underway or planned are based on HFC networks. As a throw away market trial or a short term strategic incursion into a cable market, HFC may make sense. In the long run, if interactive services see high demand, HFC costs per node and an ever shrinking neighborhood node size to service large numbers of subscribers make FTTC appear attractive. For example, thirty-three 64-QAM modulators are required to fill the 550 MHz to 750 MHz spectrum with compressed video streams in 6 MHz channels. This large amount of hardware at each node drives not only initial build-out costs, but operations and maintenance costs as well. FTTC, with its potential for digitally switching large amounts of bandwidth to an given home, offers the potential to grow with the interactive subscriber base with less downstream cost. Integrated telephony on these networks is an issue that appears to be an afterthought for most of the networks being selected at the present time. The major players seem to be videocentric and include telephony as a simple add-on later. This may be a reasonable view point for the telephone companies that plan to leave their existing phone networks untouched. However, a phone company planning a network upgrade or a cable company jumping into the telephony business needs to carefully weigh the cost and performance issues of the various network choices. Each network type provides varying capability in both upstream and downstream bandwidth for voice channels. The noise characteristics

  8. Selective immunosuppression by radiation

    International Nuclear Information System (INIS)

    Chanana, A.D.; Cronkite, E.P.; Joel, D.D.


    The historical aspects of selective irradiation of lymphocytes are reviewed as well as the problems concerned with dosimetry and the radiosensitivity of circulating blood elements other than lymphocytes. The possibilities of perturbations in steady-state lymphocytopoiesis which might be triggered by products of radiation-induced cell death are presented; however, the parameters investigated thus far, such as the degree of lymphocytopenia, thoracic duct lymphocyte output, and cell-cycle times of thoracic duct lymphocytes, have failed to reveal any such perturbations. Studies in adrenalectomized calves have failed to confirm the notion that lymphocytopenia after extracorporeal irradiation of blood and lymph might primarily be accounted for by stress-induced corticosteroid hormonal activity. Of the various techniques, only local-graft irradiation and extracorporeal irradiation of blood (ECIB) have found clinical application. The results obtained are encouraging and indicate a need for additional, well-controlled clinical trials, especially concerning the role of ECIB as an adjunct to standard immunosuppressive therapy. The experimental results with extracorporeal irradiation of lymph have also established the potential of this technique for clinical application. There is an urgent need for studying the influence of irradiation on various subpopulations of lymphocytes with regard to their functional capabilities and in particular with regard to their reproductive potential. Possible influence of selective blood irradiation on circulating stem cells in blood needs to be evaluated

  9. Selection of new constraints

    International Nuclear Information System (INIS)

    Sugier, A.


    The selected new constraints should be consistent with the scale of concern i.e. be expressed roughly as fractions or multiples of the average annual background. They should take into account risk considerations and include the values of the currents limits, constraints and other action levels. The recommendation is to select four leading values for the new constraints: 500 mSv ( single event or in a decade) as a maximum value, 0.01 mSv/year as a minimum value; and two intermediate values: 20 mSv/year and 0.3 mSv/year. This new set of dose constraints, representing basic minimum standards of protection for the individuals taking into account the specificity of the exposure situations are thus coherent with the current values which can be found in ICRP Publications. A few warning need however to be noticed: There is no more multi sources limit set by ICRP. The coherence between the proposed value of dose constraint (20 mSv/year) and the current occupational dose limit of 20 mSv/year is valid only if the workers are exposed to one single source. When there is more than one source, it will be necessary to apportion. The value of 1000 mSv lifetimes used for relocation can be expressed into annual dose, which gives approximately 10 mSv/year and is coherent with the proposed dose constraint. (N.C.)

  10. Proximity hybridization-mediated isothermal exponential amplification for ultrasensitive electrochemical protein detection

    Directory of Open Access Journals (Sweden)

    Yu Y


    Full Text Available Yanyan Yu, Gaoxing Su, Hongyan Zhu, Qing Zhu, Yong Chen, Bohui Xu, Yuqin Li, Wei Zhang School of Pharmacy, Nantong University, Nantong, People’s Republic of China Abstract: In this study, we fabricated a novel electrochemical biosensing platform on the basis of target-triggered proximity hybridization-mediated isothermal exponential amplification reaction (EXPAR for ultrasensitive protein analysis. Through rational design, the aptamers for protein recognition were integrated within two DNA probes. Via proximity hybridization principle, the affinity protein-binding event was converted into DNA assembly process. The recognition of protein by aptamers can trigger the strand displacement through the increase of the local concentrations of the involved probes. As a consequence, the output DNA was displaced, which can hybridize with the duplex probes immobilized on the electrode surface subsequently, leading to the initiation of the EXPAR as well as the cleavage of duplex probes. Each cleavage will release the gold nanoparticles (AuNPs binding sequence. With the modification of G-quadruplex sequence, electrochemical signals were yielded by the AuNPs through oxidizing 3,3',5,5'-tetramethylbenzidine in the presence of H2O2. The study we proposed exhibited high sensitivity toward platelet-derived growth factor BB (PDGF-BB with the detection limit of 52 fM. And, this method also showed great selectivity among the PDGF isoforms and performed well in spiked human serum samples. Keywords: electrochemical biosensor, proximity hybridization, PDGF-BB, isothermal exponential amplification, G-quadruplex 

  11. Ion-selective electrode reviews

    CERN Document Server

    Thomas, J D R


    Ion-Selective Electrode Reviews, Volume 5 is a collection of articles that covers ion-speciation. The book aims to present the advancements of the range and capabilities of selective ion-sensors. The topics covered in the selection are neutral carrier based ion-selective electrodes; reference electrodes and liquid junction effects in ion-selective electrode potentiometry; ion transfer across water/organic phase boundaries and analytical; and carbon substrate ion-selective electrodes. The text will be of great use to chemists and chemical engineers.

  12. Selective inorganic thin films

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, M.L.F.; Weisenbach, L.A.; Anderson, M.T. [Sandia National Laboratories, Albuquerque, NM (United States)] [and others


    This project is developing inorganic thin films as membranes for gas separation applications, and as discriminating coatings for liquid-phase chemical sensors. Our goal is to synthesize these coatings with tailored porosity and surface chemistry on porous substrates and on acoustic and optical sensors. Molecular sieve films offer the possibility of performing separations involving hydrogen, air, and natural gas constituents at elevated temperatures with very high separation factors. We are focusing on improving permeability and molecular sieve properties of crystalline zeolitic membranes made by hydrothermally reacting layered multicomponent sol-gel films deposited on mesoporous substrates. We also used acoustic plate mode (APM) oscillator and surface plasmon resonance (SPR) sensor elements as substrates for sol-gel films, and have both used these modified sensors to determine physical properties of the films and have determined the sensitivity and selectivity of these sensors to aqueous chemical species.

  13. Selection of maintenance tasks

    Energy Technology Data Exchange (ETDEWEB)

    Dean, B; Rombos, P [Wardrop (W.L.) and Associates Ltd., Winnipeg, MB (Canada)


    Two methodologies for maintenance task selection, Reliability Centre Maintenance (RCM) and Degradation Mode Analysis (DMA), are compared with regard to application in the nuclear industry and potential for application at CANDU nuclear power plants. RCM is the favoured one of the two methodologies. It is more thorough than DMA, is well supported within the US nuclear industry, and - with experience in application - is gaining cost effectiveness. There is interest in the use of RCM in other nations, including France and Japan, and it is already being implemented at Bruce A NGS and Bruce B NGS in Canada. DMA lags behind RCM in development and currently there is little experience to support claims of major benefits at reduced cost. Significant advantages over RCM need to be demonstrated if DMA is to gain acceptance in the nuclear industry. (author). 41 refs., 7 tabs., 8 figs.

  14. Selection of maintenance tasks

    International Nuclear Information System (INIS)

    Dean, B.; Rombos, P.


    Two methodologies for maintenance task selection, Reliability Centre Maintenance (RCM) and Degradation Mode Analysis (DMA), are compared with regard to application in the nuclear industry and potential for application at CANDU nuclear power plants. RCM is the favoured one of the two methodologies. It is more thorough than DMA, is well supported within the US nuclear industry, and - with experience in application - is gaining cost effectiveness. There is interest in the use of RCM in other nations, including France and Japan, and it is already being implemented at Bruce A NGS and Bruce B NGS in Canada. DMA lags behind RCM in development and currently there is little experience to support claims of major benefits at reduced cost. Significant advantages over RCM need to be demonstrated if DMA is to gain acceptance in the nuclear industry. (author). 41 refs., 7 tabs., 8 figs

  15. Selected bibliography of agroforestry

    Energy Technology Data Exchange (ETDEWEB)

    Majisu, L.; Labelle, R.


    A successor to a preliminary bibliography by Teemba, L. and containing some of the same references. References (1953-1982) were selected from the 3000 reprints in the agroforestry collection in the ICRAF library, and from approximately 1500 monographs, reports etc. They are grouped in 7 main sections: Agroforestry general, including subsections on agroforestry in arid and semi-arid lands, in lowlands - humid tropics, and in highlands; Agroforestry land-use systems, including concepts from agriculture and forestry land-use systems, and agroforestry systems (cropping with trees, silvopastoral and agrosilvopastoral systems); Plants and plant management, including multipurpose trees and shrubs; Physical and ecological aspects, (desertification and deforestation, agricultural meteorology, soils and soil management); social and economic aspects, including rural development and human ecology; Training and education; and Information sources and management. A list of information centres relevant to agroforestry is given, and there are subject, species and geographical indexes. 437 references

  16. Skateboard deck materials selection (United States)

    Liu, Haoyu; Coote, Tasha; Aiolos; Charlie


    The goal of this project was to identify the ideal material for a skateboard deck under 200 in price, minimizing the weight. The material must have a fracture toughness of 5 MPa/m2, have a minimum lifetime of 10, 000 cycles and must not experience brittle fracture. Both single material and hybrid solutions were explored. When further selecting to minimize weight, woods were found to be the best material. Titanium alloy-wood composites were explored to determine the optimal percentage composition of each material.A sandwich panel hybrid of 50% titanium alloy and 50% wood (Ti-Wood) was found to be the optimum material, performing better than the currently used plywood.

  17. Antidepressant-selective gynecomastia. (United States)

    Kaufman, Kenneth R; Podolsky, Dina; Greenman, Danielle; Madraswala, Rehman


    To describe what we believe is the first reported case of synergistic gynecomastia during treatment of depressive and anxiety disorders when sertraline was added to a stable medication regimen including duloxetine, rosuvastatin, and amlodipine. A 67-year-old male with major depression, dysthymia, obsessive-compulsive disorder, social anxiety, hypertension, diabetes, and hyperlipidemia presented with new-onset gynecomastia and breast tenderness. Mammography revealed bilateral gynecomastia (fibroglandular tissue posterior to the nipples bilaterally) without suspicious mass, calcification, or other abnormalities. These new symptoms developed after sertraline was added to his stable medication regimen (duloxetine, alprazolam, rosuvastatin, metoprolol, amlodipine, hydrochlorothiazide/triamterene, metformin, and sitagliptin). These symptoms were dose-dependent, with gynecomastia and breast tenderness more severe as sertraline was titrated from 25 mg/day to 50 mg/day and then to 75 mg/day. When sertraline was discontinued, gynecomastia and breast tenderness rapidly resolved. Mammoplasia and gynecomastia are associated with altered dopamine neurotransmission and/or perturbations in sexual hormones. These adverse effects may be medication induced. Selective serotonin reuptake inhibitors (sertraline), serotonin-norepinephrine reuptake inhibitors (duloxetine), rosuvastatin, and amlodipine have been reported to cause these adverse effects. This case was unique, since the patient had been on both sertraline and duloxetine previously as independent psychotropics without the development of gynecomastia. In the context of an additive drug adverse effect, the probability of sertraline as the precipitant drug was determined by both the Naranjo probability scale and the Horn drug interaction probability scale as probable. Gynecomastia is associated with antidepressants and other medications but is rarely addressed. Gynecomastia may be antidepressant selective or may be the result of

  18. Selective Impairment of Auditory Selective Attention under Concurrent Cognitive Load (United States)

    Dittrich, Kerstin; Stahl, Christoph


    Load theory predicts that concurrent cognitive load impairs selective attention. For visual stimuli, it has been shown that this impairment can be selective: Distraction was specifically increased when the stimulus material used in the cognitive load task matches that of the selective attention task. Here, we report four experiments that…

  19. Selection signature in domesticated animals. (United States)

    Pan, Zhang-yuan; He, Xiao-yun; Wang, Xiang-yu; Guo, Xiao-fei; Cao, Xiao-han; Hu, Wen-ping; Di, Ran; Liu, Qiu-yue; Chu, Ming-xing


    Domesticated animals play an important role in the life of humanity. All these domesticated animals undergo same process, first domesticated from wild animals, then after long time natural and artificial selection, formed various breeds that adapted to the local environment and human needs. In this process, domestication, natural and artificial selection will leave the selection signal in the genome. The research on these selection signals can find functional genes directly, is one of the most important strategies in screening functional genes. The current studies of selection signal have been performed in pigs, chickens, cattle, sheep, goats, dogs and other domestic animals, and found a great deal of functional genes. This paper provided an overview of the types and the detected methods of selection signal, and outlined researches of selection signal in domestic animals, and discussed the key issues in selection signal analysis and its prospects.

  20. Ion-selective electrode reviews

    CERN Document Server

    Thomas, J D R


    Ion-Selective Electrode Reviews, Volume 7 is a collection of papers that covers the applications of electrochemical sensors, along with the versatility of ion-selective electrodes. The coverage of the text includes solid contact in membrane ion-selective electrodes; immobilized enzyme probes for determining inhibitors; potentiometric titrations based on ion-pair formation; and application of ion-selective electrodes in soil science, kinetics, and kinetic analysis. The text will be of great use to chemists and chemical engineers.

  1. Genomic selection in plant breeding. (United States)

    Newell, Mark A; Jannink, Jean-Luc


    Genomic selection (GS) is a method to predict the genetic value of selection candidates based on the genomic estimated breeding value (GEBV) predicted from high-density markers positioned throughout the genome. Unlike marker-assisted selection, the GEBV is based on all markers including both minor and major marker effects. Thus, the GEBV may capture more of the genetic variation for the particular trait under selection.

  2. Beef Cattle: Selection and Evaluation. (United States)

    Clemson Univ., SC. Vocational Education Media Center.

    Designed for secondary vocational agriculture students, this text provides an overview of selecting and evaluating beef cattle in Future Farmers of America livestock judging events. The first of four major sections addresses topics such as the ideal beef animal, selecting steers, selecting breeding animals, studying the animal systematically, and…

  3. Index Selection in Relational Databases

    NARCIS (Netherlands)

    Choenni, R.S.; Blanken, Henk; Chang, S.C.

