Selectivity in ligand recognition of G-quadruplex loops.
Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen
2009-03-03
A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
Effect of Urea on G-Quadruplex Stability.
Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V
2017-07-13
G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the
Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands
Directory of Open Access Journals (Sweden)
Alessandro Altieri
2013-10-01
Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.
Directory of Open Access Journals (Sweden)
Li-Na Zhu
Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming
2012-01-01
The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications
2018-01-01
Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699
Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein
2014-01-01
G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...
Macrocyclic G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, M C; Ulven, Trond
2010-01-01
are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...
A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative
Directory of Open Access Journals (Sweden)
Md. Monirul Islam
2015-06-01
Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.
G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.
Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela
2015-09-22
Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.
G-quadruplexes as novel cis-elements controlling transcription during embryonic development.
David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B
2016-05-19
G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
DEFF Research Database (Denmark)
Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte
2011-01-01
G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...
Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents
Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David
2013-01-01
Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518
Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung
2013-01-01
We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.
A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.
Directory of Open Access Journals (Sweden)
Ka-Ho Leung
Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.
Multimerization rules for G-quadruplexes
Czech Academy of Sciences Publication Activity Database
Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.
2017-01-01
Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes
Guanine base stacking in G-quadruplex nucleic acids
Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân
2013-01-01
G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444
Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee
2016-03-02
The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Seven essential questions on G-quadruplexes.
König, Sebastian L B; Evans, Amanda C; Huppert, Julian L
2010-08-01
The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.
Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.
Directory of Open Access Journals (Sweden)
Li-Ping Bai
Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.
Efficient Long-Range Hole Transport Through G-Quadruplexes.
Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei
2017-10-09
DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
A multi-functional guanine derivative for studying the DNA G-quadruplex structure.
Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan
2017-10-23
In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.
Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands
DEFF Research Database (Denmark)
Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond
2012-01-01
Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....
Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân
2014-01-01
G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274
Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate
Ranjan, Nihar; Davis, Erik; Xue, Liang
2013-01-01
The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792
Experimental approaches to identify cellular G-quadruplex structures and functions.
Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar
2012-05-01
Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.
Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.
Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro
2009-09-16
We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.
Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao
2018-06-01
G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.
Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences
König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.
2013-01-01
G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141
Studies of G-quadruplexes formed within self-assembled DNA mini-circles.
Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon
2016-10-13
We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.
Directory of Open Access Journals (Sweden)
Gajjela Raju
Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.
Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana
2012-01-01
Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271
Altered biochemical specificity of G-quadruplexes with mutated tetrads
Czech Academy of Sciences Publication Activity Database
Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.
2016-01-01
Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes
Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.
Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân
2016-01-04
G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Juan Hu
2013-01-01
Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.
Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David
2014-09-03
Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.
Directory of Open Access Journals (Sweden)
Stefano Alcaro
2013-09-01
Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.
Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.
Directory of Open Access Journals (Sweden)
Dmitry Kaluzhny
Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.
Studies of G-quadruplex DNA structures at the single molecule level
DEFF Research Database (Denmark)
Kragh, Sofie Louise
2015-01-01
Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...
Leblanc, T; Deméocq, F; Leverger, G; Baruchel, A; Lemerle, S; Vannier, J P; Nelken, B; Guillot, T; Schaison, G
1994-01-01
Bisantrene is an anthracene derivative which has demonstrated activity in acute myeloblastic leukemia (AML) and in lymphoma. The present study was designed to assess the reinduction rate and toxicity of bisantrene (250 mg/m2/d x 5) associated with aracytine (100 mg/m2 twice a day x 5) in refractory and relapsed acute childhood leukemia. Patients who relapsed after bone marrow transplantation were eligible. Twenty-six children were included. Diagnoses were as follows: 13 AML, 9 acute lymphoblastic leukemia (ALL), and 4 undifferentiated leukemia (AUL). All patients had been very highly pretreated, especially with anthracyclines, and most of them were of poor prognosis. The overall response rate was 46% with a 95% confidence interval ranging from 27-65%. According to diagnosis, complete remission (CR) rates are: AML: 5/13, ALL: 5/9, and AUL: 2/4. Four children died, three from infection and one from acute lysis syndrome. The major toxicity was infection with grade 3 and 4 episodes occurring in 42% of patients. No significant cardiac toxicity was noted. Hepatic and renal toxicity was noted. Hepatic and renal toxicity were limited and transient. Bisantrene in association with aracytine is effective in both AML and ALL of childhood. Bisantrene should be evaluated with a five-day schedule in other pediatric malignancies. In children with acute leukemia previously treated with high dose aracytine, new combination regimen is warranted.
Simultaneous G-Quadruplex DNA Logic.
Bader, Antoine; Cockroft, Scott L
2018-04-03
A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.
Armas, Pablo; David, Aldana; Calcaterra, Nora B
2017-01-01
G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.
Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela
2016-03-18
The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO
Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo
2018-02-01
As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.
Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun
2017-07-19
RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.
Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A
2018-06-01
Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.
Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression
Directory of Open Access Journals (Sweden)
Charikleia Papadopoulou
2015-12-01
Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.
Directory of Open Access Journals (Sweden)
Giovanna Sattin
Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.
Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.
Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân
2015-12-02
G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu
2013-10-01
G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.
Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.
Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij
2015-12-02
Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix
Phan, Anh Tuân; Mergny, Jean-Louis
2002-01-01
Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451
GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.
Directory of Open Access Journals (Sweden)
Kohal Das
Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.
Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo
2009-01-01
Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.
Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S
2017-09-12
The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.
Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng
2017-10-20
Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.
A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore
Energy Technology Data Exchange (ETDEWEB)
Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC
2014-08-21
Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
Directory of Open Access Journals (Sweden)
Natalia Rizeq
2017-12-01
Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.
Takahashi, Shuntaro; Sugimoto, Naoki
2017-12-01
DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.
Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes
Directory of Open Access Journals (Sweden)
Rowe J
2009-08-01
Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.
UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA
International Nuclear Information System (INIS)
Das, Anubrata; Misra, H.S.
2015-01-01
Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)
Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond
2009-01-01
the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....
Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu
2014-10-01
Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
Directory of Open Access Journals (Sweden)
David Monchaud
2010-01-01
Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.
Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey
2016-10-01
Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different
Energy Technology Data Exchange (ETDEWEB)
Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)
2017-02-15
In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.
Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin
2015-02-15
Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.
Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu
2018-03-01
A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.
A mRNA-Responsive G-Quadruplex-Based Drug Release System
Directory of Open Access Journals (Sweden)
Hidenobu Yaku
2015-04-01
Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.
Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui
2018-10-05
G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.
Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis
2017-07-15
Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the
Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes
Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij
2015-01-01
Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...
Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.
Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi
2016-05-17
ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes
Czech Academy of Sciences Publication Activity Database
Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis
2017-01-01
Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016
Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.
Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo
2014-03-21
In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.
2014-01-01
O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506
Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki
2011-01-01
Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901
Directory of Open Access Journals (Sweden)
Emmanuel O Ariyo
Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.
Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi
2013-01-01
Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846
DEFF Research Database (Denmark)
Porru, Manuela; Artuso, Simona; Salvati, Erica
2015-01-01
We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...
Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes
Czech Academy of Sciences Publication Activity Database
Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří
2017-01-01
Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016
Directory of Open Access Journals (Sweden)
Andrzej S Kudlicki
Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.
Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan
2015-05-01
Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.
Local epigenetic reprogramming induced by G-quadruplex ligands
Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar
2017-11-01
DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.
Directory of Open Access Journals (Sweden)
Rosalba Perrone
Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.
Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.
Directory of Open Access Journals (Sweden)
Khondaker M Rahman
Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.
DEFF Research Database (Denmark)
Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard
2017-01-01
Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....
Sun, Daekyu; Hurley, Laurence H
2010-01-01
The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.
Intermolecular G-quadruplex structure-based fluorescent DNA detection system.
Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin
2013-03-15
Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.
Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar
2012-06-05
The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.
Directory of Open Access Journals (Sweden)
Aishwarya Prakash
2011-01-01
Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.
Directory of Open Access Journals (Sweden)
Deanna N Edwards
Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.
Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân
2009-11-25
Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.
DEFF Research Database (Denmark)
Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong
2016-01-01
DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...
Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel
2018-05-01
An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.
Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng
2013-05-01
G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.
RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.
Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola
2018-05-25
DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.
Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.
2018-05-01
Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.
De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân
2016-07-27
The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Yanhua Chen
2016-05-01
Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.
McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L
2017-07-25
G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.
G-Quadruplexes influence pri-microRNA processing.
Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre
2018-02-01
RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.
G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.
Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja
2017-01-01
G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.
G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance
Directory of Open Access Journals (Sweden)
Vikas Yadav
2017-07-01
Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.
Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.
Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke
2016-01-01
We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.
Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.
Directory of Open Access Journals (Sweden)
Yunqiang Bian
2014-04-01
Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.
Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N
2016-02-03
We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano
2013-10-01
Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
G-Quadruplexes in DNA Replication: A Problem or a Necessity?
Valton, Anne-Laure; Prioleau, Marie-Noëlle
2016-11-01
DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.
Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S
2016-01-15
The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small
Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar
2014-07-23
L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.
Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia
2015-01-01
A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.
Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik
2013-03-05
Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.
Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2018-03-20
A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G
2018-06-01
APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.
Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole
2018-03-01
Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong
2017-12-21
An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.
Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping
2014-07-15
For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.
Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae
2018-06-01
The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.
Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch
Czech Academy of Sciences Publication Activity Database
Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.
2017-01-01
Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016
Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.
Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek
2015-06-22
A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina
2018-03-01
Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos
2018-02-08
G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.
Lech, Christopher Jacques; Phan, Anh Tuân
2017-06-20
Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng
2018-02-07
Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.
Thermal stability of DNA quadruplex-duplex hybrids.
Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân
2014-01-14
DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.
DNA and RNA Quadruplex-Binding Proteins
Czech Academy of Sciences Publication Activity Database
Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav
2014-01-01
Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014
Directory of Open Access Journals (Sweden)
Aaron J. Stevens
2017-03-01
Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.
DEFF Research Database (Denmark)
Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus
2011-01-01
Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...
Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu
2017-03-15
This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.
Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V
2012-09-19
Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.
Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch
Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.
2017-10-01
We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.
Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A
2017-03-10
Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.
Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin
2017-07-21
G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable
Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.
Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P
2010-01-15
A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.
RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP
Czech Academy of Sciences Publication Activity Database
Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.
2014-01-01
Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014
Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N
2018-06-01
G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.
Directory of Open Access Journals (Sweden)
Ezekiel Crenshaw
Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.
Czech Academy of Sciences Publication Activity Database
Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk
2015-01-01
Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015
Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C
2018-02-15
Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.
Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua
2018-05-01
Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.
Mms1 is an assistant for regulating G-quadruplex DNA structures.
Schwindt, Eike; Paeschke, Katrin
2017-11-02
The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.
Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun
2014-09-01
A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels
2017-01-01
The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...
Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal
2018-06-01
Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.
DNA secondary structures: stability and function of G-quadruplex structures
Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.
2013-01-01
In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257
Extended molecular dynamics of a c-kit promoter quadruplex
Czech Academy of Sciences Publication Activity Database
Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří
2015-01-01
Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015
Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu
2018-04-21
An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.
Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate
2016-09-21
Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.
Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo
2015-08-04
Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.
Directory of Open Access Journals (Sweden)
John A Capra
2010-07-01
Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.
Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao
2017-12-01
A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.
Directory of Open Access Journals (Sweden)
Jinzhi Tan
2009-05-01
Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins
Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.
2014-01-01
Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669
Energy Technology Data Exchange (ETDEWEB)
Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao
2015-08-05
Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.
G-quadruplex recognition activities of E. Coli MutS
Directory of Open Access Journals (Sweden)
Ehrat Edward A
2012-07-01
Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.
G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*
Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang
2015-01-01
The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683
Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân
2017-09-20
Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.
Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can
2015-03-02
Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
RPA-mediated unfolding of systematically varying G-quadruplex structures.
Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza
2013-05-21
G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.
Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole
2014-08-01
Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei
2016-01-15
Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua
2017-08-01
Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.
Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization
Directory of Open Access Journals (Sweden)
Victor Constantin Diculescu
2010-01-01
Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.
Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.
Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang
2017-12-01
Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.
Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.
Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng
2014-01-29
We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.
Czech Academy of Sciences Publication Activity Database
Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.
2017-01-01
Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016
Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen
2010-08-21
A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.
DEFF Research Database (Denmark)
Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav
2009-01-01
A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....
Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena
2018-02-01
Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.
De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela
2013-11-20
A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.
Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin
2017-09-05
The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.
Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun
2016-06-15
The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.
Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.
Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio
2017-03-14
G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.
Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen
2015-11-23
A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding
Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza
2014-01-01
Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170
Directory of Open Access Journals (Sweden)
Julia H Chariker
Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.
DEFF Research Database (Denmark)
Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.
2007-01-01
Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...
Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E
2014-02-21
Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.
Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer
Directory of Open Access Journals (Sweden)
Felipe Opazo
2015-01-01
Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.
Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage
Czech Academy of Sciences Publication Activity Database
Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel
2017-01-01
Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016
G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression
Czech Academy of Sciences Publication Activity Database
Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela
2017-01-01
Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016
Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo
2015-01-28
In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).
Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang
2016-01-01
Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032
Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.
Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V
2015-03-28
Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.
DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes
Czech Academy of Sciences Publication Activity Database
Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor
2009-01-01
Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process
Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.
2011-01-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589
Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta
2016-09-01
Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.
Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.
Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo
2017-06-01
To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.
Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun
2017-06-02
G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang
2015-01-01
This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.
Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro
Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.
2015-01-01
The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241
Czech Academy of Sciences Publication Activity Database
Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.
2017-01-01
Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016
Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka
2018-03-01
The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.
Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V
2011-12-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.
Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.
Directory of Open Access Journals (Sweden)
Bidisha Sengupta
Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.
Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach
Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.
2013-01-01
Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423
Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia
2011-05-17
Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.
Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.
Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro
2012-04-14
The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012
Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J
2015-08-26
Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.
Directory of Open Access Journals (Sweden)
Alexandro Membrino
Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.
Qu, Konggang; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang
2012-03-01
Strontium ions play important roles in biological systems. The inhalation of strontium can cause severe respiratory difficulties, anaphylactic reaction and extreme tachycardia. Strontium can replace calcium in organisms, inhibit normal calcium absorption and induce strontium "rickets" in childhood. Thus, the development of sensitive and selective methods for the determination of trace amounts of Sr(2+) in aqueous media is of considerable importance for environmental and human health protection. A number of methodologies, such as X-ray energy dispersive spectrometry, inductively coupled argon plasma atomic emission spectroscopy (ICP-AES), atomic absorption spectrometry (AAS) and instrumental thermal neutron activation analysis, have been reported. However, these methods are somewhat complex, costly, time consuming and, especially, need special instruments. Thus, the design of convenient and inexpensive approaches for the sensitive and selective detection of Sr(2+) with rapid, easy manipulation is in ever-increasing demand. To the best of our knowledge, using DNA conformational change to detect Sr(2+) has not yet been reported. Herein we utilized thiazole orange (TO) as a signal reporter to devise a simple Sr(2+) detection assay based on Sr(2+) induced human telomeric DNA conformational change in the presence of SWNTs. The limit of detection is 10 nM Sr(2+) (0.87 μg L(-1)), far below 4 mg L(-1), the U.S. Federal threshold in drinking water defined by the U.S. EPA.
Czech Academy of Sciences Publication Activity Database
Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří
105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014
DEFF Research Database (Denmark)
Foulk, M. S.; Urban, J. M.; Casella, Cinzia
2015-01-01
Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...
Czech Academy of Sciences Publication Activity Database
Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří
2016-01-01
Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016
Monovalent cation induced structural transitions in telomeric DNAs: G-DNA folding intermediates
International Nuclear Information System (INIS)
Hardin, C.C.; Watson, T.; Henderson, E.; Prosser, J.K.
1991-01-01
Telomeric DNA consists of G- and C-rich strands that are always polarized such that the G-rich strand extends past the 3' end of the duplex to form a 12-16-base overhang. These overhanging strands can self-associate in vitro to form intramolecular structures that have several unusual physical properties and at least one common feature, the presence of non-Watson-Crick G·G base pairs. The term G-DNA was coined for this class of structures. On the basis of gel electrophoresis, imino proton NMR, and circular dichroism (CD) results, the authors find that changing the counterions from sodium to potassium specifically induces conformational transitions in the G-rich telomeric DNA from Tetrahymena, d(T 2 G 4 ) 4 (TET4), which results in a change from the intramolecular species to an apparent multistranded structure, accompanied by an increase in the melting temperature of the base pairs of >25 degree, as monitored by loss of the imino proton NMR signals. They infer that the multistranded structure is a quadruplex. The results indicate that specific differences in ionic interactions can result in a switch in telomeric DNAs between intramolecular hairpin-like or quadruplex-containing species and intermolecular quadruplex structures, all of which involve G·G base pairing interaction. They propose a model in which duplex or hairpin forms of G-DNA are folding intermediates in the formation of either 1-, 2-, or 4-stranded quadruplex structures
2015-01-01
Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692
Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong
2017-11-29
G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.
Hirashima, Kyotaro; Seimiya, Hiroyuki
2015-02-27
Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Mostafavi, Najmeh; Ebrahimi, Ali
2018-06-01
In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.
Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao
2018-03-09
Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Directory of Open Access Journals (Sweden)
Charlotte Rehm
Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S
2015-01-01
In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
Charge splitters and charge transport junctions based on guanine quadruplexes
Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.
2018-04-01
Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.
The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.
Zaccaria, F; Paragi, G; Fonseca Guerra, C
2016-08-21
The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.
Audry, Julien; Maestroni, Laetitia; Delagoutte, Emmanuelle; Gauthier, Tiphaine; Nakamura, Toru M; Gachet, Yannick; Saintomé, Carole; Géli, Vincent; Coulon, Stéphane
2015-07-14
Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in DNA replication, recombination, and repair. In fission yeast, the Rpa1-D223Y mutation provokes telomere shortening. Here, we show that this mutation impairs lagging-strand telomere replication and leads to the accumulation of secondary structures and recruitment of the homologous recombination factor Rad52. The presence of these secondary DNA structures correlates with reduced association of shelterin subunits Pot1 and Ccq1 at telomeres. Strikingly, heterologous expression of the budding yeast Pif1 known to efficiently unwind G-quadruplex rescues all the telomeric defects of the D223Y cells. Furthermore, in vitro data show that the identical D to Y mutation in human RPA specifically affects its ability to bind G-quadruplex. We propose that RPA prevents the formation of G-quadruplex structures at lagging-strand telomeres to promote shelterin association and facilitate telomerase action at telomeres. © 2015 The Authors.
Structure of a Stable G-Hairpin
Czech Academy of Sciences Publication Activity Database
Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.
2017-01-01
Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded-dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016
Stability of Human Telomere Quadruplexes at High DNA Concentrations
Czech Academy of Sciences Publication Activity Database
Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.
2014-01-01
Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014
Isolation of deletion alleles by G4 DNA-induced mutagenesis
Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel
Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature
Czech Academy of Sciences Publication Activity Database
Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří
2014-01-01
Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014
Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A
2015-05-01
Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.
Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai
2013-02-01
Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".
Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar
2015-01-01
Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.
Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei
2017-01-01
To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564
DEFF Research Database (Denmark)
Litman, Thomas; Brangi, M; Hudson, E
2000-01-01
by PCR, immunoblot assay and immunohistochemistry. These MXR overexpressing sublines were compared to cell lines with P-glycoprotein- and MRP-mediated resistance. High levels of cross-resistance were observed for mitoxantrone, the anthracyclines, bisantrene and topotecan. Reduced levels of mitoxantrone......, daunorubicin, bisantrene, topotecan, rhodamine 123 and prazosin were observed in the two sublines with high MXR expression. Neither the P-glycoprotein substrates vinblastine, paclitaxel, verapamil and calcein-AM, nor the MRP substrate calcein, were extruded from MCF-7 AdVp3000 and S1-M1-80 cells. Thus...
Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets
Czech Academy of Sciences Publication Activity Database
Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela
2009-01-01
Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009
Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations
Czech Academy of Sciences Publication Activity Database
Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří
2004-01-01
Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004
Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons
Czech Academy of Sciences Publication Activity Database
Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris
2014-01-01
Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014
QuadBase2: web server for multiplexed guanine quadruplex mining and visualization
Dhapola, Parashar; Chowdhury, Shantanu
2016-01-01
DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890
Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding
Czech Academy of Sciences Publication Activity Database
Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela
2014-01-01
Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014
Czech Academy of Sciences Publication Activity Database
Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří
2016-01-01
Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016
Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang
2015-01-01
Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.
Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju
2017-12-15
Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.
Marathias, V M; Sawicki, M J; Bolton, P H
1999-07-15
The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.
Selectivity determinants of GPCR-G-protein binding
DEFF Research Database (Denmark)
Flock, Tilman; Hauser, Alexander S; Lund, Nadia
2017-01-01
of the G-protein barcode through distinct residues, like multiple keys (receptors) opening the same lock (G protein) using non-identical cuts. Considering the evolutionary history of GPCRs allows the identification of these selectivity-determining residues. These findings lay the foundation...
Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions
Kocman, Vojč; Plavec, Janez
2017-05-01
Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.
Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.
Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu
2018-08-01
In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.
New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.
Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni
2018-02-10
The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50 = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Minglei Yang
Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.
Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie
2018-06-01
An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process
Czech Academy of Sciences Publication Activity Database
Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.
2011-01-01
Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011
CpG islands undermethylation in human genomic regions under selective pressure.
Directory of Open Access Journals (Sweden)
Sergio Cocozza
Full Text Available DNA methylation at CpG islands (CGIs is one of the most intensively studied epigenetic mechanisms. It is fundamental for cellular differentiation and control of transcriptional potential. DNA methylation is involved also in several processes that are central to evolutionary biology, including phenotypic plasticity and evolvability. In this study, we explored the relationship between CpG islands methylation and signatures of selective pressure in Homo Sapiens, using a computational biology approach. By analyzing methylation data of 25 cell lines from the Encyclopedia of DNA Elements (ENCODE Consortium, we compared the DNA methylation of CpG islands in genomic regions under selective pressure with the methylation of CpG islands in the remaining part of the genome. To define genomic regions under selective pressure, we used three different methods, each oriented to provide distinct information about selective events. Independently of the method and of the cell type used, we found evidences of undermethylation of CGIs in human genomic regions under selective pressure. Additionally, by analyzing SNP frequency in CpG islands, we demonstrated that CpG islands in regions under selective pressure show lower genetic variation. Our findings suggest that the CpG islands in regions under selective pressure seem to be somehow more "protected" from methylation when compared with other regions of the genome.
Energy Technology Data Exchange (ETDEWEB)
Shi, Kai; Dou, Baoting; Yang, Jianmei; Yuan, Ruo; Xiang, Yun, E-mail: yunatswu@swu.edu.cn
2016-04-15
The monitoring of microRNA (miRNA) expression levels is of great importance in cancer diagnosis. In the present work, based on two cascaded toehold-mediated strand displacement reactions (TSDRs), we have developed a label- and enzyme-free target recycling signal amplification approach for sensitive electronic detection of miRNA-21 from human breast cancer cells. The junction probes containing the locked G-quadruplex forming sequences are self-assembled on the senor surface. The presence of the target miRNA-21 initiates the first TSDR and results in the disassembly of the junction probes and the release of the active G-quadruplex forming sequences. Subsequently, the DNA fuel strand triggers the second TSDR and leads to cyclic reuse of the target miRNA-21. The cascaded TSDRs thus generate many active G-quadruplex forming sequences on the sensor surface, which associate with hemin to produce significantly amplified current response for sensitive detection of miRNA-21 at 1.15 fM. The sensor is also selective and can be employed to monitor miRNA-21 from human breast cancer cells. - Highlights: • Amplified and sensitive detection of microRNA from tumor cells is achieved. • Signal amplification is realized by two cascaded strand displacement reactions. • The developed sensor is selective and label-free without involving any enzymes.
Gong, Xue; Li, Jinfu; Zhou, Wenjiao; Xiang, Yun; Yuan, Ruo; Chai, Yaqin
2014-05-30
Based on target recycling amplification, the development of a new label-free, simple and sensitive colorimetric detection method for ATP by using un-modified aptamers and DNAzymes is described. The association of the model target molecules (ATP) with the corresponding aptamers of the dsDNA probes leads to the release of the G-quadruplex sequences. The ATP-bound aptamers can be further degraded by Exonuclease III to release ATP, which can again bind the aptamers of the dsDNA probes to initiate the target recycling amplification process. Due to this target recycling amplification, the amount of the released G-quadruplex sequences is significantly enhanced. Subsequently, these G-quadruplex sequences bind hemin to form numerous peroxidase mimicking DNAzymes, which cause substantially intensified color change of the probe solution for highly sensitive colorimetric detection of ATP down to the sub-nanomolar (0.33nM) level. Our method is highly selective toward ATP against other control molecules and can be performed in one single homogeneous solution, which makes our sensing approach hold great potential for sensitive colorimetric detection of other small molecules and proteins. Copyright © 2014 Elsevier B.V. All rights reserved.
Yan, Shengyong; Huang, Rong; Zhou, Yangyang; Zhang, Ming; Deng, Minggang; Wang, Xiaolin; Weng, Xiaocheng; Zhou, Xiang
2011-01-28
In this thrombin detection system, the bright fluorescence of TASPI is almost eliminated by the DNA aptamer TBA (turn-off); however, in the presence of thrombin, it specifically binds to TBA by folding unrestricted TBA into an anti-parallel G-quadruplex structure and then releasing TASPI molecules, resulting in vivid and facile fluorescence recovery (turn-on).
Effective DNA Inhibitors of Cathepsin G by In Vitro Selection
Gatto, Barbara; Vianini, Elena; Lucatello, Lorena; Sissi, Claudia; Moltrasio, Danilo; Pescador, Rodolfo; Porta, Roberto; Palumbo, Manlio
2008-01-01
Cathepsin G (CatG) is a chymotrypsin-like protease released upon degranulation of neutrophils. In several inflammatory and ischaemic diseases the impaired balance between CatG and its physiological inhibitors leads to tissue destruction and platelet aggregation. Inhibitors of CatG are suitable for the treatment of inflammatory diseases and procoagulant conditions. DNA released upon the death of neutrophils at injury sites binds CatG. Moreover, short DNA fragments are more inhibitory than genomic DNA. Defibrotide, a single stranded polydeoxyribonucleotide with antithrombotic effect is also a potent CatG inhibitor. Given the above experimental evidences we employed a selection protocol to assess whether DNA inhibition of CatG may be ascribed to specific sequences present in defibrotide DNA. A Selex protocol was applied to identify the single-stranded DNA sequences exhibiting the highest affinity for CatG, the diversity of a combinatorial pool of oligodeoxyribonucleotides being a good representation of the complexity found in defibrotide. Biophysical and biochemical studies confirmed that the selected sequences bind tightly to the target enzyme and also efficiently inhibit its catalytic activity. Sequence analysis carried out to unveil a motif responsible for CatG recognition showed a recurrence of alternating TG repeats in the selected CatG binders, adopting an extended conformation that grants maximal interaction with the highly charged protein surface. This unprecedented finding is validated by our results showing high affinity and inhibition of CatG by specific DNA sequences of variable length designed to maximally reduce pairing/folding interactions. PMID:19325843
Effective DNA Inhibitors of Cathepsin G by In Vitro Selection
Directory of Open Access Journals (Sweden)
Manlio Palumbo
2008-06-01
Full Text Available Cathepsin G (CatG is a chymotrypsin-like protease released upon degranulation of neutrophils. In several inflammatory and ischaemic diseases the impaired balance between CatG and its physiological inhibitors leads to tissue destruction and platelet aggregation. Inhibitors of CatG are suitable for the treatment of inflammatory diseases and procoagulant conditions. DNA released upon the death of neutrophils at injury sites binds CatG. Moreover, short DNA fragments are more inhibitory than genomic DNA. Defibrotide, a single stranded polydeoxyribonucleotide with antithrombotic effect is also a potent CatG inhibitor. Given the above experimental evidences we employed a selection protocol to assess whether DNA inhibition of CatG may be ascribed to specific sequences present in defibrotide DNA. A Selex protocol was applied to identify the single-stranded DNA sequences exhibiting the highest affinity for CatG, the diversity of a combinatorial pool of oligodeoxyribonucleotides being a good representation of the complexity found in defibrotide. Biophysical and biochemical studies confirmed that the selected sequences bind tightly to the target enzyme and also efficiently inhibit its catalytic activity. Sequence analysis carried out to unveil a motif responsible for CatG recognition showed a recurrence of alternating TG repeats in the selected CatG binders, adopting an extended conformation that grants maximal interaction with the highly charged protein surface. This unprecedented finding is validated by our results showing high affinity and inhibition of CatG by specific DNA sequences of variable length designed to maximally reduce pairing/folding interactions.
Czech Academy of Sciences Publication Activity Database
Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří
2010-01-01
Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010
Novel molecular targets for kRAS downregulation: promoter G-quadruplexes
2016-11-01
proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with
Spinello, A; Barone, G; Grunenberg, J
2016-01-28
In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.
Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA
DEFF Research Database (Denmark)
Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch
2016-01-01
of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...
Transposable elements and G-quadruplexes
Czech Academy of Sciences Publication Activity Database
Kejnovský, Eduard; Tokan, Viktor; Lexa, M.
2015-01-01
Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015
Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh
2014-09-05
The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
DEFF Research Database (Denmark)
Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich
2012-01-01
Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...
Present status of understanding on the G6PD deficiency and natural selection
Directory of Open Access Journals (Sweden)
Tripathy V
2007-01-01
Full Text Available G6PD deficiency is a common hemolytic genetic disorder, particularly in the areas endemic to malaria. Individuals are generally asymptomatic and hemolytic anemia occurs when some anti-malarial drugs or other oxidizing chemicals are administered. It has been proposed that G6PD deficiency provides protection against malaria. Maintaining of G6PD deficient alleles at polymorphic proportions is complicated because of the X-linked nature of G6PD deficiency. A comprehensive review of the literature on the hypothesis of malarial protection and the nature of the selection is being presented. Most of the epidemiological, in vitro and in vivo studies report selection for G6PD deficiency. Analysis of the G6PD gene also reveals that G6PD-deficient alleles show some signatures of selection. However, the question of how this polymorphism is being maintained remains unresolved because the selection/fitness coefficients for the different genotypes in the two sexes have not been established. Prevalence of G6PD deficiency in Indian caste and tribal populations and the different variants reported has also been reviewed.
Autonomous Component Carrier Selection for 4G Femtocells
DEFF Research Database (Denmark)
Garcia, Luis Guilherme Uzeda; Kovacs, Istvan; Pedersen, Klaus
2012-01-01
main contribution in this paper, denominated Generalized Autonomous Component Carrier Selection (G-ACCS), is a distributed carrier-based inter-cell interference coordination scheme that represents one step towards cognitive radio networks. The algorithm relies on expected rather than sensed...... interference levels. This approach facilitates scheduler-independent decisions, however, it can lead to overestimation of the interference coupling among cells when the resources are not fully utilized. Acknowledging this fact, G-ACCS leverages the power domain to circumvent the restrictive nature of expected...
Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří
2016-04-12
Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.
Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence
Tawani, Arpita; Kumar, Amit
2015-01-01
Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543
2017-01-01
We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322
Potent and Selective Covalent Quinazoline Inhibitors of KRAS G12C
Energy Technology Data Exchange (ETDEWEB)
Zeng, Mei; Lu, Jia; Li, Lianbo; Feru, Frederic; Quan, Chunshan; Gero, Thomas W.; Ficarro, Scott B.; Xiong, Yuan; Ambrogio, Chiara; Paranal, Raymond M.; Catalano, Marco; Shao, Jay; Wong, Kwok-Kin; Marto, Jarrod A.; Fischer, Eric S.; Jänne, Pasi A.; Scott, David A.; Westover, Kenneth D.; Gray, Nathanael S. (DFCI); (UTSMC); (Harvard-Med); (NYUSM)
2017-08-01
Targeted covalent small molecules have shown promise for cancers driven by KRAS G12C. Allosteric compounds that access an inducible pocket formed by movement of a dynamic structural element in KRAS, switch II, have been reported, but these compounds require further optimization to enable their advancement into clinical development. We demonstrate that covalent quinazoline-based switch II pocket (SIIP) compounds effectively suppress GTP loading of KRAS G12C, MAPK phosphorylation, and the growth of cancer cells harboring G12C. Notably we find that adding an amide substituent to the quinazoline scaffold allows additional interactions with KRAS G12C, and remarkably increases the labeling efficiency, potency, and selectivity of KRAS G12C inhibitors. Structural studies using X-ray crystallography reveal a new conformation of SIIP and key interactions made by substituents located at the quinazoline 2-, 4-, and 7-positions. Optimized lead compounds in the quinazoline series selectively inhibit KRAS G12C-dependent signaling and cancer cell growth at sub-micromolar concentrations.
Zeng, Xiaojun; Zhang, Liyun; Xiao, Xiuchan; Jiang, Yuanyuan; Guo, Yanzhi; Yu, Xinyan; Pu, Xuemei; Li, Menglong
2016-04-05
Thrombin-binding aptamer (TBA) with the sequence 5'GGTTGGTGTGGTTGG3' could fold into G-quadruplex, which correlates with functionally important genomic regionsis. However, unfolding mechanism involved in the structural stability of G-quadruplex has not been satisfactorily elucidated on experiments so far. Herein, we studied the unfolding pathway of TBA by a combination of molecular dynamics simulation (MD) and Markov State Model (MSM). Our results revealed that the unfolding of TBA is not a simple two-state process but proceeds along multiple pathways with multistate intermediates. One high flux confirms some observations from NMR experiment. Another high flux exhibits a different and simpler unfolding pathway with less intermediates. Two important intermediate states were identified. One is similar to the G-triplex reported in the folding of G-quadruplex, but lack of H-bonding between guanines in the upper plane. More importantly, another intermediate state acting as a connector to link the folding region and the unfolding one, was the first time identified, which exhibits higher population and stability than the G-triplex-like intermediate. These results will provide valuable information for extending our understanding the folding landscape of G-quadruplex formation.
High-resolution AFM structure of DNA G-wires in aqueous solution.
Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân
2018-05-17
We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.
Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.
Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar
2010-06-01
The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.
Ren, Wang; Zhang, Ying; Huang, Wei Tao; Li, Nian Bing; Luo, Hong Qun
2015-06-15
This work reported a label-free colorimetric assay for sensitive detection of Hg(2+) based on Hg(2+)-triggered hairpin DNA probe (H-DNA) termini-binding and exonuclease Ш (Exo Ш)-assisted target recycling, as well as hemin/G-quadruplex (DNAzyme) signal amplification. The specific binding of free Hg(2+) with the thymine-thymine (T-T) mismatches termini of H-DNA could immediately trigger the Exo Ш digestion, and then set free G-quadruplex segments and Hg(2+). The Exo Ш impellent recycling of ultratrace Hg(2+) produced numerous G-quadruplexes. The corresponding DNAzymes catalyzed efficiently the H2O2-mediated oxidation of the ABTS(2-) to the colored product in the presence of hemin. Using the color change as the output signal, and the Exo Ш-aided Hg(2+) recycling and DNAzyme as the signal amplifier, the ultrasensitive assay system successfully achieved visual detection of Hg(2+) as low as 1.0 nM by the naked eye, and was suitable for field monitoring. The calibration curve was linear in the range of 50.0 pM to 20.0 nM for Hg(2+) (R=0.9962) with a detection limit of 10.0 pM. Moreover, this proposed strategy showed excellent selectivity, portability and low-cost, and was successfully applied to colorimetric detection of Hg(2+) in laboratory tap water and Jialing river water samples. Copyright © 2015 Elsevier B.V. All rights reserved.
