WorldWideScience

Sample records for g-quadruplex nucleic acid

  1. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  2. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  3. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    Science.gov (United States)

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  5. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  6. Effect of Urea on G-Quadruplex Stability.

    Science.gov (United States)

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  7. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  8. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  9. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Science.gov (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  10. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    Science.gov (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  12. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    Science.gov (United States)

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  13. Experimental approaches to identify cellular G-quadruplex structures and functions.

    Science.gov (United States)

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

    2012-05-01

    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  15. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Science.gov (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  17. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Science.gov (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  19. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  20. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  1. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  2. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

    Science.gov (United States)

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-01-01

    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  3. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    Science.gov (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Local epigenetic reprogramming induced by G-quadruplex ligands

    Science.gov (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  5. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

    Science.gov (United States)

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

    2018-06-01

    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  6. Macrocyclic G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, M C; Ulven, Trond

    2010-01-01

    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  7. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  8. Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2003-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  9. Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    1998-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  10. Peptide Nucleic Acids (PNA)

    DEFF Research Database (Denmark)

    2002-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  11. Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2004-01-01

    A novel class of compounds known as peptide nucleic acids, bind complementary DNA and RNA strands, and generally do so more strongly than the corresponding DNA or RNA strands while exhibiting increased sequence specificity and solubility. The peptide nucleic acids comprise ligands selected from...

  12. Peptide Nucleic Acid Synthons

    DEFF Research Database (Denmark)

    2004-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  13. Locked nucleic acid

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Sørensen, Mads D; Wengel, Jesper

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing very high affinity and excellent specificity toward complementary DNA and RNA, and LNA oligonucleotides have been applied as antisense molecules both in vitro and in vivo. In this review, we briefly describe the basic...

  14. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    Science.gov (United States)

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  15. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Portable nucleic acid thermocyclers.

    Science.gov (United States)

    Almassian, David R; Cockrell, Lisa M; Nelson, William M

    2013-11-21

    A nucleic acid thermal cycler is considered to be portable if it is under ten pounds, easily carried by one individual, and battery powered. Nucleic acid amplification includes both polymerase chain reaction (e.g. PCR, RT-PCR) and isothermal amplification (e.g. RPA, HDA, LAMP, NASBA, RCA, ICAN, SMART, SDA). There are valuable applications for portable nucleic acid thermocyclers in fields that include clinical diagnostics, biothreat detection, and veterinary testing. A system that is portable allows for the distributed detection of targets at the point of care and a reduction of the time from sample to answer. The designer of a portable nucleic acid thermocycler must carefully consider both thermal control and the detection of amplification. In addition to thermal control and detection, the designer may consider the integration of a sample preparation subsystem with the nucleic acid thermocycler. There are a variety of technologies that can achieve accurate thermal control and the detection of nucleic acid amplification. Important evaluation criteria for each technology include maturity, power requirements, cost, sensitivity, speed, and manufacturability. Ultimately the needs of a particular market will lead to user requirements that drive the decision between available technologies.

  17. Structure, stability and behaviour of nucleic acids in ionic liquids

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Sugimoto, Naoki

    2014-01-01

    Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178

  18. A DNA origami nanorobot controlled by nucleic acid hybridization

    KAUST Repository

    Torelli, Emanuela

    2014-03-20

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. A DNA origami nanorobot controlled by nucleic acid hybridization.

    Science.gov (United States)

    Torelli, Emanuela; Marini, Monica; Palmano, Sabrina; Piantanida, Luca; Polano, Cesare; Scarpellini, Alice; Lazzarino, Marco; Firrao, Giuseppe

    2014-07-23

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

    Science.gov (United States)

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2013-10-01

    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  1. Nucleic acids in circulation

    Indian Academy of Sciences (India)

    Elevated blood levels of extracellular nucleic acids have been reported in various disease conditions; such as ageing and age-related degenerative disorders, cancer; acute and chronic inflammatory conditions, severe trauma and autoimmune disorders. In addition to genomic DNA and nucleosomes, mitochondrial DNA is ...

  2. Molecular Structure of Nucleic Acids

    Indian Academy of Sciences (India)

    Molecular Structure of Nucleic Acids. A Structure for Deoxyribose Nucleic Acid. J. D. Watson and F. H. C. Crick. Medical Research Council Unit for the Study of the Molecular Structure of Biological. Systems, Cavendish Laboratory, Cambridge. April 2. We wish to suggest a structure for the salt of deoxyribose nucleic acid ...

  3. Simultaneous G-Quadruplex DNA Logic.

    Science.gov (United States)

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

    Science.gov (United States)

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

    2012-09-19

    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  6. Logic gates and antisense DNA devices operating on a translator nucleic Acid scaffold.

    Science.gov (United States)

    Shlyahovsky, Bella; Li, Yang; Lioubashevski, Oleg; Elbaz, Johann; Willner, Itamar

    2009-07-28

    A series of logic gates, "AND", "OR", and "XOR", are designed using a DNA scaffold that includes four "footholds" on which the logic operations are activated. Two of the footholds represent input-recognition strands, and these are blocked by complementary nucleic acids, whereas the other two footholds are blocked by nucleic acids that include the horseradish peroxidase (HRP)-mimicking DNAzyme sequence. The logic gates are activated by either nucleic acid inputs that hybridize to the respective "footholds", or by low-molecular-weight inputs (adenosine monophosphate or cocaine) that yield the respective aptamer-substrate complexes. This results in the respective translocation of the blocking nucleic acids to the footholds carrying the HRP-mimicking DNAzyme sequence, and the concomitant release of the respective DNAzyme. The released product-strands then self-assemble into the hemin/G-quadruplex-HRP-mimicking DNAzyme that biocatalyzes the formation of a colored product and provides an output signal for the different logic gates. The principle of the logic operation is, then, implemented as a possible paradigm for future nanomedicine. The nucleic acid inputs that bind to the blocked footholds result in the translocation of the blocking nucleic acids to the respective footholds carrying the antithrombin aptamer. The released aptamer inhibits, then, the hydrolytic activity of thrombin. The system demonstrates the regulation of a biocatalytic reaction by a translator system activated on a DNA scaffold.

  7. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  8. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  9. Origin of nucleic acids

    International Nuclear Information System (INIS)

    Prieur, B.E.

    1995-01-01

    The appearance of nucleic acids is the first event after the birth of membranes which made it possible to assure the perenniality of information. The complexity of these molecules has led some scientists to propose that they were not prebiotic but rather derived a more simple and achiral primitive ancestor. This hypothesis suggests that ribose possesses properties that allowed the formation of certain polysaccharides which evolved to RNA. The first step of the hypothesis is the selection and concentration of ribofuranose. This sugar has chelating properties and its alpha-ribofuranose is favoured in the chelating position. The density of the sugar with a heavy cation is greater than water and thus the complex can escape the UV radiation at the surface of the ocean. The particularity of ribose is to be able to form a homochiral regular array of these basic chelating structures with pyrophosphite. These arrays evolve towards the formation of polysaccharides (poly ribose phosphate) which have a very organized structure. These polysaccharides in turn evolve to RNA by binding of adenine and deoxyguanine which are HCN derivatives that can react with the polysaccharides. The primitive RNA is methylated and oxidized to form prebiotic RNA with adenosine, cytidine, 7methyl-guanosine and ribothymidine as nucleic bases. The pathway of biosynthesis of DNA form RNA will be studied. I suggest that the appearance of DNA results form the interaction between prebiotic double stranded RNA and proteins. DNA could be a product of RNA degradation by proteins. The catabolism of RNA to DNA requires a source of free radicals, protons and hydrides. RNA cannot produce free radicals, which are provided by the phenol group of the amino acid tyrosien. Protons are provided by the medium and hydrides are provided by 7-methyl-guanosine which can fix hydrides coming from hydrogen gas and donate them for the transformation of a riboside to a deoxyriboside. This pathway suggests that DNA appeared at

  10. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    Science.gov (United States)

    Schwindt, Eike; Paeschke, Katrin

    2017-11-02

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  11. RPA-mediated unfolding of systematically varying G-quadruplex structures.

    Science.gov (United States)

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

    2013-05-21

    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  12. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Science.gov (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Nucleic Acid-Based Nanoconstructs

    Science.gov (United States)

    Focuses on the design, synthesis, characterization, and development of spherical nucleic acid constructs as effective nanotherapeutic, single-entity agents for the treatment of glioblastoma multiforme and prostate cancers.

  14. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Science.gov (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Identifying a base in a nucleic acid

    Science.gov (United States)

    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

    2005-02-08

    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  16. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  18. Improved thrombin binding aptamer by incorporation of a single unlocked nucleic acid monomer

    DEFF Research Database (Denmark)

    Pasternak, Anna; Hernandez, Frank J; Rasmussen, Lars Melholt

    2011-01-01

    A 15-mer DNA aptamer (named TBA) adopts a G-quadruplex structure that strongly inhibits fibrin-clot formation by binding to thrombin. We have performed thermodynamic analysis, binding affinity and biological activity studies of TBA variants modified by unlocked nucleic acid (UNA) monomers. UNA...... that a UNA monomer is allowed in many positions of the aptamer without significantly changing the thrombin-binding properties. The biological effect of a selection of the modified aptamers was tested by a thrombin time assay and showed that most of the UNA-modified TBAs possess anticoagulant properties......, and that the construct with a UNA-U monomer in position 7 is a highly potent inhibitor of fibrin-clot formation....

  19. Histidine-Containing Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2000-01-01

    Peptide nucleic acids containing histidine moieties are provided. These compounds have applications including diagnostics, research and potential therapeutics.......Peptide nucleic acids containing histidine moieties are provided. These compounds have applications including diagnostics, research and potential therapeutics....

  20. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    Science.gov (United States)

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  1. Cleaving Double-Stranded DNA with Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    1997-01-01

    Peptide nucleic acids and analogues of peptide nucleic acids are used to form duplex, triplex, and other structures with nucleic acids and to modify nucleic acids. The peptide nucleic acids and analogues thereof also are used to modulate protein activity through, for example, transcription arrest......, transcription initiation, and site specific cleavage of nucleic acids....

  2. Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

    Science.gov (United States)

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

    2016-10-13

    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  3. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Science.gov (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  4. Multiplexed microfluidic approach for nucleic acid enrichment

    Science.gov (United States)

    VanderNoot, Victoria A.; Langevin, Stanley Alan; Bent, Zachary; Renzi, Ronald F.; Ferko, Scott M.; Van De Vreugde, James L.; Lane, Todd; Patel, Kamlesh; Branda, Steven

    2016-04-26

    A system for enhancing a nucleic acid sample may include a one pump, a denaturing chamber; a microfluidic hydroxyapatite chromatography device configured for performing hydroxyapatite chromatography on the nucleic acid sample, a sample collector, and tubing connecting the pump with the denaturing chamber, the hydroxyapatite chromatography device and the sample collector such that the pump may be used to move the nucleic acid sample from the denaturing chamber to the hydroxyapatite chromatography device and then to the sample collector.

  5. Double-Stranded Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2001-01-01

    A novel class of compounds, known as peptide nucleic acids, form double-stranded structures with one another and with ssDNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker.......A novel class of compounds, known as peptide nucleic acids, form double-stranded structures with one another and with ssDNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  6. Selectivity in ligand recognition of G-quadruplex loops.

    Science.gov (United States)

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

    2009-03-03

    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  7. Nucleic acid drugs: a novel approach

    African Journals Online (AJOL)

    Administrator

    Nucleic acid base sequence of proteins plays a crucial role in the expression of gene. The gene is responsible for the synthesis of proteins and these proteins, which are synthesized, are responsible for the biological process and also for dreadful diseases as well. Once if the nucleic acid sequence is altered, we would be ...

  8. Synthetic Procedures for Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2004-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  9. Nucleic Acid Aptamers Against Proteases

    DEFF Research Database (Denmark)

    Dupont, D M; Andersen, L M; Bøtkjær, Kenneth Alrø

    2011-01-01

    , directed against blood coagulation factors, are in clinical trials as anticoagulant drugs. Several of the studies on protease-binding aptamers have been pioneering and trend-setting in the field. The work with protease-binding aptamers also demonstrates many interesting examples of non-standard selection......Proteases are potential or realized therapeutic targets in a wide variety of pathological conditions. Moreover, proteases are classical subjects for studies of enzymatic and regulatory mechanisms. We here review the literature on nucleic acid aptamers selected with proteases as targets. Designing...... small molecule protease inhibitors of sufficient specificity has proved a daunting task. Aptamers seem to represent a promising alternative. In our review, we concentrate on biochemical mechanisms of aptamer selection, proteinaptamer recognition, protease inhibition, and advantages of aptamers...

  10. Circulating nucleic acids and evolution.

    Science.gov (United States)

    Anker, Philippe; Stroun, Maurice

    2012-06-01

    J.B. Lamarck in 1809 was the first to present a theory of evolution. He proposed it was due to the adaptation of species to environmental changes, this adaptation being acquired by the offspring. In 1868, Darwin suggested that cells excrete gemmules, which circulate through the body and reach the gonads where they are transmitted to the next generation. His main argument came from graft hybrids. In the fifties and sixties, Russian geneticists, rejecting neo-Darwinism, said that acquired characteristics were the basis of evolution. The main experiments on which they based their theory were the transmission of hereditary characteristics by a special technique of grafting between two varieties of plants. We repeated this kind of experiment and also succeeded in obtaining hereditary modifications of the pupil plants that acquired some characteristics of the mentor variety. Rather than adopting the views of the Russian scientists, we suggested that DNA was circulating between the mentor and pupil plants. Hirata's group have shown recently, by using molecular techniques such as cloning, RFLP PCR and sequencing some genes of their graft hybrids of pepper plants, that transfer of informative molecules from the mentor to the pupil plant does exist. Nucleic acids are actively released by cells; they circulate in the body. They can transform oncogenically or trigger antibody response but the only genetic transformation showing that DNA can go from the soma to the germen comes from graft hybrids. This suggests that circulating nucleic acids, in this case DNA, like Darwin's gemmules, play a role in the mechanism of evolution.

  11. Molecular radiobiology of nucleic acids

    Energy Technology Data Exchange (ETDEWEB)

    Fuciarelli, A F

    1987-01-01

    In addition to radiolytic adenine release, radiolysis of adenosine 5'-monophosphate, in the absence of oxygen, can result in the formation of 8-hydroxyadenosine 5'-monophosphate and both the (R)- and (S)-epimer of 8,5'-cycloadenosine 5'-monophosphate. The mononucleoside derivatives of these modified nucleotides were also observed in irradiated solutions of adenosine and in the enzyme hydrolysates of irradiated solutions of polyadenylic acid (poly A) using high-performance liquid chromatography (HPLC). In an effort to detect 8,5'-cyclo(deoxy) adenosine formation in irradiated nucleic acids, polyclonal antiserum were raised with specificity to the 8,5'-cycloadenosine 5'-monophosphate moiety and used in an enzyme-linked immunosorbent assay (ELISA). The 8,5'-cyclo(deoxy)adenosine moiety could be detected in nitrous oxide-saturated aqueous solutions containing unhydrolyzed poly A at 10 Gy and DNA at 200 Gy using the colorimetric ELISA. Correlation of product yield measured by ELISA with HPLC analysis of irradiated, enzyme-hydrolyzed solutions of poly A revealed that the ELISA was precisely reflecting changes in the combined yield of (R)- and (S)-8,5'-cycloadenosine.

  12. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Science.gov (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  13. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Science.gov (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  14. Nucleic acids, proteins, and chirality

    Science.gov (United States)

    Usher, D. A.; Profy, A. T.; Walstrum, S. A.; Needels, M. C.; Bulack, S. C.; Lo, K. M.

    1984-01-01

    The present investigation is concerned with experimental results related, in one case, to the chirality of nucleotides, and, in another case, to the possibility of a link between the chirality of nucleic acids, and that of peptides. It has been found that aminoacylation of the 'internal' hydroxyl group of a dinucleoside monophosphate can occur stereoselectively. However, this reaction has not yet been made a part of a working peptide synthesis scheme. The formation and cleavage of oligonucleotides is considered. In the event of the formation of a helical complex between the oligonucleotide and the polymer, 1-prime,5-prime-bonds in the oligomer are found to become more resistant towards cleavage. The conditions required for peptide bond formation are examined, taking into account the known structures of RNA and possible mechanisms for prebiotic peptide bond formation. The possibility is considered that the 2-prime,5-prime-internucleotide linkage could have played an important part in the early days of biological peptide synthesis.

  15. Nanoparticulate systems for nucleic acid delivery

    NARCIS (Netherlands)

    Varkouhi, A.K.

    2011-01-01

    Development of carrier systems with controllable physicochemical and delivery properties has opened up the possibility of nanomedicines containing nucleic acids. In the last decades, much effort has been dedicated to two exciting approaches in biomedicine, namely gene and RNA interference

  16. Method of Identifying a Base in a Nucleic Acid

    Science.gov (United States)

    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

    1999-01-01

    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  17. Hybridization and sequencing of nucleic acids using base pair mismatches

    Science.gov (United States)

    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

    2001-01-01

    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  18. Probe kit for identifying a base in a nucleic acid

    Science.gov (United States)

    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

    2001-01-01

    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  19. Novel Biochip Platform for Nucleic Acid Analysis

    Directory of Open Access Journals (Sweden)

    Juan J. Diaz-Mochon

    2012-06-01

    Full Text Available This manuscript describes the use of a novel biochip platform for the rapid analysis/identification of nucleic acids, including DNA and microRNAs, with very high specificity. This approach combines a unique dynamic chemistry approach for nucleic acid testing and analysis developed by DestiNA Genomics with the STMicroelectronics In-Check platform, which comprises two microfluidic optimized and independent PCR reaction chambers, and a sequential microarray area for nucleic acid capture and identification by fluorescence. With its compact bench-top “footprint” requiring only a single technician to operate, the biochip system promises to transform and expand routine clinical diagnostic testing and screening for genetic diseases, cancers, drug toxicology and heart disease, as well as employment in the emerging companion diagnostics market.

  20. Peptide Nucleic Acids Having Amino Acid Side Chains

    DEFF Research Database (Denmark)

    1998-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary DNA and RNA strands more strongly than the corresponding DNA or RNA strands, and exhibit increased sequence specificity and solubility. The peptide nucleic acids comprise ligands selected from a group consisting...

  1. Detection of nucleic acid sequences by invader-directed cleavage

    Science.gov (United States)

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  2. Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

    Science.gov (United States)

    Hirashima, Kyotaro; Seimiya, Hiroyuki

    2015-02-27

    Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. G-Quadruplexes influence pri-microRNA processing.

    Science.gov (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  4. Chemical consequences of irradiating nucleic acids

    International Nuclear Information System (INIS)

    Ward, J.F.

    1976-01-01

    On the basis of literature data, a discussion is presented of the DNA damage which would be produced in a cellular environment and an attempt is made to place this damage in perspective as a potential hazard in food irradiation. The topics discussed are radiation damage mechanisms, OH reactions with DNA, base products, sugar products, and evaluation of damage from irradiated nucleic acids

  5. A locked nucleic Acid-based nanocrawler

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Pasternak, Karol; Campbell, Meghan A

    2013-01-01

    Herein we introduce a novel fluorescent LNA/DNA machine, a nanocrawler, which reversibly moves along a directionally polar complementary road controlled by affinity-enhancing locked nucleic acid (LNA) monomers and additional regulatory strands. Polyaromatic hydrocarbon (PAH) dyes attached to 2...

  6. Miniaturized isothermal nucleic acid amplification, a review.

    Science.gov (United States)

    Asiello, Peter J; Baeumner, Antje J

    2011-04-21

    Micro-Total Analysis Systems (µTAS) for use in on-site rapid detection of DNA or RNA are increasingly being developed. Here, amplification of the target sequence is key to increasing sensitivity, enabling single-cell and few-copy nucleic acid detection. The several advantages to miniaturizing amplification reactions and coupling them with sample preparation and detection on the same chip are well known and include fewer manual steps, preventing contamination, and significantly reducing the volume of expensive reagents. To-date, the majority of miniaturized systems for nucleic acid analysis have used the polymerase chain reaction (PCR) for amplification and those systems are covered in previous reviews. This review provides a thorough overview of miniaturized analysis systems using alternatives to PCR, specifically isothermal amplification reactions. With no need for thermal cycling, isothermal microsystems can be designed to be simple and low-energy consuming and therefore may outperform PCR in portable, battery-operated detection systems in the future. The main isothermal methods as miniaturized systems reviewed here include nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rolling circle amplification (RCA), and strand displacement amplification (SDA). Also, important design criteria for the miniaturized devices are discussed. Finally, the potential of miniaturization of some new isothermal methods such as the exponential amplification reaction (EXPAR), isothermal and chimeric primer-initiated amplification of nucleic acids (ICANs), signal-mediated amplification of RNA technology (SMART) and others is presented.

  7. Recent progress in nucleic acids isotachophoresis

    Czech Academy of Sciences Publication Activity Database

    Datinská, Vladimíra; Voráčová, Ivona; Schlecht, U.; Berka, J.; Foret, František

    2018-01-01

    Roč. 41, č. 1 (2018), s. 236-247 ISSN 1615-9306 R&D Projects: GA ČR(CZ) GBP206/12/G014 Institutional support: RVO:68081715 Keywords : isotachophoresis * nucleic acids * sample preparation Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 2.557, year: 2016

  8. Nucleic acid secondary structure prediction and display.

    OpenAIRE

    Stüber, K

    1986-01-01

    A set of programs has been developed for the prediction and display of nucleic acid secondary structures. Information from experimental data can be used to restrict or enforce secondary structural elements. The predictions can be displayed either on normal line printers or on graphic devices like plotters or graphic terminals.

  9. Recent progress in nucleic acids isotachophoresis

    Czech Academy of Sciences Publication Activity Database

    Datinská, Vladimíra; Voráčová, Ivona; Schlecht, U.; Berka, J.; Foret, František

    2018-01-01

    Roč. 41, č. 1 (2018), s. 236-247 ISSN 1615-9306 R&D Projects: GA ČR(CZ) GBP206/12/G014 Institutional support: RVO:68081715 Keywords : isotachophoresis * nucleic acid s * sample preparation Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 2.557, year: 2016

  10. Construction of tunable peptide nucleic acid junctions.

    Science.gov (United States)

    Duan, Tanghui; He, Liu; Tokura, Yu; Liu, Xin; Wu, Yuzhou; Shi, Zhengshuang

    2018-03-15

    We report here the construction of 3-way and 4-way peptide nucleic acid (PNA) junctions as basic structural units for PNA nanostructuring. The incorporation of amino acid residues into PNA chains makes PNA nanostructures with more structural complexity and architectural flexibility possible, as exemplified by building 3-way PNA junctions with tunable nanopores. Given that PNA nanostructures have good thermal and enzymatic stabilities, they are expected to have broad potential applications in biosensing, drug delivery and bioengineering.

  11. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  12. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  13. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Science.gov (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  14. Digital Microfluidics for Nucleic Acid Amplification

    Directory of Open Access Journals (Sweden)

    Beatriz Coelho

    2017-06-01

    Full Text Available Digital Microfluidics (DMF has emerged as a disruptive methodology for the control and manipulation of low volume droplets. In DMF, each droplet acts as a single reactor, which allows for extensive multiparallelization of biological and chemical reactions at a much smaller scale. DMF devices open entirely new and promising pathways for multiplex analysis and reaction occurring in a miniaturized format, thus allowing for healthcare decentralization from major laboratories to point-of-care with accurate, robust and inexpensive molecular diagnostics. Here, we shall focus on DMF platforms specifically designed for nucleic acid amplification, which is key for molecular diagnostics of several diseases and conditions, from pathogen identification to cancer mutations detection. Particular attention will be given to the device architecture, materials and nucleic acid amplification applications in validated settings.

  15. Rapid hybridization of nucleic acids using isotachophoresis

    Science.gov (United States)

    Bercovici, Moran; Han, Crystal M.; Liao, Joseph C.; Santiago, Juan G.

    2012-01-01

    We use isotachophoresis (ITP) to control and increase the rate of nucleic acid hybridization reactions in free solution. We present a new physical model, validation experiments, and demonstrations of this assay. We studied the coupled physicochemical processes of preconcentration, mixing, and chemical reaction kinetics under ITP. Our experimentally validated model enables a closed form solution for ITP-aided reaction kinetics, and reveals a new characteristic time scale which correctly predicts order 10,000-fold speed-up of chemical reaction rate for order 100 pM reactants, and greater enhancement at lower concentrations. At 500 pM concentration, we measured a reaction time which is 14,000-fold lower than that predicted for standard second-order hybridization. The model and method are generally applicable to acceleration of reactions involving nucleic acids, and may be applicable to a wide range of reactions involving ionic reactants. PMID:22733732

  16. Nucleic acid protocols: Extraction and optimization

    Directory of Open Access Journals (Sweden)

    Saeed El-Ashram

    2016-12-01

    Full Text Available Yield and quality are fundamental features for any researchers during nucleic acid extraction. Here, we describe a simplified, semi-unified, effective, and toxic material free protocol for extracting DNA and RNA from different prokaryotic and eukaryotic sources exploiting the physical and chemical properties of nucleic acids. Furthermore, this protocol showed that DNA and RNA are under triple protection (i.e. EDTA, SDS and NaCl during lysis step, and this environment is improper for RNase to have DNA liberated of RNA and even for DNase to degrade the DNA. Therefore, the complete removal of RNA under RNase influence is achieved when RNase is added after DNA extraction, which gives optimal quality with any protocols. Similarly, DNA contamination in an isolated RNA is degraded by DNase to obtain high-quality RNA. Our protocol is the protocol of choice in terms of simplicity, recovery time, environmental safety, amount, purity, PCR and RT-PCR applicability.

  17. Nucleic acid compositions and the encoding proteins

    Science.gov (United States)

    Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.

    2014-09-02

    The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

  18. Nucleic Acid Templated Reactions for Chemical Biology.

    Science.gov (United States)

    Di Pisa, Margherita; Seitz, Oliver

    2017-06-21

    Nucleic acid directed bioorthogonal reactions offer the fascinating opportunity to unveil and redirect a plethora of intracellular mechanisms. Nano- to picomolar amounts of specific RNA molecules serve as templates and catalyze the selective formation of molecules that 1) exert biological effects, or 2) provide measurable signals for RNA detection. Turnover of reactants on the template is a valuable asset when concentrations of RNA templates are low. The idea is to use RNA-templated reactions to fully control the biodistribution of drugs and to push the detection limits of DNA or RNA analytes to extraordinary sensitivities. Herein we review recent and instructive examples of conditional synthesis or release of compounds for in cellulo protein interference and intracellular nucleic acid imaging. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  19. Optimizing the specificity of nucleic acid hybridization.

    Science.gov (United States)

    Zhang, David Yu; Chen, Sherry Xi; Yin, Peng

    2012-01-22

    The specific hybridization of complementary sequences is an essential property of nucleic acids, enabling diverse biological and biotechnological reactions and functions. However, the specificity of nucleic acid hybridization is compromised for long strands, except near the melting temperature. Here, we analytically derived the thermodynamic properties of a hybridization probe that would enable near-optimal single-base discrimination and perform robustly across diverse temperature, salt and concentration conditions. We rationally designed 'toehold exchange' probes that approximate these properties, and comprehensively tested them against five different DNA targets and 55 spurious analogues with energetically representative single-base changes (replacements, deletions and insertions). These probes produced discrimination factors between 3 and 100+ (median, 26). Without retuning, our probes function robustly from 10 °C to 37 °C, from 1 mM Mg(2+) to 47 mM Mg(2+), and with nucleic acid concentrations from 1 nM to 5 µM. Experiments with RNA also showed effective single-base change discrimination.

  20. Unraveling Prion Protein Interactions with Aptamers and Other PrP-Binding Nucleic Acids.

    Science.gov (United States)

    Macedo, Bruno; Cordeiro, Yraima

    2017-05-17

    Transmissible spongiform encephalopathies (TSEs) are a group of neurodegenerative disorders that affect humans and other mammals. The etiologic agents common to these diseases are misfolded conformations of the prion protein (PrP). The molecular mechanisms that trigger the structural conversion of the normal cellular PrP (PrP C ) into the pathogenic conformer (PrP Sc ) are still poorly understood. It is proposed that a molecular cofactor would act as a catalyst, lowering the activation energy of the conversion process, therefore favoring the transition of PrP C to PrP Sc . Several in vitro studies have described physical interactions between PrP and different classes of molecules, which might play a role in either PrP physiology or pathology. Among these molecules, nucleic acids (NAs) are highlighted as potential PrP molecular partners. In this context, the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) methodology has proven extremely valuable to investigate PrP-NA interactions, due to its ability to select small nucleic acids, also termed aptamers, that bind PrP with high affinity and specificity. Aptamers are single-stranded DNA or RNA oligonucleotides that can be folded into a wide range of structures (from harpins to G-quadruplexes). They are selected from a nucleic acid pool containing a large number (10 14 -10 16 ) of random sequences of the same size (~20-100 bases). Aptamers stand out because of their potential ability to bind with different affinities to distinct conformations of the same protein target. Therefore, the identification of high-affinity and selective PrP ligands may aid the development of new therapies and diagnostic tools for TSEs. This review will focus on the selection of aptamers targeted against either full-length or truncated forms of PrP, discussing the implications that result from interactions of PrP with NAs, and their potential advances in the studies of prions. We will also provide a critical evaluation

  1. Use of Nucleic Acid Analogs for the Study of Nucleic Acid Interactions

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2011-01-01

    Full Text Available Unnatural nucleosides have been explored to expand the properties and the applications of oligonucleotides. This paper briefly summarizes nucleic acid analogs in which the base is modified or replaced by an unnatural stacking group for the study of nucleic acid interactions. We also describe the nucleoside analogs of a base pair-mimic structure that we have examined. Although the base pair-mimic nucleosides possess a simplified stacking moiety of a phenyl or naphthyl group, they can be used as a structural analog of Watson-Crick base pairs. Remarkably, they can adopt two different conformations responding to their interaction energies, and one of them is the stacking conformation of the nonpolar aromatic group causing the site-selective flipping of the opposite base in a DNA double helix. The base pair-mimic nucleosides can be used to study the mechanism responsible for the base stacking and the flipping of bases out of a nucleic acid duplex.

  2. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Science.gov (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  3. Helicase-dependent amplification of nucleic acids.

    Science.gov (United States)

    Cao, Yun; Kim, Hyun-Jin; Li, Ying; Kong, Huimin; Lemieux, Bertrand

    2013-10-11

    Helicase-dependent amplification (HDA) is a novel method for the isothermal in vitro amplification of nucleic acids. The HDA reaction selectively amplifies a target sequence by extension of two oligonucleotide primers. Unlike the polymerase chain reaction (PCR), HDA uses a helicase enzyme to separate the deoxyribonucleic acid (DNA) strands, rather than heat denaturation. This allows DNA amplification without the need for thermal cycling. The helicase used in HDA is a helicase super family II protein obtained from a thermophilic organism, Thermoanaerobacter tengcongensis (TteUvrD). This thermostable helicase is capable of unwinding blunt-end nucleic acid substrates at elevated temperatures (60° to 65°C). The HDA reaction can also be coupled with reverse transcription for ribonucleic acid (RNA) amplification. The products of this reaction can be detected during the reaction using fluorescent probes when incubations are conducted in a fluorimeter. Alternatively, products can be detected after amplification using a disposable amplicon containment device that contains an embedded lateral flow strip. Copyright © 2013 John Wiley & Sons, Inc.

  4. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

    Science.gov (United States)

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

    2014-03-21

    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Soybean phytase and nucleic acid encoding the same

    OpenAIRE

    1999-01-01

    Isolated soybean phytase polypeptides and isolated nucleic acids encoding soybean phytases are provided. The invention is also directed to nucleic acid expression constructs, vectors, and host cells comprising the isolated soybean phytase nucleic acids, as well as methods for producing recombinant and non-recombinant purified soybean phytase. The invention also relates to transgenic plants expressing the soybean phytase, particularly expression under seed-specific expression control elements.

  6. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Science.gov (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  7. EGVII endoglucanase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2009-05-05

    The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  8. Nucleic acid interactions with pyrite surfaces

    International Nuclear Information System (INIS)

    Mateo-Marti, E.; Briones, C.; Rogero, C.; Gomez-Navarro, C.; Methivier, Ch.; Pradier, C.M.; Martin-Gago, J.A.

    2008-01-01

    The study of the interaction of nucleic acid molecules with mineral surfaces is a field of growing interest in organic chemistry, origin of life, material science and biotechnology. We have characterized the adsorption of single-stranded peptide nucleic acid (ssPNA) on a natural pyrite surface, as well as the further adsorption of ssDNA on a PNA-modified pyrite surface. The characterization has been performed by means of reflection absorption infrared spectroscopy (RAIRS), atomic force microscopy (AFM) and X-ray photoemission spectroscopy (XPS) techniques. The N(1s) and S(2p) XPS core level peaks of PNA and PNA + DNA have been decomposed in curve-components that we have assigned to different chemical species. RAIRS spectra recorded for different concentrations show the presence of positive and negative adsorption bands, related to the semiconducting nature of the surface. The combination of the information gathered by these techniques confirms that PNA adsorbs on pyrite surface, interacting through nitrogen-containing groups of the nucleobases and the iron atoms of the surface, instead of the thiol group of the molecule. The strong PNA/pyrite interaction inhibits further hybridization of PNA with complementary ssDNA, contrary to the behavior reported on gold surfaces

  9. Nucleic acid interactions with pyrite surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Mateo-Marti, E. [Centro de Astrobiologia (CSIC-INTA), Ctra. Ajalvir, Km. 4, 28850-Torrejon de Ardoz, Madrid (Spain)], E-mail: mateome@inta.es; Briones, C.; Rogero, C. [Centro de Astrobiologia (CSIC-INTA), Ctra. Ajalvir, Km. 4, 28850-Torrejon de Ardoz, Madrid (Spain); Gomez-Navarro, C. [Instituto de Ciencia de Materiales de Madrid (CSIC), Cantoblanco, 28049-Madrid (Spain); Methivier, Ch.; Pradier, C.M. [Laboratoire de Reactivite de Surface, UMR CNRS 7609. Universite Pierre et Marie Curie, 4, Pl Jussieu, 75005-Paris (France); Martin-Gago, J.A. [Centro de Astrobiologia (CSIC-INTA), Ctra. Ajalvir, Km. 4, 28850-Torrejon de Ardoz, Madrid (Spain); Instituto de Ciencia de Materiales de Madrid (CSIC), Cantoblanco, 28049-Madrid (Spain)

    2008-09-03

    The study of the interaction of nucleic acid molecules with mineral surfaces is a field of growing interest in organic chemistry, origin of life, material science and biotechnology. We have characterized the adsorption of single-stranded peptide nucleic acid (ssPNA) on a natural pyrite surface, as well as the further adsorption of ssDNA on a PNA-modified pyrite surface. The characterization has been performed by means of reflection absorption infrared spectroscopy (RAIRS), atomic force microscopy (AFM) and X-ray photoemission spectroscopy (XPS) techniques. The N(1s) and S(2p) XPS core level peaks of PNA and PNA + DNA have been decomposed in curve-components that we have assigned to different chemical species. RAIRS spectra recorded for different concentrations show the presence of positive and negative adsorption bands, related to the semiconducting nature of the surface. The combination of the information gathered by these techniques confirms that PNA adsorbs on pyrite surface, interacting through nitrogen-containing groups of the nucleobases and the iron atoms of the surface, instead of the thiol group of the molecule. The strong PNA/pyrite interaction inhibits further hybridization of PNA with complementary ssDNA, contrary to the behavior reported on gold surfaces.

  10. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Science.gov (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  11. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Boronic acid-based autoligation of nucleic acids

    DEFF Research Database (Denmark)

    Barbeyron, R.; Vasseur, J.-J.; Smietana, M.

    2013-01-01

    Abstract: The development of synthetic systems displaying dynamic and adaptive characteristics is a formidable challenge with wide applications from biotechnology to therapeutics. Recently, we described a dynamic and programmable nucleic acid-based system relying on the formation of reversible bo....... Evidence suggests that geometric and steric factors are key features for controlling the equilibria. Graphical Abstract: [Figure not available: see fulltext.]...

  14. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  15. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  16. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  17. Nucleic acid-binding glycoproteins which solubilize nucleic acids in dilute acid: re-examination of the Ustilago maydis glycoproteins

    Energy Technology Data Exchange (ETDEWEB)

    Unrau, P.; Champ, D.R.; Young, J.L.; Grant, C.E.

    1980-01-01

    Holloman reported the isolation from Ustilago maydis of a glycoprotein which prevented the precipitation of nucleic acids in cold 5% trichloroacetic acid. Two glycoprotein fractions from U. maydis with this nucleic acid-solubilizing activity were isolated in our laboratory using improved purification procedures. The activity was not due to nuclease contamination. The glycoproteins are distinguished by: their ability to bind to concanavalin A-Sepharose; their differential binding to double- and single-stranded deoxyribonucleic acid, and to ribonucleic acid; their molecular weights (46,000 and 69,000); and the relative amounts present in growing versus nongrowing cells. Both fractions required sulfhydryl-reducing conditions for optimal yields, specific activity, and stability. Nucleic acid binding was cooperative, the minimum number of glycoproteins required to make a native T7 DNA molecule soluble in dilute acid being estimated at 2 and 15, respectively.

  18. Nucleic Acid Therapy: from humble beginnings a dynamic technology

    CSIR Research Space (South Africa)

    Millroy, L

    2011-02-01

    Full Text Available The term “nucleic acid therapy” encompasses a wide range of technologies for the treatment of a range of plant and animal ailments. As the name implies, it makes use of nucleic acid (either DNA or RNA) as a therapeutic agent. There are six branches...

  19. Peptide Nucleic Acids Having 2,6-Diaminopurine Nucleobases

    DEFF Research Database (Denmark)

    2003-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary DNA and RNA strands more strongly than a corresponding DNA strand, and exhibit increased sequence specificity and binding affinity. The peptide nucleic acids of the invention comprise ligands selected from a group...

  20. Gene Targeting and Expression Modulation by Peptide Nucleic Acids (PNA)

    DEFF Research Database (Denmark)

    Nielsen, Peter E

    2010-01-01

    Peptide nucleic acids (PNA) are artificial structural mimics of nucleic acids capable of sequence specific hybridization to both RNA and DNA. Thus they have obvious potential as gene targeting agents for drug discovery approaches. An overview with emphasis on recent progress on RNA "interference...

  1. Non-enzymatic Polymerization of Nucleic Acids from Monomers

    DEFF Research Database (Denmark)

    Dörr, Mark; Löffler, Philipp M. G.; Monnard, Pierre-Alain

    2012-01-01

    synthesis of long nucleic acid polymers or to sequence-specifically amplify nucleic acid polymers, respectively. Starting from molecular requirements, details of the polymerization mechanisms and strategies are first presented and then compared. Finally, we discuss the relevance of these strategies...