    Intending to develop a tool which aims to support the physical design of relational databases can not be done without considering the problem of index selection. Generally the problem is split into a primary and secondary index selection problem and the selection is done per table. Whereas much

  4. Materials selection in mechanical design

    International Nuclear Information System (INIS)

    Ashby, M.F.; Cebon, D.


    A novel materials-selection procedure has been developed and implemented in software. The procedure makes use of Materials Selection Charts: a new way of displaying material property data; and performance indices: combinations of material properties which govern performance. Optimisation methods are employed for simultaneous selection of both material and shape. (orig.)

  5. Materials selection in mechanical design


    Ashby , M.; Cebon , D.


    A novel materials-selection procedure has been developed and implemented in software. The procedure makes use of Materials Selection Charts: a new way of displaying material property data; and performance indices: combinations of material properties which govern performance. Optimisation methods are employed for simultaneous selection of both material and shape.

  6. Nitrate and bicarbonate selective CHEMFETs

    NARCIS (Netherlands)

    Antonisse, M.M.G.; Engbersen, Johannes F.J.; Reinhoudt, David


    The development of durable anion selective CHEMFET micro sensors is described. Selectivity in these sensors is either obtained from differences in hydration energy of the anions (the Hlofmeister series, giving nitrate selectivity) or by introduction of a new class of uranyl salophene ionophores

  7. [Dental implant restoration abutment selection]. (United States)

    Bin, Shi; Hao, Zeng


    An increasing number of implant restoration abutment types are produced with the rapid development of dental implantology. Although various abutments can meet different clinical demands, the selection of the appropriate abutment is both difficult and confusing. This article aims to help clinicians select the appropriate abutment by describing abutment design, types, and selection criteria.

  8. Selective laser trabeculoplasty

    Directory of Open Access Journals (Sweden)

    Jing-Ming Shi


    Full Text Available The introduction of selective laser trabeculoplasty (SLT provided a new choice for the reduction of intraocular pressure (IOP in eyes with open angle glaucoma (OAG and ocular hypertension (OHT. SLT was demonstrated equally as effective as topical medical therapy and argon laser trabeculoplasty (ALT to lower IOP. It is a potentially repeatable procedure because of the lack of coagulation damage to the trabecular meshwork (TM and also effect in patients with previously failed ALT. SLT can be used to treat patients with OAG, pseudoexfoliation glaucoma, pigmentary glaucoma, normal-tension glaucoma, OHT, juvenile glaucoma, pseudophakic and aphakic glaucoma. Furthermore, SLT can be considered as a primary treatment option in patients who cannot tolerate or are noncompliant with medications, while not interfering with the success of future surgery. Its safety profiles include mild and transient inflammation, ocular pain and a small risk of moderate IOP elevations after the procedure. SLT is a safe and effective means of IOP reduction in eyes with OAG and OHT.

  9. Stirling Engine Configuration Selection

    Directory of Open Access Journals (Sweden)

    Jose Egas


    Full Text Available Unlike internal combustion engines, Stirling engines can be designed to work with many drive mechanisms based on the three primary configurations, alpha, beta and gamma. Hundreds of different combinations of configuration and mechanical drives have been proposed. Few succeed beyond prototypes. A reason for poor success is the use of inappropriate configuration and drive mechanisms, which leads to low power to weight ratio and reduced economic viability. The large number of options, the lack of an objective comparison method, and the absence of a selection criteria force designers to make random choices. In this article, the pressure—volume diagrams and compression ratios of machines of equal dimensions, using the main (alpha, beta and gamma crank based configurations as well as rhombic drive and Ross yoke mechanisms, are obtained. The existence of a direct relation between the optimum compression ratio and the temperature ratio is derived from the ideal Stirling cycle, and the usability of an empirical low temperature difference compression ratio equation for high temperature difference applications is tested using experimental data. It is shown that each machine has a different compression ratio, making it more or less suitable for a specific application, depending on the temperature difference reachable.

  10. Selective sorting of waste

    CERN Multimedia


    Not much effort needed, just willpower In order to keep the cost of disposing of waste materials as low as possible, CERN provides two types of recipient at the entrance to each building: a green plastic one for paper/cardboard and a metal one for general refuse. For some time now we have noticed, to our great regret, a growing negligence as far as selective sorting is concerned, with, for example, the green recipients being filled with a mixture of cardboard boxes full of polystyrene or protective wrappers, plastic bottles, empty yogurts pots, etc. …We have been able to ascertain, after careful checking, that this haphazard mixing of waste cannot be attributed to the cleaning staff but rather to members of the personnel who unscrupulously throw away their rubbish in a completely random manner. Non-sorted waste entails heavy costs for CERN. For information, once a non-compliant item is found in a green recipient, the entire contents are sent off for incineration rather than recycling… We are all concerned...

  11. Selective chemical stripping (United States)

    Malavallon, Olivier


    At the end of the 80's, some of the large European airlines expressed a wish for paint systems with improved strippability on their aircraft, allowing the possibility to strip down to the primer without altering it, using 'mild' chemical strippers based on methylene chloride. These improvements were initially intended to reduce costs and stripping cycle times while facilitating rapid repainting, and this without the need to change the conventionally used industrial facilities. The level of in-service performance of these paint systems was to be the same as the previous ones. Requirements related to hygiene safety and the environment were added to these initial requirements. To meet customers' expectations, Aerospatiale, within the Airbus Industry GIE, formed a work group. This group was given the task of specifying, following up the elaboration and qualifying the paint systems allowing requirements to be met, in relation with the paint suppliers and the airlines. The analysis made in this report showed the interest of transferring as far upstream as possible (to paint conception level) most of the technical constraints related to stripping. Thus, the concept retained for the paint system, allowing selective chemical stripping, is a 3-coat system with characteristics as near as possible to the previously used paints.

  12. Selection vector filter framework (United States)

    Lukac, Rastislav; Plataniotis, Konstantinos N.; Smolka, Bogdan; Venetsanopoulos, Anastasios N.


    We provide a unified framework of nonlinear vector techniques outputting the lowest ranked vector. The proposed framework constitutes a generalized filter class for multichannel signal processing. A new class of nonlinear selection filters are based on the robust order-statistic theory and the minimization of the weighted distance function to other input samples. The proposed method can be designed to perform a variety of filtering operations including previously developed filtering techniques such as vector median, basic vector directional filter, directional distance filter, weighted vector median filters and weighted directional filters. A wide range of filtering operations is guaranteed by the filter structure with two independent weight vectors for angular and distance domains of the vector space. In order to adapt the filter parameters to varying signal and noise statistics, we provide also the generalized optimization algorithms taking the advantage of the weighted median filters and the relationship between standard median filter and vector median filter. Thus, we can deal with both statistical and deterministic aspects of the filter design process. It will be shown that the proposed method holds the required properties such as the capability of modelling the underlying system in the application at hand, the robustness with respect to errors in the model of underlying system, the availability of the training procedure and finally, the simplicity of filter representation, analysis, design and implementation. Simulation studies also indicate that the new filters are computationally attractive and have excellent performance in environments corrupted by bit errors and impulsive noise.

  13. Opportunity structures for selective exposure

    DEFF Research Database (Denmark)

    Skovsgaard, Morten; Shehata, Adam; Strömbäck, Jesper


    Abstract The transition from low-choice to high-choice media environments has raised new concerns about selective exposure. In this context, two types of selective media exposure are relevant. One is selectivity based on political ideological preferences, the other selectivity based on political...... interest. Evidence for both has been found primarily in an American context, while there is less research on European countries. This is problematic, as the opportunity structures for different forms of selectivity vary across media environments. Against this background, the purpose of this study...

  14. Selective structural source identification (United States)

    Totaro, Nicolas


    In the field of acoustic source reconstruction, the inverse Patch Transfer Function (iPTF) has been recently proposed and has shown satisfactory results whatever the shape of the vibrating surface and whatever the acoustic environment. These two interesting features are due to the virtual acoustic volume concept underlying the iPTF methods. The aim of the present article is to show how this concept of virtual subsystem can be used in structures to reconstruct the applied force distribution. Some virtual boundary conditions can be applied on a part of the structure, called virtual testing structure, to identify the force distribution applied in that zone regardless of the presence of other sources outside the zone under consideration. In the present article, the applicability of the method is only demonstrated on planar structures. However, the final example show how the method can be applied to a complex shape planar structure with point welded stiffeners even in the tested zone. In that case, if the virtual testing structure includes the stiffeners the identified force distribution only exhibits the positions of external applied forces. If the virtual testing structure does not include the stiffeners, the identified force distribution permits to localize the forces due to the coupling between the structure and the stiffeners through the welded points as well as the ones due to the external forces. This is why this approach is considered here as a selective structural source identification method. It is demonstrated that this approach clearly falls in the same framework as the Force Analysis Technique, the Virtual Fields Method or the 2D spatial Fourier transform. Even if this approach has a lot in common with these latters, it has some interesting particularities like its low sensitivity to measurement noise.

  15. Selective noble gases monitoring

    International Nuclear Information System (INIS)

    Janecka, S.; Jancik, O.; Kapisovsky, V.; Kubik, I.; Sevecka, S.


    The monitoring of leak releases from ventilation stack of NPP requires a system by several orders more sensitive then currently used radiometer Kalina, designed to cover the range up to a design-based accident. To reach this goal a noble gases monitor with a germanium detector (MPVG) has been developed. It enables nuclide selective monitoring of current value of volume activity of particular nuclides in ventilation stack and daily releases of noble gases (balancing). MPVG can be viewed as a system build of three levels of subsystem: measuring level; control level; presentation level. Measuring level consists of gamma-spectroscopy system and operational parameters monitoring unit (flow rate, temperature, humidity). Control level provides communication between presentation and measuring level, acquisition of operational parameters and power supply. The presentation level of MPVG enables: 1) the measured data storage in predetermined time intervals; 2) the presentation of measured and evaluated values of radiation characteristics. The monitored radionuclides - default set: argon-41, krypton-85m, krypton-87, krypton-88, krypton-89, xenon-131m, xenon-133, xenon-133m, xenon-135, xenon-135m, xenon-137 and xenon-138. The values of volume activities observed at maximum releases have been approximately ten times higher. In that case in balancing some other nuclides exceed corresponding detection limits: 88 Kr(67; 22) Bq/m 3 ; 85m Kr(17; 7) Bq/m 3 ; 135m Xe(7.1; 0.5) Bq/m 3 ; 138 Xe(5.9; 0.9) Bq/m 3 . (J.K.)

  16. Selective noble gases monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Janecka, S; Jancik, O; Kapisovsky, V; Kubik, I; Sevecka, S [Nuclear Power Plants Research Institute, a.s., Trnava (Slovakia)


    The monitoring of leak releases from ventilation stack of NPP requires a system by several orders more sensitive then currently used radiometer Kalina, designed to cover the range up to a design-based accident. To reach this goal a noble gases monitor with a germanium detector (MPVG) has been developed. It enables nuclide selective monitoring of current value of volume activity of particular nuclides in ventilation stack and daily releases of noble gases (balancing). MPVG can be viewed as a system build of three levels of subsystem: measuring level; control level; presentation level. Measuring level consists of gamma-spectroscopy system and operational parameters monitoring unit (flow rate, temperature, humidity). Control level provides communication between presentation and measuring level, acquisition of operational parameters and power supply. The presentation level of MPVG enables: 1) the measured data storage in predetermined time intervals; 2) the presentation of measured and evaluated values of radiation characteristics. The monitored radionuclides - default set: argon-41, krypton-85m, krypton-87, krypton-88, krypton-89, xenon-131m, xenon-133, xenon-133m, xenon-135, xenon-135m, xenon-137 and xenon-138. The values of volume activities observed at maximum releases have been approximately ten times higher. In that case in balancing some other nuclides exceed corresponding detection limits: {sup 88}Kr(67; 22) Bq/m{sup 3}; {sup 85m}Kr(17; 7) Bq/m{sup 3}; {sup 135m}Xe(7.1; 0.5) Bq/m{sup 3}; {sup 138}Xe(5.9; 0.9) Bq/m{sup 3}. (J.K.).

  17. Sexual selection: Another Darwinian process. (United States)

    Gayon, Jean


    Why was sexual selection so important to Darwin? And why was it de-emphasized by almost all of Darwin's followers until the second half of the 20th century? These two questions shed light on the complexity of the scientific tradition named "Darwinism". Darwin's interest in sexual selection was almost as old as his discovery of the principle of natural selection. From the beginning, sexual selection was just another "natural means of selection", although different from standard "natural selection" in its mechanism. But it took Darwin 30 years to fully develop his theory, from the early notebooks to the 1871 book The Descent of Man, and Selection in Relation to Sex. Although there is a remarkable continuity in his basic ideas about sexual selection, he emphasized increasingly the idea that sexual selection could oppose the action of natural selection and be non adaptive. In time, he also gave more weight to mate choice (especially female choice), giving explicit arguments in favor of psychological notions such as "choice" and "aesthetic sense". But he also argued that there was no strict demarcation line between natural and sexual selection, a major difficulty of the theory from the beginning. Female choice was the main reason why Alfred Russel Wallace, the co-discoverer of the principle of natural selection, engaged in a major controversy with Darwin about sexual selection. Wallace was suspicious about sexual selection in general, trying to minimize it by all sorts of arguments. And he denied entirely the existence of female choice, because he thought that it was both unnecessary and an anthropomorphic notion. This had something to do with his spiritualist convictions, but also with his conception of natural selection as a sufficient principle for the evolutionary explanation of all biological phenomena (except for the origin of mind). This is why Wallace proposed to redefine Darwinism in a way that excluded Darwin's principle of sexual selection. The main result of

  18. Detecting selection needs comparative data

    DEFF Research Database (Denmark)

    Nielsen, Rasmus; Hubisz, Melissa J.


    Positive selection at the molecular level is usually indicated by an increase in the ratio of non-synonymous to synonymous substitutions (dN/dS) in comparative data. However, Plotkin et al. 1 describe a new method for detecting positive selection based on a single nucleotide sequence. We show here...... that this method is particularly sensitive to assumptions regarding the underlying mutational processes and does not provide a reliable way to identify positive selection....

  19. Recruitment and selection of employees


    Čermochová, Barbora


    The Bachelor's thesis focuses on the process of recruitment and selection of employees. The thesis is divided into theoretical and practical part. The theoretical part includes concepts that are important for understanding of issues of the process of recruitment and selection of employees. The practical part is divided into three chapters. The first chapter briefly describes the company xxx. Next two chapters deal with the process of recruitment and selection of employees in the company. The ...

  20. Ion-selective electrode reviews

    CERN Document Server

    Thomas, J D R


    Ion-Selective Electrode Reviews, Volume 3, provides a review of articles on ion-selective electrodes (ISEs). The volume begins with an article on methods based on titration procedures for surfactant analysis, which have been developed for discrete batch operation and for continuous AutoAnalyser use. Separate chapters deal with detection limits of ion-selective electrodes; the possibility of using inorganic ion-exchange materials as ion-sensors; and the effect of solvent on potentials of cells with ion-selective electrodes. Also included is a chapter on advances in calibration procedures, the d

  1. From demand driven contractor selection towards value driven contractor selection

    NARCIS (Netherlands)

    Walraven, A.R.; Vries, de B.