49 CFR Schedule G to Subpart B of... - Selected Statistical Data
2010-10-01
..., L. 12, col. (b) 26Total passenger revenue Sch. 9002, L. 16, col. (b) 27Passenger-miles per bus mile... PROCEEDINGS Intercity Bus Industry Pt. 1139, Subpt. B, Sch. G Schedule G to Subpart B of Part 1139—Selected.... (b) 2Special bus revenue Sch. 2998, L. 2, col. (b) 3Express revenue Sch. 2998, L. 5, col. (b) 4Total...
Molecular Mechanism of Selectivity among G Protein-Coupled Receptor Kinase 2 Inhibitors
Energy Technology Data Exchange (ETDEWEB)
Thal, David M.; Yeow, Raymond Y.; Schoenau, Christian; Huber, Jochen; Tesmer, John J.G. (Sanofi); (Michigan)
2012-07-11
G protein-coupled receptors (GPCRs) are key regulators of cell physiology and control processes ranging from glucose homeostasis to contractility of the heart. A major mechanism for the desensitization of activated GPCRs is their phosphorylation by GPCR kinases (GRKs). Overexpression of GRK2 is strongly linked to heart failure, and GRK2 has long been considered a pharmaceutical target for the treatment of cardiovascular disease. Several lead compounds developed by Takeda Pharmaceuticals show high selectivity for GRK2 and therapeutic potential for the treatment of heart failure. To understand how these drugs achieve their selectivity, we determined crystal structures of the bovine GRK2-G{beta}{gamma} complex in the presence of two of these inhibitors. Comparison with the apoGRK2-G{beta}{gamma} structure demonstrates that the compounds bind in the kinase active site in a manner similar to that of the AGC kinase inhibitor balanol. Both balanol and the Takeda compounds induce a slight closure of the kinase domain, the degree of which correlates with the potencies of the inhibitors. Based on our crystal structures and homology modeling, we identified five amino acids surrounding the inhibitor binding site that we hypothesized could contribute to inhibitor selectivity. However, our results indicate that these residues are not major determinants of selectivity among GRK subfamilies. Rather, selectivity is achieved by the stabilization of a unique inactive conformation of the GRK2 kinase domain.
Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.
Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh
2017-10-18
G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki
2014-01-01
The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.
Selective localization of IgG from cerebrospinal fluid to brain parenchyma
DEFF Research Database (Denmark)
Mørch, Marlene Thorsen; Forsberg Sørensen, Sofie; Khorooshi, Reza M. H.
2018-01-01
the cerebrospinal fluid and induce subpial and periventricular NMO-like lesions and blood-brain barrier breakdown, in a complement-dependent manner. To investigate how IgG trafficking from cerebrospinal fluid to brain parenchyma can be influenced by injury. IgG from healthy donors was intrathecally injected...... into the cerebrospinal fluid via cisterna magna at 1, 2, 4, or 7 days after a distal stereotactic sterile needle insertion to the striatum. Antibody deposition, detected by staining for human IgG, peaked 1 day after the intrathecal injection and was selectively seen close to the needle insertion. When NMO...
RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.
Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J
2012-05-11
T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.
Park, Yeonkyung; Lee, Chang Yeol; Kang, Shinyoung; Kim, Hansol; Park, Ki Soo; Park, Hyun Gyu
2018-02-01
In this work, we developed a novel, label-free, and enzyme-free strategy for the colorimetric detection of microRNA (miRNA), which relies on a target-catalyzed toehold-mediated strand displacement (TMSD) reaction. The system employs a detection probe that specifically binds to the target miRNA and sequentially releases a catalyst strand (CS) intended to trigger the subsequent TMSD reaction. Thus, the presence of target miRNA releases the CS that mediates the formation of an active G-quadruplex DNAzyme which is initially caged and inactivated by a blocker strand. In addition, a fuel strand that is supplemented for the recycling of the CS promotes another TMSD reaction, consequently generating a large number of active G-quadruplex DNAzymes. As a result, a distinct colorimetric signal is produced by the ABTS oxidation promoted by the peroxidase mimicking activity of the released G-quadruplex DNAzymes. Based on this novel strategy, we successfully detected miR-141, a promising biomarker for human prostate cancer, with high selectivity. The diagnostic capability of this system was also demonstrated by reliably determining target miR-141 in human serum, showing its great potential towards real clinical applications. Importantly, the proposed approach is composed of separate target recognition and signal transduction modules. Thus, it could be extended to analyze different target miRNAs by simply redesigning the detection probe while keeping the same signal transduction module as a universal signal amplification unit, which was successfully demonstrated by analyzing another target miRNA, let-7d.
Li, Xia; Song, Juan; Xue, Qing-Wang; You, Fu-Heng; Lu, Xia; Kong, Yan-Cong; Ma, Shu-Yi; Jiang, Wei; Li, Chen-Zhong
2016-10-21
Bisphenol A (BPA) detection in drinking water and food packaging materials has attracted much attention since the discovery that BPA can interfere with normal physiological processes and cause adverse health effects. Here, we constructed a label-free aptamer fluorescent assay for selective and sensitive detection of BPA based on the rolling circle amplification (RCA)/Exonuclease III (Exo III)-combined cascade amplification strategy. First, the duplex DNA probe (RP) with anti-BPA aptamer and trigger sequence was designed for BPA recognition and signal amplification. Next, under the action of BPA, the trigger probe was liberated from RP to initiate RCA reaction as primary amplification. Subsequently, the RCA products were used to trigger Exo III assisted secondary amplification with the help of hairpin probes, producing plenty of "G-quadruplex" in lantern-like structures. Finally, the continuously enriched "G-quadruplex lanterns" were lightened by zinc(II)-protoporphyrin IX (ZnPPIX) generating enhanced fluorescence signals. By integrating the primary RCA and secondary Exo III mediated cascade amplification strategy, this method displayed an excellent sensitivity with the detection limits of 5.4 × 10 -17 M. In addition, the anti-BPA aptamer exhibits high recognition ability with BPA, guaranteeing the specificity of detection. The reporter signal probe (G-quadruplex with ZnPPIX) provides a label-free fluorescence signals readout without complicated labeling procedures, making the method simple in design and cost-effective in operation. Moreover, environmental samples analysis was also performed, suggesting that our strategy was reliable and had a great potential application in environmental monitoring.
Stoltenburg, Regina; Kraf?ikov?, Petra; V?glask?, Viktor; Strehlitz, Beate
2016-01-01
Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting P...
2010-07-01
... Enforcement Auditing of Marine Engines A Appendix A to Subpart G of Part 91 Protection of Environment...-IGNITION ENGINES Selective Enforcement Auditing Regulations Pt. 91, Subpt. G, App. A Appendix A to Subpart G of Part 91—Sampling Plans for Selective Enforcement Auditing of Marine Engines Table 1—Sampling...
Bao, Ting; Shu, Huawei; Wen, Wei; Zhang, Xiuhua; Wang, Shengfu
2015-03-03
A target-induced structure-switching electrochemical aptasensor for sensitive detection of ATP was successfully constructed which was based on exonuclease III-catalyzed target recycling for signal amplification. With the existence of ATP, methylene blue (MB) labeled hairpin DNA formed G-quadruplex with ATP, which led to conformational changes of the hairpin DNA and created catalytic cleavage sites for exonuclease III (Exo III). Then the structure-switching DNA hybridized with capture DNA which made MB close to electrode surface. Meanwhile, Exo III selectively digested aptamer from its 3'-end, thus G-quadruplex structure was destroyed and ATP was released for target recycling. The Exo III-assisted target recycling amplified electrochemical signal significantly. Fluorescence experiment was performed to confirm the structure-switching process of the hairpin DNA. In fluorescence experiment, AuNPs-aptamer conjugates were synthesized, AuNPs quenched fluorescence of MB, the target-induced structure-switching made Exo III digested aptamer, which restored fluorescence. Under optimized conditions, the proposed aptasensor showed a linear range of 0.1-20 nM with a detection limit of 34 pM. In addition, the proposed aptasensor had good stability and selectivity, offered promising choice for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.
Zhang, Baozhu; Wei, Chunying
2018-05-15
A novel turn-on fluorescent biosensor has been constructed using C-PS2.M-DNA-templated silver nanoclusters (Ag NCs) with an average diameter of about 1 nm. The proposed approach presents a low-toxic, simple, sensitive, and selective detection for Pb 2+ . The fluorescence intensity of C-PS2.M-DNA-Ag NCs enhances significantly in the presence of Pb 2+ , which is attributed to the special interaction between Pb 2+ and its aptamer DNA PS2.M. Pb 2+ induces the aptamer to form G-quadruplex and makes two darkish DNA/Ag NCs located at the 3' and 5' terminus close, resulting in the fluorescence light-up. Moreover, Pb 2+ can be detected as low as 3.0 nM within a good linear range from 5 to 50 nM (R = 0.9862). Furthermore, the application for detection of Pb 2+ in real water samples further demonstrates the reliability of the sensor. Thus, this sensor system shows a potential application for monitoring Pb 2+ in environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.
Selective oxidation of alcohols using photoactive VO@g-C3N4.
A photoactive VO@g-C3N4 catalyst has been developed for the selective oxidation of alcohols to the corresponding aldehydes and ketones. The visible light mediated activity of the catalyst could be attributed to photoactive graphitic carbon nitrides surface.
DEFF Research Database (Denmark)
Cogoi, Susanna; Zorzet, Sonia; Rapozzi, Valentina
2013-01-01
and stability, two polycyclic aromatic hydrocarbon units (TINA or AMANY) were inserted internally, to cap the quadruplex. The most active G4-decoy (2998), which had two para-TINAs, strongly suppressed KRAS expression in Panc-1 cells. It also repressed their metabolic activity (IC50 = 520 nM), and it inhibited...... cell growth and colony formation by activating apoptosis. We finally injected 2998 and control oligonucleotides 5153, 5154 (2 nmol/mouse) intratumorally in SCID mice bearing a Panc-1 xenograft. After three treatments, 2998 reduced tumor xenograft growth by 64% compared with control and increased...
Backbone modified TBA analogues endowed with antiproliferative activity.
Esposito, Veronica; Russo, Annapina; Amato, Teresa; Varra, Michela; Vellecco, Valentina; Bucci, Mariarosaria; Russo, Giulia; Virgilio, Antonella; Galeone, Aldo
2017-05-01
The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.
An Adaptive Learning Based Network Selection Approach for 5G Dynamic Environments
Directory of Open Access Journals (Sweden)
Xiaohong Li
2018-03-01
Full Text Available Networks will continue to become increasingly heterogeneous as we move toward 5G. Meanwhile, the intelligent programming of the core network makes the available radio resource be more changeable rather than static. In such a dynamic and heterogeneous network environment, how to help terminal users select optimal networks to access is challenging. Prior implementations of network selection are usually applicable for the environment with static radio resources, while they cannot handle the unpredictable dynamics in 5G network environments. To this end, this paper considers both the fluctuation of radio resources and the variation of user demand. We model the access network selection scenario as a multiagent coordination problem, in which a bunch of rationally terminal users compete to maximize their benefits with incomplete information about the environment (no prior knowledge of network resource and other users’ choices. Then, an adaptive learning based strategy is proposed, which enables users to adaptively adjust their selections in response to the gradually or abruptly changing environment. The system is experimentally shown to converge to Nash equilibrium, which also turns out to be both Pareto optimal and socially optimal. Extensive simulation results show that our approach achieves significantly better performance compared with two learning and non-learning based approaches in terms of load balancing, user payoff and the overall bandwidth utilization efficiency. In addition, the system has a good robustness performance under the condition with non-compliant terminal users.
Kutushov, M; Gorelik, O
2013-01-01
Rhodamine-6G is a fluorescent dye binding to mitochondria, thus reducing the intact mitochondria number and inhibiting mitochondrial metabolic activity. Resultantly, the respiratory chain functioning becomes blocked, the cell "suffocated" and eventually destroyed. Unlike normal cells, malignant cells demonstrate a priori reduced mitochondrial numbers and aberrant metabolism. Therefore, a turning point might exist, when Rhodamine-induced loss of active mitochondria would selectively destroy malignant, but spare normal cells. Various malignant vs. non-malignant cell lines were cultured with Rhodamine-6G at different concentrations. In addition, C57Bl mice were implanted with B16-F10 melanoma and treated with Rhodamine-6G at different dosage/time regimens. Viability and proliferation of cultured tumor cells were time and dose-dependently inhibited, up to 90%, by Rhodamine-6G, with profound histological signs of cell death. By contrast, inhibition of normal control cell proliferation hardly exceeded 15-17%. Melanoma-transplanted mice receiving Rhodamine-6G demonstrated prolonged survival, improved clinical parameters, inhibited tumor growth and metastases count, compared to their untreated counterparts. Twice-a-week 10-6M Rhodamine-6G regimen yielded the most prominent results. We conclude that malignant, but not normal, cells are selectively destroyed by low doses of Rhodamine-6G. In vivo, such treatment selectively suppresses tumor progression and dissemination, thus improving prognosis. We suggest that selective anti-tumor properties of Rhodamine-6G are based on unique physiologic differences in energy metabolism between malignant and normal cells. If found clinically relevant, low concentrations of Rhodamine-6G might be useful for replacing, or backing up, more aggressive nonselective chemotherapeutic compounds.
DEFF Research Database (Denmark)
Sergeev, Eugenia; Hansen, Anders Højgaard; Bolognini, Daniele
2017-01-01
selectivity and mutational swap studies confirmed this hypothesis. Extending these studies to agonist function indicated that although the lysine - arginine variation between human and mouse orthologs had limited effect on G protein-mediated signal transduction, removal of positive charge from this residue...... produced a signalling-biased variant of Free Fatty Acid Receptor 2 in which Gi-mediated signalling by both short chain fatty acids and synthetic agonists was maintained whilst there was marked loss of agonist potency for signalling via Gq/11 and G12/13 G proteins. A single residue at the extracellular face...
Xiong, Xiaoqin; Gan, Lu; Liu, Ying; Zhang, Chun; Yong, Tuying; Wang, Ziyi; Xu, Huibi; Yang, Xiangliang
2015-03-01
Carbon-based materials have been widely used in the biomedical fields including drug delivery and cancer therapies. In this paper, a recently synthesized three-dimensional nanographene (NG) based on triptycene self-assembles into nanoparticles which selectively kill human hepatocellular carcinoma HepG2 cells as compared to human normal liver HL7702 cells. Obvious differences in cellular accumulation, the endocytic pathway and intracellular trafficking of NG nanoparticles are observed in HepG2 cells and HL7702 cells. Further studies reveal that NG nanoparticles significantly increase the levels of reactive oxygen species (ROS) in HepG2 cells, but not in HL7702 cells. NG nanoparticle-induced ROS result in apoptosis induction and the decrease in mitochondrial membrane potential in HepG2 cells. Moreover, IKK/nuclear factor-κB (NF-κB) signaling is found to be activated by NG nanoparticle-induced ROS and serves to antagonize NG nanoparticle-induced apoptosis in HepG2 cells. Our studies show that the distinct behaviors of cellular uptake and ROS-mediated cytotoxicity are responsible for the selective killing of HepG2 cells. This study provides a foundation for understanding the mechanism of selective induction of apoptosis in cancer cells by NG nanoparticles and designing more effective chemotherapeutical agents.Carbon-based materials have been widely used in the biomedical fields including drug delivery and cancer therapies. In this paper, a recently synthesized three-dimensional nanographene (NG) based on triptycene self-assembles into nanoparticles which selectively kill human hepatocellular carcinoma HepG2 cells as compared to human normal liver HL7702 cells. Obvious differences in cellular accumulation, the endocytic pathway and intracellular trafficking of NG nanoparticles are observed in HepG2 cells and HL7702 cells. Further studies reveal that NG nanoparticles significantly increase the levels of reactive oxygen species (ROS) in HepG2 cells, but not in HL7702
Çorman, Mehmet Emin; Armutcu, Canan; Uzun, Lokman; Say, Rıdvan; Denizli, Adil
2014-11-01
Molecular imprinting is a polymerization technique that provides synthetic analogs for template molecules. Molecularly imprinted polymers (MIPs) have gained much attention due to their unique properties such as selectivity and specificity for target molecules. In this study, we focused on the development of polymeric materials with molecular recognition ability, so molecular imprinting was combined with miniemulsion polymerization to synthesize self-orienting nanoparticles through the use of an epitope imprinting approach. Thus, L-lysine imprinted nanoparticles (LMIP) were synthesized via miniemulsion polymerization technique. Immunoglobulin G (IgG) was then bound to the cavities that specifically formed for L-lysine molecules that are typically found at the C-terminus of the Fc region of antibody molecules. The resulting nanoparticles makes it possible to minimize the nonspecific interaction between monomer and template molecules. In addition, the orientation of the entire IgG molecule was controlled, and random imprinting of the IgG was prevented. The optimum conditions were determined for IgG recognition using the imprinted nanoparticles. The selectivity of the nanoparticles against IgG molecules was also evaluated using albumin and hemoglobin as competitor molecules. In order to show the self-orientation capability of imprinted nanoparticles, human serum albumin (HSA) adsorption onto both the plain nanoparticles and immobilized nanoparticles by anti-human serum albumin antibody (anti-HSA antibody) was also carried out. Due to anti-HSA antibody immobilization on the imprinted nanoparticles, the adsorption capability of nanoparticles against HSA molecules vigorously enhanced. It is proved that the oriented immobilization of antibodies was appropriately succeeded. Copyright © 2014 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Rodriguez, Pilar [Unitat de Biologia Cel.lular, Departament de Biologia Cel.lular, Fisiologia i Immunologia, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Barquinero, Joan Francesc [Unitat d' Antropologia Biologica, Departament de Biologia Animal, Biologia Vegetal i Ecologia, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Duran, Assumpta [Unitat de Biologia Cel.lular, Departament de Biologia Cel.lular, Fisiologia i Immunologia, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Caballin, Maria Rosa [Unitat d' Antropologia Biologica, Departament de Biologia Animal, Biologia Vegetal i Ecologia, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Ribas, Montserrat [Servei de Radiofisica i Radioproteccio de l' Hospital de la Santa Creu i Sant Pau, 08025 Barcelona (Spain); Barrios, Leonardo, E-mail: Lleonard.Barrios@uab.cat [Unitat de Biologia Cel.lular, Departament de Biologia Cel.lular, Fisiologia i Immunologia, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain)
2009-11-02
Cell cycle checkpoints are part of the cellular mechanisms to maintain genomic integrity. After ionizing radiation exposure, the cells can show delay or arrest in their progression through the cell cycle, as well as an activation of the DNA repair machinery in order to reduce the damage. The G2/M checkpoint prevents G2 cells entering mitosis until the DNA damage has been reduced. The present study evaluates which G0 radiation-induced chromosome aberrations are negatively selected in the G2/M checkpoint. For this purpose, peripheral blood samples were irradiated at 1 and 3 Gy of {gamma}-rays, and lymphocytes were cultured for 48 h. Calyculin-A and Colcemid were used to analyze, in the same slide, cells in G2 and M. Chromosome spreads were consecutively analyzed by solid stain, pancentromeric and pantelomeric FISH and mFISH. The results show that the frequency of incomplete chromosome elements, those lacking a telomeric signal at one end, decreases abruptly from G2 to M. This indicates that cells with incomplete chromosome elements can progress from G0 to G2, but at the G2/M checkpoint suffer a strong negative selection.
International Nuclear Information System (INIS)
Rodriguez, Pilar; Barquinero, Joan Francesc; Duran, Assumpta; Caballin, Maria Rosa; Ribas, Montserrat; Barrios, Leonardo
2009-01-01
Cell cycle checkpoints are part of the cellular mechanisms to maintain genomic integrity. After ionizing radiation exposure, the cells can show delay or arrest in their progression through the cell cycle, as well as an activation of the DNA repair machinery in order to reduce the damage. The G2/M checkpoint prevents G2 cells entering mitosis until the DNA damage has been reduced. The present study evaluates which G0 radiation-induced chromosome aberrations are negatively selected in the G2/M checkpoint. For this purpose, peripheral blood samples were irradiated at 1 and 3 Gy of γ-rays, and lymphocytes were cultured for 48 h. Calyculin-A and Colcemid were used to analyze, in the same slide, cells in G2 and M. Chromosome spreads were consecutively analyzed by solid stain, pancentromeric and pantelomeric FISH and mFISH. The results show that the frequency of incomplete chromosome elements, those lacking a telomeric signal at one end, decreases abruptly from G2 to M. This indicates that cells with incomplete chromosome elements can progress from G0 to G2, but at the G2/M checkpoint suffer a strong negative selection.
Ogawa, Seiji; Watanabe, Toshihide; Moriyuki, Kazumi; Goto, Yoshikazu; Yamane, Shinsaku; Watanabe, Akio; Tsuboi, Kazuma; Kinoshita, Atsushi; Okada, Takuya; Takeda, Hiroyuki; Tani, Kousuke; Maruyama, Toru
2016-05-15
The modification of the novel G protein-biased EP2 agonist 1 has been investigated to improve its G protein activity and develop a better understanding of its structure-functional selectivity relationship (SFSR). The optimization of the substituents on the phenyl ring of 1, followed by the inversion of the hydroxyl group on the cyclopentane moiety led to compound 9, which showed a 100-fold increase in its G protein activity compared with 1 without any increase in β-arrestin recruitment. Furthermore, SFSR studies revealed that the combination of meta and para substituents on the phenyl moiety was crucial to the functional selectivity. Copyright © 2016 Elsevier Ltd. All rights reserved.
Selective induction of cyclin B protein abrogates the G2 delay after irradiation
International Nuclear Information System (INIS)
Kao, G.; Muschel, R.J.; Maity, A.; Kunig, A.; McKenna, W.G.
1996-01-01
Purpose/Objective: Irradiation of tumor cells commonly results in G2 delay, which has been postulated to allow DNA repair and cell survival. The G2 delay after irradiation is also often marked in some cell lines by delayed expression of cyclin B protein, suggesting a role for cyclin B regulation. Investigations of these hypotheses however has been hampered by the inability to selectively perturb the G2 delay in a physiologic manner. Materials and Methods: We have devised a system, with which we are able to selectively induce cyclin B protein expression in vivo at specific points in the cell cycle, by transfecting Hela cells with an expression vector under control of a dexamethasone-inducible promoter. Experiments were subsequently performed by synchronizing, releasing, irradiating, inducing, and harvesting these cells through the cell cycle. Results: Irradiation with 5 Gy led to a pronounced G2 delay, reflected by markedly slowed progression into mitosis, concomitant with reduced expression of cyclin B protein. Induction of cyclin B after radiation in these cells abrogated the G2 delay by approximately doubling the rate at which the cells re-enter mitosis. Treatment of irradiated untransfected control cells with dexamethasone, in which cyclin B is not induced, led to minimal changes. Studies of effects of cyclin B induction on cyclin B localization (using immunofluorescence), cdc2 phosphorylation and activation will also be presented. Conclusion: This system should allow further investigations into fundamental mechanisms of cell cycle regulation after irradiation and DNA damage. This also provides direct evidence for the first time that cyclin B protein regulation may play a role in the G2 delay following irradiation in Hela cells, perhaps complementing phosphorylation events
DEFF Research Database (Denmark)
Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard
2016-01-01
1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...
Directory of Open Access Journals (Sweden)
Di Chen
Full Text Available Speciation is always a contentious and challenging issue following with the presence of gene flow. In Gossypium, there are many valuable resources and wild diploid cotton especially C and B genome species possess some excellent traits which cultivated cotton always lacks. In order to explore character transferring rule from wild cotton to upland tetraploid cotton, the [G. capitis-viridis × (G. hirsutum × G. australe2] triple hybrid was synthesized by interspecies hybridization and chromosome doubling. Morphology comparisons were measured among this hybrid and its parents. It showed that trispecific hybrid F1 had some intermediate morphological characters like leaf style between its parents and some different characters from its parents, like crawl growth characteristics and two kind flower color. It is highly resistant to insects comparing with other cotton species by four year field investigation. By cytogenetic analysis, triple hybrid was further confirmed by meiosis behavior of pollen mother cells. Comparing with regular meiosis of its three parents, it was distinguished by the occurrence of polyads with various numbers of unbalanced microspores and finally generating various abnormal pollen grains. All this phenomenon results in the sterility of this hybrid. This hybrid was further identified by SSR marker from DNA molecular level. It showed that 98 selected polymorphism primers amplified effective bands in this hybrids and its parents. The genetic proportion of three parents in this hybrid is 47.8% from G. hirsutum, 14.3% from G. australe, 7.0% from G. capitis-viridis, and 30.9% recombination bands respectively. It was testified that wild genetic material has been transferred into cultivated cotton and this new germplasm can be incorporated into cotton breeding program.
Scuotto, Maria; Rivieccio, Elisa; Varone, Alessia; Corda, Daniela; Bucci, Mariarosaria; Vellecco, Valentina; Cirino, Giuseppe; Virgilio, Antonella; Esposito, Veronica; Galeone, Aldo; Borbone, Nicola; Varra, Michela; Mayol, Luciano
2015-09-18
Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13. © Crown copyright 2015.
Mendes-Junior, C T; Castelli, E C; Meyer, D; Simões, A L; Donadi, E A
2013-12-01
HLA-G has an important role in the modulation of the maternal immune system during pregnancy, and evidence that balancing selection acts in the promoter and 3'UTR regions has been previously reported. To determine whether selection acts on the HLA-G coding region in the Amazon Rainforest, exons 2, 3 and 4 were analyzed in a sample of 142 Amerindians from nine villages of five isolated tribes that inhabit the Central Amazon. Six previously described single-nucleotide polymorphisms (SNPs) were identified and the Expectation-Maximization (EM) and PHASE algorithms were used to computationally reconstruct SNP haplotypes (HLA-G alleles). A new HLA-G allele, which originated in Amerindian populations by a crossing-over event between two widespread HLA-G alleles, was identified in 18 individuals. Neutrality tests evidenced that natural selection has a complex part in the HLA-G coding region. Although balancing selection is the type of selection that shapes variability at a local level (Native American populations), we have also shown that purifying selection may occur on a worldwide scale. Moreover, the balancing selection does not seem to act on the coding region as strongly as it acts on the flanking regulatory regions, and such coding signature may actually reflect a hitchhiking effect.
Pierce, Sarah E.; Wang, Junmei; Jayawickramarajah, Janarthanan; Hamilton, Andrew D.; Brodbelt, Jennifer S.
2010-01-01
Isoguanine (2-oxo-6-amino-guanine), a natural but non-standard base, exhibits unique self-association properties compared to its isomer, guanine, and results in formation of different higher order DNA structures. In this work, the higher order structures formed by oligonucleotides containing guanine repeats or isoguanine repeats after annealing in solutions containing various cations are evaluated by electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy. The guanine-containing strand (G9) consistently formed quadruplexes upon annealing, whereas the isoguanine strand (Ig9) formed both pentaplexes and quadruplexes depending on the annealing cation. Quadruplex formation with G9 showed some dependence on the identity of the cation present during annealing with high relative quadruplex formation detected with six of ten cations. Analogous annealing experiments with Ig9 resulted in complex formation with all ten cations, and the majority of the resulting complexes were pentaplexes. CD results indicated most of the original complexes survived the desalting process necessary for ESI-MS analysis. In addition, several complexes, especially the pentaplexes, were found to be capable of cation exchange with ammonium ions. Ab initio calculations were conducted for isoguanine tetrads and pentads coordinated with all ten cations to predict the most energetically stable structures of the complexes in the gas phase. The observed preference of forming quadruplexes versus pentaplexes as a function of the coordinated cation can be interpreted by the calculated reaction energies of both the tetrads and pentads in combination with the distortion energies of tetrads. PMID:19746468
Highly Sensitive and Selective Potassium Ion Detection Based on Graphene Hall Effect Biosensors
Directory of Open Access Journals (Sweden)
Xiangqi Liu
2018-03-01
Full Text Available Potassium (K+ ion is an important biological substance in the human body and plays a critical role in the maintenance of transmembrane potential and hormone secretion. Several detection techniques, including fluorescent, electrochemical, and electrical methods, have been extensively investigated to selectively recognize K+ ions. In this work, a highly sensitive and selective biosensor based on single-layer graphene has been developed for K+ ion detection under Van der Pauw measurement configuration. With pre-immobilization of guanine-rich DNA on the graphene surface, the graphene devices exhibit a very low limit of detection (≈1 nM with a dynamic range of 1 nM–10 μM and excellent K+ ion specificity against other alkali cations, such as Na+ ions. The origin of K+ ion selectivity can be attributed to the fact that the formation of guanine-quadruplexes from guanine-rich DNA has a strong affinity for capturing K+ ions. The graphene-based biosensors with improved sensing performance for K+ ion recognition can be applied to health monitoring and early disease diagnosis.
Selection of scFvs specific for the HepG2 cell line using ribosome ...
Indian Academy of Sciences (India)
Madhsudhan
the important advantage of requiring no prior knowledge of ... were amplified separately by RT-PCR, and an anti-HepG2 VH/k chain ribosome display library was constructed ..... Engert A, Hudson P R and Power B E 2007 Selection of human.
Carvalho, Josue´; Queiroz, João A.; Cruz, Carla
2017-01-01
Circular dichroism (CD) has emerged as one of the standard biophysical techniques for the study of guaninequadruplex (G4) folding, cation effect, and ligand binding. The utility of this technique is based on its robustness, ease of use, and requirement of only small quantities of nucleic acid. This experiment is also extendable to the classroom…
Delivery, Effect on Cell Viability, and Plasticity of Modified Aptamer Constructs
DEFF Research Database (Denmark)
Gissberg, Olof; Zaghloul, Eman M; Lundin, Karin E
2016-01-01
AS1411 is a g-quadruplex-forming aptamer capable of selectively entering cancer cells by nucleolin receptor-mediated uptake. In this study, we investigated the cell internalization properties and plasticity of AS1411 carrying different locked nucleic acid-containing cargo oligonucleotides (ONs......) for delivery into A549 and U2OS cells. We found that internalization efficiency is highly governed by ON cargo chemistry and composition since the inherent antitumor properties of AS1411 were lost when attached to a nontoxic ON, noTox. However, a toxic ON, Tox, demonstrated potent cytotoxicity after aptamer...
Geetha Bai, Renu; Muthoosamy, Kasturi; Zhou, Meifang; Ashokkumar, Muthupandian; Huang, Nay Ming; Manickam, Sivakumar
2017-01-15
In this study, a sonochemical approach was utilised for the development of graphene-gold (G-Au) nanocomposite. Through the sonochemical method, simultaneous exfoliation of graphite and the reduction of gold chloride occurs to produce highly crystalline G-Au nanocomposite. The in situ growth of gold nanoparticles (AuNPs) took place on the surface of exfoliated few-layer graphene sheets. The G-Au nanocomposite was characterised by UV-vis, XRD, FTIR, TEM, XPS and Raman spectroscopy techniques. This G-Au nanocomposite was used to modify glassy carbon electrode (GCE) to fabricate an electrochemical sensor for the selective detection of nitric oxide (NO), a critical cancer biomarker. G-Au modified GCE exhibited an enhanced electrocatalytic response towards the oxidation of NO as compared to other control electrodes. The electrochemical detection of NO was investigated by linear sweep voltammetry analysis, utilising the G-Au modified GCE in a linear range of 10-5000μM which exhibited a limit of detection of 0.04μM (S/N=3). Furthermore, this enzyme-free G-Au/GCE exhibited an excellent selectivity towards NO in the presence of interferences. The synergistic effect of graphene and AuNPs, which facilitated exceptional electron-transfer processes between the electrolyte and the GCE thereby improving the sensing performance of the fabricated G-Au modified electrode with stable and reproducible responses. This G-Au nanocomposite introduces a new electrode material in the sensitive and selective detection of NO, a prominent biomarker of cancer. Copyright © 2016 Elsevier B.V. All rights reserved.
Selective tumor cell death induced by irradiated riboflavin through recognizing DNA G-T mismatch.
Yuan, Yi; Zhao, Yongyun; Chen, Lianqi; Wu, Jiasi; Chen, Gangyi; Li, Sheng; Zou, Jiawei; Chen, Rong; Wang, Jian; Jiang, Fan; Tang, Zhuo
2017-09-06
Riboflavin (vitamin B2) has been thought to be a promising antitumoral agent in photodynamic therapy, though the further application of the method was limited by the unclear molecular mechanism. Our work reveals that riboflavin was able to recognize G-T mismatch specifically and induce single-strand breaks in duplex DNA targets efficiently under irradiation. In the presence of riboflavin, the photo-irradiation could induce the death of tumor cells that are defective in mismatch repair system selectively, highlighting the G-T mismatch as potential drug target for tumor cells. Moreover, riboflavin is a promising leading compound for further drug design due to its inherent specific recognition of the G-T mismatch. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Hurng-Wern Huang
2018-04-01
Full Text Available The natural compound sinularin, isolated from marine soft corals, is antiproliferative against several cancers, but its possible selective killing effect has rarely been investigated. This study investigates the selective killing potential and mechanisms of sinularin-treated breast cancer cells. In 3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H- tetrazolium, inner salt (MTS assay, sinularin dose-responsively decreased the cell viability of two breast cancer (SKBR3 and MDA-MB-231 cells, but showed less effect on breast normal (M10 cells after a 24 h treatment. According to 7-aminoactinomycin D (7AAD flow cytometry, sinularin dose-responsively induced the G2/M cycle arrest of SKBR3 cells. Sinularin dose-responsively induced apoptosis on SKBR3 cells in terms of a flow cytometry-based annexin V/7AAD assay and pancaspase activity, as well as Western blotting for cleaved forms of poly(ADP-ribose polymerase (PARP, caspases 3, 8, and 9. These caspases and PARP activations were suppressed by N-acetylcysteine (NAC pretreatment. Moreover, sinularin dose-responsively induced oxidative stress and DNA damage according to flow cytometry analyses of reactive oxygen species (ROS, mitochondrial membrane potential (MitoMP, mitochondrial superoxide, and 8-oxo-2′-deoxyguanosine (8-oxodG. In conclusion, sinularin induces selective killing, G2/M arrest, apoptosis, and oxidative DNA damage of breast cancer cells.
Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.
Scheibye-Knudsen, Morten; Tseng, Anne; Borch Jensen, Martin; Scheibye-Alsing, Karsten; Fang, Evandro Fei; Iyama, Teruaki; Bharti, Sanjay Kumar; Marosi, Krisztina; Froetscher, Lynn; Kassahun, Henok; Eckley, David Mark; Maul, Robert W; Bastian, Paul; De, Supriyo; Ghosh, Soumita; Nilsen, Hilde; Goldberg, Ilya G; Mattson, Mark P; Wilson, David M; Brosh, Robert M; Gorospe, Myriam; Bohr, Vilhelm A
2016-11-01
Cockayne syndrome is a neurodegenerative accelerated aging disorder caused by mutations in the CSA or CSB genes. Although the pathogenesis of Cockayne syndrome has remained elusive, recent work implicates mitochondrial dysfunction in the disease progression. Here, we present evidence that loss of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number of cell lines. Furthermore, machine-learning algorithms predict that diseases with defects in ribosomal DNA (rDNA) transcription have mitochondrial dysfunction, and, accordingly, this is found when factors involved in rDNA transcription are knocked down. Mechanistically, loss of CSA or CSB leads to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans In conclusion, this work supports a role for impaired ribosomal DNA transcription in Cockayne syndrome and suggests that transcription-coupled resolution of secondary structures may be a mechanism to repress spurious activation of a DNA damage response.
Sun, Xiang-Yu; Zhao, Ping; Jin, Shu-Fang; Liu, Min-Chao; Wang, Xia-Hong; Huang, Yu-Min; Cheng, Zhen-Feng; Yan, Si-Qi; Li, Yan-Yu; Chen, Ya-Qing; Zhong, Yan-Mei
2017-08-01
DNA polymorphism exerts a fascination on a large scientific community. Without crystallographic structural data, clarification of the binding modes between G-quadruplex (G4) and ligand (complex) is a challenging job. In the present work, three porphyrin compounds with different flexible carbon chains (arms) were designed, synthesized and characterized. Their binding, folding and stabilizing abilities to human telomeric G4 DNA structures were comparatively researched. Positive charges at the end of the flexible carbon chains seem to be favorable for the DNA-porphyrin interactions, which were evidenced by the spectral results and further confirmed by the molecular docking calculations. Biological function analysis demonstrated that these porphyrins show no substantial inhibition to Hela, A549 and BEL 7402 cancer cell lines under dark while exhibit broad inhibition under visible light. This significantly enhanced photocytotoxicity relative to the dark control is an essential property of photochemotherapeutic agents. The feature of the flexible arms emerges as critical influencing factors in the cell photocytotoxicity. Moreover, an ROS-mediated mitochondrial dysfunction pathway was suggested for the cell apoptosis induced by these flexible-armed porphyrins. It is found that the porphyrins with positive charges located at the end of the flexible arms represent an exciting opportunity for photochemotherapeutic anti-cancer drug design. Copyright © 2017. Published by Elsevier B.V.
p53 binds human telomeric G-quadruplex in vitro
Czech Academy of Sciences Publication Activity Database
Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie
2016-01-01
Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016
Cytokine-Regulated GADD45G Induces Differentiation and Lineage Selection in Hematopoietic Stem Cells
Directory of Open Access Journals (Sweden)
Frederic B. Thalheimer
2014-07-01
Full Text Available The balance of self-renewal and differentiation in long-term repopulating hematopoietic stem cells (LT-HSC must be strictly controlled to maintain blood homeostasis and to prevent leukemogenesis. Hematopoietic cytokines can induce differentiation in LT-HSCs; however, the molecular mechanism orchestrating this delicate balance requires further elucidation. We identified the tumor suppressor GADD45G as an instructor of LT-HSC differentiation under the control of differentiation-promoting cytokine receptor signaling. GADD45G immediately induces and accelerates differentiation in LT-HSCs and overrides the self-renewal program by specifically activating MAP3K4-mediated MAPK p38. Conversely, the absence of GADD45G enhances the self-renewal potential of LT-HSCs. Videomicroscopy-based tracking of single LT-HSCs revealed that, once GADD45G is expressed, the development of LT-HSCs into lineage-committed progeny occurred within 36 hr and uncovered a selective lineage choice with a severe reduction in megakaryocytic-erythroid cells. Here, we report an unrecognized role of GADD45G as a central molecular linker of extrinsic cytokine differentiation and lineage choice control in hematopoiesis.
Semack, Ansley; Sandhu, Manbir; Malik, Rabia U; Vaidehi, Nagarajan; Sivaramakrishnan, Sivaraj
2016-08-19
Although the importance of the C terminus of the α subunit of the heterotrimeric G protein in G protein-coupled receptor (GPCR)-G protein pairing is well established, the structural basis of selective interactions remains unknown. Here, we combine live cell FRET-based measurements and molecular dynamics simulations of the interaction between the GPCR and a peptide derived from the C terminus of the Gα subunit (Gα peptide) to dissect the molecular mechanisms of G protein selectivity. We observe a direct link between Gα peptide binding and stabilization of the GPCR conformational ensemble. We find that cognate and non-cognate Gα peptides show deep and shallow binding, respectively, and in distinct orientations within the GPCR. Binding of the cognate Gα peptide stabilizes the agonist-bound GPCR conformational ensemble resulting in favorable binding energy and lower flexibility of the agonist-GPCR pair. We identify three hot spot residues (Gαs/Gαq-Gln-384/Leu-349, Gln-390/Glu-355, and Glu-392/Asn-357) that contribute to selective interactions between the β2-adrenergic receptor (β2-AR)-Gαs and V1A receptor (V1AR)-Gαq The Gαs and Gαq peptides adopt different orientations in β2-AR and V1AR, respectively. The β2-AR/Gαs peptide interface is dominated by electrostatic interactions, whereas the V1AR/Gαq peptide interactions are predominantly hydrophobic. Interestingly, our study reveals a role for both favorable and unfavorable interactions in G protein selection. Residue Glu-355 in Gαq prevents this peptide from interacting strongly with β2-AR. Mutagenesis to the Gαs counterpart (E355Q) imparts a cognate-like interaction. Overall, our study highlights the synergy in molecular dynamics and FRET-based approaches to dissect the structural basis of selective G protein interactions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Weronika Kotkowiak
2018-03-01
Full Text Available Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation of a novel 4-thiouracil derivative of unlocked nucleic acid (UNA, as well as single incorporation of 4-thiouridine and all four canonical UNAs, was evaluated. The studies presented herein have shown that 4-thiouridine in RNA and UNA series, as well as all four canonical UNAs, can efficiently modulate G-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G-quadruplex anticoagulant properties. Noteworthy, some TBA variants, characterized by decreased ability to inhibit thrombin activity, possess significant antiproliferative properties reducing the viability of the HeLa cell line even by 95% at 10 μM concentration.
Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei
2014-09-15
Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.
Whitehurst, Charles E; Annis, D Allen
2008-07-01
Advances in combinatorial chemistry and genomics have inspired the development of novel affinity selection-based screening techniques that rely on mass spectrometry to identify compounds that preferentially bind to a protein target. Of the many affinity selection-mass spectrometry techniques so far documented, only a few solution-based implementations that separate target-ligand complexes away from unbound ligands persist today as routine high throughput screening platforms. Because affinity selection-mass spectrometry techniques do not rely on radioactive or fluorescent reporters or enzyme activities, they can complement traditional biochemical and cell-based screening assays and enable scientists to screen targets that may not be easily amenable to other methods. In addition, by employing mass spectrometry for ligand detection, these techniques enable high throughput screening of massive library collections of pooled compound mixtures, vastly increasing the chemical space that a target can encounter during screening. Of all drug targets, G protein coupled receptors yield the highest percentage of therapeutically effective drugs. In this manuscript, we present the emerging application of affinity selection-mass spectrometry to the high throughput screening of G protein coupled receptors. We also review how affinity selection-mass spectrometry can be used as an analytical tool to guide receptor purification, and further used after screening to characterize target-ligand binding interactions, enabling the classification of orthosteric and allosteric binders.
Energy Technology Data Exchange (ETDEWEB)
Homan, Kristoff T.; Larimore, Kelly M.; Elkins, Jonathan M.; Szklarz, Marta; Knapp, Stefan; Tesmer, John J.G. [Michigan; (Oxford)
2015-02-13
Selective inhibitors of individual subfamilies of G protein-coupled receptor kinases (GRKs) would serve as useful chemical probes as well as leads for therapeutic applications ranging from heart failure to Parkinson’s disease. To identify such inhibitors, differential scanning fluorimetry was used to screen a collection of known protein kinase inhibitors that could increase the melting points of the two most ubiquitously expressed GRKs: GRK2 and GRK5. Enzymatic assays on 14 of the most stabilizing hits revealed that three exhibit nanomolar potency of inhibition for individual GRKs, some of which exhibiting orders of magnitude selectivity. Most of the identified compounds can be clustered into two chemical classes: indazole/dihydropyrimidine-containing compounds that are selective for GRK2 and pyrrolopyrimidine-containing compounds that potently inhibit GRK1 and GRK5 but with more modest selectivity. The two most potent inhibitors representing each class, GSK180736A and GSK2163632A, were cocrystallized with GRK2 and GRK1, and their atomic structures were determined to 2.6 and 1.85 Å spacings, respectively. GSK180736A, developed as a Rho-associated, coiled-coil-containing protein kinase inhibitor, binds to GRK2 in a manner analogous to that of paroxetine, whereas GSK2163632A, developed as an insulin-like growth factor 1 receptor inhibitor, occupies a novel region of the GRK active site cleft that could likely be exploited to achieve more selectivity. However, neither compound inhibits GRKs more potently than their initial targets. This data provides the foundation for future efforts to rationally design even more potent and selective GRK inhibitors.
Directory of Open Access Journals (Sweden)
Xia Li
2016-10-01
Full Text Available Bisphenol A (BPA detection in drinking water and food packaging materials has attracted much attention since the discovery that BPA can interfere with normal physiological processes and cause adverse health effects. Here, we constructed a label-free aptamer fluorescent assay for selective and sensitive detection of BPA based on the rolling circle amplification (RCA/Exonuclease III (Exo III-combined cascade amplification strategy. First, the duplex DNA probe (RP with anti-BPA aptamer and trigger sequence was designed for BPA recognition and signal amplification. Next, under the action of BPA, the trigger probe was liberated from RP to initiate RCA reaction as primary amplification. Subsequently, the RCA products were used to trigger Exo III assisted secondary amplification with the help of hairpin probes, producing plenty of “G-quadruplex” in lantern-like structures. Finally, the continuously enriched “G-quadruplex lanterns” were lightened by zinc(II-protoporphyrin IX (ZnPPIX generating enhanced fluorescence signals. By integrating the primary RCA and secondary Exo III mediated cascade amplification strategy, this method displayed an excellent sensitivity with the detection limits of 5.4 × 10−17 M. In addition, the anti-BPA aptamer exhibits high recognition ability with BPA, guaranteeing the specificity of detection. The reporter signal probe (G-quadruplex with ZnPPIX provides a label-free fluorescence signals readout without complicated labeling procedures, making the method simple in design and cost-effective in operation. Moreover, environmental samples analysis was also performed, suggesting that our strategy was reliable and had a great potential application in environmental monitoring.
Niida, Ayumu; Sasaki, Shigekazu; Yonemori, Kazuko; Sameshima, Tomoya; Yaguchi, Masahiro; Asami, Taiji; Sakamoto, Kotaro; Kamaura, Masahiro
2017-06-15
A structure-activity relationship study of a K-Ras(G12D) selective inhibitory cyclic peptide, KRpep-2d was performed. Alanine scanning of KRpep-2d focusing on the cyclic moiety showed that Leu 7 , Ile 9 , and Asp 12 are the key elements for K-Ras(G12D) selective inhibition of KRpep-2d. The cysteine bridging was also examined to identify the stable analog of KRpep-2d under reductive conditions. As a result, the KRpep-2d analog (12) including mono-methylene bridging showed potent K-Ras(G12D) selective inhibition in both the presence and the absence of dithiothreitol. This means that mono-methylene bridging is an effective strategy to obtain a reduction-resistance analog of parent disulfide cyclic peptides. Peptide 12 inhibited proliferation of K-Ras(G12D)-driven cancer cells significantly. These results gave valuable information for further optimization of KRpep-2d to provide novel anti-cancer drug candidates targeting the K-Ras(G12D) mutant. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Sharmini Gunawardena
Full Text Available Glucose-6-Phosphate Dehydrogenase (G6PD enzyme deficiency is known to offer protection against malaria and an increased selection of mutant genes in malaria endemic regions is expected. However, anti-malarial drugs such as primaquine can cause haemolytic anaemia in persons with G6PD deficiency. We studied the extent of G6PD deficiency in selected persons attending Teaching Hospitals of Anuradhapura and Kurunegala, two previously high malaria endemic districts in Sri Lanka. A total of 2059 filter-paper blood spots collected between November 2013 and June 2014 were analysed for phenotypic G6PD deficiency using the modified WST-8/1-methoxy PMS method. Each assay was conducted with a set of controls and the colour development assessed visually as well as with a microplate reader at OD450-630nm. Overall, 142/1018 (13.95% and 83/1041 (7.97% were G6PD deficient in Anuradhapura and Kurunegala districts respectively. The G6PD prevalence was significantly greater in Anuradhapura when compared to Kurunegala (P0.05. Severe deficiency (<10% normal was seen among 28/1018 (2.75% in Anuradhapura (7 males; 21 females and 17/1041 (1.63% in Kurunegala (7 males; 10 females. Enzyme activity between 10-30% was observed among 114/1018 (11.20%; 28 males; 86 females in Anuradhapura while it was 66/1041 (6.34%; 18 males; 48 females in Kurunegala. Screening and educational programmes for G6PD deficiency are warranted in these high risk areas irrespective of gender for the prevention of disease states related to this condition.
Study on Electrochemical Insulin Sensing Utilizing a DNA Aptamer-Immobilized Gold Electrode
Directory of Open Access Journals (Sweden)
Izumi Kubo
2015-07-01
Full Text Available We investigated an insulin-sensing method by utilizing an insulin-binding aptamer IGA3, which forms an anti-parallel G-quadruplex with folded single strands. Spectroscopic observation indicates that some anti-parallel G-quadruplex bind hemin and show peroxidase activity. In this study, the peroxidase activity of IGA3 with hemin was confirmed by spectrophotometric measurements, i.e., the activity was three-times higher than hemin itself. IGA3 was then immobilized onto a gold electrode to determine its electrochemical activity. The peroxidase activity of the immobilized IGA3-hemin complex was determined by cyclic voltammetry, and a cathodic peak current of the electrode showed a dependence on the concentration of H2O2. The cathodic peak current of the IGA3-hemin complex decreased by binding it to insulin, and this decrease depended on the concentration of insulin.
Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction
Zhang, Z.; Birkedal, V.; Gothelf, K. V.
2016-05-01
The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.
Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction
DEFF Research Database (Denmark)
Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager
2016-01-01
The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split...
FANCJ couples replication past natural fork barriers with maintenance of chromatin structure.
Schwab, Rebekka A; Nieminuszczy, Jadwiga; Shin-ya, Kazuo; Niedzwiedz, Wojciech
2013-04-01
Defective DNA repair causes Fanconi anemia (FA), a rare childhood cancer-predisposing syndrome. At least 15 genes are known to be mutated in FA; however, their role in DNA repair remains unclear. Here, we show that the FANCJ helicase promotes DNA replication in trans by counteracting fork stalling on replication barriers, such as G4 quadruplex structures. Accordingly, stabilization of G4 quadruplexes in ΔFANCJ cells restricts fork movements, uncouples leading- and lagging-strand synthesis and generates small single-stranded DNA gaps behind the fork. Unexpectedly, we also discovered that FANCJ suppresses heterochromatin spreading by coupling fork movement through replication barriers with maintenance of chromatin structure. We propose that FANCJ plays an essential role in counteracting chromatin compaction associated with unscheduled replication fork stalling and restart, and suppresses tumorigenesis, at least partially, in this replication-specific manner.
Wild-type p53 binds to MYC promoter G-quadruplex
Czech Academy of Sciences Publication Activity Database
Petr, Marek; Helma, Robert; Polášková, Alena; Krejci, Aneta; Dvořáková, Zuzana; Kejnovská, Iva; Navrátilová, Lucie; Adámik, Matěj; Vorlíčková, Michaela; Brázdová, Marie
2016-01-01
Roč. 36, OCT2016 (2016), č. článku e00397. ISSN 0144-8463 R&D Projects: GA ČR GA13-36108S; GA ČR GAP205/12/0466 Institutional support: RVO:68081707 Keywords : nuclease-hypersensitive element * c-terminal domain * gene-expression Subject RIV: BO - Biophysics Impact factor: 2.906, year: 2016
Bloom’s syndrome protein unfolding G-quadruplexes in two pathways
Zhao, Zhen-Ye; Xu, Chun-Hua; Shi, Jing; Li, Jing-Hua; Ma, Jian-Bing; Jia, Qi; Ma, Dong-Fei; Li, Ming; Lu, Ying
2017-08-01
Not Available Project supported by the National Natural Science Foundation of China (Grant Nos. 11674382, 11574381, and 11574382) and the Key Research Program of Frontier Sciences, Chinese Academy of Sciences (Grant No. QYZDJ-SSW-SYS014).
Directory of Open Access Journals (Sweden)
Yu Y
2017-08-01
Full Text Available Yanyan Yu, Gaoxing Su, Hongyan Zhu, Qing Zhu, Yong Chen, Bohui Xu, Yuqin Li, Wei Zhang School of Pharmacy, Nantong University, Nantong, People’s Republic of China Abstract: In this study, we fabricated a novel electrochemical biosensing platform on the basis of target-triggered proximity hybridization-mediated isothermal exponential amplification reaction (EXPAR for ultrasensitive protein analysis. Through rational design, the aptamers for protein recognition were integrated within two DNA probes. Via proximity hybridization principle, the affinity protein-binding event was converted into DNA assembly process. The recognition of protein by aptamers can trigger the strand displacement through the increase of the local concentrations of the involved probes. As a consequence, the output DNA was displaced, which can hybridize with the duplex probes immobilized on the electrode surface subsequently, leading to the initiation of the EXPAR as well as the cleavage of duplex probes. Each cleavage will release the gold nanoparticles (AuNPs binding sequence. With the modification of G-quadruplex sequence, electrochemical signals were yielded by the AuNPs through oxidizing 3,3',5,5'-tetramethylbenzidine in the presence of H2O2. The study we proposed exhibited high sensitivity toward platelet-derived growth factor BB (PDGF-BB with the detection limit of 52 fM. And, this method also showed great selectivity among the PDGF isoforms and performed well in spiked human serum samples. Keywords: electrochemical biosensor, proximity hybridization, PDGF-BB, isothermal exponential amplification, G-quadruplex
van Berkel, Patrick H. C.; Gerritsen, Jolanda; Perdok, Gerrard; Valbjorn, Jesper; Vink, Tom; van de Winkel, Jan G. J.; Parren, Paul W. H. I.
2009-01-01
We studied the variations in N-linked glycosylation of human IgG molecules derived from 105 different stable cell lines each expressing one of the six different antibodies. Antibody expression was based on glutamine synthetase selection technology in suspension growing CHO-KISV cells. The glycans
Analysis on China 3G Development
Institute of Scientific and Technical Information of China (English)
Shen Zixin
2005-01-01
@@ Foreword: Forecast of 3G and 3G Evolution International Market Size According to UMTS forecast, by 2010, global annual 3G income could reach USD 320 billion, while that from Asia-Pacific region will be around USD 118 billion.China's selection of 3G standards will affect all global wireless equipment suppliers, while how to select TD-SCDMA most crucial.
International Nuclear Information System (INIS)
Buczkowski, Adam; Palecz, Bartlomiej
2014-01-01
Highlights: • Calorimetric titration and dilution calorimetry show strong interactions between PAMAM-NH 2 G4 dendrimer and amino acids. • The more polar the amino acid side chain, the more exothermic the effects of the direct interactions with dendrimer. • Macromolecule of PAMAM-NH 2 G4 dendrimer can coordinate 20 to 40 molecules of amino acid. -- Abstract: The interactions of PAMAM-NH 2 G4 dendrimer with selected natural amino acids (Gly, Ala, Val, Leu, Ile, Phe, Ser, Thr, Met, Asn, Gln, Pro and Trp) in aqueous solutions were measured with the use of the techniques of calorimetric titration and dilution calorimetry. The results of calorimetric measurements show strong interactions between PAMAM-NH 2 G4 dendrimer and amino acids with polar substituents. A macromolecule of PAMAM-NH 2 G4 dendrimer can coordinate 20 to 40 molecules of amino acid
Improved thrombin binding aptamer by incorporation of a single unlocked nucleic acid monomer
DEFF Research Database (Denmark)
Pasternak, Anna; Hernandez, Frank J; Rasmussen, Lars Melholt
2011-01-01
A 15-mer DNA aptamer (named TBA) adopts a G-quadruplex structure that strongly inhibits fibrin-clot formation by binding to thrombin. We have performed thermodynamic analysis, binding affinity and biological activity studies of TBA variants modified by unlocked nucleic acid (UNA) monomers. UNA...... that a UNA monomer is allowed in many positions of the aptamer without significantly changing the thrombin-binding properties. The biological effect of a selection of the modified aptamers was tested by a thrombin time assay and showed that most of the UNA-modified TBAs possess anticoagulant properties......, and that the construct with a UNA-U monomer in position 7 is a highly potent inhibitor of fibrin-clot formation....
Selective cytotoxicity of PAMAM G5 core–PAMAM G2.5 shell tecto-dendrimers on melanoma cells
Directory of Open Access Journals (Sweden)
Schilrreff P
2012-07-01
Full Text Available Priscila Schilrreff,1 Cecilia Mundiña-Weilenmann,2 Eder Lilia Romero,1 Maria Jose Morilla11Programa de Nanomedicinas, Universidad Nacional de Quilmes, Buenos Aires, Argentina; 2Centro de Investigaciones Cardiovasculares, Universidad Nacional de La Plata, La Plata, ArgentinaBackground: The controlled introduction of covalent linkages between dendrimer building blocks leads to polymers of higher architectural order known as tecto-dendrimers. Because of the few simple steps involved in their synthesis, tecto-dendrimers could expand the portfolio of structures beyond commercial dendrimers, due to the absence of synthetic drawbacks (large number of reaction steps, excessive monomer loading, and lengthy chromatographic separations and structural constraints of high-generation dendrimers (reduction of good monodispersity and ideal dendritic construction due to de Gennes dense-packing phenomenon. However, the biomedical uses of tecto-dendrimers remain unexplored. In this work, after synthesizing saturated shell core–shell tecto-dendrimers using amine-terminated polyamidoamine (PAMAM generation 5 (G5 as core and carboxyl-terminated PAMAM G2.5 as shell (G5G2.5 tecto-dendrimers, we surveyed for the first time the main features of their interaction with epithelial cells.Methods: Structural characterization of G5G2.5 was performed by polyacrylamide gel electrophoresis, matrix-assisted laser desorption time-of-flight mass spectrometry, and microscopic techniques; their hydrodynamic size and Z-potential was also determined. Cellular uptake by human epidermal keratinocytes, colon adenocarcinoma, and epidermal melanoma (SK-Mel-28 cells was determined by flow cytometry. Cytotoxicity was determined by mitochondrial activity, lactate dehydrogenase release, glutathione depletion, and apoptosis/necrosis measurement.Results: The resultant 60%–67% saturated shell, 87,000-dalton G5G2.5 (mean molecular weight interacted with cells in a significantly different
In Silico Molecular Docking Analysis of Natural Pyridoacridines as Anticancer Agents
Directory of Open Access Journals (Sweden)
Vikas Sharma
2016-01-01
Full Text Available Docking studies are proved to be an essential tool that facilitates the structural diversity of natural products to be harnessed in an organized manner. In this study, pyridoacridines containing natural anticancer pigments were subjected to docking studies using Glide (Schrodinger. Investigations were carried out to find out the potential molecular targets for these selected pigments. The docking was carried out on different cancer macromolecules involved in different cell cycle pathways, that is, CDK-2, CDK-6, Bcl-2, VEGFR-2, IGF-1R kinase, and G-Quadruplexes. CDK-6 was found to be the most suitable anticancer target for the pyridoacridines. In addition, effectiveness of the study was further evaluated by performing docking of known inhibitors against their respective selected macromolecules. However, the results are preliminary and experimental evaluation will be carried out in near future.
Luo, Ying-Di; Zhang, Qi-Lei; Yao, Shan-Jing; Lin, Dong-Qiang
2018-01-19
This study investigated adsorption selectivity of immunoglobulin M (IgM), immunoglobulin A (IgA) and immunoglobulin (IgG) on four mixed-mode resins with the functional ligands of 4-mercatoethyl-pyridine (MEP), 2-mercapto-1-methylimidazole (MMI), 5-aminobenzimidazole (ABI) and tryptophan-5-aminobenzimidazole (W-ABI), respectively. IgM purification processes with mixed-mode resins were also proposed. All resins showed typical pH-dependent adsorption, and high adsorption capacity was found at pH 5.0-8.0 with low adsorption capacity under acidic conditions. Meanwhile, high selectivity of IgM/IgA and IgM/IgG was obtained with ABI-4FF and MMI-4FF resins at pH 4.0-5.0, which was used to develop a method for IgM, IgA and IgG separation by controlling loading and elution pH. Capture of monoclonal IgM from cell culture supernatant with ABI-4FF resins was studied and high purity (∼99%) and good recovery (80.8%) were obtained. Moreover, IgM direct separation from human serum with combined two-step chromatography (ABI-4FF and MMI-4FF) was investigated, and IgM purity of 65.2% and a purification factor of 28.3 were obtained after optimization. The antibody activity of IgM was maintained after purification. The results demonstrated that mixed-mode chromatography with specially-designed ligands is a promising way to improve adsorption selectivity and process efficiency of IgM purification from complex feedstock. Copyright © 2017 Elsevier B.V. All rights reserved.
Strong preference of BRCA1 protein to topologically constrained non-B DNA structures
Czech Academy of Sciences Publication Activity Database
Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fridrichova, Helena; Jagelská, Eva
2016-01-01
Roč. 17, JAN2016 (2016), č. článku 14. ISSN 1471-2199 R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : double-strand breaks * g-quadruplexes * c-myc Subject RIV: BO - Biophysics Impact factor: 1.939, year: 2016
Chen, Xiufang; Zhang, Ligang; Zhang, Bo; Guo, Xingcui; Mu, Xindong
2016-06-01
Graphitic carbon nitride nanosheets were investigated for developing effective Pt catalyst supports for selective hydrogenation of furfural to furfuryl alcohol in water. The nanosheets with an average thickness of about 3 nm were synthesized by a simple and green method through thermal oxidation etching of bulk g-C3N4 in air. Combined with the unique feature of nitrogen richness and locally conjugated structure, the g-C3N4 nanosheets with a high surface area of 142 m2 g-1 were demonstrated to be an excellent supports for loading small-size Pt nanoparticles. Superior furfural hydrogenation activity in water with complete conversion of furfural and high selectivity of furfuryl alcohol (>99%) was observed for g-C3N4 nanosheets supported Pt catalysts. The large specific surface area, uniform dispersion of Pt nanoparticles and the stronger furfural adsorption ability of nanosheets contributed to the considerable catalytic performance. The reusability tests showed that the novel Pt catalyst could maintain high activity and stability in the furfural hydrogenation reaction.
Chen, Xiufang; Zhang, Ligang; Zhang, Bo; Guo, Xingcui; Mu, Xindong
2016-06-22
Graphitic carbon nitride nanosheets were investigated for developing effective Pt catalyst supports for selective hydrogenation of furfural to furfuryl alcohol in water. The nanosheets with an average thickness of about 3 nm were synthesized by a simple and green method through thermal oxidation etching of bulk g-C3N4 in air. Combined with the unique feature of nitrogen richness and locally conjugated structure, the g-C3N4 nanosheets with a high surface area of 142 m(2) g(-1) were demonstrated to be an excellent supports for loading small-size Pt nanoparticles. Superior furfural hydrogenation activity in water with complete conversion of furfural and high selectivity of furfuryl alcohol (>99%) was observed for g-C3N4 nanosheets supported Pt catalysts. The large specific surface area, uniform dispersion of Pt nanoparticles and the stronger furfural adsorption ability of nanosheets contributed to the considerable catalytic performance. The reusability tests showed that the novel Pt catalyst could maintain high activity and stability in the furfural hydrogenation reaction.
C9orf72 nucleotide repeat structures initiate molecular cascades of disease.
Haeusler, Aaron R; Donnelly, Christopher J; Periz, Goran; Simko, Eric A J; Shaw, Patrick G; Kim, Min-Sik; Maragakis, Nicholas J; Troncoso, Juan C; Pandey, Akhilesh; Sattler, Rita; Rothstein, Jeffrey D; Wang, Jiou
2014-03-13
A hexanucleotide repeat expansion (HRE), (GGGGCC)n, in C9orf72 is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Here we identify a molecular mechanism by which structural polymorphism of the HRE leads to ALS/FTD pathology and defects. The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA•DNA hybrids (R-loops). The structural polymorphism causes a repeat-length-dependent accumulation of transcripts aborted in the HRE region. These transcribed repeats bind to ribonucleoproteins in a conformation-dependent manner. Specifically, nucleolin, an essential nucleolar protein, preferentially binds the HRE G-quadruplex, and patient cells show evidence of nucleolar stress. Our results demonstrate that distinct C9orf72 HRE structural polymorphism at both DNA and RNA levels initiates molecular cascades leading to ALS/FTD pathologies, and provide the basis for a mechanistic model for repeat-associated neurodegenerative diseases.
Guillon, Jean; Cohen, Anita; Gueddouda, Nassima Meriem; Das, Rabindra Nath; Moreau, Stéphane; Ronga, Luisa; Savrimoutou, Solène; Basmaciyan, Louise; Monnier, Alix; Monget, Myriam; Rubio, Sandra; Garnerin, Timothée; Azas, Nadine; Mergny, Jean-Louis; Mullié, Catherine; Sonnet, Pascal
2017-12-01
Novel series of bis- and tris-pyrrolo[1,2-a]quinoxaline derivatives 1 were synthesized and tested for in vitro activity upon the intraerythrocytic stage of W2 and 3D7 Plasmodium falciparum strains. Biological results showed good antimalarial activity with IC 50 in the μM range. In attempting to investigate the large broad-spectrum antiprotozoal activities of these new derivatives, their properties toward Leishmania donovani were also investigated and revealed their selective antiplasmodial profile. In parallel, the in vitro cytotoxicity of these molecules was assessed on the human HepG2 cell line. Structure-activity relationships of these new synthetic compounds are discussed here. The bis-pyrrolo[1,2-a]quinoxalines 1n and 1p were identified as the most potent antimalarial candidates with selectivity index (SI) of 40.6 on W2 strain, and 39.25 on 3D7 strain, respectively. As the telomeres of the parasite could constitute an attractive target, we investigated the possibility of targeting Plasmodium telomeres by stabilizing the Plasmodium telomeric G-quadruplexes through a FRET melting assay by our new compounds.
Stockwell, Simon R; Platt, Georgina; Barrie, S Elaine; Zoumpoulidou, Georgia; Te Poele, Robert H; Aherne, G Wynne; Wilson, Stuart C; Sheldrake, Peter; McDonald, Edward; Venet, Mathilde; Soudy, Christelle; Elustondo, Frédéric; Rigoreau, Laurent; Blagg, Julian; Workman, Paul; Garrett, Michelle D; Mittnacht, Sibylle
2012-01-01
Human cancers often contain genetic alterations that disable G1/S checkpoint control and loss of this checkpoint is thought to critically contribute to cancer generation by permitting inappropriate proliferation and distorting fate-driven cell cycle exit. The identification of cell permeable small molecules that activate the G1/S checkpoint may therefore represent a broadly applicable and clinically effective strategy for the treatment of cancer. Here we describe the identification of several novel small molecules that trigger G1/S checkpoint activation and characterise the mechanism of action for one, CCT020312, in detail. Transcriptional profiling by cDNA microarray combined with reverse genetics revealed phosphorylation of the eukaryotic initiation factor 2-alpha (EIF2A) through the eukaryotic translation initiation factor 2-alpha kinase 3 (EIF2AK3/PERK) as the mechanism of action of this compound. While EIF2AK3/PERK activation classically follows endoplasmic reticulum (ER) stress signalling that sets off a range of different cellular responses, CCT020312 does not trigger these other cellular responses but instead selectively elicits EIF2AK3/PERK signalling. Phosphorylation of EIF2A by EIF2A kinases is a known means to block protein translation and hence restriction point transit in G1, but further supports apoptosis in specific contexts. Significantly, EIF2AK3/PERK signalling has previously been linked to the resistance of cancer cells to multiple anticancer chemotherapeutic agents, including drugs that target the ubiquitin/proteasome pathway and taxanes. Consistent with such findings CCT020312 sensitizes cancer cells with defective taxane-induced EIF2A phosphorylation to paclitaxel treatment. Our work therefore identifies CCT020312 as a novel small molecule chemical tool for the selective activation of EIF2A-mediated translation control with utility for proof-of-concept applications in EIF2A-centered therapeutic approaches, and as a chemical starting point for
DEFF Research Database (Denmark)
Jensen, Troels B.; Henriksen, Jonas Rosager; Rasmussen, Bjarne E.
2011-01-01
Thrombin binding aptamer is a DNA 15-mer which forms a G-quadruplex structure and possess promising anticoagulant properties due to specific interactions with thrombin. Herein we present the influence of a single 2′-C-piperazino-UNA residue and UNA residues incorporated in several positions on th...