  2. MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

    NARCIS (Netherlands)

    Geertsma, Eric Robin; Poolman, Berend

    2008-01-01

    The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably,

  3. Biological activity and biotechnological aspects of locked nucleic acids

    DEFF Research Database (Denmark)

    Lundin, Karin E; Højland, Torben; Hansen, Bo

    2013-01-01

    Locked nucleic acid (LNA) is one of the most promising new nucleic acid analogues that has been produced under the past two decades. In this chapter, we have tried to cover many of the different areas, where this molecule has been used to improve the function of synthetic oligonucleotides (ONs). ...

  4. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  5. Intumescent features of nucleic acids and proteins

    International Nuclear Information System (INIS)

    Alongi, Jenny; Cuttica, Fabio; Blasio, Alessandro Di; Carosio, Federico; Malucelli, Giulio

    2014-01-01

    Highlights: • The combustion resistance of DNA and caseins to different heat fluxes was studied. • Upon heating, DNA and caseins exhibited an intumescent behaviour. • The char derived from DNA was more stable and coherent than that from caseins. - Abstract: Are nucleic acids and proteins intumescent molecules? In order to get an answer, in the present manuscript, powders of deoxyribose nucleic acids (DNA) and caseins have been exposed to different heat fluxes under a cone calorimeter source and to the direct application of a propane flame. Under these conditions, DNA and caseins exhibited a typical intumescent behaviour, generating a coherent expanded cellular carbonaceous residue (char), extremely resistant to heat exposure. The resulting volumetric expansion as well as the resistance of the formed char turned out to be dependent on (i) the chemical structure of the chosen biomacromolecule, (ii) the evolution of ammonia and (iii) the adopted heat flux in cone calorimetry tests (namely, 25, 35, 50 and 75 kW/m 2 ). The presence of ribose units within the DNA backbone determined the formation of highly expanded and coherent residues as compared to those obtained from caseins. Indeed, under a heat flux of 35 kW/m 2 , when a carbon source (i.e. common cane sugar) was added to caseins, the resulting char was similar to that formed by DNA. Furthermore, the char expansion was ascribed to the evolution of ammonia released by these biomacromolecules upon heating, as detected by thermogravimetry coupled to infrared spectroscopy, and confirmed by scanning electron microscopy experiments performed on the bubbles present in the residues of flammability tests

  6. Intumescent features of nucleic acids and proteins

    Energy Technology Data Exchange (ETDEWEB)

    Alongi, Jenny, E-mail: jenny.alongi@polito.it; Cuttica, Fabio; Blasio, Alessandro Di; Carosio, Federico; Malucelli, Giulio

    2014-09-10

    Highlights: • The combustion resistance of DNA and caseins to different heat fluxes was studied. • Upon heating, DNA and caseins exhibited an intumescent behaviour. • The char derived from DNA was more stable and coherent than that from caseins. - Abstract: Are nucleic acids and proteins intumescent molecules? In order to get an answer, in the present manuscript, powders of deoxyribose nucleic acids (DNA) and caseins have been exposed to different heat fluxes under a cone calorimeter source and to the direct application of a propane flame. Under these conditions, DNA and caseins exhibited a typical intumescent behaviour, generating a coherent expanded cellular carbonaceous residue (char), extremely resistant to heat exposure. The resulting volumetric expansion as well as the resistance of the formed char turned out to be dependent on (i) the chemical structure of the chosen biomacromolecule, (ii) the evolution of ammonia and (iii) the adopted heat flux in cone calorimetry tests (namely, 25, 35, 50 and 75 kW/m{sup 2}). The presence of ribose units within the DNA backbone determined the formation of highly expanded and coherent residues as compared to those obtained from caseins. Indeed, under a heat flux of 35 kW/m{sup 2}, when a carbon source (i.e. common cane sugar) was added to caseins, the resulting char was similar to that formed by DNA. Furthermore, the char expansion was ascribed to the evolution of ammonia released by these biomacromolecules upon heating, as detected by thermogravimetry coupled to infrared spectroscopy, and confirmed by scanning electron microscopy experiments performed on the bubbles present in the residues of flammability tests.

  7. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Juan Hu

    2013-01-01

    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  8. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  9. Quantitative thermodynamic predication of interactions between nucleic acid and non-nucleic acid species using Microsoft excel.

    Science.gov (United States)

    Zou, Jiaqi; Li, Na

    2013-09-01

    Proper design of nucleic acid sequences is crucial for many applications. We have previously established a thermodynamics-based quantitative model to help design aptamer-based nucleic acid probes by predicting equilibrium concentrations of all interacting species. To facilitate customization of this thermodynamic model for different applications, here we present a generic and easy-to-use platform to implement the algorithm of the model with Microsoft(®) Excel formulas and VBA (Visual Basic for Applications) macros. Two Excel spreadsheets have been developed: one for the applications involving only nucleic acid species, the other for the applications involving both nucleic acid and non-nucleic acid species. The spreadsheets take the nucleic acid sequences and the initial concentrations of all species as input, guide the user to retrieve the necessary thermodynamic constants, and finally calculate equilibrium concentrations for all species in various bound and unbound conformations. The validity of both spreadsheets has been verified by comparing the modeling results with the experimental results on nucleic acid sequences reported in the literature. This Excel-based platform described here will allow biomedical researchers to rationalize the sequence design of nucleic acid probes using the thermodynamics-based modeling even without relevant theoretical and computational skills. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Computational Approaches to Nucleic Acid Origami.

    Science.gov (United States)

    Jabbari, Hosna; Aminpour, Maral; Montemagno, Carlo

    2015-10-12

    Recent advances in experimental DNA origami have dramatically expanded the horizon of DNA nanotechnology. Complex 3D suprastructures have been designed and developed using DNA origami with applications in biomaterial science, nanomedicine, nanorobotics, and molecular computation. Ribonucleic acid (RNA) origami has recently been realized as a new approach. Similar to DNA, RNA molecules can be designed to form complex 3D structures through complementary base pairings. RNA origami structures are, however, more compact and more thermodynamically stable due to RNA's non-canonical base pairing and tertiary interactions. With all these advantages, the development of RNA origami lags behind DNA origami by a large gap. Furthermore, although computational methods have proven to be effective in designing DNA and RNA origami structures and in their evaluation, advances in computational nucleic acid origami is even more limited. In this paper, we review major milestones in experimental and computational DNA and RNA origami and present current challenges in these fields. We believe collaboration between experimental nanotechnologists and computer scientists are critical for advancing these new research paradigms.

  11. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Science.gov (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  12. Nucleic acid detection system and method for detecting influenza

    Science.gov (United States)

    Cai, Hong; Song, Jian

    2015-03-17

    The invention provides a rapid, sensitive and specific nucleic acid detection system which utilizes isothermal nucleic acid amplification in combination with a lateral flow chromatographic device, or DNA dipstick, for DNA-hybridization detection. The system of the invention requires no complex instrumentation or electronic hardware, and provides a low cost nucleic acid detection system suitable for highly sensitive pathogen detection. Hybridization to single-stranded DNA amplification products using the system of the invention provides a sensitive and specific means by which assays can be multiplexed for the detection of multiple target sequences.

  13. Far-red fluorescent probes for canonical and non-canonical nucleic acid structures: current progress and future implications.

    Science.gov (United States)

    Suseela, Y V; Narayanaswamy, Nagarjun; Pratihar, Sumon; Govindaraju, Thimmaiah

    2018-02-05

    The structural diversity and functional relevance of nucleic acids (NAs), mainly deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), are indispensable for almost all living organisms, with minute aberrations in their structure and function becoming causative factors in numerous human diseases. The standard structures of NAs, termed canonical structures, are supported by Watson-Crick hydrogen bonding. Under special physiological conditions, NAs adopt distinct spatial organisations, giving rise to non-canonical conformations supported by hydrogen bonding other than the Watson-Crick type; such non-canonical structures have a definite function in controlling gene expression and are considered as novel diagnostic and therapeutic targets. Development of molecular probes for these canonical and non-canonical DNA/RNA structures has been an active field of research. Among the numerous probes studied, probes with turn-on fluorescence in the far-red (600-750 nm) region are highly sought-after due to minimal autofluorescence and cellular damage. Far-red fluorescent probes are vital for real-time imaging of NAs in live cells as they provide good resolution and minimal perturbation of the cell under investigation. In this review, we present recent advances in the area of far-red fluorescent probes of DNA/RNA and non-canonical G-quadruplex structures. For the sake of continuity and completeness, we provide a brief overview of visible fluorescent probes. Utmost importance is given to design criteria, characteristic properties and biological applications, including in cellulo imaging, apart from critical discussion on limitations of the far-red fluorescent probes. Finally, we offer current and future prospects in targeting canonical and non-canonical NAs specific to cellular organelles, through sequence- and conformation-specific far-red fluorescent probes. We also cover their implications in chemical and molecular biology, with particular focus on decoding various disease

  14. Continuously tunable nucleic acid hybridization probes.

    Science.gov (United States)

    Wu, Lucia R; Wang, Juexiao Sherry; Fang, John Z; Evans, Emily R; Pinto, Alessandro; Pekker, Irena; Boykin, Richard; Ngouenet, Celine; Webster, Philippa J; Beechem, Joseph; Zhang, David Yu

    2015-12-01

    In silico-designed nucleic acid probes and primers often do not achieve favorable specificity and sensitivity tradeoffs on the first try, and iterative empirical sequence-based optimization is needed, particularly in multiplexed assays. We present a novel, on-the-fly method of tuning probe affinity and selectivity by adjusting the stoichiometry of auxiliary species, which allows for independent and decoupled adjustment of the hybridization yield for different probes in multiplexed assays. Using this method, we achieved near-continuous tuning of probe effective free energy. To demonstrate our approach, we enforced uniform capture efficiency of 31 DNA molecules (GC content, 0-100%), maximized the signal difference for 11 pairs of single-nucleotide variants and performed tunable hybrid capture of mRNA from total RNA. Using the Nanostring nCounter platform, we applied stoichiometric tuning to simultaneously adjust yields for a 24-plex assay, and we show multiplexed quantitation of RNA sequences and variants from formalin-fixed, paraffin-embedded samples.

  15. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  16. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

    Science.gov (United States)

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  17. Dioxaphosphorinane-constrained nucleic Acid dinucleotides as tools for structural tuning of nucleic acids.

    Science.gov (United States)

    Catana, Dan-Andrei; Renard, Brice-Loïc; Maturano, Marie; Payrastre, Corinne; Tarrat, Nathalie; Escudier, Jean-Marc

    2012-01-01

    We describe a rational approach devoted to modulate the sugar-phosphate backbone geometry of nucleic acids. Constraints were generated by connecting one oxygen of the phosphate group to a carbon of the sugar moiety. The so-called dioxaphosphorinane rings were introduced at key positions along the sugar-phosphate backbone allowing the control of the six-torsion angles α to ζ defining the polymer structure. The syntheses of all the members of the D-CNA family are described, and we emphasize the effect on secondary structure stabilization of a couple of diastereoisomers of α,β-D-CNA exhibiting wether B-type canonical values or not.

  18. Scaffolding along Nucleic Acid Duplexes Using 2'-Amino-Locked Nucleic Acids

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Wengel, Jesper

    2014-01-01

    -LNA nucleotides. By application of different chemical reactions, modification of 2'-amino-LNA scaffolds can be efficiently performed in high yields and with various tags, postsynthetically or during the automated oligonucleotide synthesis. The choice of a synthetic method for scaffolding along 2'-amino-LNA mainly....../DNA probes bind nucleic acid targets with advantages of high affinity and specificity. Thus, molecular motion of nanodevices and programmable self-assembly of chemically modified LNA/DNA nanomaterials can be followed by bright fluorescence signaling from the functionalized LNA units. Another appealing aspect...

  19. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

    Science.gov (United States)

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

    2009-01-01

    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  20. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  1. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

    Science.gov (United States)

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

    2013-01-01

    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  2. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  3. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    OpenAIRE

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  4. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Science.gov (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  5. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Science.gov (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  6. Assays for urinary biomarkers of oxidatively damaged nucleic acids

    DEFF Research Database (Denmark)

    Weimann, Allan; Broedbaek, Kasper; Henriksen, Trine

    2012-01-01

    Abstract The analysis of oxidized nucleic acid metabolites can be performed by a variety of methodologies: liquid chromatography coupled with electrochemical or mass-spectrometry detection, gas chromatography coupled with mass spectrometry, capillary electrophoresis and ELISA (Enzyme-linked immun...

  7. Nanopore biosensors for detection of proteins and nucleic acids

    NARCIS (Netherlands)

    Maglia, Giovanni; Soskine, Mikhael

    2014-01-01

    Described herein are nanopore biosensors based on a modified cytolysin protein. The nanopore biosensors accommodate macromoiecules including proteins and nucleic acids, and may additionally comprise ligands with selective binding properties.

  8. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

    Science.gov (United States)

    Berti, Lorenzo; Burley, Glenn A.

    2008-02-01

    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  9. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  10. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Directory of Open Access Journals (Sweden)

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  11. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    Science.gov (United States)

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  12. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  13. Assembly of barcode-like nucleic acid nanostructures.

    Science.gov (United States)

    Wang, Pengfei; Tian, Cheng; Li, Xiang; Mao, Chengde

    2014-10-15

    Barcode-like (BC) nanopatterns from programmed self-assembly of nucleic acids (DNA and RNA) are reported. BC nanostructures are generated by the introduction of open spaces at selected sites to an otherwise closely packed, plain, rectangle nucleic acid nanostructure. This strategy is applied to nanostructures assembled from both origami approach and single stranded tile approach. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Nucleic acid-functionalized transition metal nanosheets for biosensing applications.

    Science.gov (United States)

    Mo, Liuting; Li, Juan; Liu, Qiaoling; Qiu, Liping; Tan, Weihong

    2017-03-15

    In clinical diagnostics, as well as food and environmental safety practices, biosensors are powerful tools for monitoring biological or biochemical processes. Two-dimensional (2D) transition metal nanomaterials, including transition metal chalcogenides (TMCs) and transition metal oxides (TMOs), are receiving growing interest for their use in biosensing applications based on such unique properties as high surface area and fluorescence quenching abilities. Meanwhile, nucleic acid probes based on Watson-Crick base-pairing rules are also being widely applied in biosensing based on their excellent recognition capability. In particular, the emergence of functional nucleic acids in the 1980s, especially aptamers, has substantially extended the recognition capability of nucleic acids to various targets, ranging from small organic molecules and metal ions to proteins and cells. Based on π-π stacking interaction between transition metal nanosheets and nucleic acids, biosensing systems can be easily assembled. Therefore, the combination of 2D transition metal nanomaterials and nucleic acids brings intriguing opportunities in bioanalysis and biomedicine. In this review, we summarize recent advances of nucleic acid-functionalized transition metal nanosheets in biosensing applications. The structure and properties of 2D transition metal nanomaterials are first discussed, emphasizing the interaction between transition metal nanosheets and nucleic acids. Then, the applications of nucleic acid-functionalized transition metal nanosheet-based biosensors are discussed in the context of different signal transducing mechanisms, including optical and electrochemical approaches. Finally, we provide our perspectives on the current challenges and opportunities in this promising field. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Single-stranded nucleic acids promote SAMHD1 complex formation.

    Science.gov (United States)

    Tüngler, Victoria; Staroske, Wolfgang; Kind, Barbara; Dobrick, Manuela; Kretschmer, Stefanie; Schmidt, Franziska; Krug, Claudia; Lorenz, Mike; Chara, Osvaldo; Schwille, Petra; Lee-Kirsch, Min Ae

    2013-06-01

    SAM domain and HD domain-containing protein 1 (SAMHD1) is a dGTP-dependent triphosphohydrolase that degrades deoxyribonucleoside triphosphates (dNTPs) thereby limiting the intracellular dNTP pool. Mutations in SAMHD1 cause Aicardi-Goutières syndrome (AGS), an inflammatory encephalopathy that mimics congenital viral infection and that phenotypically overlaps with the autoimmune disease systemic lupus erythematosus. Both disorders are characterized by activation of the antiviral cytokine interferon-α initiated by immune recognition of self nucleic acids. Here we provide first direct evidence that SAMHD1 associates with endogenous nucleic acids in situ. Using fluorescence cross-correlation spectroscopy, we demonstrate that SAMHD1 specifically interacts with ssRNA and ssDNA and establish that nucleic acid-binding and formation of SAMHD1 complexes are mutually dependent. Interaction with nucleic acids and complex formation do not require the SAM domain, but are dependent on the HD domain and the C-terminal region of SAMHD1. We finally demonstrate that mutations associated with AGS exhibit both impaired nucleic acid-binding and complex formation implicating that interaction with nucleic acids is an integral aspect of SAMHD1 function.

  16. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  17. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  18. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  19. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

    Science.gov (United States)

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

    2016-03-02

    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. 1H-1H correlations across N-H···N hydrogen bonds in nucleic acids

    International Nuclear Information System (INIS)

    Majumdar, Ananya; Gosser, Yuying; Patel, Dinshaw J.

    2001-01-01

    In 2H J NN -COSY experiments, which correlate protons with donor/acceptor nitrogens across N d ···HN a bonds, the receptor nitrogen needs to be assigned in order to unambiguously identify the hydrogen bond. For many situations this is a non-trivial task which is further complicated by poor dispersion of (N a ,N d ) resonances. To address these problems, we present pulse sequences to obtain direct, internucleotide correlations between protons in uniformly 13 C/ 15 N labeled nucleic acids containing N d ···HN a hydrogen bonds. Specifically, the pulse sequence H2(N1N3)H3 correlates H2(A,ω 1 ):H3(U,ω 2 ) protons across Watson-Crick A-U and mismatched G·A base pairs, the sequences H5(N3N1)H1/H6(N3N1)H1 correlate H5(C,ω 1 )/H6(C,ω 1 ):H1(G,ω 2 ) protons across Watson-Crick G-C base pairs, and the H 2 (N2N7)H8 sequence correlates NH 2 (G,A,C;ω 1 ):H8(G,A;ω 2 ) protons across G·G, A·A, sheared G·A and other mismatch pairs. These 1 H- 1 H connectivities circumvent the need for independent assignment of the donor/acceptor nitrogen and related degeneracy issues associated with poorly dispersed nitrogen resonances. The methodology is demonstrated on uniformly 13 C/ 15 N labeled samples of (a) an RNA regulatory element involving the HIV-1 TAR RNA fragment, (b) a multi-stranded DNA architecture involving a G·(C-A) triad-containing G-quadruplex and (c) a peptide-RNA complex involving an evolved peptide bound to the HIV-1 Rev response element (RRE) RNA fragment

  1. Prediction of molecular alignment of nucleic acids in aligned media

    International Nuclear Information System (INIS)

    Wu Bin; Petersen, Michael; Girard, Frederic; Tessari, Marco; Wijmenga, Sybren S.

    2006-01-01

    We demonstrate - using the data base of all deposited DNA and RNA structures aligned in Pf1-medium and RDC refined - that for nucleic acids in a Pf1-medium the electrostatic alignment tensor can be predicted reliably and accurately via a simple and fast calculation based on the gyration tensor spanned out by the phosphodiester atoms. The rhombicity is well predicted over its full range from 0 to 0.66, while the alignment tensor orientation is predicted correctly for rhombicities up to ca. 0.4, for larger rhombicities it appears to deviate somewhat more than expected based on structural noise and measurement error. This simple analytical approach is based on the Debye-Huckel approximation for the electrostatic interaction potential, valid at distances sufficiently far away from a poly-ionic charged surface, a condition naturally enforced when the charge of alignment medium and solute are of equal sign, as for nucleic acids in a Pf1-phage medium. For the usual salt strengths and nucleic acid sizes, the Debye-Huckel screening length is smaller than the nucleic acid size, but large enough for the collective of Debye-Huckel spheres to encompass the whole molecule. The molecular alignment is then purely electrostatic, but it's functional form is under these conditions similar to that for steric alignment. The proposed analytical expression allows for very fast calculation of the alignment tensor and hence RDCs from the conformation of the nucleic acid molecule. This information provides opportunities for improved structure determination of nucleic acids, including better assessment of dynamics in (multi-domain) nucleic acids and the possibility to incorporate alignment tensor prediction from shape directly into the structure calculation process. The procedures are incorporated into MATLAB scripts, which are available on request

  2. Dioxaphosphorinane-Constrained Nucleic Acid Dinucleotides as Tools for Structural Tuning of Nucleic Acids

    Directory of Open Access Journals (Sweden)

    Dan-Andrei Catana

    2012-01-01

    Full Text Available We describe a rational approach devoted to modulate the sugar-phosphate backbone geometry of nucleic acids. Constraints were generated by connecting one oxygen of the phosphate group to a carbon of the sugar moiety. The so-called dioxaphosphorinane rings were introduced at key positions along the sugar-phosphate backbone allowing the control of the six-torsion angles α to ζ defining the polymer structure. The syntheses of all the members of the D-CNA family are described, and we emphasize the effect on secondary structure stabilization of a couple of diastereoisomers of α,β-D-CNA exhibiting wether B-type canonical values or not.

  3. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Science.gov (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Peptide nucleic acids and their potential applications in biotechnology

    DEFF Research Database (Denmark)

    Buchardt, O.; Egholm, M.; Berg, R.H.

    1993-01-01

    Peptide nucleic acids (PNAs) are novel DNA mimics in which the sugar-phosphate backbone has been replaced with a backbone based on amino acids1-3. PNAs exhibit sequence-specific binding to DNA and RNA with higher affinities and specificities than unmodified DNA. They,are resistant to nuclease...

  5. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  6. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  8. Soni-removal of nucleic acids from inclusion bodies.

    Science.gov (United States)

    Neerathilingam, Muniasamy; Mysore, Sumukh; Gandham, Sai Hari A

    2014-05-23

    Inclusion bodies (IBs) are commonly formed in Escherichia coli due to over expression of recombinant proteins in non-native state. Isolation, denaturation and refolding of these IBs is generally performed to obtain functional protein. However, during this process IBs tend to form non-specific interactions with sheared nucleic acids from the genome, thus getting carried over into downstream processes. This may hinder the refolding of IBs into their native state. To circumvent this, we demonstrate a methodology termed soni-removal which involves disruption of nucleic acid-inclusion body interaction using sonication; followed by solvent based separation. As opposed to conventional techniques that use enzymes and column-based separations, soni-removal is a cost effective alternative for complete elimination of buried and/or strongly bound short nucleic acid contaminants from IBs. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Nucleic acids for the rational design of reaction circuits.

    Science.gov (United States)

    Padirac, Adrien; Fujii, Teruo; Rondelez, Yannick

    2013-08-01

    Nucleic acid-based circuits are rationally designed in vitro assemblies that can perform complex preencoded programs. They can be used to mimic in silico computations. Recent works emphasized the modularity and robustness of these circuits, which allow their scaling-up. Another new development has led to dynamic, time-responsive systems that can display emergent behaviors like oscillations. These are closely related to biological architectures and provide an in vitro model of in vivo information processing. Nucleic acid circuits have already been used to handle various processes for technological or biotechnological purposes. Future applications of these chemical smart systems will benefit from the rapidly growing ability to design, construct, and model nucleic acid circuits of increasing size. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Science.gov (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  11. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Science.gov (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  13. Biomimetic High Density Lipoprotein Nanoparticles For Nucleic Acid Delivery

    Science.gov (United States)

    McMahon, Kaylin M.; Mutharasan, R. Kannan; Tripathy, Sushant; Veliceasa, Dorina; Bobeica, Mariana; Shumaker, Dale K.; Luthi, Andrea J.; Helfand, Brian T.; Ardehali, Hossein; Mirkin, Chad A.; Volpert, Olga; Thaxton, C. Shad

    2014-01-01

    We report a gold nanoparticle-templated high density lipoprotein (HDL AuNP) platform for gene therapy which combines lipid-based nucleic acid transfection strategies with HDL biomimicry. For proof-of-concept, HDL AuNPs are shown to adsorb antisense cholesterylated DNA. The conjugates are internalized by human cells, can be tracked within cells using transmission electron microscopy (TEM), and regulate target gene expression. Overall, the ability to directly image the AuNP core within cells, the chemical tailorability of the HDL AuNP platform, and the potential for cell-specific targeting afforded by HDL biomimicry make this platform appealing for nucleic acid delivery. PMID:21319839

  14. Nucleic acid aptamers: an emerging frontier in cancer therapy.

    Science.gov (United States)

    Zhu, Guizhi; Ye, Mao; Donovan, Michael J; Song, Erqun; Zhao, Zilong; Tan, Weihong

    2012-11-04

    The last two decades have witnessed the development and application of nucleic acid aptamers in a variety of fields, including target analysis, disease therapy, and molecular and cellular engineering. The efficient and widely applicable aptamer selection, reproducible chemical synthesis and modification, generally impressive target binding selectivity and affinity, relatively rapid tissue penetration, low immunogenicity, and rapid systemic clearance make aptamers ideal recognition elements for use as therapeutics or for in vivo delivery of therapeutics. In this feature article, we discuss the development and biomedical application of nucleic acid aptamers, with emphasis on cancer cell aptamer isolation, targeted cancer therapy, oncology biomarker identification and drug discovery.

  15. Methods of introducing nucleic acids into cellular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.

    2017-06-27

    A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

  16. Improved Inhibition of Telomerase by Short Twisted Intercalating Nucleic Acids under Molecular Crowding Conditions

    DEFF Research Database (Denmark)

    Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich

    2012-01-01

    Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...

  17. Spherical Nucleic Acids as Intracellular Agents for Nucleic Acid Based Therapeutics

    Science.gov (United States)

    Hao, Liangliang

    Recent functional discoveries on the noncoding sequences of human genome and transcriptome could lead to revolutionary treatment modalities because the noncoding RNAs (ncRNAs) can be applied as therapeutic agents to manipulate disease-causing genes. To date few nucleic acid-based therapeutics have been translated into the clinic due to challenges in the delivery of the oligonucleotide agents in an effective, cell specific, and non-toxic fashion. Unmodified oligonucleotide agents are destroyed rapidly in biological fluids by enzymatic degradation and have difficulty crossing the plasma membrane without the aid of transfection reagents, which often cause inflammatory, cytotoxic, or immunogenic side effects. Spherical nucleic acids (SNAs), nanoparticles consisting of densely organized and highly oriented oligonucleotides, pose one possible solution to circumventing these problems in both the antisense and RNA interference (RNAi) pathways. The unique three dimensional architecture of SNAs protects the bioactive oligonucleotides from unspecific degradation during delivery and supports their targeting of class A scavenger receptors and endocytosis via a lipid-raft-dependent, caveolae-mediated pathway. Owing to their unique structure, SNAs are able to cross cell membranes and regulate target genes expression as a single entity, without triggering the cellular innate immune response. Herein, my thesis has focused on understanding the interactions between SNAs and cellular components and developing SNA-based nanostructures to improve therapeutic capabilities. Specifically, I developed a novel SNA-based, nanoscale agent for delivery of therapeutic oligonucleotides to manipulate microRNAs (miRNAs), the endogenous post-transcriptional gene regulators. I investigated the role of SNAs involving miRNAs in anti-cancer or anti-inflammation responses in cells and in in vivo murine disease models via systemic injection. Furthermore, I explored using different strategies to construct

  18. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Science.gov (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  19. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  20. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Science.gov (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  2. Conformations of Human Telomeric G-Quadruplex Studied Using a Nucleotide-Independent Nitroxide Label

    Czech Academy of Sciences Publication Activity Database

    Zhang, X.J.; Xu, C.X.; Di Felice, R.; Šponer, Jiří; Islam, B.; Stadlbauer, Petr; Ding, Y.; Mao, L.; Mao, Z.W.; Qin, P.Z.

    2016-01-01

    Roč. 55, č. 2 (2016), s. 360-372 ISSN 0006-2960 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : PARAMAGNETIC-RESONANCE SPECTROSCOPY * AMBER FORCE-FIELD * NUCLEIC-ACIDS Subject RIV: BO - Biophysics Impact factor: 2.938, year: 2016

  3. A nucleic acid dependent chemical photocatalysis in live human cells

    DEFF Research Database (Denmark)

    Arian, Dumitru; Cló, Emiliano; Gothelf, Kurt V

    2010-01-01

    Only two nucleic acid directed chemical reactions that are compatible with live cells have been reported to date. Neither of these processes generate toxic species from nontoxic starting materials. Reactions of the latter type could be applied as gene-specific drugs, for example, in the treatment...

  4. Nucleic Acid Amplification as used in the Diagnosis and ...

    African Journals Online (AJOL)

    Nucleic Acid Amplification as used in the Diagnosis and Management of Viral Diseases: A Review. ... Bayero Journal of Pure and Applied Sciences ... are highly unculturable, fastidious or hazardous to the laboratory personnel and diagnosis depends on serological methods or culture in an expensive bio-safety level.

  5. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  6. Circulating nucleic acids as a new diagnostic tool

    Czech Academy of Sciences Publication Activity Database

    Urbanová, Markéta; Plzák, J.; Strnad, Hynek; Betka, J.

    2010-01-01

    Roč. 15, č. 2 (2010), s. 242-259 ISSN 1425-8153 R&D Projects: GA MŠk 2B06106 Institutional research plan: CEZ:AV0Z50520514 Keywords : circulating nucleic acids * diagnostics * cancer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.455, year: 2010

  7. Mosaic protein and nucleic acid vaccines against hepatitis C virus

    Science.gov (United States)

    Yusim, Karina; Korber, Bette T. M.; Kuiken, Carla L.; Fischer, William M.

    2013-06-11

    The invention relates to immunogenic compositions useful as HCV vaccines. Provided are HCV mosaic polypeptide and nucleic acid compositions which provide higher levels of T-cell epitope coverage while minimizing the occurrence of unnatural and rare epitopes compared to natural HCV polypeptides and consensus HCV sequences.

  8. Assessment for Melting Temperature Measurement of Nucleic Acid by HRM.

    Science.gov (United States)

    Wang, Jing; Pan, Xiaoming; Liang, Xingguo

    2016-01-01

    High resolution melting (HRM), with a high sensitivity to distinguish the nucleic acid species with small variations, has been widely applied in the mutation scanning, methylation analysis, and genotyping. For the aim of extending HRM for the evaluation of thermal stability of nucleic acid secondary structures on sequence dependence, we investigated effects of the dye of EvaGreen, metal ions, and impurities (such as dNTPs) on melting temperature ( T m ) measurement by HRM. The accuracy of HRM was assessed as compared with UV melting method, and little difference between the two methods was found when the DNA T m was higher than 40°C. Both insufficiency and excessiveness of EvaGreen were found to give rise to a little bit higher T m , showing that the proportion of dye should be considered for precise T m measurement of nucleic acids. Finally, HRM method was also successfully used to measure T m s of DNA triplex, hairpin, and RNA duplex. In conclusion, HRM can be applied in the evaluation of thermal stability of nucleic acid (DNA or RNA) or secondary structural elements (even when dNTPs are present).

  9. Surface plasmon resonance sensing of nucleic acids: A review

    Czech Academy of Sciences Publication Activity Database

    Šípová, Hana; Homola, Jiří

    -, č. 773 (2013), s. 9-23 ISSN 0003-2670 R&D Projects: GA MŠk(CZ) LH11102 Institutional support: RVO:67985882 Keywords : Surface plasmon resonance * Nucleic acid * Biosensor Subject RIV: JB - Sensors, Measurment, Regulation Impact factor: 4.517, year: 2013

  10. Geometric properties of nucleic acids with potential for autobuilding

    International Nuclear Information System (INIS)

    Gruene, Tim; Sheldrick, George M.

    2011-01-01

    Algorithms and geometrical properties are described for the automated building of nucleic acids in experimental electron density. Medium- to high-resolution X-ray structures of DNA and RNA molecules were investigated to find geometric properties useful for automated model building in crystallographic electron-density maps. We describe a simple method, starting from a list of electron-density ‘blobs’, for identifying backbone phosphates and nucleic acid bases based on properties of the local electron-density distribution. This knowledge should be useful for the automated building of nucleic acid models into electron-density maps. We show that the distances and angles involving C1′ and the P atoms, using the pseudo-torsion angles η' and θ' that describe the …P—C1′—P—C1′… chain, provide a promising basis for building the nucleic acid polymer. These quantities show reasonably narrow distributions with asymmetry that should allow the direction of the phosphate backbone to be established

  11. Delivery Systems for In Vivo use of Nucleic Acid Drugs

    Directory of Open Access Journals (Sweden)

    Resende R.R

    2007-01-01

    Full Text Available The notorious biotechnological advance of the last few decades has allowed the development of experimental methods for understanding molecular mechanisms of genes and new therapeutic approaches. Gene therapy is maturing into a viable, practical method with the potential to cure a variety of human illnesses. Some nucleic-acid-based drugs are now available for controlling the progression of genetic diseases by inhibiting gene expression or the activity of their gene products. New therapeutic strategies employ a wide range of molecular tools such as bacterial plasmids containing transgenic inserts, RNA interference aptamers. A nucleic-acid based constitution confers a lower immunogenic potential and as result of the high stringency selection of large molecular variety, these drugs have high affi nity and selectivity for their targets. However, nucleic acids have poor biostability thus requiring chemical modifications and delivery systems to maintain their activity and ease their cellular internalization. This review discusses some of the mechanisms of action and the application of therapies based on nucleic acids such as aptamers and RNA interference as well as platforms for cellular uptake and intracellular delivery of therapeutic oligonucleotides and their trade-offs.

  12. Predicting nucleic acid binding interfaces from structural models of proteins.

    Science.gov (United States)

    Dror, Iris; Shazman, Shula; Mukherjee, Srayanta; Zhang, Yang; Glaser, Fabian; Mandel-Gutfreund, Yael

    2012-02-01

    The function of DNA- and RNA-binding proteins can be inferred from the characterization and accurate prediction of their binding interfaces. However, the main pitfall of various structure-based methods for predicting nucleic acid binding function is that they are all limited to a relatively small number of proteins for which high-resolution three-dimensional structures are available. In this study, we developed a pipeline for extracting functional electrostatic patches from surfaces of protein structural models, obtained using the I-TASSER protein structure predictor. The largest positive patches are extracted from the protein surface using the patchfinder algorithm. We show that functional electrostatic patches extracted from an ensemble of structural models highly overlap the patches extracted from high-resolution structures. Furthermore, by testing our pipeline on a set of 55 known nucleic acid binding proteins for which I-TASSER produces high-quality models, we show that the method accurately identifies the nucleic acids binding interface on structural models of proteins. Employing a combined patch approach we show that patches extracted from an ensemble of models better predicts the real nucleic acid binding interfaces compared with patches extracted from independent models. Overall, these results suggest that combining information from a collection of low-resolution structural models could be a valuable approach for functional annotation. We suggest that our method will be further applicable for predicting other functional surfaces of proteins with unknown structure. Copyright © 2011 Wiley Periodicals, Inc.

  13. PYRENE INTERCALATING NUCLEIC ACIDS WITH A CARBON LINKER

    DEFF Research Database (Denmark)

    Østergaard, Michael E.; Wamberg, Michael Chr.; Pedersen, Erik Bjerregaard

    2011-01-01

    geminally attached. Fluorescence studies of this intercalating nucleic acid with the pyrene moieties inserted as a bulge showed formation of an excimer band. When a mismatch was introduced at the site of the intercalator, an excimer band was formed for the destabilized duplexes whereas an exciplex band...

  14. Karyotype and nucleic acid content in Zantedeschia aethiopica Spr ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-07-03

    Jul 3, 2012 ... Analysis of karyotype, nucleic deoxyribonucleic acid (DNA) content and sodium dodecyl sulfate polyacrylamide ... base pairs) for Z. aethiopica and 1144.26 ± 0.05 picograms (equivalent to 1144.26 mega base pairs) for Z. elliottiana. ... ml ice-cold nuclei-isolation buffer A of the Partec high resolution. DNA kit ...

  15. Localization of Bovine Papillomavirus Nucleic Acid in Equine Sarcoids.

    Science.gov (United States)

    Gaynor, A M; Zhu, K W; Dela Cruz, F N; Affolter, V K; Pesavento, P A

    2016-05-01

    Bovine papillomaviruses (BPV1/BPV2) have long been associated with equine sarcoids; deciphering their contribution has been difficult due to their ubiquitous presence on skin and in the environment, as well as the lack of decent techniques to interrogate their role in pathogenesis. We have developed and characterized an in situ hybridization (ISH) assay that uses a pool of probes complementary to portions of the E5, E6, and E7 genes. This assay is highly sensitive for direct visualization of viral transcript and nucleic acid in routinely processed histopathologic samples. We demonstrate here the visualization of BPV nucleic acid in 18 of 18 equine sarcoids, whereas no detectable viral DNA was present in 15 of 15 nonsarcoid controls by this technique. In nearly 90% (16/18) of the sarcoids, 50% or more of the fibroblastic cell nuclei distributed throughout the neoplasm had detectable hybridization. In the remaining 2 cases, fewer than half of the fibroblastic cells contained detectable hybridization, but viral nucleic acid was also detected in epithelial cells of the sebaceous glands, hair follicles and epidermis. A sensitive ISH assay is an indispensable addition to the molecular methods used to detect viral nucleic acid in tissue. We have used this technique to determine the specific cellular localization and distribution of BPV in a subset of equine sarcoids. © The Author(s) 2015.