    The procurement of a construction contractor should consider more aspects than only cost or price. Taking value and price into account to select the ‘best value for money’ bid results in adopting a structured multicriteria approach. An alternative contractor selection method is presented, which

  2. Binding Mechanisms in Selective Laser Sintering and Selective Laser Melting

    NARCIS (Netherlands)

    Kruth, J.P.; Mercelis, P.; Van Vaerenbergh, J.; van Vaerenbergh, J.; Froyen, L.; Rombouts, M.


    Purpose – This paper provides an overview of the different binding mechanisms in selective laser sintering (SLS) and selective laser melting (SLM), thus improving the understanding of these processes. Design/methodology/approach – A classification of SLS/SLM processes was developed, based on the

  3. Selection of Air Terminal Device

    DEFF Research Database (Denmark)

    Nielsen, Peter V.

    This paper discusses the selection of the air terminal device for the experiments and numerical prediction in the International Energy Agency Annex 20 work: Air Flow Pattern within Buildings,......This paper discusses the selection of the air terminal device for the experiments and numerical prediction in the International Energy Agency Annex 20 work: Air Flow Pattern within Buildings,...

  4. Conditional control in visual selection

    NARCIS (Netherlands)

    van Zoest, Wieske; Van der Stigchel, Stefan; Donk, Mieke


    Attention and eye movements provide a window into the selective processing of visual information. Evidence suggests that selection is influenced by various factors and is not always under the strategic control of the observer. The aims of this tutorial review are to give a brief introduction to eye

  5. Genomic selection in dairy cattle

    NARCIS (Netherlands)

    Roos, de A.P.W.


    The objectives of this Ph.D. thesis were (1) to optimise genomic selection in dairy cattle with respect to the accuracy of predicting total genetic merit and (2) to optimise a dairy cattle breeding program using genomic selection. The study was performed using a combination of real data sets and

  6. Exo selective enantioselective nitrone cycloadditions. (United States)

    Sibi, Mukund P; Ma, Zhihua; Jasperse, Craig P


    We have developed a novel method for accessing exo adducts with high enantioselectivity in nitrone cycloadditions to enoates. Pyrazolidinones proved to be effective achiral templates in the cycloadditions, providing exo adducts typically in >15:1 selectivity and 90-98% ee. The use of Lewis acids that form square planar complexes, such as copper triflate, was important for obtaining high exo selectivity.

  7. Selective Mutism in Elementary Students (United States)

    Hahn, Jennifer Joy


    Selective mutism is defined as "the consistent failure to speak in specific social situations despite the ability to speak in other settings" (American Psychiatric Association, 1994 as cited in Zelenko & Shaw, 2000). For many years, selective mutism was considered to be a very rare disorder amongst individuals, and little attention…

  8. Interviews with Selectively Mute Children (United States)

    Omdal, Heidi; Galloway, David


    The assessment of selective mutism usually takes place in a clinic, where the child often refuses to speak to the therapist. The challenge when trying to understand the child's own perspective is to find a medium for communication. Three selectively mute children were interviewed using Raven's Controlled Projection for Children (RCPC). The…

  9. Advertising media selection and planning

    NARCIS (Netherlands)

    Moorman, M.; Neijens, P.C.; Smit, E.G.; Belch, M.A.; Belch, G.E.


    Reach, frequency, and timing are key concepts in selecting TV, radio, newspapers, magazines, out-of-home, direct mail, Internet, and other media for advertising campaigns. We discuss these concepts and their role in media selection and media planning processes. We also describe media and audience

  10. Model selection in periodic autoregressions

    NARCIS (Netherlands)

    Ph.H.B.F. Franses (Philip Hans); R. Paap (Richard)


    textabstractThis paper focuses on the issue of period autoagressive time series models (PAR) selection in practice. One aspect of model selection is the choice for the appropriate PAR order. This can be of interest for the valuation of economic models. Further, the appropriate PAR order is important

  11. Selective attention without a neocortex. (United States)

    Krauzlis, Richard J; Bogadhi, Amarender R; Herman, James P; Bollimunta, Anil


    Selective attention refers to the ability to restrict neural processing and behavioral responses to a relevant subset of available stimuli, while simultaneously excluding other valid stimuli from consideration. In primates and other mammals, descriptions of this ability typically emphasize the neural processing that takes place in the cerebral neocortex. However, non-mammals such as birds, reptiles, amphibians and fish, which completely lack a neocortex, also have the ability to selectively attend. In this article, we survey the behavioral evidence for selective attention in non-mammals, and review the midbrain and forebrain structures that are responsible. The ancestral forms of selective attention are presumably selective orienting behaviors, such as prey-catching and predator avoidance. These behaviors depend critically on a set of subcortical structures, including the optic tectum (OT), thalamus and striatum, that are highly conserved across vertebrate evolution. In contrast, the contributions of different pallial regions in the forebrain to selective attention have been subject to more substantial changes and reorganization. This evolutionary perspective makes plain that selective attention is not a function achieved de novo with the emergence of the neocortex, but instead is implemented by circuits accrued and modified over hundreds of millions of years, beginning well before the forebrain contained a neocortex. Determining how older subcortical circuits interact with the more recently evolved components in the neocortex will likely be crucial for understanding the complex properties of selective attention in primates and other mammals, and for identifying the etiology of attention disorders. Published by Elsevier Ltd.

  12. Natural selection promotes antigenic evolvability

    NARCIS (Netherlands)

    Graves, C.J.; Ros, V.I.D.; Stevenson, B.; Sniegowski, P.D.; Brisson, D.


    The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide

  13. Selection effects in forensic science

    NARCIS (Netherlands)

    Franx, G.J.; Gennip, van Yves; Hochs, P.; Nuyens, M.; Palla, L.; Quant, C.; Trapman, P.; Berg, van den J.B.; Bhulai, S.; Hulshof, J.; Koole, G.; Quant, C.; Williams, J.F.


    In this report we consider the following question: does a forensic expert need to know exactly how the evidential material was selected? We set up a few simple models of situations in which the way evidence is selected may influence its value in court. Although reality is far from a probabilistic

  14. Partner selection and Hollywood Films

    DEFF Research Database (Denmark)

    Grodal, Torben Kragh; Kramer, Mette


    Based on cognitive, neurological and evolutionary based film theory the article describes the representation of partner selection in Hollywood films. It analyses paradigm scenarios of partner selection and love, It further describes some of those mechanisms that regulate the relation between...

  15. Selecting a Cable System Operator. (United States)

    Cable Television Information Center, Washington, DC.

    Intended to assist franchising authorities with the process of selecting a cable television system operator from franchise applicants, this document provides a framework for analysis of individual applications. Section 1 deals with various methods which can be used to select an operator. The next section covers the application form, the vehicle a…

  16. Sexual selection in marine plankton

    DEFF Research Database (Denmark)

    Sichlau, Mie Hylstofte

    Copepods are among the most abundant metazoans on the planet and play an important role in the marine food web. Many aspects of their ecology have consequently been studied, including details of their reproductive biology and mating behaviour. Sexual selection, the part of evolution which selects...

  17. Comparing Patterns of Natural Selection Across Species Using Selective Signatures

    Energy Technology Data Exchange (ETDEWEB)

    Alm, Eric J.; Shapiro, B. Jesse; Alm, Eric J.


    Comparing gene expression profiles over many different conditions has led to insights that were not obvious from single experiments. In the same way, comparing patterns of natural selection across a set of ecologically distinct species may extend what can be learned from individual genome-wide surveys. Toward this end, we show how variation in protein evolutionary rates, after correcting for genome-wide effects such as mutation rate and demographic factors, can be used to estimate the level and types of natural selection acting on genes across different species. We identify unusually rapidly and slowly evolving genes, relative to empirically derived genome-wide and gene family-specific background rates for 744 core protein families in 30 gamma-proteobacterial species. We describe the pattern of fast or slow evolution across species as the 'selective signature' of a gene. Selective signatures represent a profile of selection across species that is predictive of gene function: pairs of genes with correlated selective signatures are more likely to share the same cellular function, and genes in the same pathway can evolve in concert. For example, glycolysis and phenylalanine metabolism genes evolve rapidly in Idiomarina loihiensis, mirroring an ecological shift in carbon source from sugars to amino acids. In a broader context, our results suggest that the genomic landscape is organized into functional modules even at the level of natural selection, and thus it may be easier than expected to understand the complex evolutionary pressures on a cell.

  18. Comparing Patterns of Natural Selection across Species Using Selective Signatures

    Energy Technology Data Exchange (ETDEWEB)

    Shapiro, Jesse; Alm, Eric J.


    Comparing gene expression profiles over many different conditions has led to insights that were not obvious from single experiments. In the same way, comparing patterns of natural selection across a set of ecologically distinct species may extend what can be learned from individual genome-wide surveys. Toward this end, we show how variation in protein evolutionary rates, after correcting for genome-wide effects such as mutation rate and demographic factors, can be used to estimate the level and types of natural selection acting on genes across different species. We identify unusually rapidly and slowly evolving genes, relative to empirically derived genome-wide and gene family-specific background rates for 744 core protein families in 30 c-proteobacterial species. We describe the pattern of fast or slow evolution across species as the"selective signature" of a gene. Selective signatures represent aprofile of selection across species that is predictive of gene function: pairs of genes with correlated selective signatures are more likely to share the same cellular function, and genes in the same pathway can evolve in concert. For example,glycolysis and phenylalanine metabolism genes evolve rapidly in Idiomarina loihiensis, mirroring an ecological shift in carbon source from sugars to amino acids. In a broader context, our results suggest that the genomic landscape is organized into functional modules even at the level of natural selection, and thus it may be easier than expected to understand the complex evolutionary pressures on a cell.

  19. Selection for components of complex characteristics - indirect selection

    International Nuclear Information System (INIS)

    Haensel, H.


    A hierarchy of complexity exists in plant characteristics. The efficiency of indirect selection for a complex characteristic by a sub-trait depends on the heritability of the complex characteristic (hsub(c)), the heritability of the sub-trait (hsub(s)), and the genotypic correlation between sub-trait and complex characteristic (rsub(s.c)). In 1961 hsub(s)Xrsub(s.c)>hsub(c) was postulated, when indirect selection becomes more efficient than direct selection. Numerical examples for this relationship are given and a table for indirect selection for yield in wheat is elaborated. Efficiency ranking of sub-traits in indirect selection may change with climate, conditions of cultivation, the level of other sub-traits, the level of the complex characteristic already reached by breeding, and the breeding material. An example shows that regression analysis for different sub-traits on the same complex characteristic, and an estimation of the differences of the within - and the between - variety slopes, may help to select the more efficient sub-trait. In another example, where simultaneous selection was made for two polygenic characteristics, one directly and the other indirectly by two sub-traits, less than half the F 5 -lines had to be continued, when using the more efficient sub-trait. (author)

  20. Lines of Descent Under Selection (United States)

    Baake, Ellen; Wakolbinger, Anton


    We review recent progress on ancestral processes related to mutation-selection models, both in the deterministic and the stochastic setting. We mainly rely on two concepts, namely, the killed ancestral selection graph and the pruned lookdown ancestral selection graph. The killed ancestral selection graph gives a representation of the type of a random individual from a stationary population, based upon the individual's potential ancestry back until the mutations that define the individual's type. The pruned lookdown ancestral selection graph allows one to trace the ancestry of individuals from a stationary distribution back into the distant past, thus leading to the stationary distribution of ancestral types. We illustrate the results by applying them to a prototype model for the error threshold phenomenon.

  1. Drug product selection: legal issues. (United States)

    Christensen, T P; Kirking, D M; Ascione, F J; Welage, L S; Gaither, C A


    To review the potential legal liability of the pharmacist in the drug product selection process. Published articles identified through MEDLINE, published law reviews identified through InfoTrac, and appellate court decisions. Search terms used included pharmacist liability, drug product selection, and generic substitution. Additional articles, books, and appellate court decisions were identified from the bibliographies of retrieved articles and citations in appellate court decisions. Pharmacists engaging in drug product selection are civilly liable under three legal theories: negligence, express or implied warranties, and strict product liability. Potential criminal liability includes prosecution for insurance fraud, deceptive business practices, and violation of state drug product selection laws and regulation. Pharmacists increase their liability when engaging in drug product selection, but the increase is small. Still, the law continues to evolve as pharmacists seek expanded roles and responsibilities. When courts give closer examination to pharmacists' expanded role, it is likely that pharmacists' liability will increase.

  2. Benchmarking Variable Selection in QSAR. (United States)

    Eklund, Martin; Norinder, Ulf; Boyer, Scott; Carlsson, Lars


    Variable selection is important in QSAR modeling since it can improve model performance and transparency, as well as reduce the computational cost of model fitting and predictions. Which variable selection methods that perform well in QSAR settings is largely unknown. To address this question we, in a total of 1728 benchmarking experiments, rigorously investigated how eight variable selection methods affect the predictive performance and transparency of random forest models fitted to seven QSAR datasets covering different endpoints, descriptors sets, types of response variables, and number of chemical compounds. The results show that univariate variable selection methods are suboptimal and that the number of variables in the benchmarked datasets can be reduced with about 60 % without significant loss in model performance when using multivariate adaptive regression splines MARS and forward selection. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Selective Serotonin Reuptake Inhibitors for Treatment of Selective Mutism

    Directory of Open Access Journals (Sweden)

    Mazlum Çöpür


    Full Text Available Some authors suggest that selective mutism should be considered as a variant of social phobia or a disorder in the obsessive-compulsive spectrum. Recent studies indicate that pharmacological treatments may be effective in the treatment of selective mutism. In this article, four cases who were treated with citalopram and escitalopram are presented. The results indicate that the drugs were well tolerated, and the level of social and verbal interactions improved significantly. These findings have shown that citalopram and escitalopram can be considered in medication of selective mutism; nevertheless, it is essential that research be done with more cases than previous ones, in order to prove their accuracy

  4. Improved Inhibition of Telomerase by Short Twisted Intercalating Nucleic Acids under Molecular Crowding Conditions

    DEFF Research Database (Denmark)

    Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich


    Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...

  5. Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.


    Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  6. Measurement invariance versus selection invariance: Is fair selection possible?

    NARCIS (Netherlands)

    Borsboom, D.; Romeijn, J.W.; Wicherts, J.M.


    This article shows that measurement invariance (defined in terms of an invariant measurement model in different groups) is generally inconsistent with selection invariance (defined in terms of equal sensitivity and specificity across groups). In particular, when a unidimensional measurement

  7. Measurement invariance versus selection invariance : Is fair selection possible?

    NARCIS (Netherlands)

    Borsboom, Denny; Romeijn, Jan-Willem; Wicherts, Jelte M.