Targeting C-Myc Promoter: Helquats As Novel G-Quadruplex Stabilizing Ligands
Czech Academy of Sciences Publication Activity Database
Kužmová, Erika; Kozák, Jaroslav; Komárková, Veronika; Pytlík, R.; Teplý, Filip; Hájek, Miroslav
2014-01-01
Roč. 124, č. 21 (2014) ISSN 0006-4971. [Annual Meeting of the American Society of Hematology /56./. 06.12.2014-09.12.2014, San Francisco] Institutional support: RVO:61388963 Keywords : helquats * C-Myc * leukemia Subject RIV: CE - Biochemistry
BLM helicase suppresses recombination at G-quadruplex motifs in transcribed genes
van Wietmarschen, Niek; Merzouk, Sarra; Halsema, Nancy; Spierings, Diana C J; Guryev, Victor; Lansdorp, Peter M
2018-01-01
Bloom syndrome is a cancer predisposition disorder caused by mutations in the BLM helicase gene. Cells from persons with Bloom syndrome exhibit striking genomic instability characterized by excessive sister chromatid exchange events (SCEs). We applied single-cell DNA template strand sequencing
Viboonratanasri, Duangkamon; Pabchanda, Suwat; Prompinit, Panida
2018-05-01
In this study, a simple, rapid and relatively less toxic method for rhodamine 6G dye adsorption on hydrogen-form Y-type zeolite for highly selective nitrite detection was demonstrated. The adsorption behavior was described by Langmuir isotherm and the adsorption process reached the equilibrium promptly within a minute. The developed test papers characterized by fluorescence technique display high sensing performance with wide working range (0.04-20.0 mg L-1) and high selectivity. The test papers show good reproducibility with relative standard deviation (RSD) of 7% for five replicated determinations of 3 mg L-1 of nitrite. The nitrite concentration determined by using the test paper was in the same range as using ion chromatography within a 95% confidence level. The test papers offer advantages in terms of low cost and practical usage enabling them to be a promising candidate for nitrite sensor in environmental samples, food, and fertilizers.
Energy Technology Data Exchange (ETDEWEB)
Jing, Pei; Yi, Huayu; Xue, Shuyan; Chai, Yaqin; Yuan, Ruo; Xu, Wenju, E-mail: xwju@swu.edu.cn
2015-01-01
Highlights: • PDDA–G–MoS{sub 2} nanoflowers were firstly used for the fabrication of thrombin aptasensor. • MoS{sub 2} was adopted to enhance the surface area of graphene and accelerate the electron transfer. • GOD, PdNPs and hemin/G-quadruplex could amplify the electrochemical signal through synergetic catalysis. • The proposed aptasensor displayed an improved sensitivity. - Abstract: In the present study, with the aggregated advantages of graphene and molybdenum disulfide (MoS{sub 2}), we prepared poly(diallyldimethylammonium chloride)–graphene/molybdenum disulfide (PDDA–G–MoS{sub 2}) nanocomposites with flower-like structure, large surface area and excellent conductivity. Furthermore, an advanced sandwich-type electrochemical assay for sensitive detection of thrombin (TB) was fabricated using palladium nanoparticles decorated PDDA–G–MoS{sub 2} (PdNPs/PDDA–G–MoS{sub 2}) as nanocarriers, which were functionalized by hemin/G-quadruplex, glucose oxidase (GOD), and toluidine blue (Tb) as redox probes. The signal amplification strategy was achieved as follows: Firstly, the immobilized GOD could effectively catalyze the oxidation of glucose to gluconolactone, coupling with the reduction of the dissolved oxygen to H{sub 2}O{sub 2}. Then, both PdNPs and hemin/G-quadruplex acting as hydrogen peroxide (HRP)-mimicking enzyme could further catalyze the reduction of H{sub 2}O{sub 2}, resulting in significant electrochemical signal amplification. So the proposed aptasensor showed high sensitivity with a wide dynamic linear range of 0.0001 to 40 nM and a relatively low detection limit of 0.062 pM for TB determination. The strategy showed huge potential of application in protein detection and disease diagnosis.
Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua
2017-11-01
In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.
Directory of Open Access Journals (Sweden)
Yazdan Naghdi
2013-09-01
Full Text Available This study has attempted to examine and compare the effects of 2007 financial crisis on inflation in OPEC countries and selected countries of G8, based on a panel data regression model during 2000-2010. It should be noted that the selected countries of G8 group are 5 industrial countries member of this group, including: America, Italy, Britain, France and Japan, that crisis has been seen faster in them than other countries. Growth economic variables (real sector of the economy, oil price and stock price index (i.e. financial market have been considered as affected shared variables of the financial crisis in both countries group. According to the obtained results, the only affected variable by the crisis in OPEC countries, is oil price which has positive and significant effect on inflation in the above mentioned countries so that one percent increase in oil price lead to about 0.08 percent increase on inflation, on the other hand, according to survey results there is no relationship between output and inflation in OPEC countries, so it reflects weak manufacturing structure sector (real sector of the economy in these countries
Sasmal, Dinabandhu; Maity, Jayanta; Kolya, Haradhan; Tripathy, Tridib
2017-04-01
Amylopectin-g-poly (acrylamide-co-acrylic acid) [AP-g-poly (AM-co-AA)] was synthesised in water medium by using potassium perdisulphate as an initiator. The graft copolymer was characterized by molecular weight determination by size exclusion chromatography (SEC), fourier transform infrared spectroscopy (FTIR) and nuclear magnetic resonance (NMR) spectroscopy, scanning electron microscope (SEM) studies, thermal analysis, measurement of neutralisation equivalent and biodegradation studies. The graft copolymer was used for Pb (II) ion removal from aqueous solution. The Pb (II) ion removal capacity of the graft copolymer was also compared with another laboratory developed graft copolymer Amylopectin-g-poly (acrylamide) (AP-g-PAM). Both the graft copolymers were also used for the competitive metal ions removal with Pb (II)/Cd (II), Pb (II)/Zn (II), Pb (II)/Ni (II), Pb (II)/Cu (II) pairs separately under similar conditions. AP-g-poly (AM-co-AA) showed better Pb (II) ion adsorbing power over AP-g-PAM and also much selective towards Pb (II) ions. The adsorption follows a second order rate equation and Langmuir isotherm model. Copyright © 2017 Elsevier B.V. All rights reserved.
Chen, Xiufang; Zhang, Ligang; Zhang, Bo; Guo, Xingcui; Mu, Xindong
2016-01-01
Graphitic carbon nitride nanosheets were investigated for developing effective Pt catalyst supports for selective hydrogenation of furfural to furfuryl alcohol in water. The nanosheets with an average thickness of about 3 nm were synthesized by a simple and green method through thermal oxidation etching of bulk g-C3N4 in air. Combined with the unique feature of nitrogen richness and locally conjugated structure, the g-C3N4 nanosheets with a high surface area of 142?m2 g?1 were demonstrated to...
Czech Academy of Sciences Publication Activity Database
Noureini, S.K.; Esmaeili, H.; Abachi, F.; Khiali, S.; Islam, Barira; Kuta, M.; Saboury, A.A.; Hoffillann, M.; Šponer, Jiří; Parkinson, G.; Haider, S.
2017-01-01
Roč. 1861, č. 8 (2017), s. 2020-2030 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : prostate-cancer cells * amber force-field * nucleic-acids Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016
DEFF Research Database (Denmark)
Agerskov, Claus; Mortensen, Rasmus M.; Bohr, Henrik G.
2015-01-01
A study is presented on how well possible drug-molecules can be predicted with respect to their function and binding to a selection of neuro-receptors by the use of artificial neural networks. The ligands investigated in this study are chosen to be corresponding to the G protein-coupled receptors...... computational tools, able to aid in drug-design in a fast and cheap fashion, compared to conventional pharmacological techniques....... mu-opioid, serotonin 2B (5-HT2B) and metabotropic glutamate D5. They are selected due to the availability of pharmacological drug-molecule binding data for these receptors. Feedback and deep belief artificial neural network architectures (NNs) were chosen to perform the task of aiding drug-design.......925. The performance of 8 category networks (8 output classes for binding strength) obtained a prediction accuracy of above 60 %. After training the networks, tests were done on how well the systems could be used as an aid in designing candidate drug molecules. Specifically, it was shown how a selection of chemical...
Tyagi, A K; Ramkumar, Jayshree; Jayakumar, O D
2012-02-07
Lead metal ions are of great concern and the monitoring of their concentration in the environment has become extremely important. In the present study, a new inorganic-organic hybrid assay of Ag nanorods (AgNR)-Rhodamine 6G (R6G) was developed for the sensitive and selective determination of Pb(2+) ions in aqueous solutions. To the best of our knowledge there is almost no literature on the use of silver nanorod sensors for determination of lead ions in aqueous solutions. The sensor is developed by the coating of R6G on the surface of AgNRs. The sensing is based on the photoluminescence of R6G. The sensor was rapid as the measurements were carried out within 3 min of addition of the test solution to the AgNR-R6G hybrid. Moreover, the system showed excellent stability at tested concentration levels of Pb(2+) ions. The naked eye detection of the colour was possible with 1 mg L(-1) of Pb(2+) ions. The present method has a detection limit of 50 μg L(-1) of Pb(2+) (for a signal/noise (S/N) ratio > 3). The selectivity toward Pb(2+) ions against other metal ions was improved using chelating agents. The proposed method was validated by analysis using different techniques.
Wei, Yin; Zhang, Ji; Wang, Xu; Duan, Yixiang
2015-03-15
This paper describes a novel approach utilizing nano-graphite-aptamer hybrid and DNase I for the amplified detection of ochratoxin A (OTA) for the first time. Nano-graphite can effectively quench the fluorescence of carboxyfluorescein (FAM) labeled OTA specific aptamer due to their strong π-π; stacking interactions; while upon OTA addition, it will bind with aptamer to fold into an OTA-aptamerG-quadruplex structure, which does not adsorb on the surface of nano-graphite and thus retains the dye fluorescence. Meanwhile, the G-quadruplex structure can be cleaved by DNase I, and in such case OTA is delivered from the complex. The released OTA then binds other FAM-labeled aptamers on the nano-graphite surface, and touches off another target recycling, resulting in the successive release of dye-labeled aptamers from the nano-graphite, which leads to significant amplification of the signal. Under the optimized conditions, the present amplified sensing system exhibits high sensitivity toward OTA with a limit of detection of 20nM (practical measurement), which is about 100-fold higher than that of traditional unamplified homogeneous assay. Our developed method also showed high selectivity against other interference molecules and can be applied for the detection of OTA in real red wine samples. The proposed assay is simple, cost-effective, and might open a door for the development of new assays for other biomolecules. This aptasensor is of great practical importance in food safety and could be widely extended to the detection of other toxins by replacing the sequence of the recognition aptamer. Copyright © 2014 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Batista, Enrique R [Los Alamos National Laboratory; Newcomer, Micharel B [YALE UNIV; Raggin, Christina M [YALE UNIV; Gascon, Jose A [YALE UNIV; Loria, J Patrick [YALE UNIV; Batista, Victor S [YALE UNIV
2008-01-01
This paper generalizes the MoD-QM/MM hybrid method, developed for ab initio computations of protein electrostatic potentials [Gasc6n, l.A.; Leung, S.S.F.; Batista, E.R.; Batista, V.S. J. Chem. Theory Comput. 2006,2, 175-186], as a practical algorithm for structural refinement of extended systems. The computational protocol involves a space-domain decomposition scheme for the formal fragmentation of extended systems into smaller, partially overlapping, molecular domains and the iterative self-consistent energy minimization of the constituent domains by relaxation of their geometry and electronic structure. The method accounts for mutual polarization of the molecular domains, modeled as Quantum-Mechanical (QM) layers embedded in the otherwise classical Molecular-Mechanics (MM) environment according to QM/MM hybrid methods. The method is applied to the description of benchmark models systems that allow for direct comparisons with full QM calculations, and subsequently applied to the structural characterization of the DNA Oxytricha nova Guanine quadruplex (G4). The resulting MoD-QM/MM structural model of the DNA G4 is compared to recently reported highresolution X-ray diffraction and NMR models, and partially validated by direct comparisons between {sup 1}H NMR chemical shifts that are highly sensitive to hydrogen-bonding and stacking interactions and the corresponding theoretical values obtained at the density functional theory DFT QM/MM (BH&H/6-31 G*:Amber) level in conjunction with the gauge independent atomic orbital (GIAO) method for the ab initio self consistent-field (SCF) calculation of NMR chemical shifts.
DEFF Research Database (Denmark)
Kotkowiak, Weronika; Lisowiec-Wachnicka, Jolanta; Grynda, Jakub
2018-01-01
Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antipar......Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular......, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation......-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G...
Serra-Vinardell, Jenny; Díaz, Lucía; Gutiérrez-de Terán, Hugo; Sánchez-Ollé, Gessamí; Bujons, Jordi; Michelakakis, Helen; Mavridou, Irene; Aerts, Johannes M F G; Delgado, Antonio; Grinberg, Daniel; Vilageliu, Lluïsa; Casas, Josefina
2014-09-01
Gaucher disease is an autosomal recessive lysosomal disorder characterized by the accumulation of glucosylceramide as a result of a deficiency of the enzyme glucocerebrosidase. Several competitive glucocerebrosidase inhibitors are able to act as pharmacological chaperones for an efficient rescue of the mutated, misfolded forms of the enzyme. Along this line, we report in this work on the ability of several aminocyclitols to increase the residual glucocerebrosidase activity in patient fibroblasts with different genotypes. Some of the compounds were slightly active on fibroblasts bearing some mutations, including the highly prevalent N370S mutation. All compounds were highly active as enzyme activity enhancers on fibroblasts from Gaucher disease patients containing the G202R mutation. Moreover, using the novel tagged sphingolipid ω-azidosphingosine, a reduction in the tagged glucosylceramide accumulation was also observed for selected aminocyclitols. Attempts to explain the activity impairment observed in glucocerebrosidase bearing the G202R mutation by comparative molecular dynamic studies on wild type and the G202R mutated proteins (free and isofagomine-bound, in both cases) were unsuccessful. Under the simulation conditions used, no clear effect of the G202R mutation neither over the global structure of the protein nor on the loops that constitute the glucocerebrosidase active site was observed. Since the G202R residue is located on the protein surface, altered protein-membrane or protein-protein interactions could account for the observed differences. In conclusion, we have tested novel compounds that have shown some chaperone effect on particular glucocerebrosidase mutant enzymes, supporting the enhancement therapy as an alternative approach for Gaucher disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Cline, Gary W., E-mail: gary.cline@yale.edu [Yale University School of Medicine (United States); Zhao, Xiaojian [Yale University School of Medicine (United States); Jakowski, Amy B.; Soeller, Walter C.; Treadway, Judith L. [Pfizer Global Research and Development, Pfizer Inc., Groton CT (United States)
2011-09-02
Highlights: {yields} We screened G-protein coupled receptors for imaging pancreatic. {yields} Database mining and immunohistochemistry identified GPCRs enriched in {beta}-cells. {yields} In vitro and in vivo assays were used to determine exocrine vs endocrine specificity. {yields} GPCR candidates for imaging of {beta}-cell mass are Prokineticin-1R, mGluR5, and GLP-1R. -- Abstract: A critical unmet need exists for methods to quantitatively measure endogenous pancreatic {beta}-cell mass (BCM) for the clinical evaluation of therapies to prevent or reverse loss of BCM and diabetes progression. Our objective was to identify G-protein coupled receptors (GPCRs) that are expressed with a high degree of specificity to islet {beta}-cells for receptor-targeted imaging of BCM. GPCRs enriched in pancreatic islets relative to pancreas acinar and hepatic tissue were identified using a database screen. Islet-specific expression was confirmed by human pancreas immunohistochemistry (IHC). In vitro selectivity assessment was determined from the binding and uptake of radiolabeled ligands to the rat insulinoma INS-1 832/13 cell line and isolated rat islets relative to the exocrine pancreas cell-type, PANC-1. Tail-vein injections of radioligands into rats were used to determine favorable image criteria of in vivo biodistribution to the pancreas relative to other internal organs (i.e., liver, spleen, stomach, and lungs). Database and IHC screening identified four candidate receptors for further in vitro and in vivo evaluation for PET imaging of BCM: prokineticin-1 receptor (PK-1R), metabotropic glutamate receptor type-5 (mGluR5), neuropeptide Y-2 receptor (NPY-2R), and glucagon-like peptide 1 receptor (GLP-1R). In vitro specificity ratios gave the following receptor rank order: PK-1R > GLP-1R > NPY-2R > mGluR5. The biodistribution rank order of selectivity to the pancreas was found to be PK-1R > VMAT2 {approx} GLP-1R > mGluR5. Favorable islet selectivity and biodistribution
International Nuclear Information System (INIS)
Cline, Gary W.; Zhao, Xiaojian; Jakowski, Amy B.; Soeller, Walter C.; Treadway, Judith L.
2011-01-01
Highlights: → We screened G-protein coupled receptors for imaging pancreatic. → Database mining and immunohistochemistry identified GPCRs enriched in β-cells. → In vitro and in vivo assays were used to determine exocrine vs endocrine specificity. → GPCR candidates for imaging of β-cell mass are Prokineticin-1R, mGluR5, and GLP-1R. -- Abstract: A critical unmet need exists for methods to quantitatively measure endogenous pancreatic β-cell mass (BCM) for the clinical evaluation of therapies to prevent or reverse loss of BCM and diabetes progression. Our objective was to identify G-protein coupled receptors (GPCRs) that are expressed with a high degree of specificity to islet β-cells for receptor-targeted imaging of BCM. GPCRs enriched in pancreatic islets relative to pancreas acinar and hepatic tissue were identified using a database screen. Islet-specific expression was confirmed by human pancreas immunohistochemistry (IHC). In vitro selectivity assessment was determined from the binding and uptake of radiolabeled ligands to the rat insulinoma INS-1 832/13 cell line and isolated rat islets relative to the exocrine pancreas cell-type, PANC-1. Tail-vein injections of radioligands into rats were used to determine favorable image criteria of in vivo biodistribution to the pancreas relative to other internal organs (i.e., liver, spleen, stomach, and lungs). Database and IHC screening identified four candidate receptors for further in vitro and in vivo evaluation for PET imaging of BCM: prokineticin-1 receptor (PK-1R), metabotropic glutamate receptor type-5 (mGluR5), neuropeptide Y-2 receptor (NPY-2R), and glucagon-like peptide 1 receptor (GLP-1R). In vitro specificity ratios gave the following receptor rank order: PK-1R > GLP-1R > NPY-2R > mGluR5. The biodistribution rank order of selectivity to the pancreas was found to be PK-1R > VMAT2 ∼ GLP-1R > mGluR5. Favorable islet selectivity and biodistribution characteristics suggest several GPCRs as potential
Evaluation of the Stability of DNA i-Motifs in the Nuclei of Living Mammalian Cells
Czech Academy of Sciences Publication Activity Database
Dzatko, S.; Krafčíková, M.; Haensel-Hertsch, R.; Fessl, T.; Fiala, R.; Loja, T.; Krafčík, D.; Mergny, Jean-Louis; Foldynova-Trantirkova, Silvie; Trantírek, L.
2018-01-01
Roč. 57, č. 8 (2018), s. 2165-2169 ISSN 1433-7851 R&D Projects: GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : g-quadruplex * telomeric dna * base-pairs * molecular switch Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 11.994, year: 2016
Czech Academy of Sciences Publication Activity Database
Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, R.; Vorlíčková, Michaela; Trantírek, L.
2015-01-01
Roč. 43, č. 9 (2015), s. 4733-4745 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA13-28310S; GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : NUCLEASE HYPERSENSITIVE ELEMENT * G-QUADRUPLEX STRUCTURES * I-MOTIF Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015
International Nuclear Information System (INIS)
Yan, Yu-Qian; Tang, Xian; Wang, Yong-Sheng; Li, Ming-Hui; Cao, Jin-Xiu; Chen, Si-Han; Zhu, Yu-Feng; Wang, Xiao-Feng; Huang, Yan-Qin
2015-01-01
We report on a sensitive and selective strategy for the determination of metallothioneins (MTs). The assay is based on the suppression of the surface energy transfer that occurs between rhodamine 6G (Rh6G) and gold nanoparticles (AuNPs). If Rh6G is adsorbed onto the surface of AuNPs in water solution of pH 3.0, its fluorescence is quenched due to surface energy transfer. However, on addition of MTs to the Rh6G-AuNPs system, fluorescence is recovered owing to the formation of the MTs-AuNPs complex and the release of Rh6G into the solution. Under optimized conditions, the increase in fluorescence intensity is directly proportional to the concentration of the MTs in the range from 9.68 to 500 ng mL −1 , with a detection limit as low as 2.9 ng mL −1 . The possible mechanism of this assay is discussed. The method was successfully applied to the determination of MTs in (spiked) human urine. (author)
Shi, Guodong; Yang, Lin; Liu, Zhuowen; Chen, Xiao; Zhou, Jianqing; Yu, Ying
2018-01-01
Photocatalytic reduction of CO2 to fuel has attracted considerable attention due to the consumption of fossil fuels and serious environmental problems. Although there are many photocatalysts reported for CO2 reduction, the improvement of activity and selectivity is still in great need of. In this work, a series of Cu nanoparticle decorated g-C3N4 nanosheets with different Cu loadings were fabricated by a facile secondary calcination and subsequent microwave hydrothermal method. The designed catalysts shown good photocatalytic activity and selectivity for CO2 reduction to CO. The optimal sample exhibited a 3-fold augmentation of the CO yield in comparison with pristine g-C3N4 under visible light. It is revealed that with the loading of Cu nanoparticles, the resulting photocatalyst possessed an improved charge carrier transfer and separation efficiency as well as increased surface reactive sites, resulting in a significant enhancement of CO yield. It is anticipated that the designed Cu/C3N4 photocatalyst may provide new insights for two dimensional layer materials and non-noble particles applied to CO2 reduction.
Novel Resource and Energy Management for 5G Integrated Backhaul/Fronthaul (5G-Crosshaul)
Xi, Li; Ferdous, Raihana; Chiasserini, Carla Fabiana; Casetti, CLAUDIO ETTORE; Moscatelli, Francesca; Landi, Giada; Casellas, Ramon; Sakaguchi, Kei; Chundrigar, Shahzoob Bilal; Vilalta, Ricard; Mangues Bafalluy, Josep; Garcia Saavedra, Andres; Costa Perez, Xavier; Goratti, Leonardo; Siracusa, Domenico
2017-01-01
The integration of both fronthaul and backhaul into a single transport network (namely, 5G-Crosshaul) is envisioned for the future 5G transport networks. This requires a fully integrated and unified management of the fronthaul and backhaul resources in a cost-efficient, scalable and flexible way through the deployment of an SDN/NFV control framework. This paper presents the designed 5G-Crosshaul architecture, two selected SDN/NFV applications targeting for cost-efficient resource and energy u...
The GALILEO GALILEI small-satellite mission with FEEP thrusters (G G)
International Nuclear Information System (INIS)
Nobili, A. M.; Bramanti, D.; Catastini, G.
1997-01-01
The Equivalence Principle, formulated by Einstein generalizing Galileo's and Newton's work, is a fundamental principle of modern physics. As such it should be tested as accurately as possible. Its most direct consequence, namely the Universality of Free Fall, can be tested in space, in a low Earth orbit, the crucial advantage being that the driving signal is about three orders of magnitude stronger than on Earth. GALILEO GALILEI (G G) is a small space mission designed for such a high-accuracy test. At the time of print, G G has been selected by ASI (Agenzia Spaziale Italiana) as a candidate for the next small Italian mission. Ground tests of the proposed apparatus now indicate that an accuracy of 1 part in 10 17 is within the reach of this small mission
Directory of Open Access Journals (Sweden)
Mayu Sugiyama
2014-12-01
Full Text Available In multicellular organism development, a stochastic cellular response is observed, even when a population of cells is exposed to the same environmental conditions. Retrieving the spatiotemporal regulatory mode hidden in the heterogeneous cellular behavior is a challenging task. The G1/S transition observed in cell cycle progression is a highly stochastic process. By taking advantage of a fluorescence cell cycle indicator, Fucci technology, we aimed to unveil a hidden regulatory mode of cell cycle progression in developing zebrafish. Fluorescence live imaging of Cecyil, a zebrafish line genetically expressing Fucci, demonstrated that newly formed notochordal cells from the posterior tip of the embryonic mesoderm exhibited the red (G1 fluorescence signal in the developing notochord. Prior to their initial vacuolation, these cells showed a fluorescence color switch from red to green, indicating G1/S transitions. This G1/S transition did not occur in a synchronous manner, but rather exhibited a stochastic process, since a mixed population of red and green cells was always inserted between newly formed red (G1 notochordal cells and vacuolating green cells. We termed this mixed population of notochordal cells, the G1/S transition window. We first performed quantitative analyses of live imaging data and a numerical estimation of the probability of the G1/S transition, which demonstrated the existence of a posteriorly traveling regulatory wave of the G1/S transition window. To obtain a better understanding of this regulatory mode, we constructed a mathematical model and performed a model selection by comparing the results obtained from the models with those from the experimental data. Our analyses demonstrated that the stochastic G1/S transition window in the notochord travels posteriorly in a periodic fashion, with doubled the periodicity of the neighboring paraxial mesoderm segmentation. This approach may have implications for the characterization of
Botosso, Viviane F; Zanotto, Paolo M de A; Ueda, Mirthes; Arruda, Eurico; Gilio, Alfredo E; Vieira, Sandra E; Stewien, Klaus E; Peret, Teresa C T; Jamal, Leda F; Pardini, Maria I de M C; Pinho, João R R; Massad, Eduardo; Sant'anna, Osvaldo A; Holmes, Eddie C; Durigon, Edison L
2009-01-01
Human respiratory syncytial virus (HRSV) is the major cause of lower respiratory tract infections in children under 5 years of age and the elderly, causing annual disease outbreaks during the fall and winter. Multiple lineages of the HRSVA and HRSVB serotypes co-circulate within a single outbreak and display a strongly temporal pattern of genetic variation, with a replacement of dominant genotypes occurring during consecutive years. In the present study we utilized phylogenetic methods to detect and map sites subject to adaptive evolution in the G protein of HRSVA and HRSVB. A total of 29 and 23 amino acid sites were found to be putatively positively selected in HRSVA and HRSVB, respectively. Several of these sites defined genotypes and lineages within genotypes in both groups, and correlated well with epitopes previously described in group A. Remarkably, 18 of these positively selected tended to revert in time to a previous codon state, producing a "flip-flop" phylogenetic pattern. Such frequent evolutionary reversals in HRSV are indicative of a combination of frequent positive selection, reflecting the changing immune status of the human population, and a limited repertoire of functionally viable amino acids at specific amino acid sites.
Directory of Open Access Journals (Sweden)
Viviane F Botosso
2009-01-01
Full Text Available Human respiratory syncytial virus (HRSV is the major cause of lower respiratory tract infections in children under 5 years of age and the elderly, causing annual disease outbreaks during the fall and winter. Multiple lineages of the HRSVA and HRSVB serotypes co-circulate within a single outbreak and display a strongly temporal pattern of genetic variation, with a replacement of dominant genotypes occurring during consecutive years. In the present study we utilized phylogenetic methods to detect and map sites subject to adaptive evolution in the G protein of HRSVA and HRSVB. A total of 29 and 23 amino acid sites were found to be putatively positively selected in HRSVA and HRSVB, respectively. Several of these sites defined genotypes and lineages within genotypes in both groups, and correlated well with epitopes previously described in group A. Remarkably, 18 of these positively selected tended to revert in time to a previous codon state, producing a "flip-flop" phylogenetic pattern. Such frequent evolutionary reversals in HRSV are indicative of a combination of frequent positive selection, reflecting the changing immune status of the human population, and a limited repertoire of functionally viable amino acids at specific amino acid sites.
Energy Technology Data Exchange (ETDEWEB)
Zhao, Huimin; Gao, Sheng; Liu, Meng; Chang, Yangyang; Fan, Xinfei; Quan, Xie [Key Laboratory of Industrial Ecology and Environmental Engineering (Ministry of Education, China), School of Environmental Science and Technology, Dalian University of Technology, Dalian, 116024 (China)
2013-07-15
We report on a fluorescent assay for oxytetracycline (OTC) using a fluorescein-labeled long-chain aptamer assembled onto reduced graphene oxide (rGO). The π-π stacking interaction between aptamer and rGO causes the fluorescence of the label to be almost completely quenched via energy transfer so that the system has very low background fluorescence. The addition of OTC leads to the formation of G-quadruplex OTC complexes and prevents the adsorption of labeled aptamer on the surface of rGO. As a result, fluorescence is restored, and this effect allows for a quantitative assay of OTC over the 0.1–2 μM concentration range and with a detection limit of 10 nM. This method is simple, rapid, selective and sensitive. It may be applied to other small molecule analytes by applying appropriate aptamers. (author)
International Nuclear Information System (INIS)
Zhao, Huimin; Gao, Sheng; Liu, Meng; Chang, Yangyang; Fan, Xinfei; Quan, Xie
2013-01-01
We report on a fluorescent assay for oxytetracycline (OTC) using a fluorescein-labeled long-chain aptamer assembled onto reduced graphene oxide (rGO). The π-π stacking interaction between aptamer and rGO causes the fluorescence of the label to be almost completely quenched via energy transfer so that the system has very low background fluorescence. The addition of OTC leads to the formation of G-quadruplex OTC complexes and prevents the adsorption of labeled aptamer on the surface of rGO. As a result, fluorescence is restored, and this effect allows for a quantitative assay of OTC over the 0.1–2 μM concentration range and with a detection limit of 10 nM. This method is simple, rapid, selective and sensitive. It may be applied to other small molecule analytes by applying appropriate aptamers. (author)
i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions
Czech Academy of Sciences Publication Activity Database
Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela
2018-01-01
Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology
Negron Rios, Luis M.
The impact of size, shape, and distribution of lipophilic regions on the surfaces of nanoscopic objects that are amphiphilic or patchy (such as proteins) are yet to be fully understood. One of the reasons for this is the lack of an appropriate model systems in which to probe this question. Our group has previously reported 2'-deoxyguanosine (8ArG) derivatives that self-assemble in aqueous media into discrete supramolecular hexadecamers that show the lower critical solution temperature (LCST) phenomenon. The LCST phenomenon is a convenient and rigorous strategy to measure the hydrophobicity of a system. Although these SGQs are potentially attractive for biomedical applications like drug-delivery, the narrow window of physiological temperatures complicates their implementation. This moved us to redesign the constituent 8ArG subunits to incorporate imidazole moieties that would lead to pH-responsive SGQs, working isothermally. Upon reaching a threshold temperature (Lower Critical Solution Temperature, LCST) at pH 7, these dual-responsive SGQs further self-assemble to form nano/micro hydrogel globules that we called them supramolecular hacky sacks (SHS). However, we can isolate kinetically stable versions of these SHS by lowering the ionic strength of the medium (i.e., from the molar to the millimolar range) in a process that we term "fixing the SHS", in which these SHS maintain their integrity (size and shape) and stability without the requirement of crosslinking agents. After structural characterization and in vitro studies of SHS, we performed encapsulation studies of DOX, rhodamine, dsDNA (F26T), thrombin binding aptamer (TBA) and dextran (3 kDa) Texas Red conjugate. Then we performed in vivo studies of cell internalization and drug delivery with neuroblastoma SY-SH5Y. The performed studies will bring new approaches for the development of new biotechnology for fundamental applications and the emerging of novel therapeutic agents for biomedical applications.
International Nuclear Information System (INIS)
Dexheimer, Thomas S.; Carey, Steven S.; Zuohe, Song; Gokhale, Vijay M.; Hu, Xiaohui; Murata, Lauren B.; Maes, Estelle M.; Weichsel, Andrzej; Sun, Daekyu; Meuillet, Emmanuelle J.; Montfort, William R.; Hurley, Laurence H.
2009-01-01
The formation of G-quadruplex structures within the nuclease hypersensitive element (NHE) III 1 region of the c-myc promoter and the ability of these structures to repress c-myc transcription have been well established. However, just how these extremely stable DNA secondary structures are transformed to activate c-myc transcription is still unknown. NM23-H2/nucleoside diphosphate kinase B has been recognized as an activator of c-myc transcription via interactions with the NHE III 1 region of the c-myc gene promoter. Through the use of RNA interference, we confirmed the transcriptional regulatory role of NM23-H2. In addition, we find that further purification of NM23-H2 results in loss of the previously identified DNA strand cleavage activity, but retention of its DNA binding activity. NM23-H2 binds to both single-stranded guanine- and cytosine-rich strands of the c-myc NHE III 1 and, to a lesser extent, to a random single-stranded DNA template. However, it does not bind to or cleave the NHE III 1 in duplex form. Significantly, potassium ions and compounds that stabilize the G-quadruplex and i-motif structures have an inhibitory effect on NM23-H2 DNA-binding activity. Mutation of Arg 88 to Ala 88 (R88A) reduced both DNA and nucleotide binding but had minimal effect on the NM23-H2 crystal structure. On the basis of these data and molecular modeling studies, we have proposed a stepwise trapping-out of the NHE III 1 region in a single-stranded form, thus allowing single-stranded transcription factors to bind and activate c-myc transcription. Furthermore, this model provides a rationale for how the stabilization of the G-quadruplex or i-motif structures formed within the c-myc gene promoter region can inhibit NM23-H2 from activating c-myc gene expression.
Location selection in the visual domain
van der Lubbe, Robert Henricus Johannes; Woestenburg, Jaap C.
2000-01-01
According to A.H.C. Van der Heijden (1992), attentional selection of visual stimuli can be considered as location selection. Depending on the type of task, location selection can be considered to be automatic )e.g., in case of abrupt onsets), directly controlled (e.g., in case of symbolic precues),
Regulation and Selectivity of Exchange Factors for G-proteins of the Ras-family
Popovic, M.
2013-01-01
Small G-proteins are important regulators of the cellular signaling pathways. Among them, members of the Ras family of small G-proteins regulate processes such as cell differentiation, growth, migration, transport and adhesion, and their deregulation may lead to various diseases. Small G-proteins
Battlay, Paul; Schmidt, Joshua M; Fournier-Level, Alexandre; Robin, Charles
2016-08-09
Scans of the Drosophila melanogaster genome have identified organophosphate resistance loci among those with the most pronounced signature of positive selection. In this study, the molecular basis of resistance to the organophosphate insecticide azinphos-methyl was investigated using the Drosophila Genetic Reference Panel, and genome-wide association. Recently released full transcriptome data were used to extend the utility of the Drosophila Genetic Reference Panel resource beyond traditional genome-wide association studies to allow systems genetics analyses of phenotypes. We found that both genomic and transcriptomic associations independently identified Cyp6g1, a gene involved in resistance to DDT and neonicotinoid insecticides, as the top candidate for azinphos-methyl resistance. This was verified by transgenically overexpressing Cyp6g1 using natural regulatory elements from a resistant allele, resulting in a 6.5-fold increase in resistance. We also identified four novel candidate genes associated with azinphos-methyl resistance, all of which are involved in either regulation of fat storage, or nervous system development. In Cyp6g1, we find a demonstrable resistance locus, a verification that transcriptome data can be used to identify variants associated with insecticide resistance, and an overlap between peaks of a genome-wide association study, and a genome-wide selective sweep analysis. Copyright © 2016 Battlay et al.