  16. Nucleic acid detection with surface plasmon resonance using cationic latex

    NARCIS (Netherlands)

    de Vries, E.F.A.; Schasfoort, Richardus B.M.; van der Plas, J.; Greve, Jan

    1994-01-01

    An affinity sensor based on Surface Plasmon Resonance (SPR) was used to detect nucleic acids. SPR is an optical technique that is able to detect small changes in the refractive index of the immediate vicinity of a metal surface. After a specific amplification of DNA, achieved using the polymerase

  17. Electricity-free, sequential nucleic acid and protein isolation.

    Science.gov (United States)

    Pawlowski, David R; Karalus, Richard J

    2012-05-15

    Traditional and emerging pathogens such as Enterohemorrhagic Escherichia coli (EHEC), Yersinia pestis, or prion-based diseases are of significant concern for governments, industries and medical professionals worldwide. For example, EHECs, combined with Shigella, are responsible for the deaths of approximately 325,000 children each year and are particularly prevalent in the developing world where laboratory-based identification, common in the United States, is unavailable (1). The development and distribution of low cost, field-based, point-of-care tools to aid in the rapid identification and/or diagnosis of pathogens or disease markers could dramatically alter disease progression and patient prognosis. We have developed a tool to isolate nucleic acids and proteins from a sample by solid-phase extraction (SPE) without electricity or associated laboratory equipment (2). The isolated macromolecules can be used for diagnosis either in a forward lab or using field-based point-of-care platforms. Importantly, this method provides for the direct comparison of nucleic acid and protein data from an un-split sample, offering a confidence through corroboration of genomic and proteomic analysis. Our isolation tool utilizes the industry standard for solid-phase nucleic acid isolation, the BOOM technology, which isolates nucleic acids from a chaotropic salt solution, usually guanidine isothiocyanate, through binding to silica-based particles or filters (3). CUBRC's proprietary solid-phase extraction chemistry is used to purify protein from chaotropic salt solutions, in this case, from the waste or flow-thru following nucleic acid isolation(4). By packaging well-characterized chemistries into a small, inexpensive and simple platform, we have generated a portable system for nucleic acid and protein extraction that can be performed under a variety of conditions. The isolated nucleic acids are stable and can be transported to a position where power is available for PCR amplification

  18. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    Science.gov (United States)

    Nasarabadi, Shanavaz [Livermore, CA

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  19. Programming the Assembly of Unnatural Materials with Nucleic Acids

    Science.gov (United States)

    Mirkin, Chad

    Nature directs the assembly of enormously complex and highly functional materials through an encoded class of biomolecules, nucleic acids. The establishment of a similarly programmable code for the construction of synthetic, unnatural materials would allow researchers to impart functionality by precisely positioning all material components. Although it is exceedingly difficult to control the complex interactions between atomic and molecular species in such a manner, interactions between nanoscale components can be directed through the ligands attached to their surface. Our group has shown that nucleic acids can be used as highly programmable surface ligands to control the spacing and symmetry of nanoparticle building blocks in structurally sophisticated and functional materials. These nucleic acids function as programmable ``bonds'' between nanoparticle ``atoms,'' analogous to a nanoscale genetic code for assembling materials. The sequence and length tunability of nucleic acid bonds has allowed us to define a powerful set of design rules for the construction of nanoparticle superlattices with more than 30 unique lattice symmetries, tunable defect structures and interparticle spacings, and several well-defined crystal habits. Further, the nature of the nucleic acid bond enables an additional level of structural control: temporal regulation of dynamic material response to external biomolecular and chemical stimuli. This control allows for the reversible transformation between thermodynamic states with different crystal symmetries, particle stoichiometries, thermal stabilities, and interparticle spacings on demand. Notably, our unique genetic approach affords functional nanoparticle architectures that, among many other applications, can be used to systematically explore and manipulate optoelectronic material properties, such as tunable interparticle plasmonic interactions, microstructure-directed energy emission, and coupled plasmonic and photonic modes.

  20. "Clickable" LNA/DNA probes for fluorescence sensing of nucleic acids and autoimmune antibodies

    DEFF Research Database (Denmark)

    Jørgensen, Anna S; Gupta, Pankaj; Wengel, Jesper

    2013-01-01

    Herein we describe fluorescent oligonucleotides prepared by click chemistry between novel alkyne-modified locked nucleic acid (LNA) strands and a series of fluorescent azides for homogeneous (all-in-solution) detection of nucleic acids and autoimmune antibodies.......Herein we describe fluorescent oligonucleotides prepared by click chemistry between novel alkyne-modified locked nucleic acid (LNA) strands and a series of fluorescent azides for homogeneous (all-in-solution) detection of nucleic acids and autoimmune antibodies....

  1. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Science.gov (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. DNA secondary structures: stability and function of G-quadruplex structures

    Science.gov (United States)

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  3. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  4. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  5. Triptycene: A Nucleic Acid Three-Way Junction Binder Scaffold

    Science.gov (United States)

    Yoon, Ina

    Nucleic acids play a critical role in many biological processes such as gene regulation and replication. The development of small molecules that modulate nucleic acids with sequence or structure specificity would provide new strategies for regulating disease states at the nucleic acid level. However, this remains challenging mainly because of the nonspecific interactions between nucleic acids and small molecules. Three-way junctions are critical structural elements of nucleic acids. They are present in many important targets such as trinucleotide repeat junctions related to Huntington's disease, a temperature sensor sigma32 in E. coli, Dengue virus, and HIV. Triptycene-derived small molecules have been shown to bind to nucleic acid three-way junctions, resulting from their shape complementary. To develop a better understanding of designing molecules for targeting different junctions, a rapid screening of triptycene-based small molecules is needed. We envisioned that the installation of a linker at C9 position of the bicyclic core would allow for a rapid solid phase diversification. To achieve this aim, we synthesized 9-substituted triptycene scaffolds by using two different synthetic routes. The first synthetic route installed the linker from the amidation reaction between carboxylic acid at C9 position of the triptycene and an amine linker, beta-alanine ethyl ester. This new 9-substituted triptycene scaffold was then attached to a 2-chlorotrityl chloride resin for solid-phase diversification. This enabled a rapid diversification and an easy purification of mono-, di-, and tri-peptide triptycene derivatives. The binding affinities of these compounds were investigated towards a (CAG)˙(CTG) trinucleotide repeat junction. In the modified second synthetic route, we utilized a combined Heck coupling/benzyne Diels-Alder strategy. This improved synthetic strategy reduced the number of steps and total reaction times, increased the overall yield, improved solubilities of

  6. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Aishwarya Prakash

    2011-01-01

    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  7. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    DEFF Research Database (Denmark)

    Porru, Manuela; Artuso, Simona; Salvati, Erica

    2015-01-01

    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  8. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

    Science.gov (United States)

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

    2018-05-01

    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  9. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    Science.gov (United States)

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  10. Recent Developments in Peptide-Based Nucleic Acid Delivery

    Directory of Open Access Journals (Sweden)

    Tobias Restle

    2008-07-01

    Full Text Available Despite the fact that non-viral nucleic acid delivery systems are generally considered to be less efficient than viral vectors, they have gained much interest in recent years due to their superior safety profile compared to their viral counterpart. Among these synthetic vectors are cationic polymers, branched dendrimers, cationic liposomes and cellpenetrating peptides (CPPs. The latter represent an assortment of fairly unrelated sequences essentially characterised by a high content of basic amino acids and a length of 10-30 residues. CPPs are capable of mediating the cellular uptake of hydrophilic macromolecules like peptides and nucleic acids (e.g. siRNAs, aptamers and antisenseoligonucleotides, which are internalised by cells at a very low rate when applied alone. Up to now, numerous sequences have been reported to show cell-penetrating properties and many of them have been used to successfully transport a variety of different cargos into mammalian cells. In recent years, it has become apparent that endocytosis is a major route of internalisation even though the mechanisms underlying the cellular translocation of CPPs are poorly understood and still subject to controversial discussions. In this review, we will summarise the latest developments in peptide-based cellular delivery of nucleic acid cargos. We will discuss different mechanisms of entry, the intracellular fate of the cargo, correlation studies of uptake versus biological activity of the cargo as well as technical problems and pitfalls.

  11. Selected topics in photochemistry of nucleic acids. Recent results and perspectives

    International Nuclear Information System (INIS)

    Loeber, G.; Kittler, L.

    1977-01-01

    Recent results on the following photoreactions of nucleic acids are reported: photochemistry of aza-bases and minor bases, formation of photoproducts of the non-cyclobutane type, formations of furocoumarin-pyrimidine photoadducts, fluorescence of dye-nucleic acid complexes and their role in chromosomal fluorescence staining, and mechanisms of the photochemical reaction. Results are discussed with respect to: (i) photobiological relevance of light-induced defects in nucleic acids; (ii) possibilities of achieving higher selectivity of light-induced defects in nucleic acids; (iii) the use of nucleic acid photochemistry to analyze genetic material. An extensive bibliography is included. (author)

  12. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  13. A quantitative measure of chirality inside nucleic acid databank.

    Science.gov (United States)

    Pietropaolo, Adriana; Parrinello, Michele

    2011-08-01

    We show the capability of a chirality index (Pietropaolo et al., Proteins 2008;70:667-677) to investigate nucleic acid structures because of its high sensitivity to helical conformations. By analyzing selected structures of DNA and RNA, we have found that sequences rich in cytosine and guanine have a tendency to left-handed chirality, in contrast to regions rich in adenine or thymine which show strong negative, right-handed, chirality values. We also analyze RNA structures, where specific loops and hairpin motifs are characterized by a well-defined chirality value. We find that in nucleosome the chirality is exalted, whereas in ribosome it is reduced. Our results illustrate the sensitivity of this descriptor for nucleic acid conformations. Copyright © 2011 Wiley-Liss, Inc.

  14. Devices, systems, and methods for detecting nucleic acids using sedimentation

    Energy Technology Data Exchange (ETDEWEB)

    Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory J.

    2017-10-24

    Embodiments of the present invention are directed toward devices, systems, and method for conducting nucleic acid purification and quantification using sedimentation. In one example, a method includes generating complexes which bind to a plurality of beads in a fluid sample, individual ones of the complexes comprising a nucleic acid molecule such as DNA or RNA and a labeling agent. The plurality of beads including the complexes may be transported through a density media, wherein the density media has a density lower than a density of the beads and higher than a density of the fluid sample, and wherein the transporting occurs, at least in part, by sedimentation. Signal may be detected from the labeling agents of the complexes.

  15. Microfluidic "Pouch" Chips for Immunoassays and Nucleic Acid Amplification Tests.

    Science.gov (United States)

    Mauk, Michael G; Liu, Changchun; Qiu, Xianbo; Chen, Dafeng; Song, Jinzhao; Bau, Haim H

    2017-01-01

    Microfluidic cassettes ("chips") for processing and analysis of clinical specimens and other sample types facilitate point-of-care (POC) immunoassays and nucleic acid based amplification tests. These single-use test chips can be self-contained and made amenable to autonomous operation-reducing or eliminating supporting instrumentation-by incorporating laminated, pliable "pouch" and membrane structures for fluid storage, pumping, mixing, and flow control. Materials and methods for integrating flexible pouch compartments and diaphragm valves into hard plastic (e.g., acrylic and polycarbonate) microfluidic "chips" for reagent storage, fluid actuation, and flow control are described. We review several versions of these pouch chips for immunoassay and nucleic acid amplification tests, and describe related fabrication techniques. These protocols thus offer a "toolbox" of methods for storage, pumping, and flow control functions in microfluidic devices.

  16. Silicon Dioxide Thin Film Mediated Single Cell Nucleic Acid Isolation

    Science.gov (United States)

    Bogdanov, Evgeny; Dominova, Irina; Shusharina, Natalia; Botman, Stepan; Kasymov, Vitaliy; Patrushev, Maksim

    2013-01-01

    A limited amount of DNA extracted from single cells, and the development of single cell diagnostics make it necessary to create a new highly effective method for the single cells nucleic acids isolation. In this paper, we propose the DNA isolation method from biomaterials with limited DNA quantity in sample, and from samples with degradable DNA based on the use of solid-phase adsorbent silicon dioxide nanofilm deposited on the inner surface of PCR tube. PMID:23874571

  17. Caged molecular beacons: controlling nucleic acid hybridization with light.

    Science.gov (United States)

    Wang, Chunming; Zhu, Zhi; Song, Yanling; Lin, Hui; Yang, Chaoyong James; Tan, Weihong

    2011-05-28

    We have constructed a novel class of light-activatable caged molecular beacons (cMBs) that are caged by locking two stems with a photo-labile biomolecular interaction or covalent bond. With the cMBs, the nucleic acid hybridization process can be easily controlled with light, which offers the possibility for a high spatiotemporal resolution study of intracellular mRNAs. © The Royal Society of Chemistry 2011

  18. Poly(alkylene oxide) Copolymers for Nucleic Acid Delivery

    Science.gov (United States)

    2012-07-17

    Poly(alkylene oxide) Copolymers for Nucleic Acid Delivery Swati Mishra1,#, Lavanya Y. Peddada1,#, David I. Devore3,4, and Charles M. Roth1,2...Neil Raju for assistance with figures. Biographies Swati Mishra received her Ph.D. in Biomedical Engineering and Biotechnology from the University of...Kleiman N, Anderson RD, Gottlieb D, Karlsberg R, Snell J, Rocha- Singh K. Results from a phase II multicenter, double-blind placebo-controlled study of Del

  19. Preparative concentration of nucleic acids fragments by capillary isotachophoretic analyzer

    Czech Academy of Sciences Publication Activity Database

    Datinská, Vladimíra; Voráčová, Ivona; Berka, J.; Foret, František

    2018-01-01

    Roč. 1548 (2018), s. 100-103 ISSN 0021-9673 R&D Projects: GA MŠk(CZ) LQ1601; GA ČR(CZ) GBP206/12/G014; GA MŠk(CZ) 8F17003 Institutional support: RVO:68081715 Keywords : DNA * isotachophoresis * nucleic acids * sample preparation Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 3.981, year: 2016

  20. Histidine-lysine peptides as carriers of nucleic acids.

    Science.gov (United States)

    Leng, Qixin; Goldgeier, Lisa; Zhu, Jingsong; Cambell, Patricia; Ambulos, Nicholas; Mixson, A James

    2007-03-01

    With their biodegradability and diversity of permutations, peptides have significant potential as carriers of nucleic acids. This review will focus on the sequence and branching patterns of peptide carriers composed primarily of histidines and lysines. While lysines within peptides are important for binding to the negatively charged phosphates, histidines are critical for endosomal lysis enabling nucleic acids to reach the cytosol. Histidine-lysine (HK) polymers by either covalent or ionic bonds with liposomes augment transfection compared to liposome carriers alone. More recently, we have examined peptides as sole carriers of nucleic acids because of their intrinsic advantages compared to the bipartite HK/liposome carriers. With a protocol change and addition of a histidine-rich tail, HK peptides as sole carriers were more effective than liposomes alone in several cell lines. While four-branched polymers with a primary repeating sequence pattern of -HHK- were more effective as carriers of plasmids, eight-branched polymers with a sequence pattern of -HHHK- were more effective as carriers of siRNA. Compared to polyethylenimine, HK carriers of siRNA and plasmids had reduced toxicity. When injected intravenously, HK polymers in complex with plasmids encoding antiangiogenic proteins significantly decreased tumor growth. Furthermore, modification of HK polymers with polyethylene glycol and vascular-specific ligands increased specificity of the polyplex to the tumor by more than 40-fold. Together with further development and insight on the structure of HK polyplexes, HK peptides may prove to be useful as carriers of different forms of nucleic acids both in vitro and in vivo.

  1. System for portable nucleic acid testing in low resource settings

    Science.gov (United States)

    Lu, Hsiang-Wei; Roskos, Kristina; Hickerson, Anna I.; Carey, Thomas; Niemz, Angelika

    2013-03-01

    Our overall goal is to enable timely diagnosis of infectious diseases through nucleic acid testing at the point-of-care and in low resource settings, via a compact system that integrates nucleic acid sample preparation, isothermal DNA amplification, and nucleic acid lateral flow (NALF) detection. We herein present an interim milestone, the design of the amplification and detection subsystem, and the characterization of thermal and fluidic control and assay execution within this system. Using an earlier prototype of the amplification and detection unit, comprised of a disposable cartridge containing flexible pouches, passive valves, and electrolysis-driven pumps, in conjunction with a small heater, we have demonstrated successful execution of an established and clinically validated isothermal loop-mediated amplification (LAMP) reaction targeting Mycobacterium tuberculosis (M.tb) DNA, coupled to NALF detection. The refined design presented herein incorporates miniaturized and integrated electrolytic pumps, novel passive valves, overall design changes to facilitate integration with an upstream sample preparation unit, and a refined instrument design that automates pumping, heating, and timing. Nucleic acid amplification occurs in a two-layer pouch that facilitates fluid handling and appropriate thermal control. The disposable cartridge is manufactured using low-cost and scalable techniques and forms a closed system to prevent workplace contamination by amplicons. In a parallel effort, we are developing a sample preparation unit based on similar design principles, which performs mechanical lysis of mycobacteria and DNA extraction from liquefied and disinfected sputum. Our next step is to combine sample preparation, amplification, and detection in a final integrated cartridge and device, to enable fully automated sample-in to answer-out diagnosis of active tuberculosis in primary care facilities of low-resource and high-burden countries.

  2. Solid-state NMR studies of nucleic acid components

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Hodgkinson, P.

    2015-01-01

    Roč. 5, č. 16 (2015), s. 12300-12310 ISSN 2046-2069 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acid s * solid-state NMR Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.289, year: 2015 http://pubs.rsc.org/en/content/articlepdf/2015/ra/c4ra14404j

  3. Developing nucleic acid-based electrical detection systems

    Directory of Open Access Journals (Sweden)

    Gabig-Ciminska Magdalena

    2006-03-01

    Full Text Available Abstract Development of nucleic acid-based detection systems is the main focus of many research groups and high technology companies. The enormous work done in this field is particularly due to the broad versatility and variety of these sensing devices. From optical to electrical systems, from label-dependent to label-free approaches, from single to multi-analyte and array formats, this wide range of possibilities makes the research field very diversified and competitive. New challenges and requirements for an ideal detector suitable for nucleic acid analysis include high sensitivity and high specificity protocol that can be completed in a relatively short time offering at the same time low detection limit. Moreover, systems that can be miniaturized and automated present a significant advantage over conventional technology, especially if detection is needed in the field. Electrical system technology for nucleic acid-based detection is an enabling mode for making miniaturized to micro- and nanometer scale bio-monitoring devices via the fusion of modern micro- and nanofabrication technology and molecular biotechnology. The electrical biosensors that rely on the conversion of the Watson-Crick base-pair recognition event into a useful electrical signal are advancing rapidly, and recently are receiving much attention as a valuable tool for microbial pathogen detection. Pathogens may pose a serious threat to humans, animal and plants, thus their detection and analysis is a significant element of public health. Although different conventional methods for detection of pathogenic microorganisms and their toxins exist and are currently being applied, improvements of molecular-based detection methodologies have changed these traditional detection techniques and introduced a new era of rapid, miniaturized and automated electrical chip detection technologies into pathogen identification sector. In this review some developments and current directions in

  4. Preparative concentration of nucleic acids fragments by capillary isotachophoretic analyzer

    Czech Academy of Sciences Publication Activity Database

    Datinská, Vladimíra; Voráčová, Ivona; Berka, J.; Foret, František

    2018-01-01

    Roč. 1548, MAY (2018), s. 100-103 ISSN 0021-9673 R&D Projects: GA MŠk(CZ) LQ1601; GA ČR(CZ) GBP206/12/G014; GA MŠk(CZ) 8F17003 Institutional support: RVO:68081715 Keywords : DNA * isotachophoresis * nucleic acids * sample preparation Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 3.981, year: 2016

  5. Nucleic acid components from strontium-90 exposed miniature swine

    International Nuclear Information System (INIS)

    Frazier, M.E.

    1976-01-01

    The reverse transcriptase associated with porcine type C virus particles was used to generate a tritium-labeled DNA product complementary to the viral RNA template. Results of nucleic acid hybridization experiments indicate this 3 H-DNA (probe) was copied from heteropolymeric regions of the procine viral RNA. Probe prepared from this porcine type C virus contains sequences that possess some homology in sequence to RNA isolated from viruses known to cause similar diseases in other animals

  6. Universal nucleic acids sample preparation method for cells, spores and their mixture

    Science.gov (United States)

    Bavykin, Sergei [Darien, IL

    2011-01-18

    The present invention relates to a method for extracting nucleic acids from biological samples. More specifically the invention relates to a universal method for extracting nucleic acids from unidentified biological samples. An advantage of the presently invented method is its ability to effectively and efficiently extract nucleic acids from a variety of different cell types including but not limited to prokaryotic or eukaryotic cells and/or recalcitrant organisms (i.e. spores). Unlike prior art methods which are focused on extracting nucleic acids from vegetative cell or spores, the present invention effectively extracts nucleic acids from spores, multiple cell types or mixtures thereof using a single method. Important that the invented method has demonstrated an ability to extract nucleic acids from spores and vegetative bacterial cells with similar levels effectiveness. The invented method employs a multi-step protocol which erodes the cell structure of the biological sample, isolates, labels, fragments nucleic acids and purifies labeled samples from the excess of dye.

  7. Ion-pair chromatography of nucleic acid derivatives

    International Nuclear Information System (INIS)

    Perrone, P.A.; Brown, P.R.

    1985-01-01

    Little work has been done on the ion-pair chromatography of nucleic acid constituents, although there is a great potential for the use of this technique in the field. Since the classic work in 1949, nucleotides, as well as nucleosides and bases, have been separated by ion-exchange chromatography. However, ion exchange is a difficult mode and most researchers prefer the use of reversed-phase whenever possible. Although reversed-phase is now the method of choice, ionic compounds like nucleotides and some of the more polar bases are not adequately retained by many systems of this type. In addition, it is difficult to analyze simultaneously members of all three classes of nucleic acid compounds (bases, nucleosides, and nucleotides) using a reversed-phase system, even with gradient elution. Ion pairing can be a useful technique because, theoretically, the separation of nonionic bases and nucleosides along with the ionic nucleotides can be achieved. Additionally, each group of compounds may be separated isocratically. In this chapter, they will discuss ion-pair chromatography as applied to nucleic acid constituents. The current theories, advantages and disadvantages, a limited number of applications, and potential for future work are presented

  8. The role of immunostimulatory nucleic acids in septic shock

    Science.gov (United States)

    Bleiblo, Farag; Michael, Paul; Brabant, Danielle; Ramana, Chilakamarti V; Tai, TC; Saleh, Mazen; Parrillo, Joseph E; Kumar, Anand; Kumar, Aseem

    2012-01-01

    Sepsis and its associated syndromes represent the systemic host response to severe infection and is manifested by varying degrees of hypotension, coagulopathy, and multiorgan dysfunction. Despite great efforts being made to understand this condition and designing therapies to treat sepsis, mortality rates are still high in septic patients. Characterization of the complex molecular signaling networks between the various components of host-pathogen interactions, highlights the difficulty in identifying a single driving force responsible for sepsis. Although triggering the inflammatory response is generally considered as protective against pathogenic threats, the interplay between the signaling pathways that are induced or suppressed during sepsis may harm the host. Numerous surveillance mechanisms have evolved to discriminate self from foreign agents and accordingly provoke an effective cellular response to target the pathogens. Nucleic acids are not only an essential genetic component, but sensing their molecular signature is also an important quality control mechanism which has evolved to maintain the integrity of the human genome. Evidence that has accumulated recently indicated that distinct pattern recognition receptors sense nucleic acids released from infectious organisms or from damaged host cells, resulting in the modulation of intracellular signalling cascades. Immunoreceptor-mediated detection of these nucleic acids induces antigen-specific immunity, secretion of proinflammatory cytokines and reactive oxygen/nitrogen species and thus are implicated in a range of diseases including septic shock. PMID:22328944

  9. Immune activation by nucleic acids: A role in pregnancy complications.

    Science.gov (United States)

    Konečná, B; Lauková, L; Vlková, B

    2018-04-01

    Cell-free self-DNA or RNA may induce an immune response by activating specific sensing receptors. During pregnancy, placental nucleic acids present in the maternal circulation further activate these receptors due to the presence of unmethylated CpG islands. A higher concentration of cell-free foetal DNA is associated with pregnancy complications and a higher risk for foetal rejection. Cell-free foetal DNA originates from placental trophoblasts. It appears in different forms: free, bound to histones in nucleosomes, in neutrophil extracellular traps (NETs) and in extracellular vesicles (EVs). In several pregnancy complications, cell-free foetal DNA triggers the production of proinflammatory cytokines, and this production results in a cellular and humoral immune response. This review discusses preeclampsia, systemic lupus erythematosus, foetal growth restriction, gestational diabetes, rheumatoid arthritis and obesity in pregnancy from an immunological point of view and closely examines the different pathways that result in maternal inflammation. Understanding the role of cell-free nucleic acids, as well as the biogenesis of NETs and EVs, will help us to specify their functions or targets, which seem to be important in pregnancy complications. It is still not clear whether higher concentrations of cell-free nucleic acids in the maternal circulation are the cause or consequence of various complications. Therefore, further clinical studies and, even more importantly, animal experiments that focus on the involved immunological pathways are needed. © 2018 The Foundation for the Scandinavian Journal of Immunology.

  10. Molecular modeling of nucleic Acid structure: electrostatics and solvation.

    Science.gov (United States)

    Bergonzo, Christina; Galindo-Murillo, Rodrigo; Cheatham, Thomas E

    2014-12-19

    This unit presents an overview of computer simulation techniques as applied to nucleic acid systems, ranging from simple in vacuo molecular modeling techniques to more complete all-atom molecular dynamics treatments that include an explicit representation of the environment. The third in a series of four units, this unit focuses on critical issues in solvation and the treatment of electrostatics. UNITS 7.5 & 7.8 introduced the modeling of nucleic acid structure at the molecular level. This included a discussion of how to generate an initial model, how to evaluate the utility or reliability of a given model, and ultimately how to manipulate this model to better understand its structure, dynamics, and interactions. Subject to an appropriate representation of the energy, such as a specifically parameterized empirical force field, the techniques of minimization and Monte Carlo simulation, as well as molecular dynamics (MD) methods, were introduced as a way of sampling conformational space for a better understanding of the relevance of a given model. This discussion highlighted the major limitations with modeling in general. When sampling conformational space effectively, difficult issues are encountered, such as multiple minima or conformational sampling problems, and accurately representing the underlying energy of interaction. In order to provide a realistic model of the underlying energetics for nucleic acids in their native environments, it is crucial to include some representation of solvation (by water) and also to properly treat the electrostatic interactions. These subjects are discussed in detail in this unit. Copyright © 2014 John Wiley & Sons, Inc.

  11. Stephen Neidle on cancer therapy and G-quadruplex inhibitors. Interview by Joanna De Souza.

    Science.gov (United States)

    Neidle, Stephen

    2004-09-15

    Stephen Neidle was educated at Imperial College, London, where he graduated in chemistry and then proceeded to do a PhD in crystallography. After a period as an ICI Fellow, he joined the Biophysics Department at King's College, which ignited his interest in nucleic acid structural studies. He was appointed as one of the first Cancer Research Campaign Career Development Awardees, becoming a Life Fellow on moving to the Institute of Cancer Research. He was appointed to the Chair of Biophysics at the Institute of Cancer Research in 1990, and moved to the new Chair of Chemical Biology at the School of Pharmacy in the University of London in 2002, where he also directs the Cancer Research UK Biomolecular Structure Group. He is currently Chairman of the Chemical Biology Forum of the Royal Society of Chemistry, which is involved in developing the interface between chemistry and the life sciences. He will shortly assume the Directorship of the newly-established Centre for Cancer Medicines at the School. Stephen Neidle has received several awards for his work on drug-nucleic acid recognition and drug design, including the 2000 prize of the Biological and Medicinal Chemistry Sector of the Royal Society of Chemistry, and its 2002 Interdisciplinary Award. He was the 2004 Paul Ehrlich Lecturer of the French Societé de Chimie Therapeutique, and was recently awarded the 2004 Aventis Prize in Medicinal Chemistry.

  12. Nucleic acid binding and other biomedical properties of artificial oligolysines

    Directory of Open Access Journals (Sweden)

    Roviello GN

    2016-11-01

    Full Text Available Giovanni N Roviello,1 Caterina Vicidomini,1 Vincenzo Costanzo,1 Valentina Roviello2 1CNR Istituto di Biostrutture e Bioimmagini, Via Mezzocannone site and Headquarters, 2Centro Regionale di Competenza (CRdC Tecnologie, Via Nuova Agnano, Napoli, Italy Abstract: In the present study, we report the interaction of an artificial oligolysine (referred to as AOL realized in our laboratory with targets of biomedical importance. These included polyinosinic acid (poly rI and its complex with polycytidylic acid (poly I:C, RNAs with well-known interferon-inducing ability, and double-stranded (ds DNA. The ability of the peptide to bind both single-stranded poly rI and ds poly I:C RNAs emerged from our circular dichroism (CD and ultraviolet (UV studies. In addition, we found that AOL forms complexes with dsDNA, as shown by spectroscopic binding assays and UV thermal denaturation experiments. These findings are encouraging for the possible use of AOL in biomedicine for nucleic acid targeting and oligonucleotide condensation, with the latter being a key step preceding their clinical application. Moreover, we tested the ability of AOL to bind to proteins, using serum albumin as a model protein. We demonstrated the oligolysine–protein binding by CD experiments which suggested that AOL, positively charged under physiological conditions, binds to the protein regions rich in anionic residues. Finally, the morphology characterization of the solid oligolysine, performed by scanning electron microscopy, showed different crystal forms including cubic-shaped crystals confirming the high purity of AOL. Keywords: nucleic acid binding, polyinosinic acid, double-stranded nucleic acids, oligolysine, circular dichroism

  13. Selenium Derivatization of Nucleic Acids for Phase and Structure Determination in Nucleic Acid X-ray Crystallography

    Directory of Open Access Journals (Sweden)

    Zhen Huang

    2008-03-01

    Full Text Available Selenium derivatization (via selenomethionine of proteins for crystal structure determination via MAD phasing has revolutionized protein X-ray crystallography. It is estimated that over two thirds of all new crystal structures of proteins have been determined via Se-Met derivatization. Similarly, selenium functionalities have also been successfully incorporated into nucleic acids to facilitate their structure studies and it has been proved that this Se-derivatization has advantages over halogen strategy, which was usually used as a traditional method in this field. This review reports the development of site-specific selenium derivatization of nucleic acids for phase determination since the year of 2001 (mainly focus on the 2’-position of the ribose. All the synthesis of 2’-SeMe modified phosphoramidite building blocks (U, C, T, A, G and the according oligonucleotides are included. In addition, several structures of selenium contained nucleic acid are also described in this paper.

  14. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Science.gov (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  15. Highly simplified lateral flow-based nucleic acid sample preparation and passive fluid flow control

    Science.gov (United States)

    Cary, Robert E.

    2015-12-08

    Highly simplified lateral flow chromatographic nucleic acid sample preparation methods, devices, and integrated systems are provided for the efficient concentration of trace samples and the removal of nucleic acid amplification inhibitors. Methods for capturing and reducing inhibitors of nucleic acid amplification reactions, such as humic acid, using polyvinylpyrrolidone treated elements of the lateral flow device are also provided. Further provided are passive fluid control methods and systems for use in lateral flow assays.

  16. Highly simplified lateral flow-based nucleic acid sample preparation and passive fluid flow control

    Energy Technology Data Exchange (ETDEWEB)

    Cary, Robert B.

    2018-04-17

    Highly simplified lateral flow chromatographic nucleic acid sample preparation methods, devices, and integrated systems are provided for the efficient concentration of trace samples and the removal of nucleic acid amplification inhibitors. Methods for capturing and reducing inhibitors of nucleic acid amplification reactions, such as humic acid, using polyvinylpyrrolidone treated elements of the lateral flow device are also provided. Further provided are passive fluid control methods and systems for use in lateral flow assays.

  17. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    Science.gov (United States)

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  18. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

    Science.gov (United States)

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

    2014-01-01

    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  19. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Science.gov (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  20. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  1. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Science.gov (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  2. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

    Science.gov (United States)

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

    2017-01-01

    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  3. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Directory of Open Access Journals (Sweden)

    Vikas Yadav

    2017-07-01

    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  4. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  5. Advances in nucleic acid-based diagnostics of bacterial infections

    DEFF Research Database (Denmark)

    Barken, Kim Bundvig; Haagensen, Janus Anders Juul; Tolker-Nielsen, Tim

    2007-01-01

    Methods for rapid detection of infectious bacteria and antimicrobial-resistant pathogens have evolved significantly over the last decade. Many of the new procedures are nucleic acid-based and replace conventional diagnostic methods like culturing which is time consuming especially with fastidious...... of these pathogens is important to isolate patients and prevent further spreading of the diseases. Newly developed diagnostic procedures are superior with respect to turnaround time, sensitivity and specificity. Methods like multiplex real time PCR and different array-based technologies offer the possibility...

  6. Fluorescently labeled bionanotransporters of nucleic acid based on carbon nanotubes

    International Nuclear Information System (INIS)

    Novopashina, D.S.; Apartsin, E.K.; Venyaminova, A.G.

    2012-01-01

    We propose an approach to the design of a new type of hybrids of oligonucleotides with fluorescein-functionalized single-walled carbon nanotubes. The approach is based on stacking interactions of functionalized nanotubes with pyrene residues in conjugates of oligonucleotides. The amino- and fluorescein-modified single walled carbon nanotubes are obtained, and their physico-chemical properties are investigated. The effect of the functionalization type of carbon nanotubes on the efficacy of the sorption of pyrene conjugates of oligonucleotides was examined. The proposed noncovalent hybrids of fluorescein-labeled carbon nanotubes with oligonucleotides may be used for the intracellular transport of functional nucleic acids.

  7. Spectrofluorometric study on photochemical interaction between chlorpromazine and nucleic acids

    International Nuclear Information System (INIS)

    Fujita, H.; Hayashi, H.; Suzuki, K.

    1981-01-01

    Near-UV irradiation of a mixture of chlorpromazine and single-stranded nucleic acids produced a non-dialyzable photoproduct which emitted characteristic fluorescence at around 520 nm. The same fluorescent species was also formed by the photoreaction with purine nucleotides but not with pyrimidine nucleotide. The highest photoreactivity was observed with GMP. Smaller amounts of the species were formed in a solution with a high salt concentration than in that with a low salt concentration. A higher rate was observed under anaerobic conditions than under aerobic conditions. (author)

  8. Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

    Energy Technology Data Exchange (ETDEWEB)

    Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

    2017-08-29

    The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

  9. Solving nucleic acid structures by molecular replacement: examples from group II intron studies

    International Nuclear Information System (INIS)

    Marcia, Marco; Humphris-Narayanan, Elisabeth; Keating, Kevin S.; Somarowthu, Srinivas; Rajashankar, Kanagalaghatta; Pyle, Anna Marie

    2013-01-01

    Strategies for phasing nucleic acid structures by molecular replacement, using both experimental and de novo designed models, are discussed. Structured RNA molecules are key players in ensuring cellular viability. It is now emerging that, like proteins, the functions of many nucleic acids are dictated by their tertiary folds. At the same time, the number of known crystal structures of nucleic acids is also increasing rapidly. In this context, molecular replacement will become an increasingly useful technique for phasing nucleic acid crystallographic data in the near future. Here, strategies to select, create and refine molecular-replacement search models for nucleic acids are discussed. Using examples taken primarily from research on group II introns, it is shown that nucleic acids are amenable to different and potentially more flexible and sophisticated molecular-replacement searches than proteins. These observations specifically aim to encourage future crystallographic studies on the newly discovered repertoire of noncoding transcripts

  10. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

    Science.gov (United States)

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

    2013-05-01

    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  11. Photochemical reactions of nucleic acids and their constituents of photobiological relevance

    International Nuclear Information System (INIS)

    Saito, I.; Sugiyama, H.; Matsuura, T.

    1983-01-01

    A review is given of the papers published from 1977 to May 1983 on the UV-induced photochemical reactions of nucleic acids and their constituents of photobiological relevance where the structures of photoproducts have been fully characterized. Among the topics discussed are photoadditions relevant to nucleic acid-protein photocrosslinking, photoreactions with psoralens and nucleic acids and photochemical reactions of polynucleotides. (U.K.)

  12. BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE

    OpenAIRE

    Rao, Archana N.; Grainger, David W.

    2014-01-01

    Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surface...

  13. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  14. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    Science.gov (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  15. Accelerated digestion of nucleic acids by pepsin from the stomach of chicken.

    Science.gov (United States)

    Liu, Y; Zhang, Y; Guo, H; Wu, W; Dong, P; Liang, X

    2016-10-01

    Nucleic acids have become an important nutritional supplement in poultry feed; however, the digestion of nucleic acids in poultry is unclear. The objective of this study was to investigate the digestion of nucleic acids by chicken pepsin in vitro. The extracted pepsinogen from the stomach of the chicken was purified to homogeneity. Upon activation at pH 2.0, chicken pepsinogen was converted to its active form. Nucleic acids, including λ-DNA, salmon sperm DNA and single-strand DNA (ssDNA), can be used as substrates and digested into short-chain oligonucleotides by pepsin. Interestingly, the digestion of the nucleic acids was inhibited when pepsin was treated by alkaline solution (pH 8.0) or pepstatin A. Also, the digestion of the nucleic acids was not affected by the addition of haemoglobin or bovine serum albumin. The results suggested that nucleic acids could be digested by chicken pepsin. Thus pepsin may have a role in digesting nucleic acids in vivo. Nucleic acids added to poultry fed may be digested, starting from the stomach.

  16. Ionizing radiation induced attachment reactions of nucleic acids and their components

    International Nuclear Information System (INIS)

    Myers, L.S. Jr.

    1975-01-01

    An extensive bibliographic review is given of experimental and theoretical data on radiation-induced attachment reactions of nucleic acids and their components. Mechanisms of these reactions are reviewed. The reactions with water, formate, and alcohols, with amines and other small molecules, and with radiation sensitizers and nucleic acid-nucleic acid reactions are discussed. Studies of the reaction mechanisms show that many of the reactions occur by radical-molecule reactions, but radical-radical reactions also occur. Radiation modifiers become attached to nucleic acids in vitro and in vivo and there are indications that attachment may be necessary for the action of some sensitizers. (U.S.)

  17. BGL6 beta-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Ward, Michael [San Francisco, CA

    2009-09-01

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  18. Radiation-induced electron migration in nucleic acids

    International Nuclear Information System (INIS)

    Fuciarelli, A.F.; Sisk, E.C.; Miller, J.H.; Zimbrick, J.D.