    This article shows that measurement invariance (defined in terms of an invariant measurement model in different groups) is generally inconsistent with selection invariance (defined in terms of equal sensitivity and specificity across groups). In particular, when a unidimensional measurement

  8. A checkerboard selective absorber with excellent spectral selectivity

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Liu, E-mail: [Centre for Optical and Electromagnetic Research, State Key Laboratory of Modern Optical Instrumentation, Zhejiang University, Hangzhou 310058 (China); School of Electrical, Computer, and Engineering, Arizona State University, Tempe, Arizona 85287 (United States); Mo, Lei; Chen, Tuo [Centre for Optical and Electromagnetic Research, State Key Laboratory of Modern Optical Instrumentation, Zhejiang University, Hangzhou 310058 (China); Department of Physics, Zhejiang University, Hangzhou 310027 (China); Forsberg, Erik [Centre for Optical and Electromagnetic Research, State Key Laboratory of Modern Optical Instrumentation, Zhejiang University, Hangzhou 310058 (China); He, Sailing [Centre for Optical and Electromagnetic Research, State Key Laboratory of Modern Optical Instrumentation, Zhejiang University, Hangzhou 310058 (China); Department of Electromagnetic Engineering, JORCEP, Roy Institute of Technology (KTH), S-100 44 Stockholm (Sweden)


    A selective absorber with excellent spectral selectivity is proposed and analyzed. The absorber is based on a germanium (Ge) checkerboard on top of a tantalum (Ta) substrate. At wavelengths shorter than the 1.2 μm cutoff, a very high absorption is achieved due to strong cavity resonances in the Ge nanosquares, and their interactions with adjacent nanocavities and the bottom Ta substrate. At longer wavelengths, absorption is greatly suppressed due to destructive interference between the transparent checkerboard layer and the highly reflective Ta substrate. To better describe the superior selectivity of our configuration, a new figure of merit (FOM) is introduced. We observe a FOM value of 0.88 compared to 0.69 for its planar counterpart. We also conduct a thermal analysis to verify the excellent selectivity of our absorber. A high temperature can be achieved and maintained, promising good potential for applications in solar thermophotovoltaic systems.

  9. Variable Selection via Partial Correlation. (United States)

    Li, Runze; Liu, Jingyuan; Lou, Lejia


    Partial correlation based variable selection method was proposed for normal linear regression models by Bühlmann, Kalisch and Maathuis (2010) as a comparable alternative method to regularization methods for variable selection. This paper addresses two important issues related to partial correlation based variable selection method: (a) whether this method is sensitive to normality assumption, and (b) whether this method is valid when the dimension of predictor increases in an exponential rate of the sample size. To address issue (a), we systematically study this method for elliptical linear regression models. Our finding indicates that the original proposal may lead to inferior performance when the marginal kurtosis of predictor is not close to that of normal distribution. Our simulation results further confirm this finding. To ensure the superior performance of partial correlation based variable selection procedure, we propose a thresholded partial correlation (TPC) approach to select significant variables in linear regression models. We establish the selection consistency of the TPC in the presence of ultrahigh dimensional predictors. Since the TPC procedure includes the original proposal as a special case, our theoretical results address the issue (b) directly. As a by-product, the sure screening property of the first step of TPC was obtained. The numerical examples also illustrate that the TPC is competitively comparable to the commonly-used regularization methods for variable selection.

  10. Contemporary views on selective mutism

    Directory of Open Access Journals (Sweden)

    Dimoski Sanja


    Full Text Available The aim of this paper is to review contemporary literature on selective mutism (SM, available in our language. The paper includes a contemporary definition of the disorder, previous studies of selective mutism, theories about its origin, and treatment. SM is a disorder that occurs in childhood, when a child's speech is selectively lacking in certain social situations. School is the context in which the disorder is typically manifested, which is why SM is often diagnosed only after children start school. The paper gives a historical account of changes in views on this disorder. Modern conceptions emphasize selective inability of children to spontaneously and successfully express themselves verbally. In researching SM, case studies on children who have selective mutism are most commonly published. Etiological factors are not precisely defined, and different conceptions give their interpretations depending on various theoretical frameworks. Some studies consistently indicate a relation between SM and social anxiety, and some with opposing behavior and delays in language development. Based on theoretical explanations of SM, psychological interventions (behavioral and cognitive-behavioral, psychodynamic and projective techniques, counseling and family therapy are created. Modern treatment of selective mutism includes an eclectic approach and emphasizes the role of teachers and school in general. Future studies should deepen the knowledge about selective mutism, specify the methodological procedure and stimulate the individualized treatment of children with SM.

  11. Sexual selection protects against extinction. (United States)

    Lumley, Alyson J; Michalczyk, Łukasz; Kitson, James J N; Spurgin, Lewis G; Morrison, Catriona A; Godwin, Joanne L; Dickinson, Matthew E; Martin, Oliver Y; Emerson, Brent C; Chapman, Tracey; Gage, Matthew J G


    Reproduction through sex carries substantial costs, mainly because only half of sexual adults produce offspring. It has been theorized that these costs could be countered if sex allows sexual selection to clear the universal fitness constraint of mutation load. Under sexual selection, competition between (usually) males and mate choice by (usually) females create important intraspecific filters for reproductive success, so that only a subset of males gains paternity. If reproductive success under sexual selection is dependent on individual condition, which is contingent to mutation load, then sexually selected filtering through 'genic capture' could offset the costs of sex because it provides genetic benefits to populations. Here we test this theory experimentally by comparing whether populations with histories of strong versus weak sexual selection purge mutation load and resist extinction differently. After evolving replicate populations of the flour beetle Tribolium castaneum for 6 to 7 years under conditions that differed solely in the strengths of sexual selection, we revealed mutation load using inbreeding. Lineages from populations that had previously experienced strong sexual selection were resilient to extinction and maintained fitness under inbreeding, with some families continuing to survive after 20 generations of sib × sib mating. By contrast, lineages derived from populations that experienced weak or non-existent sexual selection showed rapid fitness declines under inbreeding, and all were extinct after generation 10. Multiple mutations across the genome with individually small effects can be difficult to clear, yet sum to a significant fitness load; our findings reveal that sexual selection reduces this load, improving population viability in the face of genetic stress.

  12. Selective Audiovisual Semantic Integration Enabled by Feature-Selective Attention. (United States)

    Li, Yuanqing; Long, Jinyi; Huang, Biao; Yu, Tianyou; Wu, Wei; Li, Peijun; Fang, Fang; Sun, Pei


    An audiovisual object may contain multiple semantic features, such as the gender and emotional features of the speaker. Feature-selective attention and audiovisual semantic integration are two brain functions involved in the recognition of audiovisual objects. Humans often selectively attend to one or several features while ignoring the other features of an audiovisual object. Meanwhile, the human brain integrates semantic information from the visual and auditory modalities. However, how these two brain functions correlate with each other remains to be elucidated. In this functional magnetic resonance imaging (fMRI) study, we explored the neural mechanism by which feature-selective attention modulates audiovisual semantic integration. During the fMRI experiment, the subjects were presented with visual-only, auditory-only, or audiovisual dynamical facial stimuli and performed several feature-selective attention tasks. Our results revealed that a distribution of areas, including heteromodal areas and brain areas encoding attended features, may be involved in audiovisual semantic integration. Through feature-selective attention, the human brain may selectively integrate audiovisual semantic information from attended features by enhancing functional connectivity and thus regulating information flows from heteromodal areas to brain areas encoding the attended features.

  13. Natural selection. VII. History and interpretation of kin selection theory. (United States)

    Frank, S A


    Kin selection theory is a kind of causal analysis. The initial form of kin selection ascribed cause to costs, benefits and genetic relatedness. The theory then slowly developed a deeper and more sophisticated approach to partitioning the causes of social evolution. Controversy followed because causal analysis inevitably attracts opposing views. It is always possible to separate total effects into different component causes. Alternative causal schemes emphasize different aspects of a problem, reflecting the distinct goals, interests and biases of different perspectives. For example, group selection is a particular causal scheme with certain advantages and significant limitations. Ultimately, to use kin selection theory to analyse natural patterns and to understand the history of debates over different approaches, one must follow the underlying history of causal analysis. This article describes the history of kin selection theory, with emphasis on how the causal perspective improved through the study of key patterns of natural history, such as dispersal and sex ratio, and through a unified approach to demographic and social processes. Independent historical developments in the multivariate analysis of quantitative traits merged with the causal analysis of social evolution by kin selection. © 2013 The Author. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.

  14. Molecular Signatures of Natural Selection

    DEFF Research Database (Denmark)

    Nielsen, Rasmus


    provide important functional information. This review provides a nonmathematical description of the issues involved in detecting selection from DNA sequences and SNP data and is intended for readers who are not familiar with population genetic theory. Particular attention is placed on issues relating......There is an increasing interest in detecting genes, or genomic regions, that have been targeted by natural selection. The interest stems from a basic desire to learn more about evolutionary processes in humans and other organisms, and from the realization that inferences regarding selection may...

  15. Pedagogical basement of sport selection.

    Directory of Open Access Journals (Sweden)

    Abdullaev A.K.


    Full Text Available We consider the problem of relevance, goals, objectives psychological selection of sports heroes. The analysis of the literature reveals the stages of the selection of fighters, revealed three interdependent parts of the selection of athletes as part of the wrestling coach. Established that the content and focus of initial training for wrestling must meet age, stage of training, the level of preparedness practitioners. So it is proved that the intellectual sphere of athletes is mediocre and the average level of development.

  16. Selecting practice management information systems. (United States)

    Worley, R; Ciotti, V


    Despite enormous advances in information systems, the process by which most medical practices select them has remained virtually unchanged for decades: the request for proposal (RFP). Unfortunately, vendors have learned ways to minimize the value of RFP checklists to where purchasers now learn little about the system functionality. The authors describe a selection methodology that replaces the RFP with scored demos, reviews of vendor user manuals and mathematically structured reference checking. In a recent selection process at a major medical center, these techniques yielded greater user buy-in and favorable contract terms as well.

  17. Mannuronic Acids : Reactivity and Selectivity

    NARCIS (Netherlands)

    Codee, Jeroen D. C.; Walvoort, Marthe T. C.; de Jong, Ana-Rae; Lodder, Gerrit; Overkleeft, Herman S.; van der Marel, Gijsbert A.


    This review describes our recent studies toward the reactivity and selectivity of mannopyranosyl uronic acid donors, which have been found to be very powerful donors for the construction of beta-mannosidic linkages.

  18. Strategic Vision: A Selected Bibliography

    National Research Council Canada - National Science Library

    Moyer, Jeannette


    Strategic Vision is an enduring theme at the U.S. Army War College. Compiled in support of this theme, this selected bibliography reflects books, documents, periodical articles, and a number of web sites...

  19. Selected topics in nuclear structure

    International Nuclear Information System (INIS)


    The collection of abstracts on selected topics in nuclear structure are given. Special attention pays to collective excitations and high-spin states of nuclei, giant resonance structure, nuclear reaction mechanisms and so on

  20. Technique Selectively Represses Immune System (United States)

    ... Research Matters December 3, 2012 Technique Selectively Represses Immune System Myelin (green) encases and protects nerve fibers (brown). A new technique prevents the immune system from attacking myelin in a mouse model of ...

  1. Selecting and Buying Educational Software. (United States)

    Ahl, David H.


    Guidelines for selecting/buying educational software are discussed under the following headings: educational soundness; appropriateness; challenge and progress; motivation and reward; correctness; compatibility with systems; instructions and handlings. Includes several sources of software reviews. (JN)

  2. Selecting Landscape Plants: Shade Trees


    Relf, Diane; Appleton, Bonnie Lee, 1948-2012; Close, David


    Because of the permanency of trees and their importance in the landscape, care must be taken to select the best species for each situation. This publication goes over how to choose landscape trees that are shade tolerant.

  3. Optimal selection of TLD chips

    International Nuclear Information System (INIS)

    Phung, P.; Nicoll, J.J.; Edmonds, P.; Paris, M.; Thompson, C.


    Large sets of TLD chips are often used to measure beam dose characteristics in radiotherapy. A sorting method is presented to allow optimal selection of chips from a chosen set. This method considers the variation

  4. Species selection for smallholder aquaculture


    Brummett, R.E.


    Systems for selection of species for smallholder aquaculture are presented. These are: food fits; management decisions; and economic criteria. Food fits suggests categorizing pond food resources into a few categories based loosely on the instrinsic traits of food which effect their selectivity by predators. Using management decision techniques, potential polycultures might also be compared with each other and with monoculture. Under economic criteria (and for species known in local markets), ...

  5. Selective functionalization of carbon nanotubes (United States)

    Strano, Michael S. (Inventor); Usrey, Monica (Inventor); Barone, Paul (Inventor); Dyke, Christopher A. (Inventor); Tour, James M. (Inventor); Kittrell, W. Carter (Inventor); Hauge, Robert H. (Inventor); Smalley, Richard E. (Inventor)


    The present invention is directed toward methods of selectively functionalizing carbon nanotubes of a specific type or range of types, based on their electronic properties, using diazonium chemistry. The present invention is also directed toward methods of separating carbon nanotubes into populations of specific types or range(s) of types via selective functionalization and electrophoresis, and also to the novel compositions generated by such separations.

  6. Contractor Selection in Saudi Arabia


    M. A. Bajaber; M. A. Taha


    Contractor selection in Saudi Arabia is very important due to the large construction boom and the contractor role to get over construction risks. The need for investigating contractor selection is due to the following reasons; large number of defaulted or failed projects (18%), large number of disputes attributed to contractor during the project execution stage (almost twofold), the extension of the General Agreement on Tariffs and Trade (GATT) into construction industry, and finally the few ...

  7. A Heckman Selection- t Model

    KAUST Repository

    Marchenko, Yulia V.


    Sample selection arises often in practice as a result of the partial observability of the outcome of interest in a study. In the presence of sample selection, the observed data do not represent a random sample from the population, even after controlling for explanatory variables. That is, data are missing not at random. Thus, standard analysis using only complete cases will lead to biased results. Heckman introduced a sample selection model to analyze such data and proposed a full maximum likelihood estimation method under the assumption of normality. The method was criticized in the literature because of its sensitivity to the normality assumption. In practice, data, such as income or expenditure data, often violate the normality assumption because of heavier tails. We first establish a new link between sample selection models and recently studied families of extended skew-elliptical distributions. Then, this allows us to introduce a selection-t (SLt) model, which models the error distribution using a Student\\'s t distribution. We study its properties and investigate the finite-sample performance of the maximum likelihood estimators for this model. We compare the performance of the SLt model to the conventional Heckman selection-normal (SLN) model and apply it to analyze ambulatory expenditures. Unlike the SLNmodel, our analysis using the SLt model provides statistical evidence for the existence of sample selection bias in these data. We also investigate the performance of the test for sample selection bias based on the SLt model and compare it with the performances of several tests used with the SLN model. Our findings indicate that the latter tests can be misleading in the presence of heavy-tailed data. © 2012 American Statistical Association.