Bacigalupe, Leonardo D; Barrientos, Karin; Beckerman, Andrew P; Carter, Mauricio J; Figueroa, Christian C; Foster, Stephen P; Moore, Allen J; Silva, Andrea X; Nespolo, Roberto F
2013-01-01
Most evolutionary research on biological invasions has focused on changes seen between the native and invaded range for a particular species. However, it is likely that species that live in human-modified habitats in their native range might have evolved specific adaptations to those environments, which increase the likelihood of establishment and spread in similar human-altered environments. From a quantitative genetic perspective, this hypothesis suggests that both native and introduced populations should reside at or near the same adaptive peak. Therefore, we should observe no overall changes in the G (genetic variance–covariance) matrices between native and introduced ranges, and stabilizing selection on fitness-related traits in all populations. We tested these predictions comparing three populations of the worldwide pest Myzus persicae from the Middle East (native range) and the UK and Chile (separately introduced ranges). In general, our results provide mixed support for this idea, but further comparisons of other species are needed. In particular, we found that there has been some limited evolution in the studied traits, with the Middle East population differing from the UK and Chilean populations. This was reflected in the structure of the G-matrices, in which Chile differed from both UK and Middle East populations. Furthermore, the amount of genetic variation was massively reduced in Chile in comparison with UK and Middle East populations. Finally, we found no detectable selection on any trait in the three populations, but clones from the introduced ranges started to reproduce later, were smaller, had smaller offspring, and had lower reproductive fitness than clones from the native range. PMID:24455140
Selection of G1 Phase Yeast Cells for Synchronous Meiosis and Sporulation.
Stuart, David T
2017-01-01
Centrifugal elutriation is a procedure that allows the fractionation of cell populations based upon their size and shape. This allows cells in distinct cell cycle stages can be captured from an asynchronous population. The technique is particularly helpful when performing an experiment to monitor the progression of cells through the cell cycle or meiosis. Yeast sporulation like gametogenesis in other eukaryotes initiates from the G1 phase of the cell cycle. Conveniently, S. cerevisiae arrest in G1 phase when starved for nutrients and so withdrawal of nitrogen and glucose allows cells to abandon vegetative growth in G1 phase before initiating the sporulation program. This simple starvation protocol yields a partial synchronization that has been used extensively in studies of progression through meiosis and sporulation. By using centrifugal elutriation it is possible to isolate a homogeneous population of G1 phase cells and induce them to sporulate synchronously, which is beneficial for investigating progression through meiosis and sporulation. An additionally benefit of this protocol is that cell populations can be isolated based upon size and both large and small cell populations can be tested for progression through meiosis and sporulation. Here we present a protocol for purification of G1 phase diploid cells for examining synchronous progression through meiosis and sporulation.
Wang, Lusheng; Wang, Yamei; Ding, Zhizhong; Wang, Xiumin
2015-09-18
With the rapid development of wireless networking technologies, the Internet of Things and heterogeneous cellular networks (HCNs) tend to be integrated to form a promising wireless network paradigm for 5G. Hyper-dense sensor and mobile devices will be deployed under the coverage of heterogeneous cells, so that each of them could freely select any available cell covering it and compete for resource with others selecting the same cell, forming a cell selection (CS) game between these devices. Since different types of cells usually share the same portion of the spectrum, devices selecting overlapped cells can experience severe inter-cell interference (ICI). In this article, we study the CS game among a large amount of densely-deployed sensor and mobile devices for their uplink transmissions in a two-tier HCN. ICI is embedded with the traditional congestion game (TCG), forming a congestion game with ICI (CGI) and a congestion game with capacity (CGC). For the three games above, we theoretically find the circular boundaries between the devices selecting the macrocell and those selecting the picocells, indicated by the pure strategy Nash equilibria (PSNE). Meanwhile, through a number of simulations with different picocell radii and different path loss exponents, the collapse of the PSNE impacted by severe ICI (i.e., a large number of picocell devices change their CS preferences to the macrocell) is profoundly revealed, and the collapse points are identified.
Synthesis of L-lysine imprinted cryogels for immunoglobulin G adsorption
Energy Technology Data Exchange (ETDEWEB)
Çulha, Senem; Armutcu, Canan; Uzun, Lokman; Şenel, Serap, E-mail: senel@hacettepe.edu.tr; Denizli, Adil
2015-07-01
L-Lysine imprinted poly(2-hydroxyethyl methacrylate-co-N-methacryloyl-L-aspartic acid) [P(HEMA-co-MAAsp)] cryogels were synthesized and characterized with Fourier transform infrared spectroscopy, scanning electron microscopy, surface area measurements, swelling, and squeezing tests. Specific surface area for imprinted cryogel was 34.2 m{sup 2}/g while the value was 21.3 m{sup 2}/g for non-imprinted cryogel. IgG adsorption from aqueous solution was examined in continuous mode examining the factors effecting adsorption capacity such as pH, concentration, flow rate, temperature, ionic strength, and incubation time. 0.5 M NaCl was used as desorption agent. The IgG adsorption capacity was determined as 55.1 mg/g for 1.0 mg/mL IgG original concentration at 25.0 °C while pH and flow rate were 7.0 and 0.5 mL/min, respectively. When human serum was used as IgG source, the removal of 90.4% of crude IgG was attained for 1/20 diluted plasma sample. The imprinted cryogel was used in ten successive cycles without significant loss in adsorption capacity. The cryogel was determined to be 1.79 times more selective to IgG than albumin and 1.45 times more selective than hemoglobin. The adsorption behavior well suited to Langmuir isotherm and the kinetics followed pseudo-second-order model. Thermodynamic parameters ΔH°, ΔS° and ΔG° for this adsorption process were also calculated. - Highlights: • L-Lysine imprinted cryogels through epitope imprinting approach • Optimization of recognition conditions for template (L-lysine) and target (IgG) biomolecules • Efficient reusability (upto 10 cycles) without any significant change in capacity • A great potential for specific and selective IgG purification • Promising, cost-friendly, specific and selective adsorbent • IgG separation/purification from complex feeding solutions like human serum.
Conformations of Human Telomeric G-Quadruplex Studied Using a Nucleotide-Independent Nitroxide Label
Czech Academy of Sciences Publication Activity Database
Zhang, X.J.; Xu, C.X.; Di Felice, R.; Šponer, Jiří; Islam, B.; Stadlbauer, Petr; Ding, Y.; Mao, L.; Mao, Z.W.; Qin, P.Z.
2016-01-01
Roč. 55, č. 2 (2016), s. 360-372 ISSN 0006-2960 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : PARAMAGNETIC-RESONANCE SPECTROSCOPY * AMBER FORCE-FIELD * NUCLEIC-ACIDS Subject RIV: BO - Biophysics Impact factor: 2.938, year: 2016
Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer
DEFF Research Database (Denmark)
Opazo, Felipe; Eiden, Laura; Hansen, Line
2015-01-01
cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target...
Ohyama, Ayumu; Higashi, Taishi; Motoyama, Keiichi; Arima, Hidetoshi
2017-06-01
We previously developed a tumor-selective siRNA carrier by preparing polyamidoamine dendrimer (generation 4, G4) conjugates with α-cyclodextrin and folate-polyethylene glycol (Fol-PαC (G4)). In the present study, we developed ternary complexes of Fol-PαC (G4)/siRNA with low-molecular-weight-sacrans to achieve more effective siRNA transfer activity. Among the different molecular-weight sacrans, i.e. sacran 100, 1000 and 10,000 (MW 44,889Da, 943,692Da and 1,488,281Da, respectively), sacran 100 significantly increased the cellular uptake and the RNAi effects of Fol-PαC (G4)/siRNA binary complex with negligible cytotoxicity in KB cells (folate receptor-α positive cells). In addition, the ζ-potential and particle size of Fol-PαC (G4)/siRNA complex were decreased by the ternary complexation with sacran 100. Importantly, the in vivo RNAi effect of the ternary complex after the intravenous administration to tumor-bearing BALB/c mice was significantly higher than that of the binary complex. In conclusion, Fol-PαC (G4)/siRNA/sacran 100 ternary complex has a potential as a novel tumor-selective siRNA delivery system. Copyright © 2017 Elsevier B.V. All rights reserved.
Taylor, Veronica G; Bommarito, Paige A; Tesmer, John J G
2016-03-04
Regulator of G protein signaling (RGS) proteins interact with activated Gα subunits via their RGS domains and accelerate the hydrolysis of GTP. Although the R4 subfamily of RGS proteins generally accepts both Gαi/o and Gαq/11 subunits as substrates, the R7 and R12 subfamilies select against Gαq/11. In contrast, only one RGS protein, RGS2, is known to be selective for Gαq/11. The molecular basis for this selectivity is not clear. Previously, the crystal structure of RGS2 in complex with Gαq revealed a non-canonical interaction that could be due to interfacial differences imposed by RGS2, the Gα subunit, or both. To resolve this ambiguity, the 2.6 Å crystal structure of RGS8, an R4 subfamily member, was determined in complex with Gαq. RGS8 adopts the same pose on Gαq as it does when bound to Gαi3, indicating that the non-canonical interaction of RGS2 with Gαq is due to unique features of RGS2. Based on the RGS8-Gαq structure, residues in RGS8 that contact a unique α-helical domain loop of Gαq were converted to those typically found in R12 subfamily members, and the reverse substitutions were introduced into RGS10, an R12 subfamily member. Although these substitutions perturbed their ability to stimulate GTP hydrolysis, they did not reverse selectivity. Instead, selectivity for Gαq seems more likely determined by whether strong contacts can be maintained between α6 of the RGS domain and Switch III of Gαq, regions of high sequence and conformational diversity in both protein families. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Bhattacharjee, Anukana; Wang, Yongyao; Diao, Jiajie; Price, Carolyn M
2017-12-01
Human CST (CTC1-STN1-TEN1) is a ssDNA-binding complex that helps resolve replication problems both at telomeres and genome-wide. CST resembles Replication Protein A (RPA) in that the two complexes harbor comparable arrays of OB-folds and have structurally similar small subunits. However, the overall architecture and functions of CST and RPA are distinct. Currently, the mechanism underlying CST action at diverse replication issues remains unclear. To clarify CST mechanism, we examined the capacity of CST to bind and resolve DNA structures found at sites of CST activity. We show that CST binds preferentially to ss-dsDNA junctions, an activity that can explain the incremental nature of telomeric C-strand synthesis following telomerase action. We also show that CST unfolds G-quadruplex structures, thus providing a mechanism for CST to facilitate replication through telomeres and other GC-rich regions. Finally, smFRET analysis indicates that CST binding to ssDNA is dynamic with CST complexes undergoing concentration-dependent self-displacement. These findings support an RPA-based model where dissociation and re-association of individual OB-folds allow CST to mediate loading and unloading of partner proteins to facilitate various aspects of telomere replication and genome-wide resolution of replication stress. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Wang, Lusheng; Wang, Yamei; Ding, Zhizhong; Wang, Xiumin
2015-01-01
With the rapid development of wireless networking technologies, the Internet of Things and heterogeneous cellular networks (HCNs) tend to be integrated to form a promising wireless network paradigm for 5G. Hyper-dense sensor and mobile devices will be deployed under the coverage of heterogeneous cells, so that each of them could freely select any available cell covering it and compete for resource with others selecting the same cell, forming a cell selection (CS) game between these devices. Since different types of cells usually share the same portion of the spectrum, devices selecting overlapped cells can experience severe inter-cell interference (ICI). In this article, we study the CS game among a large amount of densely-deployed sensor and mobile devices for their uplink transmissions in a two-tier HCN. ICI is embedded with the traditional congestion game (TCG), forming a congestion game with ICI (CGI) and a congestion game with capacity (CGC). For the three games above, we theoretically find the circular boundaries between the devices selecting the macrocell and those selecting the picocells, indicated by the pure strategy Nash equilibria (PSNE). Meanwhile, through a number of simulations with different picocell radii and different path loss exponents, the collapse of the PSNE impacted by severe ICI (i.e., a large number of picocell devices change their CS preferences to the macrocell) is profoundly revealed, and the collapse points are identified. PMID:26393617
Directory of Open Access Journals (Sweden)
Lusheng Wang
2015-09-01
Full Text Available With the rapid development of wireless networking technologies, the Internet of Things and heterogeneous cellular networks (HCNs tend to be integrated to form a promising wireless network paradigm for 5G. Hyper-dense sensor and mobile devices will be deployed under the coverage of heterogeneous cells, so that each of them could freely select any available cell covering it and compete for resource with others selecting the same cell, forming a cell selection (CS game between these devices. Since different types of cells usually share the same portion of the spectrum, devices selecting overlapped cells can experience severe inter-cell interference (ICI. In this article, we study the CS game among a large amount of densely-deployed sensor and mobile devices for their uplink transmissions in a two-tier HCN. ICI is embedded with the traditional congestion game (TCG, forming a congestion game with ICI (CGI and a congestion game with capacity (CGC. For the three games above, we theoretically find the circular boundaries between the devices selecting the macrocell and those selecting the picocells, indicated by the pure strategy Nash equilibria (PSNE. Meanwhile, through a number of simulations with different picocell radii and different path loss exponents, the collapse of the PSNE impacted by severe ICI (i.e., a large number of picocell devices change their CS preferences to the macrocell is profoundly revealed, and the collapse points are identified.
Zhao, Hui; Wang, Yong-Sheng; Tang, Xian; Zhou, Bin; Xue, Jin-Hua; Liu, Hui; Liu, Shan-Du; Cao, Jin-Xiu; Li, Ming-Hui; Chen, Si-Han
2015-08-05
We report on an enzyme-free and label-free strategy for the ultrasensitive determination of adenosine. A novel multipurpose adenosine aptamer (MAAP) is designed, which serves as an effective target recognition probe and a capture probe for malachite green. In the presence of adenosine, the conformation of the MAAP is converted from a hairpin structure to a G-quadruplex. Upon addition of malachite green into this solution, a noticeable enhancement of resonance light scattering was observed. The signal response is directly proportional to the concentration of adenosine ranging from 75 pM to 2.2 nM with a detection limit of 23 pM, which was 100-10,000 folds lower than those obtained by previous reported methods. Moreover, this strategy has been applied successfully for detecting adenosine in human urine and blood samples, further proving its reliability. The mechanism of adenosine inducing MAAP to form a G-quadruplex was demonstrated by a series of control experiments. Such a MAAP probe can also be used to other strategies such as fluorescence or spectrophotometric ones. We suppose that this strategy can be expanded to develop a universal analytical platform for various target molecules in the biomedical field and clinical diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.
Wang, Xuewei; Qin, Wei
2013-07-22
The determination of peroxidase activities is the basis for enzyme-labeled bioaffinity assays, peroxidase-mimicking DNAzymes- and nanoparticles-based assays, and characterization of the catalytic functions of peroxidase mimetics. Here, a facile, sensitive, and cost-effective solvent polymeric membrane-based peroxidase detection platform is described that utilizes reaction intermediates with different pKa values from those of substrates and final products. Several key but long-debated intermediates in the peroxidative oxidation of o-phenylenediamine (o-PD) have been identified and their charge states have been estimated. By using a solvent polymeric membrane functionalized by an appropriate substituted tetraphenylborate as a receptor, those cationic intermediates could be transferred into the membrane from the aqueous phase to induce a large cationic potential response. Thus, the potentiometric indication of the o-PD oxidation catalyzed by peroxidase or its mimetics can be fulfilled. Horseradish peroxidase has been detected with a detection limit at least two orders of magnitude lower than those obtained by spectrophotometric techniques and traditional membrane-based methods. As an example of peroxidase mimetics, G-quadruplex DNAzymes were probed by the intermediate-sensitive membrane and a label-free thrombin detection protocol was developed based on the catalytic activity of the thrombin-binding G-quadruplex aptamer. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Selection of donor platelets for alloimmunized patients using a platelet-associated IgG assay
International Nuclear Information System (INIS)
Myers, T.J.; Kim, B.K.; Steiner, M.; Baldini, M.G.
1981-01-01
A quantitative immunofluorescence platelet-associated immunoglobulin-G (PA-IgG) assay was used to detect alloimmunity to platelets in 8/12 multitransfused patients and to perform platelet crossmatching in the 8 alloimmunized patients. The correct separation of multitransfused patients into alloimmune and nonalloimmune groups was substantiated with chromium-51-labeled platelet survival studies. For 5 alloimmunized patients, compatible and incompatible donor platelets were demonstrated by PA-IgG crossmatching and were confirmed by platelet survival studies. With the other 3 alloimmunized patients, only Pa-IgG incompatible donor platelets were found. Survival studies with 5 of these incompatible donor platelets showed markedly reduced survival times on 4 occasions. Pa-IgG compatible donor platelets survived 3.5 to 8.7 days, while Pa-IgG incompatible platelets showed survival times of 0.1 to 2.4 days
G-protein coupling of cannabinoid receptors
International Nuclear Information System (INIS)
Glass, M.
2001-01-01
into a conformation that can selectively target one pool of G-proteins over another suggests that agonists could be designed which show greater selectively for one G-protein over another. If the receptor activates several G-protein classes, and one of these pathways leads to specific adverse effects, those adverse effects could be avoided by agonists that direct signalling in favour of more constructive pathways. Given the highly conserved nature of this receptor family, this phenomenon should hold for other GPCRs, therefore characterising this selectivity should advance drug discovery for the numerous disorders and diseases treated through the activation or inhibition of GPCRs. Copyright (2001) Australasian Society of Clinical and Experimental Pharmacologists and Toxicologists
A Selection Method for COTS Systems
DEFF Research Database (Denmark)
Hedman, Jonas
new skills and methods supporting the process of evaluating and selecting information systems. This paper presents a method for selecting COTS systems. The method includes the following phases: problem framing, requirements and appraisal, and selection of systems. The idea and distinguishing feature...... behind the method is that improved understanding of organizational' ends' or goals should govern the selection of a COTS system. This can also be expressed as a match or fit between ‘ends' (e.g. improved organizational effectiveness) and ‘means' (e.g. implementing COTS systems). This way of approaching...
Relationship between post-SARS osteonecrosis and PAI-1 4G/5G gene polymorphisms.
Sun, Wei; Li, Zirong; Shi, Zhengcai; Wang, Bailiang; Gao, Fuqiang; Yang, Yurun; Guo, Wanshou
2014-05-01
To explore the correlation between post-severe acute respiratory symptom (SARS) patients with osteonecrosis, investigate the etiology of post-SARS osteonecrosis and select the sensitive molecular symbols for early diagnosis and distinguish the high-risk population. The studied subjects were divided into two groups. Sixty-two post-SARS patients with osteonecrosis were one group, and 52 age- and sex-matched healthy people were as normal controlled group. Empty stomach blood samples from cubital veins were collected from both groups. Plasminogen activator inhibitor (PAI) by means of enzyme-linked immunosorbent assay and PAI-1 4G/5G polymorphism was detected by polymerase chain reaction and solid phase oligonucleotide assay. The blood agents of post-SARS patients changed obviously with 15.64 ± 13.85 U/ml while the control group 7.96 ± 4.27 U/ml; 4G/4G genotype for the PAI-1 polymorphism detected in post-SARS group was more than that of the control group, but had no statistical significance. The plasma PAI activity was related to homozygote 4G/4G genotype. This reveals that homozygote 4G/4G genotype may be a susceptible gene mark to Chinese osteonecrosis patients. Plasminogen activator inhibitor-1 is sensitive blood symbol for screening high-risk susceptible population; 4G/4G PAI-1 genotype may be an etiological factor in osteonecrosis.
Balana, Bartosz; Maslennikov, Innokentiy; Kwiatkowski, Witek; Stern, Kalyn M.; Bahima, Laia; Choe, Senyon; Slesinger, Paul A.
2011-01-01
G protein-gated inwardly rectifying potassium (GIRK) channels are important gatekeepers of neuronal excitability. The surface expression of neuronal GIRK channels is regulated by the psychostimulant-sensitive sorting nexin 27 (SNX27) protein through a class I (-X-Ser/Thr-X-Φ, where X is any residue and Φ is a hydrophobic amino acid) PDZ-binding interaction. The G protein-insensitive inward rectifier channel (IRK1) contains the same class I PDZ-binding motif but associates with a different synaptic PDZ protein, postsynaptic density protein 95 (PSD95). The mechanism by which SNX27 and PSD95 discriminate these channels was previously unclear. Using high-resolution structures coupled with biochemical and functional analyses, we identified key amino acids upstream of the channel's canonical PDZ-binding motif that associate electrostatically with a unique structural pocket in the SNX27-PDZ domain. Changing specific charged residues in the channel's carboxyl terminus or in the PDZ domain converts the selective association and functional regulation by SNX27. Elucidation of this unique interaction site between ion channels and PDZ-containing proteins could provide a therapeutic target for treating brain diseases. PMID:21422294
Gmeiner, William H; Lema-Tome, Carla; Gibo, Denise; Jennings-Gee, Jamie; Milligan, Carol; Debinski, Waldemar
2014-02-01
F10 is a novel anti-tumor agent with minimal systemic toxicity in vivo and which displays strong cytotoxicity towards glioblastoma (GBM) cells in vitro. Here we investigate the cytotoxicity of F10 towards GBM cells and evaluate the anti-tumor activity of locally-administered F10 towards an orthotopic xenograft model of GBM. The effects of F10 on thymidylate synthase (TS) inhibition and Topoisomerase 1 (Top1) cleavage complex formation were evaluated using TS activity assays and in vivo complex of enzyme bioassays. Cytotoxicity of F10 towards normal brain was evaluated using cortices from embryonic (day 18) mice. F10 displays minimal penetrance of the blood-brain barrier and was delivered by intra-cerebral (i.c.) administration and prospective anti-tumor response towards luciferase-expressing G48a human GBM tumors in nude mice was evaluated using IVIS imaging. Histological examination of tumor and normal brain tissue was used to assess the selectivity of anti-tumor activity. F10 is cytotoxic towards G48a, SNB-19, and U-251 MG GBM cells through dual targeting of TS and Top1. F10 is not toxic to murine primary neuronal cultures. F10 is well-tolerated upon i.c. administration and induces significant regression of G48a tumors that is dose-dependent. Histological analysis from F10-treated mice revealed tumors were essentially completely eradicated in F10-treated mice while vehicle-treated mice displayed substantial infiltration into normal tissue. F10 displays strong efficacy for GBM treatment with minimal toxicity upon i.c. administration establishing F10 as a promising drug-candidate for treating GBM in human patients.
Brasca, Romina; Onaindia, María C.; Goicoechea, Héctor C.; Muñoz de la Peña, Arsenio; Culzoni, María J.
2016-01-01
A method for the detection and quantitation of Hg2+ in aqueous samples by fluorescence spectroscopy is presented. It consists of a turn-on sensor developed by coupling Gold nanoparticles (AuNPs) with the rhodamine 6G derivative FC1, in which the response is generated by a mercury-induced ring-opening reaction. The AuNPs were included in order to improve the sensitivity of the method towards the analyte, maintaining its high selectivity. The method was validated in terms of linearity, precision and accuracy, and applied to the quantitation of Hg2+ in Milli-Q and tap water with and without spiked analyte. The limit of detection and quantitation were 0.15 μg·L−1 and 0.43 μg·L−1, respectively, constituting a substantial improvement of sensitivity in comparison with the previously reported detection of Hg2+ with free FC1. PMID:27782059
International Nuclear Information System (INIS)
Zhou, Dandan; Chen, Hui; Xie, Guoming; Cao, Xianqing; Chen, Xueping; Zhang, Xing
2016-01-01
The authors describe a colorimetric method for the determination of the staphylococcal enterotoxin B (SEB) that also allows for visual readout. The assay is based on the growth of gold nanoparticles (AuNPs) mediated by a hemin/G-quadruplex DNAzyme which generates a color change from red to blue in the presence of SEB. The method is enzyme-free and does not require a label. The kinetics of the formation of the AuNPs is controlled by the hemin/G-quadruplex DNAzyme and this is key to the signal generation mechanism. In the presence of SEB, the reactions between aptamer and target modulated the amount of single probe G strands that form DNAzyme capable of consuming hydrogen peroxide. The growth process of AuNPs is influenced by the resulting concentration of H 2 O 2 and leads to the color change. Under optimal conditions, a linear relationship exists between absorbance and SEB concentration in the range from 0.1 to 500 pg·mL -1 which covers the clinically relevant range. In case of visual detection, the lower limit of detection is 1 pg·mL −1 . The assay described here is sensitive, comparably inexpensive and can detect SEB rapidly without the need for sophisticated equipment. In our perception, the method has a wide scope in that it may be adapted to various nucleic acids, proteins and other biomolecules if respective aptamers are available. (author)
PATH COEFFICIENT ANALYSIS G39×CIHERANG AND MENTIK WANGI×G39 RICE IN F4 GENERATION
Directory of Open Access Journals (Sweden)
Totok Agung D.H.
2014-02-01
Full Text Available Current research was conducted with the objectives to identify the utmost traits that may be beneficial for the higher productivity of the grains on high protein content genotypes lines by path coefficient. Path coefficient can define coefficient correlation directly and indirectly to gain information about nature relationship between yield component and protein content to grain yield. Research material consisted of 61 selected plants from G39×Ciherang and 66 selected plants from Mentik Wangi×G39 at F4 generation. Plants were planted in Banyumas in May 2011. Number of panicles per plant, panicle length, 1000 g of grain weight, percentage of filled grain per panicle, protein content, and grain yield were correlated by using Pearson correlation and were followed by path coefficient. Number of panicles per plant, panicle length, 1000 g of grain weight, percentage filled grain per panicle, and protein content were used as dependent variable, while grain yield was used as independent variable. The result showed that protein content in both populations was not correlated with all yield components. The numbers of panicles, followed by panicle length, had highest positive direct effect to yield. The number of panicle was a positive mediator variable to yield from another variable.
A Biofunctional Molecular Beacon for Detecting Single Base Mutations in Cancer Cells
Directory of Open Access Journals (Sweden)
Haiyan Dong
2016-01-01
Full Text Available The development of a convenient and sensitive biosensing system to detect specific DNA sequences is an important issue in the field of genetic disease therapy. As a classic DNA detection technique, molecular beacon (MB is often used in the biosensing system. However, it has intrinsic drawbacks, including high assay cost, complicated chemical modification, and operational complexity. In this study, we developed a simple and cost-effective label-free multifunctional MB (LMMB by integrating elements of polymerization primer, template, target recognition, and G-quadruplex into one entity to detect target DNA. The core technique was accomplished by introducing a G-hairpin that features fragments of both G-quadruplex and target DNA recognition in the G-hairpin stem. Hybridization between LMMB and target DNA triggered conformational change between the G-hairpin and the common C-hairpin, resulting in significant SYBR-green signal amplification. The hybridization continues to the isothermal circular strand-displacement polymerization and accumulation of the double-stranded fragments, causing the uninterrupted extension of the LMMB without a need of chemical modification and other assistant DNA sequences. The novel and programmable LMMB could detect target DNA with sensitivity at 250 pmol/l with a linear range from 2 to 100 nmol/l and the relative standard deviation of 7.98%. The LMMB could sense a single base mutation from the normal DNA, and polymerase chain reaction (PCR amplicons of the mutant-type cell line from the wild-type one. The total time required for preparation and assaying was only 25 minutes. Apparently, the LMMB shows great potential for detecting DNA and its mutations in biosamples, and therefore it opens up a new prospect for genetic disease therapy.
Reversible Modulation of DNA-Based Hydrogel Shapes by Internal Stress Interactions.
Hu, Yuwei; Kahn, Jason S; Guo, Weiwei; Huang, Fujian; Fadeev, Michael; Harries, Daniel; Willner, Itamar
2016-12-14
We present the assembly of asymmetric two-layer hybrid DNA-based hydrogels revealing stimuli-triggered reversibly modulated shape transitions. Asymmetric, linear hydrogels that include layer-selective switchable stimuli-responsive elements that control the hydrogel stiffness are designed. Trigger-induced stress in one of the layers results in the bending of the linear hybrid structure, thereby minimizing the elastic free energy of the systems. The removal of the stress by a counter-trigger restores the original linear bilayer hydrogel. The stiffness of the DNA hydrogel layers is controlled by thermal, pH (i-motif), K + ion/crown ether (G-quadruplexes), chemical (pH-doped polyaniline), or biocatalytic (glucose oxidase/urease) triggers. A theoretical model relating the experimental bending radius of curvatures of the hydrogels with the Young's moduli and geometrical parameters of the hydrogels is provided. Promising applications of shape-regulated stimuli-responsive asymmetric hydrogels include their use as valves, actuators, sensors, and drug delivery devices.
Directory of Open Access Journals (Sweden)
Peng Zhao
2018-01-01
Full Text Available A compact frequency selective surface (FSS for 5G applications has been designed based on 2.5-dimensional Jerusalem cross. The proposed element consists of two main parts: the successive segments of the metal traces placed alternately on the two surfaces of the substrate and the vertical vias connecting traces. Compared with previous published two-dimensional miniaturized elements, the transmission curves indicate a significant size reduction (1/26 wavelengths at the resonant frequency and exhibit good angular and polarization stabilities. Furthermore, a general equivalent circuit model is established to provide direct physical insight into the operating principle of this FSS. A prototype of the proposed FSS has been fabricated and measured, and the results validate this design.
LiCABEDS II. Modeling of ligand selectivity for G-protein-coupled cannabinoid receptors.
Ma, Chao; Wang, Lirong; Yang, Peng; Myint, Kyaw Z; Xie, Xiang-Qun
2013-01-28
The cannabinoid receptor subtype 2 (CB2) is a promising therapeutic target for blood cancer, pain relief, osteoporosis, and immune system disease. The recent withdrawal of Rimonabant, which targets another closely related cannabinoid receptor (CB1), accentuates the importance of selectivity for the development of CB2 ligands in order to minimize their effects on the CB1 receptor. In our previous study, LiCABEDS (Ligand Classifier of Adaptively Boosting Ensemble Decision Stumps) was reported as a generic ligand classification algorithm for the prediction of categorical molecular properties. Here, we report extension of the application of LiCABEDS to the modeling of cannabinoid ligand selectivity with molecular fingerprints as descriptors. The performance of LiCABEDS was systematically compared with another popular classification algorithm, support vector machine (SVM), according to prediction precision and recall rate. In addition, the examination of LiCABEDS models revealed the difference in structure diversity of CB1 and CB2 selective ligands. The structure determination from data mining could be useful for the design of novel cannabinoid lead compounds. More importantly, the potential of LiCABEDS was demonstrated through successful identification of newly synthesized CB2 selective compounds.
RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP
Czech Academy of Sciences Publication Activity Database
Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Yodh, J.G.; Balci, H.
2014-01-01
Roč. 42, č. 18 (2014), 11528–11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation(US) 1430124 Institutional support: RVO:68378050 Keywords : Bloom helicase * ATP * Gquadruplex (GQ) structure * GQ destabilization Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014
Stephen Neidle on cancer therapy and G-quadruplex inhibitors. Interview by Joanna De Souza.
Neidle, Stephen
2004-09-15
Stephen Neidle was educated at Imperial College, London, where he graduated in chemistry and then proceeded to do a PhD in crystallography. After a period as an ICI Fellow, he joined the Biophysics Department at King's College, which ignited his interest in nucleic acid structural studies. He was appointed as one of the first Cancer Research Campaign Career Development Awardees, becoming a Life Fellow on moving to the Institute of Cancer Research. He was appointed to the Chair of Biophysics at the Institute of Cancer Research in 1990, and moved to the new Chair of Chemical Biology at the School of Pharmacy in the University of London in 2002, where he also directs the Cancer Research UK Biomolecular Structure Group. He is currently Chairman of the Chemical Biology Forum of the Royal Society of Chemistry, which is involved in developing the interface between chemistry and the life sciences. He will shortly assume the Directorship of the newly-established Centre for Cancer Medicines at the School. Stephen Neidle has received several awards for his work on drug-nucleic acid recognition and drug design, including the 2000 prize of the Biological and Medicinal Chemistry Sector of the Royal Society of Chemistry, and its 2002 Interdisciplinary Award. He was the 2004 Paul Ehrlich Lecturer of the French Societé de Chimie Therapeutique, and was recently awarded the 2004 Aventis Prize in Medicinal Chemistry.
Huang, Xiangao; Di Liberto, Maurizio; Jayabalan, David; Liang, Jun; Ely, Scott; Bretz, Jamieson; Shaffer, Arthur L.; Louie, Tracey; Chen, Isan; Randolph, Sophia; Hahn, William C.; Staudt, Louis M.; Niesvizky, Ruben; Moore, Malcolm A. S.
2012-01-01
Dysregulation of cyclin-dependent kinase 4 (CDK4) and CDK6 by gain of function or loss of inhibition is common in human cancer, including multiple myeloma, but success in targeting CDK with broad-spectrum inhibitors has been modest. By selective and reversible inhibition of CDK4/CDK6, we have developed a strategy to both inhibit proliferation and enhance cytotoxic killing of cancer cells. We show that induction of prolonged early-G1 arrest (pG1) by CDK4/CDK6 inhibition halts gene expression in early-G1 and prevents expression of genes programmed for other cell-cycle phases. Removal of the early-G1 block leads to S-phase synchronization (pG1-S) but fails to completely restore scheduled gene expression. Consequently, the IRF4 protein required to protect myeloma cells from apoptosis is markedly reduced in pG1 and further in pG1-S in response to cytotoxic agents, such as the proteasome inhibitor bortezomib. The coordinated loss of IRF4 and gain of Bim sensitize myeloma tumor cells to bortezomib-induced apoptosis in pG1 in the absence of Noxa and more profoundly in pG1-S in cooperation with Noxa in vitro. Induction of pG1 and pG1-S by reversible CDK4/CDK6 inhibition further augments tumor-specific bortezomib killing in myeloma xenografts. Reversible inhibition of CDK4/CDK6 in sequential combination therapy thus represents a novel mechanism-based cancer therapy. PMID:22718837
Huang, Xiangao; Di Liberto, Maurizio; Jayabalan, David; Liang, Jun; Ely, Scott; Bretz, Jamieson; Shaffer, Arthur L; Louie, Tracey; Chen, Isan; Randolph, Sophia; Hahn, William C; Staudt, Louis M; Niesvizky, Ruben; Moore, Malcolm A S; Chen-Kiang, Selina
2012-08-02
Dysregulation of cyclin-dependent kinase 4 (CDK4) and CDK6 by gain of function or loss of inhibition is common in human cancer, including multiple myeloma, but success in targeting CDK with broad-spectrum inhibitors has been modest. By selective and reversible inhibition of CDK4/CDK6, we have developed a strategy to both inhibit proliferation and enhance cytotoxic killing of cancer cells. We show that induction of prolonged early-G(1) arrest (pG1) by CDK4/CDK6 inhibition halts gene expression in early-G(1) and prevents expression of genes programmed for other cell-cycle phases. Removal of the early-G(1) block leads to S-phase synchronization (pG1-S) but fails to completely restore scheduled gene expression. Consequently, the IRF4 protein required to protect myeloma cells from apoptosis is markedly reduced in pG1 and further in pG1-S in response to cytotoxic agents, such as the proteasome inhibitor bortezomib. The coordinated loss of IRF4 and gain of Bim sensitize myeloma tumor cells to bortezomib-induced apoptosis in pG1 in the absence of Noxa and more profoundly in pG1-S in cooperation with Noxa in vitro. Induction of pG1 and pG1-S by reversible CDK4/CDK6 inhibition further augments tumor-specific bortezomib killing in myeloma xenografts. Reversible inhibition of CDK4/CDK6 in sequential combination therapy thus represents a novel mechanism-based cancer therapy.