    1994-01-01

    Radiation-induced electron migration along DNA is a mechanism by which randomly produced stochastic energy deposition events can lead to non-random types of damage along DNA manifested distal to the sites of the initial energy deposition. Radiation-induced electron migration in nucleic acids has been examined using oligonucleotides containing 5-bromouracil (5-BrU). Interaction of 5-BrU with solvated electrons results in release of bromide ions and formation of uracil-5-yl radicals. Monitoring either bromide ion release or uracil formation provides an opportunity to study electron migration processes in model nucleic acid systems. Using this approach we have discovered that electron migration along oligonucleotides is significantly influenced by the base sequence and strandedness. Migration along 7 base pairs in oligonucleotides containing guanine bases was observed for oligonucleotides irradiated in solution, which compares with mean migration distances of 6-10 bp for Escherichia coli DNA irradiated in solution and 5.5 bp for E. coli DNA irradiated in cells. Evidence also suggests that electron migration can occur preferentially in the 5' to 3' direction along a double-stranded oligonucleotide containing a region of purine bases adjacent to the 5-BrU moiety. Our continued efforts will provide information regarding the contribution of electron transfer along DNA to formation of locally multiply damaged sites created in DNA by exposure to ionizing radiation. (Author)

  19. Nucleic acid helix structure determination from NMR proton chemical shifts

    Energy Technology Data Exchange (ETDEWEB)

    Werf, Ramon M. van der; Tessari, Marco; Wijmenga, Sybren S., E-mail: S.Wijmenga@science.ru.nl [Radboud University Nijmegen, Department of Biophysical Chemistry, Institute of Molecules and Materials (Netherlands)

    2013-06-15

    We present a method for de novo derivation of the three-dimensional helix structure of nucleic acids using non-exchangeable proton chemical shifts as sole source of experimental restraints. The method is called chemical shift de novo structure derivation protocol employing singular value decomposition (CHEOPS) and uses iterative singular value decomposition to optimize the structure in helix parameter space. The correct performance of CHEOPS and its range of application are established via an extensive set of structure derivations using either simulated or experimental chemical shifts as input. The simulated input data are used to assess in a defined manner the effect of errors or limitations in the input data on the derived structures. We find that the RNA helix parameters can be determined with high accuracy. We finally demonstrate via three deposited RNA structures that experimental proton chemical shifts suffice to derive RNA helix structures with high precision and accuracy. CHEOPS provides, subject to further development, new directions for high-resolution NMR structure determination of nucleic acids.

  20. Molecular polarization potential maps of the nucleic acid bases

    International Nuclear Information System (INIS)

    Alkorta, I.; Perez, J.J.

    1996-01-01

    Ab initio calculations at the SCF level were carried out to compute the polarization potential map NM of the nucleic acid bases: cytosine, thymine, uracil, adedine, and guanine. For this purpose, the Dunning's 9s5p basis set contracted to a split-valence, was selected to perform the calculations. The molecular polarization potential (MPP) at each point was evaluated by the difference between the interaction energy of the molecule with a unit point charge and the molecular electrostatic potential (MEP) at that point. MEPS and MPPS for the different molecules were computed with a density of 5 points/Angstrom 2 on the van der Waals surface of each molecule, defined using the van der Waals radii. Due to the symmetry of the molecules, only half the points were computed. The total number of points calculated was 558 for cytosine, 621 for thymine, 526 for uracil, 666 for adenine, and 699 for guanine. The results of these calculations are analyzed in terms of their implications on the molecular interactions between pairs of nucleic acid bases. 23 refs., 5 figs., 1 tab

  1. Evolution of sequence-defined highly functionalized nucleic acid polymers

    Science.gov (United States)

    Chen, Zhen; Lichtor, Phillip A.; Berliner, Adrian P.; Chen, Jonathan C.; Liu, David R.

    2018-03-01

    The evolution of sequence-defined synthetic polymers made of building blocks beyond those compatible with polymerase enzymes or the ribosome has the potential to generate new classes of receptors, catalysts and materials. Here we describe a ligase-mediated DNA-templated polymerization and in vitro selection system to evolve highly functionalized nucleic acid polymers (HFNAPs) made from 32 building blocks that contain eight chemically diverse side chains on a DNA backbone. Through iterated cycles of polymer translation, selection and reverse translation, we discovered HFNAPs that bind proprotein convertase subtilisin/kexin type 9 (PCSK9) and interleukin-6, two protein targets implicated in human diseases. Mutation and reselection of an active PCSK9-binding polymer yielded evolved polymers with high affinity (KD = 3 nM). This evolved polymer potently inhibited the binding between PCSK9 and the low-density lipoprotein receptor. Structure-activity relationship studies revealed that specific side chains at defined positions in the polymers are required for binding to their respective targets. Our findings expand the chemical space of evolvable polymers to include densely functionalized nucleic acids with diverse, researcher-defined chemical repertoires.

  2. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Natalia Rizeq

    2017-12-01

    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  3. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  4. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Science.gov (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  5. Locked nucleic acid (LNA): High affinity targeting of RNA for diagnostics and therapeutics

    DEFF Research Database (Denmark)

    Kauppinen, S.; Vester, Birte; Wengel, Jesper

    2005-01-01

    Locked nucleic acid (LNA) is a nucleic acid analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation. This conformational restriction results in unprecedented hybridization affinity towards complementary single stranded RN...

  6. Covering all the bases : Coarse-grained model design and application for nucleic acids

    NARCIS (Netherlands)

    Uusitalo, Jaakko Juhani

    2016-01-01

    Nucleic acids play a crucial role in the storage, transportation and expression of our genetic information. They have also become an interesting tool for many applications in nanotechnology. Studying biomolecular systems containing nucleic acids using experimental and imaging techniques has its

  7. Cleavage and protection of locked nucleic acid-modified DNA by restriction endonucleases

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Wengel, Jesper

    2012-01-01

    Locked nucleic acid (LNA) is one of the most prominent nucleic acid analogues reported so far. We herein for the first time report cleavage by restriction endonuclease of LNA-modified DNA oligonucleotides. The experiments revealed that RsaI is an efficient enzyme capable of recognizing and cleaving...

  8. Novel fluorescent nanoparticles for ultrasensitive identification of nucleic acids by optical methods

    DEFF Research Database (Denmark)

    Mulberg, Mads Westergaard; Taskova, Maria; Thomsen, Rasmus P.

    2017-01-01

    For decades, the detection of nucleic acids and their interactions at low abundances has been a challenging task. Present nucleic acid diagnostics are primarily based on enzymatic reactions including sequencing, polymerase-chain reaction and microarrays. However, the use of enzymatic amplificatio...

  9. Bis-Pyrene-Modified Unlocked Nucleic Acids: Synthesis, Hybridization Studies, and Fluorescent Properties

    Czech Academy of Sciences Publication Activity Database

    Perlíková, Pavla; Ejlersen, M.; Langkjaer, N.; Wengel, J.

    2014-01-01

    Roč. 9, č. 9 (2014), s. 2120-2127 ISSN 1860-7179 Grant - others:European Research Council(XE) FP7-268776 Institutional support: RVO:61388963 Keywords : fluorescence * nucleic acid hybridization * oligonucleotides * pyrenes * unlocked nucleic acids Subject RIV: CC - Organic Chemistry Impact factor: 2.968, year: 2014

  10. Autoantibody Profiling in Lupus Patients using Synthetic Nucleic Acids

    DEFF Research Database (Denmark)

    Klecka, Martin; Thybo, Christina; Macaubas, Claudia

    2018-01-01

    specificity and reproducibility. Applying the ELISA tests to serological studies of pediatric and adult SLE, we identified novel clinical correlations. We also observed preferential recognition of a specific synthetic antigen by antibodies in SLE sera. We determined the probable basis for this finding using...... computational analyses, providing valuable structural information for future development of DNA antigens. Synthetic nucleic acid molecules offer the opportunity to standardize assays and to dissect antibody-antigen interactions.......Autoantibodies to nuclear components of cells (antinuclear antibodies, ANA), including DNA (a-DNA), are widely used in the diagnosis and subtyping of certain autoimmune diseases, including systemic lupus erythematosus (SLE). Despite clinical use over decades, precise, reproducible measurement of a...

  11. Nucleic Acid-Based Approaches for Detection of Viral Hepatitis

    Science.gov (United States)

    Behzadi, Payam; Ranjbar, Reza; Alavian, Seyed Moayed

    2014-01-01

    Context: To determining suitable nucleic acid diagnostics for individual viral hepatitis agent, an extensive search using related keywords was done in major medical library and data were collected, categorized, and summarized in different sections. Results: Various types of molecular biology tools can be used to detect and quantify viral genomic elements and analyze the sequences. These molecular assays are proper technologies for rapidly detecting viral agents with high accuracy, high sensitivity, and high specificity. Nonetheless, the application of each diagnostic method is completely dependent on viral agent. Conclusions: Despite rapidity, automation, accuracy, cost-effectiveness, high sensitivity, and high specificity of molecular techniques, each type of molecular technology has its own advantages and disadvantages. PMID:25789132

  12. Rapid genotyping using pyrene-perylene locked nucleic acid complexes

    DEFF Research Database (Denmark)

    Kumar, Santhosh T.; Myznikova, Anna; Samokhina, Evgeniya

    2013-01-01

    We have developed an assay for single strand DNA and RNA detection which is based on novel pyrene-perylene FRET pairs attached to short LNA/DNA probes. The assay is based on ratiometric emission upon binding of target DNA/RNA by three combinations of fluorescent LNA/DNA reporter strands. Specific...... geometry of the pyrene fluorophore attached to the 2'-amino group of 2'-amino-LNA in position 4 allows for the first time to efficiently utilize dipole-dipole orientation parameter for sensing of single-nucleotide polymorphisms (SNPs) in nucleic acid targets by FRET. Using novel probes, SNP detection......-perylene FRET pairs, e.g., in imaging and clinical diagnostics....

  13. Mfold web server for nucleic acid folding and hybridization prediction.

    Science.gov (United States)

    Zuker, Michael

    2003-07-01

    The abbreviated name, 'mfold web server', describes a number of closely related software applications available on the World Wide Web (WWW) for the prediction of the secondary structure of single stranded nucleic acids. The objective of this web server is to provide easy access to RNA and DNA folding and hybridization software to the scientific community at large. By making use of universally available web GUIs (Graphical User Interfaces), the server circumvents the problem of portability of this software. Detailed output, in the form of structure plots with or without reliability information, single strand frequency plots and 'energy dot plots', are available for the folding of single sequences. A variety of 'bulk' servers give less information, but in a shorter time and for up to hundreds of sequences at once. The portal for the mfold web server is http://www.bioinfo.rpi.edu/applications/mfold. This URL will be referred to as 'MFOLDROOT'.

  14. Multi-chamber nucleic acid amplification and detection device

    Science.gov (United States)

    Dugan, Lawrence

    2017-10-25

    A nucleic acid amplification and detection device includes an amplification cartridge with a plurality of reaction chambers for containing an amplification reagent and a visual detection reagent, and a plurality of optically transparent view ports for viewing inside the reaction chambers. The cartridge also includes a sample receiving port which is adapted to receive a fluid sample and fluidically connected to distribute the fluid sample to the reaction chamber, and in one embodiment, a plunger is carried by the cartridge for occluding fluidic communication to the reaction chambers. The device also includes a heating apparatus having a heating element which is activated by controller to generate heat when a trigger event is detected. The heating apparatus includes a cartridge-mounting section which positioned a cartridge in thermal communication with the heating element so that visual changes to the contents of the reaction chambers are viewable through the view ports.

  15. Nucleic Acid-Based Therapy Approaches for Huntington's Disease

    Directory of Open Access Journals (Sweden)

    Tatyana Vagner

    2012-01-01

    Full Text Available Huntington's disease (HD is caused by a dominant mutation that results in an unstable expansion of a CAG repeat in the huntingtin gene leading to a toxic gain of function in huntingtin protein which causes massive neurodegeneration mainly in the striatum and clinical symptoms associated with the disease. Since the mutation has multiple effects in the cell and the precise mechanism of the disease remains to be elucidated, gene therapy approaches have been developed that intervene in different aspects of the condition. These approaches include increasing expression of growth factors, decreasing levels of mutant huntingtin, and restoring cell metabolism and transcriptional balance. The aim of this paper is to outline the nucleic acid-based therapeutic strategies that have been tested to date.

  16. 2011 Rita Schaffer lecture: nanoparticles for intracellular nucleic acid delivery.

    Science.gov (United States)

    Green, Jordan J

    2012-07-01

    Nanoparticles are a promising technology for delivery of new types of therapeutics. A polymer library approach has allowed engineering of polymeric particles that are particularly effective for the delivery of DNA and siRNA to human cells. Certain chemical structural motifs, degradable linkages, hydrophobicity, and biophysical properties are key for successful intracellular delivery. Small differences to biomaterial structure, and especially the type of degradable linkage in the polymers, can be critical for successful delivery of siRNA vs. DNA. Furthermore, subtle changes to biomaterial structure can facilitate cell-type gene delivery specificity between human brain cancer cells and healthy cells as well as between human retinal endothelial cells and epithelial cells. These polymeric nanoparticles are effective for nucleic acid delivery in a broad range of human cell types and have applications to regenerative medicine, ophthalmology, and cancer among many other biomedical research areas.

  17. Nucleic acids--genes, drugs, molecular lego and more.

    Science.gov (United States)

    Häner, Robert

    2010-01-01

    Chemically modified nucleic acids find widespread use as tools in research, as diagnostic reagents and even as pharmaceutical compounds. On the background of antisense research and development, the synthesis and evaluation of modified oligonucleotides was intensively pursued in the early to mid nineties in corporate research of former Ciba. Most of these efforts concentrated on the development of sugar and/or backbone-modified derivatives for pharmaceutical applications. Additionally, oligonucleotide metal conjugates were investigated with the goal to develop artificial ribonucleases. Since the turn of the millennium also the potential of non-nucleosidic and non-hydrogen bonding building blocks has increasingly been recognized. Such derivatives possess unique properties that may have an impact in the fields of materials and genetic research. In this brief account, we take a personal look back on some past as well as some recent results.

  18. Nucleic acid probes in the diagnosis of human microbial pathogens

    International Nuclear Information System (INIS)

    Hyypia, T.; Huovinen, P.; Holmberg, M.; Pettersson, U.

    1989-01-01

    The development of effective vaccines and antimicrobial drugs against infectious diseases has been among the most successful achievements in modern medicine. The control of these diseases requires efficient diagnostic methods for the evaluation of the prevalence of diseases and for initiation of specific treatment. Virtually all known microbes can be specifically identified today but in many cases further development is needed for more accurate, rapid, easy-to-use, and inexpensive diagnostic assays. Cell culture facilities are needed for the isolation of viruses in clinical specimens. Any gene of any known microorganism can be cloned in a vector and produced in large amounts economically and then used in diagnostic assays for the identification of the pathogen. The application of the nucleic acid hybridization methods in detection of human pathogens has received considerable attention during the past few years. This paper presents examples of this application of gene technology

  19. Peptide nucleic acid (PNA) antisense effects in Escherichia coli

    DEFF Research Database (Denmark)

    Good, L; Nielsen, P E

    1999-01-01

    Antisense peptide nucleic acid (PNA) can be used to control cell growth, gene expression and growth phenotypes in the bacteria Escherichia coli. PNAs targeted to the RNA components of the ribosome can inhibit translation and cell growth, and PNAs targeted to mRNA can limit gene expression with gene...... and sequence specificity. In an E. coli cell extract, efficient inhibition is observed when using PNA concentrations in the nanomolar range, whereas micromolar concentrations are required for inhibition in growing cells. A mutant strain of E. coli that is more permeable to antibiotics also is more susceptible...... to antisense PNAs than the wild type. This chapter details methods for testing the antisense activities of PNA in E. coli. As an example of the specific antisense inhibition possible, we show the effects of an anti-beta-galactosidase PNA in comparison to control PNAs. With improvements in cell uptake...

  20. Circular Dichroism of G-Quadruplex: A Laboratory Experiment for the Study of Topology and Ligand Binding

    Science.gov (United States)

    Carvalho, Josue´; Queiroz, João A.; Cruz, Carla

    2017-01-01

    Circular dichroism (CD) has emerged as one of the standard biophysical techniques for the study of guaninequadruplex (G4) folding, cation effect, and ligand binding. The utility of this technique is based on its robustness, ease of use, and requirement of only small quantities of nucleic acid. This experiment is also extendable to the classroom…

  1. Integrated Microfluidic Nucleic Acid Isolation, Isothermal Amplification, and Amplicon Quantification

    Directory of Open Access Journals (Sweden)

    Michael G. Mauk

    2015-10-01

    Full Text Available Microfluidic components and systems for rapid (<60 min, low-cost, convenient, field-deployable sequence-specific nucleic acid-based amplification tests (NAATs are described. A microfluidic point-of-care (POC diagnostics test to quantify HIV viral load from blood samples serves as a representative and instructive example to discuss the technical issues and capabilities of “lab on a chip” NAAT devices. A portable, miniaturized POC NAAT with performance comparable to conventional PCR (polymerase-chain reaction-based tests in clinical laboratories can be realized with a disposable, palm-sized, plastic microfluidic chip in which: (1 nucleic acids (NAs are extracted from relatively large (~mL volume sample lysates using an embedded porous silica glass fiber or cellulose binding phase (“membrane” to capture sample NAs in a flow-through, filtration mode; (2 NAs captured on the membrane are isothermally (~65 °C amplified; (3 amplicon production is monitored by real-time fluorescence detection, such as with a smartphone CCD camera serving as a low-cost detector; and (4 paraffin-encapsulated, lyophilized reagents for temperature-activated release are pre-stored in the chip. Limits of Detection (LOD better than 103 virons/sample can be achieved. A modified chip with conduits hosting a diffusion-mode amplification process provides a simple visual indicator to readily quantify sample NA template. In addition, a companion microfluidic device for extracting plasma from whole blood without a centrifuge, generating cell-free plasma for chip-based molecular diagnostics, is described. Extensions to a myriad of related applications including, for example, food testing, cancer screening, and insect genotyping are briefly surveyed.

  2. Current and future developments in nucleic acid-based diagnostics

    International Nuclear Information System (INIS)

    Viljoen, G.J.; Romito, M.; Kara, P.D.

    2005-01-01

    The detection and characterization of specific nucleic acids of medico-veterinary pathogens have proven invaluable for diagnostic purposes. Apart from hybridization and sequencing techniques, polymerase chain reaction (PCR) and numerous other methods have contributed significantly to this process. The integration of amplification and signal detection systems, including on-line real-time devices, have increased speed and sensitivity and greatly facilitated the quantification of target nucleic acids. They have also allowed for sequence characterization using melting or hybridization curves. Rugged portable real-time instruments for field use and robotic devices for processing samples are already available commercially. Various stem-loop DNA probes have been designed to have greater specificity for target recognition during real-time PCR. Various DNA fingerprinting techniques or post amplification sequencing are used to type pathogenic strains. Characterization according to DNA sequence is becoming more readily available as automated sequencers become more widely used. Reverse hybridization and to a greater degree DNA micro-arrays, are being used for genotyping related organisms and can allow for the detection of a large variety of different pathogens simultaneously. Non-radioactive labelling of DNA, especially using fluorophores and the principles of fluorescence resonance energy transfer, is now widely used, especially in real-time detection devices. Other detection methods include the use of surface plasmon resonance and MALDI-TOF mass spectrometry. In addition to these technological advances, contributions by bioinformatics and the description of unique signatures of DNA sequences from pathogens will contribute to the development of further assays for monitoring presence of pathogens. An important goal will be the development of robust devices capable of sensitively and specifically detecting a broad spectrum of pathogens that will be applicable for point

  3. Sensitive determination of nucleic acids using organic nanoparticle fluorescence probes

    Science.gov (United States)

    Zhou, Yunyou; Bian, Guirong; Wang, Leyu; Dong, Ling; Wang, Lun; Kan, Jian

    2005-06-01

    This paper describes the preparation of organic nanoparticles by reprecipitation method under sonication and vigorous stirring. Transmission electron microscopy (TEM) was used to characterize the size and size distribution of the luminescent nanoparticles. Their average diameter was about 25 nm with a size variation of ±18%. The fluorescence decay lifetime of the nanoparticles also was determined on a self-equipped fluorospectrometer with laser light source. The lifetime (˜0.09 μs) of nanoparticles is about three times long as that of the monomer. The nanoparticles were in abundant of hydrophilic groups, which increased their miscibility in aqueous solution. These organic nanoparticles have high photochemical stability, excellent resistance to chemical degradation and photodegradation, and a good fluorescence quantum yield (25%). The fluorescence can be efficiently quenched by nucleic acids. Based on the fluorescence quenching of nanoparticles, a fluorescence quenching method was developed for determination of microamounts of nucleic acids by using the nanoparticles as a new fluorescent probe. Under optimal conditions, maximum fluorescence quenching is produced, with maximum excitation and emission wavelengths of 345 and 402 nm, respectively. Under optimal conditions, the calibration graphs are linear over the range 0.4-19.0 μg ml -1 for calf thymus DNA (ct-DNA) and 0.3-19.0 μg ml -1 for fish sperm DNA (fs-DNA). The corresponding detection limits are 0.25 μg ml -1 for ct-DNA and 0.17 μg ml -1 for fs-DNA. The relative standard deviation of six replicate measurements is 1.3-2.1%. The method is simple, rapid and sensitive with wide linear range. The recovery and relative standard deviation are very satisfactory.

  4. Revealing Nucleic Acid Mutations Using Förster Resonance Energy Transfer-Based Probes

    Directory of Open Access Journals (Sweden)

    Nina P. L. Junager

    2016-07-01

    Full Text Available Nucleic acid mutations are of tremendous importance in modern clinical work, biotechnology and in fundamental studies of nucleic acids. Therefore, rapid, cost-effective and reliable detection of mutations is an object of extensive research. Today, Förster resonance energy transfer (FRET probes are among the most often used tools for the detection of nucleic acids and in particular, for the detection of mutations. However, multiple parameters must be taken into account in order to create efficient FRET probes that are sensitive to nucleic acid mutations. In this review; we focus on the design principles for such probes and available computational methods that allow for their rational design. Applications of advanced, rationally designed FRET probes range from new insights into cellular heterogeneity to gaining new knowledge of nucleic acid structures directly in living cells.

  5. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Directory of Open Access Journals (Sweden)

    Yunqiang Bian

    2014-04-01

    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  6. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

    Science.gov (United States)

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

    2013-10-01

    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  7. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Science.gov (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  8. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Directory of Open Access Journals (Sweden)

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  9. Pyrazine Nucleic Acids: From Small Molecules to Proto-Informational Polymers

    Science.gov (United States)

    Wong, S. B.; Gately, M.; Young, E.; Krishnamurthy, R.; Weber, A. L.; Campbell, T.

    2017-07-01

    Pyrazine nucleosides are derivable from amino acid amides and pentoses under plausibly prebiotic conditions. Pyrazines share features similar to adenine or thymine, and may behave as an informational polymer when polymerized as pyrazine nucleic acid.

  10. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

    Science.gov (United States)

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

    2014-07-23

    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Science.gov (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  12. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  13. Nucleic Acid Extraction from Synthetic Mars Analog Soils for in situ Life Detection.

    Science.gov (United States)

    Mojarro, Angel; Ruvkun, Gary; Zuber, Maria T; Carr, Christopher E

    2017-08-01

    Biological informational polymers such as nucleic acids have the potential to provide unambiguous evidence of life beyond Earth. To this end, we are developing an automated in situ life-detection instrument that integrates nucleic acid extraction and nanopore sequencing: the Search for Extra-Terrestrial Genomes (SETG) instrument. Our goal is to isolate and determine the sequence of nucleic acids from extant or preserved life on Mars, if, for example, there is common ancestry to life on Mars and Earth. As is true of metagenomic analysis of terrestrial environmental samples, the SETG instrument must isolate nucleic acids from crude samples and then determine the DNA sequence of the unknown nucleic acids. Our initial DNA extraction experiments resulted in low to undetectable amounts of DNA due to soil chemistry-dependent soil-DNA interactions, namely adsorption to mineral surfaces, binding to divalent/trivalent cations, destruction by iron redox cycling, and acidic conditions. Subsequently, we developed soil-specific extraction protocols that increase DNA yields through a combination of desalting, utilization of competitive binders, and promotion of anaerobic conditions. Our results suggest that a combination of desalting and utilizing competitive binders may establish a "universal" nucleic acid extraction protocol suitable for analyzing samples from diverse soils on Mars. Key Words: Life-detection instruments-Nucleic acids-Mars-Panspermia. Astrobiology 17, 747-760.

  14. Shedding light on proteins, nucleic acids, cells, humans and fish

    Science.gov (United States)

    Setlow, Richard B.

    2002-01-01

    I was trained as a physicist in graduate school. Hence, when I decided to go into the field of biophysics, it was natural that I concentrated on the effects of light on relatively simple biological systems, such as proteins. The wavelengths absorbed by the amino acid subunits of proteins are in the ultraviolet (UV). The wavelengths that affect the biological activities, the action spectra, also are in the UV, but are not necessarily parallel to the absorption spectra. Understanding these differences led me to investigate the action spectra for affecting nucleic acids, and the effects of UV on viruses and cells. The latter studies led me to the discovery of the important molecular nature of the damages affecting DNA (cyclobutane pyrimidine dimers) and to the discovery of nucleotide excision repair. Individuals with the genetic disease xeroderma pigmentosum (XP) are extraordinarily sensitive to sunlight-induced skin cancer. The finding, by James Cleaver, that their skin cells were defective in DNA repair strongly suggested that DNA damage was a key step in carcinogenesis. Such information was important for estimating the wavelengths in sunlight responsible for human skin cancer and for predicting the effects of ozone depletion on the incidence of non-melanoma skin cancer. It took experiments with backcross hybrid fish to call attention to the probable role of the longer UV wavelengths not absorbed by DNA in the induction of melanoma. These reflections trace the biophysicist's path from molecules to melanoma.

  15. BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE.

    Science.gov (United States)

    Rao, Archana N; Grainger, David W

    2014-04-01

    Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA's persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools.

  16. BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE

    Science.gov (United States)

    Rao, Archana N.; Grainger, David W.

    2014-01-01

    Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA’s persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools. PMID:24765522

  17. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

    Science.gov (United States)

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

    2018-06-01

    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  18. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Science.gov (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  19. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  20. Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Science.gov (United States)

    Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang

    2015-01-01

    Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  1. Carbon composite micro- and nano-tubes-based electrodes for detection of nucleic acids

    Directory of Open Access Journals (Sweden)

    Huska Dalibor

    2011-01-01

    Full Text Available Abstract The first aim of this study was to fabricate vertically aligned multiwalled carbon nanotubes (MWCNTs. MWCNTs were successfully prepared by using plasma enhanced chemical vapour deposition. Further, three carbon composite electrodes with different content of carbon particles with various shapes and sizes were prepared and tested on measuring of nucleic acids. The dependences of adenine peak height on the concentration of nucleic acid sample were measured. Carbon composite electrode prepared from a mixture of glassy and spherical carbon powder and MWCNTs had the highest sensitivity to nucleic acids. Other interesting result is the fact that we were able to distinguish signals for all bases using this electrode.

  2. Application of locked nucleic acid-based probes in fluorescence in situ hybridization

    DEFF Research Database (Denmark)

    Fontenete, Sílvia; Carvalho, Daniel R; Guimarães, Nuno

    2016-01-01

    of nucleic acid mimics used as mixmers in LNA-based probes strongly influence the efficiency of detection. LNA probes with 10 to 15 mers showed the highest efficiency. Additionally, the combination of 2′-OMe RNA with LNA allowed an increase on the fluorescence intensities of the probes. Overall......Fluorescence in situ hybridization (FISH) employing nucleic acid mimics as probes is becoming an emerging molecular tool in the microbiology area for the detection and visualization of microorganisms. However, the impact that locked nucleic acid (LNA) and 2′-O-methyl (2′-OMe) RNA modifications have...

  3. Neutron crystallographic studies of amino acids and nucleic acids

    International Nuclear Information System (INIS)

    Kashiwagi, Tatsuki

    2014-01-01

    Neutron crystallographic studies of two representative umami materials were executed utilizing iBLX at MLF/J-PARC. The results of them will be summarized in this report. At first, structure analysis of the alpha form crystal of L-glutamic acid was performed in order to assess the usefulness of neutron crystallography at iBIX to our company's R and D. Neutron crystal structure of it was successfully determined at 0.6 A resolution. All hydrogen atoms were clearly observed. Next, the mixed crystal of disodium Inosine-5'-phosphate (IMP · 2Na) and disodium Guanosine-5'-phosphate (GMP · 2Na) was analyzed by neutron crystallography. Neutron crystal structure of the mixed crystal of IMP and GMP (IM/GMP rate = 1.7) was successfully determined at 0.8 A resolution. In the neutron crystal structure of the mixed crystal, the hydrogen atom bonded to the C2 atom of purine base in IMP and the nitrogen atom bonded to the C2 atom of purine base in GMP were clearly observed in the nuclear density map, structurally demonstrating that this crystal is the mixed crystal. (author)

  4. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    Science.gov (United States)

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Membrane Protected Apoptotic Trophoblast Microparticles Contain Nucleic Acids

    Science.gov (United States)

    Orozco, Aaron F.; Jorgez, Carolina J.; Horne, Cassandra; Marquez-Do, Deborah A.; Chapman, Matthew R.; Rodgers, John R.; Bischoff, Farideh Z.; Lewis, Dorothy E.

    2008-01-01

    Microparticles (MPs) that circulate in blood may be a source of DNA for molecular analyses, including prenatal genetic diagnoses. Because MPs are heterogeneous in nature, however, further characterization is important before use in clinical settings. One key question is whether DNA is either bound to aggregates of blood proteins and lipid micelles or intrinsically associated with MPs from dying cells. To test the latter hypothesis, we asked whether MPs derived in vitro from dying cells were similar to those in maternal plasma. JEG-3 cells model extravillous trophoblasts, which predominate during the first trimester of pregnancy when prenatal diagnosis is most relevant. MPs were derived from apoptosis and increased over 48 hours. Compared with necrotic MPs, DNA in apoptotic MPs was more fragmented and resistant to plasma DNases. Membrane-specific dyes indicated that apoptotic MPs had more membranous material, which protects nucleic acids, including RNA. Flow cytometry showed that MPs derived from dying cells displayed light scatter and DNA staining similar to MPs found in maternal plasma. Quantification of maternal MPs using characteristics defined by MPs generated in vitro revealed a significant increase of DNA+ MPs in the plasma of women with preeclampsia compared with plasma from women with normal pregnancies. Apoptotic MPs are therefore a likely source of stable DNA that could be enriched for both early genetic diagnosis and monitoring of pathological pregnancies. PMID:18974299

  6. The Role of Structural Enthalpy in Spherical Nucleic Acid Hybridization.

    Science.gov (United States)

    Fong, Lam-Kiu; Wang, Ziwei; Schatz, George C; Luijten, Erik; Mirkin, Chad A

    2018-05-23

    DNA hybridization onto DNA-functionalized nanoparticle surfaces (e.g., in the form of a spherical nucleic acid (SNA)) is known to be enhanced relative to hybridization free in solution. Surprisingly, via isothermal titration calorimetry, we reveal that this enhancement is enthalpically, as opposed to entropically, dominated by ∼20 kcal/mol. Coarse-grained molecular dynamics simulations suggest that the observed enthalpic enhancement results from structurally confining the DNA on the nanoparticle surface and preventing it from adopting enthalpically unfavorable conformations like those observed in the solution case. The idea that structural confinement leads to the formation of energetically more stable duplexes is evaluated by decreasing the degree of confinement a duplex experiences on the nanoparticle surface. Both experiment and simulation confirm that when the surface-bound duplex is less confined, i.e., at lower DNA surface density or at greater distance from the nanoparticle surface, its enthalpy of formation approaches the less favorable enthalpy of duplex formation for the linear strand in solution. This work provides insight into one of the most important and enabling properties of SNAs and will inform the design of materials that rely on the thermodynamics of hybridization onto DNA-functionalized surfaces, including diagnostic probes and therapeutic agents.

  7. What controls the hybridization thermodynamics of spherical nucleic acids?

    Science.gov (United States)

    Randeria, Pratik S; Jones, Matthew R; Kohlstedt, Kevin L; Banga, Resham J; Olvera de la Cruz, Monica; Schatz, George C; Mirkin, Chad A

    2015-03-18

    The hybridization of free oligonucleotides to densely packed, oriented arrays of DNA modifying the surfaces of spherical nucleic acid (SNA)-gold nanoparticle conjugates occurs with negative cooperativity; i.e., each binding event destabilizes subsequent binding events. DNA hybridization is thus an ever-changing function of the number of strands already hybridized to the particle. Thermodynamic quantification of this behavior reveals a 3 orders of magnitude decrease in the binding constant for the capture of a free oligonucleotide by an SNA conjugate as the fraction of pre-hybridized strands increases from 0 to ∼30%. Increasing the number of pre-hybridized strands imparts an increasing enthalpic penalty to hybridization that makes binding more difficult, while simultaneously decreasing the entropic penalty to hybridization, which makes binding more favorable. Hybridization of free DNA to an SNA is thus governed by both an electrostatic barrier as the SNA accumulates charge with additional binding events and an effect consistent with allostery, where hybridization at certain sites on an SNA modify the binding affinity at a distal site through conformational changes to the remaining single strands. Leveraging these insights allows for the design of conjugates that hybridize free strands with significantly higher efficiencies, some of which approach 100%.

  8. Improved nucleic acid descriptors for siRNA efficacy prediction.

    Science.gov (United States)

    Sciabola, Simone; Cao, Qing; Orozco, Modesto; Faustino, Ignacio; Stanton, Robert V

    2013-02-01

    Although considerable progress has been made recently in understanding how gene silencing is mediated by the RNAi pathway, the rational design of effective sequences is still a challenging task. In this article, we demonstrate that including three-dimensional descriptors improved the discrimination between active and inactive small interfering RNAs (siRNAs) in a statistical model. Five descriptor types were used: (i) nucleotide position along the siRNA sequence, (ii) nucleotide composition in terms of presence/absence of specific combinations of di- and trinucleotides, (iii) nucleotide interactions by means of a modified auto- and cross-covariance function, (iv) nucleotide thermodynamic stability derived by the nearest neighbor model representation and (v) nucleic acid structure flexibility. The duplex flexibility descriptors are derived from extended molecular dynamics simulations, which are able to describe the sequence-dependent elastic properties of RNA duplexes, even for non-standard oligonucleotides. The matrix of descriptors was analysed using three statistical packages in R (partial least squares, random forest, and support vector machine), and the most predictive model was implemented in a modeling tool we have made publicly available through SourceForge. Our implementation of new RNA descriptors coupled with appropriate statistical algorithms resulted in improved model performance for the selection of siRNA candidates when compared with publicly available siRNA prediction tools and previously published test sets. Additional validation studies based on in-house RNA interference projects confirmed the robustness of the scoring procedure in prospective studies.

  9. A miniaturized silicon based device for nucleic acids electrochemical detection

    Directory of Open Access Journals (Sweden)

    Salvatore Petralia

    2015-12-01

    Full Text Available In this paper we describe a novel portable system for nucleic acids electrochemical detection. The core of the system is a miniaturized silicon chip composed by planar microelectrodes. The chip is embedded on PCB board for the electrical driving and reading. The counter, reference and work microelectrodes are manufactured using the VLSI technology, the material is gold for reference and counter electrodes and platinum for working electrode. The device contains also a resistor to control and measuring the temperature for PCR thermal cycling. The reaction chamber has a total volume of 20 μL. It is made in hybrid silicon–plastic technology. Each device contains four independent electrochemical cells.Results show HBV Hepatitis-B virus detection using an unspecific DNA intercalating redox probe based on metal–organic compounds. The recognition event is sensitively detected by square wave voltammetry monitoring the redox signals of the intercalator that strongly binds to the double-stranded DNA. Two approaches were here evaluated: (a intercalation of electrochemical unspecific probe on ds-DNA on homogeneous solution (homogeneous phase; (b grafting of DNA probes on electrode surface (solid phase.The system and the method here reported offer better advantages in term of analytical performances compared to the standard commercial optical-based real-time PCR systems, with the additional incomes of being potentially cheaper and easier to integrate in a miniaturized device. Keywords: Electrochemical detection, Real time PCR, Unspecific DNA intercalator

  10. Development of a Capillary-driven, Microfluidic, Nucleic Acid Biosensor

    Directory of Open Access Journals (Sweden)

    Fei HE

    2011-12-01

    Full Text Available An ideal point-of-care device would incorporate the simplicity and reliability of a lateral flow assay with a microfluidic device. Our system consists of self-priming microfluidics with sealed conjugate pads of reagent delivery and an absorbent pad for additional fluid draw. Using poly (methyl methacrylate (PMMA as a substrate, we have developed a single-step surface modification method which allows strong capillary flow within a sealed microchannel. Conjugate pads within the device held trapped complex consisting of the magnetic beads and nucleic-acid-probe-conjugated horseradish peroxidase (HRP. Magnetic beads were released when sample entered the chamber and hybridized with the complex. The complex was immobilized over a magnet while a luminol co-reactant stream containing H2O2 was merged with the channel. A plate reader was able to quantify the chemiluminescence signal. This new format of biosensor will allow for a smaller and more sensitive biosensor, as well as commercial-scale manufacturing and low materials cost.

  11. Proposed Ancestors of Phage Nucleic Acid Packaging Motors (and Cells

    Directory of Open Access Journals (Sweden)

    Philip Serwer

    2011-07-01

    Full Text Available I present a hypothesis that begins with the proposal that abiotic ancestors of phage RNA and DNA packaging systems (and cells include mobile shells with an internal, molecule-transporting cavity. The foundations of this hypothesis include the conjecture that current nucleic acid packaging systems have imprints from abiotic ancestors. The abiotic shells (1 initially imbibe and later also bind and transport organic molecules, thereby providing a means for producing molecular interactions that are links in the chain of events that produces ancestors to the first molecules that are both information carrying and enzymatically active, and (2 are subsequently scaffolds on which proteins assemble to form ancestors common to both shells of viral capsids and cell membranes. Emergence of cells occurs via aggregation and merger of shells and internal contents. The hypothesis continues by using proposed imprints of abiotic and biotic ancestors to deduce an ancestral thermal ratchet-based DNA packaging motor that subsequently evolves to integrate a DNA packaging ATPase that provides a power stroke.

  12. Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

  13. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Science.gov (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  14. Gene Therapy for Advanced Melanoma: Selective Targeting and Therapeutic Nucleic Acids

    Directory of Open Access Journals (Sweden)

    Joana R. Viola

    2013-01-01

    Full Text Available Despite recent advances, the treatment of malignant melanoma still results in the relapse of the disease, and second line treatment mostly fails due to the occurrence of resistance. A wide range of mutations are known to prevent effective treatment with chemotherapeutic drugs. Hence, approaches with biopharmaceuticals including proteins, like antibodies or cytokines, are applied. As an alternative, regimens with therapeutically active nucleic acids offer the possibility for highly selective cancer treatment whilst avoiding unwanted and toxic side effects. This paper gives a brief introduction into the mechanism of this devastating disease, discusses the shortcoming of current therapy approaches, and pinpoints anchor points which could be harnessed for therapeutic intervention with nucleic acids. We bring the delivery of nucleic acid nanopharmaceutics into perspective as a novel antimelanoma therapeutic approach and discuss the possibilities for melanoma specific targeting. The latest reports on preclinical and already clinical application of nucleic acids in melanoma are discussed.