  8. Global Sourcing and Firm Selection

    DEFF Research Database (Denmark)

    Kohler, Wilhelm; Smolka, Marcel


    We analyze the sourcing strategies of firms active in the Spanish manufacturing sector. We show that firms that select strategies of vertical integration and of foreign sourcing ex post tend to have been more productive, ex ante, than other firms.......We analyze the sourcing strategies of firms active in the Spanish manufacturing sector. We show that firms that select strategies of vertical integration and of foreign sourcing ex post tend to have been more productive, ex ante, than other firms....

  9. Sexual selection protects against extinction


    Lumley, Alyson; Michalczyk, Lukasz; Kitson, James; Spurgin, Lewis; Morrison, Catriona; Godwin, Joanne; Dickinson, Matthew; Martin, Oliver; Emerson, Brent; Chapman, Tracey; Gage, Matthew


    Reproduction through sex carries substantial costs, mainly because only half of sexual adults produce offspring. It has been theorised that these costs could be countered if sex allows sexual selection to clear the universal fitness constraint of mutation load. Under sexual selection, competition between (usually) males, and mate choice by (usually) females create important intraspecific filters for reproductive success, so that only a subset of males gains paternity. If reproductive success ...

  10. Natural selection promotes antigenic evolvability. (United States)

    Graves, Christopher J; Ros, Vera I D; Stevenson, Brian; Sniegowski, Paul D; Brisson, Dustin


    The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios) and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish chronic infections.

  11. Natural selection promotes antigenic evolvability.

    Directory of Open Access Journals (Sweden)

    Christopher J Graves

    Full Text Available The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish

  12. The ancestral selection graph under strong directional selection. (United States)

    Pokalyuk, Cornelia; Pfaffelhuber, Peter


    The ancestral selection graph (ASG) was introduced by  Neuhauser and Krone (1997) in order to study populations of constant size which evolve under selection. Coalescence events, which occur at rate 1 for every pair of lines, lead to joint ancestry. In addition, splitting events in the ASG at rate α, the scaled selection coefficient, produce possible ancestors, such that the real ancestor depends on the ancestral alleles. Here, we use the ASG in the case without mutation in order to study fixation of a beneficial mutant. Using our main tool, a reversibility property of the ASG, we provide a new proof of the fact that a beneficial allele fixes roughly in time (2logα)/α if α is large. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Feature-selective attention in healthy old age: a selective decline in selective attention? (United States)

    Quigley, Cliodhna; Müller, Matthias M


    Deficient selection against irrelevant information has been proposed to underlie age-related cognitive decline. We recently reported evidence for maintained early sensory selection when older and younger adults used spatial selective attention to perform a challenging task. Here we explored age-related differences when spatial selection is not possible and feature-selective attention must be deployed. We additionally compared the integrity of feedforward processing by exploiting the well established phenomenon of suppression of visual cortical responses attributable to interstimulus competition. Electroencephalogram was measured while older and younger human adults responded to brief occurrences of coherent motion in an attended stimulus composed of randomly moving, orientation-defined, flickering bars. Attention was directed to horizontal or vertical bars by a pretrial cue, after which two orthogonally oriented, overlapping stimuli or a single stimulus were presented. Horizontal and vertical bars flickered at different frequencies and thereby elicited separable steady-state visual-evoked potentials, which were used to examine the effect of feature-based selection and the competitive influence of a second stimulus on ongoing visual processing. Age differences were found in feature-selective attentional modulation of visual responses: older adults did not show consistent modulation of magnitude or phase. In contrast, the suppressive effect of a second stimulus was robust and comparable in magnitude across age groups, suggesting that bottom-up processing of the current stimuli is essentially unchanged in healthy old age. Thus, it seems that visual processing per se is unchanged, but top-down attentional control is compromised in older adults when space cannot be used to guide selection.

  14. Materials Selection for Aerospace Systems (United States)

    Arnold, Steven M.; Cebon, David; Ashby, Mike


    A systematic design-oriented, five-step approach to material selection is described: 1) establishing design requirements, 2) material screening, 3) ranking, 4) researching specific candidates and 5) applying specific cultural constraints to the selection process. At the core of this approach is the definition performance indices (i.e., particular combinations of material properties that embody the performance of a given component) in conjunction with material property charts. These material selection charts, which plot one property against another, are introduced and shown to provide a powerful graphical environment wherein one can apply and analyze quantitative selection criteria, such as those captured in performance indices, and make trade-offs between conflicting objectives. Finding a material with a high value of these indices maximizes the performance of the component. Two specific examples pertaining to aerospace (engine blades and pressure vessels) are examined, both at room temperature and elevated temperature (where time-dependent effects are important) to demonstrate the methodology. The discussion then turns to engineered/hybrid materials and how these can be effectively tailored to fill in holes in the material property space, so as to enable innovation and increases in performance as compared to monolithic materials. Finally, a brief discussion is presented on managing the data needed for materials selection, including collection, analysis, deployment, and maintenance issues.

  15. Visuospatial selective attention in chickens. (United States)

    Sridharan, Devarajan; Ramamurthy, Deepa L; Schwarz, Jason S; Knudsen, Eric I


    Voluntary control of attention promotes intelligent, adaptive behaviors by enabling the selective processing of information that is most relevant for making decisions. Despite extensive research on attention in primates, the capacity for selective attention in nonprimate species has never been quantified. Here we demonstrate selective attention in chickens by applying protocols that have been used to characterize visual spatial attention in primates. Chickens were trained to localize and report the vertical position of a target in the presence of task-relevant distracters. A spatial cue, the location of which varied across individual trials, indicated the horizontal, but not vertical, position of the upcoming target. Spatial cueing improved localization performance: accuracy (d') increased and reaction times decreased in a space-specific manner. Distracters severely impaired perceptual performance, and this impairment was greatly reduced by spatial cueing. Signal detection analysis with an "indecision" model demonstrated that spatial cueing significantly increased choice certainty in localizing targets. By contrast, error-aversion certainty (certainty of not making an error) remained essentially constant across cueing protocols, target contrasts, and individuals. The results show that chickens shift spatial attention rapidly and dynamically, following principles of stimulus selection that closely parallel those documented in primates. The findings suggest that the mechanisms that control attention have been conserved through evolution, and establish chickens--a highly visual species that is easily trained and amenable to cutting-edge experimental technologies--as an attractive model for linking behavior to neural mechanisms of selective attention.

  16. Selective solvent extraction of oils

    Energy Technology Data Exchange (ETDEWEB)


    In the selective solvent extraction of naphthenic base oils, the solvent used consists of the extract obtained by treating a paraffinic base oil with a selective solvent. The extract, or partially spent solvent is less selective than the solvent itself. Selective solvents specified for the extraction of the paraffinic base oil are phenol, sulphur dioxide, cresylic acid, nitrobenzene, B:B/sup 1/-dichlorethyl ether, furfural, nitroaniline and benzaldehyde. Oils treated are Coastal lubricating oils, or naphthenic oils from the cracking, or destructive hydrogenation of coal, tar, lignite, peat, shale, bitumen, or petroleum. The extraction may be effected by a batch or counter-current method, and in the presence of (1) liquefied propane, or butane, or naphtha, or (2) agents which modify the solvent power such as, water, ammonia, acetonitrile, glycerine, glycol, caustic soda or potash. Treatment (2) may form a post-treatment effected on the extract phase. In counter-current treatment in a tower some pure selective solvent may be introduced near the raffinate outlet to wash out any extract therefrom.

  17. In Silico Molecular Docking Analysis of Natural Pyridoacridines as Anticancer Agents

    Directory of Open Access Journals (Sweden)

    Vikas Sharma


    Full Text Available Docking studies are proved to be an essential tool that facilitates the structural diversity of natural products to be harnessed in an organized manner. In this study, pyridoacridines containing natural anticancer pigments were subjected to docking studies using Glide (Schrodinger. Investigations were carried out to find out the potential molecular targets for these selected pigments. The docking was carried out on different cancer macromolecules involved in different cell cycle pathways, that is, CDK-2, CDK-6, Bcl-2, VEGFR-2, IGF-1R kinase, and G-Quadruplexes. CDK-6 was found to be the most suitable anticancer target for the pyridoacridines. In addition, effectiveness of the study was further evaluated by performing docking of known inhibitors against their respective selected macromolecules. However, the results are preliminary and experimental evaluation will be carried out in near future.

  18. Treatment of selective mutism: focus on selective serotonin reuptake inhibitors. (United States)

    Kaakeh, Yaman; Stumpf, Janice L


    Abstract Selective mutism is a pediatric psychiatric disorder that occurs when a child consistently fails to speak in specific situations in which speaking is expected, such as at school and social gatherings, but speaks appropriately in other settings. Selective mutism often is diagnosed when a child starts school and does not talk to teachers or peers, but talks to family members at home; the condition is frequently accompanied by anxiety and shyness. Although the underlying etiology of the condition remains unclear, psychotherapy is the preferred initial treatment, with the support of parents and teachers. If the child does not respond to psychotherapy, addition of pharmacologic treatment should be considered, depending on the severity of symptoms and presence of other illnesses. Although data are limited to case reports and trials with small patient populations and short follow-up periods, some patients with selective mutism respond to therapy with selective serotonin reuptake inhibitors (SSRIs). Fluoxetine is the most studied SSRI as treatment for the condition, although further investigation is required to determine the optimal dosage and duration of therapy.

  19. Directed evolution: selecting today's biocatalysts : selecting today's biocatalysts

    NARCIS (Netherlands)

    Otten, Linda; Quax, Wim


    Directed evolution has become a full-grown tool in molecular biology nowadays. The methods that are involved in creating a mutant library are extensive and can be divided into several categories according to their basic ideas. Furthermore, both screening and selection can be used to target the

  20. Selective carnivory by Euphausia lucens (United States)

    Gibbons, M. J.; Pillar, S. C.; Stuart, V.


    Stomach contents of adult Euphausia lucens were analysed to determine what criteria this euphausiid uses to select copepod prey. The results indicate that although E. lucens of all sizes ingest a wide range of prey sizes at apparently ambient proportions, small copepods (e.g. Oithona) are consistently consumed in greater than ambient amounts. Small copepods (especially Oithona) are known to move slowly, and have been shown to be more susceptible to predation via negative pressure than larger copepods. In the presence of an abundant phytoplankton food supply and in an otherwise generally non-selective diet, we conclude that such copepod selection by E. lucens is passive. This is in line with the idea of a non-hunting, preferentially herbivorous zooplankter.

  1. Site selection: Past and present

    International Nuclear Information System (INIS)

    Tilford, N.R.


    Site selection has been going on since the earliest times. The process has evolved through the Industrial Revolution to the present period of exploding population and environmental awareness. Now the work must be done both with increasing sophistication and greater transparency. Modern techniques for site selection have been developed during the last two decades or so, utilizing a teachable body of knowledge and a growing literature. Many firms and individuals have contributed to this growing field. The driving force has been the need for such a process in siting and licensing of critical facilities such as nuclear power plants. A list of crucial, documented steps for identifying social impacts and acceptability are provided. A recent innovation is the self-selection method developed by government. The Superconducting Supercollider serves as an example of this approach. Geological or geologically dependent factors often dominate the process. The role as engineering and environmental geoscientists is to provide responsible leadership, consultation, and communication to the effort

  2. Selection and design of solvents

    DEFF Research Database (Denmark)

    Gani, Rafiqul

    and design of solvents will be presented together with application examples. The selection problem is defined as finding known chemicals that match the desired functions of a solvent for a specified set of applications. The design problem is defined as finding the molecular structure (or mixture of molecules....... With increasing interest on issues such as waste, sustainability, environmental impact and green chemistry, the selection and design of solvents have become important problems that need to be addressed during chemical product-process design and development. Systematic methods and tools suitable for selection......) that match the desired functions of a solvent for a specified set of applications. Use of organic chemicals and ionic liquids as solvents will be covered....

  3. Materials selection for cutting tools

    International Nuclear Information System (INIS)

    Burkhis, Adel M.


    The selection of proper tool steel for a given application is a difficult task. So; the most important selection factors in choosing cutting tool materials are based on their tool material requirements, cutting tool design and service conditions which is mainly considered as functional requirements. The processability requirements concerns in heat treat ability of the material tool. The classification of these tool materials were discussed with their properties requirement and percent of alloying element which is added to give best properties with a little increase in cost that highly appear in comparison of the selection. The cutting tool materials were evaluated based on two cases; The first was in case of rough surface; the high speed steels is the best material and the other was the ceramic material is the highest performance in cutting of soft or high rate of metal removal. (author)

  4. E-recruitment and Selection

    DEFF Research Database (Denmark)

    Holm, Anna B.; Haahr, Lars


    The use of information and communication technologies has revolutionized e-recruitment and selection function in many organizations, especially transforming it into a time- and space-independent process of sourcing and evaluating candidates. In the process, organizations rely on websites, social...... media and job portals for sourcing candidates and deploy computerized and online assessment tools when selecting the best-qualified applicants. Similarly, their communication with jobseekers has moved to cyberspace and is often performed through applicant tracking systems, where hiring managers use...... mobile technologies to track and evaluate candidates. In this chapter, we present an overview of e-recruitment and selection practices and discuss the use of technology throughout the hiring process....

  5. Selective Induction of Optical Magnetism. (United States)

    Manna, Uttam; Lee, Jung-Hoon; Deng, Tian-Song; Parker, John; Shepherd, Nolan; Weizmann, Yossi; Scherer, Norbert F


    An extension of the Maxwell-Faraday law of electromagnetic induction to optical frequencies requires spatially appropriate materials and optical beams to create resonances and excitations with curl. Here we employ cylindrical vector beams with azimuthal polarization to create electric fields that selectively drive magnetic responses in dielectric core-metal nanoparticle "satellite" nanostructures. These optical frequency magnetic resonances are induced in materials that do not possess spin or orbital angular momentum. Multipole expansion analysis of the scattered fields obtained from electrodynamics simulations show that the excitation with azimuthally polarized beams selectively enhances magnetic vs electric dipole resonances by nearly 100-fold in experiments. Multipolar resonances (e.g., quadrupole and octupole) are enhanced 5-fold by focused azimuthally versus linearly polarized beams. We also selectively excite electric multipolar resonances in the same identical nanostructures with radially polarized light. This work opens new opportunities for spectroscopic investigation and control of "dark modes", Fano resonances, and magnetic modes in nanomaterials and engineered metamaterials.

  6. Spectrally selective solar energy materials

    International Nuclear Information System (INIS)

    Sikkens, M.