The G72/G30 gene complex and cognitive abnormalities in schizophrenia.
Goldberg, Terry E; Straub, Richard E; Callicott, Joseph H; Hariri, Ahmad; Mattay, Venkata S; Bigelow, Llewellyn; Coppola, Richard; Egan, Michael F; Weinberger, Daniel R
2006-09-01
A recently discovered gene complex, G72/G30 (hereafter G72, but now termed DAOA), was found to be associated with schizophrenia and with bipolar disorder, possibly because of an indirect effect on NMDA neurotransmission. In principle, if G72 increases risk for psychosis by this mechanism, it might impact with greater penetrance those cortically based cognitive and neurophysiological functions associated with NMDA signaling. We performed two independent family-based association studies (one sample contained more than 200 families and the other more than 65) of multiple SNPs in the G72 region and of multiple SNPs in the gene for D-amino acid oxidase (DAAO), which may be modulated by G72. We examined the relationship between select cognitive measures in attention, working memory, and episodic memory and a restricted set of G72 SNPs in over 600 normal controls, schizophrenic patients, and their nonpsychotic siblings using mixed model ANOVAs. We also determined genotype effects on neurophysiology measures in normal controls using the fMRI BOLD response obtained during activation procedures involving either episodic memory or working memory. There were no significant single G72 SNP associations and clinical diagnosis in either sample, though one approached significance (p=0.06). Diagnosis by genotype interaction effects for G72 SNP 10 were significant for cognitive variables assessing working memory and attention (p=0.05), and at the trend level for episodic memory, such that in the schizophrenia group an exaggerated allele load effect in the predicted directions was observed. In the fMRI paradigms, a strong effect of G72 SNP 10 genotype was observed on BOLD activation in the hippocampus during the episodic memory paradigm. Tests of association with DAAO were consistently nonsignificant. We present evidence that SNP variations in the G72 gene region increase risk of cognitive impairment in schizophrenia. SNP variations were not strongly associated with clinical diagnosis
Ramadhaningtyas, Dillani Putri; Aryana, Nurhani; Aristiawan, Yosi; Styarini, Dyah
2017-11-01
The optimization of instrument condition and chromatographic separation for analysis of aflatoxin B1, B2, G1 and G2 using liquid chromatography tandem with mass spectrometer detector was conducted in the aim to provide more accurate and reliable analysis results. The aflatoxin known to be serious threat for human health as it is classified as the carcinogenic compounds. The aflatoxin B1, B2, G1 and G2 were selected due to its extensive contamination in various agricultural commodities. The best chromatographic separation was obtained using C-18 column with gradient elution of solvent 5 mM ammonium acetate and 0.1% formic acid in methanol at 7 minutes runtime analysis. The linearity of the detector showed satisfied results as the coefficient determination found to be 0.9994, 0.9996, 0.9998 and 0.9987 for aflatoxin B1, G1, B2, and G2 respectively in the range concentration from 1 to 20 ng/g. The quantifier ion selected for the aflatoxin B1, B2, G1 and G2 was m/z 285.1, 259, 243 and 313 respectively. The instrument precision at these quantifier ions also showed satisfied result with %RSD was around 3.4 to 6.8%. The optimized method present in this study can be used for further sample analysis.
Tang, Xian; Wang, Yong-Sheng; Xue, Jin-Hua; Zhou, Bin; Cao, Jin-Xiu; Chen, Si-Han; Li, Ming-Hui; Wang, Xiao-Feng; Zhu, Yu-Feng; Huang, Yan-Qin
2015-03-25
A novel strategy for dual-channel detection of metallothioneins (MTs) and Hg(2+) has been proposed. In the absence of Hg(2+), the functional chimera aptamer (FCA) designed can form an intact G-quadruplex with flexibility, which was demonstrated to have peroxidase-like activities upon hemin binding. In the presence of Hg(2+), the formation of T-Hg(2+)-T complex results in the conformational switching of FCA, which lost the peroxidase-like activities and cannot catalyze the oxidation of ABTS by H2O2. Upon addition of MTs in this solution, MTs could interact with Hg(2+) to form a MTs-Hg(2+) complex, leading to the recovery of the G-quadruplex DNAzyme. The color and absorbance of the sensing system were also changed accordingly. In the optimizing condition, ΔA was directly proportional to the concentration ranging from 8.84 nM to 1.0 μM for Hg(2+), and 7.82 nM to 0.462 μM for MTs with the detection limits of 2.65 nM and 2.34 nM, respectively. The proposed dual-channel method avoids the label steps in common methods, and allows direct analysis of the samples without costly instruments, and is reliable, inexpensive and sensitive. Copyright © 2015 Elsevier B.V. All rights reserved.
Molecular cloning and differential IgG responses to a histidine-rich ...
African Journals Online (AJOL)
C1 immunoglobulin G (IgG) subclass levels were assessed by ELISA in 15 pairs and 18 pairs of selected and cross-matched infected and putatively immune subjects from Cameroon and Ecuador, respectively. IgG3 and IgG4 levels were shown to be significantly higher in putatively immune (immune protected) subjects.
Effect of bleomycin and irradiation on G2 progression
International Nuclear Information System (INIS)
Kimler, B.F.
1979-01-01
The interaction of bleomycin and x-irradiation on the induction of G 2 delay in Chinese hamster ovary cells was investigated utilizing the mitotic selection procedure for cell cycle analysis. Following the addition of BLM, the number of cells selected in mitosis remained at control level for a refractory period and then decreased. The location of the transition point, i.e., the age in G 2 at which cells become refractory to a progression blockade, was concentration-dependent, ranging from the S/G 2 boundary at low concentrations to the G 2 /M boundary at high concentrations. Depending upon the concentration of the drug used and the duration of exposure, the mitotic rate either decreased to zero or else leveled off at some intermediate value and then recovered to the control level. The duration of BLM-induced division delay was thus dependent upon the concentration used and the duration of exposure. When cells were treated with pulses of bleomycin (10-500 μg/ml) in addition to x-irradiation, the mitotic rate declined as with exposure to x-ray alone. However, the recovery from radiation-induced division delay and the subsequent reappearance of mitotic cells in the selection window was delayed until the cells had recovered from their BLM-induced division delay. This implies that, in contrast to the synergistic effects observed for cell lethality, BLM and radiation do not interact in the production of a progression blockade and the resultant division delay
International Nuclear Information System (INIS)
D'Anna, J.A.; Thayer, M.M.; Tobey, R.A.; Gurley, L.R.
1985-01-01
The authors have employed high-performance liquid chromatography (HPLC) to investigate the syntheses of histones H1 and H1o as synchronized cells traverse from mitosis to S phase. Chinese hamster (line CHO) cells were synchronized by mitotic selection, and, at appropriate times, they were pulse labeled for 1 h with [ 3 H]lysine. Histones H1 and H1o were extracted by blending radiolabeled and carrier cells directly in 0.83 M HC1O 4 ; the total HC1O 4 -soluble, Cl 3 CCO 2 H-precipitable proteins were then separated by a modification of an HPLC system employing three mu Bondapak reversed-phase columns. These procedures (1) produce minimally perturbed populations of synchronized proliferating cells and (2) maximize the recovery of radiolabeled histones during isolation and analysis. Measurements of rates of synthesis indicate that the rate of H1 synthesis increases as cells traverse from early to mid G1; as cells enter S phase, the rate of H1 synthesis increases an additional congruent to 22-fold and is proportional to the number of S-phase cells. In contrast to H1, the rate of H1o synthesis is nearly constant throughout G1. As cells progress into S phase, the rate of H1o synthesis increases so that it also appears to be proportional to the number of S-phase cells. Except for the first 1-2 h after mitotic selection, these results are similar to those obtained when cells are synchronized in G1 with the isoleucine deprivation procedure
Dijksterhuis, J P; Petersen, J; Schulte, G
2014-01-01
The wingless/int1 (WNT)/Frizzled (FZD) signalling pathway controls numerous cellular processes such as proliferation, differentiation, cell-fate decisions, migration and plays a crucial role during embryonic development. Nineteen mammalian WNTs can bind to 10 FZDs thereby activating different downstream pathways such as WNT/β-catenin, WNT/planar cell polarity and WNT/Ca2+. However, the mechanisms of signalling specification and the involvement of heterotrimeric G proteins are still unclear. Disturbances in the pathways can lead to various diseases ranging from cancer, inflammatory diseases to metabolic and neurological disorders. Due to the presence of seven-transmembrane segments, evidence for coupling between FZDs and G proteins and substantial structural differences in class A, B or C GPCRs, FZDs were grouped separately in the IUPHAR GPCR database as the class FZD within the superfamily of GPCRs. Recently, important progress has been made pointing to a direct activation of G proteins after WNT stimulation. WNT/FZD and G protein coupling remain to be fully explored, although the basic observation supporting the nature of FZDs as GPCRs is compelling. Because the involvement of different (i) WNTs; (ii) FZDs; and (iii) intracellular binding partners could selectively affect signalling specification, in this review we present the current understanding of receptor/ligand selectivity of FZDs and WNTs. We pinpoint what is known about signalling specification and the physiological relevance of these interactions with special emphasis on FZD–G protein interactions. LINKED ARTICLESThis article is part of a themed section on Molecular Pharmacology of GPCRs. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2014.171.issue-5 PMID:24032637
Rhenium-186 direct labelling HIgG
International Nuclear Information System (INIS)
Lungu, V.; Mihailescu, G.; Dumitrescu, G.
2001-01-01
The aim of this study is to develop and improve existing radiolabelling techniques of peptides and monoclonal antibodies with 186 Re for achievement of potential agents for cancer targeted radiotherapy. There were selected methods and techniques for the direct labelling of intact HIgG by studding chemical and radiochemical processes of -S-S- bridges prereduction, reduction of 186 ReO 4 - and coupling reaction of rhenium with HIgG. The -S-S- bridges prereduction of HIgG to sulfhydryls was effected using different reducing agents: ascorbic acid, 2,3 dimercaptopropanol, cysteine, active hydrogen. The prereduction reactions are controlled by masic ratios of HIgG/reduction agent, pH, temperature and time of incubation. A pH=4.5 and a 24 hours incubation time are in the advantage of the prereduction yield. The labelling with 186 Re of prereduced HIgG with ascorbic acid or active hydrogen and 37 deg. C incubation in 22 hours releases 92% radiochemical purity. (author)
DNA Replication Dynamics of the GGGGCC Repeat of the C9orf72 Gene.
Thys, Ryan Griffin; Wang, Yuh-Hwa
2015-11-27
DNA has the ability to form a variety of secondary structures in addition to the normal B-form DNA, including hairpins and quadruplexes. These structures are implicated in a number of neurological diseases and cancer. Expansion of a GGGGCC repeat located at C9orf72 is associated with familial amyotrophic lateral sclerosis and frontotemporal dementia. This repeat expands from two to 24 copies in normal individuals to several hundreds or thousands of repeats in individuals with the disease. Biochemical studies have demonstrated that as little as four repeats have the ability to form a stable DNA secondary structure known as a G-quadruplex. Quadruplex structures have the ability to disrupt normal DNA processes such as DNA replication and transcription. Here we examine the role of GGGGCC repeat length and orientation on DNA replication using an SV40 replication system in human cells. Replication through GGGGCC repeats leads to a decrease in overall replication efficiency and an increase in instability in a length-dependent manner. Both repeat expansions and contractions are observed, and replication orientation is found to influence the propensity for expansions or contractions. The presence of replication stress, such as low-dose aphidicolin, diminishes replication efficiency but has no effect on instability. Two-dimensional gel electrophoresis analysis demonstrates a replication stall with as few as 20 GGGGCC repeats. These results suggest that replication of the GGGGCC repeat at C9orf72 is perturbed by the presence of expanded repeats, which has the potential to result in further expansion, leading to disease. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Claudia Trigo Pedroso Moraes
2015-02-01
Full Text Available Human respiratory syncytial virus (HRSV is an important respiratory pathogens among children between zero-five years old. Host immunity and viral genetic variability are important factors that can make vaccine production difficult. In this work, differences between biological clones of HRSV were detected in clinical samples in the absence and presence of serum collected from children in the convalescent phase of the illness and from their biological mothers. Viral clones were selected by plaque assay in the absence and presence of serum and nucleotide sequences of the G2 and F2 genes of HRSV biological clones were compared. One non-synonymous mutation was found in the F gene (Ile5Asn in one clone of an HRSV-B sample and one non-synonymous mutation was found in the G gene (Ser291Pro in four clones of the same HRSV-B sample. Only one of these clones was obtained after treatment with the child's serum. In addition, some synonymous mutations were determined in two clones of the HRSV-A samples. In conclusion, it is possible that minor sequences could be selected by host antibodies contributing to the HRSV evolutionary process, hampering the development of an effective vaccine, since we verify the same codon alteration in absence and presence of human sera in individual clones of BR-85 sample.
Moraes, Claudia Trigo Pedroso; Oliveira, Danielle Bruna Leal; Campos, Angelica Cristine Almeida; Bosso, Patricia Alves; Lima, Hildener Nogueira; Stewien, Klaus Eberhard; Gilio, Alfredo Elias; Vieira, Sandra Elisabete; Botosso, Viviane Fongaro; Durigon, Edison Luiz
2015-02-01
Human respiratory syncytial virus (HRSV) is an important respiratory pathogens among children between zero-five years old. Host immunity and viral genetic variability are important factors that can make vaccine production difficult. In this work, differences between biological clones of HRSV were detected in clinical samples in the absence and presence of serum collected from children in the convalescent phase of the illness and from their biological mothers. Viral clones were selected by plaque assay in the absence and presence of serum and nucleotide sequences of the G2 and F2 genes of HRSV biological clones were compared. One non-synonymous mutation was found in the F gene (Ile5Asn) in one clone of an HRSV-B sample and one non-synonymous mutation was found in the G gene (Ser291Pro) in four clones of the same HRSV-B sample. Only one of these clones was obtained after treatment with the child's serum. In addition, some synonymous mutations were determined in two clones of the HRSV-A samples. In conclusion, it is possible that minor sequences could be selected by host antibodies contributing to the HRSV evolutionary process, hampering the development of an effective vaccine, since we verify the same codon alteration in absence and presence of human sera in individual clones of BR-85 sample.
Pediatric Academic Productivity: Pediatric Benchmarks for the h- and g-Indices.
Tschudy, Megan M; Rowe, Tashi L; Dover, George J; Cheng, Tina L
2016-02-01
To describe h- and g-indices benchmarks in pediatric subspecialties and general academic pediatrics. Academic productivity is measured increasingly through bibliometrics that derive a statistical enumeration of academic output and impact. The h- and g-indices incorporate the number of publications and citations. Benchmarks for pediatrics have not been reported. Thirty programs were selected randomly from pediatric residency programs accredited by the Accreditation Council for Graduate Medical Education. The h- and g-indices of department chairs were calculated. For general academic pediatrics, pediatric gastroenterology, and pediatric nephrology, a random sample of 30 programs with fellowships were selected. Within each program, an MD faculty member from each academic rank was selected randomly. Google Scholar via Harzing's Publish or Perish was used to calculate the h-index, g-index, and total manuscripts. Only peer-reviewed and English language publications were included. For Chairs, calculations from Google Scholar were compared with Scopus. For all specialties, the mean h- and g-indices significantly increased with academic rank (all P calculation using different bibliographic databases only differed by ±1. Mean h-indices increased with academic rank and were not significantly different across the pediatric specialties. Benchmarks for h- and g-indices in pediatrics are provided and may be one measure of academic productivity and impact. Copyright © 2016 Elsevier Inc. All rights reserved.
Cheng, Rui; Tao, Mangjuan; Shi, Zhilu; Zhang, Xiafei; Jin, Yan; Li, Baoxin
2015-11-15
Several fluorescence signal amplification strategies have been developed for sensitive detection of T4 polynucleotide kinase (T4 PNK) activity, but they need fluorescence dye labeled DNA probe. We have addressed the limitation and report here a label-free strategy for sensitive detection of PNK activity by coupling DNA strand displacement reaction with enzymatic-aided amplification. A hairpin oligonucleotide (hpDNA) with blunt ends was used as the substrate for T4 PNK phosphorylation. In the presence of T4 PNK, the stem of hpDNA was phosphorylated and further degraded by lambda exonuclease (λ exo) from 5' to 3' direction to release a single-stranded DNA as a trigger of DNA strand displacement reaction (SDR). The trigger DNA can continuously displace DNA P2 from P1/P2 hybrid with the help of specific cleavage of nicking endonuclease (Nt.BbvCI). Then, DNA P2 can form G-quadruplex in the presence of potassium ions and quadruplex-selective fluorphore, N-methyl mesoporphyrin IX (NMM), resulting in a significant increase in fluorescence intensity of NMM. Thus, the accumulative release of DNA P2 led to fluorescence signal amplification for determining T4 PNK activity with a detection limit of 6.6×10(-4) U/mL, which is superior or comparative with established approaches. By ingeniously utilizing T4 PNK-triggered DNA SDR, T4 PNK activity can be specifically and facilely studied in homogeneous solution containing complex matrix without any external fluorescence labeling. Moreover, the influence of different inhibitors on the T4 PNK activity revealed that it also can be explored to screen T4 PNK inhibitors. Therefore, this label-free amplification strategy presents a facile and cost-effective approach for nucleic acid phosphorylation related research. Copyright © 2015 Elsevier B.V. All rights reserved.
Personality, personnel selection, and job performance
Linden, Dimitri; Pelt, Dirk; Dunkel, Curtis; Born, Marise
2017-01-01
markdownabstractJob Performance: The term job performance can either refer to the objective or subjective outcomes one achieves in a specific job (e.g., the profit of a sales persons, the number of publications of a scientist, the number of successful operations of a surgeon) or to work-related activities (e.g., writing an article, conducting specific surgical acts). In the majority of research on this topic, job performance as an outcome is used. Personnel selection: Personnel selection refe...
Efficacy of Substance Removal by Immunoadsorption With a Selective Plasma Separator.
Hanafusa, Norio; Yamamoto, Hiroko; Tamachi, Masaki; Torato, Toshihiro; Sakurai, Satoko; Tsuchiya, Ken; Nitta, Kosaku; Nangaku, Masaomi
2017-06-01
Immunoadsorption with a tryptophan-conjugated column has a limited capacity and reduces fibrinogen. We speculated that immunoadsorption with a selective plasma separator has higher efficiency in removing immunoglobulins than ordinary immunoadsorption without affecting coagulation factors. This study investigated the efficacy of immunoadsorption with a selective plasma separator in vitro. The sieving coefficients, the pool concentration, and the adsorbed amount were investigated serially with up to 5 L of processed plasma. The sieving coefficients of the selective plasma separator were 0.8, 0.5, and 0.1 for albumin, immunoglobulin G (IgG), and factor 13, respectively. The trend of concentrations for the ordinary plasma separator in the pool reached its nadir at 1.5 L and 3.5 L of plasma processed for IgG, IgG1, or IgG2, and IgG3, respectively. However, the volume was doubled for the selective plasma separator. The trends of fibrinogen and factor 13 concentrations differed significantly between two plasma separators. The trends of the absorbed amount were mirror images of the concentration in the pool. Comparison of the peak amount absorbed indicated that the amounts were almost identical between the two separators for IgG, IgG1, and IgG2. On the other hand, the peak amounts were less for albumin, fibrinogen, and IgG3 with the selective plasma separator than with the ordinary separator. Although further investigations about bradykinin are required, immunoadsorption with the selective plasma separator supports the administration of more frequent and intensive treatments to remove IgG1 or IgG2 without affecting coagulation factors. © 2017 International Society for Apheresis, Japanese Society for Apheresis, and Japanese Society for Dialysis Therapy.
Video Quality Prediction over Wireless 4G
Lau, Chun Pong
2013-04-14
In this paper, we study the problem of video quality prediction over the wireless 4G network. Video transmission data is collected from a real 4G SCM testbed for investigating factors that affect video quality. After feature transformation and selection on video and network parameters, video quality is predicted by solving as regression problem. Experimental results show that the dominated factor on video quality is the channel attenuation and video quality can be well estimated by our models with small errors.
Video Quality Prediction over Wireless 4G
Lau, Chun Pong; Zhang, Xiangliang; Shihada, Basem
2013-01-01
In this paper, we study the problem of video quality prediction over the wireless 4G network. Video transmission data is collected from a real 4G SCM testbed for investigating factors that affect video quality. After feature transformation and selection on video and network parameters, video quality is predicted by solving as regression problem. Experimental results show that the dominated factor on video quality is the channel attenuation and video quality can be well estimated by our models with small errors.
Thrombin–aptamer recognition: a revealed ambiguity
Russo Krauss, Irene; Merlino, Antonello; Giancola, Concetta; Randazzo, Antonio; Mazzarella, Lelio; Sica, Filomena
2011-01-01
Aptamers are structured oligonucleotides that recognize molecular targets and can function as direct protein inhibitors. The best-known example is the thrombin-binding aptamer, TBA, a single-stranded 15-mer DNA that inhibits the activity of thrombin, the key enzyme of coagulation cascade. TBA folds as a G-quadruplex structure, as proved by its NMR structure. The X-ray structure of the complex between TBA and human α-thrombin was solved at 2.9-Å resolution, but did not provide details of the a...
Teaching Animal Habitat Selection Using Wildlife Tracking Equipment
Laskowski, Jessica; Gillespie, Caitlyn; Corral, Lucia; Oden, Amy; Fricke, Kent; Fontaine, Joseph J.
2016-01-01
We present a hands-on outdoor activity coupled with classroom discussion to teach students about wildlife habitat selection, the process by which animals choose where to live. By selecting locations or habitats with many benefits (e.g., food, shelter, mates) and few costs (e.g., predators), animals improve their ability to survive and reproduce.…
Principles and determinants of G-protein coupling by the rhodopsin-like thyrotropin receptor.
Directory of Open Access Journals (Sweden)
Gunnar Kleinau
Full Text Available In this study we wanted to gain insights into selectivity mechanisms between G-protein-coupled receptors (GPCR and different subtypes of G-proteins. The thyrotropin receptor (TSHR binds G-proteins promiscuously and activates both Gs (cAMP and Gq (IP. Our goal was to dissect selectivity patterns for both pathways in the intracellular region of this receptor. We were particularly interested in the participation of poorly investigated receptor parts.We systematically investigated the amino acids of intracellular loop (ICL 1 and helix 8 using site-directed mutagenesis alongside characterization of cAMP and IP accumulation. This approach was guided by a homology model of activated TSHR in complex with heterotrimeric Gq, using the X-ray structure of opsin with a bound G-protein peptide as a structural template.We provide evidence that ICL1 is significantly involved in G-protein activation and our model suggests potential interactions with subunits G alpha as well as G betagamma. Several amino acid substitutions impaired both IP and cAMP accumulation. Moreover, we found a few residues in ICL1 (L440, T441, H443 and helix 8 (R687 that are sensitive for Gq but not for Gs activation. Conversely, not even one residue was found that selectively affects cAMP accumulation only. Together with our previous mutagenesis data on ICL2 and ICL3 we provide here the first systematically completed map of potential interfaces between TSHR and heterotrimeric G-protein. The TSHR/Gq-heterotrimer complex is characterized by more selective interactions than the TSHR/Gs complex. In fact the receptor interface for binding Gs is a subset of that for Gq and we postulate that this may be true for other GPCRs coupling these G-proteins. Our findings support that G-protein coupling and preference is dominated by specific structural features at the intracellular region of the activated GPCR but is completed by additional complementary recognition patterns between receptor and G
Principles and determinants of G-protein coupling by the rhodopsin-like thyrotropin receptor.
Kleinau, Gunnar; Jaeschke, Holger; Worth, Catherine L; Mueller, Sandra; Gonzalez, Jorge; Paschke, Ralf; Krause, Gerd
2010-03-18
In this study we wanted to gain insights into selectivity mechanisms between G-protein-coupled receptors (GPCR) and different subtypes of G-proteins. The thyrotropin receptor (TSHR) binds G-proteins promiscuously and activates both Gs (cAMP) and Gq (IP). Our goal was to dissect selectivity patterns for both pathways in the intracellular region of this receptor. We were particularly interested in the participation of poorly investigated receptor parts.We systematically investigated the amino acids of intracellular loop (ICL) 1 and helix 8 using site-directed mutagenesis alongside characterization of cAMP and IP accumulation. This approach was guided by a homology model of activated TSHR in complex with heterotrimeric Gq, using the X-ray structure of opsin with a bound G-protein peptide as a structural template.We provide evidence that ICL1 is significantly involved in G-protein activation and our model suggests potential interactions with subunits G alpha as well as G betagamma. Several amino acid substitutions impaired both IP and cAMP accumulation. Moreover, we found a few residues in ICL1 (L440, T441, H443) and helix 8 (R687) that are sensitive for Gq but not for Gs activation. Conversely, not even one residue was found that selectively affects cAMP accumulation only. Together with our previous mutagenesis data on ICL2 and ICL3 we provide here the first systematically completed map of potential interfaces between TSHR and heterotrimeric G-protein. The TSHR/Gq-heterotrimer complex is characterized by more selective interactions than the TSHR/Gs complex. In fact the receptor interface for binding Gs is a subset of that for Gq and we postulate that this may be true for other GPCRs coupling these G-proteins. Our findings support that G-protein coupling and preference is dominated by specific structural features at the intracellular region of the activated GPCR but is completed by additional complementary recognition patterns between receptor and G-protein subtypes.
Sepe, Valentina; Renga, Barbara; Festa, Carmen; D'Amore, Claudio; Masullo, Dario; Cipriani, Sabrina; Di Leva, Francesco Saverio; Monti, Maria Chiara; Novellino, Ettore; Limongelli, Vittorio; Zampella, Angela; Fiorucci, Stefano
2014-09-25
Bile acids are signaling molecules interacting with the nuclear receptor FXR and the G-protein coupled receptor 1 (GP-BAR1/TGR5). GP-BAR1 is a promising pharmacological target for the treatment of steatohepatitis, type 2 diabetes, and obesity. Endogenous bile acids and currently available semisynthetic bile acids are poorly selective toward GP-BAR1 and FXR. Thus, in the present study we have investigated around the structure of UDCA, a clinically used bile acid devoid of FXR agonist activity, to develop a large family of side chain modified 3α,7β-dihydroxyl cholanoids that selectively activate GP-BAR1. In vivo and in vitro pharmacological evaluation demonstrated that administration of compound 16 selectively increases the expression of pro-glucagon 1, a GP-BAR1 target, in the small intestine, while it had no effect on FXR target genes in the liver. Further, compound 16 results in a significant reshaping of bile acid pool in a rodent model of cholestasis. These data demonstrate that UDCA is a useful scaffold to generate novel and selective steroidal ligands for GP-BAR1.
Long, Feng; Zhu, Anna; Wang, Hongchen
2014-11-07
Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.
Potent and Selective Peptide-based Inhibition of the G Protein Gαq*
Charpentier, Thomas H.; Waldo, Gary L.; Lowery-Gionta, Emily G.; Krajewski, Krzysztof; Strahl, Brian D.; Kash, Thomas L.; Harden, T. Kendall; Sondek, John
2016-01-01
In contrast to G protein-coupled receptors, for which chemical and peptidic inhibitors have been extensively explored, few compounds are available that directly modulate heterotrimeric G proteins. Active Gαq binds its two major classes of effectors, the phospholipase C (PLC)-β isozymes and Rho guanine nucleotide exchange factors (RhoGEFs) related to Trio, in a strikingly similar fashion: a continuous helix-turn-helix of the effectors engages Gαq within its canonical binding site consisting of a groove formed between switch II and helix α3. This information was exploited to synthesize peptides that bound active Gαq in vitro with affinities similar to full-length effectors and directly competed with effectors for engagement of Gαq. A representative peptide was specific for active Gαq because it did not bind inactive Gαq or other classes of active Gα subunits and did not inhibit the activation of PLC-β3 by Gβ1γ2. In contrast, the peptide robustly prevented activation of PLC-β3 or p63RhoGEF by Gαq; it also prevented G protein-coupled receptor-promoted neuronal depolarization downstream of Gαq in the mouse prefrontal cortex. Moreover, a genetically encoded form of this peptide flanked by fluorescent proteins inhibited Gαq-dependent activation of PLC-β3 at least as effectively as a dominant-negative form of full-length PLC-β3. These attributes suggest that related, cell-penetrating peptides should effectively inhibit active Gαq in cells and that these and genetically encoded sequences may find application as molecular probes, drug leads, and biosensors to monitor the spatiotemporal activation of Gαq in cells. PMID:27742837
Selection Method for COTS Systems
DEFF Research Database (Denmark)
Hedman, Jonas; Andersson, Bo
2014-01-01
feature behind the method is that improved understanding of organizational ‘ends’ or goals should govern the selection of a COTS system. This can also be expressed as a match or fit between ‘ends’ (e.g. improved organizational effectiveness) and ‘means’ (e.g. implementing COTS systems). This way...
Woo, Ho-Hyung; Baker, Terri; Laszlo, Csaba; Chambers, Setsuko K.
2013-01-01
CSF-1 mRNA 3′UTR contains multiple unique motifs, including a common microRNA (miRNA) target in close proximity to a noncanonical G-quadruplex and AU-rich elements (AREs). Using a luciferase reporter system fused to CSF-1 mRNA 3′UTR, disruption of the miRNA target region, G-quadruplex, and AREs together dramatically increased reporter RNA levels, suggesting important roles for these cis-acting regulatory elements in the down-regulation of CSF-1 mRNA. We find that nucleolin, which binds both G-quadruplex and AREs, enhances deadenylation of CSF-1 mRNA, promoting CSF-1 mRNA decay, while having the capacity to increase translation of CSF-1 mRNA. Through interaction with the CSF-1 3′UTR miRNA common target, we find that miR-130a and miR-301a inhibit CSF-1 expression by enhancing mRNA decay. Silencing of nucleolin prevents the miRNA-directed mRNA decay, indicating a requirement for nucleolin in miRNA activity on CSF-1 mRNA. Downstream effects followed by miR-130a and miR-301a inhibition of directed cellular motility of ovarian cancer cells were found to be dependent on nucleolin. The paradoxical effects of nucleolin on miRNA-directed CSF-1 mRNA deadenylation and on translational activation were explored further. The nucleolin protein contains four acidic stretches, four RNA recognition motifs (RRMs), and nine RGG repeats. All three domains in nucleolin regulate CSF-1 mRNA and protein levels. RRMs increase CSF-1 mRNA, whereas the acidic and RGG domains decrease CSF-1 protein levels. This suggests that nucleolin has the capacity to differentially regulate both CSF-1 RNA and protein levels. Our finding that nucleolin interacts with Ago2 indirectly via RNA and with poly(A)-binding protein C (PABPC) directly suggests a nucleolin-Ago2-PABPC complex formation on mRNA. This complex is in keeping with our suggestion that nucleolin may work with PABPC as a double-edged sword on both mRNA deadenylation and translational activation. Our findings underscore the complexity of
Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun
2015-02-15
In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Oyoshi Takanori
2012-01-01
Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.
Potent and Selective Peptide-based Inhibition of the G Protein Gαq.
Charpentier, Thomas H; Waldo, Gary L; Lowery-Gionta, Emily G; Krajewski, Krzysztof; Strahl, Brian D; Kash, Thomas L; Harden, T Kendall; Sondek, John
2016-12-02
In contrast to G protein-coupled receptors, for which chemical and peptidic inhibitors have been extensively explored, few compounds are available that directly modulate heterotrimeric G proteins. Active Gα q binds its two major classes of effectors, the phospholipase C (PLC)-β isozymes and Rho guanine nucleotide exchange factors (RhoGEFs) related to Trio, in a strikingly similar fashion: a continuous helix-turn-helix of the effectors engages Gα q within its canonical binding site consisting of a groove formed between switch II and helix α3. This information was exploited to synthesize peptides that bound active Gα q in vitro with affinities similar to full-length effectors and directly competed with effectors for engagement of Gα q A representative peptide was specific for active Gα q because it did not bind inactive Gα q or other classes of active Gα subunits and did not inhibit the activation of PLC-β3 by Gβ 1 γ 2 In contrast, the peptide robustly prevented activation of PLC-β3 or p63RhoGEF by Gα q ; it also prevented G protein-coupled receptor-promoted neuronal depolarization downstream of Gα q in the mouse prefrontal cortex. Moreover, a genetically encoded form of this peptide flanked by fluorescent proteins inhibited Gα q -dependent activation of PLC-β3 at least as effectively as a dominant-negative form of full-length PLC-β3. These attributes suggest that related, cell-penetrating peptides should effectively inhibit active Gα q in cells and that these and genetically encoded sequences may find application as molecular probes, drug leads, and biosensors to monitor the spatiotemporal activation of Gα q in cells. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu
2015-04-15
Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.
Views of a physicist selected papers of N G van Kampen
Meijer, Paul Herman E
2000-01-01
N G van Kampen is a well-known theoretical physicist who has had a long and distinguished career. His research covers scattering theory, plasma physics, statistical mechanics, and various mathematical aspects of physics. In addition to his scientific work, he has written a number of papers about more general aspects of science. An indefatigable fighter for intellectual honesty and clarity, he has pointed out repeatedly that the fundamental ideas of physics have been needlessly obscured.As those papers appeared in various journals, partly in Dutch, it was felt that it would be worthwhile to col
DEFF Research Database (Denmark)
Kostenis, Evi; Martini, Lene; Ellis, James
2004-01-01
Numerous studies have attested to the importance of the extreme C terminus of G protein alpha subunits in determining their selectivity of receptor recognition. We have previously reported that a highly conserved glycine residue within linker I is important for constraining the fidelity of receptor...... recognition by Galpha(q) proteins. Herein, we explored whether both modules (linker I and extreme C terminus) interact cooperatively in switching G protein-coupled receptor (GPCR)-to-effector specificity and created as models mutant Galpha(q) proteins in which glycine was replaced with various amino acids...... and the C-terminal five Galpha(q) residues with the corresponding Galpha(i) or Galpha(s) sequence. Coupling properties of the mutated Galpha(q) proteins were determined after coexpression with a panel of 13 G(i)-and G(s) -selective receptors and compared with those of Galpha proteins modified in only one...