  15. Nucleic acid polymeric properties and electrostatics: Directly comparing theory and simulation with experiment.

    Science.gov (United States)

    Sim, Adelene Y L

    2016-06-01

    Nucleic acids are biopolymers that carry genetic information and are also involved in various gene regulation functions such as gene silencing and protein translation. Because of their negatively charged backbones, nucleic acids are polyelectrolytes. To adequately understand nucleic acid folding and function, we need to properly describe its i) polymer/polyelectrolyte properties and ii) associating ion atmosphere. While various theories and simulation models have been developed to describe nucleic acids and the ions around them, many of these theories/simulations have not been well evaluated due to complexities in comparison with experiment. In this review, I discuss some recent experiments that have been strategically designed for straightforward comparison with theories and simulation models. Such data serve as excellent benchmarks to identify limitations in prevailing theories and simulation parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. THE VARIATION OF NUCLEIC ACIDS CONTENT AFTER SIMAZIN TREATMENT ON VICIA SATIVA L.

    Directory of Open Access Journals (Sweden)

    Odeta Grama-Tiganasu

    2005-08-01

    Full Text Available Simazin has in certain conditions stimulatory effects on nucleic acids biosynthese. The biosyntese and mitotic division stimulation sugest the possibility to use simazin like growing and germination stimulator.

  17. [Blood Test Patterns for Blood Donors after Nucleic Acid Detection in the Blood Center].

    Science.gov (United States)

    Men, Shou-Shan; Lv, Lian-Zhi; Chen, Yuan-Feng; Han, Chun-Hua; Liu, Hong-Yu; Yan, Yan

    2017-12-01

    To investigate the blood test patterns for blood donors after nucleic acid detection in blood center. The collected blood samples after voluntary blood donors first were detected by conventional ELISA, then 31981 negative samples were detected via HBV/HCV/HIV combined nucleic acid test of 6 mixed samples(22716 cases) or single samples(9265 cases) by means of Roche cobas s201 instrument. The combined detection method as follows: the blood samples were assayed by conventional nucleic acid test of 6 mixed samples, at same time, 6 mixed samples were treated with polyethylene glycol precipitation method to concentrate the virus, then the nucleic acid test of blood samples was performed; the single detection method as follows: firstly the conventional nucleic acid test of single sample was performed, then the positive reactive samples after re-examination were 6-fold diluted to simulate the nucleic acid test of 6-mixed samples. The positive rate of positive samples detected by combined nucleic acid test, positive samples detected by nucleic acid test of mixed virus concentration and positive samples detected by single nucleic acid test was statistically analyzed. In addition, for HBV + persons the serological test yet should be performed. In 22 716 samples detected by nucleic acid test of 6 mixed samples (MP-6-NAT) , 9 cases were HBV + (0.40‰, 9/22716); at same time, the detection of same samples by nucleic acid test of mixed sample virus concentration showed 29 cases of HBV + (1.28‰, 29/22716). In 9265 samples detected by single nucleic acid test(ID-NAT) 12 cases showed HBV + (1.30‰, 12/9265), meanwhile the detection of these 12 samples with HBV + by 6-fold dilution for virus concentration found only 4 samples with HBV + . In serological qualified samples, ID-NAT unqualified rate was 1.28‰, which was higher than that of MP-6-NAT(0.4‰) (χ 2 =8.11, P0.05). In 41 samples with HBsAg - HBV DNA + detected by ELISA, 36 samples were confirmed to be occult HBV

  18. The association between low-grade inflammation, iron status and nucleic acid oxidation in the elderly

    DEFF Research Database (Denmark)

    Broedbaek, Kasper; Siersma, Volkert Dirk; Andersen, Jon T

    2011-01-01

    This study applied a case-control approach to investigate the association between low-grade inflammation, defined by high values within the normal range of C-reactive protein (CRP) and interleukin-6 (IL-6), and urinary markers of nucleic acid oxidation. No differences in excretion of urinary...... markers of nucleic acid oxidation between cases and controls were found and multivariable linear regression analysis showed no association between urinary markers of nucleic acid oxidation and inflammatory markers. Post-hoc multivariable linear regression analysis showed significant associations between...... suggest that low-grade inflammation only has a negligible impact on whole body nucleic acid oxidation, whereas iron status seems to be of great importance....

  19. Nucleic Acid Extraction from Synthetic Mars Analog Soils for in situ Life Detection

    Science.gov (United States)

    Mojarro, Angel; Ruvkun, Gary; Zuber, Maria T.; Carr, Christopher E.

    2017-08-01

    Biological informational polymers such as nucleic acids have the potential to provide unambiguous evidence of life beyond Earth. To this end, we are developing an automated in situ life-detection instrument that integrates nucleic acid extraction and nanopore sequencing: the Search for Extra-Terrestrial Genomes (SETG) instrument. Our goal is to isolate and determine the sequence of nucleic acids from extant or preserved life on Mars, if, for example, there is common ancestry to life on Mars and Earth. As is true of metagenomic analysis of terrestrial environmental samples, the SETG instrument must isolate nucleic acids from crude samples and then determine the DNA sequence of the unknown nucleic acids. Our initial DNA extraction experiments resulted in low to undetectable amounts of DNA due to soil chemistry-dependent soil-DNA interactions, namely adsorption to mineral surfaces, binding to divalent/trivalent cations, destruction by iron redox cycling, and acidic conditions. Subsequently, we developed soil-specific extraction protocols that increase DNA yields through a combination of desalting, utilization of competitive binders, and promotion of anaerobic conditions. Our results suggest that a combination of desalting and utilizing competitive binders may establish a "universal" nucleic acid extraction protocol suitable for analyzing samples from diverse soils on Mars.

  20. The effects of borate minerals on the synthesis of nucleic acid bases, amino acids and biogenic carboxylic acids from formamide.

    Science.gov (United States)

    Saladino, Raffaele; Barontini, Maurizio; Cossetti, Cristina; Di Mauro, Ernesto; Crestini, Claudia

    2011-08-01

    The thermal condensation of formamide in the presence of mineral borates is reported. The products afforded are precursors of nucleic acids, amino acids derivatives and carboxylic acids. The efficiency and the selectivity of the reaction was studied in relation to the elemental composition of the 18 minerals analyzed. The possibility of synthesizing at the same time building blocks of both genetic and metabolic apparatuses, along with the production of amino acids, highlights the interest of the formamide/borate system in prebiotic chemistry.

  1. Peptide nucleic acid probe for protein affinity purification based on biotin-streptavidin interaction and peptide nucleic acid strand hybridization.

    Science.gov (United States)

    Tse, Jenny; Wang, Yuanyuan; Zengeya, Thomas; Rozners, Eriks; Tan-Wilson, Anna

    2015-02-01

    We describe a new method for protein affinity purification that capitalizes on the high affinity of streptavidin for biotin but does not require dissociation of the biotin-streptavidin complex for protein retrieval. Conventional reagents place both the selectively reacting group (the "warhead") and the biotin on the same molecule. We place the warhead and the biotin on separate molecules, each linked to a short strand of peptide nucleic acid (PNA), synthetic polymers that use the same bases as DNA but attached to a backbone that is resistant to attack by proteases and nucleases. As in DNA, PNA strands with complementary base sequences hybridize. In conditions that favor PNA duplex formation, the warhead strand (carrying the tagged protein) and the biotin strand form a complex that is held onto immobilized streptavidin. As in DNA, the PNA duplex dissociates at moderately elevated temperature; therefore, retrieval of the tagged protein is accomplished by a brief exposure to heat. Using iodoacetate as the warhead, 8-base PNA strands, biotin, and streptavidin-coated magnetic beads, we demonstrate retrieval of the cysteine protease papain. We were also able to use our iodoacetyl-PNA:PNA-biotin probe for retrieval and identification of a thiol reductase and a glutathione transferase from soybean seedling cotyledons. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. DimaSense™: A Novel Nucleic Acid Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Stadler, A.

    2011-05-18

    Recently, we developed a suite of methods for the rational design and fabrication of well-defined nanoparticle architectures, including clusters using bio-encoded nanoscale building blocks and layer-by-layer stepwise assembly on a solid support. In particular, the Nano-Assembly platform using Encoded Solid Supports (NAESS) allows for controlled interactions, purification of side products, modularity of design, and the construction of complex nanoparticle architectures. This approach offers several advantages over the current art of designing nanoparticle clusters, which include the high-yield synthesis of desired architectures, a 'plug-and-play' design allowing for the introduction of a variety of sensing modalities, and ease of scalability in high-throughput and synthesis yield. As a utility proof of concept, we implemented our unique cluster fabrication platform to design gold nanoparticle dimers which are linked via a single-stranded DNA oligonucleotide recognition motif. The design of this motif is such that binding of complementary nucleic acids results in specific, selective and rapid dimer dissociation, which can be monitored by dynamic light scattering (DLS). We demonstrated single level mismatch selectivity using this approach. The limit of detection was determined to be 1011 molecules of synthetic target RNA or DNA within 30 minutes of incubation at 33 C. This detection limit is determined by the dimer's concentration which can be probed by currently used standard DLS instruments. We also demonstrated a specific detection of target RNA in a solution containing competing 1,000-fold excess of non-complementary DNA fragments, 10% BSA, and endonucleases. Molecular diagnostic companies, RNA-based technology developers, and personalized medicine companies have applications that could benefit from using DimaSense{trademark}. The technology represents a platform which enables the simple and reasonably inexpensive design and fabrication of highly

  3. Artificial specific binders directly recovered from chemically modified nucleic acid libraries.

    Science.gov (United States)

    Kasahara, Yuuya; Kuwahara, Masayasu

    2012-01-01

    Specific binders comprised of nucleic acids, that is, RNA/DNA aptamers, are attractive functional biopolymers owing to their potential broad application in medicine, food hygiene, environmental analysis, and biological research. Despite the large number of reports on selection of natural DNA/RNA aptamers, there are not many examples of direct screening of chemically modified nucleic acid aptamers. This is because of (i) the inferior efficiency and accuracy of polymerase reactions involving transcription/reverse-transcription of modified nucleotides compared with those of natural nucleotides, (ii) technical difficulties and additional time and effort required when using modified nucleic acid libraries, and (iii) ambiguous efficacies of chemical modifications in binding properties until recently; in contrast, the effects of chemical modifications on biostability are well studied using various nucleotide analogs. Although reports on the direct screening of a modified nucleic acid library remain in the minority, chemical modifications would be essential when further functional expansion of nucleic acid aptamers, in particular for medical and biological uses, is considered. This paper focuses on enzymatic production of chemically modified nucleic acids and their application to random screenings. In addition, recent advances and possible future research are also described.

  4. Artificial Specific Binders Directly Recovered from Chemically Modified Nucleic Acid Libraries

    Directory of Open Access Journals (Sweden)

    Yuuya Kasahara

    2012-01-01

    Full Text Available Specific binders comprised of nucleic acids, that is, RNA/DNA aptamers, are attractive functional biopolymers owing to their potential broad application in medicine, food hygiene, environmental analysis, and biological research. Despite the large number of reports on selection of natural DNA/RNA aptamers, there are not many examples of direct screening of chemically modified nucleic acid aptamers. This is because of (i the inferior efficiency and accuracy of polymerase reactions involving transcription/reverse-transcription of modified nucleotides compared with those of natural nucleotides, (ii technical difficulties and additional time and effort required when using modified nucleic acid libraries, and (iii ambiguous efficacies of chemical modifications in binding properties until recently; in contrast, the effects of chemical modifications on biostability are well studied using various nucleotide analogs. Although reports on the direct screening of a modified nucleic acid library remain in the minority, chemical modifications would be essential when further functional expansion of nucleic acid aptamers, in particular for medical and biological uses, is considered. This paper focuses on enzymatic production of chemically modified nucleic acids and their application to random screenings. In addition, recent advances and possible future research are also described.

  5. Comparative evaluation of three commercial systems for nucleic acid extraction from urine specimens.

    Science.gov (United States)

    Tang, Yi-Wei; Sefers, Susan E; Li, Haijing; Kohn, Debra J; Procop, Gary W

    2005-09-01

    A nucleic acid extraction system that can handle small numbers of specimens with a short test turnaround time and short hands-on time is desirable for emergent testing. We performed a comparative validation on three systems: the MagNA Pure compact system (Compact), the NucliSens miniMAG extraction instrument (miniMAG), and the BioRobot EZ1 system (EZ1). A total of 75 urine specimens submitted for polyomavirus BK virus detection were used. The human beta-actin gene was detected on 75 (100%), 75 (100%), and 72 (96%) nucleic acid extracts prepared by the miniMAG, EZ1, and Compact, respectively. The miniMAG produced the highest quantity of nucleic acids and the best precision among the three systems. The agreement rate was 100% for BKV detection on nucleic acid extracts prepared by the three extraction systems. When a full panel of specimens was run, the hands-on time and test turnaround time were 105.7 and 121.1 min for miniMAG, 6.1 and 22.6 min for EZ1, and 7.4 and 33.7 min for Compact, respectively. The EZ1 and Compact systems processed automatic nucleic acid extraction properly, providing a good solution to the need for sporadic but emergent specimen detection. The miniMAG yielded the highest quantity of nucleic acids, suggesting that this system would be the best for specimens containing a low number of microorganisms of interest.

  6. Identification of nucleic acid binding sites on translin-associated factor X (TRAX protein.

    Directory of Open Access Journals (Sweden)

    Gagan Deep Gupta

    Full Text Available Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity.

  7. Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein

    Science.gov (United States)

    Gupta, Gagan Deep; Kumar, Vinay

    2012-01-01

    Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937

  8. Nucleic acid purification from plants, animals and microbes in under 30 seconds.

    Directory of Open Access Journals (Sweden)

    Yiping Zou

    2017-11-01

    Full Text Available Nucleic acid amplification is a powerful molecular biology tool, although its use outside the modern laboratory environment is limited due to the relatively cumbersome methods required to extract nucleic acids from biological samples. To address this issue, we investigated a variety of materials for their suitability for nucleic acid capture and purification. We report here that untreated cellulose-based paper can rapidly capture nucleic acids within seconds and retain them during a single washing step, while contaminants present in complex biological samples are quickly removed. Building on this knowledge, we have successfully created an equipment-free nucleic acid extraction dipstick methodology that can obtain amplification-ready DNA and RNA from plants, animals, and microbes from difficult biological samples such as blood and leaves from adult trees in less than 30 seconds. The simplicity and speed of this method as well as the low cost and availability of suitable materials (e.g., common paper towelling, means that nucleic acid extraction is now more accessible and affordable for researchers and the broader community. Furthermore, when combined with recent advancements in isothermal amplification and naked eye DNA visualization techniques, the dipstick extraction technology makes performing molecular diagnostic assays achievable in limited resource settings including university and high school classrooms, field-based environments, and developing countries.

  9. Probing the mechanical properties, conformational changes, and interactions of nucleic acids with magnetic tweezers.

    Science.gov (United States)

    Kriegel, Franziska; Ermann, Niklas; Lipfert, Jan

    2017-01-01

    Nucleic acids are central to the storage and transmission of genetic information. Mechanical properties, along with their sequence, both enable and fundamentally constrain the biological functions of DNA and RNA. For small deformations from the equilibrium conformations, nucleic acids are well described by an isotropic elastic rod model. However, external forces and torsional strains can induce conformational changes, giving rise to a complex force-torque phase diagram. This review focuses on magnetic tweezers as a powerful tool to precisely determine both the elastic parameters and conformational transitions of nucleic acids under external forces and torques at the single-molecule level. We review several variations of magnetic tweezers, in particular conventional magnetic tweezers, freely orbiting magnetic tweezers and magnetic torque tweezers, and discuss their characteristic capabilities. We then describe the elastic rod model for DNA and RNA and discuss conformational changes induced by mechanical stress. The focus lies on the responses to torque and twist, which are crucial in the mechanics and interactions of nucleic acids and can directly be measured using magnetic tweezers. We conclude by highlighting several recent studies of nucleic acid-protein and nucleic acid-small-molecule interactions as further applications of magnetic tweezers and give an outlook of some exciting developments to come. Copyright © 2016. Published by Elsevier Inc.

  10. Targeting Cytosolic Nucleic Acid-Sensing Pathways for Cancer Immunotherapies.

    Science.gov (United States)

    Iurescia, Sandra; Fioretti, Daniela; Rinaldi, Monica

    2018-01-01

    The innate immune system provides the first line of defense against pathogen infection though also influences pathways involved in cancer immunosurveillance. The innate immune system relies on a limited set of germ line-encoded sensors termed pattern recognition receptors (PRRs), signaling proteins and immune response factors. Cytosolic receptors mediate recognition of danger damage-associated molecular patterns (DAMPs) signals. Once activated, these sensors trigger multiple signaling cascades, converging on the production of type I interferons and proinflammatory cytokines. Recent studies revealed that PRRs respond to nucleic acids (NA) released by dying, damaged, cancer cells, as danger DAMPs signals, and presence of signaling proteins across cancer types suggests that these signaling mechanisms may be involved in cancer biology. DAMPs play important roles in shaping adaptive immune responses through the activation of innate immune cells and immunological response to danger DAMPs signals is crucial for the host response to cancer and tumor rejection. Furthermore, PRRs mediate the response to NA in several vaccination strategies, including DNA immunization. As route of double-strand DNA intracellular entry, DNA immunization leads to expression of key components of cytosolic NA-sensing pathways. The involvement of NA-sensing mechanisms in the antitumor response makes these pathways attractive drug targets. Natural and synthetic agonists of NA-sensing pathways can trigger cell death in malignant cells, recruit immune cells, such as DCs, CD8 + T cells, and NK cells, into the tumor microenvironment and are being explored as promising adjuvants in cancer immunotherapies. In this minireview, we discuss how cGAS-STING and RIG-I-MAVS pathways have been targeted for cancer treatment in preclinical translational researches. In addition, we present a targeted selection of recent clinical trials employing agonists of cytosolic NA-sensing pathways showing how these pathways

  11. DSSR-enhanced visualization of nucleic acid structures in Jmol.

    Science.gov (United States)

    Hanson, Robert M; Lu, Xiang-Jun

    2017-07-03

    Sophisticated and interactive visualizations are essential for making sense of the intricate 3D structures of macromolecules. For proteins, secondary structural components are routinely featured in molecular graphics visualizations. However, the field of RNA structural bioinformatics is still lagging behind; for example, current molecular graphics tools lack built-in support even for base pairs, double helices, or hairpin loops. DSSR (Dissecting the Spatial Structure of RNA) is an integrated and automated command-line tool for the analysis and annotation of RNA tertiary structures. It calculates a comprehensive and unique set of features for characterizing RNA, as well as DNA structures. Jmol is a widely used, open-source Java viewer for 3D structures, with a powerful scripting language. JSmol, its reincarnation based on native JavaScript, has a predominant position in the post Java-applet era for web-based visualization of molecular structures. The DSSR-Jmol integration presented here makes salient features of DSSR readily accessible, either via the Java-based Jmol application itself, or its HTML5-based equivalent, JSmol. The DSSR web service accepts 3D coordinate files (in mmCIF or PDB format) initiated from a Jmol or JSmol session and returns DSSR-derived structural features in JSON format. This seamless combination of DSSR and Jmol/JSmol brings the molecular graphics of 3D RNA structures to a similar level as that for proteins, and enables a much deeper analysis of structural characteristics. It fills a gap in RNA structural bioinformatics, and is freely accessible (via the Jmol application or the JSmol-based website http://jmol.x3dna.org). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. A modern mode of activation for nucleic acid enzymes.

    Directory of Open Access Journals (Sweden)

    Dominique Lévesque

    2007-07-01

    Full Text Available Through evolution, enzymes have developed subtle modes of activation in order to ensure the sufficiently high substrate specificity required by modern cellular metabolism. One of these modes is the use of a target-dependent module (i.e. a docking domain such as those found in signalling kinases. Upon the binding of the target to a docking domain, the substrate is positioned within the catalytic site. The prodomain acts as a target-dependent module switching the kinase from an off state to an on state. As compared to the allosteric mode of activation, there is no need for the presence of a third partner. None of the ribozymes discovered to date have such a mode of activation, nor does any other known RNA. Starting from a specific on/off adaptor for the hepatitis delta virus ribozyme, that differs but has a mechanism reminiscent of this signalling kinase, we have adapted this mode of activation, using the techniques of molecular engineering, to both catalytic RNAs and DNAs exhibiting various activities. Specifically, we adapted three cleaving ribozymes (hepatitis delta virus, hammerhead and hairpin ribozymes, a cleaving 10-23 deoxyribozyme, a ligating hairpin ribozyme and an artificially selected capping ribozyme. In each case, there was a significant gain in terms of substrate specificity. Even if this mode of control is unreported for natural catalytic nucleic acids, its use needs not be limited to proteinous enzymes. We suggest that the complexity of the modern cellular metabolism might have been an important selective pressure in this evolutionary process.

  13. Chance and necessity in the selection of nucleic acid catalysts

    Science.gov (United States)

    Lorsch, J. R.; Szostak, J. W.

    1996-01-01

    In Tom Stoppard's famous play [Rosencrantz and Guildenstern are Dead], the ill-fated heroes toss a coin 101 times. The first 100 times they do so the coin lands heads up. The chance of this happening is approximately 1 in 10(30), a sequence of events so rare that one might argue that it could only happen in such a delightful fiction. Similarly rare events, however, may underlie the origins of biological catalysis. What is the probability that an RNA, DNA, or protein molecule of a given random sequence will display a particular catalytic activity? The answer to this question determines whether a collection of such sequences, such as might result from prebiotic chemistry on the early earth, is extremely likely or unlikely to contain catalytically active molecules, and hence whether the origin of life itself is a virtually inevitable consequence of chemical laws or merely a bizarre fluke. The fact that a priori estimates of this probability, given by otherwise informed chemists and biologists, ranged from 10(-5) to 10(-50), inspired us to begin to address the question experimentally. As it turns out, the chance that a given random sequence RNA molecule will be able to catalyze an RNA polymerase-like phosphoryl transfer reaction is close to 1 in 10(13), rare enough, to be sure, but nevertheless in a range that is comfortably accessible by experiment. It is the purpose of this Account to describe the recent advances in combinatorial biochemistry that have made it possible for us to explore the abundance and diversity of catalysts existing in nucleic acid sequence space.

  14. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Directory of Open Access Journals (Sweden)

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  15. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  16. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

    Science.gov (United States)

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

    2014-07-15

    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    Science.gov (United States)

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  19. Highly Efficient Synthesis of Allopurinol Locked Nucleic Acid Monomer by C6 Deamination of 8-Aza-7-bromo-7-deazaadenine Locked Nucleic Acid Monomer

    DEFF Research Database (Denmark)

    Kosbar, Tamer Reda El-Saeed; Sofan, M.; Abou-Zeid, L.

    2013-01-01

    An allopurinol locked nucleic acid (LNA) monomer was prepared by a novel strategy through C6 deamination of the corresponding 8-aza-7-bromo-7-deazaadenine LNA monomer with aqueous sodium hydroxide. An 8-aza-7-deazaadenine LNA monomer was also synthesized by a modification of the new synthetic...... the required LNA monomers....

  20. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

    Science.gov (United States)

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

    2018-10-05

    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Science.gov (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  2. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Science.gov (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  3. DNA-like double helix formed by peptide nucleic acid

    DEFF Research Database (Denmark)

    Wittung, P; Nielsen, Peter E.; Buchardt, O

    1994-01-01

    Although the importance of the nucleobases in the DNA double helix is well understood, the evolutionary significance of the deoxyribose phosphate backbone and the contribution of this chemical entity to the overall helical structure and stability of the double helix is not so clear. Peptide nucleic...

  4. Nucleic acid therapeutic carriers with on-demand triggered release.

    Science.gov (United States)

    Venkatesh, Siddarth; Wower, Jacek; Byrne, Mark E

    2009-09-01

    optimization of a rich toolbox of novel drug and gene delivery platforms. We anticipate further inquiry into nucleic acid based programmable on-demand switches and modulatory devices of exquisite sensitivity and control.

  5. Integrated sample-to-detection chip for nucleic acid test assays.

    Science.gov (United States)

    Prakash, R; Pabbaraju, K; Wong, S; Tellier, R; Kaler, K V I S

    2016-06-01

    Nucleic acid based diagnostic techniques are routinely used for the detection of infectious agents. Most of these assays rely on nucleic acid extraction platforms for the extraction and purification of nucleic acids and a separate real-time PCR platform for quantitative nucleic acid amplification tests (NATs). Several microfluidic lab on chip (LOC) technologies have been developed, where mechanical and chemical methods are used for the extraction and purification of nucleic acids. Microfluidic technologies have also been effectively utilized for chip based real-time PCR assays. However, there are few examples of microfluidic systems which have successfully integrated these two key processes. In this study, we have implemented an electro-actuation based LOC micro-device that leverages multi-frequency actuation of samples and reagents droplets for chip based nucleic acid extraction and real-time, reverse transcription (RT) PCR (qRT-PCR) amplification from clinical samples. Our prototype micro-device combines chemical lysis with electric field assisted isolation of nucleic acid in a four channel parallel processing scheme. Furthermore, a four channel parallel qRT-PCR amplification and detection assay is integrated to deliver the sample-to-detection NAT chip. The NAT chip combines dielectrophoresis and electrostatic/electrowetting actuation methods with resistive micro-heaters and temperature sensors to perform chip based integrated NATs. The two chip modules have been validated using different panels of clinical samples and their performance compared with standard platforms. This study has established that our integrated NAT chip system has a sensitivity and specificity comparable to that of the standard platforms while providing up to 10 fold reduction in sample/reagent volumes.

  6. Optimizing scoring function of protein-nucleic acid interactions with both affinity and specificity.

    Directory of Open Access Journals (Sweden)

    Zhiqiang Yan

    Full Text Available Protein-nucleic acid (protein-DNA and protein-RNA recognition is fundamental to the regulation of gene expression. Determination of the structures of the protein-nucleic acid recognition and insight into their interactions at molecular level are vital to understanding the regulation function. Recently, quantitative computational approach has been becoming an alternative of experimental technique for predicting the structures and interactions of biomolecular recognition. However, the progress of protein-nucleic acid structure prediction, especially protein-RNA, is far behind that of the protein-ligand and protein-protein structure predictions due to the lack of reliable and accurate scoring function for quantifying the protein-nucleic acid interactions. In this work, we developed an accurate scoring function (named as SPA-PN, SPecificity and Affinity of the Protein-Nucleic acid interactions for protein-nucleic acid interactions by incorporating both the specificity and affinity into the optimization strategy. Specificity and affinity are two requirements of highly efficient and specific biomolecular recognition. Previous quantitative descriptions of the biomolecular interactions considered the affinity, but often ignored the specificity owing to the challenge of specificity quantification. We applied our concept of intrinsic specificity to connect the conventional specificity, which circumvents the challenge of specificity quantification. In addition to the affinity optimization, we incorporated the quantified intrinsic specificity into the optimization strategy of SPA-PN. The testing results and comparisons with other scoring functions validated that SPA-PN performs well on both the prediction of binding affinity and identification of native conformation. In terms of its performance, SPA-PN can be widely used to predict the protein-nucleic acid structures and quantify their interactions.

  7. Nucleic acid-induced antiviral immunity in invertebrates: an evolutionary perspective.

    Science.gov (United States)

    Wang, Pei-Hui; Weng, Shao-Ping; He, Jian-Guo

    2015-02-01

    Nucleic acids derived from viral pathogens are typical pathogen associated molecular patterns (PAMPs). In mammals, the recognition of viral nucleic acids by pattern recognition receptors (PRRs), which include Toll-like receptors (TLRs) and retinoic acid-inducible gene (RIG)-I-like receptors (RLRs), induces the release of inflammatory cytokines and type I interferons (IFNs) through the activation of nuclear factor κB (NF-κB) and interferon regulatory factor (IRF) 3/7 pathways, triggering the host antiviral state. However, whether nucleic acids can induce similar antiviral immunity in invertebrates remains ambiguous. Several studies have reported that nucleic acid mimics, especially dsRNA mimic poly(I:C), can strongly induce non-specific antiviral immune responses in insects, shrimp, and oyster. This behavior shows multiple similarities to the hallmarks of mammalian IFN responses. In this review, we highlight the current understanding of nucleic acid-induced antiviral immunity in invertebrates. We also discuss the potential recognition and regulatory mechanisms that confer non-specific antiviral immunity on invertebrate hosts. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Directory of Open Access Journals (Sweden)

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  9. Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

    Science.gov (United States)

    Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

    2018-03-09

    Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. [Genotoxic modification of nucleic acid bases and biological consequences of it. Review and prospects of experimental and computational investigations

    Science.gov (United States)

    Poltev, V. I.; Bruskov, V. I.; Shuliupina, N. V.; Rein, R.; Shibata, M.; Ornstein, R.; Miller, J.

    1993-01-01

    The review is presented of experimental and computational data on the influence of genotoxic modification of bases (deamination, alkylation, oxidation) on the structure and biological functioning of nucleic acids. Pathways are discussed for the influence of modification on coding properties of bases, on possible errors of nucleic acid biosynthesis, and on configurations of nucleotide mispairs. The atomic structure of nucleic acid fragments with modified bases and the role of base damages in mutagenesis and carcinogenesis are considered.

  11. Recent advances in delivery of drug-nucleic acid combinations for cancer treatment.

    Science.gov (United States)

    Li, Jing; Wang, Yan; Zhu, Yu; Oupický, David

    2013-12-10

    Cancer treatment that uses a combination of approaches with the ability to affect multiple disease pathways has been proven highly effective in the treatment of many cancers. Combination therapy can include multiple chemotherapeutics or combinations of chemotherapeutics with other treatment modalities like surgery or radiation. However, despite the widespread clinical use of combination therapies, relatively little attention has been given to the potential of modern nanocarrier delivery methods, like liposomes, micelles, and nanoparticles, to enhance the efficacy of combination treatments. This lack of knowledge is particularly notable in the limited success of vectors for the delivery of combinations of nucleic acids with traditional small molecule drugs. The delivery of drug-nucleic acid combinations is particularly challenging due to differences in the physicochemical properties of the two types of agents. This review discusses recent advances in the development of delivery methods using combinations of small molecule drugs and nucleic acid therapeutics to treat cancer. This review primarily focuses on the rationale used for selecting appropriate drug-nucleic acid combinations as well as progress in the development of nanocarriers suitable for simultaneous delivery of drug-nucleic acid combinations. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Possibilities for prognostication of radiation injury in rats by leucocyte nucleic acid levels

    International Nuclear Information System (INIS)

    Minkova, M.; Pantev, T.

    1988-01-01

    The possibilities to prognosticate acute radiation injury by the changes in the amount of nucleic acids in the leucocytes was studied. Experiments were carried out on male Wistar albino rats, gamma-irradiated with nonlethal and sublethal doses of 0.5, 2 and 4 Gy and lethal dose of 8 Gy (LD 90/30 ). The nucleic acid content and the total leucocyte count were determined at definite intervals on days 1-30. The changes in the nucleic acids in nonlethally and sublethally irradiated animals had phase nature, with a clear-cut abortive increase in their amount on days 7-10. In lethally irradiated animals the phase character of the changes was lost and the abortive peak disappeared. By reducing the effectiveness of the lethal radiation dose survival of the population increased from 10-75% through physical and from 10-70% - through chemical protection. The nucleic acid dynamics showed features typical for an injury with possible survival - appearance of abortive peak and resumption of their normal values. It is assumed that determination of leucocyte nucleic acid content may be used for early prognostication of radiation injury, as it allows keen differentiation of the lethal from nonlethal outcome of radiation sickness. The absence of abortive peak (over 50%) by day 14 post-irradiation is a poor prognostic sign

  13. Molecular structure and interactions of nucleic acid components in nanoparticles: ab initio calculations

    International Nuclear Information System (INIS)

    Rubin, Yu.V.; Belous, L.F.

    2012-01-01

    Self-associates of nucleic acid components (stacking trimers and tetramers of the base pairs of nucleic acids) and short fragments of nucleic acids are nanoparticles (linear sizes of these particles are more than 10 A). Modern quantum-mechanical methods and softwares allow one to perform ab initio calculations of the systems consisting of 150-200 atoms with enough large basis sets (for example, 6-31G * ). The aim of this work is to reveal the peculiarities of molecular and electronic structures, as well as the energy features of nanoparticles of nucleic acid components. We had carried out ab initio calculations of the molecular structure and interactions in the stacking dimer, trimer, and tetramer of nucleic base pairs and in the stacking (TpG)(ApC) dimer and (TpGpC) (ApCpG) trimer of nucleotides, which are small DNA fragments. The performed calculations of molecular structures of dimers and trimers of nucleotide pairs showed that the interplanar distance in the structures studied is equal to 3.2 A on average, and the helical angle in a trimer is approximately equal to 30 o : The distance between phosphor atoms in neighboring chains is 13.1 A. For dimers and trimers under study, we calculated the horizontal interaction energies. The analysis of interplanar distances and angles between nucleic bases and their pairs in the calculated short oligomers of nucleic acid base pairs (stacking dimer, trimer, and tetramer) has been carried out. Studies of interactions in the calculated short oligomers showed a considerable role of the cross interaction in the stabilization of the structures. The contribution of cross interactions to the horizontal interactions grows with the length of an oligomer. Nanoparticle components get electric charges in nanoparticles. Longwave low-intensity bands can appear in the electron spectra of nanoparticles.

  14. Labelling of nucleic acid components with tritium by hydrogenolysis of corresponding precursors

    International Nuclear Information System (INIS)

    Myasoedov, V.F.; Kvyatkovskij, Yu.G.; Sidorov, G.V.

    1981-01-01

    To desalt the luates of liquid column chromatography containing components of the nucleic acids different types of activated carbons are used: AG-5, Ou-4, KAD, BAU (SU), Norit (GB) and Carboafin (CS). The Carborafin (CS) carbon proved to be the most efficient for the purpose. Dependences of the adsorption degree on pH, the time of the phases contact, temperature, concentration of the salt background (ammonium formite, lithium chloride) as well as adsorption isotherm are determined for the activated carbon. Desorption conditions of the nucleic acids components from the carbon are studied. It is shown that quantitative desorption is achieved when 1n solution of ammonia is used in 50% ethanole for 50-60 min. Data on practical application of the method to desalt the eluates containing tritiated nucleic acid components with a high activity are presented [ru

  15. [Comparison of two nucleic acid extraction methods for norovirus in oysters].

    Science.gov (United States)

    Yuan, Qiao; Li, Hui; Deng, Xiaoling; Mo, Yanling; Fang, Ling; Ke, Changwen

    2013-04-01

    To explore a convenient and effective method for norovirus nucleic acid extraction from oysters suitable for long-term viral surveillance. Two methods, namely method A (glycine washing and polyethylene glycol precipitation of the virus followed by silica gel centrifugal column) and method B (protease K digestion followed by application of paramagnetic silicon) were compared for their performance in norovirus nucleic acid extraction from oysters. Real-time RT-PCR was used to detect norovirus in naturally infected oysters and in oysters with induced infection. The two methods yielded comparable positive detection rates for the samples, but the recovery rate of the virus was higher with method B than with method A. Method B is a more convenient and rapid method for norovirus nucleic acid extraction from oysters and suitable for long-term surveillance of norovirus.

  16. Engineering nucleic acid structures for programmable molecular circuitry and intracellular biocomputation

    Science.gov (United States)

    Li, Jiang; Green, Alexander A.; Yan, Hao; Fan, Chunhai

    2017-11-01

    Nucleic acids have attracted widespread attention due to the simplicity with which they can be designed to form discrete structures and programmed to perform specific functions at the nanoscale. The advantages of DNA/RNA nanotechnology offer numerous opportunities for in-cell and in-vivo applications, and the technology holds great promise to advance the growing field of synthetic biology. Many elegant examples have revealed the potential in integrating nucleic acid nanostructures in cells and in vivo where they can perform important physiological functions. In this Review, we summarize the current abilities of DNA/RNA nanotechnology to realize applications in live cells and then discuss the key problems that must be solved to fully exploit the useful properties of nanostructures. Finally, we provide viewpoints on how to integrate the tools provided by DNA/RNA nanotechnology and related new technologies to construct nucleic acid nanostructure-based molecular circuitry for synthetic biology.

  17. Key Aspects of Nucleic Acid Library Design for in Vitro Selection

    Science.gov (United States)

    Vorobyeva, Maria A.; Davydova, Anna S.; Vorobjev, Pavel E.; Pyshnyi, Dmitrii V.; Venyaminova, Alya G.

    2018-01-01

    Nucleic acid aptamers capable of selectively recognizing their target molecules have nowadays been established as powerful and tunable tools for biospecific applications, be it therapeutics, drug delivery systems or biosensors. It is now generally acknowledged that in vitro selection enables one to generate aptamers to almost any target of interest. However, the success of selection and the affinity of the resulting aptamers depend to a large extent on the nature and design of an initial random nucleic acid library. In this review, we summarize and discuss the most important features of the design of nucleic acid libraries for in vitro selection such as the nature of the library (DNA, RNA or modified nucleotides), the length of a randomized region and the presence of fixed sequences. We also compare and contrast different randomization strategies and consider computer methods of library design and some other aspects. PMID:29401748

  18. New nucleic acid testing devices to diagnose infectious diseases in resource-limited settings.

    Science.gov (United States)

    Maffert, P; Reverchon, S; Nasser, W; Rozand, C; Abaibou, H

    2017-10-01

    Point-of-care diagnosis based on nucleic acid testing aims to incorporate all the analytical steps, from sample preparation to nucleic acid amplification and detection, in a single device. This device needs to provide a low-cost, robust, sensitive, specific, and easily readable analysis. Microfluidics has great potential for handling small volumes of fluids on a single platform. Microfluidic technology has recently been applied to paper, which is already used in low-cost lateral flow tests. Nucleic acid extraction from a biological specimen usually requires cell filtration and lysis on specific membranes, while affinity matrices, such as chitosan or polydiacetylene, are well suited to concentrating nucleic acids for subsequent amplification. Access to electricity is often difficult in resource-limited areas, so the amplification step needs to be equipment-free. Consequently, the reaction has to be isothermal to alleviate the need for a thermocycler. LAMP, NASBA, HDA, and RPA are examples of the technologies available. Nucleic acid detection techniques are currently based on fluorescence, colorimetry, or chemiluminescence. For point-of-care diagnostics, the results should be readable with the naked eye. Nowadays, interpretation and communication of results to health professionals could rely on a smartphone, used as a telemedicine device. The major challenge of creating an "all-in-one" diagnostic test involves the design of an optimal solution and a sequence for each analytical step, as well as combining the execution of all these steps on a single device. This review provides an overview of available materials and technologies which seem to be adapted to point-of-care nucleic acid-based diagnosis, in low-resource areas.

  19. Effects of nucleic acid local structure and magnesium ions on minus-strand transfer mediated by the nucleic acid chaperone activity of HIV-1 nucleocapsid protein

    OpenAIRE

    Wu, Tiyun; Heilman-Miller, Susan L.; Levin, Judith G.