    The performance and properties of spectrally selective materials are considered and, in particular, the selective absorption of solar radiation by free electrons is discussed, both in a homogeneous material in which these electrons are strongly scattered, and in a composite material consisting of small metal particles in a dielectric host. Such materials can be used as selective absorbers if they are deposited as a thin film onto a metal substrate, the latter providing the required low emittance. This type of selective surfaces is produced by reactive sputtering of Ni in an Ar/CH 4 gas mixture. This method can yield Ni films with a considerable carbon concentration. The carbon concentration can be varied over a wide range by adjusting the partial methane pressure. The associated experimental techniques are discussed. As the carbon concentration increases, the structure of the films changes from a Ni phase in which carbon is dissolved, via an intermediate Ni 3 C phase into an amorphous carbon phase with a high electrical resistivity in which small nickel particles are embedded. Both mechanisms of selective absorption by free electrons are observed and are found to be well described by rather simple models. The best selectivity is obtained at high carbon concentrations where the films consist of nickel particles in carbon. Depending on the film thickness and the substrate material, the solar absorptance varies between 0.78 and 0.90, while the thermal emittance varies between 0.025 and 0.04. Since the films are found to be stable at 400 0 C in vacuum, it appears that these films are good candidates for application in photothermal solar energy conversion at temperature levels around 200 0 C and higher. (Auth.)

  7. The physiology of follicle selection

    Directory of Open Access Journals (Sweden)

    Zeleznik Anthony J


    Full Text Available Abstract During the follicular phase of the primate menstrual cycle, a single follicle usually matures to the preovulatory stage and releases its oocyte for fertilization and the potential establishment of pregnancy. In assisted reproductive technology procedures, it is desirable to override the natural process of follicle selection to produce many oocytes that are capable of being fertilized and undergoing normal embryo development. The goal of this chapter is to summarize the current views regarding the natural process of follicle selection in primates and to discuss how this process may be amplified to produce a greater number of oocytes.

  8. Feature selection for portfolio optimization

    DEFF Research Database (Denmark)

    Bjerring, Thomas Trier; Ross, Omri; Weissensteiner, Alex


    Most portfolio selection rules based on the sample mean and covariance matrix perform poorly out-of-sample. Moreover, there is a growing body of evidence that such optimization rules are not able to beat simple rules of thumb, such as 1/N. Parameter uncertainty has been identified as one major....... While most of the diversification benefits are preserved, the parameter estimation problem is alleviated. We conduct out-of-sample back-tests to show that in most cases different well-established portfolio selection rules applied on the reduced asset universe are able to improve alpha relative...

  9. Generic maximum likely scale selection

    DEFF Research Database (Denmark)

    Pedersen, Kim Steenstrup; Loog, Marco; Markussen, Bo


    in this work is on applying this selection principle under a Brownian image model. This image model provides a simple scale invariant prior for natural images and we provide illustrative examples of the behavior of our scale estimation on such images. In these illustrative examples, estimation is based......The fundamental problem of local scale selection is addressed by means of a novel principle, which is based on maximum likelihood estimation. The principle is generally applicable to a broad variety of image models and descriptors, and provides a generic scale estimation methodology. The focus...

  10. Normal movement selectivity in autism. (United States)

    Dinstein, Ilan; Thomas, Cibu; Humphreys, Kate; Minshew, Nancy; Behrmann, Marlene; Heeger, David J


    It has been proposed that individuals with autism have difficulties understanding the goals and intentions of others because of a fundamental dysfunction in the mirror neuron system. Here, however, we show that individuals with autism exhibited not only normal fMRI responses in mirror system areas during observation and execution of hand movements but also exhibited typical movement-selective adaptation (repetition suppression) when observing or executing the same movement repeatedly. Movement selectivity is a defining characteristic of neurons involved in movement perception, including mirror neurons, and, as such, these findings argue against a mirror system dysfunction in autism. Copyright 2010 Elsevier Inc. All rights reserved.

  11. Will sex selection reduce fertility? (United States)

    Leung, S F


    Population control is one of the primary policies applied against poverty in many low income countries. The widespread prevalence of son preference in some countries such as China and India, however, works against any reduction of fertility. This is so because parents often continue to have children until they obtain the number of sons which they desire. The bias against girls has also led to higher abortion and mortality rates of female children. It is frequently argued that if sex selection methods are made available to parents so that they can control the gender of their children, population growth would be lowered and women's welfare improved. The author investigates both theoretically and numerically the impact of sex selection on fertility. A static quantity-quality model of fertility is used to compare fertility choices when parents cannot choose the gender of children versus a situation in which parents can choose gender. Empirical data are drawn from the 1976 Malaysian Family Life Survey. Analysis found that whether sex selection reduces fertility depends upon the second and third derivatives of the utility function and the child expenditure function. A numerical dynamic analysis is also presented. The simulation shows, using empirical dynamic models of fertility and the Monte Carlo integration technique, that sex selection on the firstborn child among the Chinese in Malaysia could reduce fertility by about 3%.

  12. Selection Method for COTS Systems

    DEFF Research Database (Denmark)

    Hedman, Jonas; Andersson, Bo


    feature behind the method is that improved understanding of organizational ‘ends’ or goals should govern the selection of a COTS system. This can also be expressed as a match or fit between ‘ends’ (e.g. improved organizational effectiveness) and ‘means’ (e.g. implementing COTS systems). This way...

  13. Market formation and market selection

    NARCIS (Netherlands)

    van Raalte, C.L.J.P.


    The organization of markets is an important field of inquiry in modern economic theory. This monograph analyzes models which consider the formation and selection of markets. In these models, markets are organized by middlemen and used by traders. In Part I of the monograph, coalitions of middlemen

  14. Guidelines for Effective Selective Listening. (United States)

    Schendel, Joel D.; Shields, Joyce L.

    Defining selective listening as an intelligence gathering technique that depends on an individual's ability to access, monitor, and report oral messages accurately and to give processing priority to messages of possible intelligence value, this report describes one important application of the technique: overhearing the conversations of others…

  15. Geodesy and Mapping (Selected Articles), (United States)


    August 1979 MICROFICHE NR. C-0/O GEODESY AND MAPPING (SELECTED ARTICLES) English pages: 53 Source: Geodezja i Kartograflia, Vol. 27, Nr. 2, 1978, pp. 83...Hausbrandt S., Wyrdwnanie sieci trygonemetryernych z odrzuceniem zalolenia bezbIfdneil pwo- ktdw dowiqzania, Geodezja i Kartografia. T III, z. 1, 1954. [2

  16. Selection rules for splitting strings

    NARCIS (Netherlands)

    Achucarro, A; Gregory, R


    It has been pointed out that Nielsen-Olesen vortices may be able to decay by pair production of black holes. We show that when the Abelian-Higgs model is embedded in a larger theory, the additional fields mau lead to selection rules for this process-even in the absence of fermions-due to the failure

  17. Select Papyri from Danish Collections

    DEFF Research Database (Denmark)

    Christiansen, Thomas

    The thesis, Select Papyri from Danish Collections: Philological and Archaeometric Studies, consists of an introduction, a book, four articles and a rapport on a scientific experiment at EuropeanRadiation Synchrotron Facility(ESRF), Grenoble, France, together with an application for another...

  18. Development, Awareness and Inductive Selectivity (United States)

    Hayes, Brett K.; Lim, Melissa


    Two studies examined whether adults and children could learn to make context-dependent inferences about novel stimuli and the role of awareness of context cues in such learning. Participants were trained to match probes to targets on the basis of shape or color with the relevant dimension shifting according to item context. A selective induction…

  19. Mass-Selective Laser Photoionization. (United States)

    Smalley, R. E.


    Discusses the nature and applications of mass-selective laser photoionization. The ionization can be done with a single intense laser pulse lasting a few billionths of a second with no molecular fragmentation. Applications focus on: (1) benzene clusters, excimers, and exciplexes; (2) metal clusters; and (3) triplet formation and decay. (Author/JN)

  20. Memory control with selective retention

    NARCIS (Netherlands)


    The present invention relates to a memory circuit and a method of controlling data retention in the memory circuit, wherein a supply signal is selectively switched to a respective one of at least two virtual supply lines (24) each shared by a respective one of a plurality of groups (30-1 to 30-n) of

  1. Memory control with selective retention

    NARCIS (Netherlands)


    The present invention relates to a memory circuit and a method of controlling data retention in the memory circuit, wherein a supply signal is selectively switched to a respective one of at least two virtual supply lines (24) each shared by a respective one of a plurality of groups (30-1 to 30-n) of

  2. Black Holes: A Selected Bibliography. (United States)

    Fraknoi, Andrew


    Offers a selected bibliography pertaining to black holes with the following categories: introductory books; introductory articles; somewhat more advanced articles; readings about Einstein's general theory of relativity; books on the death of stars; articles on the death of stars; specific articles about Supernova 1987A; relevant science fiction…

  3. Selected papers on classical analysis

    CERN Document Server

    Nomizu, Katsumi


    This volume contains papers that originally appeared in Japanese in the journal Sūgaku. Ordinarily the papers would appear in the AMS translation of that journal, but to expedite publication, the Society has chosen to publish them as a volume of selected papers. The papers here are in the general area of mathematical analysis as it pertains to free probability theory.

  4. Selectivity in microemulsion electrokinetic chromatography

    DEFF Research Database (Denmark)

    Pedersen-Bjergaard, S; Gabel-Jensen, Charlotte; Honoré Hansen, S


    Microemulsion electrokinetic chromatography (MEEKC) is a most promising separation technique providing good selectivity and high separation efficiency of anionic, cationic as well as neutral solutes. In MEEKC lipophilic organic solvents dispersed as tiny droplets in an aqueous buffer by the use...

  5. Efficient data selection for ASR

    CSIR Research Space (South Africa)

    Kleynhans, NT


    Full Text Available the deployment of ASR systems in the developing world is severely inhibited. One approach to assist with resource-scarce ASR system development, is to select ‘‘useful’’ training samples which could reduce the resources needed to collect new corpora. In this work...

  6. Selecting Copulas for Risk Management

    NARCIS (Netherlands)

    H.J.W.G. Kole (Erik); C.G. Koedijk (Kees); M.J.C.M. Verbeek (Marno)


    textabstractCopulas offer financial risk managers a powerful tool to model the dependence between the different elements of a portfolio and are preferable to the traditional, correlation-based approach. In this paper we show the importance of selecting an accurate copula for risk management. We

  7. Selective Mutism: Causes and Interventions. (United States)

    Hultquist, Alan M.


    This article reviews the literature regarding the diagnostic criteria, causes, assessment, and treatment of selective mutism in school-age children. The most successful treatments have included various forms or combinations of behavior modification, though these may not address the underlying problem. (Author/DB)

  8. density-dependent selection revisited

    Indian Academy of Sciences (India)


    is a more useful way of looking at density-dependent selection, and then go on ... these models was that the condition for maintenance of ... In a way, their formulation may be viewed as ... different than competition among species, and typical.

  9. Selection arena in Aspergillus nidulans

    NARCIS (Netherlands)

    Bruggeman, J.; Debets, A.J.M.; Hoekstra, R.F.


    The selection arena hypothesis states that overproduction of zygotes-a widespread phenomenon in animals and plants-can be explained as a mechanism of progeny choice. As a similar mechanism, the ascomycetous fungus Aspergillus nidulans may overproduce dikaryotic fruit initials, hereafter called

  10. The selective addition of water

    NARCIS (Netherlands)

    Resch, V.; Hanefeld, U.


    Water is omnipresent and essential. Yet at the same time it is a rather unreactive molecule. The direct addition of water to C[double bond, length as m-dash]C double bonds is therefore a challenge not answered convincingly. In this perspective we critically evaluate the selectivity and the

  11. Teacher Candidate Selection and Evaluation. (United States)

    Collins, Mary Lynn; And Others

    Summaries are presented of three papers presented at a summer workshop on Quality Assurance in Teacher Education conducted by the Association of Teacher Educators. The general topic covered by these presentations was teacher candidate selection and evaluation. Papers focused upon the following questions: (1) What entry level criteria should be…

  12. Selecting Safe Pets (For Parents) (United States)

    ... supplies (pet bowls, pet bed, leash, etc.) as gifts, then selecting the pet as a family. That way, everyone has time to really think about whether your family is ready for a pet. Key Questions Before adopting or purchasing any pet, talk to all family members, discuss ...

  13. Feature selection toolbox software package

    Czech Academy of Sciences Publication Activity Database

    Pudil, Pavel; Novovičová, Jana; Somol, Petr


    Roč. 23, č. 4 (2002), s. 487-492 ISSN 0167-8655 R&D Projects: GA ČR GA402/01/0981 Institutional research plan: CEZ:AV0Z1075907 Keywords : pattern recognition * feature selection * loating search algorithms Subject RIV: BB - Applied Statistics, Operational Research Impact factor: 0.409, year: 2002

  14. A Selection Method That Succeeds! (United States)

    Weitman, Catheryn J.

    Provided a structural selection method is carried out, it is possible to find quality early childhood personnel. The hiring process involves five definite steps, each of which establishes a base for the next. A needs assessment formulating basic minimal qualifications is the first step. The second step involves review of current job descriptions…

  15. Selected topics in nuclear structure

    International Nuclear Information System (INIS)

    Stachura, Z.


    19. winter school in Zakopane was devoted to selected topics in nuclear structure such as: production of spin resonances, heavy ions reactions and their applications to the investigation of high spin states, octupole deformations, excited states and production of new elements etc. The experimental data are ofen compared with theoretical predictions. Report contains 28 papers. (M.F.W.)

  16. Production Systems and Supplier Selection

    DEFF Research Database (Denmark)

    Pedraza-Acosta, Isabel; Pilkington, Alan; Barnes, David


    strategic stamping suppliers. Findings: Our contribution is the multi-phased production and product innovation process. This is an advance from traditional supplier selection and also an extension of ideas of supplier-located product development as it includes production system development, and complements...

  17. Molecular Components of Catalytic Selectivity

    Energy Technology Data Exchange (ETDEWEB)

    Somorjai, Gabor A.; Park, Jeong Y.


    Selectivity, that is, to produce one molecule out of many other thermodynamically feasible product molecules, is the key concept to develop 'clean manufacturing' processes that do not produce byproducts (green chemistry). Small differences in potential energy barriers for elementary reaction steps control which reaction channel is more likely to yield the desired product molecule (selectivity), instead of the overall activation energy for the reaction that controls turnover rates (activity). Recent studies have demonstrated the atomic- or molecular-level tailoring of parameters such as the surface structures of active sites that give rise to nanoparticle size and shape dependence of turnover rates and reaction selectivities. Here, we highlight seven molecular components that influence reaction selectivities. These include: surface structure, adsorbate-induced restructuring, adsorbate mobility, reaction intermediates, surface composition, charge transport, and oxidation states for model metal single crystal and colloid nanoparticle catalysts. We show examples of their functioning and describe in-situ instruments that permit us to investigate their roles in surface reactions.