Detection of Serum IgG4 Levels in Patients with IgG4-Related Disease and Other Disorders
Wang, Chenqiong; Wu, Xuefen; Miao, Ye; Xiong, Hui; Bai, Lin; Dong, Lingli
2015-01-01
Objective Elevated serum IgG4 levels are an important hallmark for diagnosing IgG4-related disease (IgG4-RD), but can also be observed in other diseases. This study aimed to compare two different testing methods for IgG4: ELISA and nephelometric assay. Both assays were used to measure serum IgG4 concentrations, and to assess the prevalence of high serum IgG4 levels in both IgG4-RD and non-IgG4-RD diseases. Methods A total of 80 serum samples were tested using the nephelometric assay and ELISA method that we established. Serum IgG4 concentrations were determined by ELISA for 957 patients with distinct diseases, including 12 cases of IgG4-RD and 945 cases of non-IgG4-RD. Results IgG4 levels from 80 selected serum samples examined by ELISA were in agreement with those detected using the nephelometry assay. Meanwhile, the serum IgG4 concentrations measured by ELISA were also consistent with the clinical diagnoses of patients with IgG4-RD during the course of disease. The Elevated levels of serum IgG4 (>1.35 g/L) were detected in all IgG4-RD (12/12) patients, and the prevalence of high IgG4 serum levels was 3.39% in non-IgG4-RD cases. Among them, the positive rates of serum IgG4 were 2.06% in patients with carcinoma and 6.3% in patients with other non-IgG4 autoimmune diseases. Conclusion Our established ELISA method is a reliable and convenient technique, which could be extensively used in the clinic to measure serum IgG4 levels. High levels of IgG4 were observed in IgG4-RD. However, this phenomenon could also be observed in other diseases, such as carcinomas and other autoimmune diseases. Thus, a diagnosis of IgG4 disease cannot only be dependent on the detection of elevated serum IgG4 levels. PMID:25885536
Selection of Reliable Reference Genes for Gene Expression Studies on Rhododendron molle G. Don.
Xiao, Zheng; Sun, Xiaobo; Liu, Xiaoqing; Li, Chang; He, Lisi; Chen, Shangping; Su, Jiale
2016-01-01
The quantitative real-time polymerase chain reaction (qRT-PCR) approach has become a widely used method to analyze expression patterns of target genes. The selection of an optimal reference gene is a prerequisite for the accurate normalization of gene expression in qRT-PCR. The present study constitutes the first systematic evaluation of potential reference genes in Rhododendron molle G. Don. Eleven candidate reference genes in different tissues and flowers at different developmental stages of R. molle were assessed using the following three software packages: GeNorm, NormFinder, and BestKeeper. The results showed that EF1- α (elongation factor 1-alpha), 18S (18s ribosomal RNA), and RPL3 (ribosomal protein L3) were the most stable reference genes in developing rhododendron flowers and, thus, in all of the tested samples, while tublin ( TUB ) was the least stable. ACT5 (actin), RPL3 , 18S , and EF1- α were found to be the top four choices for different tissues, whereas TUB was not found to favor qRT-PCR normalization in these tissues. Three stable reference genes are recommended for the normalization of qRT-PCR data in R. molle . Furthermore, the expression profiles of RmPSY (phytoene synthase) and RmPDS (phytoene dehydrogenase) were assessed using EF1- α, 18S , ACT5 , RPL3 , and their combination as internals. Similar trends were found, but these trends varied when the least stable reference gene TUB was used. The results further prove that it is necessary to validate the stability of reference genes prior to their use for normalization under different experimental conditions. This study provides useful information for reliable qRT-PCR data normalization in gene studies of R. molle .
Selection of Reliable Reference Genes for Gene Expression Studies on Rhododendron molle G. Don
Directory of Open Access Journals (Sweden)
Zheng Xiao
2016-10-01
Full Text Available The quantitative real-time polymerase chain reaction (qRT-PCR approach has become a widely used method to analyze expression patterns of target genes. The selection of an optimal reference gene is a prerequisite for the accurate normalization of gene expression in qRT-PCR. The present study constitutes the first systematic evaluation of potential reference genes in Rhododendron molle G. Don. Eleven candidate reference genes in different tissues and flowers at different developmental stages of R. molle were assessed using the following three software packages: GeNorm, NormFinder and BestKeeper. The results showed that EF1-α (elongation factor 1-alpha, 18S (18s ribosomal RNA and RPL3 (ribosomal protein L3 were the most stable reference genes in developing rhododendron flowers and, thus, in all of the tested samples, while tublin (TUB was the least stable. ACT5 (actin, RPL3, 18S and EF1-α were found to be the top four choices for different tissues, whereas TUB was not found to favor qRT-PCR normalization in these tissues. Three stable reference genes are recommended for the normalization of qRT-PCR data in R. molle. Furthermore, the expression profiles of RmPSY (phytoene synthase and RmPDS (phytoene dehydrogenase were assessed using EF1-α, 18S, ACT5, and RPL3 and their combination as internals. Similar trends were found, but these trends varied when the least stable reference gene TUB was used. The results further prove that it is necessary to validate the stability of reference genes prior to their use for normalization under different experimental conditions. This study provides useful information for reliable qRT-PCR data normalization in gene studies of R. molle.
Xu, Li; Wang, Sheng; Lv, Yingnian; Son, Young-A; Cao, Derong
2014-07-15
A new photochromic diarylethene derivative bearing rhodamine 6G dimmer as a fluorescent molecular probe is designed and synthesized successfully. All the compounds are characterized by nuclear magnetic resonance and mass spectrometry. The bisthienylethene-rhodamine 6G dyad exhibit excellent phtochromism with reversibly color and fluorescence changes alternating irradiation with ultraviolet and visible light. Upon addition of Hg(2+), its color changes from colorless to red and its fluorescence is remarkably enhanced. Whereas other ions including K(+), Na(+), Ca(2+), Mg(2+), Fe(2+), Co(2+), Ni(2+), Cu(2+), Zn(2+), Mn(2+), Pb(2+), Ni(2+), Fe(3+), Al(3+), Cr(3+) and so on induce basically no spectral changes, which constitute a highly selective and sensitive photoswitchable fluorescent probe toward Hg(2+). Furthermore, by means of laser confocal scanning microscopy experiments, it is demonstrated that this probe can be applied for live cell imaging and monitoring Hg(2+) in living lung cancer cells with satisfying results, which shows its value of potential application in environmental and biological systems. Copyright © 2014 Elsevier B.V. All rights reserved.
On the Selection of Guard Period and Cyclic Prefix for Beyond 4G TDD Radio Access Network
DEFF Research Database (Denmark)
Lähetkangas, Eeva; Pajukoski, Kari; Berardinelli, Gilberto
2013-01-01
In parallel with ongoing standardization of third generation partnership project (3GPP) Long Term Evolution ?? Advanced (LTE-A), also referred as 4G, the discussion on next generation beyond 4G (B4G) radio access technologies is already active. Purpose of B4G system, expected to be available in 2...
Ambroise, Jérôme; Butoescu, Valentina; Robert, Annie; Tombal, Bertrand; Gala, Jean-Luc
2015-06-25
Single Nucleotide Polymorphisms (SNPs) identified in Genome Wide Association Studies (GWAS) have generally moderate association with related complex diseases. Accordingly, Multilocus Genetic Risk Scores (MGRSs) have been computed in previous studies in order to assess the cumulative association of multiple SNPs. When several SNPs have to be genotyped for each patient, using successive uniplex pyrosequencing reactions increases analytical reagent expenses and Turnaround Time (TAT). While a set of several pyrosequencing primers could theoretically be used to analyze multiplex amplicons, this would generate overlapping primer-specific pyro-signals that are visually uninterpretable. In the current study, two multiplex assays were developed consisting of a quadruplex (n=4) and a quintuplex (n=5) polymerase chain reaction (PCR) each followed by multiplex pyrosequencing analysis. The aim was to reliably but rapidly genotype a set of prostate cancer-related SNPs (n=9). The nucleotide dispensation order was selected using SENATOR software. Multiplex pyro-signals were analyzed using the new AdvISER-MH-PYRO software based on a sparse representation of the signal. Using uniplex assays as gold standard, the concordance between multiplex and uniplex assays was assessed on DNA extracted from patient blood samples (n = 10). All genotypes (n=90) generated with the quadruplex and the quintuplex pyroquencing assays were perfectly (100 %) concordant with uniplex pyrosequencing. Using multiplex genotyping approach for analyzing a set of 90 patients allowed reducing TAT by approximately 75 % (i.e., from 2025 to 470 min) while reducing reagent consumption and cost by approximately 70 % (i.e., from ~229 US$ /patient to ~64 US$ /patient). This combination of quadruplex and quintuplex pyrosequencing and PCR assays enabled to reduce the amount of DNA required for multi-SNP analysis, and to lower the global TAT and costs of SNP genotyping while providing results as reliable as uniplex
Evaluation of the hydrometer for testing immunoglobulin G1 concentrations in Holstein colostrum.
Pritchett, L C; Gay, C C; Hancock, D D; Besser, T E
1994-06-01
Hydrometer measurement in globulin and IgG1 concentration measured by the radial immunodiffusion technique were compared for 915 samples of first milking colostrum from Holstein cows. Least squares analysis of the relationship between hydrometer measurement and IgG1 concentration was improved by log transformation of IgG1 concentration and resulted in a significant linear relationship between hydrometer measurement and log10 IgG1 concentration; r2 = .469. At 50 mg of globulin/ml of colostrum, the recommended hydrometer cutoff point for colostrum selection, the sensitivity of the hydrometer as a test of IgG1 concentration in Holstein colostrum was 26%, and the negative predictive value was 67%. The negative predictive value and sensitivity of the hydrometer as a test of IgG1 in Holstein colostrum was improved, and the cost of misclassification of colostrum was minimized, when the cutoff point for colostrum selection was increased above the recommended 50 mg/ml.
G5..., G6..., G7..., G8..., G?
Monteiro, António
2001-01-01
O G8 tem as suas raízes no primitivo embrião do G5 quando, em 1973, o então Secretário de Estado do Tesouro americano, George Schultz, convocou os Ministros das Finanças da França, Japão, Reino Unido e República Federal da Alemanha para uma reunião. O objectivo era analisar como fazer face à primeira crise do petróleo da OPEC e subsequente recessão económica nos países mais industrializados, ao colapso do sistema monetário das taxas de câmbio de paridades fixas de Bretton-Woods e ao alargamen...
Surface Grafted Glycopolymer Brushes to Enhance Selective Adhesion of HepG2 Cells
DEFF Research Database (Denmark)
Chernyy, Sergey; Jensen, Bettina Elisabeth Brøgger; Shimizu, Kyoko
2013-01-01
on the polymerization kinetics of 2-lactobionamidoethyl methacrylate) (LAMA) monomer on thermally oxidized silicon wafer. Both monolayer and multilayered aminosilane precursor layers have been prepared followed by reaction with 2-bromoisobutyrylbromide to form the ATRP initiator layer. It is inferred from the kinetic...... studies that the rate of termination is low on a multilayered initiator layer compared to a disordered monolayer structure. However both initiator types results in similar graft densities. Furthermore, it is shown that thick comb-like poly(LAMA) brushes can be constructed by initiating a second ATRP...... process on a previously formed poly(LAMA) brushes. The morphology of human hepatocellular carcinoma cancer cells (HepG2) on the comb-like poly(LAMA) brush layer has been studied. The fluorescent images of the HepG2 cells on the glycopolymer brush surface display distinct protrusions that extend outside...
Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang
2017-07-05
DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Careau, Vincent; Wolak, Matthew E.; Carter, Patrick A.; Garland, Theodore
2015-01-01
Given the pace at which human-induced environmental changes occur, a pressing challenge is to determine the speed with which selection can drive evolutionary change. A key determinant of adaptive response to multivariate phenotypic selection is the additive genetic variance–covariance matrix (G). Yet knowledge of G in a population experiencing new or altered selection is not sufficient to predict selection response because G itself evolves in ways that are poorly understood. We experimentally evaluated changes in G when closely related behavioural traits experience continuous directional selection. We applied the genetic covariance tensor approach to a large dataset (n = 17 328 individuals) from a replicated, 31-generation artificial selection experiment that bred mice for voluntary wheel running on days 5 and 6 of a 6-day test. Selection on this subset of G induced proportional changes across the matrix for all 6 days of running behaviour within the first four generations. The changes in G induced by selection resulted in a fourfold slower-than-predicted rate of response to selection. Thus, selection exacerbated constraints within G and limited future adaptive response, a phenomenon that could have profound consequences for populations facing rapid environmental change. PMID:26582016
Careau, Vincent; Wolak, Matthew E; Carter, Patrick A; Garland, Theodore
2015-11-22
Given the pace at which human-induced environmental changes occur, a pressing challenge is to determine the speed with which selection can drive evolutionary change. A key determinant of adaptive response to multivariate phenotypic selection is the additive genetic variance-covariance matrix ( G: ). Yet knowledge of G: in a population experiencing new or altered selection is not sufficient to predict selection response because G: itself evolves in ways that are poorly understood. We experimentally evaluated changes in G: when closely related behavioural traits experience continuous directional selection. We applied the genetic covariance tensor approach to a large dataset (n = 17 328 individuals) from a replicated, 31-generation artificial selection experiment that bred mice for voluntary wheel running on days 5 and 6 of a 6-day test. Selection on this subset of G: induced proportional changes across the matrix for all 6 days of running behaviour within the first four generations. The changes in G: induced by selection resulted in a fourfold slower-than-predicted rate of response to selection. Thus, selection exacerbated constraints within G: and limited future adaptive response, a phenomenon that could have profound consequences for populations facing rapid environmental change. © 2015 The Author(s).
G-Bean: an ontology-graph based web tool for biomedical literature retrieval.
Wang, James Z; Zhang, Yuanyuan; Dong, Liang; Li, Lin; Srimani, Pradip K; Yu, Philip S
2014-01-01
Currently, most people use NCBI's PubMed to search the MEDLINE database, an important bibliographical information source for life science and biomedical information. However, PubMed has some drawbacks that make it difficult to find relevant publications pertaining to users' individual intentions, especially for non-expert users. To ameliorate the disadvantages of PubMed, we developed G-Bean, a graph based biomedical search engine, to search biomedical articles in MEDLINE database more efficiently. G-Bean addresses PubMed's limitations with three innovations: (1) Parallel document index creation: a multithreaded index creation strategy is employed to generate the document index for G-Bean in parallel; (2) Ontology-graph based query expansion: an ontology graph is constructed by merging four major UMLS (Version 2013AA) vocabularies, MeSH, SNOMEDCT, CSP and AOD, to cover all concepts in National Library of Medicine (NLM) database; a Personalized PageRank algorithm is used to compute concept relevance in this ontology graph and the Term Frequency - Inverse Document Frequency (TF-IDF) weighting scheme is used to re-rank the concepts. The top 500 ranked concepts are selected for expanding the initial query to retrieve more accurate and relevant information; (3) Retrieval and re-ranking of documents based on user's search intention: after the user selects any article from the existing search results, G-Bean analyzes user's selections to determine his/her true search intention and then uses more relevant and more specific terms to retrieve additional related articles. The new articles are presented to the user in the order of their relevance to the already selected articles. Performance evaluation with 106 OHSUMED benchmark queries shows that G-Bean returns more relevant results than PubMed does when using these queries to search the MEDLINE database. PubMed could not even return any search result for some OHSUMED queries because it failed to form the appropriate Boolean
In vivo control of CpG and non-CpG DNA methylation by DNA methyltransferases.
Directory of Open Access Journals (Sweden)
Julia Arand
2012-06-01
Full Text Available The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites. The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position-, cell type-, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM to calculate the relative contribution of DNA methyltransferases (Dnmts for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs.
Czech Academy of Sciences Publication Activity Database
Krepl, Miroslav; Zgarbová, M.; Stadlbauer, Petr; Otyepka, M.; Banáš, P.; Koča, J.; Cheatham III, T.E.; Jurečka, P.; Šponer, Jiří
2012-01-01
Roč. 8, č. 7 (2012), s. 2506-2520 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GD203/09/H046; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA ČR(CZ) GBP305/12/G034 Institutional research plan: CEZ:AV0Z50040702 Keywords : refinement of empirical force fields * DNA * Z-DNA backbone Subject RIV: BO - Biophysics Impact factor: 5.389, year: 2012
100G shortwave wavelength division multiplexing solutions for multimode fiber data links
DEFF Research Database (Denmark)
Cimoli, Bruno; Estaran Tolosa, Jose Manuel; Rodes Lopez, Guillermo Arturo
2016-01-01
We investigate an alternative 100G solution for optical short-range data center links. The presented solution adopts wavelength division multiplexing technology to transmit four channels of 25G over a multimode fiber. A comparative performance analysis of the wavelength-grid selection for the wav...
Pardi, A; Morden, K M; Patel, D J; Tinoco, I
1982-12-07
The relaxation lifetimes of imino protons from individual base pairs were measured in (I) a perfect helix, d(C-G-C-G-A-A-T-T-C-G-C-G), (II) this helix with a G . C base pair replaced with a G . T base pair, d(C-G-T-G-A-A-T-T-C-G-C-G), and (III) the perfect helix with an extra adenine base in a mismatch, d(C-G-C-A-G-A-A-T-T-C-G-C-G). The lifetimes were measured by saturation recovery proton nuclear magnetic resonance experiments performed on the imino protons of these duplexes. The measured lifetimes of the imino protons were shown to correspond to chemical exchange lifetimes at higher temperatures and spin-lattice relaxation times at lower temperatures. Comparison of the lifetimes in these duplexes showed that the destabilizing effect of the G . T base pair in II affected the opening rate of only the nearest-neighbor base pairs. For helix III, the extra adenine affected the opening rates of all the base pairs in the helix and thus was a larger perturbation for opening of the base pairs than the G . T base pair. The temperature dependence of the exchange rates of the imino proton in the perfect helix gives values of 14-15 kcal/mol for activation energies of A . T imino protons. These relaxation rates were shown to correspond to exchange involving individual base pair opening in this helix, which means that one base-paired imino proton can exchange independent of the others. For the other two helices that contain perturbations, much larger activation energies for exchange of the imino protons were found, indicating that a cooperative transition involving exchange of at least several base pairs was the exchange mechanism of the imino protons. The effects of a perturbation in a helix on the exchange rates and the mechanisms for exchange of imino protons from oligonucleotide helices are discussed.
Resonant count diagram and solar g mode oscillations
International Nuclear Information System (INIS)
Guenther, D.B.; Demarque, P.
1984-01-01
Evidence is provided to support the hypothesis that, because of the particular frequency separations of the solar g modes, resonant three-wave interactions stimulate only a selected few g modes. A resonant count diagram was obtained by plotting the total number of possible resonant three-wave interactions or a given beat frequency against the inverse of the beat frequency (the beat period), within a given frequency tolerance. The 1 = 1, 2, 3, 4 g modes calculated by Christensen-Dalsgaard, Gough and Morgan (1979) for a standard model of the Sun were used. The diagram has a significant peak at 160 minutes as well as other peaks at longer periods. The g modes that Delache and Scherrer (1983) tentatively identified from the Crimea-Stanford data were also plotted. These modes were found to correspond with the other peaks in the diagram. This coincidence between the observed g modes and the peaks in the resonant count diagram suggest that the observed g modes do owe their observability to resonant three-wave interactions
Non-Selective Lexical Access in Late Arabic-English Bilinguals: Evidence from Gating.
Boudelaa, Sami
2018-02-07
Previous research suggests that late bilinguals who speak typologically distant languages are the least likely to show evidence of non-selective lexical access processes. This study puts this claim to test by using the gating task to determine whether words beginning with speech sounds that are phonetically similar in Arabic and English (e.g., [b,d,m,n]) give rise to selective or non-selective lexical access processes in late Arabic-English bilinguals. The results show that an acoustic-phonetic input (e.g., [bæ]) that is consistent with words in Arabic (e.g., [bædrun] "moon") and English (e.g., [bæd] "bad") activates lexical representations in both languages of the bilingual. This non-selective activation holds equally well for mixed lists with words from both Arabic and English and blocked lists consisting only of Arabic or English words. These results suggest that non-selective lexical access processes are the default mechanism even in late bilinguals of typologically distant languages.
48 CFR 1019.202-70-8 - Protégé firms.
2010-10-01
... multiple mentors unless approved, in writing, by the Director, Office of Small Business Development (OSBD... SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS Policies 1019.202-70-8 Protégé firms. (a) For selection as a protégé, a firm must be: (1) A small business, women-owned small business, small disadvantaged business...
Generalisability of a composite student selection programme
DEFF Research Database (Denmark)
O'Neill, Lotte Dyhrberg; Korsholm, Lars; Wallstedt, Birgitta
2009-01-01
format); general knowledge (multiple-choice test), and a semi-structured admission interview. The aim of this study was to estimate the generalisability of a composite selection. METHODS: Data from 307 applicants who participated in the admission to medicine in 2007 were available for analysis. Each...... admission parameter was double-scored using two random, blinded and independent raters. Variance components for applicant, rater and residual effects were estimated for a mixed model with the restricted maximum likelihood (REML) method. The reliability of obtained applicant ranks (G coefficients......) was calculated for individual admission criteria and for composite admission procedures. RESULTS: A pre-selection procedure combining qualification and motivation scores showed insufficient generalisability (G = 0.45). The written motivation in particular, displayed low generalisability (G = 0.10). Good...
Teaching animal habitat selection using wildlife tracking equipment
Laskowski, Jessica; Gillespie, Caitlyn R.; Corral, Lucia; Oden, Amy; Fricke, Kent A.; Fontaine, Joseph J.
2016-01-01
We present a hands-on outdoor activity coupled with classroom discussion to teach students about wildlife habitat selection, the process by which animals choose where to live. By selecting locations or habitats with many benefits (e.g., food, shelter, mates) and few costs (e.g., predators), animals improve their ability to survive and reproduce. Biologists track animal movement using radio telemetry technology to study habitat selection so they can better provide species with habitats that promote population growth. We present a curriculum in which students locate “animals” (transmitters) using radio telemetry equipment and apply math skills (use of fractions and percentages) to assess their “animal's” habitat selection by comparing the availability of habitat types with the proportion of “animals” they find in each habitat type.
Gesture Decoding Using ECoG Signals from Human Sensorimotor Cortex: A Pilot Study
Directory of Open Access Journals (Sweden)
Yue Li
2017-01-01
Full Text Available Electrocorticography (ECoG has been demonstrated as a promising neural signal source for developing brain-machine interfaces (BMIs. However, many concerns about the disadvantages brought by large craniotomy for implanting the ECoG grid limit the clinical translation of ECoG-based BMIs. In this study, we collected clinical ECoG signals from the sensorimotor cortex of three epileptic participants when they performed hand gestures. The ECoG power spectrum in hybrid frequency bands was extracted to build a synchronous real-time BMI system. High decoding accuracy of the three gestures was achieved in both offline analysis (85.7%, 84.5%, and 69.7% and online tests (80% and 82%, tested on two participants only. We found that the decoding performance was maintained even with a subset of channels selected by a greedy algorithm. More importantly, these selected channels were mostly distributed along the central sulcus and clustered in the area of 3 interelectrode squares. Our findings of the reduced and clustered distribution of ECoG channels further supported the feasibility of clinically implementing the ECoG-based BMI system for the control of hand gestures.
The Histopathology of IgG4-Related Disease.
Avincsal, Mehmet Ozgur; Zen, Yoh
2017-01-01
IgG4-related disease is a multi-organ immune-mediated chronic fibroinflammatory condition characterized by elevated serum IgG4 concentrations, tumefaction, and tissue infiltration by IgG4-positive plasma cells. The exact etiology of IgG4-related disease remains unclear with no known role of the IgG4 molecule itself being identified. Although the pancreas and salivary glands are the main organs affected, the involvement of other organs has also been reported. This multi-organ disease mimics a large number of malignant, infectious, and inflammatory disorders; therefore, a prompt differential diagnosis is important for selecting the right therapeutic strategy. Early steroid therapy assists in preventing tissue fibrosis, parenchymal extinction, and severe functional impairments in the affected organs. The definitive and prompt diagnosis of IgG4-related disease requires both histopathological confirmation and clinicopathological correlations. A histopathological examination is mandatory to exclude neoplastic or inflammatory conditions that mimic IgG4-related disease. The histological changes that occur are basically similar in any organ manifestation, with several site-specific findings being recognized. This chapter summarizes general rules for the pathological examination of IgG4-related disease, as well as the histopathological features and differential diagnoses of major organ manifestations.
Selective discrimination of cyclodextrin diols using cyclic sulfates
DEFF Research Database (Denmark)
Petrillo, Marta; Marinescu, Lavinia; Rousseau, Cyril
2009-01-01
A method for selective monofunctionalition of readily available cyclodextrin diols (2(A-F),3(A-F),6(B,C,E,F)-hexadeca-O-benzyl-alpha-cyclodextrin and 2(A-G),3(A-G),6(B,C,E-G)-nonadeca-O-benzyl-beta-cyclodextrin) by regioselective nucleophilic opening of their cyclic sulfates is presented. Although...
Energy Technology Data Exchange (ETDEWEB)
Chi, Se-Hwan, E-mail: shchi@kaeri.re.kr
2016-08-01
The fracture behaviors of six nuclear graphite grades for a high-temperature gas-cooled reactor (HTGR), which differed in coke particle size and forming method, were characterized based on the ASTM standard graphite fracture toughness test method (ASTM D 7779-11) at room temperature. The G appeared to show good correlation with the fracture surface roughness and the G-Δa curves appeared to describe the fracture process well from crack initiation to failure. Comparison of the local (K{sub IC}) and gross (G{sub IC}, G-Δa) fracture parameters showed that the resistance to crack initiation and propagation was higher in the extruded or vibration molded medium particle size grades (PCEA, NBG-17, NBG-18: EVM group) than in the iso-molded fine particle size grades (IG-110, IG-430, NBG-25: IMF group). The ASTM may need to provide a guideline for G-Δa curve analysis. The K{sub IC} appeared to increase with specimen thickness (size).
Guerra, Mónica; Machado, Patrícia; Manco, Licínio; Fernandes, Natércia; Miranda, Juliana; Arez, Ana Paula
2015-06-01
TPI1 promoter polymorphisms occur in high prevalence in individuals from African origin. Malaria-patients from Angola and Mozambique were screened for the TPI1 gene promoter variants rs1800200A>G, (-5G>A), rs1800201G>A, (-8G>A), rs1800202T>G, (-24T>G), and for the intron 5 polymorphism rs2071069G>A, (2262G>A). -5G>A and -8G>A variants occur in 47% and 53% in Angola and Mozambique, respectively while -24T>G was monomorphic for the wild-type T allele. Six haplotypes were identified and -8A occurred in 45% of the individuals, especially associated with the GAG haplotype and more frequent in non-severe malaria groups, although not significantly. The arising and dispersion of -5G>A and -8G>A polymorphisms is controversial. Their age was estimated by analyses of two microsatellite loci, CD4 and ATN1, adjacent to TPI1 gene. The -5G>A is older than -8G>A, with an average estimate of approximately 35,000 years. The -8A variant arose in two different backgrounds, suggesting independent mutational events. The first, on the -5G background, may have occurred in East Africa around 20,800 years ago; the second, on the -5A background, may have occurred in West Africa some 7500 years ago. These estimates are within the period of spread of agriculture and the malaria mosquito vector in Africa, which could has been a possible reason for the selection of -8A polymorphism in malaria endemic countries. Copyright © 2015 Elsevier B.V. All rights reserved.
Material selection for an aerospace component
Jönsson, Gustav
2015-01-01
In the world of today there is a drive for lighter and more effective products for various reasons e.g. reduced environmental impact, higher payload, fuel efficiency etc. There is also an expanding development of new materials for a large number of different applications. This makes it more and more difficult for engineers to make good material selections. This has led to the development of a large amount of material selection methods that require more or less effort to select material. An ef...
Sr and Pb isotopic composition of five USGS glasses (BHVO-2G, BIR-1G, BCR-2G, TB-1G, NKT-1G)
Elburg, M.A.; Vroon, P.Z.; van der Wagt, R.A.C.A.; Tchalikian, A.
2005-01-01
Sr isotopic compositions and Rb/Sr ratios of three USGS glasses (BHVO-2G, BIR-1G, BCR-2G) are identical to those of the original USGS reference materials. NKT-1G and TB-1G give values of 0.70351 and 0.70558, respectively. Pb isotopic ratios were measured by the standard-sample bracketing technique
The empirical Gaia G-band extinction coefficient
Danielski, C.; Babusiaux, C.; Ruiz-Dern, L.; Sartoretti, P.; Arenou, F.
2018-06-01
Context. The first Gaia data release unlocked the access to photometric information for 1.1 billion sources in the G-band. Yet, given the high level of degeneracy between extinction and spectral energy distribution for large passbands such as the Gaia G-band, a correction for the interstellar reddening is needed in order to exploit Gaia data. Aims: The purpose of this manuscript is to provide the empirical estimation of the Gaia G-band extinction coefficient kG for both the red giants and main sequence stars in order to be able to exploit the first data release DR1. Methods: We selected two samples of single stars: one for the red giants and one for the main sequence. Both samples are the result of a cross-match between Gaia DR1 and 2MASS catalogues; they consist of high-quality photometry in the G-, J- and KS-bands. These samples were complemented by temperature and metallicity information retrieved from APOGEE DR13 and LAMOST DR2 surveys, respectively. We implemented a Markov chain Monte Carlo method where we used (G - KS)0 versus Teff and (J - KS)0 versus (G - KS)0, calibration relations to estimate the extinction coefficient kG and we quantify its corresponding confidence interval via bootstrap resampling. We tested our method on samples of red giants and main sequence stars, finding consistent solutions. Results: We present here the determination of the Gaia extinction coefficient through a completely empirical method. Furthermore we provide the scientific community with a formula for measuring the extinction coefficient as a function of stellar effective temperature, the intrinsic colour (G - KS)0, and absorption.
A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.
Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao
2012-06-01
Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.
Problems of selectivity in liquid-phase oxidation
Energy Technology Data Exchange (ETDEWEB)
Emanuel, N M
1978-07-01
Based on a kinetic analysis of a generalized scheme for radical-chain process and on published experimental results, factors determining the selectivities of various liquid-phase oxidations of organic compounds are examined, including the kinetic chain length, molecular and chain decomposition of products, and competing routes in the initiated oxidation or autoxidation of hydrocarbons to peroxides. Also discussed are selective inhibition of undesirable routes in chain reactions, e.g., styrene and acetaldehyde co-oxidation; activation of molecular oxygen by variable-valence metal compounds used as homogeneous catalysts; modeling of fermentative processes by oxidation of hydrocarbons in complex catalytic systems, e.g., hydroxylation of alkanes, epoxidation or carbonylation of olefins, or oxidation of alcohols and ketones to acids; and the mechanisms of heterogeneous catalysis in liquid-phase reactions, e.g., oxidation of alkylaromatic hydrocarbons to peroxides and co-oxidation of propylene and acetaldehyde.
Global ICT Standardisation Forum for India (GISFI) and 5G Standardization
DEFF Research Database (Denmark)
Prasad, Ramjee
2013-01-01
This paper covers a selected set of potentially high impact emerging technologies for 5G wireless communication as well as their current state of maturity and scenarios for the future. ‘Interoperable’, ‘ubiquitous’ and ‘dynamic’ are key words describing 5G networks and applications. The paper...... focuses on what are the necessary critical innovations, also undertaken within standardization and how to explore these as well as what are the expected challenges. It further identifies future directions for 5G and gives a vision of such communication system....
Directory of Open Access Journals (Sweden)
Sungho Ghil
Full Text Available Protease-activated receptor 1 (PAR1 is a G-protein coupled receptor (GPCR that is activated by natural proteases to regulate many physiological actions. We previously reported that PAR1 couples to Gi, Gq and G12 to activate linked signaling pathways. Regulators of G protein signaling (RGS proteins serve as GTPase activating proteins to inhibit GPCR/G protein signaling. Some RGS proteins interact directly with certain GPCRs to modulate their signals, though cellular mechanisms dictating selective RGS/GPCR coupling are poorly understood. Here, using bioluminescence resonance energy transfer (BRET, we tested whether RGS2 and RGS4 bind to PAR1 in live COS-7 cells to regulate PAR1/Gα-mediated signaling. We report that PAR1 selectively interacts with either RGS2 or RGS4 in a G protein-dependent manner. Very little BRET activity is observed between PAR1-Venus (PAR1-Ven and either RGS2-Luciferase (RGS2-Luc or RGS4-Luc in the absence of Gα. However, in the presence of specific Gα subunits, BRET activity was markedly enhanced between PAR1-RGS2 by Gαq/11, and PAR1-RGS4 by Gαo, but not by other Gα subunits. Gαq/11-YFP/RGS2-Luc BRET activity is promoted by PAR1 and is markedly enhanced by agonist (TFLLR stimulation. However, PAR1-Ven/RGS-Luc BRET activity was blocked by a PAR1 mutant (R205A that eliminates PAR1-Gq/11 coupling. The purified intracellular third loop of PAR1 binds directly to purified His-RGS2 or His-RGS4. In cells, RGS2 and RGS4 inhibited PAR1/Gα-mediated calcium and MAPK/ERK signaling, respectively, but not RhoA signaling. Our findings indicate that RGS2 and RGS4 interact directly with PAR1 in Gα-dependent manner to modulate PAR1/Gα-mediated signaling, and highlight a cellular mechanism for selective GPCR/G protein/RGS coupling.
DEFF Research Database (Denmark)
Alemayehu, Fikadu Reta; Frenck, Georg; van der Linden, Leon
2013-01-01
to environmental stress, we conducted a selection experiment over five plant generations (G0–G4) in three scenarios, where atmospheric [CO2] and temperature were increased as single factors and in combination. The treatments represented the expected environmental characteristics in Northern Europe around year 2075...... to environmental change needs to be explored in order to select the most productive genotypes. Presently, it is unknown whether cereal crops like spring barley can adapt to climate stressors over relatively few generations. To evaluate if strong selection pressures could change the performance of barley......, the G4-generation of selected plants did not improve its reproductive output compared to the G0-generation, as G4 produced less seeds and had a lower yield than unselected plants. These results indicate that barley might not respond positively to rapid and strong selection by elevated [CO2...
2011-03-02
... Airworthiness Directives; Allied Ag Cat Productions, Inc. Models G-164, G-164A, G-164B, G-164B With 73'' Wing... identified in this AD, contact Allied Ag Cat Productions, Inc., 301 West Walnut Street, P.O. Box 482, Walnut... Allied Ag Cat Productions, Inc. Models G-164, G-164A, G-164B, G-164B with 73'' wing gap, G-164B- 15T, G...