    2007-01-01

    HIV-1 nucleocapsid protein (NC) is a nucleic acid chaperone, which is required for highly specific and efficient reverse transcription. Here, we demonstrate that local structure of acceptor RNA at a potential nucleation site, rather than overall thermodynamic stability, is a critical determinant for the minus-strand transfer step (annealing of acceptor RNA to (−) strong-stop DNA followed by reverse transcriptase (RT)-catalyzed DNA extension). In our system, destabilization of a stem-loop stru...

  20. Interactions of hydrated divalent metal cations with nucleic acid bases. How to relate the gas phase data to solution situation and binding selectivity in nucleic acids

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Sychrovský, Vladimír; Hobza, Pavel; Šponer, Jiří

    2004-01-01

    Roč. 6, č. 10 (2004), s. 2772-2780 ISSN 1463-9076 R&D Projects: GA MŠk LN00A016; GA MŠk LN00A032 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : nucleic acids * gas phase * guanine Subject RIV: BO - Biophysics Impact factor: 2.076, year: 2004

  1. Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.

    Science.gov (United States)

    Lund, F; Telhag, H

    1978-12-01

    The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.

  2. Synthetic oligonucleotide antigens modified with locked nucleic acids detect disease specific antibodies

    DEFF Research Database (Denmark)

    Samuelsen, Simone V; Solov'yov, Ilia A.; Balboni, Imelda M.

    2016-01-01

    New techniques to detect and quantify antibodies to nucleic acids would provide a significant advance over current methods, which often lack specificity. We investigate the potential of novel antigens containing locked nucleic acids (LNAs) as targets for antibodies. Particularly, employing...... molecular dynamics we predict optimal nucleotide composition for targeting DNA-binding antibodies. As a proof of concept, we address a problem of detecting anti-DNA antibodies that are characteristic of systemic lupus erythematosus, a chronic autoimmune disease with multiple manifestations. We test the best...... that the novel method is a promising tool to create antigens for research and point-of-care monitoring of anti-DNA antibodies....

  3. Novel (Phenylethynyl)pyrene-LNA Constructs for Fluorescence SNP Sensing in Polymorphic Nucleic Acid Targets

    DEFF Research Database (Denmark)

    Astakhova, Irina Kira; Samokhina, Evgeniya; Babu, B Ravindra

    2012-01-01

    We describe fluorescent oligonucleotide probes labeled with novel (phenylethynyl)pyrene dyes attached to locked nucleic acids. Furthermore, we prove the utility of these probes for the effective detection of single-nucleotide polymorphisms in natural nucleic acids. High-affinity hybridization......DNA and RNA gene fragments. Target sequences were obtained by analysis of 200 clinical samples from patients currently receiving anti-HIV/AIDS combination therapy at the Russian Federal AIDS Center. Using these fluorescent oligonucleotides, we were able to detect the target mutation despite all the challenges...

  4. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    Directory of Open Access Journals (Sweden)

    Carl A. Batt

    2009-05-01

    Full Text Available The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform.

  5. Efficacy of peptide nucleic acid and selected conjugates against specific cellular pathologies of amyotrophic lateral sclerosis.

    Science.gov (United States)

    Browne, Elisse C; Parakh, Sonam; Duncan, Luke F; Langford, Steven J; Atkin, Julie D; Abbott, Belinda M

    2016-04-01

    Cellular studies have been undertaken on a nonamer peptide nucleic acid (PNA) sequence, which binds to mRNA encoding superoxide dismutase 1, and a series of peptide nucleic acids conjugated to synthetic lipophilic vitamin analogs including a recently prepared menadione (vitamin K) analog. Reduction of both mutant superoxide dismutase 1 inclusion formation and endoplasmic reticulum stress, two of the key cellular pathological hallmarks in amyotrophic lateral sclerosis, by two of the prepared PNA oligomers is reported for the first time. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  6. Nucleic acid metabolism in hemopoietic tissues of polycythemic rats during long-term fractionated irradiation

    International Nuclear Information System (INIS)

    Mushkacheva, G.S.; Murzina, L.D.

    1980-01-01

    A study was made of the effect of long-term fractionated exposure with a daily dose of 50 R on the nucleic acid metabolism in hemopoietic tissues (bone marrow and spleen) of rats with erythropoiesis selectively inhibited by posttransfusion polycythemia. The comparison of present and previously obtained results enables us to conclude that the pathways of changes in the nucleic acid metabolism, which is responsible for hemopoiesis compensation during long-term exposure, are, in the main, similar for both white and red compartments of hemopoiesis

  7. Recent advances in nanopore-based nucleic acid analysis and sequencing

    International Nuclear Information System (INIS)

    Shi, Jidong; Fang, Ying; Hou, Junfeng

    2016-01-01

    Nanopore-based sequencing platforms are transforming the field of genomic science. This review (containing 116 references) highlights some recent progress on nanopore-based nucleic acid analysis and sequencing. These studies are classified into three categories, biological, solid-state, and hybrid nanopores, according to their nanoporous materials. We begin with a brief description of the translocation-based detection mechanism of nanopores. Next, specific examples are given in nanopore-based nucleic acid analysis and sequencing, with an emphasis on identifying strategies that can improve the resolution of nanopores. This review concludes with a discussion of future research directions that will advance the practical applications of nanopore technology. (author)

  8. Structure and behaviour of proteins, nucleic acids and viruses from vibrational Raman optical activity

    DEFF Research Database (Denmark)

    Barron, L.D.; Blanch, E.W.; McColl, I.H.

    2003-01-01

    stacking arrangement and the mutual orientation of the sugar and base rings around the C-N glycosidic link. The ROA spectra of intact viruses provide information on the folds of the coat proteins and the nucleic acid structure. The large number of structure-sensitive bands in protein ROA spectra...... is especially favourable for fold determination using pattern recognition techniques. This article gives a brief account of the ROA technique and presents the ROA spectra of a selection of proteins, nucleic acids and viruses that illustrate the applications of ROA spectroscopy in biomolecular research....

  9. Accuracy assessment of the linear Poisson-Boltzmann equation and reparametrization of the OBC generalized Born model for nucleic acids and nucleic acid-protein complexes.

    Science.gov (United States)

    Fogolari, Federico; Corazza, Alessandra; Esposito, Gennaro

    2015-04-05

    The generalized Born model in the Onufriev, Bashford, and Case (Onufriev et al., Proteins: Struct Funct Genet 2004, 55, 383) implementation has emerged as one of the best compromises between accuracy and speed of computation. For simulations of nucleic acids, however, a number of issues should be addressed: (1) the generalized Born model is based on a linear model and the linearization of the reference Poisson-Boltmann equation may be questioned for highly charged systems as nucleic acids; (2) although much attention has been given to potentials, solvation forces could be much less sensitive to linearization than the potentials; and (3) the accuracy of the Onufriev-Bashford-Case (OBC) model for nucleic acids depends on fine tuning of parameters. Here, we show that the linearization of the Poisson Boltzmann equation has mild effects on computed forces, and that with optimal choice of the OBC model parameters, solvation forces, essential for molecular dynamics simulations, agree well with those computed using the reference Poisson-Boltzmann model. © 2015 Wiley Periodicals, Inc.

  10. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

    Science.gov (United States)

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

    2017-08-01

    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  11. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

    Science.gov (United States)

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

    2015-03-02

    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Science.gov (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  13. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Science.gov (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  14. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  15. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  16. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  17. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

    Science.gov (United States)

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

    2014-09-01

    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Science.gov (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  19. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  20. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

    Science.gov (United States)

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

    2015-08-04

    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  1. Structural aspects of catalytic mechanisms of endonucleases and their binding to nucleic acids

    Energy Technology Data Exchange (ETDEWEB)

    Zhukhlistova, N. E.; Balaev, V. V.; Lyashenko, A. V.; Lashkov, A. A., E-mail: alashkov83@gmail.com [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2012-05-15

    Endonucleases (EC 3.1) are enzymes of the hydrolase class that catalyze the hydrolytic cleavage of deoxyribonucleic and ribonucleic acids at any region of the polynucleotide chain. Endonucleases are widely used both in biotechnological processes and in veterinary medicine as antiviral agents. Medical applications of endonucleases in human cancer therapy hold promise. The results of X-ray diffraction studies of the spatial organization of endonucleases and their complexes and the mechanism of their action are analyzed and generalized. An analysis of the structural studies of this class of enzymes showed that the specific binding of enzymes to nucleic acids is characterized by interactions with nitrogen bases and the nucleotide backbone, whereas the nonspecific binding of enzymes is generally characterized by interactions only with the nucleic-acid backbone. It should be taken into account that the specificity can be modulated by metal ions and certain low-molecular-weight organic compounds. To test the hypotheses about specific and nonspecific nucleic-acid-binding proteins, it is necessary to perform additional studies of atomic-resolution three-dimensional structures of enzyme-nucleic-acid complexes by methods of structural biology.

  2. DMPD: Plasmacytoid dendritic cells: sensing nucleic acids in viral infection andautoimmune diseases. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18641647 Plasmacytoid dendritic cells: sensing nucleic acids in viral infection andautoimmune dise... (.csml) Show Plasmacytoid dendritic cells: sensing nucleic acids in viral infection andautoimmune diseases....iral infection andautoimmune diseases. Authors Gilliet M, Cao W, Liu YJ. Publication Nat Rev Immunol. 2008 A

  3. Unlocked Nucleic Acids with a Pyrene-Modified Uracil: Synthesis, Hybridization Studies, Fluorescent Properties and i-Motif Stability

    Czech Academy of Sciences Publication Activity Database

    Perlíková, Pavla; Karlsen, K. K.; Pedersen, E. B.; Wengel, J.

    2014-01-01

    Roč. 15, č. 1 (2014), s. 146-156 ISSN 1439-4227 Grant - others:European Research Council(XE) FP7-268776 Institutional support: RVO:61388963 Keywords : fluorescence * i-motifs * nucleic acid hybridization * oligonucleotides * unlocked nucleic acids Subject RIV: CE - Biochemistry Impact factor: 3.088, year: 2014

  4. The pattern recognition molecule deleted in malignant brain tumors 1 (DMBT1) and synthetic mimics inhibit liposomal nucleic acid delivery

    DEFF Research Database (Denmark)

    Lund Hansen, Pernille; Blaich, Stephanie; End, Caroline

    2011-01-01

    Liposomal nucleic acid delivery is a preferred option for therapeutic settings. The cellular pattern recognition molecule DMBT1, secreted at high levels in various diseases, and synthetic mimics efficiently inhibit liposomal nucleic acid delivery to human cells. These findings may have relevance...

  5. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Science.gov (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2018-06-01

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  6. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Science.gov (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  7. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    Science.gov (United States)

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  9. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    Science.gov (United States)

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  10. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  11. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Science.gov (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Optical nano-biosensing interface via nucleic acid amplification strategy: construction and application.

    Science.gov (United States)

    Zhou, Hong; Liu, Jing; Xu, Jing-Juan; Zhang, Shu-Sheng; Chen, Hong-Yuan

    2018-03-21

    Modern optical detection technology plays a critical role in current clinical detection due to its high sensitivity and accuracy. However, higher requirements such as extremely high detection sensitivity have been put forward due to the clinical needs for the early finding and diagnosing of malignant tumors which are significant for tumor therapy. The technology of isothermal amplification with nucleic acids opens up avenues for meeting this requirement. Recent reports have shown that a nucleic acid amplification-assisted modern optical sensing interface has achieved satisfactory sensitivity and accuracy, high speed and specificity. Compared with isothermal amplification technology designed to work completely in a solution system, solid biosensing interfaces demonstrated better performances in stability and sensitivity due to their ease of separation from the reaction mixture and the better signal transduction on these optical nano-biosensing interfaces. Also the flexibility and designability during the construction of these nano-biosensing interfaces provided a promising research topic for the ultrasensitive detection of cancer diseases. In this review, we describe the construction of the burgeoning number of optical nano-biosensing interfaces assisted by a nucleic acid amplification strategy, and provide insightful views on: (1) approaches to the smart fabrication of an optical nano-biosensing interface, (2) biosensing mechanisms via the nucleic acid amplification method, (3) the newest strategies and future perspectives.

  13. Multiplexed Detection of Attomoles of Nucleic Acids Using Fluorescent Nanoparticle Counting Platform.

    Science.gov (United States)

    Pei, Xiaojing; Yin, Haoyan; Lai, Tiancheng; Zhang, Junlong; Liu, Feng; Xu, Xiao; Li, Na

    2018-01-16

    The sensitive multiplexed detection of nucleic acids in a single sample by a simple manner is of pivotal importance for the diagnosis and therapy of human diseases. Herein, we constructed an automatic fluorescent nanoparticle (FNP) counting platform with a common fluorescence microscopic imaging setup for nonamplification multiplexed detection of attomoles of nucleic acids. Taking the advantages of the highly bright, multicolor emitting FNPs and magnetic separation, the platform enables sensitive multiplexed detection without the need for extra fluorescent labels. Quantification for multiplex DNAs, multiplex microRNAs (miRNA), as well as a DNA and miRNA mixture was achieved with a similar dynamic range, a limit of detection down to 5 amol (5 μL detection volume), and a 81-115% spike recovery from different biological sample matrices. In particular, the sensitivity for multiplex miRNA is by far among the highest without using amplification or the lock nucleic acid hybridization enhancement strategy. Results regarding miRNA-141 from four different cell lines were agreeable with those of the quantitative reverse transcription polymerase chain reaction. Simultaneous detection of miRNA-141 and miRNA-21 in four different cell lines yielded consistent results with publications, indicating the potential for monitoring multiplex miRNA expression associated with the collaborative regulation of important cellular events. This work expands the rule set of multiplex nucleic acid detection strategies and shows promising potential application in clinical diagnosis.

  14. Role of Cell-Penetrating Peptides in Intracellular Delivery of Peptide Nucleic Acids Targeting Hepadnaviral Replication

    DEFF Research Database (Denmark)

    Ndeboko, Benedicte; Ramamurthy, Narayan; Lemamy, Guy Joseph

    2017-01-01

    Peptide nucleic acids (PNAs) are potentially attractive antisense agents against hepatitis B virus (HBV), although poor cellular uptake limits their therapeutic application. In the duck HBV (DHBV) model, we evaluated different cell-penetrating peptides (CPPs) for delivery to hepatocytes of a PNA...

  15. Nucleic acid and protein extraction from electropermeabilized E. coli cells on a microfluidic chip

    DEFF Research Database (Denmark)

    Matos, T.; Senkbeil, Silja; Mendonça, A.

    2013-01-01

    technique has been developed which is based on exposing E. coli cells to low voltages to allow extraction of nucleic acids and proteins. The flow-through electropermeability chip used consists of a microfluidic channel with integrated gold electrodes that promote cell envelope channel formation at low...

  16. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry

    DEFF Research Database (Denmark)

    Steen, Hanno; Jensen, Ole Nørregaard

    2002-01-01

    . Mass spectrometry (MS) has emerged as a sensitive and efficient analytical technique for determination of such cross-linking sites in proteins. The present review of the field describes a number of MS-based approaches for the characterization of cross-linked protein-nucleic acid complexes...

  17. External quality assurance of malaria nucleic acid testing for clinical trials and eradication surveillance

    NARCIS (Netherlands)

    Murphy, S.C.; Hermsen, C.C.; Douglas, A.D.; Edwards, N.J.; Petersen, I.; Fahle, G.A.; Adams, M.; Berry, A.A.; Billman, Z.P.; Gilbert, S.C.; Laurens, M.B.; Leroy, O.; Lyke, K.E.; Plowe, C.V.; Seilie, A.M.; Strauss, K.A.; Teelen, K.; Hill, A.V.; Sauerwein, R.W.

    2014-01-01

    Nucleic acid testing (NAT) for malaria parasites is an increasingly recommended diagnostic endpoint in clinical trials of vaccine and drug candidates and is also important in surveillance of malaria control and elimination efforts. A variety of reported NAT assays have been described, yet no formal

  18. Non-viral Nucleic Acid Delivery Strategies to the Central Nervous System

    Directory of Open Access Journals (Sweden)

    James-Kevin Tan

    2016-11-01

    Full Text Available With an increased prevalence and understanding of central nervous system injuries and neurological disorders, nucleic acid therapies are gaining promise as a way to regenerate lost neurons or halt disease progression. While more viral vectors have been used clinically as tools for gene delivery, non-viral vectors are gaining interest due to lower safety concerns and the ability to deliver all types of nucleic acids. Nevertheless, there are still a number of barriers to nucleic acid delivery. In this focused review, we explore the in vivo challenges hindering non-viral nucleic acid delivery to the central nervous system and the strategies and vehicles used to overcome them. Advantages and disadvantages of different routes of administration including: systemic injection, cerebrospinal fluid injection, intraparenchymal injection, and peripheral administration are discussed. Non-viral vehicles and treatment strategies that have overcome delivery barriers and demonstrated in vivo gene transfer to the central nervous system are presented. These approaches can be used as guidelines in developing synthetic gene delivery vectors for central nervous system applications and will ultimately bring non-viral vectors closer to clinical application.

  19. Synergistic Combination of Unquenching and Plasmonic Fluorescence Enhancement in Fluorogenic Nucleic Acid Hybridization Probes.

    Science.gov (United States)

    Vietz, Carolin; Lalkens, Birka; Acuna, Guillermo P; Tinnefeld, Philip

    2017-10-11

    Fluorogenic nucleic acid hybridization probes are widely used for detecting and quantifying nucleic acids. The achieved sensitivity strongly depends on the contrast between a quenched closed form and an unquenched opened form with liberated fluorescence. So far, this contrast was improved by improving the quenching efficiency of the closed form. In this study, we modularly combine these probes with optical antennas used for plasmonic fluorescence enhancement and study the effect of the nanophotonic structure on the fluorescence of the quenched and the opened form. As quenched fluorescent dyes are usually enhanced more by fluorescence enhancement, a detrimental reduction of the contrast between closed and opened form was anticipated. In contrast, we could achieve a surprising increase of the contrast with full additivity of quenching of the dark form and fluorescence enhancement of the bright form. Using single-molecule experiments, we demonstrate that the additivity of the two mechanisms depends on the perfect quenching in the quenched form, and we delineate the rules for new nucleic acid probes for enhanced contrast and absolute brightness. Fluorogenic hybridization probes optimized not only for quenching but also for the brightness of the open form might find application in nucleic acid assays with PCR avoiding detection schemes.

  20. Sensitive detection of nucleic acids by PNA hybridization directed co-localization of fluorescent beads

    DEFF Research Database (Denmark)

    Shiraishi, Takehiko; Deborggraeve, Stijn; Büscher, Philippe

    2011-01-01

    )avidin-coated fluorescent beads, differing in size and color [green beads (1 µm) and red beads (5.9 µm)], thereby allowing distinct detection of each PNA probe by conventional fluorescence microscopy. These two PNA beads showed easily detectable co-localization when simultaneously hybridizing to a target nucleic acid...

  1. DMPD: Nucleic acid-sensing TLRs as modifiers of autoimmunity. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available S. J Immunol. 2006 Nov 15;177(10):6573-8. (.png) (.svg) (.html) (.csml) Show Nucleic acid-sensing TLRs as mo...way - PNG File (.png) SVG File (.svg) HTML File (.html) CSML File (.csml) Open .csml file with CIOPlayer Ope

  2. Survivin mRNA antagonists using locked nucleic acid, potential for molecular cancer therapy

    DEFF Research Database (Denmark)

    Fisker, Niels; Westergaard, Majken; Hansen, Henrik Frydenlund

    2007-01-01

    We have investigated the effects of different locked nucleic acid modified antisense mRNA antagonists against Survivin in a prostate cancer model. These mRNA antagonists were found to be potent inhibitors of Survivin expression at low nanomolar concentrations. Additionally there was a pronounced ...

  3. 78 FR 36698 - Microbiology Devices; Reclassification of Nucleic Acid-Based Systems for Mycobacterium tuberculosis

    Science.gov (United States)

    2013-06-19

    .... FDA-2013-N-0544] Microbiology Devices; Reclassification of Nucleic Acid-Based Systems for... workshop, FDA agreed to consider this issue further and subsequently convened a meeting of the Microbiology... Health After considering the information discussed by the Microbiology Devices Panel during the June 29...

  4. 77 FR 16126 - Microbiology Devices; Reclassification of Nucleic Acid-Based Systems for Mycobacterium tuberculosis

    Science.gov (United States)

    2012-03-19

    .... FDA-2012-N-0159] Microbiology Devices; Reclassification of Nucleic Acid-Based Systems for... convened a meeting of the Microbiology Devices Panel of the Medical Devices Advisory Committee (Microbiology Devices Panel) on June 29, 2011 (Ref. 2). Although not a formal reclassification meeting, panel...

  5. Enhanced peptide nucleic acid binding to supercoiled DNA: possible implications for DNA "breathing" dynamics

    DEFF Research Database (Denmark)

    Bentin, T; Nielsen, Peter E.

    1996-01-01

    The influence of DNA topology on peptide nucleic acid (PNA) binding was studied. Formation of sequence-specific PNA2/dsDNA (double-stranded DNA) complexes was monitored by a potassium permanganate probing/primer extension assay. At low ionic strengths, the binding of PNA was 2-3 times more...

  6. Synthetic Nucleic Acid Analogues in Gene Therapy: An Update for Peptide–Oligonucleotide Conjugates

    DEFF Research Database (Denmark)

    Taskova, Maria; Mantsiou, Anna; Astakhova, Kira

    2017-01-01

    The main objective of this work is to provide an update on synthetic nucleic acid analogues and nanoassemblies as tools in gene therapy. In particular, the synthesis and properties of peptide–oligonucleotide conjugates (POCs), which have high potential in research and as therapeutics, are described...

  7. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek

    2015-01-01

    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  8. PrPC has nucleic acid chaperoning properties similar to the nucleocapsid protein of HIV-1.

    Science.gov (United States)

    Derrington, Edmund; Gabus, Caroline; Leblanc, Pascal; Chnaidermann, Jonas; Grave, Linda; Dormont, Dominique; Swietnicki, Wieslaw; Morillas, Manuel; Marck, Daniel; Nandi, Pradip; Darlix, Jean-Luc

    2002-01-01

    The function of the cellular prion protein (PrPC) remains obscure. Studies suggest that PrPC functions in several processes including signal transduction and Cu2+ metabolism. PrPC has also been established to bind nucleic acids. Therefore we investigated the properties of PrPC as a putative nucleic acid chaperone. Surprisingly, PrPC possesses all the nucleic acid chaperoning properties previously specific to retroviral nucleocapsid proteins. PrPC appears to be a molecular mimic of NCP7, the nucleocapsid protein of HIV-1. Thus PrPC, like NCP7, chaperones the annealing of tRNA(Lys) to the HIV-1 primer binding site, the initial step of retrovirus replication. PrPC also chaperones the two DNA strand transfers required for production of a complete proviral DNA with LTRs. Concerning the functions of NCP7 during budding, PrPC also mimices NCP7 by dimerizing the HIV-1 genomic RNA. These data are unprecedented because, although many cellular proteins have been identified as nucleic acid chaperones, none have the properties of retroviral nucleocapsid proteins.

  9. Analysis of nucleic acid chaperoning by the prion protein and its inhibition by oligonucleotides.

    Science.gov (United States)

    Guichard, Cécile; Ivanyi-Nagy, Roland; Sharma, Kamal Kant; Gabus, Caroline; Marc, Daniel; Mély, Yves; Darlix, Jean-Luc

    2011-10-01

    Prion diseases are unique neurodegenerative illnesses associated with the conversion of the cellular prion protein (PrP(C)) into the aggregated misfolded scrapie isoform, named PrP(Sc). Recent studies on the physiological role of PrP(C) revealed that this protein has probably multiple functions, notably in cell-cell adhesion and signal transduction, and in assisting nucleic acid folding. In fact, in vitro findings indicated that the human PrP (huPrP) possesses nucleic acid binding and annealing activities, similarly to nucleic acid chaperone proteins that play essential roles in cellular DNA and RNA metabolism. Here, we show that a peptide, representing the N-terminal domain of huPrP, facilitates nucleic acid annealing by two parallel pathways nucleated through the stem termini. We also show that PrP of human or ovine origin facilitates DNA strand exchange, ribozyme-directed cleavage of an RNA template and RNA trans-splicing in a manner similar to the nucleocapsid protein of HIV-1. In an attempt to characterize inhibitors of PrP-chaperoning in vitro we discovered that the thioaptamer 5'-GACACAAGCCGA-3' was extensively inhibiting the PrP chaperoning activities. At the same time a recently characterized methylated oligoribonucleotide inhibiting the chaperoning activity of the HIV-1 nucleocapsid protein was poorly impairing the PrP chaperoning activities.

  10. The HIV-1 transcriptional activator Tat has potent nucleic acid chaperoning activities in vitro.

    Science.gov (United States)

    Kuciak, Monika; Gabus, Caroline; Ivanyi-Nagy, Roland; Semrad, Katharina; Storchak, Roman; Chaloin, Olivier; Muller, Sylviane; Mély, Yves; Darlix, Jean-Luc

    2008-06-01

    The human immunodeficiency virus type 1 (HIV-1) is a primate lentivirus that causes the acquired immunodeficiency syndrome (AIDS). In addition to the virion structural proteins and enzyme precursors, that are Gag, Env and Pol, HIV-1 encodes several regulatory proteins, notably a small nuclear transcriptional activator named Tat. The Tat protein is absolutely required for virus replication since it controls proviral DNA transcription to generate the full-length viral mRNA. Tat can also regulate mRNA capping and splicing and was recently found to interfere with the cellular mi- and siRNA machinery. Because of its extensive interplay with nucleic acids, and its basic and disordered nature we speculated that Tat had nucleic acid-chaperoning properties. This prompted us to examine in vitro the nucleic acid-chaperoning activities of Tat and Tat peptides made by chemical synthesis. Here we report that Tat has potent nucleic acid-chaperoning activities according to the standard DNA annealing, DNA and RNA strand exchange, RNA ribozyme cleavage and trans-splicing assays. The active Tat(44-61) peptide identified here corresponds to the smallest known sequence with DNA/RNA chaperoning properties.

  11. Real-time electrochemical monitoring of isothermal helicase-dependent amplification of nucleic acids.

    Science.gov (United States)

    Kivlehan, Francine; Mavré, François; Talini, Luc; Limoges, Benoît; Marchal, Damien

    2011-09-21

    We described an electrochemical method to monitor in real-time the isothermal helicase-dependent amplification of nucleic acids. The principle of detection is simple and well-adapted to the development of portable, easy-to-use and inexpensive nucleic acids detection technologies. It consists of monitoring a decrease in the electrochemical current response of a reporter DNA intercalating redox probe during the isothermal DNA amplification. The method offers the possibility to quantitatively analyze target nucleic acids in less than one hour at a single constant temperature, and to perform at the end of the isothermal amplification a DNA melt curve analysis for differentiating between specific and non-specific amplifications. To illustrate the potentialities of this approach for the development of a simple, robust and low-cost instrument with high throughput capability, the method was validated with an electrochemical system capable of monitoring up to 48 real-time isothermal HDA reactions simultaneously in a disposable microplate consisting of 48-electrochemical microwells. Results obtained with this approach are comparable to that obtained with a well-established but more sophisticated and expensive fluorescence-based method. This makes for a promising alternative detection method not only for real-time isothermal helicase-dependent amplification of nucleic acid, but also for other isothermal DNA amplification strategies.

  12. Modulation of i-motif thermodynamic stability by the introduction of UNA (unlocked nucleic acid) monomers

    DEFF Research Database (Denmark)

    Pasternak, Anna; Wengel, Jesper

    2011-01-01

    The influence of acyclic RNA derivatives, UNA (unlocked nucleic acid) monomers, on i-DNA thermodynamic stability has been investigated. The 22 nt human telomeric fragment was chosen as the model sequence for stability studies. UNA monomers modulate i-motif stability in a position-depending manner...

  13. Isolation of nucleic acids and cultures from fossil ice and permafrost

    DEFF Research Database (Denmark)

    Willerslev, E.; Hansen, Anders J.; Poinar, H. N.

    2004-01-01

    Owing to their constant low temperatures, glacial ice and permafrost might contain the oldest nucleic acids and microbial cells on Earth, which could prove key to reconstructing past ecosystems and for the planning of missions to other planets. However, recent claims concerning viable cells and m...

  14. A chemical perspective on transcriptional fidelity dominant contributions of sugar integrity revealed by unlocked nucleic acids

    DEFF Research Database (Denmark)

    Xu, Liang; Plouffe, Steven W; Chong, Jenny

    2013-01-01

    Transcription unlocked: A synthetic chemical biology approach involving unlocked nucleic acids was used to dissect the contribution of sugar backbone integrity to the RNA Polymerase II (Pol II) transcription process. An unexpected dominant role for sugar-ring integrity in Pol II transcriptional...

  15. Vibrational spectroscopy and principal component analysis for conformational study of virus nucleic acids

    Science.gov (United States)

    Dovbeshko, G. I.; Repnytska, O. P.; Pererva, T.; Miruta, A.; Kosenkov, D.

    2004-07-01

    Conformation analysis of mutated DNA-bacteriophages (PLys-23, P23-2, P47- the numbers have been assigned by T. Pererva) induced by MS2 virus incorporated in Ecoli AB 259 Hfr 3000 has been done. Surface enhanced infrared absorption (SEIRA) spectroscopy and principal component analysis has been applied for solving this problem. The nucleic acids isolated from the mutated phages had a form of double stranded DNA with different modifications. The nucleic acid from phage P47 was undergone the structural rearrangement in the most degree. The shape and position ofthe fine structure of the Phosphate asymmetrical band at 1071cm-1 as well as the stretching OH vibration at 3370-3390 cm-1 has indicated to the appearance ofadditional OH-groups. The Z-form feature has been found in the base vibration region (1694 cm-1) and the sugar region (932 cm-1). A supposition about modification of structure of DNA by Z-fragments for P47 phage has been proposed. The P23-2 and PLys-23 phages have showed the numerous minor structural changes also. On the basis of SEIRA spectra we have determined the characteristic parameters of the marker bands of nucleic acid used for construction of principal components. Contribution of different spectral parameters of nucleic acids to principal components has been estimated.

  16. Modification of nucleic acids by azobenzene derivatives and their applications in biotechnology and nanotechnology.

    Science.gov (United States)

    Li, Jing; Wang, Xingyu; Liang, Xingguo

    2014-12-01

    Azobenzene has been widely used as a photoregulator due to its reversible photoisomerization, large structural change between E and Z isomers, high photoisomerization yield, and high chemical stability. On the other hand, some azobenzene derivatives can be used as universal quenchers for many fluorophores. Nucleic acid is a good candidate to be modified because it is not only the template of gene expression but also widely used for building well-organized nanostructures and nanodevices. Because the size and polarity distribution of the azobenzene molecule is similar to a nucleobase pair, the introduction of azobenzene into nucleic acids has been shown to be an ingenious molecular design for constructing light-switching biosystems or light-driven nanomachines. Here we review recent advances in azobenzene-modified nucleic acids and their applications for artificial regulation of gene expression and enzymatic reactions, construction of photoresponsive nanostructures and nanodevices, molecular beacons, as well as obtaining structural information using the introduced azobenzene as an internal probe. In particular, nucleic acids bearing multiple azobenzenes can be used as a novel artificial nanomaterial with merits of high sequence specificity, regular duplex structure, and high photoregulation efficiency. The combination of functional groups with biomolecules may further advance the development of chemical biotechnology and biomolecular engineering. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Nucleic acid probes as a diagnostic method for tick-borne hemoparasites of veterinary importance.

    Science.gov (United States)

    Figueroa, J V; Buening, G M

    1995-03-01

    An increased number of articles on the use of nucleic acid-based hybridization techniques for diagnostic purposes have been recently published. This article reviews nucleic acid-based hybridization as an assay to detect hemoparasite infections of economic relevance in veterinary medicine. By using recombinant DNA techniques, selected clones containing inserts of Anaplasma, Babesia, Cowdria or Theileria genomic DNA sequences have been obtained, and they are now available to be utilized as specific, highly sensitive DNA or RNA probes to detect the presence of the hemoparasite DNA in an infected animal. Either in an isotopic or non-isotopic detection system, probes have allowed scientists to test for--originally in samples collected from experimentally infected animals and later in samples collected in the field--the presence of hemoparasites during the prepatent, patent, convalescent, and chronic periods of the infection in the host. Nucleic acid probes have given researchers the opportunity to carry out genomic analysis of parasite DNA to differentiate hemoparasite species and to identify genetically distinct populations among and within isolates, strains and clonal populations. Prevalence of parasite infection in the tick vector can now be accomplished more specifically with the nucleic acid probes. Lately, with the advent of the polymerase chain reaction technique, small numbers of hemoparasites can be positively identified in the vertebrate host and tick vector. These techniques can be used to assess the veterinary epidemiological situation in a particular geographical region for the planning of control measures.

  18. Label-free direct surface-enhanced Raman scattering (SERS) of nucleic acids (Conference Presentation)

    Science.gov (United States)

    Guerrini, Luca; Morla-Folch, Judit; Gisbert-Quilis, Patricia; Xie, Hainan; Alvarez-Puebla, Ramon

    2016-03-01

    Recently, plasmonic-based biosensing has experienced an unprecedented level of attention, with a particular focus on the nucleic acid detection, offering efficient solutions to engineer simple, fast, highly sensitive sensing platforms while overcoming important limitations of PCR and microarray techniques. In the broad field of plasmonics, surface-enhanced Raman scattering (SERS) spectroscopy has arisen as a powerful analytical tool for detection and structural characterization of biomolecules. Today applications of SERS to nucleic acid analysis largely rely on indirect strategies, which have been demonstrated very effective for pure sensing purposes but completely dismiss the exquisite structural information provided by the direct acquisition of the biomolecular vibrational fingerprint. Contrarily, direct label-free SERS of nucleic acid shows an outstanding potential in terms of chemical-specific information which, however, remained largely unexpressed mainly because of the inherent poor spectral reproducibility and/or limited sensitivity. To address these limitations, we developed a fast and affordable high-throughput screening direct SERS method for gaining detailed genomic information on nucleic acids (DNA and RNA) and for the characterization and quantitative recognition of DNA interactions with exogenous agents. The simple strategy relies on the electrostatic adhesion of DNA/RNA onto positively-charged silver colloids that promotes the nanoparticle aggregation into stable clusters yielding intense and reproducible SERS spectra at picogram level (i.e. the analysis can be performed without the necessity of amplification steps thus providing realistic direct information of the nucleic acid in its native state). We anticipate this method to gain a vast impact and set of applications in different fields, including medical diagnostics, genomic screening, drug discovery, forensic science and even molecular electronics.

  19. Study of nucleic acids variations in children in nearest areas to the Chernobyl accident

    International Nuclear Information System (INIS)

    Morera, L.; Navarro, I.; Proenza, E.; Estrada, L.

    1996-01-01

    The technique used to determine the nucleic acids concentration of leucocytes in peripheral blood is simple, quick and reproducible. Mathematical patterns for small doses have been achieved by means of this technique, which is also useful as biochemical indicator for evaluating exposure to ionizing radiations. The following information is the result of a research in 445 children from 43 locations that suffered, in different degrees, the effect of this accident. Children were grouped taking into account different degrees of superficial pollution for Cs-137 of original places. Groups were built as follows: G-1, 165 children from 20 superficially polluted places between 0-37 KBq/m 2 ; G-2, 135 children from 15 locations with a level of superficial pollution higher than 37 KBq/m 2 and lower than 185 KBq/m 2 ; G-3, 85 children from 7 locations with a pollution degree higher than 296 KBq/m 2 and G-4, 60 children from a place with a non-determined superficial pollution. Values within the interval 1,29 - 4,89 mg/100 ml of blood samples taken from healthy children in group G-1 were considered as normal. The increase in dose led neither to a decrease in nucleic acids medium value, nor to a meaningful growth in the number of cases with nucleic acids figures under rank considered normal. On the other hand, thyroid hyperplasia did not lead either to an increase in medium values of nucleic acids or to an increase in the number of cases with nucleic acids figures over intervals considered as normal. (authors). 10 refs., 2 tabs

  20. RNA:DNA Ratio and Other Nucleic Acid Derived Indices in Marine Ecology

    Directory of Open Access Journals (Sweden)

    Luis Chícharo

    2008-08-01

    Full Text Available Some of most used indicators in marine ecology are nucleic acid-derived indices. They can be divided by target levels in three groups: 1 at the organism level as ecophysiologic indicators, indicators such as RNA:DNA ratios, DNA:dry weight and RNA:protein, 2 at the population level, indicators such as growth rate, starvation incidence or fisheries impact indicators, and 3 at the community level, indicators such as trophic interactions, exergy indices and prey identification. The nucleic acids derived indices, especially RNA:DNA ratio, have been applied with success as indicators of nutritional condition, well been and growth in marine organisms. They are also useful as indicators of natural or anthropogenic impacts in marine population and communities, such as upwelling or dredge fisheries, respectively. They can help in understanding important issues of marine ecology such as trophic interactions in marine environment, fish and invertebrate recruitment failure and biodiversity changes, without laborious work of counting, measuring and identification of small marine organisms. Besides the objective of integrate nucleic acid derived indices across levels of organization, the paper will also include a general characterization of most used nucleic acid derived indices in marine ecology and also advantages and limitations of them. We can conclude that using indicators, such RNA:DNA ratios and other nucleic acids derived indices concomitantly with organism and ecosystems measures of responses to climate change (distribution, abundance, activity, metabolic rate, survival will allow for the development of more rigorous and realistic predictions of the effects of anthropogenic climate change on marine systems.