  18. Binaural frequency selectivity in humans. (United States)

    Verhey, Jesko L; van de Par, Steven


    Several behavioural studies in humans have shown that listening to sounds with two ears that is binaural hearing, provides the human auditory system with extra information on the sound source that is not available when sounds are only perceived through one ear that is monaurally. Binaural processing involves the analysis of phase and level differences between the two ear signals. As monaural cochlea processing (in each ear) precedes the neural stages responsible for binaural processing properties it is reasonable to assume that properties of the cochlea may also be observed in binaural processing. A main characteristic of cochlea processing is its frequency selectivity. In psychoacoustics, there is an ongoing discussion on the frequency selectivity of the binaural auditory system. While some psychoacoustic experiments seem to indicate poorer frequency selectivity of the binaural system than that of the monaural processing others seem to indicate the same frequency selectivity for monaural and binaural processing. This study provides an overview of these seemingly controversial results and the different explanations that were provided to account for the different results. © 2018 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  19. Portfolio selection with heavy tails

    NARCIS (Netherlands)

    Hyung, N.; Vries, de C.G.


    Consider the portfolio problem of choosing the mix between stocks and bonds under a downside risk constraint. Typically stock returns exhibit fatter tails than bonds corresponding to their greater downside risk. Downside risk criteria like the safety first criterion therefore often select corner

  20. A Heckman Selection- t Model

    KAUST Repository

    Marchenko, Yulia V.; Genton, Marc G.


    for sample selection bias based on the SLt model and compare it with the performances of several tests used with the SLN model. Our findings indicate that the latter tests can be misleading in the presence of heavy-tailed data. © 2012 American Statistical

  1. Special Warfare: A Selected Bibliography. (United States)


    Strategy. Boston: Routledge & Kegan Paul, 1981. (U162 .A78) 8. Atlantic Research Corporation. Georgetown Research Project. A Histori- cal Survey of...Corps Gazette. The Guerrillp. and How to Fight Him: Selections, ed. by T.N. Greene . Nev ’ork: Praeger, 1962. (U240 K33) 108. Martic, Milos. Insurrection

  2. Directional Darwinian Selection in proteins. (United States)

    McClellan, David A


    Molecular evolution is a very active field of research, with several complementary approaches, including dN/dS, HON90, MM01, and others. Each has documented strengths and weaknesses, and no one approach provides a clear picture of how natural selection works at the molecular level. The purpose of this work is to present a simple new method that uses quantitative amino acid properties to identify and characterize directional selection in proteins. Inferred amino acid replacements are viewed through the prism of a single physicochemical property to determine the amount and direction of change caused by each replacement. This allows the calculation of the probability that the mean change in the single property associated with the amino acid replacements is equal to zero (H0: μ = 0; i.e., no net change) using a simple two-tailed t-test. Example data from calanoid and cyclopoid copepod cytochrome oxidase subunit I sequence pairs are presented to demonstrate how directional selection may be linked to major shifts in adaptive zones, and that convergent evolution at the whole organism level may be the result of convergent protein adaptations. Rather than replace previous methods, this new method further complements existing methods to provide a holistic glimpse of how natural selection shapes protein structure and function over evolutionary time.

  3. Selected Reference Books of 1998. (United States)

    McIlvaine, Eileen


    Reviews a selection of recent scholarly and general reference works under the categories of Periodicals and Newspapers, Philosophy, Literature, Film and Radio, Art and Architecture, Music, Political Science, Women's Studies, and History. A brief summary of new editions of standard works is provided at the end of the articles. (AEF)

  4. Environmental Pollution, A Selective Bibliography. (United States)

    Clearinghouse for Federal Scientific and Technical Information, Springfield, VA.

    This bibliography on environmental pollution is comprised primarily of reports of federally sponsored research by such departments and agencies as HEW, Interior, AEC, NASA, Defense, Transportation, and others. The reports were selected from Clearinghouse announcement journals during the period 1968 through April 1970. The bibliography contains…

  5. Inspection methods and their selection

    International Nuclear Information System (INIS)

    Maier, H.J.


    First those nondestructive testing methods, which are used in quality assurance, are to be treated, e.g. - ultrasonics - radiography - magnetic particle testing - dye penetrant testing - eddy currents, and their capabilities and limitations are shown. Second the selection of optimal testing methods under the aspect of defect recognition in different materials and components are shown. (orig./RW)

  6. Persuasion: A Selected, Annotated Bibliography. (United States)

    McDermott, Steven T.

    Designed to reflect the diversity of approaches to persuasion, this annotated bibliography cites materials selected for their contribution to that diversity as well as for being relatively current and/or especially significant representatives of particular approaches. The bibliography starts with a list of 17 general textbooks on approaches to…

  7. Repetition priming in selective attention

    DEFF Research Database (Denmark)

    Ásgeirsson, Árni Gunnar; Kristjánsson, Árni; Bundesen, Claus


    . Repeating target colors enhanced performance for all 12 observers. As predicted, this was only true under conditions that required selection of a target among distractors, but not when a target was presented alone. Model fits by TVA were obtained with a trial-by-trial maximum likelihood estimation procedure...

  8. Sales Tax Compliance and Audit Selection


    Murray, Matthew N.


    Uses sample selection estimation techniques to identify systematic audit selection rules and determinants of sales tax underreporting. Though based on data from only one state (Tennessee), outcomes are useful in developing and evaluating audit selection results.

  9. Opportunistic Relay Selection With Limited Feedback

    KAUST Repository

    Eltayeb, Mohammed E.; Elkhalil, Khalil; Bahrami, Hamid Reza; Al-Naffouri, Tareq Y.


    Relay selection is a simple technique that achieves spatial diversity in cooperative relay networks. Generally, relay selection algorithms require channel state information (CSI) feedback from all cooperating relays to make a selection decision

  10. The spatial patterns of directional phenotypic selection

    KAUST Repository

    Siepielski, Adam M.; Gotanda, Kiyoko M.; Morrissey, Michael B.; Diamond, Sarah E.; DiBattista, Joseph; Carlson, Stephanie Marie


    the spatial patterns of selection, namely the extent of variation among populations in the strength and direction of selection. Here, we analyse a data set of spatially replicated studies of directional phenotypic selection from natural populations. The data

  11. Behavioral toxicity of selected radioprotectors (United States)

    Landauer, M. R.; Davis, H. D.; Kumar, K. S.; Weiss, J. F.


    Effective radioprotection with minimal behavioral disruption is essential for the selection of protective agents to be used in manned spaceflight. This overview summarizes the studies on the behavioral toxicity of selected radioprotectors classified as phosphorothioates (WR-2721, WR-3689), bioactive lipids (16, 16 dimethylprostaglandin E2(DiPGE2), platelet activating factor (PAF), leukotriene C4), and immunomodulators (glucan, synthetic trehalose dicorynomycolate, and interleukin-1). Behavioral toxicity was examined in laboratory mice using a locomotor activity test. For all compounds tested, there was a dose-dependent decrease in locomotor behavior that paralleled the dose-dependent increase in radioprotection. While combinations of radioprotective compounds (DiPGE2 plus WR-2721) increased radioprotection, they also decreased locomotor activity. The central nervous system stimulant, caffeine, was able to mitigate the locomotor decrement produced by WR-3689 or PAF.

  12. Statistical learning and selective inference. (United States)

    Taylor, Jonathan; Tibshirani, Robert J


    We describe the problem of "selective inference." This addresses the following challenge: Having mined a set of data to find potential associations, how do we properly assess the strength of these associations? The fact that we have "cherry-picked"--searched for the strongest associations--means that we must set a higher bar for declaring significant the associations that we see. This challenge becomes more important in the era of big data and complex statistical modeling. The cherry tree (dataset) can be very large and the tools for cherry picking (statistical learning methods) are now very sophisticated. We describe some recent new developments in selective inference and illustrate their use in forward stepwise regression, the lasso, and principal components analysis.

  13. Selective arterial thrombolysis with urokinase

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jae Hyung; Park, Kil Sun; Chung, Jin Wook; Han, Joon Koo; Kim, Sang Joon [Seoul National University College of Medicine, Seoul (Korea, Republic of); Kim, Dae Young [Choong Buk University College of Medicine, Jeonju (Korea, Republic of)


    Seven patients with thrombotic occlusions of the peripheral arteries or grafts were treated with urokinase by direct intraarterial selective infusion. During the infusion, simultaneous heparin infusion was used to reduce the frequency of thrombus formation on the infusion catheter or recurrent thrombosis. In 4 patients in whom a complete thrombolysis occurred, urokinase was infused by a high-dose transthrombus bolus technique followed by continuous infusion. There other patients, in whom thrombolysis was partially accomplished and then surgical thrombectomy was performed, were treated only by continuous urokinase infusion. Small hematomas developed at the infusion catheter entry site in 2 patients, but transfusion or operation was not required. Other significant complications were not found. Our results suggest that selective arterial infusion of urokinase with a transthrombus bolus technique can accomplish a complete arterial thrombolysis without any significant complications.

  14. Selective arterial thrombolysis with urokinase

    International Nuclear Information System (INIS)

    Park, Jae Hyung; Park, Kil Sun; Chung, Jin Wook; Han, Joon Koo; Kim, Sang Joon; Kim, Dae Young


    Seven patients with thrombotic occlusions of the peripheral arteries or grafts were treated with urokinase by direct intraarterial selective infusion. During the infusion, simultaneous heparin infusion was used to reduce the frequency of thrombus formation on the infusion catheter or recurrent thrombosis. In 4 patients in whom a complete thrombolysis occurred, urokinase was infused by a high-dose transthrombus bolus technique followed by continuous infusion. There other patients, in whom thrombolysis was partially accomplished and then surgical thrombectomy was performed, were treated only by continuous urokinase infusion. Small hematomas developed at the infusion catheter entry site in 2 patients, but transfusion or operation was not required. Other significant complications were not found. Our results suggest that selective arterial infusion of urokinase with a transthrombus bolus technique can accomplish a complete arterial thrombolysis without any significant complications

  15. Selective inhibition of distracting input. (United States)

    Noonan, MaryAnn P; Crittenden, Ben M; Jensen, Ole; Stokes, Mark G


    We review a series of studies exploring distractor suppression. It is often assumed that preparatory distractor suppression is controlled via top-down mechanisms of attention akin to those that prepare brain areas for target enhancement. Here, we consider two alternative mechanisms: secondary inhibition and expectation suppression within a predictive coding framework. We draw on behavioural studies, evidence from neuroimaging and some animal studies. We conclude that there is very limited evidence for selective top-down control of preparatory inhibition. By contrast, we argue that distractor suppression often relies secondary inhibition of non-target items (relatively non-selective inhibition) and on statistical regularities of the environment, learned through direct experience. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  16. Rabi N. Bhattacharya selected papers

    CERN Document Server

    Waymire, Edward


    This volume presents some of the most influential papers published by Rabi N. Bhattacharya, along with commentaries from international experts, demonstrating his knowledge, insight, and influence in the field of probability and its applications. For more than three decades, Bhattacharya has made significant contributions in areas ranging from theoretical statistics via analytical probability theory, Markov processes, and random dynamics to applied topics in statistics, economics, and geophysics. Selected reprints of Bhattacharya’s papers are divided into three sections: Modes of Approximation, Large Times for Markov Processes, and Stochastic Foundations in Applied Sciences. The accompanying articles by the contributing authors not only help to position his work in the context of other achievements, but also provide a unique assessment of the state of their individual fields, both historically and for the next generation of researchers. Rabi N. Bhattacharya: Selected Papers will be a valuable resource for yo...

  17. Rare Earth Garnet Selective Emitter (United States)

    Lowe, Roland A.; Chubb, Donald L.; Farmer, Serene C.; Good, Brian S.


    Thin film Ho-YAG and Er-YAG emitters with a platinum substrate exhibit high spectral emittance in the emission band (epsilon(sub lambda) approx. = 0.75, sup 4)|(sub 15/2) - (sup 4)|(sub 13/2),for Er-YAG and epsilon(sub lambda) approx. = 0.65, (sup 5)|(sub 7) - (sup 5)|(sub 8) for Ho-YAG) at 1500 K. In addition, low out-of-band spectral emittance, epsilon(sub lambda) less than 0.2, suggest these materials would be excellent candidates for high efficiency selective emitters in thermophotovoltaic (TPV) systems operating at moderate temperatures (1200-1500 K). Spectral emittance measurements of the thin films were made (1.2 less than lambda less than 3.0 microns) and compared to the theoretical emittances calculated using measured values of the spectral extinction coefficient. In this paper we present the results for a new class of rare earth ion selective emitters. These emitters are thin sections (less than 1 mm) of yttrium aluminum garnet (YAG) single crystal with a rare earth substitutional impurity. Selective emitters in the near IR are of special interest for thermophotovoltaic (TPV) energy conversion. The most promising solid selective emitters for use in a TPV system are rare earth oxides. Early spectral emittance work on rare earth oxides showed strong emission bands in the infrared (0.9 - 3 microns). However, the emittance outside the emission band was also significant and the efficiency of these emitters was low. Recent improvements in efficiency have been made with emitters fabricated from fine (5 - 10 microns) rare earth oxide fibers similar to the Welsbach mantle used in gas lanterns. However, the rare earth garnet emitters are more rugged than the mantle type emitters. A thin film selective emitter on a low emissivity substrate such as gold, platinum etc., is rugged and easily adapted to a wide variety of thermal sources. The garnet structure and its many subgroups have been successfully used as hosts for rare earth ions, introduced as substitutional

  18. EBTR design-point selection

    International Nuclear Information System (INIS)

    Krakowski, R.A.; Bathke, C.G.


    The procedure used to select the design point for the ELMO Bumpy Torus Reactor (EBTR) study is described. The models used in each phase of the selection process are described, with an emphasis placed on the parametric design curves produced by each model. The tradeoffs related to burn physics, stability/equilibrium, electron-ring physics, and magnetics design are discussed. The resulting design point indicates a plasma with a 35-m major radius and a 1-m minor radium operating at an average core-plasma beta of 0.17, which at approx. 30 keV produces an average neutron wall loading of 1.4 MW/m 2 while maintaining key magnet (< 10 T) and total power (less than or equal to 4000 MWt) constraints

  19. Geodesy and Cartography (Selected Articles), (United States)


    C-OO/b73 GEODESY AND CARTOGRAPHY (SELECTED ARTICLES) English pages: 40 Source: GeodezJa i Kartografia, Vol. 27, Nr. 1, 1978, PP. 3-27 Country of...1976. 14) kledzixski, J., Zibek, Z., Czarnecki, K., Rogowski, J.B., Problems in Using Satellite Surveys in an Astronomical-Geodesic Network, Geodezja i...Based on Observations of Low-Low Satellites Using Collocation Methods, Geodezja i Kartografia, Vol. XXVI, No. 4, 1977. [-7. Krynski, J., Schwarz, K.P

  20. Optimal Contracting under Adverse Selection

    DEFF Research Database (Denmark)

    Lenells, Jonatan; Stea, Diego; Foss, Nicolai Juul


    We study a model of adverse selection, hard and soft information, and mentalizing ability--the human capacity to represent others' intentions, knowledge, and beliefs. By allowing for a continuous range of different information types, as well as for different means of acquiring information, we dev...... of that information. This strategy affects the properties of the optimal contract, which grows closer to the first best. This research provides insights into the implications of mentalizing for agency theory....