Long-term selection experiment with Afrikaner cattle
African Journals Online (AJOL)
Mario Beffa
Long-term selection experiment with Afrikaner cattle. 3. Selection applied and response in calf growth traits. L.M. Beffa. 1,2,3. , J.B. van Wyk. 1# and G.J. Erasmus. 1. 1 University of the Free State, P.O. Box 339, Bloemfontein 9300, South Africa. 2 Matopos Research Station, P. Bag K5137, Bulawayo, Zimbabwe ...
SHORT COMMUNICATION A SOLVENT FREE AND SELECTIVE ...
African Journals Online (AJOL)
Preferred Customer
Selective protection of 1,2-propanediol (1n) with dimethoxytrityl chloride and triethylamine under microwave irradiation. In a beaker, a mixture of dimethoxytrityl chloride (4.06 g, 12 mmol) and triethylamine (3.5 mL, 25 mmol) was taken and 1,2-propanediol 1n (0.76 g, 10 mmol) was added to this mixture and was irradiated ...
Jekic, Biljana; Lukovic, Ljiljana; Bunjevacki, Vera; Milic, Vera; Novakovic, Ivana; Damnjanovic, Tatjana; Milasin, Jelena; Popovic, Branka; Maksimovic, Nela; Damjanov, Nemanja; Radunovic, Goran; Kovacevic, Ljiljana; Krajinovic, Maja
2013-03-01
Gamma-glutamyl hydrolase (GGH), cyclin D1 (CCND1) and thymidylate synthase (TS) genes encode enzymes that are involved in methotrexate (MTX) action. In a group of 184 RA patients treated with MTX, we have investigated whether selected polymorphisms in these genes modulate MTX efficacy and/or have impact on adverse drug effects (ADEs). The efficacy of the MTX therapy has been estimated using the disease activity score in 28 joints (DAS28-ESR) based on EULAR criteria and relative DAS28 values (rDAS28). All adverse drug events were recorded. Patients were genotyped for selected polymorphisms of the GGH (-354 G > T and 452 C > T), CCND1 (870 A > G) and TYMS (variable number of tandem repeats, VNTR, and G to C substitution of triple repeat, 3R allele) gene. Association studies have been performed between obtained genotypes and the efficacy and toxicity of MTX. According to the EULAR response criteria, 146 RA patients (79.3 %) were classified as responders (good/moderate response) and 38 (20.7 %) as non-responders (poor response). Higher frequency of the TYMS 3 G/3 G genotype has been found among non-responders as compared to individuals with remaining genotypes (p = 0.02). ADEs were recorded in 53 patients. Among those patients eight experienced bone marrow toxicity, all of them carried GGH -354GG genotype (p = 0.003). No other significant association were observed. The 3 G/3 G genotype of the TYMS gene may indicate predisposition of poor response to MTX and GG genotype of GGH -354 T > G polymorphism may have high predictive value for myelosuppression in RA patients.
Palindromic Molecule Beacon-Based Cascade Amplification for Colorimetric Detection of Cancer Genes.
Shen, Zhi-Fa; Li, Feng; Jiang, Yi-Fan; Chen, Chang; Xu, Huo; Li, Cong-Cong; Yang, Zhe; Wu, Zai-Sheng
2018-03-06
A highly sensitive and selective colorimetric assay based on a multifunctional molecular beacon with palindromic tail (PMB) was proposed for the detection of target p53 gene. The PMB probe can serve as recognition element, primer, and polymerization template and contains a nicking site and a C-rich region complementary to a DNAzyme. In the presence of target DNA, the hairpin of PMB is opened, and the released palindromic tails intermolecularly hybridize with each other, triggering the autonomous polymerization/nicking/displacement cycles. Although only one type of probe is involved, the system can execute triple and continuous polymerization strand displacement amplifications, generating large amounts of G-quadruplex fragments. These G-rich fragments can bind to hemin and form the DNAzymes that possess the catalytic activity similar to horseradish peroxidase, catalyzing the oxidation of ABTS by H 2 O 2 and producing the colorimetric signal. Utilizing the newly proposed sensing system, target DNA can be detected down to 10 pM with a linear response range from 10 pM to 200 nM, and mutant target DNAs are able to be distinguished even by the naked eye. The desirable detection sensitivity, high specificity, and operation convenience without any separation step and chemical modification demonstrate that the palindromic molecular beacon holds the potential for detecting and monitoring a variety of nucleic acid-related biomarkers.
Directory of Open Access Journals (Sweden)
Gunaseelan Goldsmith
Full Text Available Implications of DNA, RNA and RNA.DNA hybrid triplexes in diverse biological functions, diseases and therapeutic applications call for a thorough understanding of their structure-function relationships. Despite exhaustive studies mechanistic rationale for the discriminatory preference of parallel DNA triplexes with G*GC & T*AT triplets still remains elusive. Here, we show that the highest nonisostericity between the G*GC & T*AT triplets imposes extensive stereochemical rearrangements contributing to context dependent triplex destabilisation through selective disruption of Hoogsteen scheme of hydrogen bonds. MD simulations of nineteen DNA triplexes with an assortment of sequence milieu reveal for the first time fresh insights into the nature and extent of destabilization from a single (non-overlapping, double (overlapping and multiple pairs of nonisosteric base triplets (NIBTs. It is found that a solitary pair of NIBTs, feasible either at a G*GC/T*AT or T*AT/G*GC triplex junction, does not impinge significantly on triplex stability. But two overlapping pairs of NIBTs resulting from either a T*AT or a G*GC interruption disrupt Hoogsteen pair to a noncanonical mismatch destabilizing the triplex by ~10 to 14 kcal/mol, implying that their frequent incidence in multiples, especially, in short sequences could even hinder triplex formation. The results provide (i an unambiguous and generalised mechanistic rationale for the discriminatory trait of parallel triplexes, including those studied experimentally (ii clarity for the prevalence of antiparallel triplexes and (iii comprehensive perspectives on the sequence dependent influence of nonisosteric base triplets useful in the rational design of TFO's against potential triplex target sites.
The species status of Echinococcus canadensis has long been controversial, mainly because it consists of the mitochondrial genotypes G6, G7, G8 and G10 with different host affinity: G6 (camel strain) and G7 (pig strain) with domestic cycles and G8 (cervid strain) and G10 (Fennoscandian cervid strain...
[Treatment of selective mutism].
Melfsen, Siebke; Warnke, Andreas
2007-11-01
Selective mutism is a communication disorder of childhood in which the child does not speak in specific social situations despite the ability to speak in other situations. A literature review was completed in order to provide practical guidelines for the assessment and treatment of children with selective mutism. There are many different behavioral approaches in the treatment of this disorder, e.g. contingency management, shaping, stimulus fading, escape-avoidance, self-modeling, learning theory approaches. A clearer diagnostic understanding of the disorder as part of anxiety or oppositional disorders needs to be realized prior to generalize an effective treatment for this disorder.
Equilibrious Strand Exchange Promoted by DNA Conformational Switching
Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang
2013-01-01
Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.
Higuchi, Robert I; Arienti, Kristen L; López, Francisco J; Mani, Neelakhanda S; Mais, Dale E; Caferro, Thomas R; Long, Yun Oliver; Jones, Todd K; Edwards, James P; Zhi, Lin; Schrader, William T; Negro-Vilar, Andrés; Marschke, Keith B
2007-05-17
Recent interest in orally available androgens has fueled the search for new androgens for use in hormone replacement therapy and as anabolic agents. In pursuit of this, we have discovered a series of novel androgen receptor modulators derived from 7H-[1,4]oxazino[3,2-g]quinolin-7-ones. These compounds were synthesized and evaluated in competitive binding assays and an androgen receptor transcriptional activation assay. A number of compounds from the series demonstrated single-digit nanomolar agonist activity in vitro. In addition, lead compound (R)-16e was orally active in established rodent models that measure androgenic and anabolic properties of these agents. In this assay, (R)-16e demonstrated full efficacy in muscle and only partially stimulated the prostate at 100 mg/kg. These data suggest that these compounds may be utilized as selective androgen receptor modulators or SARMs. This series represents a novel class of compounds for use in androgen replacement therapy.
Structure of Human G Protein-Coupled Receptor Kinase 2 in Complex with the Kinase Inhibitor Balanol
Energy Technology Data Exchange (ETDEWEB)
Tesmer, John J.G.; Tesmer, Valerie M.; Lodowski, David T.; Steinhagen, Henning; Huber, Jochen (Sanofi); (Michigan); (Texas)
2010-07-19
G protein-coupled receptor kinase 2 (GRK2) is a pharmaceutical target for the treatment of cardiovascular diseases such as congestive heart failure, myocardial infarction, and hypertension. To better understand how nanomolar inhibition and selectivity for GRK2 might be achieved, we have determined crystal structures of human GRK2 in complex with G{beta}{gamma} in the presence and absence of the AGC kinase inhibitor balanol. The selectivity of balanol among human GRKs is assessed.
Tang, Jen-Yang; Huang, Hurng-Wern; Wang, Hui-Ru; Chan, Ya-Ching; Haung, Jo-Wen; Shu, Chih-Wen; Wu, Yang-Chang; Chang, Hsueh-Wei
2018-03-01
Reactive oxygen species (ROS) induction had been previously reported in 4β-hydroxywithanolide (4βHWE)-induced selective killing of oral cancer cells, but the mechanism involving ROS and the DNA damage effect remain unclear. This study explores the role of ROS and oxidative DNA damage of 4βHWE in the selective killing of oral cancer cells. Changes in cell viability, morphology, ROS, DNA double strand break (DSB) signaling (γH2AX foci in immunofluorescence and DSB signaling in western blotting), and oxidative DNA damage (8-oxo-2'deoxyguanosine [8-oxodG]) were detected in 4βHWE-treated oral cancer (Ca9-22) and/or normal (HGF-1) cells. 4βHWE decreased cell viability, changed cell morphology and induced ROS generation in oral cancer cells rather than oral normal cells, which were recovered by a free radical scavenger N-acetylcysteine (NAC). For immunofluorescence, 4βHWE also accumulated more of the DSB marker, γH2AX foci, in oral cancer cells than in oral normal cells. For western blotting, DSB signaling proteins such as γH2AX and MRN complex (MRE11, RAD50, and NBS1) were overexpressed in 4βHWE-treated oral cancer cells in different concentrations and treatment time. In the formamidopyrimidine-DNA glycolyase (Fpg)-based comet assay and 8-oxodG-based flow cytometry, the 8-oxodG expressions were higher in 4βHWE-treated oral cancer cells than in oral normal cells. All the 4βHWE-induced DSB and oxidative DNA damage to oral cancer cells were recovered by NAC pretreatment. Taken together, the 4βHWE selectively induced DSB and oxidative DNA damage for the ROS-mediated selective killing of oral cancer cells. © 2017 Wiley Periodicals, Inc.
Protein synthetic requirements for caffeine amelioration of radiation-induced G/sub 2/-arrest
International Nuclear Information System (INIS)
Rowley, R.; Colkitt, D.
1984-01-01
Irradiated cells are arrested in G/sub 2/ (transition point [TP] = 32 min before cell selection in mitosis). Irradiated cells do not recover from G/sub 2/ arrest in the presence of cycloheximide (CHM) indicating dependence of recovery on protein synthesis. Irradiated cells in the presence of caffeine progress to mitosis without arrest. The authors investigate whether irradiated cells in the presence of caffeine require protein synthesis to progress to mitosis. Mitotic cell selection was used to monitor the progression of irradiated CHO cells (150 rad) during exposure to 5 mM caffeine and/or 50 μg/ml CHM. Protein synthesis inhibition was confirmed using /sup 3/H-leucine incorporation. Cells exposed to CHM alone are arrested in G/sub 2/ (TP=49 min), thus cells beyond this point have synthesized all proteins necessary for entry into mitosis. In the presence of caffeine, unirradiated cells exposed to CHM are not arrested at all in G/sub 2/, instead arrest occurs near the S/G/sub 2/ boundary (TP=95 min) indicating that caffeine alleviates the dependence of G/sub 2/ cell progression on protein synthesis. However, irradiated cells exposed to both caffeine and CHM are only able to progress to mitosis if beyond the CHM-TP. Irradiated cells in the presence of caffeine thus behave as untreated cells and require protein synthesis for progression to mitosis when prior to the CHM-TP
Baldry, I.K.; Brown, M.J.I.; Robotham, A.S.G.; Driver, S.P.; Dunne, L.; Alpaslan, M.; Brough, S.; Cluver, M.E.; Eardley, E.; Farrow, D.J.; Heymans, C.; Hildebrandt, H.; Hopkins, A.M.; Kelvin, L.S.; Loveday, J.; Moffett, A.J.; Norberg, P.; Owers, M.S.; Taylor, E.N.; Wright, A.H.; Bamford, S.P.; Bland-Hawthorn, J.; Bourne, N.; Bremer, M.N.; Colless, M.; Conselice, C.J.; Croom, S.M.; Davies, L.J.M.; Foster, C.; Grootes, M.W.; Holwerda, B.W.; Jones, D.H.; Kafle, P.R.; Kuijken, K.; Lara-Lopez, M.A.; Lopez-Sanchez, A.R.; Meyer, M.J.; Phillipps, S.; Sutherland, W.J.; van Kampen, E.; Wilkins, S.M.
We describe data release 3 (DR3) of the Galaxy And Mass Assembly (GAMA) survey. The GAMA survey is a spectroscopic redshift and multi-wavelength photometric survey in three equatorial regions each of 60.0 deg^2 (G09, G12, G15), and two southern regions of 55.7 deg^2 (G02) and 50.6 deg^2 (G23). DR3 consists of: the first release of data covering the G02 region and of data on H-ATLAS sources in the equatorial regions; and updates to data on sources released in DR2. DR3 includes 154809 sources with secure redshifts across four regions. A subset of the G02 region is 95.5% redshift complete to r<19.8 over an area of 19.5 deg^2, with 20086 galaxy redshifts, that overlaps substantially with the XXL survey (X-ray) and VIPERS (redshift survey). In the equatorial regions, the main survey has even higher completeness (98.5%), and spectra for about 75% of H-ATLAS filler targets were also obtained. This filler sample extends spectroscopic redshifts, for probable optical counterparts to H-ATLAS sub-mm sources, to 0.8 ma...
[Fluorescence Determination of Trace Se with the Hydride-K13-Rhodamine 6G System].
Liang, Ai-hui; Li, Yuan; Huang, Shan-shan; Luo, Yang-he; Wen, Gui-qing; Jiang, Zhi-liang
2015-05-01
Se is a necessary trace element for human and animals, but the excess intake of Se caused poison. Thus, it is very important to determination of Se in foods and water. The target of this study is development of a new, sensitive and selective hydride generation-molecular fluorescence method for the determination of Se. In 0. 36 mol . L-1 sulfuric acid, NaBH4 as reducing agent, Se (IV) is reduced to H2 Se. Usin3-g I solution as absorption liquid3, I- is reduced to I- by H2Se. When adding rhodamine 6G, Rhodamine 6G and I3- form association particles, which lead to the fluorescence intensity decreased. When Se(IV) existing, Rhodamine 6G and I3- bind less, And the remaining amount of Rhodamine 6G increase. So the fluorescence intensity is enhanced. The analytical conditions were optimized, a 0. 36 ml . L-1 H2SO4, 21. 6.g . L-1 NaBH4, 23.3 µm . L-1 rhodamine 6G, and 50 µmol . L-1 KI3 were chosen for use. When the excitation wavelength is at 480nm, the Rayleigh scattering peak does not affect the fluorescence recording, and was selected for determination of Se. Under the selected conditions, Se(IV) concentration in the 0. 02~0. 60 µg . mL-1 range and the increase value of the fluorescence intensity (ΔF) at 562 nm linear relationship. The linear regression equation is ΔF562 nm =12. 6c + 20. 9. The detecton limit was 0.01 µ.g . L-1. The influence of coexistence substances on the hydride generatin-molecular fluorescence determination of 5. 07 X10(-6) mol . L-1 Se(IV) was considered in details. Results showed that this new fluorescence method is of high selectivity, that is, 0. 5 mmol. L-1 Ba2+, Ca2+, Zn2+ and Fe3+, 0. 25 mmol . L-1 . Mg2+, 0. 05 mmol . L-1 K+, 0. 2 mmol . L-1 Al3+, 0. 025 mmol . L-1 Te(VI) do not interfere with the determination. The influence of Hg2+, CD2+ and Cu2+ that precipitate with Se(IV), can be eliminated by addition of complex reagent. This hydride generation-molecular fluorescence method has been applied to determination of trace Se in water
Selective laser etching or ablation for fabrication of devices
Buttner, Ulrich; Salama, Khaled N.; Sapsanis, Christos
2017-01-01
Methods of fabricating devices vial selective laser etching are provided. The methods can include selective laser etching of a portion of a metal layer, e.g. using a laser light source having a wavelength of 1,000 nm to 1,500 nm. The methods can
Wakoh, M; Farman, A G; Scarfe, W C; Shibuya, H; Nishikawa, K; Kuroyanagi, K
1997-02-01
Sensitometric properties, clinical image quality, and patient dose requirements are important considerations when selecting film for cephalometrics. Two recently released films, XD/A Plus and ST 8G green sensitive films, were studied. The films were each combined with Grenex G8 (Fuji Medical) green-fluorescing matched and BH-III (Kasei Optonix) blue-fluorescing mismatched intensifying screens. The density response and resolution for each screen-film combination were evaluated by use of the characteristic curve and modulation transfer function. The kilovoltage settings providing clinically acceptable images were assessed individually by 12 observers. Clinically acceptable images for each combination were also compared, and the skin entrance doses in the temporomandibular joint region were determined. The average contrast at the most effective density range was found to be slightly higher for the BH-III group than for the G8 group. The modulation transfer function for the BH-III group was inferior to that for the G8 screens. There were no significant differences in diagnostically acceptable image quality among the four combinations; nevertheless the BH-III screen group required two to three times more exposure than the G8 screen group. XD/A Plus and ST8G films provide acceptable image detail for cephalometrics. To minimize the patient dose they should be used with green-emitting screens.
Domain-Specific Control of Selective Attention
Lin, Szu-Hung; Yeh, Yei-Yu
2014-01-01
Previous research has shown that loading information on working memory affects selective attention. However, whether the load effect on selective attention is domain-general or domain-specific remains unresolved. The domain-general effect refers to the findings that load in one content (e.g. phonological) domain in working memory influences processing in another content (e.g., visuospatial) domain. Attentional control supervises selection regardless of information domain. The domain-specific effect refers to the constraint of influence only when maintenance and processing operate in the same domain. Selective attention operates in a specific content domain. This study is designed to resolve this controversy. Across three experiments, we manipulated the type of representation maintained in working memory and the type of representation upon which the participants must exert control to resolve conflict and select a target into the focus of attention. In Experiments 1a and 1b, participants maintained digits and nonverbalized objects, respectively, in working memory while selecting a target in a letter array. In Experiment 2, we presented auditory digits with a letter flanker task to exclude the involvement of resource competition within the same input modality. In Experiments 3a and 3b, we replaced the letter flanker task with an object flanker task while manipulating the memory load on object and digit representation, respectively. The results consistently showed that memory load modulated distractibility only when the stimuli of the two tasks were represented in the same domain. The magnitude of distractor interference was larger under high load than under low load, reflecting a lower efficacy of information prioritization. When the stimuli of the two tasks were represented in different domains, memory load did not modulate distractibility. Control of processing priority in selective attention demands domain-specific resources. PMID:24866977
Preparation and characterization of PANI@G/CWO nanocomposite for enhanced 2-nitrophenol sensing
Khan, Anish; Khan, Aftab Aslam Parwaz; Rahman, Mohammed M.; Asiri, Abdullah M.; Inamuddin; Alamry, Khalid A.; Hameed, Salem A.
2018-03-01
A new material by polymer insertion via graphene oxide into cerium tungstate was prepared by very simple oxidation-reduction method. Aniline polymerization was done on the surface of graphene oxide (GO) which was reduced to graphene (G) simultaneously mixed with separately prepared inorganic matrices of cerium tungstate (Ce2(WO4)3 (CWO)). PANI@G/CWO was characterized by various spectroscopic methods as SEM, FTIR, TGA, XRD and XPS to confirm its possibilities. Selective 2-nitrophenol sensor was fabricated on flat glassy carbon electrode (GCE) and PANI@G/CWO nanocomposites in the form of thin layer. It was found excellent sensitivity as well as long life spam with broad dynamic concentration range (LDR) that showed efficient electrochemical performance towards 2-nitrophenol on fabricated chemical sensor by PANI@G/CWO. The linear calibration curve (r2 = 0.9914) with wide range of 2-nitrophenol concentration (1.0 nM-1.0 mM) was found having the detection limit of 0.87 nM while the sensitivity of the sensor was around 1.229 μ A μM-1 cm-2. It was introduced a new route for the development of a versatile phenolic sensor based on PANI@G/CWO nanocomposites by I-V method that is proved more selective and sensitive for environmental toxic materials.
Effects of intraguild predators on nest-site selection by prey.
Huang, Wen-San; Pike, David A
2012-01-01
Nest-site selection involves tradeoffs between the risk of predation (on females and/or nests) and nest-site quality (microenvironment), and consequently suitable nesting sites are often in limited supply. Interactions with "classical" predators (e.g., those not competing for shared resources) can strongly influence nest-site selection, but whether intraguild predation also influences this behavior is unknown. We tested whether risk of predation from an intraguild predator [the diurnal scincid lizard Eutropis (Mabuya) longicaudata] influences nest-site selection by its prey (the nocturnal gecko Gekko hokouensis) on Orchid Island, Taiwan. These two species putatively compete for shared resources, including invertebrate prey and nesting microhabitat, but the larger E. longicaudata also predates G. hokouensis (but not its hard-shelled eggs). Both species nested within a concrete wall containing a series of drainage holes that have either one ("closed-in") or two openings ("open"). In allopatry, E. longicaudata preferred to nest within holes that were plugged by debris (thereby protecting eggs from water intrusion), whereas G. hokouensis selected holes that were open at both ends (facilitating escape from predators). When we experimentally excluded E. longicaudata from its preferred nesting area, G. hokouensis not only nested in higher abundances, but also modified its nest-site selection, such that communal nesting was more prevalent and both open and closed-in holes were used equally. Egg viability was unaffected by the choice of hole type, but was reduced slightly (by 7%) in the predator exclusion area (presumably due to higher local incubation temperatures). Our field experiment demonstrates that intraguild predators can directly influence the nest density of prey by altering maternal nest-site selection behavior, even when the predator and prey are active at different times of day and the eggs are not at risk of predation.
Characterization of rambutan (Nephelium lappaceum fruits from outstanding mexican selections
Directory of Open Access Journals (Sweden)
Marian Guadalupe Hernández Arenas
2010-12-01
Full Text Available Fruits of five regional selections of rambutan (Nephelium lappaceum L. were characterized to identify those with international marketing quality to promote their propagation in Mexico, improvement and conservation in germoplasm bank. The fruits were harvested in June, July, and August 2008 and, after each harvest, were assessed for shape (length/diameter, firmness, fruit weight, number of fruits per kilogram, weight and percentage of pericarp, seed and aril, total soluble solids, total sugars, vitamin C content, pH, and titratable acidity. In addition, a sensorial evaluation was carried out with 31 panelists who graded each selection for color, sweetness, and acidity. Fruits of five selections were ovoid, and with the following characteristics: firmness values from 43.7 to 51.0 N, fruit weight ranged from 22.4 to 34.7 g, registering from 28.9 to 45.0 fruits per kg; pericarp weight from 10.5 to 17.3 g (45.9 to 49.9% of the total fruit weight; total seed weight from 2.2 to 2.5 g (7.0 to 10.0%; average arils weight from 8.9 to 13.1 g (37.5 to 41.4%. The fruits had high contents of total soluble solids (17.8 to 20.4 ºBrix, total sugars (211.95 to 242.70 mg/100g in the edible portion, vitamin C (37.9 to 69.1 mg/100 g, pH 5.0, and titratable acidity of 0.20 to 0.28%. The fruits from the RT-01 and RT-05 selections had better attributes in fruit weight, total soluble solids and titratable acidity and were better accepted by the panelists. Harvest date significantly affects rambutan fruit quality; at the middle and end of the season harvested fruits had better qualitative characteristics for the marketing.
Directory of Open Access Journals (Sweden)
María Garcés Quílez
2018-04-01
Full Text Available In response to climate change, which is caused by the increasing pollution of the environment and leads to the deterioration of human health, future electricity generations should reduce reliance on fossil fuels by growing the use of clean and renewable energy generation sources and by using clean vehicle technologies. Battery storage systems have been recognized as one of the most promising approaches for supporting the renewable energy generation sources and cleanly powering vehicles instead of burning gasoline and diesel fuel. However, the cost of batteries is still a prominent barrier for their use in stationary and traction applications. As a rule, the cost of batteries can be decreased by lowering material costs, enhancing process efficiencies, and increasing production volume. Another more effective solution is called Vehicle-to-grid (V2G application. In V2G application, the battery system can be used to support the grid services, whereas the battery is still in the vehicle. To make a battery system economically viable for V2G/G2V applications, an effective power-electronics converter should be selected as well. This converter should be supported by an advanced control strategy. Therefore, this article provides a detailed technical assessment and review of V2G/G2V concepts, in conjunction with various power-electronics converter topologies. In this paper, modeling and detailed control strategies are fully designed and investigated in terms of dynamic response and harmonics. Furthermore, an extensive design and analysis of charging systems for low-duty/high-duty vehicles are also presented.
Peleg, Orna; Markus, Andrey; Eviatar, Zohar
2012-01-01
Research investigating hemispheric asymmetries in meaning selection using homophonic homographs (e.g., "bank"), suggests that the left hemisphere (LH) quickly selects contextually relevant meanings, whereas the right hemisphere (RH) maintains a broader spectrum of meanings including those that are contextually irrelevant (e.g., Faust & Chiarello,…
DEFF Research Database (Denmark)
Regenberg, Birgitte; Hansen, J.
2000-01-01
the GAP1 gene. This is caused by recombination between two Salmonella typuimurium hisG direct repeats embracing GAP1, and will result in a sub-population of gap1 cells. Such cells are selected on a medium containing D-histidine, and may subsequently be used for a second gene disruption. Hence, multiple...... flanked by short (60 bp) stretches of the gene in question. Through homologous recombination, the cassette will integrate into the target gene, which is thus replaced by GAP1, and mutants are selected for on minimal L-citrulline medium. When propagated under non-selective conditions, some cells will lose...... gene disruptions can be made fast, cheaply and easily in a gap1 strain, with two positive selection steps for each disruption. Copyright (C) 2000 John Wiley & Sons, Ltd....
Electrochemiluminescent detection of Pb{sup 2+} by graphene/gold nanoparticles and CdSe quantum dots
Energy Technology Data Exchange (ETDEWEB)
Lu, Liping, E-mail: lipinglu@bjut.edu.cn; Guo, Linqing; Li, Jiao; Kang, Tianfang; Cheng, Shuiyuan
2016-12-01
Highlights: • An ECL sensor was fabricated based on the distance dependent between CdSe QDs and gold nanoparticles. • The ssDNA strands rich in G bases adopt the G4 conformation when Pb{sup 2+} is present in detection system. • AuNPs/RGO composite improved the performance of electron transfer of sensor. • The ECL sensor was used to detect Pb{sup 2+} concentration in an actual water sample with high sensitivity and selectivity. - Abstract: A highly sensitive electrochemiluminescent detection method for lead ions (Pb(II)) was fabricated based on the distance-dependent quenching of the electrochemiluminescence from CdSe quantum dots by nanocomposites of graphene and gold nanoparticles. Graphene/gold nanoparticles were electrochemically deposited onto a glassy carbon electrode through the constant potential method. Thiol-labeled DNA was then assembled on the surface of the electrode via gold−sulfur bonding, following which the amino-labeled terminal of the DNA was linked to carboxylated CdSe quantum dots by the formation of amide bonds. The 27-base aptamer was designed with two different domains: the immobilization and detection sequences. The immobilization sequence was paired with 12 complementary bases and immobilized on the gold electrode; the single-stranded detection sequence, rich in G bases, formed a G-quadruplex (G4) structure in the presence of Pb{sup 2+}. The formation of G4 shortens the distance between the CdSe quantum dots and the Au electrode, which decreases the electrochemiluminescent intensity in a linear fashion, proportional to the concentration of Pb(II). The linear range of the sensor was 10{sup −10} to 10{sup −8} mol/L (R = 0.9819) with a detection limit of 10{sup −10} mol/L. This sensor detected Pb(II) in real water samples with satisfactory results.
Selective carnivory by Euphausia lucens
Gibbons, M. J.; Pillar, S. C.; Stuart, V.
1991-07-01
Stomach contents of adult Euphausia lucens were analysed to determine what criteria this euphausiid uses to select copepod prey. The results indicate that although E. lucens of all sizes ingest a wide range of prey sizes at apparently ambient proportions, small copepods (e.g. Oithona) are consistently consumed in greater than ambient amounts. Small copepods (especially Oithona) are known to move slowly, and have been shown to be more susceptible to predation via negative pressure than larger copepods. In the presence of an abundant phytoplankton food supply and in an otherwise generally non-selective diet, we conclude that such copepod selection by E. lucens is passive. This is in line with the idea of a non-hunting, preferentially herbivorous zooplankter.
Chan, Anita S Y; Mudhar, Hardeep; Shen, Sunny Yu; Lang, Stephanie S; Fernando, Malee; Hilmy, Maryam Hazly; Guppy, Naomi Jayne; Rennie, Ian; Dunkley, Lisa; Al Jajeh, Issam
2017-11-01
To determine the role of serum and tissue IgG2 in orbital biopsies with the histological features of IgG4-related disease (IgG4-RD) in comparison with non-IgG4-related orbital inflammatory disorders (OID), including autoimmune disorders. This is an international (Sheffield, UK, and Singapore) collaborative, retrospective case review of 69 patients (38 from Singapore National Eye Centre and 31 from Royal Hallamshire Hospital, Sheffield) with orbital inflammatory biopsies between 2002 and 2016. Clinical information and histology were reviewed and cases were classified into three groups: Group 1: IgG4-RD orbital inflammation (n=43); Group 2: idiopathic OID (n=12) and Group 3: autoimmune OID (n=14). Serum IgG1, IgG2, IgG3 and IgG4 levels were collated where available and immunohistochemistry (IHC) for tissue IgG2 plasma cells was performed. Dual IHC showed IgG2 plasma cells as a distinct population from IgG4 plasma cells. Significant (twofold) serum IgG2 elevation was noted among IgG4-RD (group 1), idiopathic (group 2) and autoimmune OID (group 3). Similarly, significant elevation of tissue IgG2 plasma cells was also seen among IgG4-RD (group 1), idiopathic and autoimmune OID (groups 2 and 3). Significant elevations of serum IgG2 and tissue IgG2 plasma cells are present in orbital IgG4-RD in comparison with non-IgG4 orbital inflammation (idiopathic and autoimmune OID), suggesting that IgG2 may play a role in IgG4-RD. A serum IgG2 cut-off >5.3 g/L was found to be 80% sensitive and 91.7% specific for orbital IgG4-RD, with an accuracy of 0.90. Tissue IgG2 and IgG4 subclass reporting may provide additional insight regarding the 'IgG4-RD' pathogenesis. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Afraid To Be Heard: The Selectively Mute Child.
Longo, Sharon L.
2001-01-01
Presents facts about selective mutism, an anxiety disorder believed to be caused by low levels of serotonin in the brain, discussing its effects on school children, explaining how to get the necessary help (e.g., talking to health professionals and becoming educated about the disorder), and noting what parents can do (e.g., help raise the child's…
van Ree, R.; Aalberse, R. C.
1995-01-01
From a group of 92 patients receiving grass pollen immunotherapy, and selected on grounds of high IgG4 titers against Lol p I, sera were tested for IgG4 antibodies against the glycosylated grass pollen allergen Lol p XI. In 72 of 92 cases IgG4 antibodies were demonstrated. The N-glycan of Lol p XI
Selecting Schizosaccharomyces pombe diploids
DEFF Research Database (Denmark)
Ekwall, Karl; Thon, Genevieve
2017-01-01
Here we describe procedures for the selection of diploid Schizosaccharomyces pombe. ade6-M210/ade6-M216 heteroallelic complementation is widely used to select for Ade+ diploids. Such diploids will readily sporulate when starved of nitrogen. For some investigations, stable diploids are preferable (e.......g., for genetic complementation tests), and in these cases mating an h− strain with an h90 mat2-Pi-102 strain can be used to prevent sporulation. When ade6-M210/ade6-M216 mutations impact on, or show synthetic interactions with, the gene of interest, two different auxotrophic markers can be used to select...
Irradiated graphite studies prior to decommissioning of G1, G2 and G3 reactors
International Nuclear Information System (INIS)
Bonal, J.P.; Vistoli, J.Ph.; Combes, C.
2005-01-01
G1 (46 MW th ), G2 (250 MW th ) and G3 (250 MW th ) are the first French plutonium production reactors owned by CEA (Commissariat a l'Energie Atomique). They started to be operated in 1956 (G1), 1959 (G2) and 1960 (G3); their final shutdown occurred in 1968, 1980 and 1984 respectively. Each reactor used about 1200 tons of graphite as moderator, moreover in G2 and G3, a 95 tons graphite wall is used to shield the rear side concrete from neutron irradiation. G1 is an air cooled reactor operated at a graphite temperature ranging from 30 C to 230 C; G2 and G3 are CO 2 cooled reactors and during operation the graphite temperature is higher (140 C to 400 C). These reactors are now partly decommissioned, but the graphite stacks are still inside the reactors. The graphite core radioactivity has decreased enough so that a full decommissioning stage may be considered. Conceming this decommissioning, the studies reported here are: (i) stored energy in graphite, (ii) graphite radioactivity measurements, (iii) leaching of radionuclide ( 14 C, 36 Cl, 63 Ni, 60 Co, 3 H) from graphite, (iv) chlorine diffusion through graphite. (authors)
Microporous carbonaceous adsorbents for CO2 separation via selective adsorption
Zhao, Yunfeng; Liu, Xin; Han, Yu
2015-01-01
Selective adsorption of CO2 has important implications for many energy and environment-related processes, which require the separation of CO2 from other gases (e.g. N2 and CH4) with high uptakes and selectivity. The development of high
DEFF Research Database (Denmark)
Nguyen, Giang Huong; Tang, Weiliang; Robles, Ana I
2014-01-01
Bloom syndrome is a rare autosomal recessive disorder characterized by genetic instability and cancer predisposition, and caused by mutations in the gene encoding the Bloom syndrome, RecQ helicase-like (BLM) protein. To determine whether altered gene expression might be responsible for pathologic...