  1. Lateral flow devices for nucleic acid analysis exploiting quantum dots as reporters

    Energy Technology Data Exchange (ETDEWEB)

    Sapountzi, Eleni A.; Tragoulias, Sotirios S.; Kalogianni, Despina P. [Department of Chemistry, University of Patras, GR-26504 Patras (Greece); Ioannou, Penelope C. [Department of Chemistry, University of Athens, GR-15771 Athens (Greece); Christopoulos, Theodore K., E-mail: tchrist@upatras.gr [Department of Chemistry, University of Patras, GR-26504 Patras (Greece); Institute of Chemical Engineering and High Temperature Processes, Foundation of Research and Technology Hellas, GR-26504 Patras (Greece)

    2015-03-15

    Highlights: • Dipstick tests for DNA hybridization assays and genotyping of single-nucleotide polymorphisms. • Use of quantum dots as reporters. • Visual detection without the need for expensive instrumentation. • Simplicity and low-cost of the assays. - Abstract: There is a growing interest in the development of biosensors in the form of simple lateral flow devices that enable visual detection of nucleic acid sequences while eliminating several steps required for pipetting, incubation and washing out the excess of reactants. In this work, we present the first dipstick-type nucleic acid biosensors based on quantum dots (QDs) as reporters. The biosensors enable sequence confirmation of the target DNA by hybridization and simple visual detection of the emitted fluorescence under a UV lamp. The ‘diagnostic’ membrane of the biosensor contains a test zone (TZ) and a control zone (CZ). The CZ always fluoresces in order to confirm the proper function of the biosensor. Fluorescence is emitted from the TZ, only when the specific nucleic acid sequence is present. We have developed two general types of QD-based nucleic acid biosensors, namely, Type I and Type II, in which the TZ consists of either immobilized streptavidin (Type I) or immobilized oligodeoxynucleotides (Type II). The control zone consists of immobilized biotinylated albumin. No purification steps are required prior to the application of the DNA sample on the strip. The QD-based nucleic acid biosensors performed accurately and reproducibly when applied to (a) the visual detection of PCR amplification products and (b) visual genotyping of single nucleotide polymorphisms (SNPs) in human genomic DNA from clinical samples. As low as 1.5 fmol of double-stranded DNA were clearly detected by naked eye and the dynamic range extended to 200 fmol. The %CV were estimated to be 4.3–8.2.

  2. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  3. Sustained release of nucleic acids from polymeric nanoparticles using microemulsion precipitation in supercritical carbon dioxide.

    Science.gov (United States)

    Ge, Jun; Jacobson, Gunilla B; Lobovkina, Tatsiana; Holmberg, Krister; Zare, Richard N

    2010-12-21

    A general approach for producing biodegradable nanoparticles for sustained nucleic acid release is presented. The nanoparticles are produced by precipitating a water-in-oil microemulsion in supercritical CO(2). The microemulsion consists of a transfer RNA aqueous solution (water phase), dichloromethane containing poly(l-lactic acid)-poly(ethylene glycol) (oil phase), the surfactant n-octyl β-D-glucopyranoside, and the cosurfactant n-butanol.

  4. DMPD: The role of viral nucleic acid recognition in dendritic cells for innate andadaptive antiviral immunity. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18086372 The role of viral nucleic acid recognition in dendritic cells for innate a...1-14. Epub 2007 Nov 9. (.png) (.svg) (.html) (.csml) Show The role of viral nucleic acid recognition in dend...e role of viral nucleic acid recognition in dendritic cells for innate andadaptive antiviral immunity. Autho

  5. The relationship between odd- and branched-chain fatty acids and microbial nucleic acid bases in rumen.

    Science.gov (United States)

    Liu, Keyuan; Hao, Xiaoyan; Li, Yang; Luo, Guobin; Zhang, Yonggen; Xin, Hangshu

    2017-11-01

    This study aims to identify the relationship between odd- and branched-chain fatty acids (OBCFAs) and microbial nucleic acid bases in the rumen, and to establish a model to accurately predict microbial protein flow by using OBCFA. To develop the regression equations, data on the rumen contents of individual cows were obtained from 2 feeding experiments. In the first experiment, 3 rumen-fistulated dry dairy cows arranged in a 3×3 Latin square were fed diets of differing forage to concentration ratios (F:C). The second experiment consisted of 9 lactating Holstein dairy cows of similar body weights at the same stage of pregnancy. For each lactation stage, 3 cows with similar milk production were selected. The rumen contents were sampled at 4 time points of every two hours after morning feeding 6 h, and then to analyse the concentrations of OBCFA and microbial nucleic acid bases in the rumen samples. The ruminal bacteria nucleic acid bases were significantly influenced by feeding diets of differing forge to concentration ratios and lactation stages of dairy cows (pacids and C15:0 isomers, strongly correlated with the microbial nucleic acid bases in the rumen (pacid bases established by ruminal OBCFAs contents showed a good predictive capacity, as indicated by reasonably low standard errors and high R-squared values. This finding suggests that the rumen OBCFA composition could be used as an internal marker of rumen microbial matter.

  6. High-throughput strategy for molecular identification of Vel- blood donors employing nucleic acids extracted from plasma pools used for viral nucleic acid test screening.

    Science.gov (United States)

    Dezan, Marcia R; Dinardo, Carla L; Bosi, Silvia R A; Vega, Sileni; Salles, Nanci A; Mendrone-Júnior, Alfredo; Levi, José E

    2016-06-01

    Serologic methods to determine the Vel- phenotype require the use of rare human antisera and do not allow for many samples to be tested simultaneously, which limits their application as a tool to search for rare donors. This study developed a low-cost molecular screening strategy using real-time polymerase chain reaction (PCR) and DNA, extracted from plasma pools for viral nucleic acid test (NAT) screening, to identify Vel- and Vel+(W) donors. A total of 4680 blood donors from the Brazilian southeast region were genotyped through real-time PCR targeting the 17-nucleotide (c.64_80del) deletion in the SMIM1 gene, which determines the Vel- phenotype, by using remaining nucleic acid from plasma pools of six donors, routinely discarded after the release of viral NAT results. Twenty pools tested reactive and individual testing of samples from reactive pools identified 19 heterozygous donors with the SMIM1*64_80del deletion (0.40%) and one homozygous donor (0.02%). Fourteen of the 19 donors were confirmed as Vel- or Vel+(W) using anti-Vel human antiserum. The DNA pool genotyping strategy using real-time PCR designed to detect the deletion in the SMIM1 gene proved effective and accurate in identifying donors with the Vel- and Vel+(W) phenotypes. The fact that remaining nucleic acid from routine viral NAT screening was used makes this technique economically attractive and definitely superior to the serologic techniques available to search for this rare phenotype. © 2016 AABB.

  7. The relationship between odd- and branched-chain fatty acids and microbial nucleic acid bases in rumen

    Directory of Open Access Journals (Sweden)

    Keyuan Liu

    2017-11-01

    Full Text Available Objective This study aims to identify the relationship between odd- and branched-chain fatty acids (OBCFAs and microbial nucleic acid bases in the rumen, and to establish a model to accurately predict microbial protein flow by using OBCFA. Methods To develop the regression equations, data on the rumen contents of individual cows were obtained from 2 feeding experiments. In the first experiment, 3 rumen-fistulated dry dairy cows arranged in a 3×3 Latin square were fed diets of differing forage to concentration ratios (F:C. The second experiment consisted of 9 lactating Holstein dairy cows of similar body weights at the same stage of pregnancy. For each lactation stage, 3 cows with similar milk production were selected. The rumen contents were sampled at 4 time points of every two hours after morning feeding 6 h, and then to analyse the concentrations of OBCFA and microbial nucleic acid bases in the rumen samples. Results The ruminal bacteria nucleic acid bases were significantly influenced by feeding diets of differing forge to concentration ratios and lactation stages of dairy cows (p<0.05. The concentrations of OBCFAs, especially odd-chain fatty acids and C15:0 isomers, strongly correlated with the microbial nucleic acid bases in the rumen (p<0.05. The equations of ruminal microbial nucleic acid bases established by ruminal OBCFAs contents showed a good predictive capacity, as indicated by reasonably low standard errors and high R-squared values. Conclusion This finding suggests that the rumen OBCFA composition could be used as an internal marker of rumen microbial matter.

  8. A novel automated device for rapid nucleic acid extraction utilizing a zigzag motion of magnetic silica beads

    International Nuclear Information System (INIS)

    Yamaguchi, Akemi; Matsuda, Kazuyuki; Uehara, Masayuki; Honda, Takayuki; Saito, Yasunori

    2016-01-01

    We report a novel automated device for nucleic acid extraction, which consists of a mechanical control system and a disposable cassette. The cassette is composed of a bottle, a capillary tube, and a chamber. After sample injection in the bottle, the sample is lysed, and nucleic acids are adsorbed on the surface of magnetic silica beads. These magnetic beads are transported and are vibrated through the washing reagents in the capillary tube under the control of the mechanical control system, and thus, the nucleic acid is purified without centrifugation. The purified nucleic acid is automatically extracted in 3 min for the polymerase chain reaction (PCR). The nucleic acid extraction is dependent on the transport speed and the vibration frequency of the magnetic beads, and optimizing these two parameters provided better PCR efficiency than the conventional manual procedure. There was no difference between the detection limits of our novel device and that of the conventional manual procedure. We have already developed the droplet-PCR machine, which can amplify and detect specific nucleic acids rapidly and automatically. Connecting the droplet-PCR machine to our novel automated extraction device enables PCR analysis within 15 min, and this system can be made available as a point-of-care testing in clinics as well as general hospitals. - Highlights: • Automatic nucleic acid extraction is performed in 3 min. • Zigzag motion of magnetic silica beads yields rapid and efficient extraction. • The present our device provides better performance than the conventional procedure.

  9. Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

    Energy Technology Data Exchange (ETDEWEB)

    Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.

    2017-10-31

    Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.

  10. The isolation of nucleic acids from fixed, paraffin-embedded tissues-which methods are useful when?

    DEFF Research Database (Denmark)

    Gilbert, M Thomas P; Haselkorn, Tamara; Bunce, Michael

    2007-01-01

    . Cross-linking not only complicates isolation of nucleic acid but also introduces polymerase "blocks" during PCR. A wide variety of methods exists for the recovery of DNA and RNA from archival tissues, and although a number of previous studies have qualitatively compared the relative merits....... These include methods of pre-treating the samples prior to extraction, extraction and nucleic acid purification methods themselves, and a post-extraction enzymatic repair technique. We find that although many of the published methods have distinct positive effects on some characteristics of the nucleic acids...

  11. Selectivity of major isoquinoline alkaloids from Chelidonium majus towards telomeric G-quadruplex: A study using a transition-FRET (t-FRET) assay

    Czech Academy of Sciences Publication Activity Database

    Noureini, S.K.; Esmaeili, H.; Abachi, F.; Khiali, S.; Islam, Barira; Kuta, M.; Saboury, A.A.; Hoffillann, M.; Šponer, Jiří; Parkinson, G.; Haider, S.

    2017-01-01

    Roč. 1861, č. 8 (2017), s. 2020-2030 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : prostate-cancer cells * amber force-field * nucleic-acids Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  12. [MEASUREMENT OF HISTONES AND CIRCULATING EXTRACELLULAR NUCLEIC ACIDS IN PATIENTS' WITH COMPLICATED FORMS OF PEPTIC ULCER].

    Science.gov (United States)

    Yerznkyan, G; Kultanov, B; Shakeev, K; Tatina, Ye

    2017-04-01

    We studied 135 people (24 people, apparently healthy, 39 uncomplicated peptic ulcer disease, 42 people with complex forms peptic ulcer, 30 and after the treatment of complicated forms of peptic ulcer disease, both sexes (18-45 y.). In all patients, the diagnosis was confirmed fibrogastroduodenoscopy (EGD). Determination of histones and acid soluble fraction (ASF), RNA, DNA, in blood was performed by the method of L. Markusheva. Studies have led to the conclusion that the change in the blood concentration of extracellular nucleic acids in patients with uncomplicated disease and complex shapes can be caused by oxidative stress products and can be a signal for elimination of nucleic acids from cells. We have registered various dynamics of the studied parameters histones in the blood of patients with various forms of peptic ulcer disease, which reflects the degree of metabolic abnormalities that occur in the body, associated with changes in the structure of the nucleus. According to the results of our research in the study of the role of extracellular nucleic acids, histones to assess the extent of violations of metabolic processes at a peptic ulcer, complicated and uncomplicated form, the obtained results can be used as predictors of complications of a stomach ulcer.

  13. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Science.gov (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  14. Summarization on the synthesis and radionuclide-labeling of peptide nucleic acid for an oligonucleotide analogue

    International Nuclear Information System (INIS)

    Song, Hongtao; Zhang, Huaming; Gao, Hui

    2009-04-01

    Peptide nucleic acid (PNA), which is one kind of antisense nucleic acid compounds and an oligonucleotide analogue that binds strongly to DNA and RNA in a sequence specific manner, has its unique advantages in the field of molecular diagnostics and treatment of diseases. Now, people gradually attach more importance to PNA. To optimize the application of PNA in genetic re- search and therapy, a great number of backbone modifications on the newly- type structures of PNA were synthesized to improve its physicochemical proper- ties, such as hybridization speciality, solubility in biofluid, or cell permeability. The modified PNA labeled with radionuclides, which can obtain the aim at specific target and minimal non-target trauma, has important role in research and application of tumorous genitherapy. Here a review on the basic synthesis idea and several primary synthetic methods of PNA analogs was given, and also correlative studies and expectation on the compounds belonging to PNA series labeled with radionuclides were included. (authors)

  15. Rapid Bedside Inactivation of Ebola Virus for Safe Nucleic Acid Tests

    DEFF Research Database (Denmark)

    Rosenstierne, Maiken Worsøe; Karlberg, Helen; Bragstad, Karoline

    2016-01-01

    Rapid bedside inactivation of Ebola virus would be a solution for the safety of medical and technical staff, risk containment, sample transport, and high-throughput or rapid diagnostic testing during an outbreak. We show that the commercially available Magna Pure lysis/binding buffer used...... for nucleic acid extraction inactivates Ebola virus. A rapid bedside inactivation method for nucleic acid tests is obtained by simply adding Magna Pure lysis/binding buffer directly into vacuum blood collection EDTA tubes using a thin needle and syringe prior to sampling. The ready-to-use inactivation vacuum...... tubes are stable for more than 4 months, and Ebola virus RNA is preserved in the Magna Pure lysis/binding buffer for at least 5 weeks independent of the storage temperature. We also show that Ebola virus RNA can be manually extracted from Magna Pure lysis/binding buffer-inactivated samples using...

  16. Isothermal amplification detection of nucleic acids by a double-nicked beacon.

    Science.gov (United States)

    Shi, Chao; Zhou, Meiling; Pan, Mei; Zhong, Guilin; Ma, Cuiping

    2016-03-01

    Isothermal and rapid amplification detection of nucleic acids is an important technology in environmental monitoring, foodborne pathogen detection, and point-of-care clinical diagnostics. Here we have developed a novel method of isothermal signal amplification for single-stranded DNA (ssDNA) detection. The ssDNA target could be used as an initiator, coupled with a double-nicked molecular beacon, to originate amplification cycles, achieving cascade signal amplification. In addition, the method showed good specificity and strong anti-jamming capability. Overall, it is a one-pot and isothermal strand displacement amplification method without the requirement of a stepwise procedure, which greatly simplifies the experimental procedure and decreases the probability of contamination of samples. With its advantages, the method would be very useful to detect nucleic acids in point-of-care or field use. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Effects of ultraviolet and visible radiation on nucleic acids and proteins

    International Nuclear Information System (INIS)

    Loeber, G.

    1977-01-01

    Three possible photochemical reaction mechanisms have been discussed which might cause changes in biological materials: 1) Photoreactions induced in that constituents of cell substrates absorbing UV-light by themselves, i.e. heteroaromatic moieties of nucleic acids and proteins. 2) Photoreactions induced in that constituents not belonging to the natural biological system and absorbing UV-light, i.e. furocoumarins or cancer producing hydrocarbons. 3) Photoreactions induced in that proper sensitizer molecules absorbing UV-light or visible light. The latter type of photoreactions consumes molecular oxygen but does not consume sensitizer molecules (photodynamic action). Examples have been given for the three possibilities concerning photochemistry of nucleic acids and proteins. Damages of biopolymers were discussed with respect to their biological consequences. Photodynamic changes in the blood system might be caused either after addition of sensitizers to blood or by sensitizers which are constituents of blood itself, i.e. porphytines. (author)

  18. The Use of Atomic Force Microscopy for 3D Analysis of Nucleic Acid Hybridization on Microarrays.

    Science.gov (United States)

    Dubrovin, E V; Presnova, G V; Rubtsova, M Yu; Egorov, A M; Grigorenko, V G; Yaminsky, I V

    2015-01-01

    Oligonucleotide microarrays are considered today to be one of the most efficient methods of gene diagnostics. The capability of atomic force microscopy (AFM) to characterize the three-dimensional morphology of single molecules on a surface allows one to use it as an effective tool for the 3D analysis of a microarray for the detection of nucleic acids. The high resolution of AFM offers ways to decrease the detection threshold of target DNA and increase the signal-to-noise ratio. In this work, we suggest an approach to the evaluation of the results of hybridization of gold nanoparticle-labeled nucleic acids on silicon microarrays based on an AFM analysis of the surface both in air and in liquid which takes into account of their three-dimensional structure. We suggest a quantitative measure of the hybridization results which is based on the fraction of the surface area occupied by the nanoparticles.

  19. Single-Labeled Oligonucleotides Showing Fluorescence Changes upon Hybridization with Target Nucleic Acids

    Directory of Open Access Journals (Sweden)

    Gil Tae Hwang

    2018-01-01

    Full Text Available Sequence-specific detection of nucleic acids has been intensively studied in the field of molecular diagnostics. In particular, the detection and analysis of single-nucleotide polymorphisms (SNPs is crucial for the identification of disease-causing genes and diagnosis of diseases. Sequence-specific hybridization probes, such as molecular beacons bearing the fluorophore and quencher at both ends of the stem, have been developed to enable DNA mutation detection. Interestingly, DNA mutations can be detected using fluorescently labeled oligonucleotide probes with only one fluorophore. This review summarizes recent research on single-labeled oligonucleotide probes that exhibit fluorescence changes after encountering target nucleic acids, such as guanine-quenching probes, cyanine-containing probes, probes containing a fluorophore-labeled base, and microenvironment-sensitive probes.

  20. Clarithromycin, trimethoprim, and penicillin and oxidative nucleic acid modifications in humans

    DEFF Research Database (Denmark)

    Larsen, Emil List; Cejvanovic, Vanja; Kjaer, Laura Kofoed

    2017-01-01

    , phenoxymethylpenicillin (penicillin V), or placebo. Oxidative modifications were measured as 24-h urinary excretion of 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) and 8-oxo-7,8-dihydroguanosine (8-oxoGuo), and plasma levels of malondialdehyde before and after treatment as a measurement of DNA oxidation, RNA oxidation.......7% (95% CI: 5.8–37.6%), but did not influence urinary excretion of 8-oxoGuo. Penicillin V did not influence urinary excretion of 8-oxodG or 8-oxoGuo. None of the antibiotic drugs influenced plasma levels of malondialdehyde. Conclusion Clarithromycin significantly increases oxidative nucleic acid...... modifications. Increased oxidative modifications might explain some of clarithromycin's known adverse reactions. Trimethoprim significantly lowers DNA oxidation but not RNA oxidation. Penicillin V had no effect on oxidative nucleic acid modifications....

  1. Locked vs. unlocked nucleic acids (LNA vs. UNA): contrasting structures work towards common therapeutic goals

    DEFF Research Database (Denmark)

    Campbell, Meghan A; Wengel, Jesper

    2011-01-01

    Oligonucleotide chemistry has been developed greatly over the past three decades, with many advances in increasing nuclease resistance, enhancing duplex stability and assisting with cellular uptake. Locked nucleic acid (LNA) is a structurally rigid modification that increases the binding affinity...... of a modified-oligonucleotide. In contrast, unlocked nucleic acid (UNA) is a highly flexible modification, which can be used to modulate duplex characteristics. In this tutorial review, we will compare the synthetic routes to both of these modifications, contrast the structural features, examine...... the hybridization properties of LNA and UNA modified duplexes, and discuss how they have been applied within biotechnology and drug research. LNA has found widespread use in antisense oligonucleotide technology, where it can stabilize interactions with target RNA and protect from cellular nucleases. The newly...

  2. The Obesity-Associated FTO Gene Encodes a 2-Oxoglutarate–Dependent Nucleic Acid Demethylase

    Science.gov (United States)

    Gerken, Thomas; Girard, Christophe A.; Tung, Yi-Chun Loraine; Webby, Celia J.; Saudek, Vladimir; Hewitson, Kirsty S.; Yeo, Giles S. H.; McDonough, Michael A.; Cunliffe, Sharon; McNeill, Luke A.; Galvanovskis, Juris; Rorsman, Patrik; Robins, Peter; Prieur, Xavier; Coll, Anthony P.; Ma, Marcella; Jovanovic, Zorica; Farooqi, I. Sadaf; Sedgwick, Barbara; Barroso, Inês; Lindahl, Tomas; Ponting, Chris P.; Ashcroft, Frances M.; O'Rahilly, Stephen; Schofield, Christopher J.

    2009-01-01

    Variants in the FTO (fat mass and obesity associated) gene are associated with increased body mass index in humans. Here, we show by bioinformatics analysis that FTO shares sequence motifs with Fe(II)- and 2-oxoglutarate–dependent oxygenases. We find that recombinant murine Fto catalyzes the Fe(II)- and 2OG-dependent demethylation of 3-methylthymine in single-stranded DNA, with concomitant production of succinate, formaldehyde, and carbon dioxide. Consistent with a potential role in nucleic acid demethylation, Fto localizes to the nucleus in transfected cells. Studies of wild-type mice indicate that Fto messenger RNA (mRNA) is most abundant in the brain, particularly in hypothalamic nuclei governing energy balance, and that Fto mRNA levels in the arcuate nucleus are regulated by feeding and fasting. Studies can now be directed toward determining the physiologically relevant FTO substrate and how nucleic acid methylation status is linked to increased fat mass. PMID:17991826

  3. Nanomedicine-based combination anticancer therapy between nucleic acids and small-molecular drugs.

    Science.gov (United States)

    Huang, Wei; Chen, Liqing; Kang, Lin; Jin, Mingji; Sun, Ping; Xin, Xin; Gao, Zhonggao; Bae, You Han

    2017-06-01

    Anticancer therapy has always been a vital challenge for the development of nanomedicine. Repeated single therapeutic agent may lead to undesirable and severe side effects, unbearable toxicity and multidrug resistance due to complex nature of tumor. Nanomedicine-based combination anticancer therapy can synergistically improve antitumor outcomes through multiple-target therapy, decreasing the dose of each therapeutic agent and reducing side effects. There are versatile combinational anticancer strategies such as chemotherapeutic combination, nucleic acid-based co-delivery, intrinsic sensitive and extrinsic stimulus combinational patterns. Based on these combination strategies, various nanocarriers and drug delivery systems were engineered to carry out the efficient co-delivery of combined therapeutic agents for combination anticancer therapy. This review focused on illustrating nanomedicine-based combination anticancer therapy between nucleic acids and small-molecular drugs for synergistically improving anticancer efficacy. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Cell number and transfection volume dependent peptide nucleic acid antisense activity by cationic delivery methods

    DEFF Research Database (Denmark)

    Llovera Nadal, Laia; Berthold, Peter; Nielsen, Peter E

    2012-01-01

    have now quantitatively compared the cellular activity (in the pLuc705 HeLa cell splice correction system) of PNA antisense oligomers using lipoplex delivery of cholesterol- and bisphosphonate-PNA conjugates, polyplex delivery via a PNA-polyethyleneimine conjugate and CPP delivery via a PNA......Efficient intracellular delivery is essential for high activity of nucleic acids based therapeutics, including antisense agents. Several strategies have been developed and practically all rely on auxiliary transfection reagents such as cationic lipids, cationic polymers and cell penetrating...... peptides as complexing agents and carriers of the nucleic acids. However, uptake mechanisms remain rather poorly understood, and protocols always require optimization of transfection parameters. Considering that cationic transfection complexes bind to and thus may up-concentrate on the cell surface, we...

  5. Nucleic Acid Aptamers Against Biotoxins: A New Paradigm Toward the Treatment and Diagnostic Approach

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Veedu, Rakesh N.

    2012-01-01

    Nucleic acid aptamers are short single-stranded DNA or RNA oligonucleotides that can bind to their targets with very high affinity and specificity, and are generally selected by a process referred to as systematic evolution of ligands by exponential enrichment. Conventional antibody-based therape......Nucleic acid aptamers are short single-stranded DNA or RNA oligonucleotides that can bind to their targets with very high affinity and specificity, and are generally selected by a process referred to as systematic evolution of ligands by exponential enrichment. Conventional antibody......-based therapeutic and diagnostic approach currently employed against biotoxins pose major limitations such as the requirement of a live animal for the in vivo enrichment of the antibody species, decreased stability, high production cost, and side effects. Aptamer technology is a viable alternative that can be used...

  6. Safety profile of the intravenous administration of brain-targeted stable nucleic acid lipid particles

    Directory of Open Access Journals (Sweden)

    Mariana Conceição

    2016-03-01

    Full Text Available In a clinical setting, where multiple administrations of the therapeutic agent are usually required to improve the therapeutic outcome, it is crucial to assess the immunogenicity of the administered nanoparticles. In this data work, we investigated the safety profile of the repeated intravenous administration of brain-targeted stable nucleic acid lipid particles (RVG-9r-targeted SNALPs. To evaluate local activation of the immune system, we performed analysis of mouse tissue homogenates and sections from cerebellum. To investigate peripheral activation of the immune system, we used serum of mice that were intravenously injected with RVG-9r-targeted SNALPs. These data are related and were discussed in the accompanying research article entitled “Intravenous administration of brain-targeted stable nucleic acid lipid particles alleviates Machado–Joseph disease neurological phenotype” (Conceição et al., in press [1].

  7. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

    Science.gov (United States)

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

    2016-01-15

    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Injury-induced inhibition of small intestinal protein and nucleic acid synthesis

    International Nuclear Information System (INIS)

    Carter, E.A.; Hatz, R.A.; Yarmush, M.L.; Tompkins, R.G.

    1990-01-01

    Small intestinal mucosal weight and nutrient absorption are significantly diminished early after cutaneous thermal injuries. Because these intestinal properties are highly dependent on rates of nucleic acid and protein synthesis, in vivo incorporation of thymidine, uridine, and leucine into small intestinal deoxyribonucleic acid, ribonucleic acid, and proteins were measured. Deoxyribonucleic acid synthesis was markedly decreased with the lowest thymidine incorporation in the jejunum (p less than 0.01); these findings were confirmed by autoradiographic identification of radiolabeled nuclei in the intestinal crypts. Protein synthesis was decreased by 6 h postinjury (p less than 0.01) but had returned to normal by 48 h. Consistent with a decreased rate of protein synthesis, ribonucleic acid synthesis was also decreased 18 h postinjury (p less than 0.01). These decreased deoxyribonucleic acid, ribonucleic acid, and protein synthesis rates are not likely a result of ischemia because in other studies of this injury model, intestinal blood flow was not significantly changed by the burn injury. Potentially, factors initiating the acute inflammatory reaction may directly inhibit nucleic acid and protein synthesis and lead to alterations in nutrient absorption and intestinal barrier function after injury

  9. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities

    KAUST Repository

    Huete-Stauffer, Tamara M.; Arandia-Gorostidi, Nestor; Alonso-Sá ez, Laura; Moran, Xose Anxelu G.

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures.

  10. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities

    KAUST Repository

    Huete-Stauffer, Tamara M.

    2016-05-23

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures.

  11. Variation, differential reproduction and oscillation: the evolution of nucleic acid hybridization.

    Science.gov (United States)

    Suárez-Díaz, Edna

    2013-01-01

    This paper builds upon Hans-Jörg Rheinberger ideas on the oscillation and intercalation of epistemic things and technical objects in experimental systems, to give a fine-grained analysis of what here is called the problems of "adaptation" between our material and cognitive tools and the phenomena of the material world. To do so, it relies on the case-study of the evolution of nucleic acid hybridization and the stabilization of satellite DNA.

  12. A measure of bending in nucleic acids structures applied to A-tract DNA

    Czech Academy of Sciences Publication Activity Database

    Lankaš, Filip; Špačková, Naďa; Moakher, M.; Enkhbayar, P.; Šponer, Jiří

    2010-01-01

    Roč. 38, č. 10 (2010), s. 3414-3422 ISSN 0305-1048 R&D Projects: GA MŠk(CZ) LC06030 Grant - others:GA MŠk(CZ) LC512 Program:LC Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : nucleic acids * DNA * molecular dynamics Subject RIV: BO - Biophysics Impact factor: 7.836, year: 2010

  13. Double Displacement: an Improved Bioorthogonal Reaction Strategy for Templated Nucleic Acid Detection

    OpenAIRE

    Kleinbaum, Daniel J.; Miller, Gregory P.; Kool, Eric T.

    2010-01-01

    Quenched autoligation probes have been employed previously in a target-templated nonenzymatic ligation strategy for detecting nucleic acids in cells by fluorescence. A common source of background signal in such probes is undesired reaction with water and other cellular nucleophiles. Here we describe a new class of self-ligating probes, double displacement (DD) probes, that rely on two displacement reactions to fully unquench a nearby fluorophore. Three potential double displacement architectu...

  14. Archive of Samples for Long-Term Preservation of RNA and Other Nucleic Acids

    Science.gov (United States)

    2016-05-15

    workflow can be developed for large scale blood collection , transport , and long-term archiving without the use of costly and unreliable cold chain...management, using commercially available biopreservation products. For the development of the automated workflow we have chosen Biomatrica’s commercially...This ambient workflow can be developed for large scale blood collection, transport and long-term nucleic acid archiving without the use of costly

  15. End-labeling of peptide nucleic acid with osmium complex. Voltammetry at carbon and mercury electrodes

    Czech Academy of Sciences Publication Activity Database

    Paleček, Emil; Trefulka, Mojmír; Fojta, Miroslav

    2009-01-01

    Roč. 11, č. 2 (2009), s. 359-362 ISSN 1388-2481 R&D Projects: GA AV ČR(CZ) KAN400310651; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : peptide nucleic acid end-labeling * osmium tetroxide complexes * electroactive labels Subject RIV: BO - Biophysics Impact factor: 4.243, year: 2009

  16. Cation–Anion Interactions within the Nucleic Acid Ion Atmosphere Revealed by Ion Counting

    Science.gov (United States)

    Gebala, Magdalena; Giambasu, George M.; Lipfert, Jan; Bisaria, Namita; Bonilla, Steve; Li, Guangchao; York, Darrin M.; Herschlag, Daniel

    2016-01-01

    The ion atmosphere is a critical structural, dynamic, and energetic component of nucleic acids that profoundly affects their interactions with proteins and ligands. Experimental methods that “count” the number of ions thermodynamically associated with the ion atmosphere allow dissection of energetic properties of the ion atmosphere, and thus provide direct comparison to theoretical results. Previous experiments have focused primarily on the cations that are attracted to nucleic acid polyanions, but have also showed that anions are excluded from the ion atmosphere. Herein, we have systematically explored the properties of anion exclusion, testing the zeroth-order model that anions of different identity are equally excluded due to electrostatic repulsion. Using a series of monovalent salts, we find, surprisingly, that the extent of anion exclusion and cation inclusion significantly depends on salt identity. The differences are prominent at higher concentrations and mirror trends in mean activity coefficients of the electrolyte solutions. Salts with lower activity coefficients exhibit greater accumulation of both cations and anions within the ion atmosphere, strongly suggesting that cation–anion correlation effects are present in the ion atmosphere and need to be accounted for to understand electrostatic interactions of nucleic acids. To test whether the effects of cation–anion correlations extend to nucleic acid kinetics and thermodynamics, we followed the folding of P4–P6, a domain of the Tetrahymena group I ribozyme, via single-molecule fluorescence resonance energy transfer in solutions with different salts. Solutions of identical concentration but lower activity gave slower and less favorable folding. Our results reveal hitherto unknown properties of the ion atmosphere and suggest possible roles of oriented ion pairs or anion-bridged cations in the ion atmosphere for electrolyte solutions of salts with reduced activity. Consideration of these new

  17. Nucleic acid detection based on the use of microbeads: a review

    International Nuclear Information System (INIS)

    Rödiger, Stefan; Liebsch, Claudia; Schmidt, Carsten; Schierack, Peter; Lehmann, Werner; Resch-Genger, Ute; Schedler, Uwe

    2014-01-01

    Microbead-based technologies represent elegant and versatile approaches for highly parallelized quantitative multiparameter assays. They also form the basis of various techniques for detection and quantification of nucleic acids and proteins. Nucleic acid-based methods include hybridization assays, solid-phase PCR, sequencing, and trapping assays. Microbead assays have been improved in the past decades and are now important tools in routine and point-of-care diagnostics as well as in life science. Its advances include low costs, low workload, high speed and high-throughput automation. The potential of microbead-based assays therefore is apparent, and commercial applications can be found in the detection and discrimination of single nucleotide polymorphism, of pathogens, and in trapping assays. This review provides an overview on microbead-based platforms for biosensing with a main focus on nucleic acid detection (including amplification strategies and on selected probe systems using fluorescent labeling). Specific sections cover chemical properties of microbeads, the coupling of targets onto solid surfaces, microbead probe systems (mainly oligonucleotide probes), microbead detection schemes (with subsections on suspension arrays, microfluidic devices, and immobilized microbeads), quantification of nucleic acids, PCR in solution and the detection of amplicons, and methods for solid-phase amplification. We discuss selected trends such as microbead-coupled amplification, heterogeneous and homogenous DNA hybridization assays, real-time assays, melting curve analysis, and digital microbead assays. We finally discuss the relevance and trends of the methods in terms of high-level multiplexed analysis and their potential in diagnosis and personalized medicine. (author)

  18. Nucleic acids encoding modified human immunodeficiency virus type 1 (HIV-1) group M consensus envelope glycoproteins

    Science.gov (United States)

    Haynes, Barton F [Durham, NC; Gao, Feng [Durham, NC; Korber, Bette T [Los Alamos, NM; Hahn, Beatrice H [Birmingham, AL; Shaw, George M [Birmingham, AL; Kothe, Denise [Birmingham, AL; Li, Ying Ying [Hoover, AL; Decker, Julie [Alabaster, AL; Liao, Hua-Xin [Chapel Hill, NC

    2011-12-06

    The present invention relates, in general, to an immunogen and, in particular, to an immunogen for inducing antibodies that neutralizes a wide spectrum of HIV primary isolates and/or to an immunogen that induces a T cell immune response. The invention also relates to a method of inducing anti-HIV antibodies, and/or to a method of inducing a T cell immune response, using such an immunogen. The invention further relates to nucleic acid sequences encoding the present immunogens.

  19. Nucleic acid reactivity : challenges for next-generation semiempirical quantum models

    OpenAIRE

    Huang, Ming; Giese, Timothy J.; York, Darrin M.

    2015-01-01

    Semiempirical quantum models are routinely used to study mechanisms of RNA catalysis and phosphoryl transfer reactions using combined quantum mechanical/molecular mechanical methods. Herein, we provide a broad assessment of the performance of existing semiempirical quantum models to describe nucleic acid structure and reactivity in order to quantify their limitations and guide the development of next-generation quantum models with improved accuracy. Neglect of diatomic diffierential overlap (...

  20. Nanomaterials for delivery of nucleic acid to the central nervous system (CNS)

    DEFF Research Database (Denmark)

    Wang, Danyang; Wu, Lin-Ping

    2017-01-01

    -related disease, such as neurodegeneration and disorders, suitable, safe and effective drug delivery nanocarriers have to been developed to overcome the blood brain barrier (BBB), which is the most inflexible barrier in human body. Here, we highlight the structure and function of barriers in the central nervous...... system (CNS) and summary several types of nanomaterials which can be potentially used in the brain delivery nucleic acid....

  1. Ebselen Inhibits Hepatitis C Virus NS3 Helicase Binding to Nucleic Acid and Prevents Viral Replication

    OpenAIRE

    Mukherjee, Sourav; Weiner, Warren S.; Schroeder, Chad E.; Simpson, Denise S.; Hanson, Alicia M.; Sweeney, Noreena L.; Marvin, Rachel K.; Ndjomou, Jean; Kolli, Rajesh; Isailovic, Dragan; Schoenen, Frank J.; Frick, David N.

    2014-01-01

    The hepatitis C virus (HCV) nonstructural protein 3 (NS3) is both a protease, which cleaves viral and host proteins, and a helicase that separates nucleic acid strands, using ATP hydrolysis to fuel the reaction. Many antiviral drugs, and compounds in clinical trials, target the NS3 protease, but few helicase inhibitors that function as antivirals have been reported. This study focuses on the analysis of the mechanism by which ebselen (2-phenyl-1,2-benzisoselenazol-3-one), a compound previousl...

  2. Ebselen inhibits hepatitis C virus NS3 helicase binding to nucleic acid and prevents viral replication.

    Science.gov (United States)

    Mukherjee, Sourav; Weiner, Warren S; Schroeder, Chad E; Simpson, Denise S; Hanson, Alicia M; Sweeney, Noreena L; Marvin, Rachel K; Ndjomou, Jean; Kolli, Rajesh; Isailovic, Dragan; Schoenen, Frank J; Frick, David N

    2014-10-17

    The hepatitis C virus (HCV) nonstructural protein 3 (NS3) is both a protease, which cleaves viral and host proteins, and a helicase that separates nucleic acid strands, using ATP hydrolysis to fuel the reaction. Many antiviral drugs, and compounds in clinical trials, target the NS3 protease, but few helicase inhibitors that function as antivirals have been reported. This study focuses on the analysis of the mechanism by which ebselen (2-phenyl-1,2-benzisoselenazol-3-one), a compound previously shown to be a HCV antiviral agent, inhibits the NS3 helicase. Ebselen inhibited the abilities of NS3 to unwind nucleic acids, to bind nucleic acids, and to hydrolyze ATP, and about 1 μM ebselen was sufficient to inhibit each of these activities by 50%. However, ebselen had no effect on the activity of the NS3 protease, even at 100 times higher ebselen concentrations. At concentrations below 10 μM, the ability of ebselen to inhibit HCV helicase was reversible, but prolonged incubation of HCV helicase with higher ebselen concentrations led to irreversible inhibition and the formation of covalent adducts between ebselen and all 14 cysteines present in HCV helicase. Ebselen analogues with sulfur replacing the selenium were just as potent HCV helicase inhibitors as ebselen, but the length of the linker between the phenyl and benzisoselenazol rings was critical. Modifications of the phenyl ring also affected compound potency over 30-fold, and ebselen was a far more potent helicase inhibitor than other, structurally unrelated, thiol-modifying agents. Ebselen analogues were also more effective antiviral agents, and they were less toxic to hepatocytes than ebselen. Although the above structure-activity relationship studies suggest that ebselen targets a specific site on NS3, we were unable to confirm binding to either the NS3 ATP binding site or nucleic acid binding cleft by examining the effects of ebselen on NS3 proteins lacking key cysteines.

  3. Nucleic Acid Analogue Induced Transcription of Double Stranded DNA

    DEFF Research Database (Denmark)

    1998-01-01

    RNA is transcribed from a double stranded DNA template by forming a complex by hybridizing to the template at a desired transcription initiation site one or more oligonucleic acid analogues of the PNA type capable of forming a transcription initiation site with the DNA and exposing the complex...... to the action of a DNA dependant RNA polymerase in the presence of nucleoside triphosphates. Equal length transcripts may be obtained by placing a block to transcription downstream from the initiation site or by cutting the template at such a selected location. The initiation site is formed by displacement...... of one strand of the DNA locally by the PNA hybridization....