  1. Selection Process of ERP Systems


    Molnár, Bálint; Szabó, Gyula; Benczúr, András


    Background: The application and introduction of ERP systems have become a central issue for management and operation of enterprises. The competition on market enforces the improvement and optimization of business processes of enterprises to increase their efficiency, effectiveness, and to manage better the resources outside the company. The primary task of ERP systems is to achieve the before-mentioned objectives. Objective: The selection of a particular ERP system has a decisive effect on th...

  2. Selective shielding device for scintiphotography

    International Nuclear Information System (INIS)

    Harper, J.W.; Kay, T.D.


    A selective shielding device to be used in combination with a scintillation camera is described. The shielding device is a substantially oval-shaped configuration removably secured to the scintillation camera. As a result of this combination scanning of preselected areas of a patient can be rapidly and accurately performed without the requirement of mounting any type of shielding paraphernalia on the patient. 1 claim, 2 drawing figures

  3. The selection of occupancy factors

    International Nuclear Information System (INIS)

    Lakey, J.R.A.


    An estimate of the proportion of time that an area is occupied by radiation workers is often used in radiological protection to permit relaxation of exposure rate limits above those for continuous occupation. This proportion is known as an occupancy factor and is used most frequently in X-ray facilities. The strategy for controlling the external exposure of radiation workers must be decided before occupancy factors are selected for the design of the radiation protection facilities. When shielding has to be designed the occupancy factor effects the design objectives and permits increased exposure rates at the shield surface. It is useful to note that the selection of occupancy factors with due regard to the expected spatial variation of the exposure rate can help to reduce the range of the worker's radiation exposure because field gradients are usually steeper close to the shield. When other hazards, such as internal exposure, and other constraints, such as cost of the space consumed, are added, the selection of the optimum set of occupancy factors is more difficult. Two zone occupancy factors are discussed in this paper and proposals are made for a strategy to be used when there is more than one hazard and the designer has to meet constraints imposed by limitations of the facilities available. An important feature of the strategy is the avoidance of high radiation exposure to small groups of workers. The errors involved in assessment of the actual dose received by the radiation worker must be taken into account and in particular the selection of the higher exposure rate limits must be made with attention to the accident potential

  4. Brand management of selected brand


    Honzíková, Dana


    This thesis addresses the subject of brand management. My main objective was to summarize the issue of brand management and apply the acquired knowledge on the selected brand of food products on the Czech market, i.e. to assess its current management and the current situation and where appropriate, propose recommendations for the future. I use the case study method, the method of survey and analysis of primary and secondary data. The theoretical part deals with the concept of brand, its featu...

  5. Selected collection of circuit drawings

    International Nuclear Information System (INIS)


    The many electronics circuits have been constracted in the Electronics Shop for use in nuclear experiments or other purposes of this Institute. The types of these circuits amount to about 500 items in total since 1968. This report describes the electronics circuit diagrams selected from this collection. The circuit details are not presented in this report, because these are already been published in the other technical reports. (auth.)

  6. Selective Functionalization of Arbitrary Nanowires (United States)


    3-mercaptopropyl)- trimethoxysilane (MPTMS). The wires were grown electrochemically in anodic aluminum oxide ( AAO ) templates. Selective deposition...In the past, templates composed of polycarbonate track-etched membranes or anodic aluminum oxide materials have been used for the construction of...modifier MPTMS was used to function- alize the AAO template because it can form covalent bonds with silanes and metal oxide surfaces21 and because of

  7. Nordic Regional Report; Selected Issues


    International Monetary Fund


    This Selected Issues paper elaborates findings and discussions of 2013 Cluster Consultation Nordic Regional report. The countries have close economic and financial ties and face some common challenges and shared risks, such as large banking sectors and high household debt. The economic performance of the four continental Nordic economies (Denmark, Finland, Norway, and Sweden—Nordic-4) ranks among the advanced economic development circle. It is analyzed that the large Nordic banking systems su...

  8. Republic of Lithuania; Selected Issues


    International Monetary Fund


    This Selected Issues paper reviews public expenditure in Lithuania with a view to identify areas for which deeper reforms may be warranted to improve spending efficiency and contain future spending pressures. The paper benchmarks spending levels and spending composition in Lithuania against those in other European countries. The 31 European countries covered in the benchmarking exercise include the EU-28 plus Iceland, Norway, and Switzerland. Reflecting the tendency for public spending to inc...

  9. Normal Movement Selectivity in Autism


    Dinstein, Ilan; Thomas, Cibu; Humphreys, Kate; Minshew, Nancy; Behrmann, Marlene; Heeger, David J.


    It has been proposed that individuals with autism have difficulties understanding the goals and intentions of others because of a fundamental dysfunction in the mirror neuron system. Here, however, we show that individuals with autism exhibited not only normal fMRI responses in mirror system areas during observation and execution of hand movements, but also exhibited typical movement-selective adaptation (repetition suppression) when observing or executing the same movement repeatedly. Moveme...

  10. Immigration And Self-Selection


    George J. Borjas


    Self-selection plays a dominant role in determining the size and composition of immigrant flows. The United States competes with other potential host countries in the "immigration market". Host countries vary in their "offers" of economic opportunities and also differ in the way they ration entry through their immigration policies. Potential immigrants compare the various opportunities and are non-randomly sorted by the immigration market among the various host countries. This paper presents ...

  11. Natural Selection in Large Populations (United States)

    Desai, Michael


    I will discuss theoretical and experimental approaches to the evolutionary dynamics and population genetics of natural selection in large populations. In these populations, many mutations are often present simultaneously, and because recombination is limited, selection cannot act on them all independently. Rather, it can only affect whole combinations of mutations linked together on the same chromosome. Methods common in theoretical population genetics have been of limited utility in analyzing this coupling between the fates of different mutations. In the past few years it has become increasingly clear that this is a crucial gap in our understanding, as sequence data has begun to show that selection appears to act pervasively on many linked sites in a wide range of populations, including viruses, microbes, Drosophila, and humans. I will describe approaches that combine analytical tools drawn from statistical physics and dynamical systems with traditional methods in theoretical population genetics to address this problem, and describe how experiments in budding yeast can help us directly observe these evolutionary dynamics.

  12. Dysprosium selective potentiometric membrane sensor

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hassan Ali, E-mail: [Department of Applied Chemistry, Mashhad Branch, Islamic Azad University, Mashhad (Iran, Islamic Republic of); Faridbod, Farnoush; Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)


    A novel Dy(III) ion-selective PVC membrane sensor was made using a new synthesized organic compound, 3,4-diamino-N Prime -((pyridin-2-yl)methylene)benzohydrazide (L) as an excellent sensing element. The electrode showed a Nernstian slope of 19.8 {+-} 0.6 mV per decade in a wide concentration range of 1.0 Multiplication-Sign 10{sup -6}-1.0 Multiplication-Sign 10{sup -2} mol L{sup -1}, a detection limit of 5.5 Multiplication-Sign 10{sup -7} mol L{sup -1}, a short conditioning time, a fast response time (< 10 s), and high selectivity towards Dy(III) ion in contrast to other cations. The proposed sensor was successfully used as an indicator electrode in the potentiometric titration of Dy(III) ions with EDTA. The membrane sensor was also applied to the F{sup -} ion indirect determination of some mouth washing solutions and to the Dy{sup 3+} determination in binary mixtures. Highlights: Black-Right-Pointing-Pointer The novelty of this work is based on the high affinity of the ionophore toward the Dy{sup 3+} ions. Black-Right-Pointing-Pointer This technique is very simple, fast and inexpensive and it is not necessary to use sophisticated equipment. Black-Right-Pointing-Pointer The newly developed sensor is superior to the formerly reported Dy{sup 3+} sensors in terms of selectivity.

  13. Geometric mean for subspace selection. (United States)

    Tao, Dacheng; Li, Xuelong; Wu, Xindong; Maybank, Stephen J


    Subspace selection approaches are powerful tools in pattern classification and data visualization. One of the most important subspace approaches is the linear dimensionality reduction step in the Fisher's linear discriminant analysis (FLDA), which has been successfully employed in many fields such as biometrics, bioinformatics, and multimedia information management. However, the linear dimensionality reduction step in FLDA has a critical drawback: for a classification task with c classes, if the dimension of the projected subspace is strictly lower than c - 1, the projection to a subspace tends to merge those classes, which are close together in the original feature space. If separate classes are sampled from Gaussian distributions, all with identical covariance matrices, then the linear dimensionality reduction step in FLDA maximizes the mean value of the Kullback-Leibler (KL) divergences between different classes. Based on this viewpoint, the geometric mean for subspace selection is studied in this paper. Three criteria are analyzed: 1) maximization of the geometric mean of the KL divergences, 2) maximization of the geometric mean of the normalized KL divergences, and 3) the combination of 1 and 2. Preliminary experimental results based on synthetic data, UCI Machine Learning Repository, and handwriting digits show that the third criterion is a potential discriminative subspace selection method, which significantly reduces the class separation problem in comparing with the linear dimensionality reduction step in FLDA and its several representative extensions.

  14. Donor selection criteria and procurement

    International Nuclear Information System (INIS)

    Agcaoili, N.R.


    Donor selection is one of the most important aspects of tissue banking practice. Without a good donor selection criteria, the results of any effort of trying to preserve tissues will have disastrous outcome for the recipient of these tissues. While with a very good and strict donor selection the Tissue Bank can guarantee safe and effective tissue allografts. There are significant aspects in the history and physical examination of the donor that must be emphasized. A donor exclusion criteria has also been formulated together with a list of all the needed laboratory examinations to eliminate possible diseases that may be transferred from the donor. The methods of procurement of tissue allografts from living and cadaver donors will be described. The limitations and advantages of each will be taken.There are also special restrictions that are important in the practice of removing the tissues from the donors. All the necessary equipment should be ready and the potential risk on the personnel should be known to all doing Tissue Banking

  15. Toddlers Selectively Help Fair Agents

    Directory of Open Access Journals (Sweden)

    Luca Surian


    Full Text Available Previous research showed that infants and toddlers are inclined to help prosocial agents and assign a positive valence to fair distributions. Also, they expect that positive and negative actions directed toward distributors will conform to reciprocity principles. This study investigates whether toddlers are selective in helping others, as a function of others’ previous distributive actions. Toddlers were presented with real-life events in which two actresses distributed resources either equally or unequally between two puppets. Then, they played together with a ball that accidentally fell to the ground and asked participants to help them to retrieve it. Participants preferred to help the actress who performed equal distributions. This finding suggests that by the second year children’s prosocial actions are modulated by their emerging sense of fairness.HighlightsToddlers (mean age = 25 months are selective in helping distributors.Toddlers prefer helping a fair rather than an unfair distributor.Toddlers’ selective helping provides evidence for an early sense of fairness.

  16. Fluorescent assay for oxytetracycline based on a long-chain aptamer assembled onto reduced graphene oxide

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Huimin; Gao, Sheng; Liu, Meng; Chang, Yangyang; Fan, Xinfei; Quan, Xie [Key Laboratory of Industrial Ecology and Environmental Engineering (Ministry of Education, China), School of Environmental Science and Technology, Dalian University of Technology, Dalian, 116024 (China)


    We report on a fluorescent assay for oxytetracycline (OTC) using a fluorescein-labeled long-chain aptamer assembled onto reduced graphene oxide (rGO). The π-π stacking interaction between aptamer and rGO causes the fluorescence of the label to be almost completely quenched via energy transfer so that the system has very low background fluorescence. The addition of OTC leads to the formation of G-quadruplex OTC complexes and prevents the adsorption of labeled aptamer on the surface of rGO. As a result, fluorescence is restored, and this effect allows for a quantitative assay of OTC over the 0.1–2 μM concentration range and with a detection limit of 10 nM. This method is simple, rapid, selective and sensitive. It may be applied to other small molecule analytes by applying appropriate aptamers. (author)

  17. Fluorescent assay for oxytetracycline based on a long-chain aptamer assembled onto reduced graphene oxide

    International Nuclear Information System (INIS)

    Zhao, Huimin; Gao, Sheng; Liu, Meng; Chang, Yangyang; Fan, Xinfei; Quan, Xie


    We report on a fluorescent assay for oxytetracycline (OTC) using a fluorescein-labeled long-chain aptamer assembled onto reduced graphene oxide (rGO). The π-π stacking interaction between aptamer and rGO causes the fluorescence of the label to be almost completely quenched via energy transfer so that the system has very low background fluorescence. The addition of OTC leads to the formation of G-quadruplex OTC complexes and prevents the adsorption of labeled aptamer on the surface of rGO. As a result, fluorescence is restored, and this effect allows for a quantitative assay of OTC over the 0.1–2 μM concentration range and with a detection limit of 10 nM. This method is simple, rapid, selective and sensitive. It may be applied to other small molecule analytes by applying appropriate aptamers. (author)

  18. Improved thrombin binding aptamer by incorporation of a single unlocked nucleic acid monomer

    DEFF Research Database (Denmark)

    Pasternak, Anna; Hernandez, Frank J; Rasmussen, Lars Melholt


    A 15-mer DNA aptamer (named TBA) adopts a G-quadruplex structure that strongly inhibits fibrin-clot formation by binding to thrombin. We have performed thermodynamic analysis, binding affinity and biological activity studies of TBA variants modified by unlocked nucleic acid (UNA) monomers. UNA...... that a UNA monomer is allowed in many positions of the aptamer without significantly changing the thrombin-binding properties. The biological effect of a selection of the modified aptamers was tested by a thrombin time assay and showed that most of the UNA-modified TBAs possess anticoagulant properties......, and that the construct with a UNA-U monomer in position 7 is a highly potent inhibitor of fibrin-clot formation....

  19. Statistical selection : a way of thinking !

    NARCIS (Netherlands)

    Laan, van der P.; Aarts, E.H.L.; Eikelder, ten H.M.M.; Hemerik, C.; Rem, M.


    Statistical selection of the best population is discussed in general terms and the principles of statistical selection procedures are presented. Advantages and disadvantages of Subset Selection, one of the main approaches, are indicated. The selection of an almost best population is considered and

  20. Statistical selection : a way of thinking!

    NARCIS (Netherlands)

    Laan, van der P.


    Statistical selection of the best population is discussed in general terms and the principles of statistical selection procedures are presented. Advantages and disadvantages of Subset Selection, one of the main approaches, are indicated. The selection of an almost best population is considered and