  4. Production of extracellular nucleic acids by genetically altered bacteria in aquatic-environment microcosms

    International Nuclear Information System (INIS)

    Paul, J.H.; David, A.W.

    1989-01-01

    The factors which affect the production of extracellular DNA by genetically altered strains of Escherichia coli, Pseudomonas aeruginosa, Pseudomonas cepacia, and Bradyrhizobium japonicum in aquatic environments were investigated. Cellular nucleic acids were labeled in vivo by incubation with [ 3 H]thymidine or [ 3 H]adenine, and production of extracellular DNA in marine waters, artificial seawater, or minimal salts media was determined by detecting radiolabeled macromolecules in incubation filtrates. The presence or absence of the ambient microbial community had little effect on the production of extracellular DNA. Three of four organisms produced the greatest amounts of extracellular nucleic acids when incubated in low-salinity media (2% artificial seawater) rather than high-salinity media (10 to 50% artificial seawater). The greatest production of extracellular nucleic acids by P. cepacia occurred at pH 7 and 37 degree C, suggesting that extracellular-DNA production may be a normal physiologic function of the cell. Incubation of labeled P. cepacia cells in water from Bimini Harbor, Bahamas, resulted in labeling of macromolecules of the ambient microbial population. Collectively these results indicate that (i) extracellular-DNA production by genetically altered bacteria released into aquatic environments is more strongly influenced by physicochemical factors than biotic factors, (ii) extracellular-DNA production rates are usually greater for organisms released in freshwater than marine environments, and (iii) ambient microbial populations can readily utilize materials released by these organisms

  5. Development of Temperature Control Solutions for Non-Instrumented Nucleic Acid Amplification Tests (NINAAT

    Directory of Open Access Journals (Sweden)

    Tamás Pardy

    2017-06-01

    Full Text Available Non-instrumented nucleic acid amplification tests (NINAAT are a novel paradigm in portable molecular diagnostics. They offer the high detection accuracy characteristic of nucleic acid amplification tests (NAAT in a self-contained device, without the need for any external instrumentation. These Point-of-Care tests typically employ a Lab-on-a-Chip for liquid handling functionality, and perform isothermal nucleic acid amplification protocols that require low power but high accuracy temperature control in a single well-defined temperature range. We propose temperature control solutions based on commercially available heating elements capable of meeting these challenges, as well as demonstrate the process by which such elements can be fitted to a NINAAT system. Self-regulated and thermostat-controlled resistive heating elements were evaluated through experimental characterization as well as thermal analysis using the finite element method (FEM. We demonstrate that the proposed solutions can support various NAAT protocols, as well as demonstrate an optimal solution for the loop-mediated isothermal amplification (LAMP protocol. Furthermore, we present an Arduino-compatible open-source thermostat developed for NINAAT applications.

  6. NaVirCept - Nucleic Acid-Based Anti-Viral Project

    International Nuclear Information System (INIS)

    Stephen, E. R.; Wong, J.; Van Loon, D.

    2007-01-01

    Vaccines are generally considered to be the most effective countermeasures to bacterial and viral diseases, however, licensed vaccines against many disease agents are either not available or their efficacies have not been demonstrated. Vaccines are generally agent specific in terms of treatment spectrum and are subject to defeat through natural mutation or through directed efforts. With respect to viral therapeutics, one of the major limitations associated with antiviral drugs is acquired drug resistance caused by antigenic shift or drift. A number of next-generation prophylactic and/or therapeutic measures are on the horizon. Of these, nucleic acid-based drugs are showing great antiviral potential. These drugs elicit long-lasting, broad spectrum protective immune responses, especially to respiratory viral pathogens. The Nucleic Acid-Based Antiviral (NaVirCept) project provides the opportunity to demonstrate the effectiveness of novel medical countermeasures against military-significant endemic and other viral threat agents. This project expands existing DRDC drug delivery capability development, in the form of proprietary liposome intellectual property, by coupling it with leading-edge nucleic acid-based technology to deliver effective medical countermeasures that will protect deployed personnel and the warfighter against a spectrum of viral disease agents. The technology pathway will offer a means to combat emerging viral diseases or modified threat agents such as the bird flu or reconstructed Spanish flu without going down the laborious, time-consuming and expensive paths to develop countermeasures for each new and/or emerging viral disease organism.(author)

  7. Operating Cooperatively (OC sensor for highly specific recognition of nucleic acids.

    Directory of Open Access Journals (Sweden)

    Evan M Cornett

    Full Text Available Molecular Beacon (MB probes have been extensively used for nucleic acid analysis because of their ability to produce fluorescent signal in solution instantly after hybridization. The indirect binding of MB probe to a target analyte offers several advantages, including: improved genotyping accuracy and the possibility to analyse folded nucleic acids. Here we report on a new design for MB-based sensor, called 'Operating Cooperatively' (OC, which takes advantage of indirect binding of MB probe to a target analyte. The sensor consists of two unmodified DNA strands, which hybridize to a universal MB probe and a nucleic acid analyte to form a fluorescent complex. OC sensors were designed to analyze two human SNPs and E. coli 16S rRNA. High specificity of the approach was demonstrated by the detection of true analyte in over 100 times excess amount of single base substituted analytes. Taking into account the flexibility in the design and the simplicity in optimization, we conclude that OC sensors may become versatile and efficient tools for instant DNA and RNA analysis in homogeneous solution.

  8. Spectroscopic Study of the Binding of Netropsin and Hoechst 33258 to Nucleic Acids

    Science.gov (United States)

    Vardevanyan, P. O.; Parsadanyan, M. A.; Antonyan, A. P.; Sahakyan, V. G.

    2018-05-01

    The interaction of groove binding compounds — peptide antibiotic (polyamide) netropsin and fluorescent dye (bisbenzimidazole) Hoechst 33258 — with the double-stranded DNA and synthetic double-stranded polynucleotide poly(rA)-poly(rU) has been studied by spectrophotometry. Absorption spectra of these ligand complexes with nucleic acids have been obtained. Spectral changes at the complexation of individual ligands with the mentioned nucleic acids reveal the similarity of binding of each of these ligands with both DNA and RNA. Based on the spectroscopic measurements, the binding parameters of netropsin and Hoechst 33258 binding to DNA and poly(rA)-poly(rU) - K and n, as well as the thermodynamic parameters ΔS, ΔG, and ΔH have been determined. It was found that the binding of Hoechst 33258 to both nucleic acids is accompanied by a positive change in enthalpy, while in the case of netropsin the change in enthalpy is negative. Moreover, the contribution of entropy to the formation of the complexes is more pronounced in the case of Hoechst 33258.

  9. Nucleic acids and smart materials: advanced building blocks for logic systems.

    Science.gov (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2014-09-03

    Logic gates can convert input signals into a defined output signal, which is the fundamental basis of computing. Inspired by molecular switching from one state to another under an external stimulus, molecular logic gates are explored extensively and recognized as an alternative to traditional silicon-based computing. Among various building blocks of molecular logic gates, nucleic acid attracts special attention owing to its specific recognition abilities and structural features. Functional materials with unique physical and chemical properties offer significant advantages and are used in many fields. The integration of nucleic acids and functional materials is expected to bring about several new phenomena. In this Progress Report, recent progress in the construction of logic gates by combining the properties of a range of smart materials with nucleic acids is introduced. According to the structural characteristics and composition, functional materials are categorized into three classes: polymers, noble-metal nanomaterials, and inorganic nanomaterials. Furthermore, the unsolved problems and future challenges in the construction of logic gates are discussed. It is hoped that broader interests in introducing new smart materials into the field are inspired and tangible applications for these constructs are found. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Design of polymer motifs for nucleic acid recognition and assembly stabilization

    Science.gov (United States)

    Zhou, Zhun

    This dissertation describes the synthesis and assembly of bio-functional polymers and the applications of these polymers to drug encapsulation, delivery, and multivalent biomimetic macromolecular recognition between synthetic polymer and nucleic acids. The main content is divided into three parts: (1) polyacidic domains as strongly stabilizing design elements for aqueous phase polyacrylate diblock assembly; (2) small molecule/polymer recognition triggered macromolecular assembly and drug encapsulation; (3) trizaine derivatized polymer as a novel class of "bifacial polymer nucleic acid" (bPoNA) and applications of bPoNA to nanoparticle loading of DNA/RNA, silencing delivery as well as control of aptamer function. Through the studies in part (1) and part (2), it was demonstrated that well-designed polymer motifs are not only able to enhance assemblies driven by non-specific hydrophobic effect, but are also able to direct assemblies based on specific recognitions. In part (3) of this dissertation, this concept was further extended by the design of polyacrylate polymers that are capable of discrete and robust hybridization with nucleic acids. This surprising finding demonstrated both fundamental and practical applications. Overall, these studies provided insights into the rational design elements for improving the bio-functions of synthetic polymers, and significantly expanded the scope of biological applications in which polymers synthesized via controlled radical polymerization may play a role.

  11. Velocity and processivity of helicase unwinding of double-stranded nucleic acids

    International Nuclear Information System (INIS)

    Betterton, M D; Juelicher, F

    2005-01-01

    Helicases are molecular motors which unwind double-stranded nucleic acids (dsNA) in cells. Many helicases move with directional bias on single-stranded (ss) nucleic acids, and couple their directional translocation to strand separation. A model of the coupling between translocation and unwinding uses an interaction potential to represent passive and active helicase mechanisms. A passive helicase must wait for thermal fluctuations to open dsNA base pairs before it can advance and inhibit NA closing. An active helicase directly destabilizes dsNA base pairs, accelerating the opening rate. Here we extend this model to include helicase unbinding from the nucleic-acid strand. The helicase processivity depends on the form of the interaction potential. A passive helicase has a mean attachment time which does not change between ss translocation and ds unwinding, while an active helicase in general shows a decrease in attachment time during unwinding relative to ss translocation. In addition, we describe how helicase unwinding velocity and processivity vary if the base-pair binding free energy is changed

  12. A bench-top automated workstation for nucleic acid isolation from clinical sample types.

    Science.gov (United States)

    Thakore, Nitu; Garber, Steve; Bueno, Arial; Qu, Peter; Norville, Ryan; Villanueva, Michael; Chandler, Darrell P; Holmberg, Rebecca; Cooney, Christopher G

    2018-04-18

    Systems that automate extraction of nucleic acid from cells or viruses in complex clinical matrices have tremendous value even in the absence of an integrated downstream detector. We describe our bench-top automated workstation that integrates our previously-reported extraction method - TruTip - with our newly-developed mechanical lysis method. This is the first report of this method for homogenizing viscous and heterogeneous samples and lysing difficult-to-disrupt cells using "MagVor": a rotating magnet that rotates a miniature stir disk amidst glass beads confined inside of a disposable tube. Using this system, we demonstrate automated nucleic acid extraction from methicillin-resistant Staphylococcus aureus (MRSA) in nasopharyngeal aspirate (NPA), influenza A in nasopharyngeal swabs (NPS), human genomic DNA from whole blood, and Mycobacterium tuberculosis in NPA. The automated workstation yields nucleic acid with comparable extraction efficiency to manual protocols, which include commercially-available Qiagen spin column kits, across each of these sample types. This work expands the scope of applications beyond previous reports of TruTip to include difficult-to-disrupt cell types and automates the process, including a method for removal of organics, inside a compact bench-top workstation. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. The fragile X mental retardation protein has nucleic acid chaperone properties.

    Science.gov (United States)

    Gabus, Caroline; Mazroui, Rachid; Tremblay, Sandra; Khandjian, Edouard W; Darlix, Jean-Luc

    2004-01-01

    The fragile X syndrome is the most common cause of inherited mental retardation resulting from the absence of the fragile X mental retardation protein (FMRP). FMRP contains two K-homology (KH) domains and one RGG box that are landmarks characteristic of RNA-binding proteins. In agreement with this, FMRP associates with messenger ribonucleoparticles (mRNPs) within actively translating ribosomes, and is thought to regulate translation of target mRNAs, including its own transcript. To investigate whether FMRP might chaperone nucleic acid folding and hybridization, we analysed the annealing and strand exchange activities of DNA oligonucleotides and the enhancement of ribozyme-directed RNA substrate cleavage by FMRP and deleted variants relative to canonical nucleic acid chaperones, such as the cellular YB-1/p50 protein and the retroviral nucleocapsid protein HIV-1 NCp7. FMRP was found to possess all the properties of a potent nucleic acid chaperone, requiring the KH motifs and RGG box for optimal activity. These findings suggest that FMRP may regulate translation by acting on RNA-RNA interactions and thus on the structural status of mRNAs.

  14. Nucleic acid stains as indicators of Giardia muris viability following cyst inactivation.

    Science.gov (United States)

    Taghi-Kilani, R; Gyürék, L L; Millard, P J; Finch, G R; Belosevic, M

    1996-06-01

    A reliable viability assay for Giardia is required for the development of disinfection process design criteria and pathogen monitoring by water treatment utilities. Surveys of single-staining nucleic acid dyes (stain dead parasites only), and double-staining vital dye kits from Molecular Probes (stain live and dead parasites) were conducted to assess the viability of untreated, heat-killed, and chemically inactivated Giardia muris cysts. Nucleic acid staining results were compared to those of in vitro excystation and animal infectivity. Nucleic acid stain, designated as SYTO-9, was considered the best among the single-staining dyes for its ability to stain dead cysts brightly and its relatively slow decay rate of visible light emission following DNA binding. SYTO-9 staining was correlated to animal infectivity. A Live/Dead BacLight was found to be the better of 2 double-staining viability kits tested. Logarithmic survival ratios based on SYTO-9 and Live/Dead BacLight were compared to excystation and infectivity results for G. muris cysts exposed to ozone or free chlorine. The results indicate that SYTO-9 and Live/Dead BacLight staining is stable following treatment of cysts with chemical disinfectants.

  15. Silver ions-mediated conformational switch: facile design of structure-controllable nucleic acid probes.

    Science.gov (United States)

    Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua

    2010-08-01

    Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.

  16. Rapid amplification/detection of nucleic acid targets utilizing a HDA/thin film biosensor.

    Science.gov (United States)

    Jenison, Robert; Jaeckel, Heidi; Klonoski, Joshua; Latorra, David; Wiens, Jacinta

    2014-08-07

    Thin film biosensors exploit a flat, optically coated silicon-based surface whereupon formation of nucleic acid hybrids are enzymatically transduced in a molecular thin film that can be detected by the unaided human eye under white light. While the limit of sensitivity for detection of nucleic acid targets is at sub-attomole levels (60 000 copies) many clinical specimens containing bacterial pathogens have much lower levels of analyte present. Herein, we describe a platform, termed HDA/thin film biosensor, which performs helicase-dependant nucleic acid amplification on a thin film biosensor surface to improve the limit of sensitivity to 10 copies of the mecA gene present in methicillin-resistant strains of Staphylococcus. As double-stranded DNA is unwound by helicase it was either bound by solution-phase DNA primers to be copied by DNA polymerase or hybridized to surface immobilized probe on the thin film biosensor surface to be detected. Herein, we show that amplification reactions on the thin film biosensor are equivalent to in standard thin wall tubes, with detection at the limit of sensitivity of the assay occurring after 30 minutes of incubation time. Further we validate the approach by detecting the presence of the mecA gene in methicillin-resistant Staphylococcus aureus (MRSA) from positive blood culture aliquots with high specificity (signal/noise ratio of 105).

  17. Comparison of femtosecond laser and continuous wave UV sources for protein-nucleic acid crosslinking.

    Science.gov (United States)

    Fecko, Christopher J; Munson, Katherine M; Saunders, Abbie; Sun, Guangxing; Begley, Tadhg P; Lis, John T; Webb, Watt W

    2007-01-01

    Crosslinking proteins to the nucleic acids they bind affords stable access to otherwise transient regulatory interactions. Photochemical crosslinking provides an attractive alternative to formaldehyde-based protocols, but irradiation with conventional UV sources typically yields inadequate product amounts. Crosslinking with pulsed UV lasers has been heralded as a revolutionary technique to increase photochemical yield, but this method had only been tested on a few protein-nucleic acid complexes. To test the generality of the yield enhancement, we have investigated the benefits of using approximately 150 fs UV pulses to crosslink TATA-binding protein, glucocorticoid receptor and heat shock factor to oligonucleotides in vitro. For these proteins, we find that the quantum yields (and saturating yields) for forming crosslinks using the high-peak intensity femtosecond laser do not improve on those obtained with low-intensity continuous wave (CW) UV sources. The photodamage to the oligonucleotides and proteins also has comparable quantum yields. Measurements of the photochemical reaction yields of several small molecules selected to model the crosslinking reactions also exhibit nearly linear dependences on UV intensity instead of the previously predicted quadratic dependence. Unfortunately, these results disprove earlier assertions that femtosecond pulsed laser sources provide significant advantages over CW radiation for protein-nucleic acid crosslinking.

  18. Nucleic acid-based diagnostics for infectious diseases in public health affairs.

    Science.gov (United States)

    Yu, Albert Cheung-Hoi; Vatcher, Greg; Yue, Xin; Dong, Yan; Li, Mao Hua; Tam, Patrick H K; Tsang, Parker Y L; Wong, April K Y; Hui, Michael H K; Yang, Bin; Tang, Hao; Lau, Lok-Ting

    2012-06-01

    Infectious diseases, mostly caused by bacteria and viruses but also a result of fungal and parasitic infection, have been one of the most important public health concerns throughout human history. The first step in combating these pathogens is to get a timely and accurate diagnosis at an affordable cost. Many kinds of diagnostics have been developed, such as pathogen culture, biochemical tests and serological tests, to help detect and fight against the causative agents of diseases. However, these diagnostic tests are generally unsatisfactory because they are not particularly sensitive and specific and are unable to deliver speedy results. Nucleic acid-based diagnostics, detecting pathogens through the identification of their genomic sequences, have shown promise to overcome the above limitations and become more widely adopted in clinical tests. Here we review some of the most popular nucleic acid-based diagnostics and focus on their adaptability and applicability to routine clinical usage. We also compare and contrast the characteristics of different types of nucleic acid-based diagnostics.

  19. Colorimetric Nucleic Acid Detection on Paper Microchip Using Loop Mediated Isothermal Amplification and Crystal Violet Dye.

    Science.gov (United States)

    Roy, Sharmili; Mohd-Naim, Noor Faizah; Safavieh, Mohammadali; Ahmed, Minhaz Uddin

    2017-11-22

    Nucleic acid detection is of paramount importance in monitoring of microbial pathogens in food safety and infectious disease diagnostic applications. To address these challenges, a rapid, cost-effective label-free technique for nucleic acid detection with minimal instrumentations is highly desired. Here, we present paper microchip to detect and quantify nucleic acid using colorimetric sensing modality. The extracted DNA from food samples of meat as well as microbial pathogens was amplified utilizing loop-mediated isothermal amplification (LAMP). LAMP amplicon was then detected and quantified on a paper microchip fabricated in a cellulose paper and a small wax chamber utilizing crystal violet dye. The affinity of crystal violet dye toward dsDNA and positive signal were identified by changing the color from colorless to purple. Using this method, detection of Sus scrofa (porcine) and Bacillus subtilis (bacteria) DNA was possible at concentrations as low as 1 pg/μL (3.43 × 10 -1 copies/μL) and 10 pg/μL (2.2 × 10 3 copies/μL), respectively. This strategy can be adapted for detection of other DNA samples, with potential for development of a new breed of simple and inexpensive paper microchip at the point-of-need.

  20. BIGNASim: a NoSQL database structure and analysis portal for nucleic acids simulation data.

    Science.gov (United States)

    Hospital, Adam; Andrio, Pau; Cugnasco, Cesare; Codo, Laia; Becerra, Yolanda; Dans, Pablo D; Battistini, Federica; Torres, Jordi; Goñi, Ramón; Orozco, Modesto; Gelpí, Josep Ll

    2016-01-04

    Molecular dynamics simulation (MD) is, just behind genomics, the bioinformatics tool that generates the largest amounts of data, and that is using the largest amount of CPU time in supercomputing centres. MD trajectories are obtained after months of calculations, analysed in situ, and in practice forgotten. Several projects to generate stable trajectory databases have been developed for proteins, but no equivalence exists in the nucleic acids world. We present here a novel database system to store MD trajectories and analyses of nucleic acids. The initial data set available consists mainly of the benchmark of the new molecular dynamics force-field, parmBSC1. It contains 156 simulations, with over 120 μs of total simulation time. A deposition protocol is available to accept the submission of new trajectory data. The database is based on the combination of two NoSQL engines, Cassandra for storing trajectories and MongoDB to store analysis results and simulation metadata. The analyses available include backbone geometries, helical analysis, NMR observables and a variety of mechanical analyses. Individual trajectories and combined meta-trajectories can be downloaded from the portal. The system is accessible through http://mmb.irbbarcelona.org/BIGNASim/. Supplementary Material is also available on-line at http://mmb.irbbarcelona.org/BIGNASim/SuppMaterial/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Polypyrrole-polyvinyl sulphonate film based disposable nucleic acid biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, Nirmal [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Road, New Delhi 110012 (India); Centre for Biomedical Engineering, Indian Institute of Technology, Hauz Khas, New Delhi 110016 (India); Arora, Kavita [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Road, New Delhi 110012 (India); Singh, Surinder P. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Road, New Delhi 110012 (India); Pandey, Manoj K. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Road, New Delhi 110012 (India); Singh, Harpal [Centre for Biomedical Engineering, Indian Institute of Technology, Hauz Khas, New Delhi 110016 (India); Malhotra, Bansi D. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Road, New Delhi 110012 (India)]. E-mail: bansi.malhotra@gmail.com

    2007-04-18

    Double stranded calf thymus deoxyribonucleic acid entrapped polypyrrole-polyvinyl sulphonate (dsCT-DNA-PPy-PVS) films fabricated onto indium-tin-oxide (ITO) coated glass plates have been used to detect organophosphates such as chlorpyrifos and malathion. These disposable dsCT-DNA-PPy-PVS/ITO bioelectrodes have been characterized using cyclic voltammetry, Fourier-transform-infra-red (FTIR) spectroscopy and atomic force microscopy (AFM), respectively. These biosensing electrodes have a response time of 30 s, are stable for about 5 months when stored in desiccated conditions at 25 deg. C and can be used to amperometrically detect chlorpyrifos (0.0016-0.025 ppm) and malathion (0.17-5.0), respectively. The additive effect of these pesticides on the amperometric response of the disposable dsCT-DNA-PPy-PVS/ITO bioelectrodes has also been investigated.

  2. Peptide and nucleic acid-directed self-assembly of cationic nanovehicles through giant unilamellar vesicle modification

    DEFF Research Database (Denmark)

    Tagalakis, A. D.; Maeshima, R.; Yu-Wai-Man, C.

    2017-01-01

    into a neuroblastoma xenograft mouse model, nanovesicle complexes were found to distribute throughout the tumour interstitium, thus providing an alternative safer approach for future development of tumour-specific therapeutic nucleic acid interventions. On oropharyngeal instillation, nanovesicle complexes displayed...

  3. Polyvinyl-alcohol-based magnetic beads for rapid and efficient separation of specific or unspecific nucleic acid sequences

    International Nuclear Information System (INIS)

    Oster, J.; Parker, Jeffrey; Brassard, Lothar

    2001-01-01

    The versatile application of polyvinyl-alcohol-based magnetic M-PVA beads is demonstrated in the separation of genomic DNA, sequence specific nucleic acid purification, and binding of bacteria for subsequent DNA extraction and detection. It is shown that nucleic acids can be obtained in high yield and purity using M-PVA beads, making sample preparation efficient, fast and highly adaptable for automation processes

  4. Bio-Orthogonal Mediated Nucleic Acid Transfection of Cells via Cell Surface Engineering.

    Science.gov (United States)

    O'Brien, Paul J; Elahipanah, Sina; Rogozhnikov, Dmitry; Yousaf, Muhammad N

    2017-05-24

    The efficient delivery of foreign nucleic acids (transfection) into cells is a critical tool for fundamental biomedical research and a pillar of several biotechnology industries. There are currently three main strategies for transfection including reagent, instrument, and viral based methods. Each technology has significantly advanced cell transfection; however, reagent based methods have captured the majority of the transfection market due to their relatively low cost and ease of use. This general method relies on the efficient packaging of a reagent with nucleic acids to form a stable complex that is subsequently associated and delivered to cells via nonspecific electrostatic targeting. Reagent transfection methods generally use various polyamine cationic type molecules to condense with negatively charged nucleic acids into a highly positively charged complex, which is subsequently delivered to negatively charged cells in culture for association, internalization, release, and expression. Although this appears to be a straightforward procedure, there are several major issues including toxicity, low efficiency, sorting of viable transfected from nontransfected cells, and limited scope of transfectable cell types. Herein, we report a new strategy (SnapFect) for nucleic acid transfection to cells that does not rely on electrostatic interactions but instead uses an integrated approach combining bio-orthogonal liposome fusion, click chemistry, and cell surface engineering. We show that a target cell population is rapidly and efficiently engineered to present a bio-orthogonal functional group on its cell surface through nanoparticle liposome delivery and fusion. A complementary bio-orthogonal nucleic acid complex is then formed and delivered to which chemoselective click chemistry induced transfection occurs to the primed cell. This new strategy requires minimal time, steps, and reagents and leads to superior transfection results for a broad range of cell types

  5. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Science.gov (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  6. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

    Science.gov (United States)

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

    2013-11-20

    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  7. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Science.gov (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  8. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

    Science.gov (United States)

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

    2018-02-07

    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  9. Autoradiographic studies on nucleic acid synthesis of human gastric cancer cells, 1. Relationship between nucleic acid synthesis of cancer cells and clinicopathological findings

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K [Kobe Univ. (Japan). School of Medicine

    1982-03-01

    The rate of nucleic acid synthesis of human gastric cancer cells was studied autoradiographically and was compared with clinicopathological findings. 1) /sup 3/H-thymidine labeling index (TLI, mean 22.4%, n = 21) ranged from 6.2% to 39.5%. Mitotic index (mean 1.96%) ranged from 1.18% to 3.48%. 2) Average TLIs in the cancerous lesions with serosal invasion, in microscopical stages III and IV, in scirrhous type and in cancer cells locating in pm- and ss-layers showed lower values compared with the counterparts. 3) /sup 3/H-uridine labeling index (mean 92.7%) ranged from 75.0% to 99.8%.

  10. Autoradiographic studies on nucleic acid synthesis of human gastric cancer cells, 2. Effects of 5-Fluorouracil on nucleic acid synthesis of cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K [Kobe Univ. (Japan). School of Medicine

    1982-03-01

    Changes in nucleic acid synthesis of gastric cancer cells by oral administration of 5-fluorouracil (5-FU) were evaluated autoradiographically. 1) Average /sup 3/H-thymidine labeling index (TLI) in the administered group (31.8%, n = 13) was a significantly high value compared with that of the control group (22.4%, n = 21). This result is considered to show that the pharmacological effects of 5-FU appeared on the cancer cells by the clinical administration of 5-FU. 2) Increase in TLI of the administered group was also found in the advanced stages. However, the degree of its increase seemed to be higher in the early stages. 3) Average /sup 3/H-uridine labeling index (89.9%) was not different from that (92.7%) of control group.

  11. Cathepsin B-sensitive polymers for compartment-specific degradation and nucleic acid release.

    Science.gov (United States)

    Chu, David S H; Johnson, Russell N; Pun, Suzie H

    2012-02-10

    Degradable cationic polymers are desirable for in vivo nucleic acid delivery because they offer significantly decreased toxicity over non-degradable counterparts. Peptide linkers provide chemical stability and high specificity for particular endopeptidases but have not been extensively studied for nucleic acid delivery applications. In this work, enzymatically degradable peptide-HPMA copolymers were synthesized by RAFT polymerization of HPMA with methacrylamido-terminated peptide macromonomers, resulting in polymers with low polydispersity and near quantitative incorporation of peptides. Three peptide-HPMA copolymers were evaluated: (i) pHCathK(10), containing peptides composed of the linker phe-lys-phe-leu (FKFL), a substrate of the endosomal/lysosomal endopeptidase cathepsin B, connected to oligo-(L)-lysine for nucleic acid binding, (ii) pHCath(D)K(10), containing the FKFL linker with oligo-(D)-lysine, and (iii) pH(D)Cath(D)K(10), containing all (D) amino acids. Cathepsin B degraded copolymers pHCathK(10) and pHCath(D)K(10) within 1 h while no degradation of pH(D)Cath(D)K(10) was observed. Polyplexes formed with pHCathK(10) copolymers show DNA release by 4 h of treatment with cathepsin B; comparatively, polyplexes formed with pHCath(D)K(10) and pH(D)Cath(D)K(10) show no DNA release within 8 h. Transfection efficiency in HeLa and NIH/3T3 cells were comparable between the copolymers but pHCathK(10) was less toxic. This work demonstrates the successful application of peptide linkers for degradable cationic polymers and DNA release. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Nucleic acid-binding properties of the RRM-containing protein RDM1

    International Nuclear Information System (INIS)

    Hamimes, Samia; Bourgeon, Dominique; Stasiak, Alicja Z.; Stasiak, Andrzej; Van Dyck, Eric

    2006-01-01

    RDM1 (RAD52 Motif 1) is a vertebrate protein involved in the cellular response to the anti-cancer drug cisplatin. In addition to an RNA recognition motif, RDM1 contains a small amino acid motif, named RD motif, which it shares with the recombination and repair protein, RAD52. RDM1 binds to single- and double-stranded DNA, and recognizes DNA distortions induced by cisplatin adducts in vitro. Here, we have performed an in-depth analysis of the nucleic acid-binding properties of RDM1 using gel-shift assays and electron microscopy. We show that RDM1 possesses acidic pH-dependent DNA-binding activity and that it binds RNA as well as DNA, and we present evidence from competition gel-shift experiments that RDM1 may be capable of discrimination between the two nucleic acids. Based on reported studies of RAD52, we have generated an RDM1 variant mutated in its RD motif. We find that the L 119 GF → AAA mutation affects the mode of RDM1 binding to single-stranded DNA

  13. Photobiological behavior of bacteria and phages supplemented with aza-analogues of nucleic acid bases

    Energy Technology Data Exchange (ETDEWEB)

    Kittler, L; Hradecna, Z; Jacob, H E; Loeber, G

    1975-01-01

    The photochemical stability of anomalous nucleic acid bases of the azatype, 5-azacytosine (1), 5-azacytidine (II), 6-azacytosine (III), 6-azacytidine (IV), 6-azathymine (V), 6-azauracil (VI), and 8-aza-adenine (VII) to uv light of the wavelength 254 nm differs from the uv stability of the normal constituents. Changes of the uv inactivation of Escherichia coli K12 C600, E. coli B, Bacillus cereus, as well as E. coli phages lambda cb/sub 2/ and lambda b/sub 2/b/sub 5/ supplemented with azaderivatives prior to irradiation were investigated. It was found that I, II, III, IV, and VII are more, V and VI less sensitive to uv light compared with corresponding natural nucleic acid bases. Their changed uv sensitivities are reflected in the survival curves after uv irradiation in as far as azabases are incorporated into the nucleic acids in vivo. This explains the increase in uv sensitivity of E. coli K 12 C600, E. coli B, and B. cereus supplemented with I, II, III, IV, and VII and the decrease in uv sensitivity of Streptococcus faecalis supplemented with V (the latter information was taken from Gunther and Prusoff 1967). The lack of any significant influence of inactivation curves of E. coli K 12 C600 by V and VI, and on E. coli phages lambda cb/sub 2/ and lambda c/sub 2/b/sub 5/ by II, is discussed in terms of too small incorporation rates. No discrimination was put forward with respect to DNA and RNA incorporation.

  14. An integrated portable hand-held analyser for real-time isothermal nucleic acid amplification

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Matthew C. [College of Marine Science, University of South Florida, St Petersburg, FL (United States)], E-mail: msmith@marine.usf.edu; Steimle, George; Ivanov, Stan; Holly, Mark; Fries, David P. [College of Marine Science, University of South Florida, St Petersburg, FL (United States)

    2007-08-29

    A compact hand-held heated fluorometric instrument for performing real-time isothermal nucleic acid amplification and detection is described. The optoelectronic instrument combines a Printed Circuit Board/Micro Electro Mechanical Systems (PCB/MEMS) reaction detection/chamber containing an integrated resistive heater with attached miniature LED light source and photo-detector and a disposable glass waveguide capillary to enable a mini-fluorometer. The fluorometer is fabricated and assembled in planar geometry, rolled into a tubular format and packaged with custom control electronics to form the hand-held reactor. Positive or negative results for each reaction are displayed to the user using an LED interface. Reaction data is stored in FLASH memory for retrieval via an in-built USB connection. Operating on one disposable 3 V lithium battery >12, 60 min reactions can be performed. Maximum dimensions of the system are 150 mm (h) x 48 mm (d) x 40 mm (w), the total instrument weight (with battery) is 140 g. The system produces comparable results to laboratory instrumentation when performing a real-time nucleic acid sequence-based amplification (NASBA) reaction, and also displayed comparable precision, accuracy and resolution to laboratory-based real-time nucleic acid amplification instrumentation. A good linear response (R{sup 2} = 0.948) to fluorescein gradients ranging from 0.5 to 10 {mu}M was also obtained from the instrument indicating that it may be utilized for other fluorometric assays. This instrument enables an inexpensive, compact approach to in-field genetic screening, providing results comparable to laboratory equipment with rapid user feedback as to the status of the reaction.

  15. An integrated portable hand-held analyser for real-time isothermal nucleic acid amplification

    International Nuclear Information System (INIS)

    Smith, Matthew C.; Steimle, George; Ivanov, Stan; Holly, Mark; Fries, David P.

    2007-01-01

    A compact hand-held heated fluorometric instrument for performing real-time isothermal nucleic acid amplification and detection is described. The optoelectronic instrument combines a Printed Circuit Board/Micro Electro Mechanical Systems (PCB/MEMS) reaction detection/chamber containing an integrated resistive heater with attached miniature LED light source and photo-detector and a disposable glass waveguide capillary to enable a mini-fluorometer. The fluorometer is fabricated and assembled in planar geometry, rolled into a tubular format and packaged with custom control electronics to form the hand-held reactor. Positive or negative results for each reaction are displayed to the user using an LED interface. Reaction data is stored in FLASH memory for retrieval via an in-built USB connection. Operating on one disposable 3 V lithium battery >12, 60 min reactions can be performed. Maximum dimensions of the system are 150 mm (h) x 48 mm (d) x 40 mm (w), the total instrument weight (with battery) is 140 g. The system produces comparable results to laboratory instrumentation when performing a real-time nucleic acid sequence-based amplification (NASBA) reaction, and also displayed comparable precision, accuracy and resolution to laboratory-based real-time nucleic acid amplification instrumentation. A good linear response (R 2 = 0.948) to fluorescein gradients ranging from 0.5 to 10 μM was also obtained from the instrument indicating that it may be utilized for other fluorometric assays. This instrument enables an inexpensive, compact approach to in-field genetic screening, providing results comparable to laboratory equipment with rapid user feedback as to the status of the reaction

  16. Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids

    International Nuclear Information System (INIS)

    El-Yazbi, Amira F.; Loppnow, Glen R.

    2013-01-01

    Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb 3+ ). Single-stranded oligonucleotides greatly enhance the Tb 3+ emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb 3+ /hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb 3+ , producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb 3+ /hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb 3+ /hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage

  17. Nucleic acid metabolism in sea urchin embryos and its alteration after x-irradiation

    International Nuclear Information System (INIS)

    Kimura, I.

    1974-01-01

    Nucleic acid metabolism observed during embryogenesis of the sea urchin (Hemicentrotus pulcherrimus) and its alteration after x irradiation were studied on both qualitative and quantitative bases. MAK chromatographic analysis has revealed that the stage-dependent synthesis of RNA occurred during embryogenesis: some RNA families were observed specifically for early cleavage stage, not being observed at stages later than gastrulation. Further, they were modified by irradiation pari passu with delay and inhibition of cleavage. These results were discussed in comparison with our previous results on normal and regenerating rat liver

  18. 8-Methoxypsoralen-nucleic acid photoreaction. Effect of methyl substitution on pyrone vs. furan photoaddition

    International Nuclear Information System (INIS)

    Kanne, D.; Rapoport, H.; Hearst, J.E.

    1984-01-01

    We have synthesized a series of 8-[3H]methoxypsoralens in which methyl and hydrogen are systematically varied at the 4- and 5'-positions. Analysis of the products resulting from the photoaddition of these four psoralens with the nucleic acid poly(dA-dT) reveals that the product distribution depends on the presence or absence of a 4-methyl substituent. Compounds with the 4-methyl group show an overwhelming preference (approximately 98%) for addition to the furan double bond, while compounds without the 4-methyl show a substantial amount (approximately 18%) of addition to the pyrone double bond

  19. Sequence-specific inhibition of duck hepatitis B virus reverse transcription by peptide nucleic acids (PNA)

    DEFF Research Database (Denmark)

    Robaczewska, Magdalena; Narayan, Ramamurthy; Seigneres, Beatrice

    2005-01-01

    BACKGROUND/AIMS: Peptide nucleic acids (PNAs) appear as promising new antisense agents, that have not yet been examined as hepatitis B virus (HBV) inhibitors. Our aim was to study the ability of PNAs targeting the duck HBV (DHBV) encapsidation signal epsilon to inhibit reverse transcription (RT...... in primary duck hepatocytes (PDH). RESULTS: Both PNAs reproducibly inhibited DHBV RT in a dose-dependent manner with IC(50) of 10nM, whereas up to 600-fold higher concentration of S-ODNs was required for similar inhibition. The PNA targeting the bulge and upper stem of epsilon appeared as more efficient RT...

  20. Hybridization of Environmental Microbial Community Nucleic Acids by GeoChip.

    Science.gov (United States)

    Van Nostrand, Joy D; Yin, Huaqin; Wu, Liyou; Yuan, Tong; Zhou, Jizhong

    2016-01-01

    Functional gene arrays, like the GeoChip, allow for the study of tens of thousands of genes in a single assay. The GeoChip array (5.0) contains probes for genes involved in geochemical cycling (N, C, S, and P), metal homeostasis, stress response, organic contaminant degradation, antibiotic resistance, secondary metabolism, and virulence factors as well as genes specific for fungi, protists, and viruses. Here, we briefly describe GeoChip design strategies (gene selection and probe design) and discuss minimum quantity and quality requirements for nucleic acids. We then provide detailed protocols for amplification, labeling, and hybridization of samples to the GeoChip.